WO2001061030A2 - LIBRARIES OF OPTIMUM SUBSEQUENCE REGIONS OF mRNA AND GENOMIC DNA FOR CONTROL OF GENE EXPRESSION - Google Patents

Abstract

The invention discloses a method for selecting optimal subsequence antisense targets for preparing an antisense oligonucleotide capable of inhibiting mRNA expression of target mRNA sequences, as well as antisense oligonucleotides capable of binding DNA. These libraries of antisense molecules may then be used for preparing therapeutic agents for the treatment of genetic disease. Antigene sequences specific for a desired target gene sequence and having mRNA, protein or cell growth inhibition efficiencies may then be used to control DNA expression. By in no way intending to be limited to any particular gene, examples of these human genes of interest in which mRNA subsequence targets will be identified and antisense molecules prepared are: c-Myc, c-Myb, Bcl-2, c-Raf, Cyclin D1, IGF-IR, PKCα, or CA12 genes. Antisense oligonucleotides of the invention may in some embodiments be at least 50 nucleotides in length. Examples include antisense oligonucleotides that specifically bind human protein kinase C-alpha and human C-Raf protein kinase.

Description

LIBRARIES OF OPTIMUM SUBSEQUENCE REGIONS

OF mRNA AND GENOMIC DNA

FOR CONTROL OF GENE EXPRESSION

FIELD OF INVENTION

The present invention relates generally to the field of antisense gene therapy and methods for identifying therapeutic oligonucleotides for selected regulation of pathogenic processes associated with specific genetic disorders. The invention further relates to methods for identifying and creating oligonucleotides for the general control of gene expression, whether or not the gene is involved in a known genetic disorder.

BACKGROUND OF INVENTION The field of gene therapy involves techniques that attempt to treat a variety of disorders that are associated with genetic deficiencies or defects. Several treatments have been proposed that attempt to remedy a disease by introducing a replacement gene in the hope that the gene will be incorporated into the genome of the patient and become self-replicating. Another type of gene therapy treatment takes the form of treating the patient with a regulatory molecule, such as an antisense DNA oligonucleotide (ODN) molecule that binds to messenger RNA (mRNA) with the subsequent inhibition or control of translation and, hence, control of the production of a protein product. The following paragraphs present background on specific proteins whose enzymatic actions are important in cellular processes and disease, as an illustration of the types of protein products that could be controlled by antisense therapy [1, 2].

Protein Kinase C. The protein kinase C (PKC) family of proteins plays an important role in controlling proliferation, transformation, gene expression, and differentiation of a wide range of cell types. PKC proteins are central in mediating the signal transduction response to hormones and growth factors.

Activation of PKC is also known to induce angiogenesis, migration, and proliferation of endothelial cells (EC), but can also prevent growth factor-induced EC proliferation. The protein kinase C family transduces a number of signals from lipid metabolism. Signals that stimulate members of the large families of protein- coupled receptors, tyrosine kinase receptors, or non-receptor tyrosine kinases can cause diacylglycerol (DAG) production to regulate PKC, either rapidly by activation of specific phospholipase C enzymes or more slowly by activation of phospholipase D to yield phosphatidic acid and then diacylglycerol. In addition, fatty acid generation by phospholipase A2 activation modulates PKC activity. Thus, multiple receptor pathways feed multiple lipid pathways that have the common end result of activating protein kinase C. In addition to regulation by diacylglycerol, all isozymes of PKC require phosphatidylserine (PtdSer), an acidic lipid located exclusively on the cytoplasmic face of membranes, and some isozymes require Ca^ for optimal activity. Upon activation, PKC translocates to different subcellular sites where it phosphorylates numerous proteins, most of which are unidentified [3-12]. Different PKC isoforms are listed in Table 1.

Table 1 PKC and PRK gene families.

Isotype Group Activators

PKCα Classic Ca2+, DAG, PtdSer PKCj3 Classic Ca2+, DAG, PtdSer PKC7 Classic Ca2+, DAG, PtdSer PKCδ Novel DAG, PtdSer PKC0 Novel DAG, PtdSer PKCη Novel DAG, PtdSer PKCε Novel DAG, PtdSer

PKQ/PKCλ Atypical Not defined PKCf Atypical Not defined PRK1 PKC related kinase Various lips PRK2 PKC related kinase Not defined

Carbonic Anhvdrase. Carbonic anhydrases in general are enzymes important to the management of CO₂. About 11% of the blood's CO₂ is transported by hemoglobin. Most of the CO₂ enters the erythrocytes (red blood cells) and dissolves in the cytoplasm (cellular fluid). It then combines with water molecules to form carbonic acid, which immediately disassociates into hydrogen ions and bicarbonate. This reaction is sped up by carbonic anhydrase, which is located in the erythrocytes. Most of the CO₂ is converted into bicarbonate as soon as it enters a red blood cell, thus keeping the red blood cell CO₂ level lower than that of the interstitial fluid. This is important since the concentration gradient between the interstitial fluid and the surrounding tissue increases the diffusion efficiency of CO₂, thereby allowing it to be removed quickly from tissues.

In the lungs, the above process is reversed. The carbonic anhydrase- mediated reaction reverses its direction, converting bicarbonate to CO₂ and water.

The total effect is to maintain a CO₂ gradient steep enough to quickly drive the gas into the alveolar air space of the lungs for exhalation from the body [13-16].

Raf. C-Raf, which is a member of the Raf-Mos ser/thr kinase subfamily of the Src super family, plays a role in gene regulation. Two other members of Raf family are A-Raf (RafAl) and B-Raf (RafBl). C-Raf is expressed in most human tissue. A-Raf is expressed predominantly in urogenital tissues and B-Raf is expressed primarily in cerebrum and testes. Raf is activated by Ras and activated Raf is translocated to the perinuclear region and the nucleus. Raf activates MAP kinase kinase (MAPKK), which in turn stimulates the MAP kinases Erkl and Erk2, resulting in activation of Fos and Jun to control transcription of DNA genes. These biochemical pathways associated with C-Raf expression have been associated with stomach cancer, laryngeal, lung and other carcinomas and sarcomas. Mechanisms to control the expression of C-Raf may provide a viable treatment method for these and other pathologies [17-20]. Mvc. The Myc oncoprotein also is involved in gene regulation. Myc is a member of the helix-loop-helix/leucine zipper superfamily. The Myc oncoprotein dimerizes with its partner, Max, to bind DNA, activate transcription, and promote cell proliferation as well as programmed cell death. Max also forms homodimers or heterodimers with its alternative partners, Mad and Mxi- 1. These complexes behave as antagonists of Myc/Max through competition for common

DNA targets, and perhaps permit cellular differentiation. The c-Myc protein contains two regions that are characteristic of transcription factors: an amino- terminal transactivation domain, and a carboxy-terminal basic helix-loop-helix leucine zipper motif (bHLHLZ) known to mediate dimerization and sequence- specific DNA binding. The most widely studied of the Myc proteins, c-Myc, was first discovered through its homology with the transforming gene (v-Myc) of the avian myelocytomatosis virus MC29. Two other Myc proteins, N-Myc and L- Myc, were discovered later through their homology with v-Myc in the amplified sequences of neuroblastoma cells, and a small cell lung tumor, respectively. Deregulation of Myc expression correlates with the occurrence of many types of human tumors, particularly small cell lung carcinoma, breast and cervical carcinomas [21-26].

Cyclin. Another factor affecting gene expression is Cyclin D 1 , a member of the Gl cyclins. Cyclin Dl regulates the progression of mammalian cells through the Gl phase of the cell cycle. In the Gl (resting) phase of the cell cycle, cyclin Dl together with its cyclin dependent kinase (cdk) partner, is responsible for transition to the S phase (DNA synthesis phase) of the cell cycle by phosphorylating a tumor suppressor gene product (pRb), that results in the release of transcription factors important in the initiation of DNA replication. Amplification of the cyclin Dl gene or overexpression of the cyclin Dl protein releases a cell from its normal controls, and causes transformation of a cell into a malignant phenotype. Analysis of these changes provides important diagnostic information in mantle cell (and related) lymphomas and allows an early detection of many cancers [27-32].

Insulin-like Growth Factor. The biological actions of the insulin-like growth factors, IGF-I and IGF-II, are mediated by their activation of the IGF-IR, a transmembrane tyrosine kinase linked to the ras-raf-MAPKK cascade. Functional IGF-IRs are required for the cell to progress through the cell cycle. Most importantly, cells lacking this receptor cannot be transformed by any of a number of dominant oncogenes, a finding that proves that the presence of the IGF- IR is important for the development of a malignant phenotype. Consistent with this role, the IGF-IR displays a potent anti-apoptotic effect, both in vitro and in vivo. IGF-IR is a very attractive therapeutic target, since targeting of the IGF-IR can both decrease the growth rate of transplantable tumors and cause massive apoptosis, and, in some cases, can result in complete inhibition of tumorigenesis [33, 34]. Myjb. The transcription factor c-Myb is involved in the regulation of many different genes. The c-myb gene is the cellular homologue of the v-myb oncogenes carried by the avian leukemia viruses AMV and E26. As does each of the viral oncogenes products, the c-Myb transcription factor recognizes the core DNA sequence C/T-A-A-C-G/T-G via a repeated helix-turn-helix-like motif. C-Myb is expressed in immature haemopoietic cells, as well as in immature cells of the gastro-intestinal epithelium, and is down regulated during differentiation. Enforced expression of activated or even normal forms of Myb can transform haemopoietic cells, most often of the myeloid lineage, in vitro and in vivo. Although many genes have been identified which are likely to be regulated by c-Myb, the critical target genes involved in its transforming activity are not known. Amplification of Myb gene has been detected in acute myeloblastic leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, T cell leukemia, colon carcinomas) and melanomas [35 -39].

Bcl-2. Gene regulation also involves the Bcl-2 protein, discovered in association with follicular lymphoma. Bcl-2 plays a prominent role in inhibiting apoptosis and enhancing cell survival in response to diverse apoptotic stimuli. Apoptosis normally eliminates cells with damaged DNA or an aberrant cell cycle, which are the cells most likely to become a neoplastic clone. Hence, Bcl-2 is tumorigenic. Although the mechanism by which Bcl-2 prevents apoptosis is not known with certainty, genetic and biochemical evidence suggests that Bcl-2 may function by inhibiting the activation of proteases that eventually lead to cell death. Activation of the Bcl-2 gene by chromosomal translocation is a common abnormality in human lymphoid neoplasms [40-45].

Brome Mosaic Virus. The Brome Mosaic Virus (BMV) is a multiparticle plant RNA Virus that has a well-characterized, segmented mRNA genome useful in the research of antisense regulation of translation. The segmented genome of BMV is composed of four single positive strand RNA chains called RNAl, RNA2, RNA3, and RNA4. All four RNAs are active in vitro messengers that stimulate synthesis of the polypeptides designated as 1 (1 10 kDa),. 2 (105 kDa), 3 (35 kDa), and 4 (20 kDa). Polypeptide 4 (the coat protein) is encoded on both RNA3 and RNA4. RNAs 1 and 2 are separately encapsulated in viral particles, while RNA3 is encapsulated with a single copy of its subgenomic mRNA, RNA4. The sequences of BMV RNAl, RNA2, and RNA3 share little or no homology except for 200 nucleotides in the 3 ' non-coding region common to each molecule and short homologues at the 5' ends. The smallest BMV genomic RNA, RNA3, contains coding regions for the coat protein gene and another gene (3 a) that encodes a host specificity protein, separated by a 250-base intercistronic coding region. These proteins are respectively 20 kDa and 35 kDa in molecular weight and their relative inhibition by antisense oligomers is a way of testing for a specific antisense effect. BMV mRNAs are well characterized and useful for the study of antisense inhibition of translation in vitro [46-50].

While much is known about the various enzymatic deficiency diseases, techniques for selecting highly potent segments of a gene encoding a critical enzyme are for the most part a tedious exercise in trial and error. A more sophisticated approach for identifying a targeted library of oligonucleotides having a relatively high degree of potency is still lacking in the medical arts, and is necessary for continued meaningful progress to be made in effective gene therapy as a feasible clinical management tool.

SUMMARY OF THE INVENTION

An important means of controlling gene expression is by interaction of mRNAtranscripts with molecules such as, but not limited to, antisense oligonucleotide (ODN) reagents. The present invention provides a method whereby subsequences of mRNA molecules that are optimal targets for hybridization with antisense molecules can be identified by analysis of nearest- neighbor compositions of all possible subsequence targets and by consideration of the secondary structures of the subsequence targets and antisense molecules. In one aspect, the invention provides a method for providing a library of specific mRNA subtargets capable of functioning as effective targets for antisense ODNs. In some embodiments, the method comprises a series of steps of identifying optimal subsequences of an mRNA target and constructing complementary oligonucleotides therefrom. This library of mRNA subtargets and complementary ODNs may be designated as an Optimal AntiSense Identified Sequence library, or OASIS library. The following steps would be followed to create same: { 1 } collecting mRNA sequences from genes expressed by human cells; {2} determining the nearest-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence; {3} determining the hybridization efficiency for each of the mRNA subtarget sequences; and {4} ranking t he subsequence targets according to hybridization efficiency. This ranking may occur by, for example, determining the free energies of interaction with antisense molecules or by the melting temperatures of hybrids formed with antisense molecules. This procedure may be accomplished, by way of example, through the use of a computer program such as the NNTSA computer program as described in United States Patent No. 5,856,103. In some embodiments, the method may include a step {5} of eliminating antisense molecule sequences that have competing structures. One method of doing same may be through eliminating antisense sequences that have more than four (4) contiguous G bases. By way of example, Oligo Toolkit ® can be used to analyze the self-hybridization of selected antisense molecules so as to eliminate oligonucleotide sequences having a high percentage of complementary bases.

An additional step {6} that may be included in some embodiments of the invention is deleting subsequence target sequences that have competing structures, selecting 10-20 subsequence targets that are highest in hybridization potential, and testing the selected 10-20 subsequence targets for inhibition or other control of mRNA expression of each mRNA sequence. There may be more than one subsequence target that is equally efficient for control of a given mRNA sequence. A collection of optimal subsequence targets within mRNA sequences chosen by steps {1-6} and called the Optimal AntiSense Identified Sequences or OASIS library may also be compiled from cDNA ("copy DNA") sequences obtained from the GenBank database. These sequences are given as sense strand sequences, which are the same as mRNA sequences (with T substituted for U).

Each sequence would be subjected to the specified steps for subsequence target selection.

Genetic control can be exercised at the level of mRNA transcripts by antisense reagents or at the level of the duplex DNA gene by antigene reagents. Regulation can be by transient inhibition of mRNA translation into protein, by inhibition of mRNA splicing, and by inhibition of DNA transcription into RNA. More permanent means may also be used involving long-term gene therapy employing homologous recombination. In the case of control at the level of the DNA gene, antigen reagents are used. Steps of the procedure for identification of each optimal subsequence target within DNA genomic sequences and constructing the second desired library, called Optimal Antigen Identified Sequence library, or OAGIS library, include: { 1 } collecting sequences for genes from the public Embank sequence database (where each gene sequence corresponds to an expressed human gene sequence plus its control sequences), {2} determining the nearest-neighbor base pair compositions of all possible subsequence targets within each target genomic DNA sequence including its control sequences, {3} calculating the hybridization efficiencies for the subsequence targets, and {4} ranking the subsequence targets according to hybridization efficiency, such as by free energies of interaction with antigene molecules or melting temperatures of triple-stranded nucleic acids formed with antigene molecules. By way of example, a computer program such as the NNTSA computer program as described in United States Patent No. 5,856,103 may be used to accomplish such ranking.

In some embodiments, the method may include a step {5} of eliminating antigene molecule sequences that have competing structures. One method of doing same may be through eliminating antigene sequences that have more than four (4) contiguous G bases. By way of example, Oligo Toolkit ® can be used to analyze the self-hybridization of selected antigene molecules so as to eliminate oligonucleotide sequences having a high percentage of complementary bases. An additional step {6} that may be included in some embodiments of the invention is deleting subsequence target sequences that have competing structures, selecting 10-20 subsequence targets that are highest in hybridization potential, and testing the selected 10-20 subsequence targets for inhibition or other control of DNA expression of each genomic DNA sequence. There may be more than one subsequence target that is equally efficient for control of. a given DNA sequence. A collection of optimal subsequence targets within DNA target sequences chosen by steps {1-6} above and called the Optimal AntiGene Identified Sequences or OAGIS library may also be compiled from gene sequences obtained from the GenBank database where each sequence is subjected to the specified steps for subsequence target selection. The OASIS and OAGIS libraries identify optimum sites for regulation of genes that may be involved in specific disease processes such as oncogene involvement in cancer. Regulation of one or more of such genes could serve as a therapeutic treatment of the respective disease. Additional commercial utility as a result of regulation of genes at the OASIS and OAGIS libraries of sites could ^aPply to, but is not limited to, agriculture, chemical, and veterinary fields. The above steps can be applied to all gene sequences, whether of human or other origin.

The cDNA sequences specified in the present invention were obtained from the public sequence database GenBank. These sequences are given as sense strand sequences, which are the same as mRNA sequences (with T substituted for

U). These mRNA sequences were then analyzed with the NNTSA program to find subtarget sequences (each 20 nucleotides long) that have relatively high melting temperature (Tm) values and large negative free energy (- G°) values when hybridized with antisense DNAs. Subtarget mRNA sequences containing repeating sequences or clusters of C bases (more than four), which require more than four G bases in the antisense DNA, were eliminated. Ten to twenty subtarget mRNA sequences (each 20 nucleotides long) in each human gene mRNA target sequence were selected as having the greatest hybridization potential for antisense DNAs. For tests of PKCo. and C-Raf inhibition, three of these selected sequences and six or seven other sequences not having the highest predicted hybridization potential were tested in cell cultures for their respective ability to inhibit protein synthesis. For a test of inhibition of brome mosaic virus mRNA translation in a cell-free assay, six antisense sequences to subtargets in the brome moasic virus mRNA were selected to have a range of hybridization potentials using the NNTSA program. In all cases, ODN sequences having a self-complementary sequence of more than eight consecutive base pairs by the Oligo Toolkit ® analysis or by inspection were eliminated. The secondary structures of subtarget sequences in the context of 100 or more neighboring nucleotides in the most stable mRNA were typically analyzed with the mfold ® RNA structure program (version 2.52), as noted in table footnotes. All mRNA subtargets that were analyzed were devoid of secondary structures containing more than ten consecutive base pairs without being interrupted by at least one bulge, loop, or unpaired nucleotide region.

In one aspect, the invention provides for a method for selecting optimal subsequence antisense targets capable of inhibiting mRNA expression of a target mRNA sequence. In addition, once the library of optimal subsequence antisense targets are identified, the invention in yet another embodiment provides for preparing a set of antisense molecular reagents that will bind these targets and thus inhibit mRNA expression.

Another aspect of the invention provides for a method of selecting optimal subsequence antigene targets for inhibition or other control of DNA expression of genomic DNA sequences. In one embodiment, this method comprises the step of collecting DNA sequences of genes of interest expressed by a cell, where each gene sequence corresponds to an expressed gene sequence plus its control sequences, determining the nearet-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence, determining the hybridization efficiency for each DNA subsequence with a triplex-forming antigene molecule according to its TM (°C) or G ° (kcal/mol at 37° C) value; selecting a set of subsequences that are optimal target sequences; preparing a set of antigene sequences specific for said target sequences; and selecting from said set of antigene sequences having mRNA, protein, or cell growth inhibition efficiencies of about 50% or more as the optimal subsequence antigene targets.

In the methods disclosed here, antigene sequences containing containing repeating G sequences or a G cluster, defined as a consecutive sequence of four or more Gs, should be eliminated. Further, antigene molecules having a percentage of self-complementary bases greater than 40 percent should be eliminated.

While in no way intending to limit the subject matter of the invention, particular selected mRNA subsequence targets of a human gene molecule, by way of example, the c-Myc, c-Myb, Bcl-2, c-Raf, Cyclin Dl, IGF-IR, PKCo; and CA 12 gene. The invention in yet another aspect provides for a library of antisense reagents having specific binding affinity for the subsequence antisense targets identified herein as another aspect of the invention.

It is anticipated that the invention may provide for an effective antisense reagent capable of inhibiting any individually identified human genomic DNA sequence of a human gene.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

Fig. 1 - Plot of - G° versus PKCα mRNA subtarget position. Numbers show the location of the first base in a 20-mer selected subtarget. Fig. 2 - Dose response curve of cell growth inhibition for PKCα ODN

22.

Fig. 3 - Western blot of antisense inhibition of PKCα protein synthesis.

Fig. 4 - Western blot of antisense inhibition of PKCα protein synthesis that include selected antisense oligos.

Fig. 5 - Correlation of calculated Tm and inhibition of PKCα protein synthesis.

Fig. 6 - Correlation between PKCα protein inhibition and cell growth inhibition.

Fig. 7 - Correlation of calculated Tm and inhibition of C-Raf protein synthesis.

Fig. 8 - Autoradiograph of 12.5% SDS-polyacrylamide gel of proteins synthesized in vitro from BMV mRNA. F Fiigg.. 9 9 -- Dose response curve of S-ODN #89.

Fig. 10 Dose response curve of S-ODN #140. Fig. 11 - Dose response curve of S-ODN #241. Fig. 12 - Plot of Tm versus percentage inhibition of BNW mRNA #3. Corresponding numerals and symbols in the different figures refer to corresponding parts unless otherwise indicated.

DETAILED DESCRIPTION OF THE INVENTION

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed In the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. Example 1 - Selection and Inhibition Test of Optimal Sites for PKCα Gene mRNA

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via inhibition of protein kinase Cα expression, to control unwanted hormone and growth-factor- induced cell growth as might occur in cancers. An analysis was carried out on the PKCα mRNA sequence, to obtain the hybridization stabilities of antisense molecules of 20 nucleotides each, starting at each sequence position from 1 through 2225 of the mRNA. Figure 1 shows the relative variation in G° (kcal/mol at 37°C) for each hybridization position in the mRNA. Target sites marked No. 89, No. 288, and No. 898 were among those of highest affinity for antisense oligomers according to the NNTSA program. Such sites revealed by the method of this invention are typically clustered as shown in Figure 1. Table 2 lists 11 optimal target sequences selected by the steps of the invention.

Table 2 Selected 11 subtarget antisense sites for PKCα from NNTSA analysis, ranked by Tm

Position Tm - G°(37) mRNA target (with t=u)*

88 66.50 47.45 gcccgcaaaggggcgctgag (SEQ ID NO: 1)

89 66.50 47.45 cccgcaaaggggcgctgagg (SEQ ID NO: 2)

90 66.50 47.45 ccgcaaaggggcgctgaggc (SEQ ID NO: 3)

44 66.36 45.85 cgggcaacgactccacggcg (SEQ ID NO: 4)

87 66.34 46.64 cgcccgcaaaggggcgctga (SEQ ID NO: 5)

92 66.16 47.10 gcaaaggggcgctgaggcag (SEQ ID NO: 6)

91 66.00 46.29 cgcaaaggggcgctgaggca (SEQ ID NO: 7)

898 65.77 48.50 ccggaaggggacgaggaagg (SEQ ID NO: 8)

86 64.94 45.44 tcgcccgcaaaggggcgctg (SEQ ID NO: 9) 899 64.51 47.32 cggaaggggacgaggaagga (SEQ ID NO: 10)

288 63.58 46.45 gggtgcggataagggacccg (SEQ ID NO: 1 1)

*Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Antisense oligodeoxynucleotides 20 nucleotides long containing phosphorothioate-modified backbones (S-ODNs) were purchased from two commercial companies (Midland Certified Reagent Company or Oligos Etc., Inc). These modified DNA oligomers can have either of two phosphate bonding positions occupied by sulfur at each of 19 backbone positions linking the 20 base- sugar nucleosides in a 20-mer. Such oligomers are therefore of mixed backbone chirality. S-ODNs were used because they have a well-known nuclease resistance while maintaining the ability to pair with mRNA and activate the RNaseH needed to cleave the target mRNA and thus disrupt translation and protein expression. Nine S-ODN sequences were used to inhibit cell growth rate and translation of the PKCα protein in A549 human lung carcinoma cells. Specifically, 20-mer antisense oligomers that were complementary to the high affinity sites 89, 288, and 899 were tested. S-ODNs starting at positions 21, 22, 25, 2044, 2100, and 2192 were used as additional test sequences. These included sequences 21, 22, 2044, and 2192 that had been recognized as effective PKCα inhibitors in published work [3, 51-53].

To study cell growth inhibition, cells were grown to 70-80% confluence, treated with Lipofectin transfecting agent (lOμ/ml) and S-ODN at various concentrations for 4 hr. After washing the cells they were allowed to recover for 20 hr in the presence of ³H thymidine. Incorporation of the radioactive ³H was used to quantitate the cell growth after harvesting the cells with a cell harvester. Figure 2 shows a dose response curve to S-ODN#22.

To assay for protein production, a Western blotting technique was used. A549 cells were grown to 70-80% confluence and treated with S-ODN at a concentration of 1 μM in the presence of cationic lipid (Lipofectin). After 4 hr of treatment and 20 hr of recovery, cells were lysed by sonication and the amount of proteins in cell lysates was determined with a protein colorimetric assay. Equal amounts (30 μg) of total cell lysates were electrophoresesed on 8% sodium dodecyl sulfate (SDS) polyacrylamide gels. Proteins were transferred to membranes by electroblottmg, the membranes were blocked and treated overnight with specific primary antibodies, one to C-Raf and, generally, one to actin as an internal control to correct for loading of different amounts in different gel lanes. Following this, the membrances were incubated with secondary antibodies conjugated to alkaline phosphatases. Antibody-specific protein bands could then be detected by an enhanced chemifluorescence detection reagent, visualized by a STORM^® phosphorimager scanner, and quantified by NIH ImageQuant 1.61.

The sequence position, percentage inhibition, and predicted rank of inhibitory efficiency as Tm (°C) or G°(37) (kcal/mol at 36 °C) are shown in Table 3. Treatment of A459 cells with lOμg/ml of Lipofectin did not inhibit PKCα protein synthesis. Examples of the Western blots that were digitized to obtain these data are shown in Figures 3 and 4. The first three selected oligomers in Table 3 were predicted to have, and experimentally were shown to have, the highest or among the highest, percent inhibition of PKCα protein expression by Western blotting. Figure 5 shows the correlation between the Tm values and protein inhibition.

Table 3

PKCα sequence position and inhibition by phosphorothioate antisense DNA sequences in A549 cells

Sequence Inhibition Rank by Rank by - OLIGO

Position (%)* Tm(°C) G°(37) (mRNA target with t=u)/(antisense DNA sequence) both sequences written 5'-to-3'

89 51.1±2.9 66.5 47.45 cccgcaaaggggcgctgagg/ (SEQ ID NO: 2)

CCTCAGCGCCCCTTTGCGGG (SEQ ID NO: 12)

899 51.1±3.7 64.51 47.32 cggaaggggacgaggaagga/ (SEQ ID NO: 10)

TCCTTCCTCGTCCCCTTCCG (SEQ ID NO: 13)

-4

288 44.7±7.8 63.58 46.44 ggtgcggataagggacccg/ (SEQ ID NO: 11 )

CGGGTCCCTTATCCGCACCC (SEQ ID NO: 14) 21 44.3±7.0 59.18 40.19 ggggaccatggctgacgttt (SEQ ID NO: 15

AAACGTCAGCCATGGTCCCC (SEQ ID NO: 16

22 40.4±4.7 56.13 37.32 gggaccatggctgacgtttt (SEQ ID NO: 17

AAAACGTCAGCCATGGTCCC (SEQ ID NO: 18

2044 35.9±3.6 54.79 36.71 tgaaactcaccagcgagaac/ (SEQ ID NO: 19

GTTCTCGCTGGTGAGTTTCA (SEQ ID NO: 20

-4

25 34.8±4.4 53.1 34.74 accatggctgacgttttccc/ (SEQ ID NO: 21

GGGAAAACGTCAGCCATGGT (SEQ ID NO: 22

-4

2192 34.0±6.4 51.33 33.77 gatcaactgttcagggtctc/ (SEQ ID NO: 23

GAGACCCTGAACAGTTGATC (SEQ ID NO: 24

-4

2100 20.6±8.6 43.27 29.55 aagtgaatccttaaccctaa/ (SEQ ID NO: 25

TTAGGGTTAAGGATTCACTT (SEQ ID NO: 26

* Average and standard deviation of at least three samples; % inhibition is relative to Hpofectintreated cells. A random sequence control showed less than 4% inhibition; the control sequence was 5' TGCGTTGAGGTCTATCCAGC 3' (SEQ ID NO: 27).

The inhibition of cell growth by the different antisense oligonucleotides was also closely correlated with the Tm of the oligonucleotides. Therefore, the percentage protein inhibition and the percentage inhibition of cell growth were related, as shown in Figure 6. This demonstrated that the PKCαprotein inhibition had a direct effect on the growth of these lung cancer cells. Dose-response studies showed that all oligonucleotides maximally inhibited cell growth at 0.5-1.0μM oligomer concentration.

United States Patent No. 5,703,054 [51] concerns antisense ODNs targeted to positions 22, 2044, and 2192 (SEQ ID Nos. 2, 3, and 5, which are identical to SEQ ID Nos. 18, 20, and 24 of the present application). United States Patent No. 5,885,970 [52] is for antisense ODNs targeted to specific sequences in each of the protein kinase isoforms; 20 sequences (SEQ ID Nos. 1 to 20 of Patent No. 5,885,970) are targeted to the PKCα isoform and are largely restricted to the 5' region (and AUG start codon), to the 3' region (and UGA stop codon), and to the beginning of the coding region. None of these specific sequences are within 50 nucleotides of positions 899 and 288, subtargets to which two of the antisense ODN sequences (SEQ ID Nos. 13 and 14 of the present application) selected by the present invention are targeted. Moreover, claims of related United States Patent No. 5,882,927 [53] are related to modified antisense ODNs that are all targeted to PKCαposition 2044 (antisense SEQ ID No.2 of Patent No. 5,882,927, which is the same as Seq. ID No. 20 of the present application). This position includes the stop codon and is more than 1000 nucleotides removed from positions selected by the present invention and given in Table 2. Thus, the present invention has allowed the efficient discovery of additional, previously unrecognized sequences that are effective subtargets for antisense inhibition of PKCα mRNA.

Example 2 - Selection and Inhibition Test of Optimal Sites for C-Raf Gene mRNA

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via control of c-Raf protein expression, in treating stomach cancer, laryngeal cancer, lung cancer, and other carcinomas and sarcomas. Ten optimal sites on the C-Raf mRNA for hybridization of antisense ODNs are shown in Table 4.

Table 4 Selected 10 subtarget antisense sites for C-Raf from NNTSA analysis, ranked by Tm position Tm G(37) mRNA target (with t7=u)*

2098 68.34 50.01 ggctgccaggggaggaggag (SEQ ID NO: 28)

1474 68.21 48.68 gcccggcagacggctcaggg (SEQ ID NO: 29)

2096 68.12 49.16 caggctgccaggggaggagg (SEQ ID NO: 30)

1395 67.01 46.54 gtggtgcgagggcagcagcc (SEQ ID NO: 31 )

79 66.20 46.40 cgttggggcggcctggctcc (SEQ ID NO: 32)

80 66.20 46.40 gttggggcggcctggctccc (SEQ ID NO: 33)

83 66.14 46.73 ggggcggcctggctccctca (SEQ ID NO: 34) 84 66.14 46.73 gggcggcctggctccctcag (SEQ ID NO: 35)

85 66.14 46.73 ggcggcctggctccctcagg (SEQ ID NO: 36)

1475 65.97 46.66 cccggcagacggctcaggga (SEQ ID NO: 37)

* Secondary structures of RNA targets except position 1395 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

S-ODNs (oligonucleotides with phosphorothioate backbone linkages to make them resistant to nucleases) were tested for their ability to inhibit C-Raf protein synthesis in A549 human lung cancer cells. Three of the selected sequences from Table 4 (targeted to positions 2098, 1474 and 85) were tested along with seven additional sequences that were not predicted to have a high antisense inhibitory rank. The sequence targeted to position 2484 was chosen because it had previously been chosen as the most effective sequence in published work [18, 19]. All ten sequences are listed in Table 5 along with their rank according to both Tm (°C) and - G° (kcal/mol at 37°C) values.

A549 cells were grown until 50 to 60% confluent and treated with the S- ODNs at a concentration of lμM in the presence of cationic lipid (Lipofectin). After 36 hr of treatment, cells were lysed in 1% sodium dodecyl sulfate (SDS) lysis buffer, and the arnbunt of proteins in cell lysates was determined with a protein colorimetric assay. Equal amounts (40 μg) of total cell lysates were electrophoresesed on 5-15% gradient SDS polyacrylamide gels. Proteins were transferred to membranes by electroblottmg, the membranes were blocked and treated overnight with specific primary antibodies, one to C-Raf and one to actin as an internal control to correct for loading of different amounts in different gel lanes. Following this, the membranes were incubated with secondary antibodies conjugated to alkaline phosphatases. Antibody-specific protein bands could then be detected by an enhanced chernifluorescence detection reagent, visualized by a STORM^® phosphorimager scanner, and quantified by NIH ImageQuant 1.61.

The levels of inhibition from four samples treated with each S-ODN are given in the second column of Table 5. Two of the three S-ODN sequences selected by the present invention were among the highest in percent inhibition, and S-ODN#2098 (SEQ ID NO: 38) that we selected was relatively better in its inhibition than S-ODN#2484 (SEQ ID NO: 48) that was previously selected by trial-and-error from 34 sequences [18, 19]. S-ODN#2482 is identical to the SEQ ID No: 1 of United States Patent No. 5,656,612 [54].

The present invention also differs from the inventions of United States Patent Nos. 5,744,362 and 5,654,284, which relate to specific types of ODN modifications in which the phosphorothioate linkages are of one chirality or in which the sugar contains a methoxyethoxy modification [55, 56]. All of the S- ODNs used in the present examples 1, 2, and 3 are from commercial sources (Midland Certified Reagent Company or Oligos Etc., Inc) and contain backbone sulfur substitutions of mixed chirality. Moreover, the present invention relates to the selection of subtarget sequences of high inhibition potential for S-ODNs of mixed chirality. However, the subtarget sequences chosen by this invention may also have utility for other types of ODN modifications.

Table 5 C-Raf sequence position and inhibition by phosphorothioate antisense DNA sequences in A549 cells

* Average and standard deviation from four experiments; % inhibition is relative to untreated and cells and corrected for gel loading by reference to an internal actin control in each lane. A random sequence control showed less than 6% inhibition; the control sequence was 5' TGCGTTGAGGTCTATCCAGC 3' (SEQ ID NO: 27).

Example 3 -Inhibition Test of Selected Sites for Brome Mosaic Virus mRNA

An in vitro translation study was performed using Brome Mosaic Virus ( 13MV). The in vitro translation mixture included rabbit reticulocyte lysate, 2.25, nM BMV mRNA, and 0.5 unit RNaseH. To this mixture was added ³⁵S- methionine and antisense oligomer (0-1500nM). The RNaseH cleaves the RNA of any hybrids formed between the mRNA target site and the added antisense phosphorothioate DNA oligonucleotide (S-ODN), which stops the production of protein from that target mRNA. The mixture was incubated at 30 °C for 30 minutes. Then, the sample was run on a 12.5% SDS-polyacrylamide gel after which the gel was exposed on a phosphorimager. The bands were quantitated by using NIH ImageQuant 1.61. Autoradiographs of 12.5% SDS-polyacrylamide gels of proteins synthesized in vitro using 2.25 nM BMV mRNA are shown in Figure 8.

The antisense inhibition of BMV RNA involved nine antisense phosphorothioate-modified S-ODNs, which were targeted to the 35 kDa protein coding sequence on BMV mRNA3. Six of the S-ODNs were 20-mers and are listed in the first six rows of Table 6. Three additional oligomers were shorter versions of S-ODN#89 and are listed together with S-ODN#89 in the last four rows of Table 6. The percentage specific in vitro translation inhibition data of the 35 kDa protein encoded on BMV mRNA #3 is shown in Table 6 for all nine oligomers. They inhibited the 35 kDa protein in a specific manner, with no effect on the 20 kDa protein from RNA3, as shown for S-ODN#89 in the example in Figure 8.

Dose response curves for inhibition of the 35 kDa protein by S-ODNs #89, #140, and #241 are shown in Figures 9, 10, and 11, respectively.

The % inhibition for the six 20-mer S-ODNs at 500 nM concentration ranged from 17.8 to 99.4% (Table 6). These 20-mer phosphorothioate oligomers demonstrated a general correlation between % inhibition and predicted ranking by our selection procedure. The correlation between Tm and percentage inhibition of BMV mRNA #3 at 500nM S-ODN concentration is shown in Figure

12. Although the correlation does not change gradually, the sequences of highest stability rank are those of best inhibitory ability. Therefore, the method of this application for selecting the best subtarget sequences for antisense inhibition provides for selecting effective sequences for in vitro translation inhibition. The S-ODN#89 subtarget sequence included the starting AUG codon. A further set of S-ODNs of varying length which were targeted to the AUG containing region were studied. They demonstrated a good correlation between % inhibition and Tm calculated for different oligomer length according to the length-dependent option of the NNTSA program. These results are in the last four rows of Table 6. Thus, the method of this application for selecting antisense sequences is not restricted to oligomers that are 20 nucleotides in length. Table 6 BMV mRNA#3 sequence position and inhibition by phosphorothioate antisense DNA sequences in an in vitro translation system

Sequence Inhibition Rank by Rank by OLIGO

Position (%)* Tm(°C) - G°(37) (mRNA target with t = u)/(antisense DNA

* Average and standard deviation of at least three samples; % inhibition is of the protein band at 500nM, oligomer concentration, relative to the inhibition of the 20 kDa protein band.

** the calculated Tm (°C) and - G° (kcal/mol at 37°C) values have a length correction applied by the NNTSA computer program as described in United States Patent No.

5,856,103. Example 4 - Selection Of Optimal Sites for Inhibition of Carbonic Anhydrase (CA12) Gene mRNA

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful in testing for an overexpression of this isozyme in lung cancers. Ten optimal sites for ODN hybridization on the carbonic anhydrase isozyme CA12 mRNA are shown in Table 7.

Table 7

Selected 10 subtarget antisense sites for CA12 from NNTSA analysis, ranked by Tm

Position Tm - G°(37) mRNA target (with t=u)*

123 71.74 49.68 ggcgcagcctgcacgcggcg (SEQ ID NO: 73) 1 12244 7 711..7744 4 499..6688 gcgcagcctgcacgcggcgg (SEQ ID NO: 74)

121 70.76 48.82 ccggcgcagcctgcacgcgg (SEQ ID NO: 75)

122 70.76 48.82 cggcgcagcctgcacgcggc (SEQ ED NO: 76)

125 70.76 48.82 cgcagcctgcacgcggcggc (SEQ ID NO: 77)

126 70.76 48.82 gcagcctgcacgcggcg;gcc (SEQ ID NO: 78) 1 12277 7 700..7766 4 488..8822 cagcctgcacgcggcggccg (SEQ ID NO: 79)

129 70.64 48.77 gcctgcacgeggcggccgtg (SEQ ID NO: 80)

120 69.78 47.97 cccggcgcagcctgcacgcg (SEQ ID NO: 81)

130 69.66 47.91 cctgcacgcggcggccgtgc (SEQ ID NO: 82)

*Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Example 5 - Selection of Optimal Sites for Inhibition of c-Myc Oncoprotein Gene mRNA The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via deregulation of c-Myc protein expression, in treating many types of human tumors, particularly small cell lung carcinoma, breast, and cervical carcinomas. Twelve optimal sites for ODN hybridization on the Myc-mRNA are shown in Table 8. Table 8 Selected 12 subtarget antisense sites for c-Myc from NNTSA analysis, ranked by Tm

Position TM - G°(37) mRNA target.(with t=u)*

816 69.53 48.998 cgacggcggtggcgggagct (SEQ ID NO: 83

805 68.72 48.9385 cggggagacaacgacggcgg (SEQ ID NO: 84

814 68.39 48.6035 aacgacggcggtggcgggag (SEQ ID NO: 85

811 68.38 48.0355 gacaacgacggcggtggcgg (SEQ ID NO: 86

812 68.38 48.0355 acaacgaeggcggtggcggg (SEQ ID NO: 87 8 81133 6 688..3388 4 488..00335555 caacgacggcggtggcggga (SEQ ID NO: 88

817 67.69 47.2395 gacggcggtggcgggagett (SEQ ID NO: 89

458 67.435 47.3435 cccgccgctgccaggacccg (SEQ ID NO: 90

459 67.435 47.3435 ccgccgctgccaggacccgc (SEQ ID NO: 91

965 67.04, 46.315 geggct-tctcggccgccgcc (SEQ ID NO: 92 1 1004488 6 666..995555 4 466..77008855 cccgcccgcggccacagcgt (SEQ ID NO: 93

1049 66.955 46.7085 ccgcccgcggccacagcgtc (SEQ ID NO: 94

* Secondary structures of RNA targets except positions 965 and 1048 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Example 6 - Selection of Optimal-Site for Inhibition of Cyclin Dl Gene mRNA

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of

Cyclin Dl gene expression, in the diagnosis of mantle cell lymphoma and related cancers. Ten optimal sites for ODN hybridization on the Cyclin D 1-mRNA are shown in Table 9. Table 9 Selected 10 subtarget antisense sites for Cyclin Dl from NNTSA analysis, ranked by Tm

Position Tm - G°(37) mRNA target (with t=u)*

1035 74.67 54.17 gggcgccaggcaggcgggcg (SEQ ID NO: 95)

1037 73.32 53.07 gcgccaggcaggcgggcgcc (SEQ ID NO: 96)

1036 74.3 53.08 ggcgccaggcaggcgggcgc (SEQ ID NO: 97)

51 73.27 53.32 gagcgegagggagcgcgggg (SEQ ID NO: 98)

52 73.05 52.47 agcgcgagggagcgcggggc (SEQ ID NO: 99)

5533 7733..0055 5522..4477 gcgcgagggagcgcggggca (SEQ ID NO: 100)

1033 72.59 52.96 gagggcgccaggcaggcggg (SEQ ID NO : 101 )

759 71.61 50.66 gcggggagcgtggtggccgc (SEQ ID NO: 102)

752 70.66 50.55 ggtggcagcggggagcgtgg (SEQ ID NO: 103)

755 70.66 50.55 ggcagcggggagcgtggtgg (SEQ ID NO: 104) *Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Example 7— Selection of Optimal Sites for Inhibition of Insulin-Like Growth Factor I

Receptor (IGF-IR) Gene mRN

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of IGF- IR activation, in providing a therapeutic target for various cancer treatments. The key element in the attractiveness of IGF-IR as a therapeutic target is that the anti- apopotic effect of IGF-IR, which can result in a malignant phenotype, could be contradicted by antisense ODNs to these targets and cause apoptosis or complete inhibition of tumorigenesis. Ten optimal sites for ODN hybridization on the IGF- IR-mRNA are shown in Table 10. Table 10 Selected 10 subtarget antisense sites for IGF-IR from NNTSA analysis, ranked.by Tm

Position Tm - G°o(37) mRNA target (with t=u)*

749 69.51 47.91 gcctgggcagctgcagcgcg (SEQ ID NO 105)

753 69.51 47.91 gggcagctgcagcgcgcctg (SEQ ID NO 106)

750 68.53 47.06 cctgggcagctgcagcgcgc (SEQ ED NO 107)

751 68.53 47.06 ctgggcagctgcagcgcgcc (SEQ ID NO 108)

695 67.99 47.67 gcacgtgtgggaagcgggcg (SEQ ID NO 109)

703 67.35 47.72 gggaagcgggcgtgcaccga (SEQ ID NO 110)

704 67.35 47.72 ggaagegggcgtgcaccgag (SEQ ID NO 111)

747 67.09 45.79 gtgcctgggcagctgcagcg (SEQ ED NO 112)

754 67.06 45.60 ggcagctgcagcgcgcctga (SEQ ID NO 113)

72 66.04 46.39 cccgacctcgctgtgggggc (SEQ ID NO 114)

*Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Example 8 - Selection of Optimal Sites for Inhibition of c-Myb Gene mRNA

The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of the expression of the transcription factor c-Myb, in treating myoblastic leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, T cell leukemia, colon carcinomas, and melanomas. Ten optimal sites for ODN hybridization on the c-Myb-mRNA are shown in Table 11.

Table 11 Selected 10 subtarget antisense sites for c-Myb from NNTSA analysis, ranked by Tm

Position Tm - G°(37) mRNA target (with t=u)*

102 69.3 49.32 gcccgccgcgccatggcccg (SEQ ID NO 115)

100 68.32 48.47 ccgcccgccgcgccatggcc (SEQ ID NO 116)

101 68.32 48.47 cgcccgccgcgccatggccc (SEQ ID NO 117)

103 67.06 47.30 cccgccgcgccatggcccga (SEQ ID NO 118)

105 66.3 46.66 cgccgcgccatggcccgaag (SEQ ID NO 119) 1 10044 6 655..5533 4 466..0099 ccgccgcgccatggcccgaa (SEQ ED NO: 120)

726 65.32 45.14 gccagccagccagcagtggc (SEQ ED NO: 121)

727 63.73 44.52 ccagccagccagcagtggcc (SEQ ED NO 122)

341 63.59 43.39 geagtgccagcaccgatggc (SEQ ID NO 123)

107 63.45 44.87 ccgcgccatggcccgaagac (SEQ ED NO 124) *Secondary structures of RNA targets except position 341 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.

Example 9 - Selection of Optimal Sites for Inhibition of Bcl-2 Gene mRNA The present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via controlling expression of the Bcl-2 protein, in the diagnosis of human lymphoid neoplasms. Twenty optimal sites for ODN hybridization on the Bcl-2 mRNA are shown in Table 12.

Table 12 Selected 20 subtarget antisense sites for Bcl-2 from NNTSA analysis, ranked by Tm

Position Tm G° (37) mRNA target (with

265 74.54 52.90 cggcgccgccgcggggcctg (SEQ ID NO 125)

266 74.54 52.90 ggcgccgccgcggggcctgc (SEQ ID NO 126)

267 74.54 52.90 gcgccgccgcggggcctgcg (SEQ ID NO 127)

263 74.37 54.02 cccggcgccgccgcggggcc (SEQ ID NO 128)

268 73.56 52.05 cgccgccgcggggcctgcgc (SEQ ID NO 129)

264 72.72 52.03 ccggcgccgccgcggggcct (SEQ ID NO 130)

270 70.32 40.44 ccgccgcggggcctgcgctc (SEQ ID NO: 13 1)

272 69.98 49.09 gccgcggggcctgcgctcag (SEQ ID NO: 132)

271 69.82 48.28 cgccgcggggcctgcgctca (SEQ ID NO: 133)

277 69.38 49.33 ggggcctgcgctcagcccgg (SEQ ID NO: 134)

125 69.18 48.93 gcgggagatgtgggcgccgc (SEQ ID NO: 135)

126 69.18 48.93 cgggagatgtgggcgccgcg (SEQ ID NO: 136)

127 69.18 48.93 gggagatgtgggcgccgcgc (SEQ ID NO: 137)

273 69.00 48.24 ccgcggggcctgcgctcagc (SEQ ID NO: 138)

274 69.00 48.24 cgcggggcctgcgctcagcc (SEQ ID NO: 139)

275 69.00 48.24 gcggggcctgcgctcagccc (SEQ ID NO: 140)

276 69.00 48.24 cggggcctgcgctcagcccg (SEQ ID NO: 141)

183 68.50 48.16 cgcagcccgggcacacgccc (SEQ ID NO: 142)

184 68.50 48.16 gcagcccgggcacacgcccc (SEQ ID NO: 143)

128 68.20 48.08 ggagatgtgggcgccgcgcc (SEQ ID NO: 144)

*Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region. Bibliography

The following references are hereby specifically incorporated herein by reference:

1. Mercola D, Cohen JS ( 1995) Antisense approaches to cancer gene therapy.

Cancr Gene Ther. 2:47-59.

2. Orr RM, Monia BP (1998) Antisense therapy for cancer. Molecular Therapeutics 1:102-108.

3. Dean N, McKay R, Miraglia L, Howard R, Cooper S, Giddings J, Nicklin P, Meister L, Ziel R, Geiger T, Muller M, Fabbro D (1996) Inhibition of growth of human tumor cell lines in nude mice by an antisense of oligonucleotide inhibitor of protein kinase C-alpha expression. Cancer Res. 56:3499-3507.

4. Denham DW, Franz MG, Denham W, Zervos EE, Gower WR Jr, Rosemurgy AS, Norman J ( 1998) Directed antisense therapy confirms the role of protein kinase C-alpha in the tumorigenicity of pancreatic cancer. Surgery 124:218-23.

5. Dennis JU, Dean NM, Bennett CF, Griffith JW, Lang CM, Welch DR (1998) Human melanoma metastasis is inhibited following ex vivo treatment with an antisense oligonucleotide to protein kinase C-alpha. Cancer Lett. 128:65-70.

6. Geiger T, Muller M, Dean NM, Fabbro D (1998) Antitumor activity of a PKC-alpha antisense oligonucleotide in combination with standard chemotherapeutic agents against various human tumors transplanted into nude mice. Anticancer Drug Des. 13:35-45. 7. Glazer RI (1997) Protein kinase C as a target for cancer therapy. A n tisense Nucleic A cid Drug Dev. 7:235-238.

8. Levesque L, Dean NM, Sasmor H, Crooke ST (1997) Antisense oligonucleotides targeting human protein kinase C-alpha inhibit phorbol ester-induced reduction of bradykinin-evoked calcium mobilization in A549 cells. Mol Pharmacol. 51:209-216.

9. McGraw K, McKay R, Miraglia L, Boggs RT, Pribble JP, Muller M, Geiger T, Fabbro D, Dean NM (1997) Antisense oligonucleotide inhibitors of isozymes of protein kinase C: in vitro and in vivo activity, and clinical development as anti-cancer therapeutics. Anticancer Drug Des. 12:315-326.

10. Mellor H, Parker PJ (1998) The extended protein kinase C superfamily.

Biochem. J. 332:281292.

11. Stewart A ( 1997) Antisense against protein kinase C-alpha mRNA makes sense for cancer therapy. Mol. Med. Today 3:324.

12. Yazaki T, Ahmad S, Chahlavi A, Zylber-Katz E, Dean NM, Rabkin SD, Martuza RL, Glazer RI (1996) Treatment of glioblastoma U-87 by systemic administration of an antisense protein kinase C-alpha phosphorothioate oligodeoxynucleotide. Mol. Pharmacol. 50:236-242.

13. Bergenhem NC, Sait SS, Eddy RL, Shows TB, Tashian RE (1995) Assignment of the gene for human carbonic anhydrase VIII (CA8) to chromosome 8ql l— >ql2. Cytogenet. Cell-Genet. 71:299-300.

14. Ivanov SV, Kuzmin 1 , Wei MH, Pack S, Geil L, Johnson BE, Stanbridge

EJ, Lerman MI (1998) Down-regulation of transmembrane carbonic anhydrases in renal cell carcinoma lines by wild-type von Hippel-Lindau transgenes. Proc. Natl Acad. Sci. USA 95:12596-125601.

15. Nagao Y, Platero JS, Waheed A, Sly WS (1993) Human mitochondrial carbonic anhydrase: cDNA cloning, expression, subcellular localization, and mapping to chromosome 16. Proc. Natl Acad. Sci. USA 90:7623-

7627.

16. Sly WS, Hu PY (1995) Human carbonic anhydrases and carbonic anhydrase deficiencies. Annu. Rev. Biochem. 64:375-401.

17. Lau QC, Brusselbach S, Muller R (1998) Abrogation of c-Raf expression induces apoptosis in tumor cells. Oncogene 16:1899-1902.

18. Monia BP, Sasmor H, Johnston JF, Freier SM, Lesnik EA, Muller M,

Geiger T, Altmann KH, Moser H, Fabbro D (1996) Sequence-specific antitumor activity of a phosphorothioate oligodeoxyribonucleotide targeted to human C-Raf kinase supports an antisense mechanism of action in vivo. Proc. Natl Acad. Sci. USA 93: 15481-15484.

19. Monia BP, Johnston JF, Geiger T, Muller M, Fabbro D (1996) Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against C-Raf kinase. Nat. Med. 2:668-675.

20. Soldatenkov VA, Dritschilo A, Wang FH, Olah Z, Anderson WB, Kasid U ( 1997) Inhibition of Raf- 1 protein kinase by antisense phosphorothioate oligodeoxyribonucleotide is associated with sensitization of human laryngeal squarnous carcinoma cells to gamma radiation. Cancer. J. Sci. Am. 3: 13-20.

21. Balaji KC, Koul H, Mitra S, Maramag C, Reddy P, Menon M, Malhotra RK, Laxmanan S (1997) Antiproliferative effects of c-Myc antisense oligonucleotide in prostate cancer cells : a novel therapy in prostate cancer. Urology 50:1007-10015.

22. Broaddus WC, Chen ZJ, Prabhu SS, Loudon WG, Gillies GT, Phillips LL, Fillmore H (1997) Effect of c-Myc antisense phosphorothioate oligodeoxynucleotides in malignant glioma cells. Neurosurgery 41 :908- 915.

23. Cerutti J, Trapasso F, Battaglia C, Zhang L, Martelli ML, Visconti R, Berlingieri MT, Fagin JA, Santoro M, Fusco A (1996) Block of c-myc expression by antisense oligonucleotides inhibits proliferation of human thyroid carcinoma cell lines. Clin. Cancer Res. 2:119-126.

24. Citro G, D'Agnano I, Leonetti C, Perini R, Bucci B, Zon G, Calabretta B, Zupi G (1998) C-myc antisense oligodeoxynucleotides enhance the efficacy, of cisplatin in melanoma chemotherapy in vitro and in nude mice. Cancer Res. 58:283-289.

25. Smith JB, Wickstrom E ( 1998) Antisense c-myc and immunostimulatory oligonucleotide inhibition of tumorigenesis in a murine B-cell lymphoma transplant model. J. Natl. Cancer Ins t. 90:1146-1154. 26. Yu BW, Nguyen D, Anderson S, Allegra CA (1997) Phosphorothioated antisense c-myc oligonucleotide inhibits the growth of human colon carcinoma cells. Anticancer Res . 17:4407-4413.

27. Arber N, Doki Y, Han EK, Sgambato A, Zhou P, Kim NH, Delohery T,

Klein MG, Holt PR, Weinstein IB (1997) Antisense to cyclin Dl inhibits the growth and tumorigenicity of human colon cancer cells. Cancer Res. 57:1569-1574.

28. Cagnoli M, Barbieri F, Bruzzo C, Alama A (1998) Control of cyclin Dl expression by antisense oligonucleotides in three ovarian cancer cell lines. Gynecol Oncol. 70:372-377.

29. Driscoll B, WuL, Buckley S, Hall FL, Anderson KD, WarburtonD (1997) Cyclin Dl antisense RNA destabilizes pRb and retards lung cancer cell growth. Am. J. Physiol. 273:L941-L949.

30. Kornmann M, Arber N, Korc M (1998) Inhibition of basal and mitogen- stimulated pancreatic cancer growth by cyclin Dl antisense is associated with loss of tumorigenicity andpotentiation of cytotoxicity to cisplatinum.

J. Clin. Invest. 101:344-352.

31. Schrump DS, Chen A, Consoli U (1996) Inhibition of lung cancer proliferation by antisense cyclin D. Cancer Gene Ther. 3:131-135.

32. Zhou P, Jiang W, Zhang YJ, Kahn SM, Schieren I, Santella RM, Weinstein IB (1995) Antisense to cyclin Dl inhibits growth and reverses the transformed phenotype of human esophageal cancer cells. Oncogene 11:571-580. 33. Baserga R, Hongo A, Rubini M, Prisco M, Valentinis B (1997) The IGF-I receptor in cell growth, transformation and apoptosis. Biochima Biochysica Acta 1332:F105-F126.

34. Muller M, Dietel M, Turzynski A, Wiechen K (1998) Antisense phosphorothioate oligodeoxynucleotide down-regulation of the insulinlike growth factor I receptor in ovarian cancer cells. Int. J. Cancer

77:567-571.

35. Citro G, Perrotti D, Cucco C, D'Agnano I, Sacchi A, Zupi G, Calabretta

B (1992) Inhibition of leukemia cell proliferation by receptor-mediated uptake of c-Myb antisense oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 89:7031-7035.

36. Citro G, Szczylik C, Ginobbi P, Zupi G, Calabretta B ( 1994) Inhibition of leukemia cell proliferation by folic acid-polylysine-mediated introduction of c-Myb antisense oligodeoxynucleotides into HL-60 cells. Br. J. Cancer 69:463-467.

37. Del Bufalo D, Cucco C, Leonetti C, Citro G, D'Agnano I, Benassi M,

Geiser T, Zon G, Calabretta B, Zupi G (1996) Effect of cisplatin and c- Myb antisense phosphorothioate oligodeoxynucleotides combination on a human colon carcinoma cell line in vitro and in vivo. Br. J. Cancer 74:387-393.

38. Ness SA (1996) The Myb oncoprotein: regulating a regulator. Biochimica Biophysica Acta 1288:F123-F139. 39. Ratajczak MZ, Kant JA, Luger SM, Hijiya N, Zhang J, Zon G, Gewirtz AM (1992) In vivo treatment of human leukemia in a scid mouse model with c-Myb antisense oligodeoxynucleoiides. Proc. Natl. Acad. Sci. USA 89:1 1823-1 1827.

40. Farrow SN, Brown R (1996) New members of the Bcl-2 family and their protein partners. Curr. Opinion Gen. & Devel 6:45-49.

41. Jansen B, Schlagbauer-Wadl H, Brown BD, Bryan RN, van Elsas A. Muller M, Wolff K, Eichler HG, Pehamberger H. (1998) Bcl-2 antisense therapy chemosensitizes human melanoma in SCID mice. Nat. Med. 4:232-234.

42. Smith MR, Abubakr Y, Mohanunad R, Xie T, Hamdan M, al-Katib, A (1995) Antisense oligodeoxyribonucleotide down-regulation of bcl-2 gene expression inhibits growth of the lowgrade non-Hodgkin's lymphoma cell line WSU-FSCCL. Cancer Gene Ther. 2:207-212.

43. Webb A, Cunningham D, Cotter F, Clarke PA, di Stefano F, Ross P, Corbo M, Dziewanowska Z (1997) BCL-2 antisense therapy in patients with non-Hodgkin lymphoma. Lancet 349:1137-1141.

44. Zangemeister-Wittke U, Schenker T, Luedke GH, Stahel RA Synergistic cytotoxicity of bcl-2 (1998) antisense oligodeoxynucleotides and etoposide, doxorubicin and cisplatin on small-cell lung cancer cell lines.

Br. J. Cancer 78: 1035-1042. 45. Ziegler A, Luedke GH, Fabbro D, Altmann KH, Stahel RA, Zangemeister- Wittke U (1997) Induction of apoptosis in small-cell lung cancer cells by an antisense oligodeoxynucleotide targeting the Bcl-2 coding sequence. J. Natl. Cancer Inst. 89: 1027-1036.

46. Ahlquist P, Dasgupta R, Kaesberg P (1981) Near identity of 3' RNA secondary structure in bromoviruses and cucumber mosaic virus. Cell 23: 183-189.

47. Ahlquist P, Dasgupta R, Kaesberg P (1984) Nucleotide sequence of the brome mosaic virus genome and its implications for viral replication. J Mol Biol. 172:369-383.

48. Janda M, Ahlquist P (1998) Brome mosaic virus RNA replication protein la dramatically increases in vivo stability but not translation of viral genomic RNA3. Proc. Natl. Acad. Sci. USA 95:2227-2232.

49. Miller WA, Dreher TW, Hall TC (1985) Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on (-) -sense genomic RNA. Nature 313:68-70.

50. Shih DS, Kaesberg P (1976) Translation of the RΝAs of brome mosaic virus: The monocistronic nature of RΝA1 and RΝA2. J. Mol. Biol. 103:77-88.

51. Bennett, CF, Dean, N. (1997) Oligonucleotide modulation of protein kinase C. United States Patent No. 5,703,054.

52. Bennett, CF, Dean, N. (1999) Antisense oligonucleotides against human protein kinase C. United States Patent No. 5,885,970. 53. Bennett, CF, Dean, N. ( 1999) Oligonucleotide inhibition of protein kinase C. United States Patent No. 5,882,927.

54. Monia BP (1997) Antisense oligonucleotide modulation of Raf gene expression. United States Patent No. 5,656,612.

55. Monia, BP, Martin, P, Altmann, K.-H. (1998) Antisense oligonucleotide modulation of Raf gene expression. United States Patent No. 5,744,362.

56. Cook, PD, Hoke, G. (1997) Oligonucleotides for modulating RAF kinase having phosphorothioate linkages of high chiral purity. United States Patent No. 5,654,284.

NUMER ICAL LIST OF SEOUENCES

275 gcggggcctgcgctcagccc (SEQ ID NO 140)

276 cggggctgcgctcagcccg (SEQ ID NO 141)

183 cgcagcccgggcacacgccc (SEQ ID NO 142)

184 gcagcccgggcacacgcccc (SEQ ID NO 143)

128 ggagatgtgggcgccgcgcc (SEQ ID NO 144)

Claims

WHAT IS CLAIMED IS:

1. A method for selecting optimal subsequence antisense targets for inhibition of mRNA expression of target mRNA sequences comprising: collecting mRNA sequences of genes of interest from a cell; deter-mining nearest-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence; determining a hybridization efficiency for each mRNA subsequence according to its Tm (°C) or G° (kcal/mol at 37 °C) value; selecting a set of subsequences to provide a set of optimal target sequences; preparing a set of antisense sequences specific for said set of optimal target sequences; and selecting from said set of antisense sequences those sequences having protein or cell growth inhibition efficiencies of at least

50% to provide optimal subsequence antisense targets.

2. The method of claim 1 further defined as comprising: deleting subsequence targets that have competing structures; and screening optimal subsequence antisense targets for antisense inhibition or other control of mRNA expression.

3. The method of claim 1 further defined as comprising: eliminating antisense sequences containing repeating G sequences or a G cluster; and analyzing secondary structure of each selected antisense oligomer sequence and each mRNA subsequence by secondary structure programs.

4. The method of claim 3 wherein a G cluster is further defined as four or more consecutive G's in the antisense sequence.

5. The method of claim 1 further comprising eliminating antisense molecules having a percentage of self-complementary bases greater than about 40% percent.

6. The method of claim 3 wherein a set of chosen subsequence targets is further defined as a set of 10 to 20 subsequence targets.

7. A method for selecting optimal subsequence antigene targets for inhibition or other control of DNA expression of genomic DNA sequences comprising: collecting DNA sequences of genes of interest expressed by a cell, where each gene sequence corresponds to an expressed gene sequence plus its control sequences; determining the nearest-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence; determining the hybridization efficiency for each DNA subsequence with a triplex-forming antigene molecule according to its Tm (°C) or G° (kcal/mol at 37°C) value; selecting a set of subsequences that are optimal target sequences; preparing a set of antigene sequences specific for said target sequences; and selecting from said set of antigene sequences having mRNA, protein, or cell growth inhibition efficiencies of about 50% or more as the optimal subsequence antigene targets.

8. The method of claim 7, further defined as comprising: deleting subsequence targets that have competing structures; selecting subsequence targets that are highest in hybridization potential; and testing the chosen subsequence targets for antigene inhibition or other control of DNA expression.

9. The method of claim 7, further defined as comprising: eliminating antigene sequences containing repeating G sequences or a G cluster; analyzing the secondary structure of each selected antigene oligomer sequence; selecting a set of subsequence targets that are highest in hybridization potential; and testing the chosen subsequence targets for antigene inhibition or other control of DNA expression.

10. The method of claim 7, further comprising the step of eliminating antigene molecules having a percentage of self-complementary bases greater than 40% percent.

11. The method of claim 9 wherein a G cluster is further defined as four or more consecutive G's in an antigene sequence.

12. The method of claim 9 wherein a set of subsequence targets is further defined as 10 to 20 subsequence targets.

13. A library of optimal subsequence antisense targets for controlling expression of target mRNA sequences of human genes comprising selected mRNA subsequence targets of a human gene of interest.

14. The library of claim 13 wherein the selected mRNA subsequence targets of a human gene are c-Myc, c-Myb, Bcl-2, c-Raf, Cyclin Dl, IGF-IR, PKCo, or CA12 genes.

15. A library of antisense reagents having binding specifically for the library of optimal subsequence antisense targets of claim 13.

16. A library of optimal subsequence antigene targets capable of controlling DNA expression of a human genomic DNA sequence of a human gene comprising a genomic DNA subsequence target, where the optimal antigene targets have high relative hybridization efficiencies.

17. The library of claim 16 wherein the genomic DNA subsequence target is a c-Myc, c-Myb, Bcl-2, c-Raf, Cyclin D 1 , IGF-IR, PKCo; or a CA12 gene.

18. A library of antisense reagents having binding specifically for the library of optimal subsequence antisense targets of claim 16.

19. An antisense oligonucleotide up to 50 nucleotides in length comprising SEQ ID NO. 13, which oligonucleotide specifically binds human protein kinase C-alpha.

20. An antisense oligonucleotide up to 50 nucleotides in length comprising SEQ ID NO. 14, which oligonucleotide specifically binds human protein kinase C-alpha.

21. An antisense oligonucleotide up to 50 nucleotides in length comprising SEQ ID NO. 38, which oligonucleotide specifically binds human C-raf protein kinase.

22. An antisense oligonucleotide up to 50 nucleotides in length comprising SEQ ID NO. 39, which oligonucleotide specifically binds human C-raf protein kinase.

23. An antisense oligonucleotide up to 50 nucleotides in length comprising SEQ ED NO. 40, which oligonucleotide specifically binds human C-raf protein kinase.