WO2001079431A2 - A novel polypeptide, a human pathway 15 protein with the huntingtine protein and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, a human pathway 15 protein with the huntingtine protein and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001079431A2 WO2001079431A2 PCT/CN2001/000442 CN0100442W WO0179431A2 WO 2001079431 A2 WO2001079431 A2 WO 2001079431A2 CN 0100442 W CN0100442 W CN 0100442W WO 0179431 A2 WO0179431 A2 WO 0179431A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- interacting protein
- human
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide—human huntingtin interacting protein 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
- Huntingt in interacting protein is a type of protein that interacts with Huntingtin protein. Abnormal expression of Huntingtin protein can cause Huntington's disease (HD). Huntingtin protein contains a polyglutamine region, a proline-rich region, and 3 to 4 HEAT repeats (Cell, 81, 811-823, 1995). Huntingtin only enriches the proline fragment through its N-terminus Binding to various types of proteins (HYPs, HIPs), but the longer the polyglutamine fragment adjacent to it, the stronger the binding ability (Human Molecular Genetics, 1998, Vol. 7, No. 9 1463-1474). Studies have found that the pathogenesis and development of HD is triggered by a protein (HIP) that interacts with the proline-rich region of the Huntingtin N terminus (Human Molecular Genetics, 1998, Vol. 7, No. 9 1463-1474).
- HIP Huntingtin yeast partners
- the WW functional domain consists of approximately 35 amino acid residues. Because it contains two very conserved tryptophan residues and one proline residue, it is named as the functional domain (WW doraain / WWP domain) (Biochem. Biophys. Res. Commun., 205: 1021-1205; Trends Biochem. Sci. 19: 531-533 (1994)).
- Most of the WW domains are rich in histidine or cysteine residues on both sides, such as dystrophin (Dystrophin), which suggests that it has the ability to bind metal ions (Nature Genetics 3, 283-291).
- the WW domain itself has a beta fold structure surrounded by four conservative aromatic amino acid residues. Both the hydrophobic core and the large number of charged residues indicate that this domain is a domain where proteins interact with proteins. Although WW domains exist in proteins with different functions, they are involved in cell signaling and regulation.
- the WW domain protein family mostly interacts with proline-rich domain factors such as Huntingtin and transmits signals (Proc. Natl. Acad. Sci. USA 92: 7819- 7823 (1995).
- YAP65 PPLP motif WW domain coupled to a respective ligand, PY motif binding (J. Biol. Chem., 272 , 17070-17077 (1997), (EMBO J., 16, 2376- 2383 (1997)) 0 WW doma in a few
- the WW domain in the ubiquitin-binding enzyme Nedd4 binds to phosphoproteins. It has been confirmed that binding to phosphoserine or phosphothreonine is necessary for Pinl and its substrate to exert their physiological effects in vitro.
- Huntingtin protein is a protein necessary for embryonic development and neurogenesis (Cell, 81, 811-823, 1995), (Nature Genet., 17, 404-410). The prolongation of its mutant polyglutamine causes Huntington's disease (HD) (Cell, 72, 971-983, 1993).
- HIPs murine FBP11 homologous protein
- HYPA HIP2
- HIP1 yeast cytoskeleton protein Sla2p homologous protein
- HYPB HYPC with unspecific functions , HYPD, etc.
- HYPA, HYPB, HYPC belong to the WW doma in protein family.
- HYPA is present in the cytoplasm and nucleus.
- the expression profile of the polypeptide of the present invention is very similar to the expression profile of human huntingtin interacting protein 65, so their functions may also be similar.
- the present invention is named human huntingtin interacting protein 15.
- the human huntingtin interacting protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these The process of human huntingtin interacting protein 15 protein, especially the amino acid sequence of this protein was identified. Isolation of the new huntingtin protein interacting protein 15 gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a polysaccharide containing a human huntingtin interacting protein 15 Recombinant vector of nucleotides.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention-human Huntington protein interaction protein 15.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human huntingtin interacting protein 15. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from: (a) a sequence having positions 1250-1618 in SEQ ID NO: 1; and (b) a sequence having 1-2452 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human Huntington protein interaction protein 15 protein, which comprises using the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human Huntington protein interacting protein 15 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human huntingtin interacting protein 15.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor Huntington protein interacting protein 15 and human huntington protein interacting protein 65.
- FIG. The upper graph is a graph of the expression profile of human huntingtin interacting protein 15 and the lower graph is the graph of the expression profile of human huntingtin interacting protein 65.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human Huntington protein interacting protein 15. 15 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when bound to a human Huntington protein interacting protein 15, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human Huntington protein interacting protein 15.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human huntingtin interacting protein 15 when combined with human huntingtin interacting protein 15.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human huntingtin interacting proteins 15.
- Regular refers to a change in the function of human huntingtin interacting protein 15, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human huntingtin interacting protein 15 Change of nature.
- substantially pure ' means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human huntingtin interacting protein 15 using standard protein purification techniques. Basic The purified human huntingtin interacting protein 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human huntingtin interacting protein 15 can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization under conditions of reduced stringency (Southern print or Nort hern blotting, etc.). Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity means the sequence is the same in two or more amino acid or nucleic acid sequence comparisons Similar percentages. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof twa repackage, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- sequence A and sequence B The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence ⁇ and sequence ⁇ 100 Number of residues in sequence ⁇ 4-Number of interval residues in the sequence- sequence residues in the interval ⁇ ⁇
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in (He in J., (1990) Methods in enzymo logy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? , It can specifically bind to the antigenic determinant of human huntingtin interacting protein 15.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- Polynucleoside in its natural state Acids and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances in their natural state.
- isolated human huntingtin interacting protein 15 means that human huntingtin interacting protein 15 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human huntingtin interacting protein 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human huntingtin interacting protein 15 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human huntingtin interacting protein 15, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- the polypeptides of the invention may also include or exclude the initial methionine residue.
- the invention also includes fragments, derivatives and analogs of human huntingtin interacting protein 15.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human huntingtin interacting protein 15 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2452 bases in length and its open reading frame of 1250-1618 encodes 137 amino acids.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DM forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 60 ° C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human huntingtin interacting protein 15.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human Huntington protein interacting protein 15 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of human huntingtin interacting protein 15; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunohistochemical techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human Huntington protein interacting protein 15 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein To select and use Regulation method synthesis.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human huntingtin interacting protein 15 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- a polynucleotide sequence encoding human huntingtin interacting protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct an expression vector containing a DM sequence encoding human huntingtin interacting protein 15 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, late SV40 enhancers on the origin of replication Polyoma enhancer and adenovirus enhancer.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human huntingtin interacting protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human Huntington protein interacting protein 15 (Scence, 1984; 224: 14 31). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- Physical, chemical, and other properties can be used for various separation methods if required Isolation and purification of recombinant proteins. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Huntingtin interacting proteins are a class of proteins that interact with Huntingtin proteins.
- the abnormal expression of Huntingtin protein can cause Huntington's disease (HD).
- HD Huntington's disease
- the pathogenesis and development of HD are triggered by the protein HIP that interacts with the N-terminal proline-rich region of Huntingtin (Human Molecular Genetics, 1998, Vol. 7, No. 91463-1474).
- Huntingtin protein is necessary for embryonic development and neurogenesis (Cell, 81, 811-823, 1995). Prolongation of its mutant polyglutamine causes neurological disease HD (Cell, 72, 971-983, 1993).
- the abnormal expression of the human Huntington protein interacting protein 15 of the present invention will produce various diseases, especially neurological diseases and embryonic developmental disorders, and these diseases include, but are not limited to, neurodegenerative diseases: Huntington's disease , Parkinson's disease, chorea, dementia, depression, amnesia, epilepsy, migraine, dementia, multiple sclerosis
- Neuromuscular diseases myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, Duchenne muscular dystrophy, tonic muscular dystrophy, myasthenia, bradykinesia, dystonia
- Neurocutaneous Syndrome Neurofibromatosis, Nodular Sclerosis, Cerebral Trigeminal Neurohemangioma, Ataxia Capillary Dilatation
- Cerebrovascular disease transient ischemic attack, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage Spinal disease: acute myelitis, spinal cord compression
- Peripheral nerve disease trigeminal neuralgia, facial nerve palsy, bulbar palsy, sciatica, Guillain-Barre syndrome
- Nervous system tumors astrocytoma, ependymal tumor, medulloblastoma, meningiomas, glioblastoma, acoustic neuroma, angiogenic tumor, pituitary adenoma, craniopharyngioma
- Fetal Developmental Disorders include, but are not limited to: congenital abortion, craniocerebral fissure, cerebral bulge, foramen deformity, Down syndrome, congenital hydrocephalus, spinal epiphyseal dysplasia, reproduction Glandular hypoplasia, congenital adrenal hyperplasia, upper urethral tract, cryptorchidism, Conrad i syndrome, congenital glaucoma or cataract, retinal dysplasia, congenital optic atrophy, congenital sensorineural hearing loss, cleft foot and papillar foot disease, Teratosis, Wi ll iams syndrome, Algille syndrome, Bayer syndrome
- HIPs have HYPA (murine FBP11 homologous protein) involved in protein splicing function (EMBO. J., 15, 1045-1054, 1996), HYPG (HIP2) involved in protein metabolism, and HIP1 (participated in specific membrane functions) Yeast cytoskeleton protein (Sla2p homologous protein), and HYPB, HYPC, HYPD, etc. with unspecified functions.
- HYPA, HYPB, HYPC belong to the WW doma in protein family.
- HYPA is present in the cytoplasm and nucleus.
- HYPA, HYPB, and HYPC mRNAs are abundant in adult and embryonic brains.
- abnormal expression of the human huntingtin interacting protein 15 of the present invention will also produce many diseases, including but not limited to: certain metabolic disorders, tumors, hereditary diseases, neurological diseases, blood diseases and immunity Systemic diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human huntingtin interacting protein 15.
- Agonists enhance human huntingtin-interacting protein 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human huntingtin interaction protein 15 can be cultured with labeled human huntingtin interaction protein 15 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human huntingtin interacting protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human huntingtin interacting protein 15 can bind to human huntingtin interacting protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human huntingtin interacting protein 15 can be added to a bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human huntingtin interacting protein 15 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human huntingtin interacting protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 15 molecules of human huntingtin interacting protein should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides Antibodies against Human Huntington's Protein Interacting Protein 15 Epitope
- These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human Huntington Interaction Protein 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human huntingtin interacting protein 15 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human huntingtin interacting protein 15.
- Antibodies against human huntingtin interacting protein 15 can be used in immunohistochemistry to detect human huntingtin interacting protein 15 in biopsy specimens.
- Monoclonal antibodies that bind to human huntingtin interacting protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human huntingtin interacting protein 15 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human Huntington Interaction Protein 15 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human huntingtin interacting protein 15. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human huntingtin interacting protein 15.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human huntingtin interacting protein 15 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human huntingtin interacting protein 15 detected in the test can be used to explain the importance of human huntingtin interacting protein 15 in various diseases and to diagnose diseases in which human huntingtin interacting protein 15 functions.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzyme, and 7 "-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis .
- Polynucleotides encoding human huntingtin interacting protein 15 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human huntingtin interacting protein 15.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human huntingtin interacting protein 15 to inhibit endogenous human huntingtin interacting protein 15 activity.
- a mutant human huntingtin interacting protein 15 may be a shortened human huntingtin interacting protein 15 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human huntingtin interacting protein 15.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human huntingtin interacting protein 15 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human huntingtin interacting protein 15 can be found in the existing literature (Sambrook, et al.). Alternatively, a recombinant polynucleotide encoding human huntingtin interacting protein 15 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human huntingtin interacting protein 15 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DM sequence has been integrated downstream of the RM polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human huntingtin interacting protein 15 can be used for the diagnosis of diseases related to human huntingtin interacting protein 15.
- the polynucleotide encoding human huntingtin interacting protein 15 can be used to detect the expression of human huntingtin interacting protein 15 or the abnormal expression of human huntingtin interacting protein 15 in a disease state.
- the DNA sequence encoding human huntingtin interacting protein 15 can be used to hybridize biopsy specimens to determine the expression of human huntingtin interacting protein 15.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- the hair Some or all of the polynucleotides can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") to analyze differential expression analysis of genes and genetic diagnosis in tissues.
- Human Huntington's Protein 15 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human Huntington's Protein 15 transcription products.
- RT-PCR RNA-polymerase chain reaction
- Human huntingtin interacting protein 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human huntingtin interacting protein 15 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human huntingtin interacting protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human Huntington Protein Interacting Protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart 00 cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multi-cloning site of pBSK (+) vector (Clontech) to transform DH5cc. The bacteria formed a cDNA library.
- the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
- the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0907g01 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0907g01 clone contains a full-length cDNA of 2452bp (as shown in Seq IDN0: 1), and has a 368bp open reading frame (0RF) from 1250bp to 1618bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0907g01 and encoded the protein as human Huntington protein interacting protein 15.
- Example 2 Cloning of a gene encoding human huntingtin interacting protein 15 by RT-PCR method. Total fetal brain cell RNA was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. After purification using Qiagene's kit, The following primers are used for PCR amplification:
- Primerl 5'- TAAAGATCTCGAGGTCCGCGAGGA -3 '(SEQ ID NO: 3)
- Primer2 5'- GTCGTGCACGTCAGTTGGCAGGGT —3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ ol / L dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2452bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human Huntington protein interacting protein 15 gene expression Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction. I.e.
- RNA precipitate was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human Huntington protein interacting protein 15 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Primer3 5,-CCCCATATGATGGCAGCGAGGAGGGTGGCGGCG -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCCTAGAACTTGGGAGGCTGAGGTGG -3' (Seq ID No: 6)
- Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the PCR reaction was performed using the pBS-0907g01 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0907g01 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the colibacillus DH5cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. Correct positive clone (PET-0907g01) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- NH2-Me t-Al a-Al a-Arg-Arg-Va l-Al a-Al a-Gly-Ser-Arg-G ly-Leu-G ly-Trp-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et a 1. Immimochemi Stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total I gG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Se P harose 4B column, and the anti-peptide antibody was separated from the total I gG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human huntingtin interacting protein 15.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardf s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardf s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. ., Chai, A., Shalom, D, (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 2 ' — Deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) in the body, and probes were prepared after purification.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to
- Probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- the scanner purchased from General Scanning Company, USA
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human huntingtin interacting protein 15 and human huntingtin interacting protein 65 according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU60023/01A AU6002301A (en) | 2000-03-28 | 2001-03-26 | A novel polypeptide, a human pathway 15 protein with the huntingtine protein andthe polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115205.X | 2000-03-28 | ||
CN 00115205 CN1315403A (en) | 2000-03-28 | 2000-03-28 | Polypeptide-human Huntingtn Protein interaction protein 15 and polynucleotide for coding it |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001079431A2 true WO2001079431A2 (en) | 2001-10-25 |
WO2001079431A3 WO2001079431A3 (en) | 2002-03-07 |
Family
ID=4584673
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000442 WO2001079431A2 (en) | 2000-03-28 | 2001-03-26 | A novel polypeptide, a human pathway 15 protein with the huntingtine protein and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315403A (en) |
AU (1) | AU6002301A (en) |
WO (1) | WO2001079431A2 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997018825A1 (en) * | 1995-11-17 | 1997-05-29 | The University Of British Columbia | PROTEIN WHICH INTERACTS WITH THE HUNTINGTON'S DISEASE GENE PRODUCT, cDNA CODING THEREFOR, AND ANTIBODIES THERETO |
-
2000
- 2000-03-28 CN CN 00115205 patent/CN1315403A/en active Pending
-
2001
- 2001-03-26 WO PCT/CN2001/000442 patent/WO2001079431A2/en active Application Filing
- 2001-03-26 AU AU60023/01A patent/AU6002301A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997018825A1 (en) * | 1995-11-17 | 1997-05-29 | The University Of British Columbia | PROTEIN WHICH INTERACTS WITH THE HUNTINGTON'S DISEASE GENE PRODUCT, cDNA CODING THEREFOR, AND ANTIBODIES THERETO |
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [Online] 14 December 1999 CLARK G. ET AL. Retrieved from NCBI, accession no. GI:3242175 Database accession no. AL022325 * |
DATABASE PROTEIN [Online] 11 March 1998 DHAR A. ET AL. Retrieved from NCBI, accession no. GI:1177607 Database accession no. CAA63219 * |
Also Published As
Publication number | Publication date |
---|---|
AU6002301A (en) | 2001-10-30 |
CN1315403A (en) | 2001-10-03 |
WO2001079431A3 (en) | 2002-03-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (en) | A novel polypeptide - tumor suppressor protein 63 and the polynucleotide encoding said polypeptide | |
WO2001068689A1 (en) | A novel polypeptide, human hypoxia-inducible factor 1 alpha subunit 13 and the polynucleotide encoding thereof | |
WO2001079431A2 (en) | A novel polypeptide, a human pathway 15 protein with the huntingtine protein and the polynucleotide encoding the polypeptide | |
WO2001055399A1 (en) | A novel polypeptide, a human dipeptide aminopeptidase 28 and the polynucleotide encoding the polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001064721A1 (en) | A NOVEL POLYPEPTIDE-HUMAN ATPase 30 AND THE POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001072799A1 (en) | A novel polypeptide, human zinc finger protein 9 and the polynucleotide encoding thereof | |
WO2001070796A1 (en) | A novel polypeptide, a human zinc finger protein 78 and the polynucleotide encoding the polypeptide | |
WO2001053499A1 (en) | Novel polypeptide---human proliferating-cell nucleolar protein 18 and polynucleotide encoding it | |
WO2001075041A2 (en) | A novel polypeptide-human epilepsy-associated protein 11 and the polynucleotide encoding said polypeptide | |
WO2001055381A1 (en) | A novel polypeptide, a human transcription regulatory factor 80 and the polynucleotide encoding the polypeptide | |
WO2001066575A1 (en) | A novel polypeptide, an actin 49 and the polynucleotide encoding the polypeptide | |
WO2001087954A1 (en) | A novel polypeptide, a human clathrin light chain 9 and the polynucleotide encoding the polypeptide | |
WO2001074886A1 (en) | A novel polypeptide - human amyloid glycoprotein 9 and a polynucleotide encoding the same | |
WO2001079425A2 (en) | A novel polypeptide - human chloride channel protein 10 and the polynucleotide encoding said polypeptide | |
WO2001075010A2 (en) | A novel polypeptide, human nuclear transduction protein 25 containing a structural atp/gtp domain | |
WO2001066576A1 (en) | A novel polypeptide-homo amyloid 11 and polynucleotide encoding said polypeptide | |
WO2001079430A2 (en) | A novel polypeptide - human serine protease 9 and the polynucleotide encoding said polypeptide | |
WO2001068693A1 (en) | A novel polypeptide, human cannabinoid receptor protein 7 and the polynucleotide encoding thereof | |
WO2001075049A2 (en) | A novel polypeptide - a human clathrin light chain 11 and the polynucleotide encoding the polypeptide | |
WO2001075059A2 (en) | A novel polypeptide, human gtp-regulatory protein 11 and a polynucleotide encoding the same | |
WO2001064732A1 (en) | A novel polypeptide - human reverse transcription-related factor-14 and a polynucleotide sequence encoding the same | |
WO2001075026A2 (en) | A novel polypeptide, human eucaryotic acetyl transferase 10 and the polynucleotide encoding the polypeptide | |
WO2001074877A1 (en) | A novel polypeptide-human excitatory amino acid transporter 12 and the polynucleotide encoding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |