WO2001045707A1 - Inhibitors of prenyl-protein transferase - Google Patents

Inhibitors of prenyl-protein transferase Download PDF

Info

Publication number
WO2001045707A1
WO2001045707A1 PCT/US2000/034324 US0034324W WO0145707A1 WO 2001045707 A1 WO2001045707 A1 WO 2001045707A1 US 0034324 W US0034324 W US 0034324W WO 0145707 A1 WO0145707 A1 WO 0145707A1
Authority
WO
WIPO (PCT)
Prior art keywords
substituted
unsubstituted
heterocycle
aryl
alkyl
Prior art date
Application number
PCT/US2000/034324
Other languages
French (fr)
Inventor
Jacob M. Hoffman
Original Assignee
Merck & Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck & Co., Inc. filed Critical Merck & Co., Inc.
Priority to AU22741/01A priority Critical patent/AU2274101A/en
Publication of WO2001045707A1 publication Critical patent/WO2001045707A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/10—Spiro-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • Ras proteins are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
  • Ras In the inactive state, Ras is bound to GDP.
  • Ras Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change.
  • the GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M.
  • Mutated ras genes (Ha-ras, KMa-ras, Ki4b-ras and N-ras) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
  • Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
  • the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa- 1 -- Aaa -Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 3i0:583-586 (1984)).
  • this motif serves as a signal sequence for the enzymes f arnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C 15 or C20 isoprenoid, respectively.
  • Ras protein transferases Such enzymes may be generally termed prenyl-protein transferases.
  • the Ras protein is one of several proteins that are known to undergo post-translational famesylation.
  • Other famesylated proteins include the Ras- related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin.
  • James, et al., /. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also famesylated.
  • James, et al. have also suggested that there are famesylated proteins of unknown structure and function in addition to those listed above.
  • Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al, Cell, (52:81-88 (1990); Schaber et al, J. Biol Chem., 265: 14701-14704 (1990); Schafer et al, Science, 249: 1133-1139 (1990); Manne et al, Proc. Natl. Acad. Sci USA, 57:7541-7545 (1990)).
  • Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells.
  • direct inhibition of farnesyl- protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
  • FPTase farnesyl-protein transferase
  • FPP farnesyl diphosphate
  • Ras protein substrates
  • the peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation.
  • Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1937 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
  • deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound.
  • the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
  • farnesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7-112930).
  • an object of this invention to develop compounds that will inhibit prenyl-protein transferase and thus, the post-translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the compounds of this invention and methods for producing the compounds of this invention.
  • the present invention comprises structurally-constrained compounds which inhibit prenyl-protein transferases. Further contained in this invention are chemotherapeutic compositions containing these prenyl-protein transferase inhibitors and methods for their production.
  • the compounds of this invention are useful in the inhibition of prenyl- protein transferase and the prenylation of the oncogene protein Ras.
  • the inhibitors of a prenyl-protein transferase are illustrated by the formula A-1:
  • X 1 is (CR ⁇ n A ⁇ CR 1 ⁇ ;
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, ) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, ) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R , 1 l 0 u ,C(O)NR 1 ⁇ 0 ⁇ -,
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) ⁇ ⁇ C cycloalkyl, unsubstituted or substituted, 1) C -C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R 10 ) 2 NC(O)NR 10 -, o) R 10 C(O)-, p) R 10 C(O)NR 10 -, q) R 10 OC(O)-, r) -N(R 10 ) 2 , and s)
  • R >3 i-s independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) ⁇ ⁇ C cycloalkyl, unsubstituted or substituted, k) C ⁇ C alkenyl, unsubstituted or substituted,
  • R 5 is selected from: a) hydrogen, b) ⁇ ⁇ C a ⁇ yl > unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R 6 and R 7 are independently selected from: H, C j -C 6 alkyl, C 3 -C 6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C ⁇ - perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j -C 8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, f) ⁇ 0 0R, ° , g) — S(0) m R 6a , and h) N(R 10 ) 2 ; or
  • R and R may be joined in a ring
  • R 6 is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, c) unsubstituted or substituted C 2 -C 6 alkynyl, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) unsubstituted or substituted C C perfluoroalkyl, f) halo, g) R 10 O-, h) CN, i) R 6a S(O) m -, j) -C(O)NR 6 R 7 , k) R 10 C(O)NR 10 -,
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) triflu ⁇ romethyl, f) 2,2,2-trifluoroethyl,, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is selected from NH, CH or oxygen
  • V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) C j -C ⁇ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and e) C 2 -C 20 alkenyl; provided that V is not hydrogen if A 1 is S(O) m and n is 0;
  • W is a heterocycle
  • Y is C(O) or NR 5 ;
  • Z is NR 5 or C(O); provided that if Y is C(O), then Z is NR 5 and if Y is NR 5 then Z is C(O); m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5, provided that r is 0 when V is hydrogen; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, or 3; and z is O or l;
  • X 1 is (CR ⁇ n A ⁇ CR 1 ⁇ ;
  • X 2 is (CR l 2 ), ,A 2 (CR l 2 ) ] P'
  • R la and R l are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10
  • P) unsubstituted or si substituted C C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R 10 O-, R 6a S(O) m halo, C(O)NR 6 R 7 , R 10 C(O)NR 10 -, (R 10 ) 2 NC(O)NR 10 -, R 10 C(O)-,
  • R >2 i •s independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C ⁇ C n cycloalkyl, unsubstituted or substituted,
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C ⁇ C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C ',-C cycloalkyl, unsubstituted or substituted, k) C ⁇ C a ⁇ enyl, unsubstituted or substituted,
  • R is selected from: a) hydrogen, b) C ⁇ C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R and R are independently selected from: H, C j -C 6 alkyl, C 3 -C 6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C j -C 4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j -C 6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
  • R and R may be joined in a ring
  • R 6 is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, c) unsubstituted or substituted C 2 -C 6 alkynyl, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) unsubstituted or substituted C C 4 perfluoroalkyl, ) halo, g) R 10 O-, h) CN, i) R a s( ⁇ ) m -, j) -C(O)NR 6 R 7 , k) R 10 C(O)NR 10 -,
  • perfluoroalkyl F, Cl, Br, R 10 O-, R 6a S(O) m -, -C(O)NR 6 R 7 , R 10 C(O)NR 10 -, CN, (R 10 ) 2 NC(O)NR 10 -, R 10 C(O)-, R 10 OC(O)-, N 3 , -N(R 10 ) 2 , and
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) C C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is selected from NH, CH 2 or oxygen
  • V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) j -C ⁇ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and e) C 2 -C 20 alkenyl, provided that V is not hydrogen if A 1 is S(O) and n is 0; W is a heterocycle;
  • X 1 is (CR ⁇ nA ⁇ CR 1 ⁇ ;
  • X z is (CR ⁇ pA ⁇ CR l 1 b 0 ,), p>
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -,
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) ⁇ ⁇ 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C ',-C cycloalkyl, unsubstituted or substituted,
  • R is independently selected from: a) hydrogen, b) halo, c) C 1-C 6, alkyl, unsubstituted or substituted, d) CN, e) NO 2 , ) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C -C cycloalkyl, unsubstituted or substitui k) C -C alkenyl, unsubstituted or substituted,
  • R 5 is selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R and R are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: ) C3- cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy, 2) aryl or heterocycle,
  • hydrc )gen is independently selected from: a) hydrc )gen, b) unsubstituted or substituted C 1 -C 4 perfluoroalkyl, c) halo, d) R 10 O-, e) -C(O)NR 6 R 7 , f) R 10 C(O)NR 10 -, g) (R 10 ) 2 NC(O)NR 10 h) R 10 C(O)-, i) R 10 OC(O)-,
  • R .10 i. s independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is CH 2 or oxygen
  • V is selected from: a) heterocycle, b) aryl, and c) C J -C JQ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N;
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopi ⁇ eridinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • n 0, 1, 2, 3, 4, 5 or 6
  • p 0, 1, 2, 3, 4, 5 or 6
  • r 0 to 5
  • s is 0, 1, 2, 3 or 4
  • t is 0, 1, 2, or 3
  • z is O or l
  • X 1 is (CR la 2 ) I1 A 1 (CR la 2)n;
  • X' is (CR , 1 1 b D 2 ) p A 2 (CR lb 2 ) p ;
  • R la and R l are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -, 1) R 10 C(O)-, m) -N(R 10 ) 2 , n) R 10 OC(O)-, o) R 10 OC(O)NR 10 -, p) unsubstituted or substituted - al
  • R is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C ⁇ C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) ⁇ "C cycloalkyl, unsubstituted or substituted,
  • R is independently selected from: a) hydrogen, b) halo, c) -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C -C cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted,
  • R 5 is selected from: a) hydrogen, b) C ⁇ C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R 6 and R 7 are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) - perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl; 11
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is CH 2 or oxygen
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • n 0,1,2, 3,4, 5 or 6
  • r 0to5
  • sis 0,1, 2, 3 or 4
  • t 0, 1, 2, or 3
  • z Oorl
  • X 2 is (CR lb 2 ) p A 2 (CR lb 2 ) p ;
  • R la and R l are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -, 1) R 10 C(O)-, m) -N(R 10 ) 2 , n) R 10 OC(O)-, o) R 10 OC(O)NR 10 -, p) unsubstituted or substituted -C
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C "C ⁇ k ' unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) ffl , k) C - - 10 cycloalkyl, unsubstituted or substituted, 1) C ⁇ C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R 10 ) 2 NC(O)NR 10 -, o) R 10 C(O)-, p) R 10 C(O)NR 10 -, q) R 10 OC(O)-, r) -N(R 10 ) 2 , and
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , ) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C 3-C 10 cycloalkyl, unsubstituted or substi k) C ⁇ C alkenyl, unsubstituted or substituted,
  • R > 5 i • s selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R 6 and R 7 are independently selected from: H, C j -C 8 alkyl, C 3 -C 6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C j -C 4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j -C 8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
  • R and R may be joined in a ring;
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy,
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C 4 perfluoroalkyl, c) halo,
  • R .10 i. s independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) C C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is CH 2 or oxygen
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, and thiazolyl;
  • n 0, 1, 2, 3, 4, 5 or 6
  • p 0, 1, 2, 3, 4, 5 or 6
  • r 0 to 5
  • s is 0, 1, 2, 3 or 4
  • t is 0, 1, 2, or 3
  • z is O or l
  • X 1 is (CR la 2 ) n A 1 (CR la 2 ) D
  • X is (CR l 1 b D 2 ⁇ )pA A 2(C-.TR ⁇ l 1 b D 2)p;
  • R , 1a and R , 1b are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 ,
  • R is independently selected from a) hydrogen, b) CN, c) NO , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C ⁇ C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C -C cycloalkyl, unsubstituted or substituted,
  • R is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C "C cycloalkyl, unsubstituted or substituted, k) C -C! alkenyl, unsubstituted or substituted,
  • R is selected from: a) hydrogen, b) C ⁇ C alkyl, unsubstituted or substituted; c) aryl, unsubstituted or substituted; d) heterocycle, unsubstituted or substituted; and c) aralkyl, unsubstituted or substituted;
  • R and R are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) C ⁇ _4 alkoxy,
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C 4 perfluoroalkyl, c) halo,
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • J is CH 2 or oxygen
  • n 0, 1, 2, 3, 4, 5 or 6; is 0, 1, 2, 3, 4, 5 or 6; ris Oto5; sis 0,1,2, 3 or 4; tis 0, 1, 2, or 3; and si Oorl;
  • the compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
  • any variable, term or substituent e.g. aryl, heterocycle, n, Rl a ; etc.
  • substituents/or variables are permissible only if such combinations result in stable compounds.
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified; "alkoxy” represents an alkyl group having 1 to 4 carbon atoms, unless otherwise indicated, attached through an oxygen bridge.
  • Halogen or “halo” as used herein means fluoro, chloro, bromo and iodo.
  • Cycloalkyl as used herein is intended to include non-aromatic cyclic hydrocarbon groups, having the specified number of carbon atoms, which may or may not be bridged or structurally constrained.
  • cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, cyclooctyl, cycloheptyl, and the like.
  • alkenyl refers to a non-aromatic hydrocarbon, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present.
  • C2-C6 alkenyl means an alkenyl radical having from
  • alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl and cyclohexenyl.
  • alkyl the straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated.
  • alkynyl refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon-carbon triple bonds may be present.
  • C2-C6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms. Examples of such alkynyl groups include, but are not limited to, ethynyl, propynyl and butynyl.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
  • aryl is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic.
  • aryl elements include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
  • aralkyl is intended to mean an aryl moiety, as defined above, attached through a C ⁇ -Cg alkyl linker, where alkyl is defined above.
  • aralkyls include, but are not limited to, benzyl, naphthylmethyl and phenylbutyl.
  • heterocycle or heterocyclic represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic hetero- cyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring.
  • the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure.
  • heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzo- thiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzopyrazolyl, benzotriazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydro- benzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, furanyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl,
  • heteroaryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S.
  • heteroaryl elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzopyrazolyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furanyl, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyrazinyl, pyrazolyl, pyri
  • heteroaralkyl is intended to mean a heteroaryl moiety, as defined above, attached through a Cj-Cg alkyl linker, where alkyl is defined above.
  • heteroaralkyls include, but are not limited to,
  • substituted alkyl As used herein, the terms "substituted alkyl”, “substituted alkenyl”,
  • substituted alkynyl and “substituted alkoxy” are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, Cl, Br, I, CF3, OCF 3 , N3, NO2, NH2, oxo, OH, -O(C r C 6 alkyl), S(O) 0 _ 2 , (C r C 6 alkyl)S(O) 0 _ 2 -, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, -(C r C 6 alkyl)S(O) 0 . 2 (C r C 6 alkyl), C 3 -C 20 cycloalkyl, C 2 -C 6 alkenyl,
  • substituted aryl As used herein, the terms “substituted aryl”, “substituted heterocycle”, “substituted heteroaryl”, “substituted cycloalkyl”, “substituted benzyl”, “substituted aralkyl” and “substituted heteroaralkyl” are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound. Such substitutents are preferably selected from the group which includes but is not limited to F, Cl, Br, I, CF3, OCF 3 , NH 2 , N(C r C 6 alkyl) 2 , NO 2 ,
  • C3 - C 2 ⁇ cycloalkyl may include, but are not limited to:
  • R la and R lb are independently selected from H, unsubstituted or substituted -C 6 alkyl, R 10 O-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle. More preferably R la and R lb are independently selected from H, unsubstituted or substituted Ci ⁇ C 6 alkyl.
  • R is independently selected from hydrogen, -OR , CN, unsubstituted or substituted aryl and halogen. Most preferably, r is 1 to 3 and at least
  • R 3 is independently selected from H, halo, unsubstituted or substituted alkyl.
  • R 5 is selected from H, unsubstituted or substituted Ci-C 6 alkyl, unsubstituted or substituted aralkyl.
  • R 8 is independently selected from H or unsubstituted or substituted Ci-C 6 alkyl.
  • J is CH 2 or oxygen.
  • V is aryl, heterocycle or -C 20 alkyl. More preferably, V is aryl. Most preferably, V is phenyl.
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 2-oxopiperidinyl, quinolinyl, isoquinolinyl, and thienyl. More preferably, W is imidazolyl or pyridinyl. Most preferably, W is imidazolyl.
  • any substituent or variable e.g., Rla, R2 ? m . p. etc.
  • -C(Rl a ) 2 can represent -CH 2 , -CHCH3, -CHC2H5, etc.
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichio- metric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • Scheme 2 shows a method for forming spiro[4H-3,l-benzoxazine- 4,4'-piperidine]-2(lH)-ones, L26.
  • Halo-substituted aniline L20 is treated with di- t-butylcarbonate to obtain L21, which is lithiated with t-butyllithium and reacted with a Boc'ed piperidone to obtain Boc-protected halobenzoxazinone L22, which can be deprotected by treatment with an acid to form L24, or can be N-alkylated on the benzoxazine ring by treatment with an alkyl or arylalkyl halide and then deprotected to form L25. Further description of this chemistry can be found in J.Med. Chem. 1983, 26: 657-661, Chem. Pharm. Bull. 1985, 33: 1129-1139, and US 4349549.
  • Scheme 3 depicts the synthesis of intermediate compounds containing a spiro-benzopiperdinone-piperidine. The techniques depicted are described in U.S. Patent 5,536,716 (issued on July 16, 1996), and herein incorporated by reference.
  • oxygenated sprioindanyl piperidine intermediates are synthesized by following hydroboration of the protected spiroindene DI with oxidative workup with pyridinium chlorochormate to provide D2.
  • the spiroindanones are then converted into benzolactam intermediates.
  • Compound D2 is treated with hydrazoic acid in an inert solvent such as chloroform (Schmidt reaction) is one of the many suitable literature methods for this transformation.
  • L is an appropriate protecting group, such as a benzyl group; R independently represents R ⁇ or a protected precursor thereof; R' independently represents R ⁇ or a protected precursor thereof,
  • X represents R ⁇ or R4 or a protected precursor thereof; arid Y represents a halide.
  • the compounds of the invention are selective inhibitors of farnesyl-protein transferase.
  • a compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 7, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 8.
  • a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: a) an IC50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC50 for the inhibition of the famesylation of hDJ protein.
  • Example 12 When measuring such IC50S and EC50S the assays described in Example 12 may be utilized.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: b) an IC50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-
  • Ras dependent activation of MAP kinases in cells at least 100-fold greater than the EC50 for inhibition of the famesylation of the protein hDJ in cells.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: c) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-r ⁇ s-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
  • IC50 a measurement of in vitro inhibitory activity
  • H-r ⁇ s-CVLL SEQ.ID.NO.: 1 dependent activation of MAP kinases in cells.
  • the compounds of the invention are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • Such a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
  • a SEAP assay such as described in Example 11 , it is preferred that the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 12 ⁇ M against K4B-Ras dependent activation of MAP kinases in cells.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC50 for inhibiting the famesylation of the protein hDJ in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC50 a measurement of in vitro inhibitory activity
  • the Class ⁇ prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against H-ras-
  • CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC50 a measurement of in vitro inhibitory activity against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC50) against H-ras-
  • CNLL SEQ.ID.NO.: 1 dependent activation of MAP kinases in cells
  • IC50 an IC50 (a measurement of in vitro inhibitory activity) against H-ras-CNLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the
  • a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of farnesyl-protein transferase.
  • the instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors.
  • Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin ( ⁇ F-1), neu, src, abl, lck, fyn) or by other mechanisms.
  • Ras activity i.e., neurofibromin ( ⁇ F-1), neu, src, abl, lck, fyn
  • the compounds of the instant invention inhibit farnesyl-protein transferase and the famesylation of the oncogene protein Ras.
  • the instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)).
  • Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
  • the compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment.
  • the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder.
  • the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992).
  • the compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
  • the instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et al.FASEB Journal, 2:A3160 (1988)).
  • the instant compounds may also be useful for the treatment of fungal infections.
  • the instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
  • the compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
  • the prenyl-protein transferase inhibitors of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the prenyl-protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue.
  • drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
  • Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
  • the instant compounds may also be useful as inhibitors of corneal inflammation. These compounds may improve the treatment of corneal opacity which results from cauterization-induced corneal inflammation. The instant compounds may also be useful in reducing corneal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol. Vis. Sci, 1998, vol. 39, p 2245-2251).
  • the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • the compounds of the instant invention may be administered to a mammal in need thereof using a gel extrusion mechanism (GEM) device, such as that described in USSN 60/144,643, filed on July 20, 1999, which is hereby incorporated by reference.
  • GEM gel extrusion mechanism
  • the compounds of the instant invention may also be administered to a mammal in need thereof using an osmotic controlled release drug delivery device, such as those described in USSN 60/162,589 and USSN 60/162,719, co-filed on October 29, 1999, and herein incorporated by reference.
  • composition is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
  • the pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, com starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropyl- cellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyl- eneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water soluble carrier such as polyethyl- eneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene- oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • preservatives for example ethyl, or n-propyl p-hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl p-hydroxybenzoate
  • flavoring agents such as sucrose, saccharin or aspartame.
  • sweetening agents such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol.
  • Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation.
  • These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in- water microemulsion where the active ingredient is dissolved in the oily phase.
  • the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug.
  • compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • compositions, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed.
  • topical application shall include mouth washes and gargles.
  • the compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms.
  • a suitable amount of compound is administered to a mammal undergoing treatment for cancer.
  • Administration occurs in an amount between about 0.1 mg kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • the compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant farnesyl-protein transferase inhibitors and an antineoplastic agent.
  • antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. It is further understood that any of the therapeutic agents described herein may also be used in combination with a compound of the instant invention and an antineoplastic agent.
  • antineoplastic agent examples include, in general, microtubule- stabilizing agents (such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, for example, nitrogen mustards, ethyleneimine compounds, alkyl sulfonates and other compounds with an alkylating action such as nitrosoureas, cisplatin, and dacarbazine; anti- metabolites, for example, folic acid, purine or pyrimidine antagonists; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; mitotic inhibitors, for example, vinca alkaloids and derivative
  • Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drags, diynenes and the podophyllotoxins.
  • Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
  • antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, bleomycin, chlorambucil, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins
  • antineoplastic, or chemotherapeutic, agents are described, for example, by D. J. Stewart in “Nausea and Vomiting: Recent Research and Clinical Advances", Eds. J. Kucharczyk, et al., CRC Press Inc., Boca Raton, Florida, USA (1991), pages 177-203, especially page 188. See also, R. J. Gralla, et al., Cancer Treatment Reports, 68(1), 163-172 (1984).
  • the preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel.
  • the compounds of the instant invention may also be co-administered with antisense oligonucleotides which are specifically hybridizable with RNA or DNA deriving from human ras gene. Such antisense oligonucleotides are described in U.S. Pat. No. 5,576,208 and PCT Publ. No. WO 99/22772.
  • the instant compounds are particularly usefule when co-administered with the antisense oligonucleotide comprising the amino acid sequence of SEQ.ID.NO: 2 of U.S. Pat. No. 5,576,208.
  • Certain compounds of the instant invention may exhibit very low plasma concentrations and significant inter-individual variation in the plasma levels of the compound. It is believed that very low plasma concentrations and high intersubject variability achieved following administration of certain prenyl- protein transferase inhibitors to mammals may be due to extensive metabolism by cytochrome P450 enzymes prior to entry of drug into the systemic circulation. Prenyl-protein transferase inhibitors may be metabolized by cytochrome P450 enzyme systems, such as CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other cytochrome P450 isoform.
  • a compound of the instant invention demonstrates an affinity for one or more of the cytochrome P450 enzyme systems
  • another compound with a higher affinity for the P450 enzyme(s) involved in metabolism should be administered concomitantly.
  • compounds that have a comparatively very high affinity for CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other P450 isoform include, but are not limited to, piperonyl butoxide, troleandomycin, erythromycin, proadifen, isoniazid, allylisopropylacetamide, ethinylestradiol, chloramphenicol, 2-ethynyl- naphthalene and the like.
  • Such a high affinity compound when employed in combination with a compound of formula A, may reduce the inter-individual variation and increase the plasma concentration of a compound of formula A to a level having substantial therapeutic activity by inhibiting the metabolism of the compound of formula A. Additionally, inhibiting the metabolism of a compound of the instant invention prolongs the pharmacokinetic half -life, and thus the pharmacodynamic effect, of the compound.
  • a compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy.
  • a compound of the present invention may be used in conjunction with other anti- emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, or a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S. Patent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712.
  • conjunctive therapy with a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is preferred.
  • Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos.
  • a particularly preferred neurokinin-1 receptor antagonist for use in conjunction with the compounds of the present invention is 2-(R)-(l-(R)-(3,5- bis(trifluoromethyl) ⁇ henyl)ethoxy)-3-(S)-(4-fluoro ⁇ henyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147.
  • a compound of the present invention for the treatment of cancer, it may be desirable to employ a compound of the present invention in conjunction with another pharmacologically active agent(s).
  • a compound of the present invention and the other pharmacologically active agent(s) may be administered to a patient simultaneously, sequentially or in combination.
  • the present compound may employed directly in combination with the other active agent(s), or it may be administered prior, concurrent or subsequent to the administration of the other active agent(s).
  • the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
  • a compound of the present invention may be presented together with another therapeutic agent in a combined preparation, such as with an antiemetic agent for simultaneous, separate, or sequential use in the relief of emesis associated with employing a compound of the present invention and radiation therapy.
  • a combined preparation may be, for example, in the form of a twin pack.
  • a preferred combination comprises a compound of the present invention with antiemetic agents, as described above.
  • Radiation therapy including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer.
  • compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
  • the instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase.
  • co-administration with a compound(s) that is a selective inhibitor of geranylgeranyl protein transferase may provide an improved therapeutic effect.
  • the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Ser. Nos. 08/254,228 and 08/435,047. Those patents and publications are incorporated herein by reference.
  • administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously.
  • the administration of each can be by the same method or by different methods.
  • the instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, and WO 98/44797, published on October 15, 1998, which are incorporated herein by reference.
  • an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells.
  • the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ v ⁇ 3 integrin and the ⁇ v ⁇ 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of ⁇ v ⁇ 3 integrin, ⁇ v ⁇ 5 integrin, ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
  • the instant compounds may also be useful in combination with an inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) for the treatment of cancer.
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase
  • HMG-CoA reductase inhibitor and “inhibitor of HMG-CoA reductase” have the same meaning when used herein.
  • HMG-CoA reductase inhibitors examples include but are not limited to lovastatin (MENACOR®; see US Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR®; see US Patent No. 4,444,784;
  • HMG- CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention.
  • An illustration of the lactone portion and its corresponding open-acid form is shown below as stractures I and H
  • HMG-CoA reductase inhibitors where an open-acid form can exist, salt and ester forms may preferably be formed from the open-acid, and all such forms are included within the meaning of the term "HMG-CoA reductase inhibitor" as used herein.
  • the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, and most preferably simvastatin.
  • the term "pharmaceutically acceptable salts" with respect to the HMG-CoA reductase inhibitor shall mean non- toxic salts of the compounds employed in this invention which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, omithine, choline, N,N' -dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, l-p-chlorobenzyl-2-pyrrolidine-l '-yl-methyl- benzimidazole, diethylamine, piperazine, and tris(hydroxymethyl)-aminomethane.
  • a suitable organic or inorganic base particularly
  • salt forms of HMG-CoA reductase inhibitors may include, but are not limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium edetate, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynapthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, oleate, oxalate, pamao
  • Ester derivatives of the described HMG-CoA reductase inhibitor compounds may act as prodrugs which, when absorbed into the bloodstream of a warm-blooded animal, may cleave in such a manner as to release the drag form and permit the drug to afford improved therapeutic efficacy.
  • the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described above and the other pharmaceutically active agent(s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
  • the instant compounds may also be useful in combination with prodrugs of antineoplastic agents.
  • the instant compounds may be co-administered either concurrently or sequentially with a conjugate (termed a "PSA conjugate") which comprises an ohgopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • a conjugate termed a "PSA conjugate”
  • PSA conjugate which comprises an ohgopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • PSA conjugate conjugate
  • PSA prostate specific antigen
  • the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl-protein transferase (FPTase) in a composition.
  • FPTase farnesyl-protein transferase
  • the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention.
  • the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
  • potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample.
  • a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl- protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention.
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • the mixture was cooled to a temperature of about 50°C to about 55°C.
  • Propionic acid was added to the mixture and the mixture was heated and maintained at a temperature of about 50°C to about 55 °C.
  • Phosphoric acid was gradually added over about 5 min to about 10 min, maintaining the reaction mixture below about 65°C to form a precipitate-containing mixture.
  • the mixture was gradually warmed to about 65°C to about 70°C over about 30 min and aged at about 65°C to about 70°C for about 30 min.
  • the mixture was then gradually cooled to about 20-25°C over about 1 hour and aged at about 20-25°C for about 1 hour.
  • the reaction slurry was then filtered.
  • the filter cake was washed four times with EtOH, using the following sequence, 2.5 L each time.
  • the filter cake was then washed with water five times, using 300 mL each time.
  • the filter cake was washed twice with MeCN (1.0 L each time) and the above identified compound was obtained.
  • Step B 4-Cyanobenzylamine Hydrochloride via Hexamethylene- tetrammonium salt
  • a 72 liter vessel was charged with 190 proof ethanol (14.4 L) followed by the addition of 4-cyanobenzylbromide (2.98 kg) and HMTA (2.18 kg) at ambient temperature. The mixture was heated to about 72-75 °C over about 60 min. On warming, the solution thickens and additional ethanol (1.0 liter) was added to facilitate stirring. The batch was aged at about 72-75°C for about 30 min.
  • the mixture was allowed to cool to about 20°C over about 60 min, and HCl gas (2.20 kg) was sparged into the slurry over about 4 hours during which time the temperature rose to about 65°C.
  • the mixture was heated to about 70-72°C and aged for about 1 hour.
  • the slurry was cooled to about 30°C and ethyl acetate (22.3 L) added over about 30 min.
  • the slurry was cooled to about -5°C over about 40 min and aged at about -3 to about -5°C for about 30 min.
  • the mixture was filtered and the crystalline solid was washed with chilled ethyl acetate (3 x 3 L).
  • the solid was dried under an N2 stream for about 1 hour before charging to a 50 liter vessel containing water (5.5 L).
  • the oil was transferred to a 50 liter vessel with the aid of ethanol (1.8 L). Ethyl acetate (4.1 L) was added at about 25°C. The solution was cooled to about 15°C and HCl gas (600 g) was sparged in over about 3 hours, while keeping batch temperature below about 40°C. At about 20-25°C, ethyl acetate (5.8 L) was added to the slurry, followed by cooling to about -5°C over about 1 hour. The slurry was aged at about -5°C for about 1 hour and the solids isolated via filtration.
  • Step C 1 -(4-Cyanobenzyl)-2-Mercapto-5-Hydroxymethyl-imidazole
  • the mixture was heated to 70°C, and aged for 2 hours. The temperature of the mixture was then cooled to room temperature and was aged overnight.
  • the thioimidazole product was obtained by vacuum filtration.
  • the filter cake was washed four times acetonitrile (25 mL each time) until the filtrates became nearly colorless. Then the filter cake was washed three times with water (approximately 25-50 mL each time) and dried in vacuo to obtain the above-identified compound.
  • Step D l-(4-Cyanobenzyl)-5-Hydroxymethylimidazole
  • a IL flask with cooling/heating jacket and glass stirrer (Lab-Max) was charged with water (200 mL) at 25°C.
  • the reaction was warmed to 40°C over 10 minutes.
  • Hydrogen peroxide (90.0 g) was added slowly over 2 hours by automatic pump maintaining a temperature of 35-45°C. The temperature was lowered to 25°C and the solution aged for 1 hour.
  • the solution was cooled to 20°C and quenched by slowly adding 20% aqueous Na2SO3 (25 mL) maintaining the temperature at less than 25°C.
  • the solution was filtered through a bed of DARCO G-60 (9.0 g) over a bed of SolkaFlok (1.9 g) in a sintered glass funnel. The bed was washed with 25 mL of 10% acetic acid in water.
  • the combined filtrates were cooled to 15°C and a 25% aqueous ammonia was added over a 30 minute period, maintaining the temperature below 25°C, to a pH of 9.3.
  • the yellowish slurry was aged overnight at 23°C (room temperature).
  • the solids were isolated via vacuum filtration.
  • the cake (100 mL wet volume) was washed with 2 x 250 mL 5% ammonia (25%) in water, followed by 100 mL of ethyl acetate.
  • the wet cake was dried with vacuum/N2 flow and the above-titled compound was obtained.
  • Step F l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Hydroxymethylimidazole to VilsmeierReagent
  • dry acetonitrile 3.2 L, 15 L/Kg hydroxymethylimidazole
  • dry DMF 178 mL, 2.30 mol, 2.30 equiv.
  • the internal temperature was allowed to warm to a temperature of about 23 °C to about 25 °C and stirred for about 1 to 3 hours.
  • the mixture was filtered, then washed with dry acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash).
  • the solid was maintained under an N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H2O. This yielded the crystalline form of the chloromethylimidazole hydrochloride.
  • Step G l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Nilsmeier Reagent to Hydroxymethylimidazole
  • Step A Preparation of l'-tert-butoxycarbonyl-spiro[3H-indole-3 ,4' -piperidin] - 2(lH)-one
  • Step C Preparation of 4-[5-(spiro[3H-indole-3,4'-piperidine]-2(lH)-on- - ylmethyPimidazol- 1 -ylmethyllbenzonitrile
  • Step A Preparation of -tert-butoxycarbonyl-3-(2,2,2-trifluoroethyl)-6- chlorospiror4H-3 , 1 -benzoxazine-4.4' -piperidin] -2( lH)-one
  • Step B Preparation of 3- ⁇ 3-(2,2,2-trifluoroethyl)-6-chlorospiro[4H-3,l- benzoxazine-4 ,4' -piperidin] -2(lH)-on- 1 ' -ylmethyl)imidazol- 1- ylmethyl ) benzonitrile Dihydrochloride
  • the title compound was prepared according to the procedure described in Example 2, beginning with Step B, except 4'-tert-butoxycarbonyl-3- (2,2,2-trifluorethyl)-6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-one from Step A above was substituted for l'-tert-butoxycarbonyl- spiro[3H-indole- 3,4'-piperidin]-2(lH)-one in Step B.
  • the dihydrochloride salt was obtained as an amorphous solid.
  • Step A Preparation of l'-tert-butoxycarbonyl-3-butyl-6-chlorospiro[4H-3, 1- benzoxazine-4.4'-piperidin1-2(lH)-one
  • the mixture was diluted with ethyl acetate and washed with saturated sodium carbonate and water (3X) .
  • the organic extract was dried over anhydrous sodium sulfate, filtered and the solvent removed.
  • the title compound was isolated as a viscous residue.
  • Step B Preparation of 3- ⁇ 3-butyl-6-chlorospiro[4H-3,l-benzoxazine-4,4'- piperidin]-2(lH)-on- -ylmethyl)imidazol-l-ylmethyl ⁇ benzonitrile
  • the FPTase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl- protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL).
  • Examples 1-6 were tested for inhibitory activity against human FPTase by the assay described above and were found to have IC50 of ⁇ 30 ⁇ M.
  • the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H] eranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl 2 , 10 ⁇ M ZnCl 2 , 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranyl-protein transferase type I(GGTase).
  • the GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference.
  • the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCNIM (single amino acid code) (SEQ. ID. ⁇ O.: 2).
  • Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 ⁇ L of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
  • streptavidin SPA beads Scintillation Proximity Assay beads
  • IC50 values are determined with Ras peptide near .KM concentrations. Enzyme and substrate concentrations for inhibitor IC 50 determinations are as follows: 75 pM GGTase-1, 1.6 ⁇ M Ras peptide, 100 ⁇ M geranylgeranyl diphosphate.
  • the compounds of the instant invention are tested for inhibitory activity against human GGTase type I by the assay described above.
  • the cell line used in this assay is a v-ras line derived from either Ratl or ⁇ IH3T3 cells, which expressed viral Ha-ras p21.
  • the assay is performed essentially as described in DeClue, J.E. et al.. Cancer Research 51:712-717. (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%).
  • the cells are labeled in 3 ml methionine-free DMEM supple-mented with 10% regular DMEM, 2% fetal bovine serum and 400 ⁇ Ci[35s]methionine (1000 Ci/mmol).
  • the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/lmM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min.
  • the immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 M EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to famesylated and nonfamesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein.
  • IP buffer 20 nM HEPES, pH 7.5/1 M EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl
  • Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 10 4 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the compound (dissolved in methanol at 1000 times the final concentration used in the assay).
  • the cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made.
  • the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI.
  • the SEAP gene is derived from the plasmid ⁇ SEAP2-Basic (Clontech, Palo Alto, CA).
  • the plasmid pCMN-RE-AKI contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter.
  • the plasmid also contains a bovine growth hormone poly-A sequence.
  • the plasmid, pDSElOO was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2- Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear D ⁇ A fragments were filled in with the Klenow fragment of E. coli D ⁇ A Polymerase I. The "blunt ended" D ⁇ A containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-H and the ends filled in with Klenow D ⁇ A Polymerase I.
  • the SEAP D ⁇ A fragment was blunt end ligated into the pCMN-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
  • the SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI.
  • the SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
  • the plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf (-)/SEAP using the restriction enzymes Apa I and Kpnl. The ends of the linear D ⁇ A fragments were chewed back with the Klenow fragment of E. coli D ⁇ A Polymerase I. The "blunt ended" D ⁇ A containing the trancated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMN-RE-AKI which had been cut with Bgl-II and filled in with E.
  • the plasmid pCMN-RE-AKI is derived from plasmid pCMNIE-AKI-DHFR (Whang, Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796- 1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers.
  • the plasmid pGEM7zf(-)/SEAP was constructed as follows.
  • the SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
  • Sense strand N-terminal SEAP 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO.:3)
  • Antisense strand N-terminal SEAP 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.: 4)
  • Sense strand C-terminal SEAP 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.: 5)
  • Antisense strand C-terminal SEAP 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.: 6)
  • the N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends.
  • the Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the Hpal site.
  • the C-terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindi ⁇ restriction sites.
  • the sense strand C-terminal oligo introduces the internal STOP codon as well as the Hpal site.
  • the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindi ⁇ .
  • the two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf (-) (Promega) which had been restriction digested with EcoRI and Hindlll and isolated on an agarose gel.
  • the resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
  • An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegaloviras (CMN) IE-1 promoter.
  • the expression plasmid also includes the CMN intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
  • the plasmid pCMNIE-AKI-DHFR (Whang et al, 1987) containing the CMN immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMN-AKI.
  • the cytomegaloviras intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI.
  • the intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286.
  • the intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a Sad restriction site using site directed mutagenesis.
  • the mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
  • Sense strand 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7)
  • Antisense strand 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.1D.NO.: 8) These two oligos generate a 991 base pair fragment with a Sad site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo.
  • the PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel.
  • the vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI-InA.
  • the DNA sequence encoding the trancated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector.
  • the SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and HindDI. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV-AKI- InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow D ⁇ A polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMN-AKI-LxA vector.
  • Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence.
  • the resulting plasmid named pCMN-SEAP, contains a modified SEAP sequence downstream of the cytomegaloviras immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence.
  • the plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
  • a D ⁇ A fragment containing viral-H-ras can be PCRed from plasmid
  • H-l (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
  • cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
  • the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end.
  • the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMN promoter of the pCI vector.
  • a viral-H-r ⁇ s clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "H-l” (Ellis R. et al., J. Virol 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by PCR using the following oligos.
  • Sense strand
  • Antisense strand 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.:
  • the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
  • the antisense strand mutates serine 189 to leucine and adds an Xbal site.
  • the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol- Xbal cut vector pCI (Promega). This results in a plasmid in which the mutated viral- H-r ⁇ s-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • the human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Sense strand a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized "Kozak" translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
  • the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-H-r ⁇ zs-Leu61 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-H-ras-Leu ⁇ l from the CMV promoter of the pCI vector.
  • the human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
  • the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18)
  • the mutated c-N-r s-Val-12 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-N-ra.s-Val-12 from the CMV promoter of the pCI vector.
  • the human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-K-ras fragment can be ligated into a Kpnl - Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-K-r ⁇ .s-Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-K-ra.s-Val-12 from the CMV promoter of the pCI vector.
  • Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + IX Pen/Strep + IX glutamine + IX NEAA. Cells are grown at 37°C in a 5% CO2 atmosphere until they reach 50 -80% of confluency.
  • the transient transfection is performed by the CaPO4 method
  • expression plasmids for H-ras, N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE-SEAP reporter construct.
  • 600ml of CaCl 2 -DNA solution is added dropwise while vortexing to 600ml of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat.
  • the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin.
  • the 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf serum + IX (Pen/Strep, Glutamine and NEAA ).
  • Transfected cells are plated in a 96 well microtiter plate (lOOml/well) to which drug, diluted in media, has already been added in a volume of 100ml. The final volume per well is 200ml with each drug concentration repeated in triplicate over a range of half -log steps. Incubation of cells and test compound is for 36 hrs at 37°C under
  • the heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.). A volume of 50 ml media is combined with 200 ml of CSPD cocktail and incubated for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein.
  • K4B-Ras processing inhibition assay PSN-1 human pancreatic carcinoma
  • PSN-1 human pancreatic carcinoma
  • Subconfluent cells in 100 mm dishes are fed with 3.5 ml of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine- free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone.
  • media methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine- free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%. Following incubation at 37°C for two hours 204 ⁇ Ci/ml [35s]Pro-Mix (Amersham, cell labeling grade) is added.
  • the cells are incubated at 37°C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS. The cells are scraped into 1 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 ⁇ g/ml AEBSF, 10 ⁇ g/ml aprotinin, 2 ⁇ g/ml leupeptin and 2 ⁇ g/ml antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4°C and the supernatant saved.
  • lysis buffer 1% Nonidet P-40, 20 mM HEPES, pH 7.5
  • Ki4B-Ras For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 ⁇ g of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4°C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • pansorbin Calbiochem
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
  • the supernatant is added to 1 ml of Dilution Buffer 0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem).
  • the second protein/ antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • the Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS- PAGE on a 12% acrylamide gel (bis-acrylamide: acrylamide, 1:100), and the Ras visualized by fluorography.
  • PSN-1 cells are seeded in 24-well assay plates. For each compound to be tested, the cells are treated with a minimum of seven concentrations in half-log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37°C / 5% CO 2 .
  • the growth media is then aspirated and the samples are washed with PBS.
  • the cells are lysed with SDS-PAGE sample buffer containing 5% 2-mercaptoethanol and heated to 95°C for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples.
  • the plates are incubated on ice for another 10 minutes.
  • the samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 mA/gel for 3-4 hours.
  • the samples are then transferred from the gels to PVDF membranes by Western blotting.
  • the membranes are blocked for at least 1 hour in buffer containing
  • the membranes are then treated with a monoclonal antibody to HDJ-2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase-conjugated secondary antibody.
  • the membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager. For each sample, the percent of total signal corresponding to the unprenylated species of HDJ (the slower-migrating species) is calculated by densitometry. Dose-response curves and IC50 values are generated using 4-parameter curve fits in SigmaPlot software.
  • PSN-1 human pancreatic carcinoma cells are used for analysis of protein processing.
  • Subconfluent cells in 150 mm dishes are fed with 20 ml of media (RPMI supplemented with 15% fetal bovine serum) containing the desired concentration of prenyl-protein transferase inhibitor or solvent alone.
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%.
  • the cells are incubated at 37°C for 24 hours, the media is then removed and the cells are washed twice with cold PBS. The cells are scraped into 2 ml of cold PBS, collected by centrifugation (10,000 x g for 5 min at 4°C) and frozen at -70°C. Cells are lysed by thawing and addition of lysis buffer (50 mM HEPES, pH 7.2, 50 mM NaCl, 1% CHAPS, 0.7 ⁇ g/ml aprotinin, 0.7 ⁇ g/ml leupeptm 300 ⁇ g/ml pefabloc, and 0.3 mM EDTA).
  • lysis buffer 50 mM HEPES, pH 7.2, 50 mM NaCl, 1% CHAPS, 0.7 ⁇ g/ml aprotinin, 0.7 ⁇ g/ml leupeptm 300 ⁇ g/ml pefabloc, and 0.3 mM EDTA).
  • the lysate is then centrifuged at 100,000 x g for 60 min at 4°C and the supernatant saved. The supernatant may be subjected to SDS- PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • the lysate is applied to a HiTrap-SP (Pharmacia Biotech) column in buffer A (50 mM HEPES pH 7.2) and resolved by gradient in buffer A plus 1 M NaCl. Peak fractions containing Ki4B-Ras are pooled, diluted with an equal volume of water and immunoprecipitated with the pan Ras monoclonal antibody, Y13-259 linked to agarose. The protein/antibody mixture is incubated at 4°C for 12 hours.
  • the immune complex is washed 3 times with PBS, followed by 3 times with water.
  • the Ras is eluted from the beads by either high pH conditions (pH>10) or by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation.
  • the supernatant may be subjected to SDS-PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • Protocol A Cells are labeled, incubated and lysed as described in Example 12.
  • samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 2 ⁇ g of the Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech), is added. The protein antibody mixture is incubated on ice at 4°C for 1 hour. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
  • the supernatant is added to 1 ml of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech).
  • the second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide: acrylamide, 1:100), and the Rapl visualized by fluorography.
  • Protocol B PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near- confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 10 6 cells are plated on 15cm plates to ensure the same stage of confluency in each assay. The media for these cells is RPMI 1640 (Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix. The day of the assay, cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37°C overnight.
  • the compounds to be assayed are diluted in DMSO in 1/2-log dilutions.
  • the range of final concentrations to be assayed is generally 0.1-100 ⁇ M. Four concentrations per compound is typical.
  • the compounds are diluted so that each concentration is lOOOx of the final concentration (i.e., for a lO ⁇ M data point, a lOmM stock of the compound is needed).
  • each lOOOx compound stock is diluted into 1ml media to produce a 2X stock of compound.
  • a vehicle control solution (2 ⁇ L DMSO to 1ml media), is utilized.
  • 0.5 ml of the 2X stocks of compound are added to the cells.
  • RNAse/DNase mix is added per well. This mix is lmg/ml DNasel (Worthington Enzymes), 0.25 mg/ml RNAse A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50mM MgCl 2 .
  • the plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70°C until use.
  • Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25 ⁇ l of each sample is loaded onto the gel. The gel is run at 15mA for about 3.5 hours. It is important to run the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd (Rab6).
  • the gels are then transferred to Novex pre-cut PVDF membranes for 1.5 hours at 30V (constant voltage). Immediately after transferring, the membranes are blocked overnight in 20ml Western blocking buffer (2% nonfat dry milk in Western wash buffer (PBS + 0.1% Tween-20). If blocked over the weekend, 0.02%) sodium azide is added. The membranes are blocked at 4°C with slow rocking.
  • the blocking solution is discarded and 20ml fresh blocking solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in Western blocking buffer) are added.
  • the membranes are incubated at room temperature for 1 hour with mild rocking.
  • the blocking solution is then discarded and the membrane is washed 3 times with Western wash buffer for 15 minutes per wash.
  • ECF detection reagent About 2ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet.
  • ECF overhead transparency
  • the developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal.
  • the Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
  • This protocol allows the determination of an EC50 for inhibition of processing of Rapla.
  • the assay is ran as described in Protocol B with the following modifications. 20 ⁇ l of sample is run on pre-cast 10-20% gradient acrylamide mini gels (Novex Inc.) at 15 mA/gel for 2.5-3 hours. Prenylated and unprenylated forms of Rapla are detected by blotting with a polyclonal antibody (Rapl/Krev-1 Ab#121 ;
  • Unprenylated Rapla is distinguished from prenylated protein by virtue of the greater apparent molecular weight of the prenylated protein. Dose-response curves and EC50 values are generated using 4-parameter curve fits in SigmaPlot software.
  • Rodent fibroblasts transformed with oncogenically mutated human Ha- ras or Ki-r ⁇ xs (10 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0.
  • the mice in each oncogene group are randomly assigned to a vehicle or compound treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment.
  • the prenyl-protein transferase inhibitor may be administered by a continuous infusion pump.
  • Compound or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle- treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Abstract

The present invention is directed to compounds which inhibit prenyl-protein transferase (FTase) and the prenylation of the oncogene protein Ras. The invention is further directed to chemotherapeutic compositions containing the compounds of this invention and methods for inhibiting prenyl-protein transferase and the prenylation of the oncogene protein Ras.

Description

TΓΓLE OF THE INVENTION
INHIBITORS OF PRENYL-PROTEIN TRANSFERASE
BACKGROUND OF THE INVENTION The Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-Ras) are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein. In the inactive state, Ras is bound to GDP. Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change. The GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M. Willumsen, Ann. Rev. Biochem. 62:851-891 (1993)). Mutated ras genes (Ha-ras, KMa-ras, Ki4b-ras and N-ras) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras. The Ras C-terminus contains a sequence motif termed a "CAAX" or "Cys-Aaa-1-- Aaa -Xaa" box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 3i0:583-586 (1984)). Depending on the specific sequence, this motif serves as a signal sequence for the enzymes f arnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C 15 or C20 isoprenoid, respectively.
Such enzymes may be generally termed prenyl-protein transferases. (S. Clarke., Ann. Rev. Biochem. 61 :355-386 (1992); W.R. Schafer and J. Rine, Ann. Rev. Genetics 30:209-237 (1992)). The Ras protein is one of several proteins that are known to undergo post-translational famesylation. Other famesylated proteins include the Ras- related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., /. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also famesylated. James, et al., have also suggested that there are famesylated proteins of unknown structure and function in addition to those listed above.
Inhibition of farnesyl-protein transferase has been shown to block the growth of Ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of farnesyl-protein transferase selectively block the processing of the Ras oncoprotein intracellularly (N.E. Kohl et al, Science, 260:1934-1937 (1993) and GL. James et al, Science, 260: 1937-1942 (1993). Recently, it has been shown that an inhibitor of farnesyl-protein transferase blocks the growth of r s-dependent tumors in nude mice (N.E. Kohl et al, Proc. Natl Acad. Sci U.S.A., 9i:9141-9145 (1994) and induces regression of mammary and salivary carcinomas in ras transgenic mice (N.E. Kohl et al, Nature Medicine, 1:792-797 (1995).
Indirect inhibition of farnesyl-protein transferase in vivo has been demonstrated with lovastatin (Merck & Co., Rahway, NJ) and compactin (Hancock et al, ibid; Casey et al, ibid; Schafer et al, Science 245:379 (1989)). These drags inhibit HMG-CoA reductase, the rate limiting enzyme for the production of polyisoprenoids including farnesyl pyrophosphate. Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al, Cell, (52:81-88 (1990); Schaber et al, J. Biol Chem., 265: 14701-14704 (1990); Schafer et al, Science, 249: 1133-1139 (1990); Manne et al, Proc. Natl. Acad. Sci USA, 57:7541-7545 (1990)). Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells. However, direct inhibition of farnesyl- protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
Inhibitors of farnesyl-protein transferase (FPTase) have been described in two general classes. The first are analogs of farnesyl diphosphate (FPP), while the second class of inhibitors is related to the protein substrates (e.g., Ras) for the enzyme. The peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al, ibid; Reiss et. al, ibid; Reiss et al, PNAS, 88:732-736 (1991)). Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1937 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)). In general, deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound. However, the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
It has recently been reported that farnesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7-112930).
It has recently been disclosed that certain tricyclic compounds which optionally incorporate a piperidine moiety are inhibitors of FPTase (WO 95/10514, WO 95/10515 and WO 95/10516). Imidazole-containing inhibitors of farnesyl protein transferase have also been disclosed (WO 95/09001 and EP 0 675 112 Al). It has also been disclosed that certain compounds which incorporate a pyrrolidine moiety are inhibitors of FPTase (WO 97/37900, and U.S. Patent Nos. 5,627,202 and 5,661,161).
It is, therefore, an object of this invention to develop compounds that will inhibit prenyl-protein transferase and thus, the post-translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the compounds of this invention and methods for producing the compounds of this invention.
SUMMARY OF THE INVENTION The present invention comprises structurally-constrained compounds which inhibit prenyl-protein transferases. Further contained in this invention are chemotherapeutic compositions containing these prenyl-protein transferase inhibitors and methods for their production.
The compounds of this invention are illustrated by the formulae A-1, A, B and C:
Figure imgf000005_0001
DF.T Aπ KD DESCRIPTION OF THE INVENTION
The compounds of this invention are useful in the inhibition of prenyl- protein transferase and the prenylation of the oncogene protein Ras. In a first embodiment of this invention, the inhibitors of a prenyl-protein transferase are illustrated by the formula A-1:
wherein
X1 is (CR^nA^CR1^;
Figure imgf000006_0002
Rla and Rlb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, ) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, ) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R , 1l0u,C(O)NR 1ι0υ-,
Figure imgf000006_0003
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted Ci-C6 alkyl, wherein the substituent on the substituted -C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, f) C(O)NR10, g) NR10C(O), ) OC(O), and i) C(O)O;
R2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) ^ ~C cycloalkyl, unsubstituted or substituted, 1) C -C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-;
R >3 i-s independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) ^ ~C cycloalkyl, unsubstituted or substituted, k) C ~C alkenyl, unsubstituted or substituted,
1) C 2-C 6 alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) ^ ~C a^yl> unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R6 and R7 are independently selected from: H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cχ- perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000009_0001
f) γ 0 0R,° , g) — S(0)mR6a , and h) N(R10)2; or
6 7
R and R may be joined in a ring;
R6 is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
Figure imgf000009_0002
7) N(R10)2; and b) Cj-Cg alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle, 3) halogen,
4) -OH,
5, •' R11
O and
R is independently selected from: a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, c) unsubstituted or substituted C2-C6 alkynyl, d) unsubstituted or substituted C3-C10 cycloalkyl, e) unsubstituted or substituted C C perfluoroalkyl, f) halo, g) R10O-, h) CN, i) R6aS(O)m-, j) -C(O)NR6R7, k) R10C(O)NR10-,
1) NO2, m) (R10)2NC(O)NR10-, n) R10C(O)-, o) R10OC(O)-, p) R10OC(O)NR10-, q) N3, r) -N(R10)2, and s) C^Cg alkyl, unsubstituted or substituted by C C perfluoroalkyl, F,
Cl, Br, R ,1ι0oOr -, R - 6*aS- (O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N ϊ3v. -N(R10)2, and
R10OC(O)NR10-
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluόromethyl, f) 2,2,2-trifluoroethyl,, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11 R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is selected from NH, CH or oxygen;
V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) Cj-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl; provided that V is not hydrogen if A1 is S(O)m and n is 0;
W is a heterocycle;
Y is C(O) or NR5;
Z is NR5 or C(O); provided that if Y is C(O), then Z is NR5 and if Y is NR5 then Z is C(O); m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5, provided that r is 0 when V is hydrogen; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, or 3; and z is O or l;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof. Another embodiment of the compounds of this invention is illustrated by formula A:
Figure imgf000012_0001
wherein
X1 is (CR^nA^CR1^;
X2 is (CRl 2), ,A2(CRl 2)] P'
Rla and Rl are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-,
P) unsubstituted or si substituted C C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-,
-N(R10) 2, R10OC(O)-, and R10OC(O)NR10-
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, ) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R >2 i •s independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C ~C n cycloalkyl, unsubstituted or substituted,
1) C ~C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted,
Figure imgf000014_0001
o) R10C(O)-,
P) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-
R3 is independently selected from: a) hydrogen, b) halo, c) C ~C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C ',-C cycloalkyl, unsubstituted or substituted, k) C ~C a^enyl, unsubstituted or substituted,
1) C ~C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-,
Figure imgf000014_0002
o) R10C(O)NR10-;
R is selected from: a) hydrogen, b) C ~C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from: H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000015_0001
f) γ 0 0R,°
g) -S(0)mR6a , and
h) N(R10)2; or
6 7
R and R may be joined in a ring;
R6 is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen, 4) HO, s, Y )11
o
6) SO2Rπ, 7) N(R10)2; and b) Cj-Cg alkyl, unsubstituted or substituted with one or more of the following:
1) -Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH,
5) Y 0 R" and
6) -N(R10)2;
R is independently selected from: a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, c) unsubstituted or substituted C2-C6 alkynyl, d) unsubstituted or substituted C3-C10 cycloalkyl, e) unsubstituted or substituted C C4 perfluoroalkyl, ) halo, g) R10O-, h) CN, i) R as(θ)m-, j) -C(O)NR6R7, k) R10C(O)NR10-,
1) NO2, ) (R10)2NC(O)NR10-, n) R10C(O)-, o) R10OC(O)-, pp)) RR110OC(O)NR10-, q) N3, r) -N(R10)2, and s) j-C6 alkyl, unsubstituted or substituted by -Q. perfluoroalkyl, F, Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) C C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is selected from NH, CH2 or oxygen;
V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) j-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if A1 is S(O) and n is 0; W is a heterocycle;
mis 0, 1 or 2; nis 0,1,2, 3,4, 5 or 6; p is 0, 1,2, 3,4, 5 or 6; ris 0 to 5, provided that r is 0 when V is hydrogen; s is 0, 1,2, 3 or 4; tis 0, 1, 2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof. Another embodiment of the compounds of this invention is illustrated by formula A:
Figure imgf000018_0001
wherein
X1 is (CR^nA^CR1^;
Xz is (CR^pA^CR l1b0,), p>
Rla and Rlb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-,
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted -Cβ alkyl, wherein the substituent on the substituted -C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-,
-N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, ) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) ^ ^6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C ',-C cycloalkyl, unsubstituted or substituted,
1) C -C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted. n) . (R10)2NC(O)NR10-, o) R10C(O)-,
P) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-;
R is independently selected from: a) hydrogen, b) halo, c) C 1-C 6, alkyl, unsubstituted or substituted, d) CN, e) NO2, ) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C -C cycloalkyl, unsubstituted or substitui k) C -C alkenyl, unsubstituted or substituted,
1) C -C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from:
H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C^ perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) CrC6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000021_0001
f) γ 0 0R,°
g) -S(0)mR6a and ) N(R10)2; or
6 7
R and R may be joined in a ring;
R6a is independently selected from: ) C3- cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy, 2) aryl or heterocycle,
3) halogen,
4) HO,
Figure imgf000022_0001
6) SO2Rn,
7) N(R10)2; and b) C -Cg alkyl, unsubstituted or substituted with one or more of the following:
1) -Cχ_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
Figure imgf000022_0002
6) -N(R10)2;
8 is independently selected from: a) hydrc )gen, b) unsubstituted or substituted C1-C4 perfluoroalkyl, c) halo, d) R10O-, e) -C(O)NR6R7, f) R10C(O)NR10-, g) (R10)2NC(O)NR10 h) R10C(O)-, i) R10OC(O)-,
J) R10OC(O)NR10-, k) -N(R10)2, and
11)) CCj,--CC66 aallkkyyll,, uunnssuuhbstituted or substituted by C C4 perfluoroalkyl, F,
6a
Cl, Br, R10O-, R S(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N J3,,, --NN((RR1100))27,, and
R10OC(O)NR10-;
R .10 i. s independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
V is selected from: a) heterocycle, b) aryl, and c) CJ-CJQ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiρeridinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, or 3; and z is O or l;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
Another embodiment of the compounds of this invention is illustrated by the formula B:
Figure imgf000024_0001
wherein
X1 is (CRla 2)I1A1(CRla2)n;
X' is (CR , 11bD 2)pA2(CRlb 2)p;
Rla and Rl are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-, 1) R10C(O)-, m) -N(R10)2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted - alkyl, wherein the substituent on the substituted C C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2~C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-,
-N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A and A are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, f) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C ~C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) ^ "C cycloalkyl, unsubstituted or substituted,
1) C ~C aH£enyl» unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-;
R is independently selected from: a) hydrogen, b) halo, c) -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C -C cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted,
1) C - alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O>, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) C ~C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted; R6 and R7 are independently selected from:
H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000027_0001
g) -S(0)mR6a , and
h) N(R10)2; or
6 7
R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
Figure imgf000027_0002
6) SO2R ,
7) N(R10)2; and b) Cj-C6 alkyl, unsubstituted or substituted with one or more of the following: 1) -Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
Figure imgf000028_0001
6) -N(R10)2;
is independently selected from: a) hydrogen, b) unsubstituted or substituted C C4 perfluoroalkyl, c) halo,
10 d) R O-, e) -C(O)NR6R7, ) R10C(O)NR10-, g) (R10)2NC(O)NR10-, h) R10C(O)-, and i) Cj-C8 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, F,
Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) - perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl; 11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
mis 0, 1 or 2; nis 0,1,2, 3,4, 5 or 6; is 0,1,2, 3,4, 5 or 6; ris 0to5; sis 0,1, 2, 3 or 4; tis 0, 1, 2, or 3; and z is Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
Another embodiment of the compounds of this invention is illustrated by formula B:
Figure imgf000029_0001
wherein
Figure imgf000030_0001
X2 is (CRlb 2)pA2(CRlb 2)p;
Rla and Rl are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-, 1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted -C6 alkyl, wherein the substituent on the substituted - alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, and e) NR 10
R2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C "C ^k ' unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)ffl, k) C - -10 cycloalkyl, unsubstituted or substituted, 1) C ~C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-;
R3 is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, ) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C 3-C 10 cycloalkyl, unsubstituted or substi k) C ~C alkenyl, unsubstituted or substituted,
1) C -C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R > 5 i •s selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R6 and R7 are independently selected from: H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
R 11 e)
O
Figure imgf000032_0001
g) — S(0)mR 6a and
h) N(R10)2; or
6 7
R and R may be joined in a ring; R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
Figure imgf000033_0001
7) N(R10)2; and b) Cj-Cg alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH, 5)
O and
6) -N(RiO)2;
R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C4 perfluoroalkyl, c) halo,
10 d) R O-, and e) j-C8 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, F,
Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R .10 i. s independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) C C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, and thiazolyl;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, or 3; and z is O or l;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
Another embodiment of the compounds of this invention is illustrated by formula C:
Figure imgf000035_0001
wherein
X1 is (CRla 2)nA1(CRla 2)D
X is (CR l1bD 2 Λ)pA A 2(C-.TRΪ l1bD2)p;
R , 1a and R , 1b are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7,
Figure imgf000035_0002
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, P) unsubstituted or substituted Cι-C6 alkyl, wherein the substituent on the substituted - alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R , 1l<uVOΛ-, R >6a Sc (O)„ halo, CC((OO))NNRR66RR77,, RR1100CC((OO))NNRR1100--,, ((RR1100))22NN(C(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-
1 9 A and A are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, and e) NR10,
R is independently selected from a) hydrogen, b) CN, c) NO , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C ~C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C -C cycloalkyl, unsubstituted or substituted,
1) C ~C alkenyl' unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and
Figure imgf000036_0001
R is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C "C cycloalkyl, unsubstituted or substituted, k) C -C! alkenyl, unsubstituted or substituted,
1) ^ ~C ^kynyl. unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-
R is selected from: a) hydrogen, b) C ~C alkyl, unsubstituted or substituted; c) aryl, unsubstituted or substituted; d) heterocycle, unsubstituted or substituted; and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from:
H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
Figure imgf000038_0001
OR 10 f)
O
g) -S(0)mR 6Oad , and
10 h) N(R ) ; or
R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
Figure imgf000038_0002
6) SO2Rn,
Figure imgf000038_0003
b) C^-Cg alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH,
Figure imgf000038_0004
6) -N(RlO)2; R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C4 perfluoroalkyl, c) halo,
10 d) R O-, and e) Cj-C8 alkyl, unsubstituted or substituted by C C perfluoroalkyl, F,
Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; is 0, 1, 2, 3, 4, 5 or 6; ris Oto5; sis 0,1,2, 3 or 4; tis 0, 1, 2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
Specific examples of the compounds of the instant invention are:
Figure imgf000040_0001
4- [5-(spiro [3H-indole-3 ,4 ' -piperidin] -2( lH)-on- 1 ' -ylmethyl)imidazol- 1 - ylmethyljbenzonitrile ;
Figure imgf000040_0002
4-{6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-on- ylmethyl)imidazol- 1 -ylmethyl }benzonitrile;
Figure imgf000040_0003
4-{3-(2,2,2-trifluoroethyl)-6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)- on- 1 ' -ylmethyl)imidazol- 1 -ylmethyl }benzonitrile;
Figure imgf000041_0001
4- { 3 -butyl-6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] -2( lH)-on- 1 ' ylmethyl)imidazol- 1 -ylmethyl } benzonitrile ;
Figure imgf000041_0002
4- { 3-(3 -trifluoromethoxybenzyl)-6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] - 2(lH)-on-l '-ylmethyl)imidazol-l-ylmethyl}-benzonitrile;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
The compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention. When any variable, term or substituent (e.g. aryl, heterocycle, n, Rla ; etc.) occurs more than one time in any formula or generic structure, its definition on each occurrence is independent from the definition at every other occurrence. Also, combinations of substituents/or variables are permissible only if such combinations result in stable compounds.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified; "alkoxy" represents an alkyl group having 1 to 4 carbon atoms, unless otherwise indicated, attached through an oxygen bridge. "Halogen" or "halo" as used herein means fluoro, chloro, bromo and iodo. "Cycloalkyl" as used herein is intended to include non-aromatic cyclic hydrocarbon groups, having the specified number of carbon atoms, which may or may not be bridged or structurally constrained. Examples of such cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, cyclooctyl, cycloheptyl, and the like.
If no number of carbon atoms is specified, the term "alkenyl" refers to a non-aromatic hydrocarbon, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present. Thus, "C2-C6 alkenyl" means an alkenyl radical having from
2 to 6 carbon atoms. Examples of such alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl and cyclohexenyl. As described above with respect to alkyl, the straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated.
The term "alkynyl" refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon-carbon triple bonds may be present. Thus, "C2-C6 alkynyl" means an alkynyl radical having from 2 to 6 carbon atoms. Examples of such alkynyl groups include, but are not limited to, ethynyl, propynyl and butynyl.
As described above with respect to alkyl, the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
As used herein, "aryl" is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic. Examples of such aryl elements include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
As used herein, "aralkyl" is intended to mean an aryl moiety, as defined above, attached through a C^-Cg alkyl linker, where alkyl is defined above.
Examples of aralkyls include, but are not limited to, benzyl, naphthylmethyl and phenylbutyl.
The term heterocycle or heterocyclic, as used herein, represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic hetero- cyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring. The heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure. Examples of such heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzo- thiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzopyrazolyl, benzotriazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydro- benzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, furanyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, 4-oxonaphthyridinyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, 2-oxopyridyl, 2-oxoquinolinyl, piperidyl, piperazinyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrimidyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuranyl, tetrahydrofuryl, tetrahydroimidazopyridinyl, tetrahydroisoquinolinyl, tetrahydro- quinolinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl, thienofuryl, thienothienyl, thienyl and triazolyl. Preferably, heterocycle or heterocyclic is not tetrazolyl.
As used herein, "heteroaryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S. Examples of such heteroaryl elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzopyrazolyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furanyl, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroimidazopyridinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl, thienyl and triazolyl. As used herein, "heteroaralkyl" is intended to mean a heteroaryl moiety, as defined above, attached through a Cj-Cg alkyl linker, where alkyl is defined above. Examples of heteroaralkyls include, but are not limited to,
2-pyridylmethyl, 2-morpholinylethyl, 2-imidazolylethyl, 2-quinolinylmethyl, 2-imidazolylmethyl, 1-piperazineethyl, and the like.
As used herein, the terms "substituted alkyl", "substituted alkenyl",
"substituted alkynyl" and "substituted alkoxy" are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, Cl, Br, I, CF3, OCF3, N3, NO2, NH2, oxo, OH, -O(CrC6 alkyl), S(O)0_2, (CrC6 alkyl)S(O)0_2-, C2-C6 alkenyl, C2-C6 alkynyl, -(CrC6 alkyl)S(O)0.2(CrC6 alkyl), C3-C20 cycloalkyl, C2-C6 alkenyl,
C2-C6 alkynyl, -C(O)NH, (CrC6 alkyl)C(O)NH-, H2N-CH(NH)-, H2NC(O)NH-
(CrC6 alkyl)C(O)-, -O(CrC6 alkyl)CF3, (CrC6 alkyl)OC(O)-, (CrC6 alkyl)O
(CrC6 alkyl)-, (CrC6 alkyl)C(O)2(CrC6 alkyl)-, (CrC6 alkyl)OC(O)NH-, aryl, benzyl, heterocycle, aralkyl, heteroaralkyl, halo-aryl, halo-benzyl, halo-heterocycle, cyano-aryl, cyano-benzyl and cyano-heterocycle.
As used herein, the terms "substituted aryl", "substituted heterocycle", "substituted heteroaryl", "substituted cycloalkyl", "substituted benzyl", "substituted aralkyl" and "substituted heteroaralkyl" are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound. Such substitutents are preferably selected from the group which includes but is not limited to F, Cl, Br, I, CF3, OCF3, NH2, N(CrC6 alkyl)2, NO2,
CN, N3, CrC20 alkyl, CrC6 alkoxy, C3-C20 cycloalkyl, -OH, -O(CrC6 alkyl), s(°)0-2> ( rc6 alkyl)S(O)0„2-, (CrC6
Figure imgf000044_0001
alkyl)-, (CrC6 alkyl)C(O)NH-, H2NC(O)NH-, H2N-CH(NH)-, H2N-C(O)NH-, (CrC6 alkyl)C(O)-,
(CrC6 alkyl)OC(O)-, (CrC6 alkyl)O(CrC6 alkyl)-, (C1-C6)C(O)2(C1-C6 alkyl)-,
(Cj-Cg alkyl)OC(O)NH-, aryl, aralkyl, heteroaryl, heteroaralkyl, halo-aryl, halo- aralkyl, halo-heterocycle, halo-heteroaralkyl, cyano-aryl, cyano-aralkyl, cyano- heterocycle and cyano-heteroaralkyl. Examples of the ring structures which may be formed when R and R are joined include, but are not limited to
Figure imgf000045_0001
As used herein, examples of "C3 - C2ø cycloalkyl" may include, but are not limited to:
Figure imgf000045_0002
3 Lines drawn into the ring systems from substituents (such as from R ,
4 R , etc.) indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms or heteroatoms.
Preferably, Rla and Rlb are independently selected from H, unsubstituted or substituted -C6 alkyl, R10O-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle. More preferably Rla and Rlb are independently selected from H, unsubstituted or substituted Ci~C6 alkyl.
2 10
Preferably, R is independently selected from hydrogen, -OR , CN, unsubstituted or substituted aryl and halogen. Most preferably, r is 1 to 3 and at least
2 one R is CN. Preferably, R3 is independently selected from H, halo, unsubstituted or substituted
Figure imgf000045_0003
alkyl.
Preferably, R5 is selected from H, unsubstituted or substituted Ci-C6 alkyl, unsubstituted or substituted aralkyl.
Preferably, R8 is independently selected from H or unsubstituted or substituted Ci-C6 alkyl.
Preferably, J is CH2 or oxygen. Preferably, V is aryl, heterocycle or -C20 alkyl. More preferably, V is aryl. Most preferably, V is phenyl.
Preferably, W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 2-oxopiperidinyl, quinolinyl, isoquinolinyl, and thienyl. More preferably, W is imidazolyl or pyridinyl. Most preferably, W is imidazolyl.
Preferably, the moiety
Figure imgf000046_0001
represents
Figure imgf000046_0002
Preferably the moiety
Figure imgf000046_0003
represents
Figure imgf000046_0004
Figure imgf000047_0001
where p is 1 or 2.
It is intended that the definition of any substituent or variable (e.g., Rla, R2? m. p. etc.) at a particular location in a molecule is independent of its definitions elsewhere in that molecule. Thus, -C(Rla)2 can represent -CH2, -CHCH3, -CHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like. The pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichio- metric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
Abbreviations which may be used in the description of the chemistry and in the Examples that follow include:
Ac2O Acetic anhydride; AIBN 2,2 -Azobisisobutyronitrile
BOC/Boc t-Butoxycarbonyl;
CBz Carbobenzyloxy;
DBAD Di-tert-butyl azodicarboxylate; DBU l,8-Diazabicyclo[5.4.0]undec-7-ene;
DCE 1,2-Dichloroethane;
DIEA NN-Diisopropylethylamine;
DMAP 4-Dimethylaminopyridine;
DME 1,2-Dimethoxyethane; DMF NN-Dimethylformamide;
DMSO Methyl sulfoxide;
DPPA Diphenylphosphoryl azide;
DTT Dithiothreitol;
EDC l-(3-Dimethylaminopropyl)-3-ethyl-carbodiimide- hydrochloride; EDTA Ethylenediaminetetraacetic acid;
Et3N Triethylamine;
EtOAc Ethyl acetate;
EtOH Ethanol;
FAB Fast atom bombardment; HEPES 4-(2-Hydroxyethyl)-l -piperazineethanesulf onic acid;
HOBT 1-Hydroxybenzotriazole hydrate;
HOOBT 3-Hydroxy-l ,2,2-benzotriazin-4(3H)-one;
ΗPLC High-performance liquid chromatography;
LAH Lithium aluminum hydride; MCPBA m-Chloroperoxybenzoic acid;
Me Methyl;
MeOH Methanol;
Ms Methanesulfonyl;
MsCl Methanesulfonyl chloride; n-Bu3P Tri-n-butylphosphine;
NaHMDS Sodium bis(trimethylsilyl)amide;
NBS N-Bromosuccinimide;
PMSF a-Toluenesulfonyl chloride;
Py or pyr Pyridine; PYBOP Benzotriazole-1-yl-oxy-trispyrrolidinophosphonium hexafluorophosphate; t-Bu tert-Butyl
TBAF Tetrabutylammoniumfluoride
RPLC Reverse Phase Liquid Chromatography
TBSC1 tert-Butyldimethylsilyl chloride
TFA Trifluoroacetic acid;
THF Tetrahydrofuran;
TMS Tetramethylsilane;
Tr Trityl;
These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the Schemes. The procedures discussed and illustrated in the following schemes and synopsis may be used in the preparation of the compounds of the instant invention, for either (R) or (S) stereochemistry.
Synopsis of Schemes The compounds of this invention are prepared by employing reactions as shown in Schemes 1-7, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. While stereochemistry is shown in the Schemes, a person of ordinary skill in the art would understand that the illustrated compounds represent racemic mixtures which may be separated at a subsequent purification step or may be utilized as the racemic mixture.
These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the reductive alkylation or acylation reactions described in the Schemes.
Scheme 2 shows a method for forming spiro[4H-3,l-benzoxazine- 4,4'-piperidine]-2(lH)-ones, L26. Halo-substituted aniline L20 is treated with di- t-butylcarbonate to obtain L21, which is lithiated with t-butyllithium and reacted with a Boc'ed piperidone to obtain Boc-protected halobenzoxazinone L22, which can be deprotected by treatment with an acid to form L24, or can be N-alkylated on the benzoxazine ring by treatment with an alkyl or arylalkyl halide and then deprotected to form L25. Further description of this chemistry can be found in J.Med. Chem. 1983, 26: 657-661, Chem. Pharm. Bull. 1985, 33: 1129-1139, and US 4349549.
Scheme 3 depicts the synthesis of intermediate compounds containing a spiro-benzopiperdinone-piperidine. The techniques depicted are described in U.S. Patent 5,536,716 (issued on July 16, 1996), and herein incorporated by reference. In Scheme 3, oxygenated sprioindanyl piperidine intermediates are synthesized by following hydroboration of the protected spiroindene DI with oxidative workup with pyridinium chlorochormate to provide D2. The spiroindanones are then converted into benzolactam intermediates. Compound D2 is treated with hydrazoic acid in an inert solvent such as chloroform (Schmidt reaction) is one of the many suitable literature methods for this transformation. A mixture of two benzolactams is formed in this example. The isomers are easily separated by chromatography on silica gel. These intermediates can then be deprotected. The alkylation of D3 with an alkyl halide in a solvent such as DMF in the presence of NaH affords the substituted D4. Such compounds may then be coupled with a benzimidazolyl to provide the piperidinone-piperidine analogs to L26. Schemes 4-7 illustrate syntheses of suitably substituted aldehydes useful in the syntheses of the instant compounds wherein the variable W is present as a pyridyl moiety. Similar synthetic strategies for preparing alkanols that incorporate other heterocyclic moieties for variable W are also well known in the art.
SCHEME 1
Figure imgf000051_0001
SCHEME 2 t-BuLi (2:1 mole ratio)
Figure imgf000052_0001
Figure imgf000053_0001
D3
Figure imgf000053_0002
D4 SCHEME 4
Figure imgf000054_0001
NaBH4 (excess)
Figure imgf000054_0002
Figure imgf000054_0003
SCHEME 5
Figure imgf000055_0001
SCHEME 6
Figure imgf000056_0001
Figure imgf000056_0002
SCHEME 7
Figure imgf000057_0001
2. (CH3)3SiCHN2
Figure imgf000057_0002
SO3Py, Et3N
Figure imgf000057_0003
In the above Schemes, it is understood that
L is an appropriate protecting group, such as a benzyl group; R independently represents R^ or a protected precursor thereof; R' independently represents R^ or a protected precursor thereof,
X represents R^ or R4 or a protected precursor thereof; arid Y represents a halide.
In a preferred embodiment of the instant invention the compounds of the invention are selective inhibitors of farnesyl-protein transferase. A compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 7, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 8. Preferably, a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: a) an IC50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC50 for the inhibition of the famesylation of hDJ protein.
When measuring such IC50S and EC50S the assays described in Example 12 may be utilized.
It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: b) an IC50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-
Ras dependent activation of MAP kinases in cells at least 100-fold greater than the EC50 for inhibition of the famesylation of the protein hDJ in cells.
It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: c) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-rαs-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells. When measuring Ras dependent activation of MAP kinases in cells the assays described in Example 11 may be utilized. In another preferred embodiment of the instant invention the compounds of the invention are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I. Such a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed. In a SEAP assay, such as described in Example 11 , it is preferred that the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 12μM against K4B-Ras dependent activation of MAP kinases in cells. The Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC50 for inhibiting the famesylation of the protein hDJ in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
The Class π prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against H-ras-
CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein. The Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC50) against H-ras-
CNLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against H-ras-CNLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the
SEAP protein.
A method for measuring the activity of the inhibitors of prenyl-protein transferase, as well as the instant combination compositions, utilized in the instant methods against Ras dependent activation of MAP kinases in cells is described in Example 11.
In yet another embodiment, a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of farnesyl-protein transferase. The instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (ΝF-1), neu, src, abl, lck, fyn) or by other mechanisms.
The compounds of the instant invention inhibit farnesyl-protein transferase and the famesylation of the oncogene protein Ras. The instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization. The compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment. For example, the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder.
The instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992).
The compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
The instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et al.FASEB Journal, 2:A3160 (1988)).
The instant compounds may also be useful for the treatment of fungal infections. The instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
The compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
In such methods of prevention and treatment as described herein, the prenyl-protein transferase inhibitors of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the prenyl-protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue. Such drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
The instant compounds may also be useful as inhibitors of corneal inflammation. These compounds may improve the treatment of corneal opacity which results from cauterization-induced corneal inflammation. The instant compounds may also be useful in reducing corneal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol. Vis. Sci, 1998, vol. 39, p 2245-2251).
The compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
Additionally, the compounds of the instant invention may be administered to a mammal in need thereof using a gel extrusion mechanism (GEM) device, such as that described in USSN 60/144,643, filed on July 20, 1999, which is hereby incorporated by reference. The compounds of the instant invention may also be administered to a mammal in need thereof using an osmotic controlled release drug delivery device, such as those described in USSN 60/162,589 and USSN 60/162,719, co-filed on October 29, 1999, and herein incorporated by reference.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts. The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, com starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropyl- cellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyl- eneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene- oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol. Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
The pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant. The pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
The sterile injectable preparation may also be a sterile injectable oil-in- water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
The injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUS™ model 5400 intravenous pump. The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed. (For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol. When a compound according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms. In one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day. The compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant farnesyl-protein transferase inhibitors and an antineoplastic agent. It is also understood that such a combination of antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. It is further understood that any of the therapeutic agents described herein may also be used in combination with a compound of the instant invention and an antineoplastic agent.
Examples of an antineoplastic agent include, in general, microtubule- stabilizing agents ( such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, for example, nitrogen mustards, ethyleneimine compounds, alkyl sulfonates and other compounds with an alkylating action such as nitrosoureas, cisplatin, and dacarbazine; anti- metabolites, for example, folic acid, purine or pyrimidine antagonists; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; mitotic inhibitors, for example, vinca alkaloids and derivatives of podophyllotoxin; cytotoxic antibiotics; hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors and antibodies (such as trastuzumab (Herceptin™)). Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drags, diynenes and the podophyllotoxins. Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like. Other useful antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, bleomycin, chlorambucil, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins. Particular examples of antineoplastic, or chemotherapeutic, agents are described, for example, by D. J. Stewart in "Nausea and Vomiting: Recent Research and Clinical Advances", Eds. J. Kucharczyk, et al., CRC Press Inc., Boca Raton, Florida, USA (1991), pages 177-203, especially page 188. See also, R. J. Gralla, et al., Cancer Treatment Reports, 68(1), 163-172 (1984).
The preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel. The compounds of the instant invention may also be co-administered with antisense oligonucleotides which are specifically hybridizable with RNA or DNA deriving from human ras gene. Such antisense oligonucleotides are described in U.S. Pat. No. 5,576,208 and PCT Publ. No. WO 99/22772. The instant compounds are particularly usefule when co-administered with the antisense oligonucleotide comprising the amino acid sequence of SEQ.ID.NO: 2 of U.S. Pat. No. 5,576,208. Certain compounds of the instant invention may exhibit very low plasma concentrations and significant inter-individual variation in the plasma levels of the compound. It is believed that very low plasma concentrations and high intersubject variability achieved following administration of certain prenyl- protein transferase inhibitors to mammals may be due to extensive metabolism by cytochrome P450 enzymes prior to entry of drug into the systemic circulation. Prenyl-protein transferase inhibitors may be metabolized by cytochrome P450 enzyme systems, such as CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other cytochrome P450 isoform. If a compound of the instant invention demonstrates an affinity for one or more of the cytochrome P450 enzyme systems, another compound with a higher affinity for the P450 enzyme(s) involved in metabolism should be administered concomitantly. Examples of compounds that have a comparatively very high affinity for CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other P450 isoform include, but are not limited to, piperonyl butoxide, troleandomycin, erythromycin, proadifen, isoniazid, allylisopropylacetamide, ethinylestradiol, chloramphenicol, 2-ethynyl- naphthalene and the like. Such a high affinity compound, when employed in combination with a compound of formula A, may reduce the inter-individual variation and increase the plasma concentration of a compound of formula A to a level having substantial therapeutic activity by inhibiting the metabolism of the compound of formula A. Additionally, inhibiting the metabolism of a compound of the instant invention prolongs the pharmacokinetic half -life, and thus the pharmacodynamic effect, of the compound. A compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy. For the prevention or treatment of emesis a compound of the present invention may be used in conjunction with other anti- emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, or a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S. Patent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712. For the treatment or prevention of emesis, conjunctive therapy with a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is preferred.
Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos. EP 0 360 390, 0 394 989, 0 428 434, 0 429 366, 0 430 771, 0436 334, 0443 132, 0482 539, 0498 069, 0 499 313, 0 512 901, 0 512 902, 0 514 273, 0 514 274, 0 514 275, 0 514 276, 0 515 681, 0 517 589, 0 520 555, 0 522 808, 0 528 495, 0 532456, 0 533 280, 0 536 817, 0 545 478, 0 558 156, 0 577 394, 0 585 913,0 590 152, 0 599 538, 0 610 793, 0 634402, 0 686 629, 0 693 489, 0 694 535, 0 699 655, 0 699 674, 0 707 006, 0 708 101, 0 709 375, 0 709 376, 0 714 891, 0 723 959, 0 733 632 and 0 776 893; PCT International Patent Publication Nos. WO 90/05525, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/05181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362, 97/18206, 97/19084, 97/19942 and 97/21702; and in British Patent Publication Nos. 2 266 529, 2 268 931, 2 269 170, 2 269 590, 2 271 774, 2 292 144, 2 293 168, 2 293 169, and 2 302 689. The preparation of such compounds is fully described in the aforementioned patents and publications.
A particularly preferred neurokinin-1 receptor antagonist for use in conjunction with the compounds of the present invention is 2-(R)-(l-(R)-(3,5- bis(trifluoromethyl)ρhenyl)ethoxy)-3-(S)-(4-fluoroρhenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147.
For the treatment of cancer, it may be desirable to employ a compound of the present invention in conjunction with another pharmacologically active agent(s). A compound of the present invention and the other pharmacologically active agent(s) may be administered to a patient simultaneously, sequentially or in combination. For example, the present compound may employed directly in combination with the other active agent(s), or it may be administered prior, concurrent or subsequent to the administration of the other active agent(s). In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
For example, a compound of the present invention may be presented together with another therapeutic agent in a combined preparation, such as with an antiemetic agent for simultaneous, separate, or sequential use in the relief of emesis associated with employing a compound of the present invention and radiation therapy. Such combined preparations may be, for example, in the form of a twin pack. A preferred combination comprises a compound of the present invention with antiemetic agents, as described above. Radiation therapy, including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer.
Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
The instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Thus, the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity. The instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase. In particular, if the compound of the instant invention is a selective inhibitor of farnesyl-protein transferase, co-administration with a compound(s) that is a selective inhibitor of geranylgeranyl protein transferase may provide an improved therapeutic effect. In particular, the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Ser. Nos. 08/254,228 and 08/435,047. Those patents and publications are incorporated herein by reference. In practicing methods of this invention, which comprise administering, simultaneously or sequentially or in any order, two or more of a protein substrate- competitive inhibitor and a farnesyl pyrophosphate-competitive inhibitor, such administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously. When the protein substrate-competitive inhibitor and farnesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods. The instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, and WO 98/44797, published on October 15, 1998, which are incorporated herein by reference.
As used herein the term an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells. In particular, the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the αvβ3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the αvβ5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the αvβ3 integrin and the αvβ5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells. The term also refers to antagonists of the αlβl, α2βl, α5βl, α6βl and α6β4 integrins. The term also refers to antagonists of any combination of αvβ3 integrin, αvβ5 integrin, αlβl, α2βl, α5βl, α6βl and α6β4 integrins. The instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin. The instant compounds may also be useful in combination with an inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) for the treatment of cancer. Compounds which have inhibitory activity for HMG-CoA reductase can be readily identified by using assays well-known in the art. For example, see the assays described or cited in U.S. Patent 4,231,938 at col. 6, and WO 84/02131 at pp. 30-33. The terms "HMG-CoA reductase inhibitor" and "inhibitor of HMG-CoA reductase" have the same meaning when used herein.
Examples of HMG-CoA reductase inhibitors that may be used include but are not limited to lovastatin (MENACOR®; see US Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR®; see US Patent No. 4,444,784;
4,820,850; 4,916,239), pravastatin (PRAVACHOL®; see US Patent Nos. 4,346,227; 4,537,859; 4,410,629; 5,030,447 and 5,180,589), fluvastatin (LESCOL®; see US Patent Nos. 5,354,772; 4,911,165; 4,929,437; 5,189,164; 5,118,853; 5,290,946; 5,356,896), atorvastatin (LMTOR®; see US Patent Nos. 5,273,995; 4,681,893; 5,489,691 ; 5,342,952) and cerivastatin (also known as rivastatin and B AYCHOL® ; see US Patent No. 5,177,080). The structural formulas of these and additional HMG- CoA reductase inhibitors that may be used in the instant methods are described at page 87 of M. Yalpani, "Cholesterol Lowering Drags", Chemistry & Industry, pp. 85- 89 (5 February 1996) and US Patent Nos. 4,782,084 and 4,885,314. The term HMG- CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention. An illustration of the lactone portion and its corresponding open-acid form is shown below as stractures I and H
Figure imgf000072_0001
Lactone Open-Acid
I n In HMG-CoA reductase inhibitors, where an open-acid form can exist, salt and ester forms may preferably be formed from the open-acid, and all such forms are included within the meaning of the term "HMG-CoA reductase inhibitor" as used herein. Preferably, the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, and most preferably simvastatin. Herein, the term "pharmaceutically acceptable salts" with respect to the HMG-CoA reductase inhibitor shall mean non- toxic salts of the compounds employed in this invention which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, omithine, choline, N,N' -dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, l-p-chlorobenzyl-2-pyrrolidine-l '-yl-methyl- benzimidazole, diethylamine, piperazine, and tris(hydroxymethyl)-aminomethane. Further examples of salt forms of HMG-CoA reductase inhibitors may include, but are not limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium edetate, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynapthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, oleate, oxalate, pamaote, palmitate, panthothenate, phosphate/diphosphate, polygalacturonate, salicylate, stearate, subacetate, succinate, tannate, tartrate, teoclate, tosylate, triethiodide, and valerate. Ester derivatives of the described HMG-CoA reductase inhibitor compounds may act as prodrugs which, when absorbed into the bloodstream of a warm-blooded animal, may cleave in such a manner as to release the drag form and permit the drug to afford improved therapeutic efficacy.
Similarly, the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described above and the other pharmaceutically active agent(s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
The instant compounds may also be useful in combination with prodrugs of antineoplastic agents. In particular, the instant compounds may be co-administered either concurrently or sequentially with a conjugate (termed a "PSA conjugate") which comprises an ohgopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent. Such co-administration will be particularly useful in the treatment of prostate cancer or other cancers which are characterized by the presence of enzymatically active PSA in the immediate surrounding cancer cells, which is secreted by the cancer cells. Compounds which are PSA conjugates and are therefore useful in such a co-administration, and methods of synthesis thereof, can be found in the following patents, pending patent applications and publications which are herein incorporated by reference:
U.S. Patent No. 5,599,686, granted on Feb. 4, 1997;
WO 96/00503 (January 11, 1996); USSN 08/404,833, filed on March 15, 1995;
USSN 08/468,161, filed on June 6, 1995;
U.S. Patent No. 5,866,679, granted on February 2, 1999;
WO 98/10651 (March 19, 1998); USSN 08/926,412, filed on September 9, 1997;
WO 98/18493 (May 7, 1998); USSN 08/950,805, filed on October 14, 1997;
WO 99/02175 (January 21, 1999); USSN 09/112,656, filed on July 9, 1998; and
WO 99/28345 (June 10, 1999); USSN 09/193,365, filed on November 17, 1998. Compounds which are described as prodrugs wherein the active therapeutic agent is released by the action of enzymatically active PSA and therefore may be useful in such a co-administration, and methods of synthesis thereof, can be found in the following patents, pending patent applications and publications, which are herein incorporated by reference: WO 98/52966 (November 26, 1998).
All patents, publications and pending patent applications identified are herein incorporated by reference.
The compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl-protein transferase (FPTase) in a composition. Thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention. After the assay mixtures are incubated for an sufficient period of time, well known in the art, to allow the FPTase to farnesylate the substrate, the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
It would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain farnesyl-protein transferase and quantitating the enzyme. Thus, potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample. A series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl- protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention. The concentration of a sufficiently potent inhibitor (i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel) required to inhibit the enzymatic activity of the sample by 50% is approximately equal to half of the concentration of the enzyme in that particular sample.
EXAMPLES
Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and are not intended to limit the reasonable scope thereof.
EXAMPLE 1
Step A: Preparation of p-Cyanobenzylamine « H3PO4 salt
Figure imgf000076_0001
A slurry of HMTA in 2.5 L EtOH was added gradually over about 30 min to about 60 min to a stirred slurry of cyanobenzyl-bromide in 3.5 L EtOH and maintained at about 48-53 °C with heating & cooling in a 22L neck flask (small exotherm). Then the transfer of HMTA to the reaction mixture was completed with the use of 1.0 L EtOH. The reaction mixture was heated to about 68-73 °C and aged at about 68-73°C for about 90 min. The reaction mixture was a slurry containing a granular precipitate which quickly settled when stirring stopped.
The mixture was cooled to a temperature of about 50°C to about 55°C. Propionic acid was added to the mixture and the mixture was heated and maintained at a temperature of about 50°C to about 55 °C. Phosphoric acid was gradually added over about 5 min to about 10 min, maintaining the reaction mixture below about 65°C to form a precipitate-containing mixture. Then the mixture was gradually warmed to about 65°C to about 70°C over about 30 min and aged at about 65°C to about 70°C for about 30 min. The mixture was then gradually cooled to about 20-25°C over about 1 hour and aged at about 20-25°C for about 1 hour.
The reaction slurry was then filtered. The filter cake was washed four times with EtOH, using the following sequence, 2.5 L each time. The filter cake was then washed with water five times, using 300 mL each time. Finally, the filter cake was washed twice with MeCN (1.0 L each time) and the above identified compound was obtained.
Step B: 4-Cyanobenzylamine Hydrochloride via Hexamethylene- tetrammonium salt
Figure imgf000077_0001
A 72 liter vessel was charged with 190 proof ethanol (14.4 L) followed by the addition of 4-cyanobenzylbromide (2.98 kg) and HMTA (2.18 kg) at ambient temperature. The mixture was heated to about 72-75 °C over about 60 min. On warming, the solution thickens and additional ethanol (1.0 liter) was added to facilitate stirring. The batch was aged at about 72-75°C for about 30 min.
The mixture was allowed to cool to about 20°C over about 60 min, and HCl gas (2.20 kg) was sparged into the slurry over about 4 hours during which time the temperature rose to about 65°C. The mixture was heated to about 70-72°C and aged for about 1 hour. The slurry was cooled to about 30°C and ethyl acetate (22.3 L) added over about 30 min. The slurry was cooled to about -5°C over about 40 min and aged at about -3 to about -5°C for about 30 min. The mixture was filtered and the crystalline solid was washed with chilled ethyl acetate (3 x 3 L). The solid was dried under an N2 stream for about 1 hour before charging to a 50 liter vessel containing water (5.5 L). The pH was adjusted to about 10-10.5 with 50% NaOH (4.0 kg) maintaining the internal temperature below about 30°C. At about 25°C, methylene chloride (2.8 L) was added and stirring continued for about 15 min. The layers were allowed to settle and the lower organic layer was removed. The aqueous layer was extracted with methylene chloride (2 x 2.2 L). The combined organic layers were dried over potassium carbonate (650 g). The carbonate was removed via filtration and the filtrate concentrated in vacuo at about 25°C to give a free base as a yellow oil.
The oil was transferred to a 50 liter vessel with the aid of ethanol (1.8 L). Ethyl acetate (4.1 L) was added at about 25°C. The solution was cooled to about 15°C and HCl gas (600 g) was sparged in over about 3 hours, while keeping batch temperature below about 40°C. At about 20-25°C, ethyl acetate (5.8 L) was added to the slurry, followed by cooling to about -5°C over about 1 hour. The slurry was aged at about -5°C for about 1 hour and the solids isolated via filtration. The cake was washed with a chilled mixture of EtOAc/EtOH (9:1 v/v) (1 x 3.8 L), then the cake was washed with chilled EtOAc (2 x 3.8 L). The solids were dried in vacuo at about 25°C to provide the above-titled compound.
!H NMR (250 MHz, CDCI3) d 7.83-7.79 (d, 2H), 7.60-7.57 (d, 2H), 4.79 (s, 2H), 4.25 (s, 2H); 13C NMR (62.9 MHz, CDCI3) d 149.9, 139.8, 134.2, 131.2, 119.7, 113.4, 49.9, 49.5, 49.2, 48.8, 48.5, 48.2, 43.8.
Step C: 1 -(4-Cyanobenzyl)-2-Mercapto-5-Hydroxymethyl-imidazole
Figure imgf000078_0001
7% water in acetonitrile (50 mL) was added to a 250 mL roundbottom flask. Next, an amine phosphate salt (12.49 g), as described above in Step A, was added to the flask. Next potassium thiocyanate (6.04 g) and dihydroxyacetone (5.61 g) was added. Lastly, propionic acid (10.0 mL) was added. Acetonitrile/water 93:7 (25 mL) was used to rinse down the sides of the flask. This mixture was then heated to 60°C, aged for about 30 minutes and seeded with 1% thioimidazole. The mixture was then aged for about 1.5 to about 2 hours at 60°C. Next, the mixture was heated to 70°C, and aged for 2 hours. The temperature of the mixture was then cooled to room temperature and was aged overnight. The thioimidazole product was obtained by vacuum filtration. The filter cake was washed four times acetonitrile (25 mL each time) until the filtrates became nearly colorless. Then the filter cake was washed three times with water (approximately 25-50 mL each time) and dried in vacuo to obtain the above-identified compound.
Step D: l-(4-Cyanobenzyl)-5-Hydroxymethylimidazole
Figure imgf000079_0001
A IL flask with cooling/heating jacket and glass stirrer (Lab-Max) was charged with water (200 mL) at 25°C. The thioimidazole (90.27 g), as described above in Step C, was added, followed by acetic acid (120 mL) and water (50 mL) to form a pale pink slurry. The reaction was warmed to 40°C over 10 minutes. Hydrogen peroxide (90.0 g) was added slowly over 2 hours by automatic pump maintaining a temperature of 35-45°C. The temperature was lowered to 25°C and the solution aged for 1 hour.
The solution was cooled to 20°C and quenched by slowly adding 20% aqueous Na2SO3 (25 mL) maintaining the temperature at less than 25°C. The solution was filtered through a bed of DARCO G-60 (9.0 g) over a bed of SolkaFlok (1.9 g) in a sintered glass funnel. The bed was washed with 25 mL of 10% acetic acid in water.
The combined filtrates were cooled to 15°C and a 25% aqueous ammonia was added over a 30 minute period, maintaining the temperature below 25°C, to a pH of 9.3. The yellowish slurry was aged overnight at 23°C (room temperature). The solids were isolated via vacuum filtration. The cake (100 mL wet volume) was washed with 2 x 250 mL 5% ammonia (25%) in water, followed by 100 mL of ethyl acetate. The wet cake was dried with vacuum/N2 flow and the above-titled compound was obtained.
!H NMR (250 MHz, CDCI3): d 7.84-7.72 (d, 2H), 7.31-7.28 (d, 2H), 6.85 (s, IH), 5.34 (s, 2H), 5.14-5.11 (t, IH), 4.30-4.28 (d, 2H), 3.35 (s, IH). Step E: l-(4-cyanobenzyl)-5-chloromethyl imidazole HCl salt
Figure imgf000080_0001
l-(4-Cyanobenzyl)-5-hydroxymethylimidazole (1.0 kg), as described in above in Step D, was slurried with DMF (4.8 L) at 22°C and then cooled to -5°C. Thionyl chloride (390 mL) was added dropwise over 60 min during which time the reaction temperature rose to a maximum of 9°C. The solution became nearly homogeneous before the product began to precipitate from solution. The slurry was warmed to 26°C and aged for 1 h. The slurry was then cooled to 5°C and 2-propanol (120 mL) was added dropwise, followed by the addition of ethyl acetate (4.8 L). The slurry was aged at 5°C for 1 h before the solids were isolated and washed with chilled ethyl acetate (3 x 1 L). The product was dried in vacuo at 40°C overnight to provide the above-titled compound.
NMR (250 MHz DMSO-d6): d 9.44 (s, IH), 7.89 (d, 2H, 8.3 Hz), 7.89 (s, IH), 7.55 (d, 2H, 8.3 Hz), 5.70 (s, 2H), 4.93 (s, 2H). 13C NMR (75.5 MHz DMSO-d6): dc 139.7, 137.7, 132.7, 130.1, 128.8, 120.7, 118.4, 111.2, 48.9, 33.1.
Step F: l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Hydroxymethylimidazole to VilsmeierReagent
Figure imgf000080_0002
To an ice cold solution of dry acetonitrile (3.2 L, 15 L/Kg hydroxymethylimidazole) was added 99% oxalyl chloride (101 mL, 1.15 mol, 1.15 equiv.), followed by dry DMF (178 mL, 2.30 mol, 2.30 equiv.), at which time vigorous evolution of gas was observed. After stirring for about 5 to 10 min following the addition of DMF, solid hydroxymethylimidazole (213 g, 1.00 mol), as described above in Step D, was added gradually. After the addition, the internal temperature was allowed to warm to a temperature of about 23 °C to about 25 °C and stirred for about 1 to 3 hours. The mixture was filtered, then washed with dry acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash). The solid was maintained under an N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H2O. This yielded the crystalline form of the chloromethylimidazole hydrochloride.
*H NMR (250 MHz DMSO-d6): d 9.44 (s, IH), 7.89 (d, 2H, 8.3 Hz), 7.89 (s, IH), 7.55 (d, 2H, 8.3 Hz), 5.70 (s, 2H), 4.93 (s, 2H). 13C NMR (75.5 MHz DMSO-d6): dc 139.7, 137.7, 132.7, 130.1, 128.8, 120.7, 118.4, 111.2, 48.9, 33.1.
Step G: l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Nilsmeier Reagent to Hydroxymethylimidazole
Figure imgf000081_0001
To an ice cold solution of dry DMF (178 mL, 2.30 mol, 2.30 equiv.) in dry acetonitrile (2.56 L, 12 L/Kg Hydroxymethylimidazole) was added oxalyl chloride (101 mL, 1.15 mol, 1.15 equiv). The heterogeneous mixture in the reagent vessel was then transferred to a mixture of hydroxymethylimidazole (213 g, 1.00 mol), as described above inStep D, in dry acetonitrile (1.7 L, 8 L/Kg hydroxymethylimidazole). Additional dry acetonitrile (1.1 - 2.3 L, 5 - 11 L/Kg hydroxymethylimidazole) was added to the remaining solid Nilsmeier reagent in the reagent vessel. This, now nearly homogenous, solution was transferred to the reaction vessel at Ti < +6°C. The reaction vessel temperature was warmed to a temperature of about 23 °C to about 25°C and stirred for about 1 to 3 hours. The mixture was then cooled to 0°C and aged 1 h. The solid was filtered and washed with dry, ice cold acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash). The solid was maintained under an N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H2O. This yielded the crystalline form of the chloromethylimidazole hydrochloride.
EXAMPLE 2
Preparation of 4- [5-(spiro [3H-indole-3 ,4 ' -piperidin] -2( lH)-on- 1 ' ~ylmethyl)imidazol- 1 -ylmethyllbenzonitrile
Figure imgf000082_0001
Step A: Preparation of l'-tert-butoxycarbonyl-spiro[3H-indole-3 ,4' -piperidin] - 2(lH)-one
Figure imgf000082_0002
To a solution of oxindole (1.33 gm, 10 mmol) in anhydrous tetrahydrofuran (8 mL) was added dropwise, with ice bath cooling, 1 M lithium bis(trimethylsilyl)amide/tetrahydrofuran (30 mL, 30 mmol) under an inert atmosphere (argon). After 15 minutes, this greenish-brown solution was added dropwise to a solution of N-tert-butoxy-carbonyl-bis(2-chloroethyl)amine (2.49 gm, 11 mmol) in anhydrous tetrahydrofuran (5 mL) which was also cooled in an ice bath under an inert atmosphere. This solution was stirred at ambient temp, over 20 hours. The reaction mixture was diluted with diethyl ether and acidified with 2 N HCl. The etheral layer was separated off and dried (anhyd. magnesium sulfate), filtered, and the solvent removed under vacuum. The residue was subjected to column chromatography on silica gel eluting with a 20-50% ethyl acetate/hexane gradient. The appropriate fractions were combined and the solvents concentrated to give a residue which was triturated with 2:1 hexane /diethyl ether to give the title compound as an off-white solid, mp: 138-140°C.
Ste B: Preparation of spiror3H-indole-3,4'-piperidin1-2(lH)-one
Figure imgf000083_0001
A solution of l'-tert-butoxycarbonyl-spiro[3H-indole-3 ,4 '-piperidin] - 2(lH)-one, as described above in Step A, (551 mg, 1.70 mmol) in ethyl acetate saturated with HCl (5 mL) was stirred at ambient temperature for 3 hours as the product salt slowly crystallized out. This salt was collected by filtration and partitioned between methylene chloride and aqueous sat'd. sodium carbonate. The organic layer was separated off, dried (anhyd. sodium sulfate), filtered, and the solvent removed under vacuum. The residue was triturated with diethyl ether to give the title compound as a white solid, mp: 184-186°C.
Step C: Preparation of 4-[5-(spiro[3H-indole-3,4'-piperidine]-2(lH)-on- - ylmethyPimidazol- 1 -ylmethyllbenzonitrile
Figure imgf000083_0002
A solution of spiro[3H-indole-3,4'-piperidin]-2(lH)-one, as described above in Step B, (110 mg, 0.54 mmol), l-(4-cyanobenzyl)-5-chloromethylimidazole hydrochloride salt, as described in Example 1, (134 mg, 0.50 mmol), and triethylamine (0.21 mL, 1.5 mmol) in anhydrous acetonitrile (1.5 mL) was stirred at room temp, for 15 hours. The resulting mixture was diluted with ethyl acetate and the solution washed with sat'd aqueous sodium carbonate, dried (anhyd. sodium sulfate), filtered and concentrated under vacuum. The resulting residue was triturated with ethyl acetate to give a white solid which was collected to afford the title compound as a crystalline freebase, mp: 245-247°C. Anal. Calcd for C26H23N5O -0.5 H2O:
C, 70.91; H, 5.95; N, 17.23. Found: C, 71.01; H, 6.00; N, 17.23.
EXAMPLE 3
Preparation of 4-{6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-on- ylmethyPimidazol- 1 -ylmethyl Ibenzonitrile hydrochloride
Figure imgf000084_0001
The title compound was prepared according to the procedure described in Example 2, beginning with Step B, except 4'-tert-butoxycarbonyl- 6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-one which is prepared as described in J. Med. Chem. 1983, 26, 657-661, was substituted for l'-tert- butoxycarbonyl- spiro[3H-indole-3,4'-piperidin]-2(lH)-one in Step B. The hydrochloride salt was obtained as an amorphous solid. Anal. Calcd for C26H22CIN5O2 -1.7 HCM.O H2O:
C, 54.60; H, 4.91; N, 13.27. Found: C, 54.66; H, 4.95; N, 13.02.
EXAMPLE 4
Preparation of 4-{3-(2,2,2-trifluoroethyl)-6-chlorospiro[4H-3,l-benzoxazine-4,4'- piperidinl-2(lH)-on-r-ylmethyl)imidazol-l-ylmethyl|benzonitrile dihydrochloride
Figure imgf000085_0001
Step A: Preparation of -tert-butoxycarbonyl-3-(2,2,2-trifluoroethyl)-6- chlorospiror4H-3 , 1 -benzoxazine-4.4' -piperidin] -2( lH)-one
Figure imgf000085_0002
A solution of l'-tert-butoxycarbonyl- 6-chlorospiro[4H-3,l- benzoxazine-4,4'-piperidin]-2(lH)-one, (247 mg,0.70 mmol), which is prepared as described in J. Med. Chem. 1983, 26, 657-661, in dry dimethylformamide (1.5 mL) containing cesium carbonate (400 mg, 1.2 mmol) and 2,2,2-trifluoroethyl iodide (1.1 mL, 11 mmol) was stirred at 50°C for 2 days in a vessel sealed with a rubber septum. The mixture was diluted with water and the crade product extracted into ethyl acetate. This extract was dried over anhydrous sodium sulfate, filtered and the solvent removed. The residue was subjected to chromatograghy on silica gel and eluted with a 10-25% ethyl acetate/hexane gradient to give the title product.
Step B: Preparation of 3-{3-(2,2,2-trifluoroethyl)-6-chlorospiro[4H-3,l- benzoxazine-4 ,4' -piperidin] -2(lH)-on- 1 ' -ylmethyl)imidazol- 1- ylmethyl ) benzonitrile Dihydrochloride
Figure imgf000085_0003
The title compound was prepared according to the procedure described in Example 2, beginning with Step B, except 4'-tert-butoxycarbonyl-3- (2,2,2-trifluorethyl)-6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-one from Step A above was substituted for l'-tert-butoxycarbonyl- spiro[3H-indole- 3,4'-piperidin]-2(lH)-one in Step B. The dihydrochloride salt was obtained as an amorphous solid.
Anal. Calcd for C26H25CIF3N5O2 -2.0 HC1-0.8 H2O:
C50.59; H, 4.34; N, 11.35. Found: C, 50.63; H, 4.69; N, 11.32.
EXAMPLE 5
Preparation of 4- { 3-butyl-6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] -2(1H)- on- 1 ' -ylmethyDimidazol- 1 -ylmethyl I benzonitrile dihydrochloride
Figure imgf000086_0001
Step A: Preparation of l'-tert-butoxycarbonyl-3-butyl-6-chlorospiro[4H-3, 1- benzoxazine-4.4'-piperidin1-2(lH)-one
Figure imgf000086_0002
A solution of l'-tert-butoxycarbonyl- 6-chlorospiro[4H-3,l- benzoxazine-4,4'-piperidin]-2(lH)-one, (154 mg,0.50 mmol), which is prepared as described in J. Med. Chem. 1983, 26, 657-661, in dry dimethylformamide (2 mL) containing 60% sodium hydride in mineral oil (36 mg, 0.9 mmol)) was stirred at 50°C for 10 minutes and then n-butyl bromide (0.10 mL, 0.9 mmol) was added and the reaction mixture was stirred for an additional hour at 50°C. The mixture was diluted with ethyl acetate and washed with saturated sodium carbonate and water (3X) .The organic extract was dried over anhydrous sodium sulfate, filtered and the solvent removed. The title compound was isolated as a viscous residue.
Step B: Preparation of 3-{3-butyl-6-chlorospiro[4H-3,l-benzoxazine-4,4'- piperidin]-2(lH)-on- -ylmethyl)imidazol-l-ylmethyl}benzonitrile
Figure imgf000087_0001
The title compound was prepared according to the procedure described in Example 2, beginning with Step B, except 4'-tert-butoxycarbonyl-3-butyl-6- chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)-one from Step A above was substituted for l'-tert-butoxycarbonyl- spiro[3H-indole-3,4'-piperidin]-2(lH)-one in Step B. The dihydrochloride salt was obtained as an crystalline solid, mp: 245-247°C. Anal. Calcd for C28H30CIF3N5O2 -2.0 HC1-0.2 H2O:
C57.92; H, 5.63; N, 12.06. Found: C, 57.88; H, 5.66; N, 12.23.
EXAMPLE 6
Preparation of 4-{3-(3-trifluoromethoxybenzyl)-6-chlorospiro[4H-3,l-benzoxazine- 4,4' -piperidin] -2( 1 H)-on- 1 ' -ylmethyl)imidazol- 1 -ylmethyl } -benzonitrile dihydrochloride
Figure imgf000087_0002
The title compound was prepared according to the procedure described in Example 5, except 3-trifluoromethoxybenzyl bromide was substituted for n-butyl bromide in Step A. The dihydrochloride salt was obtained as an crystalline solid, mp:
240-243°C.
Anal. Calcd for C32H29CIF3N5O3 -2.0 HCl:
C55.31; H, 4.21; N, 10.08. Found: C, 55.74; H, 3.94; N, 10.74.
EXAMPLE 7
In vitro inhibition of ras farnesyl transferase Transferase Assays. Isoprenyl-protein transferase activity assays are carried out at 30°C unless noted otherwise. A typical reaction contains (in a final volume of 50 μL): [3H] farnesyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl2, 5 mM dithiothreitol, 10 μM ZnCl2, 0.1% polyethyleneglycol (PEG)
(15,000-20,000 mw) and isoprenyl-protein transferase. The FPTase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl- protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL). The quenched reactions are allowed to stand for 15 m (to complete the precipitation process). After adding 2 mL of 100% ethanol, the reactions are vacuum-filtered through Whatman GF/C filters. Filters are washed four times with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL) and then counted in a Beckman LS3801 scintillation counter. For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20 fold into the enzyme assay mixture. Substrate concentrations for inhibitor IC50 determinations are as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 1),
100 nM farnesyl diphosphate. The compounds of the instant invention described in the above
Examples 1-6 were tested for inhibitory activity against human FPTase by the assay described above and were found to have IC50 of < 30 μM.
EXAMPLE 8 Modified In vitro GGTase inhibition assay
The modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature. A typical reaction contains (in a final volume of 50 μL): [3H] eranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl2, 10 μM ZnCl2, 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranyl-protein transferase type I(GGTase). The GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference. The Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCNIM (single amino acid code) (SEQ. ID.ΝO.: 2). Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 μL of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
For inhibition studies, assays are ran as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25 fold into the enzyme assay mixture. IC50 values are determined with Ras peptide near .KM concentrations. Enzyme and substrate concentrations for inhibitor IC50 determinations are as follows: 75 pM GGTase-1, 1.6 μM Ras peptide, 100 μM geranylgeranyl diphosphate.
The compounds of the instant invention are tested for inhibitory activity against human GGTase type I by the assay described above.
EXAMPLE 9
Cell-based in vitro ras famesylation assay
The cell line used in this assay is a v-ras line derived from either Ratl or ΝIH3T3 cells, which expressed viral Ha-ras p21. The assay is performed essentially as described in DeClue, J.E. et al.. Cancer Research 51:712-717. (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%). After 4 hours at 37°C, the cells are labeled in 3 ml methionine-free DMEM supple-mented with 10% regular DMEM, 2% fetal bovine serum and 400 μCi[35s]methionine (1000 Ci/mmol). After an additional 20 hours, the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/lmM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min. Aliquots of lysates containing equal numbers of acid- precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Yl 3-259 (Furth, M.E. et al, J. Virol. 43:294-304, (1982)). Following a 2 hour antibody incubation at 4°C, 200 μL of a 25% suspension of protein A-Sepharose coated with rabbit anti rat IgG is added for 45 min. The immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 M EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to famesylated and nonfamesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein.
EXAMPLE 10
Cell-based in vitro growth inhibition assay
To determine the biological consequences of FPTase inhibition, the effect of the compounds of the instant invention on the anchorage-independent growth of Ratl cells transformed with either a v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf and v-Mos maybe included in the analysis to evaluate the specificity of compounds for Ras-induced cell transformation.
Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the compound (dissolved in methanol at 1000 times the final concentration used in the assay). The cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made. EXAMPLE 11
Construction of SEAP reporter plasmid pDSElOO
The SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI. The SEAP gene is derived from the plasmid ρSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid pCMN-RE-AKI contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter. The plasmid also contains a bovine growth hormone poly-A sequence.
The plasmid, pDSElOO was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2- Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DΝA fragments were filled in with the Klenow fragment of E. coli DΝA Polymerase I. The "blunt ended" DΝA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-H and the ends filled in with Klenow DΝA Polymerase I. The SEAP DΝA fragment was blunt end ligated into the pCMN-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
Alternative Construction of SEAP reporter plasmid, pDSElOl
The SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI. The SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
The plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf (-)/SEAP using the restriction enzymes Apa I and Kpnl. The ends of the linear DΝA fragments were chewed back with the Klenow fragment of E. coli DΝA Polymerase I. The "blunt ended" DΝA containing the trancated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMN-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DΝA polymerase. Recombinant plasmids were screened for insert orientation and sequenced through the ligated junctions. The plasmid pCMN-RE-AKI is derived from plasmid pCMNIE-AKI-DHFR (Whang, Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796- 1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers. Five copies of the fos promoter serum response element were inserted as described previously (Jones, R.E., Defeo- Jones, D., McAvoy, E.M., Vuocolo, G.A., Wegrzyn, R.J., Haskell, K.M. and Oliff, A. (1991) Oncogene, 6, 745-751) to create plasmid pCMV-RE-AKI.
The plasmid pGEM7zf(-)/SEAP was constructed as follows. The SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
Sense strand N-terminal SEAP: 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO.:3)
Antisense strand N-terminal SEAP: 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.: 4)
Sense strand C-terminal SEAP: 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.: 5)
Antisense strand C-terminal SEAP: 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.: 6)
The N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends. The Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the Hpal site. The C-terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindiπ restriction sites. The sense strand C-terminal oligo (SEQ.ID.NO.: 5) introduces the internal STOP codon as well as the Hpal site. Next, the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindiπ. The two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf (-) (Promega) which had been restriction digested with EcoRI and Hindlll and isolated on an agarose gel. The resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
Construction of a constitutively expressing SEAP plasmid pCMN-SEAP
An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegaloviras (CMN) IE-1 promoter. The expression plasmid also includes the CMN intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
The plasmid pCMNIE-AKI-DHFR (Whang et al, 1987) containing the CMN immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMN-AKI. Next, the cytomegaloviras intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI. The intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286. The intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a Sad restriction site using site directed mutagenesis. The mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7)
Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.1D.NO.: 8) These two oligos generate a 991 base pair fragment with a Sad site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo. The PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI-InA.
The DNA sequence encoding the trancated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector. The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and HindDI. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI- InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DΝA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMN-AKI-LxA vector. Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid, named pCMN-SEAP, contains a modified SEAP sequence downstream of the cytomegaloviras immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence. The plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
Cloning of a Myristylated viral-H-rαs expression plasmid A DΝA fragment containing viral-H-ras can be PCRed from plasmid
"H-l" (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAAGGACCC CAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTGG3'. (SEQ.ID.NO.: 9) Antisense:
5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3' . (SEQ.ID.NO.: 10) A sequence encoding the first 15 aminoacids of the v-src gene, containing a myristylation site, is incorporated into the sense strand oligo. The sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
To prevent prenylation at the viral-ras C-terminus, cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo. The PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end. The Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMN promoter of the pCI vector.
Cloning of a viral-H-ms-CVLL expression plasmid A viral-H-rαs clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "H-l" (Ellis R. et al., J. Virol 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by PCR using the following oligos. Sense strand:
5 'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3 ' (SEQ.ID.ΝO.: 11)
Antisense strand: 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.:
12)
The sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site. The antisense strand mutates serine 189 to leucine and adds an Xbal site. The PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol- Xbal cut vector pCI (Promega). This results in a plasmid in which the mutated viral- H-rαs-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of c-H-rαs-Leuόl expression plasmid
The human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers. Sense strand:
5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3' (SEQ.ID.NO.: 13)
Antisense strand:
5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ.ID.NO.: 14)
The primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized "Kozak" translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: 15)
After selection and sequencing for the correct nucleotide substitution, the mutated c-H-r<zs-Leu61 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-H-ras-Leuόl from the CMV promoter of the pCI vector.
Cloning of a c-N-r s-Val-^ expression plasmid
The human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand: 5 ' -GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3 ' (SEQ.ID.NO.: 16)
Antisense strand:
5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ.ID.NO.: 17)
The primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18)
After selection and sequencing for the correct nucleotide substitution, the mutated c-N-r s-Val-12 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-N-ra.s-Val-12 from the CMV promoter of the pCI vector.
Cloning of a c-K-rαs-Val-12 expression plasmid
The human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3' (SEQ.ID.NO.: 19)
Antisense strand:
5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3' (SEQ.ID.NO.: 20)
The primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I site at the C-terminal end. After trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras fragment can be ligated into a Kpnl - Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.NO.: 21)
After selection and sequencing for the correct nucleotide substitution, the mutated c-K-rα.s-Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I. The new recombinant plasmid will constitutively transcribe c-K-ra.s-Val-12 from the CMV promoter of the pCI vector. SEAP assay
Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + IX Pen/Strep + IX glutamine + IX NEAA. Cells are grown at 37°C in a 5% CO2 atmosphere until they reach 50 -80% of confluency.
The transient transfection is performed by the CaPO4 method
(Sambrook et al., 1989). Thus, expression plasmids for H-ras, N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE-SEAP reporter construct. For 10cm plates 600ml of CaCl2 -DNA solution is added dropwise while vortexing to 600ml of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat. # 31053-028)+ 0.5% charcoal stripped calf serum + IX (Pen/Strep, Glutamine and nonessential aminoacids). The CaPO4-DNA precipitate is added dropwise to the cells and the plate rocked gently to distribute. DNA uptake is allowed to proceed for 5-6 hrs at 37°C under a 5% CO2 atmosphere.
Following the DNA incubation period, the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin. The 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf serum + IX (Pen/Strep, Glutamine and NEAA ). Transfected cells are plated in a 96 well microtiter plate (lOOml/well) to which drug, diluted in media, has already been added in a volume of 100ml. The final volume per well is 200ml with each drug concentration repeated in triplicate over a range of half -log steps. Incubation of cells and test compound is for 36 hrs at 37°C under
CO2- At the end of the incubation period, cells are examined microscopically for evidence of cell distress. Next, 100 ml of media containing the secreted alkaline phosphatase is removed from each well and transferred to a microtube array for heat treatment at 65°C for 1 hr to inactivate endogenous alkaline phosphatases (but not the heat stable secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.). A volume of 50 ml media is combined with 200 ml of CSPD cocktail and incubated for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein.
DNA-CaPO4 precipitate for 10cm. plate of cells Ras expression plasmid (lmg/ml) 10ml
DSE-SEAP Plasmid (lmg/ml) 2ml
Sheared Calf Thymus DNA (lmg/ml) 8ml 2M CaCl2 74ml dH2O 506ml
2X HBS Buffer
280mM NaCl lOmM KCl
1.5mM Na2HPO4 2H2O 12mM dextrose
50mM HEPES Final pH = 7.05
Luminesence Buffer (26ml) Assay Buffer 20ml
Emerald Reagent™ (Tropix) 2.5ml lOOmM homoarginine 2.5ml
CSPD Reagent® (Tropix) 1.0ml
Assay Buffer
Add 0.05M Na2CO3 to 0.05M NaHCO3 to obtain pH 9.5. Make ImM in MgCl2
EXAMPLE 12
The processing assays employed in this example and in Example 13 modifications of that described by DeClue et al [Cancer Research 51, 712-717, 1991].
K4B-Ras processing inhibition assay PSN-1 (human pancreatic carcinoma) cells are used for analysis of protein processing. Subconfluent cells in 100 mm dishes are fed with 3.5 ml of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine- free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone. Cells treated with lovastatin (5-10 μM), a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a positive control. Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%. Following incubation at 37°C for two hours 204 μCi/ml [35s]Pro-Mix (Amersham, cell labeling grade) is added.
After introducing the label amino acid mixture, the cells are incubated at 37°C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS. The cells are scraped into 1 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 μg/ml AEBSF, 10 μg/ml aprotinin, 2 μg/ml leupeptin and 2 μg/ml antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4°C and the supernatant saved.
For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 μg of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4°C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS). The Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
The supernatant is added to 1 ml of Dilution Buffer 0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem). The second protein/ antibody mixture is incubated on ice at 4°C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS- PAGE on a 12% acrylamide gel (bis-acrylamide: acrylamide, 1:100), and the Ras visualized by fluorography.
hDJ processing inhibition assay
PSN-1 cells are seeded in 24-well assay plates. For each compound to be tested, the cells are treated with a minimum of seven concentrations in half-log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37°C / 5% CO2.
The growth media is then aspirated and the samples are washed with PBS. The cells are lysed with SDS-PAGE sample buffer containing 5% 2-mercaptoethanol and heated to 95°C for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples.
The plates are incubated on ice for another 10 minutes. The samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 mA/gel for 3-4 hours. The samples are then transferred from the gels to PVDF membranes by Western blotting. The membranes are blocked for at least 1 hour in buffer containing
2% nonfat dry milk. The membranes are then treated with a monoclonal antibody to HDJ-2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase-conjugated secondary antibody. The membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager. For each sample, the percent of total signal corresponding to the unprenylated species of HDJ (the slower-migrating species) is calculated by densitometry. Dose-response curves and IC50 values are generated using 4-parameter curve fits in SigmaPlot software. EXAMPLE 13
K4B-Ras processing inhibition assay
PSN-1 (human pancreatic carcinoma) cells are used for analysis of protein processing. Subconfluent cells in 150 mm dishes are fed with 20 ml of media (RPMI supplemented with 15% fetal bovine serum) containing the desired concentration of prenyl-protein transferase inhibitor or solvent alone. Cells treated with lovastatin (5-10 μM), a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a positive control. Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%.
The cells are incubated at 37°C for 24 hours, the media is then removed and the cells are washed twice with cold PBS. The cells are scraped into 2 ml of cold PBS, collected by centrifugation (10,000 x g for 5 min at 4°C) and frozen at -70°C. Cells are lysed by thawing and addition of lysis buffer (50 mM HEPES, pH 7.2, 50 mM NaCl, 1% CHAPS, 0.7 μg/ml aprotinin, 0.7 μg/ml leupeptm 300 μg/ml pefabloc, and 0.3 mM EDTA). The lysate is then centrifuged at 100,000 x g for 60 min at 4°C and the supernatant saved. The supernatant may be subjected to SDS- PAGE, HPLC analysis, and/or chemical cleavage techniques. The lysate is applied to a HiTrap-SP (Pharmacia Biotech) column in buffer A (50 mM HEPES pH 7.2) and resolved by gradient in buffer A plus 1 M NaCl. Peak fractions containing Ki4B-Ras are pooled, diluted with an equal volume of water and immunoprecipitated with the pan Ras monoclonal antibody, Y13-259 linked to agarose. The protein/antibody mixture is incubated at 4°C for 12 hours. The immune complex is washed 3 times with PBS, followed by 3 times with water. The Ras is eluted from the beads by either high pH conditions (pH>10) or by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant may be subjected to SDS-PAGE, HPLC analysis, and/or chemical cleavage techniques.
EXAMPLE 14
Rapl processing inhibition assay
Protocol A: Cells are labeled, incubated and lysed as described in Example 12. For immunoprecipitation of Rapl, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 2 μg of the Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech), is added. The protein antibody mixture is incubated on ice at 4°C for 1 hour. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS). The Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
The supernatant is added to 1 ml of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech). The second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide: acrylamide, 1:100), and the Rapl visualized by fluorography.
Protocol B: PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near- confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 106 cells are plated on 15cm plates to ensure the same stage of confluency in each assay. The media for these cells is RPMI 1640 (Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix. The day of the assay, cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37°C overnight.
The compounds to be assayed are diluted in DMSO in 1/2-log dilutions. The range of final concentrations to be assayed is generally 0.1-100μM. Four concentrations per compound is typical. The compounds are diluted so that each concentration is lOOOx of the final concentration (i.e., for a lOμM data point, a lOmM stock of the compound is needed).
2μL of each lOOOx compound stock is diluted into 1ml media to produce a 2X stock of compound. A vehicle control solution (2μL DMSO to 1ml media), is utilized. 0.5 ml of the 2X stocks of compound are added to the cells.
After 24 hours, the media is aspirated from the assay plates. Each well is rinsed with 1ml PBS, and the PBS is aspirated. 180 μL SDS-PAGE sample buffer
(No vex) containing 5% 2-mercaptoethanol is added to each well. The plates are heated to 100°C for 5 minutes using a heat block containing an adapter for assay plates. The plates are placed on ice. After 10 minutes, 20μL of an RNAse/DNase mix is added per well. This mix is lmg/ml DNasel (Worthington Enzymes), 0.25 mg/ml RNAse A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50mM MgCl2.
The plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70°C until use.
Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25μl of each sample is loaded onto the gel. The gel is run at 15mA for about 3.5 hours. It is important to run the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd (Rab6).
The gels are then transferred to Novex pre-cut PVDF membranes for 1.5 hours at 30V (constant voltage). Immediately after transferring, the membranes are blocked overnight in 20ml Western blocking buffer (2% nonfat dry milk in Western wash buffer (PBS + 0.1% Tween-20). If blocked over the weekend, 0.02%) sodium azide is added. The membranes are blocked at 4°C with slow rocking.
The blocking solution is discarded and 20ml fresh blocking solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in Western blocking buffer) are added. The membranes are incubated at room temperature for 1 hour with mild rocking. The blocking solution is then discarded and the membrane is washed 3 times with Western wash buffer for 15 minutes per wash. 20ml blocking solution containing 1:1000 (diluted in Western blocking buffer) each of two alkaline phosphatase conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cruz Biochemical]) is then added. The membrane is incubated for one hour and washed 3x as above.
About 2ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet.
The developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal. The Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
Protocol C:
This protocol allows the determination of an EC50 for inhibition of processing of Rapla. The assay is ran as described in Protocol B with the following modifications. 20 μl of sample is run on pre-cast 10-20% gradient acrylamide mini gels (Novex Inc.) at 15 mA/gel for 2.5-3 hours. Prenylated and unprenylated forms of Rapla are detected by blotting with a polyclonal antibody (Rapl/Krev-1 Ab#121 ;
Santa Cruz Research Products #sc-65), followed by an alkaline phosphatase- conjugated anti-rabbit IgG antibody. The percentage of unprenylated Rapla relative to the total amount of Rapla is determined by peak integration using hnagequant® software (Molecular Dynamics). Unprenylated Rapla is distinguished from prenylated protein by virtue of the greater apparent molecular weight of the prenylated protein. Dose-response curves and EC50 values are generated using 4-parameter curve fits in SigmaPlot software.
EXAMPLE 15
In vivo tumor growth inhibition assay (nude mouse)
In vivo efficacy as an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Examples of such in vivo efficacy studies are described by N. E. Kohl et al. (Nature Medicine, 1:792-797 (1995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci. U.S.A., 91:9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated human Ha- ras or Ki-r<xs (10 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0. The mice in each oncogene group are randomly assigned to a vehicle or compound treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment. Alternatively, the prenyl-protein transferase inhibitor may be administered by a continuous infusion pump. Compound or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle- treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Claims

WHAT IS CLAIMED IS:
1. A compound of the formula A- 1 :
Figure imgf000107_0001
wherein
X1 is (CRla 2)nA1(CRla 2)n;
X2 is (CRlbΛ A2(CRlb 2), P'
Rla and Rl are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, ) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7,
Figure imgf000107_0002
k) (R , 1ι0υ)- 2NC(O)NR 1i0U-,
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted Ci-C6 alkyl, wherein the substituent on the substituted C C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
1 9
A and A are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m,
.10 e) NR10, ) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C _(-"6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) -^IO cycloalkyl, unsubstituted or substituted,
1) C ~C a^enyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-,
P) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-
R .3 ; is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C ~C cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted,
1) C -C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) Cf C-6 alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R6 and R7 are independently selected from:
H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) Cj-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
-R 11 θ)
O
OR 10 f)
O
g) — S(0)mR6a , and
Figure imgf000110_0001
6 7 R and R may be joined in a ring;
R6a is independently selected from: a) C3- cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
>11
O 6) SO2Rπ,
7) N(R10)2; and b) Ci-Cβ alkyl, unsubstituted or substituted with one or more of the following:
1) -Cι_4 alkoxy, 2) aryl or heterocycle,
3) halogen,
4) -OH, • R 11
5,
O and
6) -N(R10)2;
R8 is independently selected from: a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, c) unsubstituted or substituted C2-C6 alkynyl, d) unsubstituted or substituted C3-C10 cycloalkyl, e) unsubstituted or substituted C C4 perfluoroalkyl f) halo, g) R10O-, h) CN,
Figure imgf000111_0001
j) -C(O)NR6R7, k) R10C(O)NR10-,
1) NO2, m) (R10)2NC(O)NR10-, n) R10C(O)-, o) R10OC(O)-,
P) R10OC(O)NR10-, q) N3, r) -N(R10)2, and s) C^Cg alkyl, unsubstituted or substituted by C C
6a
Cl, Br, R10O-, R S(O)m-, -C(O)NR°R', RluC(O)NRlu-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) Cι-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is selected from NH, CH2 or oxygen;
V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) j-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if A1 is S(O)m and n is 0;
W is a heterocycle;
Y is C(O) or NR5;
Z is NR5 or C(O); provided that if Y is C(O), then Z is NR5 and if Y is NR5 then Z is C(O);
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; pis 0, 1,2, 3,4, 5 or 6; ris 0 to 5, provided that r is 0 when V is hydrogen; sis 0,1,2, 3 or 4; tis 0, 1,2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
The compound, according to Claim 1, of formula A:
Figure imgf000113_0001
wherein
X1 is (CRla 2)11A1(CRla2)n;
X2is(CRlb 2)pA2(CRlb 2) 'p>
Rla and Rl are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-;
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-,
P) unsubstituted or su substituted -C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, f) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) ^ ~C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) ^ ~C o cycloalkyl, unsubstituted or substituted,
1) ^ "C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-
R is independently selected from: a) hydrogen, b) halo, c) -- ~C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C ~C cycloalkyl, unsubstituted or substituted, k) -- ~C alkenyl, unsubstituted or substituted, 1) C ~C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) C - alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R6 and R7 are independently selected from:
H, C^Cg alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) Cj-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000116_0001
OR 10 f)
O
g) — S(0)mR6a , and
10 h) N(R )2; or
6 7
R and R may be joined in a ring;
R6a is independently selected from: a) C3_6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5)
O
6) SO2Rπ,
7) N(R10)2; and b) Cj-Cβ alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle, 3) halogen,
4) -OH,
5> Y O R" , and
6) -N(RlO)2;
R8 is independently selected from: a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, c) unsubstituted or substituted C2-C6 alkynyl, d) unsubstituted or substituted C3-C10 cycloalkyl, e) unsubstituted or substituted C C perfluoroalkyl, f) halo, g) R10O-, h) CN, i) R6aS(O)m-, j) -C(O)NR6R7, k) R10C(O)NR10-, 1) NO2, m) (R10)2NC(O)NR10-, n) R10C(O)-, o) R10OC(O)-, p) R10OC(O)NR10-, q) N3, r) -N(R10)2, and s) ^Cg alkyl, unsubstituted or substituted by C C perfluoroalkyl, F, Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, Nv -N(R10)7, and
R^OC^NR10-; R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted C1-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is selected from NH, CH2 or oxygen;
V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) j-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if A1 is S(O)m and n is 0;
W is a heterocycle;
m is 0, 1 or 2; nis 0, 1, 2, 3,4, 5 or 6; pis 0, 1,2, 3, 4, 5 or 6; r is 0 to 5, provided that r is 0 when V is hydrogen; sis 0,1,2, 3 or 4; tis 0, 1,2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
3. The compound, according to Claim 1, of formula A:
Figure imgf000119_0001
wherein
X1 is (CR^nA^CR1^;
X2is(CRl 2)pA2(CRI 2)p;
Rla and Rlb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-;
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-,
P) unsubstituted or su substituted Ci-C alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-,
-N(R10)2, R10OC(O)-, and R10OC(O)NR10-
^ and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, f) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, ) heterocycle, unsubstituted or substituted, g) C 1 -C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) ^ ~C cycl°alkyl, unsubstituted or substituted,
1) C ~C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)N q) R10OC(O) r) -N(R10)2, and s) R10OC(O)NR10-
R >3 is independently selected from: a) hydrogen, b) halo, c) C ~C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) -- ~C cycloalkyl, unsubstituted or substituted, k) C ~C alkenyl, unsubstituted or substituted,
1) C "C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-
R »5 i •s selected from: a) hydrogen, b.) C 1-C6, alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R6 and R7 are independently selected from: H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) Cj-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen,
Figure imgf000122_0001
f) ^0R,°
O
g) — S(0)mR6a , and
h) N(R10)2; or
6 7
R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
Figure imgf000122_0002
7) N(R10)2; and b) Cl-C6 1 alkyl, unsubstituted or substituted with one or more of the following:
1) -Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH,
5) YR" ,
0 and
6) -N(R10)2;
R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C perfluoroalkyl, c) halo,
10 d) R O-, e) -C(O)NR6R7, f) R10C(O)NR10-, g) (R10)2NC(O)NR10-, h) R10C(O)-, i) R10OC(O)-, j) R10OC(O)NR10-, k) -N(R10)2, and
1) j-C8 alkyl, unsubstituted or substituted by C C perfluoroalkyl, F, Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifIuoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
V is selected from: a) heterocycle, b) aryl, and c) j-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, or 3; and z is O or l;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof. The compound, according to Claim 1, of formula B:
(Fftr
Figure imgf000125_0001
wherein
X1 is (CR^A^CR1*^;
X2 is (CRlb 2)pA2(CRl 2)p;
R and R , 1b are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, ) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-,
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted -Cβ alkyl, wherein the substituent on the substituted -Cό alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6 S(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, e) NR10, ) C(O)NR10, g) NR10C(O), h) OC(O), and i) C(O)O;
R2 is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C -C cycloalkyl, unsubstituted or substituted,
1) C -C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-,
P) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and s) R10OC(O)NR10-;
R3 is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted. d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)π j) C -C cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted, 1) C -C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10- n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from:
H, C^Cg alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
.R 11 e)
O
OR 10 f)
O g) -S^R 61 a and
h) N(R10)2; or
6 7 R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Cι_4 alkoxy,
2) aryl or heterocycle,
3) halogen,
Figure imgf000128_0001
6) SO2Rn,
7) N(R10)2; and b) Ci-Cβ alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH,
Figure imgf000129_0001
6) -N(R10)2;
R8 is independently selected from: a) hydrogen, b) unsubstituted or substituted C1-C4 perfluoroalkyl, c) halo,
10 d) R O-, e) -C(O)NR6R7, f) R10C(O)NR10-, g) (R10)2NC(O)NR10-, h) R10C(O)-, and i) j-C8 alkyl, unsubstituted or substituted by C1-C4 perfluoroalkyl, F, τ
Figure imgf000129_0002
R> 1i0U,C~ι,(WO)v-NvmRl100-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N ϊ3,,, --NN((RR 1110U0))N2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
mis 0, 1 or 2; nis 0,1,2, 3,4, 5 or 6; pis 0, 1, 2, 3, 4, 5 or 6; ris 0to5;
•sis 0, 1,2, 3 or 4; tis 0, 1, 2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
The compound, according to Claim 1, of formula B:
Figure imgf000130_0001
wherein
Figure imgf000130_0002
X2 is (CRl 2)pA2(CRl 2)p;
R a and Rlb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-, 1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-, p) unsubstituted or substituted -C6 alkyl, wherein the substituent on the substituted Ci-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R6aS(O)m, halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, and e) NR10,
R is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR10, i) N3,
6ac j) RoaS(O) k) C ~C, 0 cycloalkyl, unsubstituted or substituted,
1) C ~C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-,
Figure imgf000132_0001
p) RI0C(O)NRI0-; q) R10OC(O)-, r) -N(R10)2, and
Figure imgf000132_0002
R is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R 6oaaSc (O) 'm. j) C 3-C 10 cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted, 1) C ~C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-;
R5 is selected from: a) hydrogen, b) C ~Cg alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from:
H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
R 11 e)
O
Figure imgf000133_0001
g) — S(0)mR6a , and
Figure imgf000133_0002
6 7
R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
Figure imgf000134_0001
6) SO2Ru,
7) N(R10)2; and b) Cj-Cg alkyl, unsubstituted < or substituted with one or more of the following:
1) -Ci-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) -OH,
Figure imgf000134_0002
R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C4 perfluoroalkyl, c) halo,
10 d) R O-, and e) j-C6 alkyl, unsubstituted or substituted by CrC perfluoroalkyl, F,
Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
R10OC(O)NR10-;
R10 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) Ci-C6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, and thiazolyl;
mis 0, 1 or 2; nis 0, 1,2, 3,4, 5 or 6; pis 0,1,2, 3,4, 5 or 6; ris 0to5; sis 0,1,2, 3 or 4; tis 0, 1,2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
6. The compound, according to Claim 1, of formula C:
Figure imgf000136_0001
wherein
X1 is (CRla 2)nA1(CRla 2)n;
X2 is (CRl 2)pA2(CRlb 2) 'P'
R > la a . —nd J R n ib are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C3-C10 cycloalkyl, e) R10O-, f) R6aS(O)m-, g) unsubstituted or substituted C2-C6 alkenyl, h) unsubstituted or substituted C2-C6 alkynyl, i) -C(O)NR6R7, j) R10C(O)NR10-, k) (R10)2NC(O)NR10-,
1) R10C(O)-, m) -N(R10) 2, n) R10OC(O)-, o) R10OC(O)NR10-,
P) unsubstituted or substituted C C6 alkyl, wherein the substituent on the substituted Cχ-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10O-, R S(O)B halo, C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10) 2, R10OC(O)-, and R10OC(O)NR10-;
A1 and A2 are independently selected from: a) a bond, b) O, c) C=O, d) S(O)m, and e) NR10,
R2 is independently selected from a) hydrogen, b) CN, c) NO 2' d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) ^ "C y loalkyl, unsubstituted or substituted,
1) C -C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, and
Figure imgf000137_0001
R is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO2, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR10, i) R6aS(O)m, j) C -C cycloalkyl, unsubstituted or substituted, k) C -C alkenyl, unsubstituted or substituted,
1) C -C alkynyl, unsubstituted or substituted, m) (R10)2NC(O)NR10-, n) R10C(O)-, and o) R10C(O)NR10-
R is selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
R and R are independently selected from:
H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C8 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO β) R 11
O
Figure imgf000139_0001
g) — S(0)mR6a , and
h) N(R10)2; or
6 7 R and R may be joined in a ring;
R6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) C1-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5> Y O R" , 6) SO2Rn,
7) N(R10)2; and b) C1-C6 alkyl, unsubstituted or substituted with one or more of the following:
1) -Ci-4 alkoxy, 2) aryl or heterocycle,
3) halogen,
4) -OH,
5) Y • R11
O and
6) -N(Rl )2; R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C perfluoroalkyl, c) halo,
10 d) R O-, and e) j-C8 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, F,
Cl, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and R10OC(O)NR10-;
R1 is independently selected from: a) hydrogen, b) unsubstituted or substituted Cj-C8 alkyl, c) C3-C6 cycloalkyl, d) -Cό perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
11
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
J is CH2 or oxygen;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; pis 0, 1,2, 3,4, 5 or 6; ris 0to5; sis 0,1,2, 3 or 4; tis 0, 1, 2, or 3; and zis Oorl;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
7. The compound, according to Claim 1, selected from:
Figure imgf000141_0001
4-[5-(spiro[3H-indole-3,4'-piperidin]-2(lH)-on- -ylmethyl)imidazol-l- ylmethyljbenzonitrile;
Figure imgf000141_0002
4- { 6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] -2( lH)-on- 1 ' - ylmethyl)imidazol-l-ylmethyl}benzonitrile;
Figure imgf000141_0003
4-{3-(2,2,2-trifluoroethyl)-6-chlorospiro[4H-3,l-benzoxazine-4,4'-piperidin]-2(lH)- on- 1 ' -ylmethyl)imidazol- 1 -ylmethyl }benzonitrile;
Figure imgf000142_0001
4- { 3 -butyl-6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] -2( lH)-on- 1 ' - ylmethyl)imidazol-l-ylmethyl}benzonitrile;
Figure imgf000142_0002
4- { 3-(3 -trifluoromethoxybenzyl)-6-chlorospiro [4H-3 , 1 -benzoxazine-4,4 ' -piperidin] - 2(lH)-on-l '-ylmethyl)imidazol-l-ylmethyl}-benzonitrile;
or a pharmaceutically acceptable salt, hydrate, stereoisomer or optical isomer thereof.
8. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of
Claim 1.
9. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 2.
10. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 3.
11. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 7.
12. A method for inhibiting farnesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
13. A method for inhibiting farnesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 2.
14. A method for inhibiting farnesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 3.
15. A method for inhibiting farnesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 7.
16. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
17. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim
2.
18. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 3.
19. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 7.
20. A method for treating neurofibromen benign proliferative disorder which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
21. A method for treating blindness related to retinal vascularization which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
22. A method for treating infections from hepatitis delta and related viruses which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
23. A method for preventing restenosis which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
24. A method for treating polycystic kidney disease which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
25. A pharmaceutical composition made by combining the compound of Claim 1 and a pharmaceutically acceptable carrier.
26. A process for making a pharmaceutical composition comprising combining a compound of Claim 1 and a pharmaceutically acceptable carrier.
27. A method of conferring radiation sensitivity on a tumor cell using a therapeutically effective amount of a compound of Claim 1 in combination with radiation therapy.
28. A method of treating cancer using a therapeutically effective amount of a compound of Claim 1 in combination with an antineoplastic.
29. A method according to Claim 28 wherein the antineoplastic is paclitaxel.
PCT/US2000/034324 1999-12-21 2000-12-18 Inhibitors of prenyl-protein transferase WO2001045707A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU22741/01A AU2274101A (en) 1999-12-21 2000-12-18 Inhibitors of prenyl-protein transferase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17167499P 1999-12-21 1999-12-21
US60/171,674 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001045707A1 true WO2001045707A1 (en) 2001-06-28

Family

ID=22624708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/034324 WO2001045707A1 (en) 1999-12-21 2000-12-18 Inhibitors of prenyl-protein transferase

Country Status (2)

Country Link
AU (1) AU2274101A (en)
WO (1) WO2001045707A1 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7214676B2 (en) 2001-03-21 2007-05-08 Warner-Lambert Company Llc Spirotricyclic derivatives and their use as phosphodiesterase-7 inhibitors
US7696201B2 (en) 2006-08-15 2010-04-13 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
JP2010527366A (en) * 2007-05-16 2010-08-12 メルク・シャープ・エンド・ドーム・コーポレイション Spiroidalon
US7786141B2 (en) 2004-08-19 2010-08-31 Vertex Pharmaceuticals Incorporated Dihydrospiroindene modulators of muscarinic receptors
US7786107B2 (en) 2006-08-18 2010-08-31 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US7858790B2 (en) 2006-06-29 2010-12-28 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US7863449B2 (en) 2004-11-29 2011-01-04 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US7879834B2 (en) 2004-08-19 2011-02-01 Vertex Pharmaceuticals Incorporated Spiroindoline modulators of muscarinic receptors
US7973162B2 (en) 2007-10-03 2011-07-05 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US8263605B2 (en) 2006-02-22 2012-09-11 Vertex Pharmaceutical Incorporated Modulators of muscarinic receptors
US8304423B2 (en) 2006-02-22 2012-11-06 Vertex Pharmaceutical Incorporated Modulators of muscarinic receptors
WO2020048826A1 (en) * 2018-09-03 2020-03-12 Bayer Aktiengesellschaft 5-substituted 1-oxa-3,9-diazaspiro[5.5]undecan-2-one compounds
JP2020180140A (en) * 2018-03-20 2020-11-05 大日本住友製薬株式会社 Dihydrochromene derivative

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4349549A (en) * 1981-05-18 1982-09-14 Syntex (U.S.A.) Inc. Anti-hypertensive 1-substituted spiro(piperidine-oxobenzoxazine)s
US4558049A (en) * 1982-11-24 1985-12-10 Farmitalia Carlo Erba S.P.A. Antipsycotic benzoxazines

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4349549A (en) * 1981-05-18 1982-09-14 Syntex (U.S.A.) Inc. Anti-hypertensive 1-substituted spiro(piperidine-oxobenzoxazine)s
US4558049A (en) * 1982-11-24 1985-12-10 Farmitalia Carlo Erba S.P.A. Antipsycotic benzoxazines

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7214676B2 (en) 2001-03-21 2007-05-08 Warner-Lambert Company Llc Spirotricyclic derivatives and their use as phosphodiesterase-7 inhibitors
US8497295B2 (en) 2004-08-19 2013-07-30 Vertex Pharmaceuticals Incorporated Spiroindoline modulators of muscarinic receptors
US7786141B2 (en) 2004-08-19 2010-08-31 Vertex Pharmaceuticals Incorporated Dihydrospiroindene modulators of muscarinic receptors
US7879834B2 (en) 2004-08-19 2011-02-01 Vertex Pharmaceuticals Incorporated Spiroindoline modulators of muscarinic receptors
US8367691B2 (en) 2004-08-19 2013-02-05 Vertex Pharmaceutical Incorporated Modulators of muscarinic receptors
EP2374455A3 (en) * 2004-08-19 2012-03-28 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US8258148B2 (en) 2004-08-19 2012-09-04 Vertex Pharmaceutical Incorporated Spiroindoline modulators of muscarinic receptors
US7863449B2 (en) 2004-11-29 2011-01-04 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US8304423B2 (en) 2006-02-22 2012-11-06 Vertex Pharmaceutical Incorporated Modulators of muscarinic receptors
US8263605B2 (en) 2006-02-22 2012-09-11 Vertex Pharmaceutical Incorporated Modulators of muscarinic receptors
US7858790B2 (en) 2006-06-29 2010-12-28 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US7696201B2 (en) 2006-08-15 2010-04-13 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
US7786107B2 (en) 2006-08-18 2010-08-31 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
JP2010527366A (en) * 2007-05-16 2010-08-12 メルク・シャープ・エンド・ドーム・コーポレイション Spiroidalon
US7973162B2 (en) 2007-10-03 2011-07-05 Vertex Pharmaceuticals Incorporated Modulators of muscarinic receptors
JP2020180140A (en) * 2018-03-20 2020-11-05 大日本住友製薬株式会社 Dihydrochromene derivative
JP7247144B2 (en) 2018-03-20 2023-03-28 住友ファーマ株式会社 Dihydrochromene derivative
WO2020048826A1 (en) * 2018-09-03 2020-03-12 Bayer Aktiengesellschaft 5-substituted 1-oxa-3,9-diazaspiro[5.5]undecan-2-one compounds

Also Published As

Publication number Publication date
AU2274101A (en) 2001-07-03

Similar Documents

Publication Publication Date Title
US6358985B1 (en) Inhibitors of prenyl-protein transferase
EP1324985A1 (en) Inhibitors of prenyl-protein transferase
US6284755B1 (en) Inhibitors of prenyl-protein transferase
US20020052380A1 (en) Inhibitors of prenyl-protein transferase
US20020010184A1 (en) Inhibitors of prenyl-protein transferase
US6441017B1 (en) Inhibitors of prenyl-protein transferase
US6350755B1 (en) Inhibitors of prenyl-protein transferase
WO2001017992A1 (en) Inhibitors of prenyl-protein transferase
WO2001045707A1 (en) Inhibitors of prenyl-protein transferase
US6329376B1 (en) Inhibitors of prenyl-protein transferase
US6632818B2 (en) Inhibitors of prenyl-protein transferase
US6525074B2 (en) Inhibitors of prenyl-protein transferase
WO2002060868A2 (en) Inhibitors of prenyl-protein transferase
US6316436B1 (en) Inhibitors of prenyl-protein transferase
US6566385B2 (en) Inhibitors of prenyl-protein transferase
US6610722B2 (en) Inhibitors of prenyl-protein transferase
WO2002079147A2 (en) Inhibitors of prenyl-protein transferase
US6413964B1 (en) Inhibitors of prenyl-protein transferase
AU762440B2 (en) Inhibitors of prenyl-protein transferase
WO2001045704A1 (en) Inhibitors of prenyl-protein transferase
US20040110764A1 (en) Inhibitors of prenyl-protein transferase
US20020022633A1 (en) Inhibitors of prenyl-protein transferase
WO2002078702A1 (en) Inhibitors of prenyl-protein transferase
US6534506B2 (en) Inhibitors of prenyl-protein transferase
WO2002020015A1 (en) Inhibitors of prenyl-protein transferase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP