WO2001023554A1 - The prv-1 gene and use thereof - Google Patents

The prv-1 gene and use thereof Download PDF

Info

Publication number
WO2001023554A1
WO2001023554A1 PCT/EP2000/009594 EP0009594W WO0123554A1 WO 2001023554 A1 WO2001023554 A1 WO 2001023554A1 EP 0009594 W EP0009594 W EP 0009594W WO 0123554 A1 WO0123554 A1 WO 0123554A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
amino acids
nucleotides
polypeptide
prv
Prior art date
Application number
PCT/EP2000/009594
Other languages
German (de)
French (fr)
Inventor
Heike Pahl
Original Assignee
Universitätsklinikum Freiburg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL14877000A priority Critical patent/IL148770A0/en
Priority to KR1020027004095A priority patent/KR20020047191A/en
Priority to SK426-2002A priority patent/SK4262002A3/en
Priority to PL00354184A priority patent/PL354184A1/en
Priority to EP00972665A priority patent/EP1220920A1/en
Priority to JP2001526936A priority patent/JP2003510077A/en
Priority to EA200200286A priority patent/EA200200286A1/en
Priority to HU0203080A priority patent/HUP0203080A2/en
Application filed by Universitätsklinikum Freiburg filed Critical Universitätsklinikum Freiburg
Priority to AU11324/01A priority patent/AU1132401A/en
Priority to BR0014444-4A priority patent/BR0014444A/en
Priority to EEP200200168A priority patent/EE200200168A/en
Priority to CA002387702A priority patent/CA2387702A1/en
Priority to MXPA02002800A priority patent/MXPA02002800A/en
Publication of WO2001023554A1 publication Critical patent/WO2001023554A1/en
Priority to NO20021498A priority patent/NO20021498L/en
Priority to BG106554A priority patent/BG106554A/en
Priority to HR20020269A priority patent/HRP20020269A2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/04Antipruritics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/06Antigout agents, e.g. antihyperuricemic or uricosuric agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/10Antioedematous agents; Diuretics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the invention relates to a nucleotide sequence which encodes the PRV-1 gene, recombinant DNA which contains this nucleotide sequence, vectors which contain the recombinant DNA and cells transformed therewith, and a PRV-1 polypeptide, antibodies against this polypeptide, process for Detection of the PRV-1 polypeptide and medicament containing the PRV-1 polypeptide or antibodies directed against the PRV-1 polypeptide.
  • Polycythemia rubra vera also known as polycythemia vera or P. vera
  • P. vera is a malignant hematological disease in which there is an increased formation of erythroid, granulocytic and megakaryocytic cells.
  • the disease is of clonal origin and arises from mutation of a single hematopoietic progenitor cell.
  • the incidence of P. vera is 4 to 6 per million inhabitants in Germany. If left untreated, the disease leads to death within 18 months. Treatment by bloodletting or chemotherapy extends the average survival to over 13 years.
  • P. vera is diagnosed using clinical criteria.
  • the clinical picture includes headache, pruritus, splenomegaly in two thirds of the patients, bleeding or thrombosis, high blood pressure in one third of the patients, gout caused by increased uric acid production and in some cases septic ulcers.
  • the most important laboratory finding is an increase in the values for hemoglobin, hematocrit, erythrocyte count and total erythrocyte volume as well as neutrophil granulocytosis or thrombocytosis in many cases. Since on the one hand most of the criteria are rather diffuse and on the other hand not all patients meet these criteria, it is often difficult to differentiate P.
  • PRV-1 gene Polycythemia rubra vera
  • An object of the invention is therefore a polynucleotide which codes for the PRV-1 gene and essentially comprises the sequence ID No. 1.
  • the polynucleotides of the present invention can be single or double stranded DNA or RNA. If it is RNA, it is clear to the person skilled in the art that "U” nucleotides are present instead of “T” nucleotides.
  • “Polynucleotide” means nucleic acids with 15 or more nucleotides.
  • the nucleotide sequence according to the invention is shown in FIG. 1.
  • the invention therefore relates to a polynucleotide which corresponds to the sequence in FIG. 1 and a polynucleotide whose nucleotide sequence has slight deviations (variant).
  • minor deviations mean those sequences in which a few, preferably no more than 50 and particularly preferably no more than 25 nucleotides can be exchanged, but the function of the gene encoded by the nucleotide sequence is not affected.
  • a base triplet coding for an amino acid can be replaced by another triplet which codes for the same amino acid.
  • less important areas can be slightly deleted and / or mutated.
  • the polynucleotide comprises nucleotides 36 to 1346 of sequence no. 1, that is to say the coding region of the PRV-1 gene. Further embodiments include nucleotides 36 to 1262 and 36 to 1238 of sequence No. 1. This area presumably codes for the active area of the PRV-1 polypeptide.
  • the polynucleotide of the invention may also include nucleotides 39 to 1346, 39 to 1262 or 39 to 1238 of sequence # 1 so that the codon encoding the start methionine is not included.
  • a preferred embodiment is a polynucleotide comprising nucleotides 99 to 1346, 99 to 1262 or 99 to 1238 of sequence # 1. The codons at the 5 'end which code for the signal peptide of the PRV-1 polypeptide are therefore not included.
  • the polynucleotide according to the invention can also be a fragment of the PRV-1 gene.
  • the fragment usually has more than 100 nucleotides, but preferably more than 300 nucleotides.
  • the fragments can also be used as primers or as probes, in particular for the PCR, in which case the fragments can be shortened according to the purpose.
  • primers are between 10 and 30 nucleotides in length and probes are between 15 and 50 nucleotides in length.
  • the PRV-1 gene is an endogenous gene, but is only expressed in a few organs in healthy individuals. It is usually expressed mainly in the hematopoietic organs, ie in the bone marrow and fetal liver, and weakly in the spleen, but not in the heart, muscle, pancreas or kidney. In patients who under P. vera suffer, this gene is very overexpressed, especially in the hematopoietic cells.
  • the PRV-1 gene codes for a protein which has the protein sequence shown in FIG. 2.
  • the signal peptide which is contained in the protein sequence of all surface molecules and is usually removed during processing of the protein, is separated by a hyphen.
  • the protein has the sequence ID No. 2.
  • a further aspect of the invention is therefore an essentially pure polypeptide of sequence No. 2 or a polypeptide of sequence No. 2 in which the signal peptide is not present (amino acids 22 to 437 of sequence No. 2). Further embodiments include amino acids 1 to 409, 22 to 409, 1 to 401 or 22 to 401 of sequence No. 2 (presumably active region of the protein).
  • the polypeptide according to the invention is preferably glycosylated, most preferably it is N-glycosylated. It can then be glycosylated on at least one of the amino acids Asn-46, Asn-189 and Asn-382 of the PRV-1 polypeptide (the amino acid numbers relate to sequence No. 2).
  • the invention also includes fragments of the polypeptides according to the invention which are N-glycosylated. The fragments are at least 50 amino acids long, preferably at least 100 amino acids, most preferably at least 150 amino acids.
  • the polypeptide can be O-glycosylated.
  • the PRV-1 polypeptide can, for example, have a glycosylphosphatidylinositol anchor due to its production. This is then bound to the amino acids which correspond to amino acids 407 to 409 of sequence ID no. 2.
  • a GPI anchor is used to anchor a protein to the outside of the cell membrane using a lipid.
  • GPI-linked proteins are also released into the medium.
  • shedding It has not yet been clarified whether this is a specific process, that is, such proteins are released from the membrane by enzymes in a controlled manner, or whether it is an unspecific loss of the anchor. It is therefore very likely that PRV-1 can be found both on the cell membrane and extracellularly.
  • the secreted, non-membrane-bound form is probably more important for the effect as a growth factor and growth inhibitor, since it can diffuse as a growth factor and reach other cells.
  • the gene codes for a surface receptor of the uPAR / Ly6 family. This family of receptors can produce mitogenic signals, i.e. Transmit signals that stimulate cell division. It is therefore believed that overexpression of the PRV-1 gene, including on the bone marrow cells of P. vera patients, contributes to hyperproliferation of these cells.
  • the polypeptide encoded by the PRV-1 gene is generated in a suitable manner from recombinant DNA, the recombinant DNA preferably having the nucleotide sequence ID No. 1 or at least the coding region of the PRV-1 Gene, ie nucleotides 36 to 1346 of sequence ID No. 1, or at least nucleotides 39 to 1262 or 39 to 1238, functionally linked to a promoter.
  • the recombinant DNA can also comprise only a fragment of sequence No. 1.
  • Another object of the invention is a vector which contains the recombinant DNA for the PRV-1 polypeptide or a fragment thereof, and a host cell transfected or transformed with this vector.
  • the host cells can be prokaryotic, for example bacteria such as E. coli. However, non-glycosylated polypeptides are expressed. Eukaryotic host cells which can post-translationally glycosylate and otherwise modify the expressed protein are therefore preferred. Examples of eukaryotic host cells are insect cells such as Sf9 cells for expression after infection with recombinant baculoviruses, mammalian cells such as 293 cells, COS cells, CHO cells, HeLa cells. These examples are not exhaustive. Yeast cells are also possible as host cells.
  • glycosylation pattern can differ depending on the host cell.
  • the biological activity of the expression product can thus also vary. Host cells which glycosylate the expression product in such a way that the biological activity of the protein is retained are particularly preferred.
  • Another aspect of the invention is a method for producing a polypeptide according to the invention.
  • a DNA coding for the polypeptide according to the invention is brought to expression in a host cell. Depending on whether that expressed polypeptide is secreted from the host cell into the culture medium or remains in the cell, the culture medium or the cells are used for the further recovery of the polypeptide.
  • the polypeptide according to the invention is then enriched or purified by methods known in the art, for example chromatographic methods. Methods of protein purification are described, for example, in Scopes, R., Protein Purification: Principles and Practice (3rd edition), Springer Verlag (1994).
  • the method according to the invention comprises a step in which glycosylated polypeptide is enriched or purified.
  • This step can take place before the polypeptide according to the invention has been essentially purified or after it has already been essentially purified. In the latter case, the glycosylated portion of the purified polypeptide is then separated off and recovered. In the most preferred embodiment of the method, specifically N-glycosylated polypeptide is obtained. In a further embodiment of the method, polypeptide is obtained which is glycosylated on at least one of the amino acids Asn-46, Asn-189 and Asn-382 of sequence No. 2.
  • the PRV-1 polypeptide obtained from granulocytes or recombinantly produced can be used both for the diagnosis of polycythemia vera and for the treatment of the disease.
  • an "antisense” RNA molecule that is an RNA that is complementary to the PRV RNA. Since the PRV-1 RNA initially has the sequence 5 '-AAAAGCAGAAAGAGATTACCAGCC-3' (Seq. ID-No. 3), the required antisense RNA against this sequence would have the following nucleotide sequence: 5'-GGCTGGTAATCTCTTTCTGCTTTT-3 '(Seq. ID-No. 4). This antisense RNA is inserted into a vector and introduced into P. vera cells.
  • This RNA is introduced, for example, via transfection, the one used for the transfection Vector is preferably designed so that it is specifically introduced into the P. vera cells.
  • the expression of the antisense RNA means that the PRV-1 mRNA can no longer be translated into a polypeptide. No PRV-1 protein is then produced in cells treated in this way.
  • Another object of the invention is therefore a method for the detection of P. vera, which is characterized in that the PRV-1 polypeptide or an epitope thereof is detected and the extent of expression is determined.
  • the detection is suitably carried out with an immunoassay using antibodies which are directed against the PRV-1 receptor.
  • the known variants of immunoassays are suitable as test methods, in which specific antibodies are used for the PRV-1 poly ⁇ eptide together with other labeled antibodies, which can be immobilized or in solution.
  • the marking can take place in a manner known per se, e.g. with radioactive isotopes, through fluorescence or luminescence, with enzymes, through color-forming reactions or other groups suitable for determination.
  • ELISA tests are particularly preferred.
  • the antibodies required for the specific detection of the PRV-1 receptor can also be produced in a manner known per se. Both monoclonal and polyclonal antibodies are suitable, the use of monoclonal antibodies being preferred.
  • Protein derived peptides can be used.
  • the polyclonal antibodies are usually generated by immunizing a suitable host (rabbit) with the PRV-1 polypeptide, optionally bound to an immunological carrier (adjuvant), and eliciting an immune response.
  • Monoclonal antibodies can be generated in a manner known per se using the hybridoma technique.
  • the antibodies can be purified by affinity purification. The production and purification of antibodies are described, for example, in "Antibodies: A Laboratory Manual” by Harlow and Lane, Cold Spring Harbor Laboratory Press.
  • polyclonal or monoclonal antibodies directed against PRV-1 can also be used for the therapy of the disease.
  • the PRV-1 receptor can be detected using an RT-PCR method.
  • RNA is first isolated from the PRV-1 overexpressing cells, usually granulocytes. Then reverse transcription is carried out in a manner known per se using an RT primer.
  • the RT primer is preferably a primer with the following nucleotide sequence (SEQ ID No. 7)
  • This DNA is then amplified in a PCR reaction in a manner known per se.
  • the following two primers are preferably used for the amplification cycles.
  • Antisense primer SEQ ID-No. 9
  • the PCR signal is only positive in those cases in which the PRV-1 gene is also expressed. As stated above, this is only the case if the patient has P. vera. PRV expression does not occur in the granulocytes in healthy patients. The absence of an RT-PCR signal indicates that there is no P. vera.
  • the quantification in the RT-PCR method is preferably carried out using TaqMan e technology. In addition to primers, a "sample” is also required for this quantification.
  • the preferred sequence of the "probe” is 5 '-TTCTTGTTGAACCACACCAGACAAATCGG-3'
  • a blotting method preferably a Northern blot
  • the RNA is isolated from granulocytes and then blotted, e.g. Northern blot, examined for the expression of PRV-1.
  • the cDNA sequence of SEQ ID No. 1 or a section of the sequence can be used as a probe.
  • Hybridization only occurs if the granulocytes come from a patient with P. vera, since only then is there an expression on the granulocytes. The absence of hybridization indicates that the person from whom the granulocytes are derived has no P. vera.
  • a fragment of the gene can also be used for Northern blot hybridization.
  • One such fragment is usually more than 100 bases long, preferably more than 300 bases long.
  • various different fragments of the gene can be produced which can be used as probes in the Northern blot. If the fragments originate from the cDNA, they are present as double strands, which have to be separated into the single strands for hybridization. Suitable examples are the Bam HI-Pstl fragment from base pair 420 to base pair 831 or the Pstl-Pstl fragment ent from base pair 831 to base pair 1900.
  • the detection of PRV-1 mRNA and thus the PRV-1 expression can also be carried out by first transversely transcribing the mRNA in an RT-PCR reaction and then amplifying the cDNA and then amplifying the DNA with a probe in a hybridization process is detected.
  • the invention therefore furthermore relates to a medicament which, in addition to conventional carriers, contains antibodies directed against the PRV-1 receptor.
  • the PRV-1 polypeptide has hematopoietic activity.
  • the PRV-1- Polypeptide is able to stimulate certain hematopoietic progenitor cells to form erythroid colonies.
  • the N-glycosylated polypeptides of PRV-1 in particular have this function.
  • the N-glycosylated PRV-1 polypeptides and fragments thereof which have the growth factor activity are preferred.
  • Another aspect of the invention is therefore a medicament which, in addition to a pharmaceutically acceptable carrier, contains the PRV-1 polypeptide or a biologically active fragment thereof. It is preferably a glycosylated PRV-1 polypeptide, more preferably an N-glycosylated PRV-1 polypeptide or a biologically active fragment thereof.
  • the invention also relates to medicaments which contain at least one polynucleotide according to the invention.
  • the present invention further relates to the use of PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof as a growth factor in vivo and ex vivo.
  • the PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof can be used to treat all pan-cytopenias and pan-cytopathies in the bone marrow and in the circulation (change in the cellular components of the peripheral blood and the bone marrow).
  • the polypeptides of the present invention can be used, for example, for the treatment of anemia with kidney failure, chemotherapy or whole body radiation, for the treatment of neutropenia and thrombocytopenia under chemotherapy or whole body radiation, for the ex vivo treatment of peripheral or bone marrow stem cells for expansion (reproduction) and retransfusion in the Patients, and for the treatment of sepsis, "systemic inflammatory response syndrome" (SIRS) or regional inflammatory response.
  • SIRS systemic inflammatory response syndrome
  • the polypeptides of the present invention or medicaments containing them can be applied in various ways.
  • the dosage forms include intravenous, intramuscular, subcutaneous, intraperitoneal, oral, transdermal and transmucosal administration.
  • the polynucleotides according to the invention can also be used for the treatment of pan-cytopenias and pan-cytopathies.
  • the aim is the expression of a PRV-1 polypeptide or a functional fragment thereof in cells of the patient concerned.
  • gene therapy procedures are used.
  • Cells from the patient can be isolated and transfected with a polynucleotide according to the invention (ex vivo manipulation) in order to then be returned to the patient.
  • Methods are also conceivable in which the polynucleotides according to the invention reach the target cells by viral transfer. Expression of the introduced nucleic acids then leads to hematopoietic activity.
  • the PRV-1 polypeptide in higher concentration has an inhibitory effect on the growth of cells.
  • PRV-1 protein practically completely prevented the formation of erythroid and granulocytic / monocytic colonies.
  • This effect is similar to the effect of interferon- ⁇ , which is used therapeutically in chronic myeloid leukemia (CML) and in P. vera.
  • CML chronic myeloid leukemia
  • a body's inhibitory substance has great advantages over a chemical cytostatic like
  • the present invention provides a hematopoiesis-inhibiting substance, the inhibitory activity being concentration-dependent.
  • Another aspect of the invention is therefore the use of a PRV-1 polypeptide described in this application for inhibiting the growth of cells, in particular the use as a cytostatic.
  • the polypeptide is preferably used to inhibit the growth of hematopoietic cells.
  • the invention also relates to the use of a polypeptide according to the invention for the manufacture of a medicament for the treatment of proliferative diseases.
  • diseases are in particular myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML and all leukemias and lymphomas as well as solid tumors.
  • Another aspect of the invention is the use of a polynucleotide described in this application, a biologically active fragment or a biologically active variant thereof to inhibit the growth of cells.
  • the polynucleotide can be incorporated into a suitable vector and transfected into suitable target cells. After expression of the PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof in an appropriate concentration, the growth-inhibiting effect comes into play.
  • the polynucleotide can also be incorporated into a viral vector, after which corresponding target cells are infected virally, which leads to the expression of PRV-1.
  • the invention also relates to the use of a polynucleotide of this application for the manufacture of a medicament for the treatment of proliferative diseases such as e.g. the myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML as well as all leukaemias and lymphomas as well as solid tumors.
  • proliferative diseases such as e.g. the myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML as well as all leukaemias and lymphomas as well as solid tumors.
  • kits for the detection of either polycythemia vera or disorders of the hematopoietic system contain a polynucleotide according to the invention and / or a polypeptide according to the invention and / or one or more antibodies according to the invention.
  • the kit can also contain a container or compositions that are used for Carrying out detection reactions are included. Examples of such compositions are buffer solutions, reagents for blocking membranes, hybridization solutions, secondary antibodies,
  • the kit is preferably used to carry out PCR reactions, RT-PCR, Northern blots, Southern blots, Western blots, ELISA, RIA or similar reactions.
  • the approach separated into two phases.
  • the upper bright phase was removed and centrifuged for 10 minutes at 1800 g and RT.
  • the cells were centrifuged at 1800 g and RT for 10 minutes.
  • the cell pellet contained 95-99% pure granulocytes.
  • PRV-1 has growth factor activity
  • Embryos were removed from a pregnant mouse on day 13.5 after fertilization.
  • the fetal livers were removed.
  • the cells contained therein were stained with antibodies and enriched for certain cells by column chromatography and depleted for other cell types.
  • the result is a cell mixture that is enriched for certain hematopoietic progenitor cells (so-called colony forming units-erythroid, CFU-E).
  • CFU-E colony forming units-erythroid
  • 293 T cells are one established human embryonic kidney cell line. 293 T cells are stably transfected with several genes of a retrovirus. If these 293-T cells are transfected with two plasmids called pOS and pKAT, the 293-T cells produce a retrovirus that can infect murine fetal liver cells. If the 293 T cells are transfected with an empty pOS vector and pKAT, a "wild type" retrovirus is produced which only expresses retroviral proteins.
  • a human gene has been cloned into the pOS vector, for example PRV-1
  • a retrovirus is produced which, when it has infected cells, expresses this protein.
  • the retrovirus is secreted by the 293 T cells into the cell culture medium.
  • the cell culture medium of the transfected 293 T cells which contains the retrovirus, is harvested and filtered once through a 0.45 ⁇ m filter.
  • these cells are mixed with the filtered cell culture medium which contains the retrovirus and centrifuged for 2 hours at 1800 rpm, 20 ° C. with the addition of polybrene.
  • the transfected fetal liver cells are then cultivated in a medium (Methocult, from Cell Systems) which, in addition to the usual salts and amino acids, fetal calf serum, 0.0001-0.4 IU / ml erythropoietin (EPO) and methyl cellulose (0, 8%) contains.
  • a medium Metalhocult, from Cell Systems
  • the EPO requires the CFU-E to form hematopoietic colonies.
  • the methyl cellulose makes the medium jelly-like, and it is possible to fix individual cells in this jelly so that, unlike in a liquid medium, they cannot move. It can therefore be observed whether or not a hematopoietic colony is formed from a single cell.
  • CFU-It form erythroid colonies, i.e. colonies that contain red blood cells and their progenitor cells.
  • GFP a non-hematopoietically active protein.
  • Approach 4 Cells transfected with pOS-PRV-1 (vector + gene according to the invention).
  • Table 1 The results of three tests carried out as described are shown. The numbers indicate the number of colonies.
  • the "packaging cell line”, 293-T produces a retrovirus not only after transfection with the pOS and pKAT vectors.
  • the 293 T cells also synthesize the protein encoded by the gene cloned in pOS, in this case PRV-1. Is the gene product a soluble protein, it is secreted into the medium surrounding the "packaging cell line", 293-T. If the 293 T cells are transfected only with the pOS vector, without pKAT, no retroviruses are produced.
  • the cell culture medium then contains only the soluble protein produced by the cells.
  • Medium from pOS-PRV-1 transfected cells, without retrovirus, is mixed with CFU-Es, and plated out in the methyl cellulose medium and the colonies formed are counted.
  • Table 2 Solubility of PRV-1. The numbers indicate the number of colonies.
  • PRV-1 also has inhibitory, cytostatic effects.
  • peripheral blood cells Since a small number of progenitor cells circulate in peripheral blood even in healthy people, hematopoietic colonies can be grown from peripheral blood cells in a suitable medium (methyl cellulose).
  • a suitable medium methyl cellulose.
  • 40 ml of peripheral venous blood was taken from a healthy donor (with the presentation of heparin or EDTA as an anti-coagulant).
  • 15 ml of Ficoll / Hypaque were added to the blood and centrifuged at 1600 rpm without brake for 40 minutes. This creates a density gradient that separates the blood into its cellular components.
  • the so-called "mononuclear cells”, among which the stem cells are located, can be found after centrifugation on the interphase between serum and Ficoll. This interphase was removed, washed in PBS (isotonic saline). This results in purified mononuclear cells in which there are approximately 0.1% hematopoietic stem cells.
  • the mononuclear cells were taken up in a particularly rich medium (IMDM) containing 3% FCS (fetal calf serum). This 3% FCS / IMDM also contained the modifications, which means that it was either PRV-1 or not.
  • IMDM particularly rich medium
  • FCS fetal calf serum
  • IMDM mononuclear cells in IMDM were added at a density of 7 ⁇ 10 5 cells / ml to a commercially available medium from Stem Cell Technologies (Methocult), which contains IMDM and 30% FCS, 1% BSA (Bovine Serum Albumin), mercaptoethanol,
  • a cell line was also constructed that expresses a very high amount of PRV-1.
  • the PRV-1 which is produced by these cells, is modified in such a way that it no longer has a lipid anchor.
  • the expression product consists of amino acids 1-401 of the sequence SEQ ID NO: 2, so amino acids 402-437 are missing.
  • This modified PRV-1 is therefore not, like wild-type PRV-1, built into the cell membrane by means of a lipid anchor, but is completely secreted from the cells.
  • the cell line was as in example
  • the growth factor PRV-1 is N-glycosylated
  • Granulocytes were isolated from a patient with P. vera and protein extracts were prepared from these cells using the standard protocol. These protein extracts were treated according to the protocol of the "N-Glycosidase F Deglycosylation Kit” from Boehringer Mannheim. Specifically, this means that the protein extracts were mixed with a "denaturing buffer", heated for 3 minutes at 95 ° C. and then either only with “reaction buffer” or with “reaction buffer” plus N-glycosidase were added. The mixture was incubated at 37 ° C. overnight and the proteins were analyzed on a PAGE gel electrophoresis with subsequent Western blot. The PRV-1 protein was raised with an antibody against a protein with the amino acid sequence ID-No. 5 detected.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Pain & Pain Management (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Neurosurgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Dermatology (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Communicable Diseases (AREA)
  • Cardiology (AREA)
  • Rheumatology (AREA)
  • Endocrinology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a necleotide sequence which codes for the PRV-1 protein and which essentially comprises the ID sequence N°.1. The invention also relates to a method for detecting this gene and the mRNA and the polypeptide that are coded for by this gene.

Description

Das Gen PRV-1 und dessen Verwendung The PRV-1 gene and its use
Beschreibungdescription
Die Erfindung betrifft eine Nucleotidsequenz, die das PRV-1- Gen codiert, rekombinante DNA, die diese Nucleotidsequenz enthält, Vektoren, die die rekombinante DNA enthalten und damit transformierte Zellen, sowie ein PRV-1-Polypeptid, Antikörper gegen dieses Polypeptid, Verfahren zum Nachweis des PRV-1-Polypeptids und Arzneimittel enthaltend das PRV-1- Polypeptid oder gegen das PRV-1-Polypeptid gerichtete Antikörper .The invention relates to a nucleotide sequence which encodes the PRV-1 gene, recombinant DNA which contains this nucleotide sequence, vectors which contain the recombinant DNA and cells transformed therewith, and a PRV-1 polypeptide, antibodies against this polypeptide, process for Detection of the PRV-1 polypeptide and medicament containing the PRV-1 polypeptide or antibodies directed against the PRV-1 polypeptide.
Die Polycythaemia rubra vera, auch als Polycythaemia vera oder P. vera bezeichnet, ist eine maligne hämatologische Erkrankung, bei der eine vermehrte Bildung erythroider, granulozytärer und megakaryozytärer Zellen vorliegt. Die Erkrankung ist klonalen Ursprungs und entsteht durch Mutation einer einzigen hämatopoietischen Vorläuferzelle. Die Inzidenz der P. vera beträgt 4 bis 6 pro Million Einwohner in Deutschland. Unbehandelt führt die Krankheit innerhalb von 18 Monaten zum Tod. Eine Behandlung durch Aderlässe oder Chemotherapie verlängert die durchschnittliche Überlebensdauer auf über 13 Jahre.Polycythemia rubra vera, also known as polycythemia vera or P. vera, is a malignant hematological disease in which there is an increased formation of erythroid, granulocytic and megakaryocytic cells. The disease is of clonal origin and arises from mutation of a single hematopoietic progenitor cell. The incidence of P. vera is 4 to 6 per million inhabitants in Germany. If left untreated, the disease leads to death within 18 months. Treatment by bloodletting or chemotherapy extends the average survival to over 13 years.
Die Diagnose der P. vera erfolgt über klinische Kriterien. Zum klinischen Bild gehören Kopfschmerzen, Pruritus, Splenomegalie bei zwei Drittel der Patienten, Blutungen oder Thrombosen, Bluthochdruck bei einem Drittel der Patienten, Gicht, ausgelöst durch gesteigerte Harnsäureproduktion und in manchen Fällen septische Ulcera. Der wichtigste Laborbefund ist eine Erhöhung der Werte für Hämoglobin, Hämatokrit, Erythrozytenzahl und Erythrozytengesamtvolumen sowie eine neutrophile Granulozytose oder Thrombozytose in vielen Fällen. Da einerseits die meisten Kriterien eher diffus sind und andererseits nicht alle Patienten diese Kriterien erfüllen, ist es häufig schwierig, die P. vera von anderen myeloproliferativen Erkrankungen, wie chronischer myeloischer Leukämie, oder essentieller Thrombozytämie, abzugrenzen und damit die Diagnose zu sichern. Die molekulare Ursache der P. vera ist bisher vollkommen unbekannt. Da aber die P. vera, wenn sie nicht behandelt wird, einen schweren Verlauf nimmt, ist eine genaue Diagnose wichtig.P. vera is diagnosed using clinical criteria. The clinical picture includes headache, pruritus, splenomegaly in two thirds of the patients, bleeding or thrombosis, high blood pressure in one third of the patients, gout caused by increased uric acid production and in some cases septic ulcers. The most important laboratory finding is an increase in the values for hemoglobin, hematocrit, erythrocyte count and total erythrocyte volume as well as neutrophil granulocytosis or thrombocytosis in many cases. Since on the one hand most of the criteria are rather diffuse and on the other hand not all patients meet these criteria, it is often difficult to differentiate P. vera from other myeloproliferative diseases such as chronic myeloid leukemia or essential thrombocytemia and thus to ensure the diagnosis. The molecular cause of P. vera is so far completely unknown. However, since P. vera takes a severe course if it is not treated, an accurate diagnosis is important.
Eine Aufgabe der Erfindung war es daher, die molekulare Ursache der Polycythaemia rubra vera aufzufinden und eine Möglichkeit zu ihrer Diagnose zu schaffen.It was therefore an object of the invention to find the molecular cause of polycythemia rubra vera and to provide a means of diagnosing it.
Diese Aufgabe wurde gelöst, indem ein Gen isoliert wurde, das spezifisch bei P. vera und nicht bei gesunden Kontrollen exprimiert wird. Dieses Gen wird als PRV-1-Gen (Polycythaemia rubra vera) bezeichnet.This problem was solved by isolating a gene that is specifically expressed in P. vera and not in healthy controls. This gene is called the PRV-1 gene (Polycythemia rubra vera).
Eine ähnliche Nucleotidsequenz wird in der internationalen Anmeldung WO 98/50552 offenbart.A similar nucleotide sequence is disclosed in international application WO 98/50552.
Ein Gegenstand der Erfindung ist daher ein Polynucleotid, das für das PRV-1-Gen codiert und im wesentlichen die Sequenz ID Nr. 1 umfaßt. Die Polynucleotide der vorliegenden Erfindung können einzel- oder doppelsträngige DNA oder RNA sein. Falls es sich um RNA handelt, ist dem Fachmann klar, daß anstelle von "T"-Nucleotiden "U"-Nucleotide vorliegen. Unter "Polynucleotid" sind Nucleinsäuren mit 15 oder mehr Nucleotiden zu verstehen.An object of the invention is therefore a polynucleotide which codes for the PRV-1 gene and essentially comprises the sequence ID No. 1. The polynucleotides of the present invention can be single or double stranded DNA or RNA. If it is RNA, it is clear to the person skilled in the art that "U" nucleotides are present instead of "T" nucleotides. “Polynucleotide” means nucleic acids with 15 or more nucleotides.
Die erfindungsgemäße Nucleotidsequenz ist in Figur 1 wiedergegeben. Gegenstand der Erfindung ist daher ein Polynucleotid, das der Sequenz von Figur 1 entspricht, sowie ein Polynucleotid, dessen Nucleotidsequenz geringfügige Abweichungen aufweist (Variante) . Unter geringfügigen Abweichungen werden im Sinne der vorliegenden Anmeldung solche Sequenzen verstanden, bei denen einige wenige, vorzugsweise nicht mehr als 50 und besonders bevorzugt nicht mehr als 25 Nucleotide ausgetauscht sein können, wobei jedoch die Funktion des durch die Nucleotidsequenz kodierten Gens nicht berührt wird. Dem Fachmann ist bekannt, daß ein für eine Aminosäure kodierendes Basentriplett durch ein anderes Triplett ersetzt werden kann, das für dieselbe Aminosäure kodiert. Darüber hinaus können weniger wichtige Bereich geringfügig deletiert und/oder mutiert sein. In einer besonderen Ausführungsform umfaßt das Polynucleotid die Nucleotide 36 bis 1346 der Sequenz Nr. 1, also den kodierenden Bereich des PRV-1-Gens. Weitere Ausführungs formen umfassen die Nucleotide 36 bis 1262 bzw. 36 bis 1238 von Sequenz Nr. 1. Dieser Bereich kodiert vermutlich für den aktiven Bereich des PRV-1-Polypeptids . Das Polynucleotid der Erfindung kann schließlich auch die Nucleotide 39 bis 1346, 39 bis 1262 oder 39 bis 1238 von Sequenz Nr. 1 umfassen, so daß das Codon, das für das Start- Methionin kodiert, nicht enthalten ist. Eine bevorzugte Ausführungsform ist ein Polynucleotid, das die Nucleotide 99 bis 1346, 99 bis 1262 oder 99 bis 1238 von Sequenz Nr. 1 umfaßt. Es sind damit die Codons am 5 '-Ende, die für das Signalpeptid des PRV-1-Polypeρtids kodieren, nicht enthalten.The nucleotide sequence according to the invention is shown in FIG. 1. The invention therefore relates to a polynucleotide which corresponds to the sequence in FIG. 1 and a polynucleotide whose nucleotide sequence has slight deviations (variant). For the purposes of the present application, minor deviations mean those sequences in which a few, preferably no more than 50 and particularly preferably no more than 25 nucleotides can be exchanged, but the function of the gene encoded by the nucleotide sequence is not affected. It is known to the person skilled in the art that a base triplet coding for an amino acid can be replaced by another triplet which codes for the same amino acid. In addition, less important areas can be slightly deleted and / or mutated. In a particular embodiment, the polynucleotide comprises nucleotides 36 to 1346 of sequence no. 1, that is to say the coding region of the PRV-1 gene. Further embodiments include nucleotides 36 to 1262 and 36 to 1238 of sequence No. 1. This area presumably codes for the active area of the PRV-1 polypeptide. Finally, the polynucleotide of the invention may also include nucleotides 39 to 1346, 39 to 1262 or 39 to 1238 of sequence # 1 so that the codon encoding the start methionine is not included. A preferred embodiment is a polynucleotide comprising nucleotides 99 to 1346, 99 to 1262 or 99 to 1238 of sequence # 1. The codons at the 5 'end which code for the signal peptide of the PRV-1 polypeptide are therefore not included.
Das erfindungsgemäße Polynucleotid kann auch ein Fragment des PRV-1-Gens sein. Das Fragment weist in der Regel mehr als 100 Nucleotide auf, bevorzugt aber mehr als 300 Nucleotide. Die Fragmente können auch als Primer oder als Sonden insbesondere für die PCR eingesetzt werden, in diesem Fall können die Fragmente dem Zweck entsprechend verkürzt sein. Üblicherweise haben Primer eine Länge zwischen 10 und 30 Nucleotiden und Sonden eine Länge zwischen 15 und 50 Nucleotiden.The polynucleotide according to the invention can also be a fragment of the PRV-1 gene. The fragment usually has more than 100 nucleotides, but preferably more than 300 nucleotides. The fragments can also be used as primers or as probes, in particular for the PCR, in which case the fragments can be shortened according to the purpose. Typically, primers are between 10 and 30 nucleotides in length and probes are between 15 and 50 nucleotides in length.
Das PRV-1-Gen ist ein körpereigenes Gen, das jedoch bei gesunden Personen nur auf wenige Organe beschränkt exprimiert wird. Normalerweise wird es im wesentlichen in den blutbildenden Organen, d.h. im Knochenmark und fötaler Leber, und schwach in der Milz exprimiert, nicht jedoch in Herz, Muskel, Pankreas oder Niere. Bei Patienten, die unter P. vera leiden, wird dieses Gen, vor allem in den hämatopoietischen Zellen, sehr stark überexprimiert .The PRV-1 gene is an endogenous gene, but is only expressed in a few organs in healthy individuals. It is usually expressed mainly in the hematopoietic organs, ie in the bone marrow and fetal liver, and weakly in the spleen, but not in the heart, muscle, pancreas or kidney. In patients who under P. vera suffer, this gene is very overexpressed, especially in the hematopoietic cells.
Das PRV-1-Gen kodiert für ein Protein, das die in Figur 2 gezeigte Proteinsequenz aufweist. Das Signalpeptid, das in der Proteinsequenz sämtlicher Oberflächenmoleküle enthalten ist und bei der Prozessierung des Proteins üblicherweise entfernt wird, ist durch einen Bindestrich abgetrennt. Das Protein hat die Sequenz ID Nr. 2. Ein weiterer Aspekt der Erfindung ist also ein im wesentlichen reines Polypeptid der Sequenz Nr. 2 oder ein Polypeptid der Sequenz Nr. 2, bei dem das Signalpeptid nicht vorhanden ist (Aminosäuren 22 bis 437 von Sequenz Nr. 2). Weitere Ausführungsformen umfassen die Aminosäuren 1 bis 409, 22 bis 409, 1 bis 401 oder 22 bis 401 der Sequenz Nr. 2 (vermutlich aktiver Bereich des Proteins).The PRV-1 gene codes for a protein which has the protein sequence shown in FIG. 2. The signal peptide, which is contained in the protein sequence of all surface molecules and is usually removed during processing of the protein, is separated by a hyphen. The protein has the sequence ID No. 2. A further aspect of the invention is therefore an essentially pure polypeptide of sequence No. 2 or a polypeptide of sequence No. 2 in which the signal peptide is not present (amino acids 22 to 437 of sequence No. 2). Further embodiments include amino acids 1 to 409, 22 to 409, 1 to 401 or 22 to 401 of sequence No. 2 (presumably active region of the protein).
Das erfindungsgemäße Polypeptid ist im Hinblick auf die biologische Aktivität vorzugsweise glycosyliert, am bevorzugtesten ist es N-glycosyliert . Es kann dann an wenigstens einer der Aminosäuren Asn-46, Asn-189 und Asn-382 des PRV-1-Polypeptids glycosyliert sein (Die Aminosäurenzahlen beziehen sich auf die Sequenz Nr. 2). Die Erfindung schließt auch Fragmente der erfindungsgemäßen Polypeptide ein, die N- glycosyliert sind. Die Fragmente sind wenigstens 50 Aminosäuren lang, bevorzugt wenigstens 100 Aminosäuren, am bevorzugtesten wenigstens 150 Aminosäuren. In einer anderen Ausführungsform kann das Polypeptid O-glycosyliert sein.In terms of biological activity, the polypeptide according to the invention is preferably glycosylated, most preferably it is N-glycosylated. It can then be glycosylated on at least one of the amino acids Asn-46, Asn-189 and Asn-382 of the PRV-1 polypeptide (the amino acid numbers relate to sequence No. 2). The invention also includes fragments of the polypeptides according to the invention which are N-glycosylated. The fragments are at least 50 amino acids long, preferably at least 100 amino acids, most preferably at least 150 amino acids. In another embodiment, the polypeptide can be O-glycosylated.
Dem Fachmann ist klar, daß bestimmte Aminosäuren gegen andere ausgetauscht sein können ohne die biologische Aktivität des Proteins zu beeinträchtigen. Solche abgewandelten Formen der erfindungsgemäßen Polypeptide sind auch Gegenstand der Erfindung (Varianten) . Bei den Aminosäureaustauschen handelt es sich um solche, die die biologische Aktivität des Proteins nicht negativ beeinträchtigen. Für die Auswahl der Austausche kann der Fachmann auf allgemein bekannte Regeln zurückgreifen. Das PRV-1-Polypeptid kann herstellungsbedingt beispielsweise einen Glycosylphosphatidylinositol-Anker aufweisen. Dieser ist dann an den Aminosäuren gebunden, die den Aminosäuren 407 bis 409 der Sequenz ID Nr. 2 entsprechen. Ein GPI-Anker dient dazu, ein Protein mittels eines Lipids auf der Außenseite der Zellmembran zu verankern. Aus bislang nicht endgültig geklärten Gründen beobachtet man aber häufig, daß GPI-gelinkte Proteine auch ins Medium abgegeben werden. Man spricht von einem sogenannten "shedding". Ob dies ein spezifischer Prozeß ist, das heißt solche Proteine in einer kontrollierten Weise von Enzymen aus der Membran abgespalten werden, oder ob es ein unspezifischer Verlust des Ankers ist, ist bislang nicht geklärt. Es ist also sehr wahrscheinlich, daß PRV-1 sowohl an der Zellmembran als auch extrazellulär zu finden ist. Für die Wirkung als Wachstumsfaktor und Wachstumshemmer ist wahrscheinlich die sezernierte, nicht Membran-gebundene Form wichtiger, da sie als Wachstumsfaktor diffundieren und andere Zellen erreichen kann.It is clear to the person skilled in the art that certain amino acids can be exchanged for others without impairing the biological activity of the protein. Such modified forms of the polypeptides according to the invention are also the subject of the invention (variants). The amino acid exchanges are those that do not adversely affect the biological activity of the protein. The person skilled in the art can use generally known rules for the selection of the exchanges. The PRV-1 polypeptide can, for example, have a glycosylphosphatidylinositol anchor due to its production. This is then bound to the amino acids which correspond to amino acids 407 to 409 of sequence ID no. 2. A GPI anchor is used to anchor a protein to the outside of the cell membrane using a lipid. For reasons that have not yet been finally clarified, however, it is frequently observed that GPI-linked proteins are also released into the medium. One speaks of a so-called "shedding". It has not yet been clarified whether this is a specific process, that is, such proteins are released from the membrane by enzymes in a controlled manner, or whether it is an unspecific loss of the anchor. It is therefore very likely that PRV-1 can be found both on the cell membrane and extracellularly. The secreted, non-membrane-bound form is probably more important for the effect as a growth factor and growth inhibitor, since it can diffuse as a growth factor and reach other cells.
Dem Fachmann ist klar, daß er durch Manipulation dieser C- terminalen Aminosäuren die Membranständigkeit des Proteins beeinflussen kann. Dies betrifft vor allem die Herstellung bestimmter DNA-Konstrukte, die zur Expression des PRV-1- Polypeptids oder von Fragmenten davon bestimmt sind. Die Codons , die für diese Aminosäuren kodieren, können mutiert oder deletiert sein.It is clear to the person skilled in the art that manipulating these C-terminal amino acids can influence the membrane independence of the protein. This concerns above all the production of certain DNA constructs which are intended for the expression of the PRV-1 polypeptide or fragments thereof. The codons coding for these amino acids can be mutated or deleted.
Das Gen codiert für einen Oberflächenrezeptor der uPAR/Ly6- Familie. Diese Rezeptorenfamilie kann mitogene Signale, d.h. Signale, die die Zellteilung anregen, übertragen. Es wird daher angenommen, daß die Überexpression des PRV-1-Gens, unter anderem auf den Knochenmarkszellen von P. vera-Patienten, zu einer Hyperproliferation dieser Zellen beiträgt.The gene codes for a surface receptor of the uPAR / Ly6 family. This family of receptors can produce mitogenic signals, i.e. Transmit signals that stimulate cell division. It is therefore believed that overexpression of the PRV-1 gene, including on the bone marrow cells of P. vera patients, contributes to hyperproliferation of these cells.
Es wurde gefunden, daß weder bei gesunden Personen noch bei Patienten mit anderen myeloproliferativen Erkrankungen, z.B. mit chronischer myeloischer Leukämie, akuter myeloischer Leukämie, essentieller Thrombozytämie oder sekundärer Erythrozytose PRV-1 auf Granulozyten exprimiert wird.It was found that neither in healthy people nor in patients with other myeloproliferative diseases, for example with chronic myeloid leukemia, acute myeloid Leukemia, essential thrombocytemia or secondary erythrocytosis PRV-1 is expressed on granulocytes.
Um das von dem PRV-1-Gen codierte Polypeptid für Analysen und Nachweisverfahren einsetzen zu können, wird es in geeigneter Weise aus rekombinanter DNA erzeugt, wobei die rekombinante DNA bevorzugt die Nucleotidsequenz ID Nr. 1 oder wenigstens den kodierenden Bereich des PRV-1-Gens, also die Nucleotide 36 bis 1346 von Sequenz ID Nr. 1, oder aber wenigstens die Nucleotide 39 bis 1262 oder 39 bis 1238, funktioneil verbunden mit einem Promotor, umfaßt. Die rekombinante DNA kann jedoch auch nur ein Fragment der Sequenz Nr. 1 umfassen.In order to be able to use the polypeptide encoded by the PRV-1 gene for analysis and detection methods, it is generated in a suitable manner from recombinant DNA, the recombinant DNA preferably having the nucleotide sequence ID No. 1 or at least the coding region of the PRV-1 Gene, ie nucleotides 36 to 1346 of sequence ID No. 1, or at least nucleotides 39 to 1262 or 39 to 1238, functionally linked to a promoter. However, the recombinant DNA can also comprise only a fragment of sequence No. 1.
Ein weiterer Gegenstand der Erfindung ist ein Vektor, der die rekombinante DNA für das PRV-1-Polypeptid oder ein Fragment davon enthält, sowie eine mit diesem Vektor transfizierte oder transformierte Wirtszelle. Die Wirtszellen können prokaryontisch sein, beispielsweise Bakterien wie E. coli. Dabei werden jedoch nicht-glycosylierte Polypeptide exprimiert. Bevorzugt sind daher eukaryontische Wirtszellen, die das exprimierte Protein posttranslational glycosylieren und anderweitig modifizieren können. Beispiele für eukaryontische Wirtszellen sind Insektenzellen wie Sf9-Zellen zur Expression nach Infektion mit rekombinanten Baculoviren, Säugerzellen wie 293-Zellen, COS-Zellen, CHO-Zellen, HeLa- Zellen. Diese Beispiele sind nicht erschöpfend. Auch Hefezellen sind als Wirtszellen möglich. Dem Fachmann ist klar, daß je nach Wirtszelle das Glycosylierungsmuster unterschiedlich sein kann. Damit kann auch die biologische Aktivität des Expressionsprodukts variieren. Besonders bevorzugt sind Wirtszellen, die das Expressionsprodukt derart glycosylieren, daß die biologische Aktivität des Proteins erhalten ist.Another object of the invention is a vector which contains the recombinant DNA for the PRV-1 polypeptide or a fragment thereof, and a host cell transfected or transformed with this vector. The host cells can be prokaryotic, for example bacteria such as E. coli. However, non-glycosylated polypeptides are expressed. Eukaryotic host cells which can post-translationally glycosylate and otherwise modify the expressed protein are therefore preferred. Examples of eukaryotic host cells are insect cells such as Sf9 cells for expression after infection with recombinant baculoviruses, mammalian cells such as 293 cells, COS cells, CHO cells, HeLa cells. These examples are not exhaustive. Yeast cells are also possible as host cells. It is clear to the person skilled in the art that the glycosylation pattern can differ depending on the host cell. The biological activity of the expression product can thus also vary. Host cells which glycosylate the expression product in such a way that the biological activity of the protein is retained are particularly preferred.
Ein weiterer Aspekt der Erfindung ist ein Verfahren zur Herstellung eines erfindungsgemäßen Polypeptids . Dabei wird eine für das erfindungsgemäße Polypeptid kodierende DNA in einer Wirtszelle zur Expression gebracht. Je nachdem, ob das exprimierte Polypeptid von der Wirtszelle in das Kulturmedium sezerniert wird oder in der Zelle verbleibt, werden für die weitere Gewinnung des Polypeptids das Kulturmedium oder die Zellen eingesetzt. Das erfindungsgemäße Polypeptid wird daraufhin durch im Stand der Technik bekannte Verfahren, beispielsweise chromatographische Verfahren, angereichert bzw. gereinigt. Methoden der Proteinreinigung sind beispielsweise beschrieben in Scopes , R., Protein Purification: Principles and Practice (3rd edition) , Springer Verlag (1994). In einer besonderen Ausführungsform umfaßt das erfindungsgemäße Verfahren einen Schritt, in dem glycosyliertes Polypeptid angereichert bzw. gereinigt wird. Dieser Schritt kann erfolgen, bevor das erfindungsgemäße Polypeptid im wesentlichen gereinigt worden ist oder nachdem es bereits im wesentlichen gereinigt worden ist. Im letzteren Fall wird dann der glycosylierte Anteil des gereinigten Polypeptids abgetrennt und gewonnen. In der bevorzugtesten Ausführungsform des Verfahrens wird spezifisch N-glycosyliertes Polypeptid gewonnen. In einer weiteren Ausführungsform des Verfahrens wird Polypeptid gewonnen, das an wenigstens einer der Aminosäuren Asn-46, Asn-189 und Asn-382 der Sequenz Nr. 2 glycosyliert ist.Another aspect of the invention is a method for producing a polypeptide according to the invention. A DNA coding for the polypeptide according to the invention is brought to expression in a host cell. Depending on whether that expressed polypeptide is secreted from the host cell into the culture medium or remains in the cell, the culture medium or the cells are used for the further recovery of the polypeptide. The polypeptide according to the invention is then enriched or purified by methods known in the art, for example chromatographic methods. Methods of protein purification are described, for example, in Scopes, R., Protein Purification: Principles and Practice (3rd edition), Springer Verlag (1994). In a particular embodiment, the method according to the invention comprises a step in which glycosylated polypeptide is enriched or purified. This step can take place before the polypeptide according to the invention has been essentially purified or after it has already been essentially purified. In the latter case, the glycosylated portion of the purified polypeptide is then separated off and recovered. In the most preferred embodiment of the method, specifically N-glycosylated polypeptide is obtained. In a further embodiment of the method, polypeptide is obtained which is glycosylated on at least one of the amino acids Asn-46, Asn-189 and Asn-382 of sequence No. 2.
Das aus Granulozyten gewonnene oder rekombinant erzeugte PRV- 1-Polypeptid kann sowohl zur Diagnose von Polycythämia vera als auch zur Behandlung der Krankheit eingesetzt werden.The PRV-1 polypeptide obtained from granulocytes or recombinantly produced can be used both for the diagnosis of polycythemia vera and for the treatment of the disease.
Eine Möglichkeit der Therapie besteht in der sogenannten "Antisense-Therapie" . Bei diesem Verfahren wird ein "Antisense"-RNA-Molekül, also eine RNA, die komplementär ist zu der PRV-RNA, eingesetzt. Da die PRV-1-RNA an ihrem Anfang die Sequenz 5 ' -AAAAGCAGAAAGAGATTACCAGCC-3 ' (Seq. ID-No. 3) hat, würde die erforderliche Antisense-RNA gegen diese Sequenz die folgende Nucleotidsequenz aufweisen: 5'- GGCTGGTAATCTCTTTCTGCTTTT-3 ' (Seq. ID-No. 4). Diese Antisense- RNA wird in einen Vektor eingebaut und in P. vera-Zellen eingebracht. Das Einbringen dieser RNA erfolgt beispielsweise über Transfektion, wobei der für die Transfektion verwendete Vektor vorzugsweise so gestaltet ist, daß er spezifisch in die P. vera-Zellen eingebracht wird. Die Expression der Antisense- RNA bewirkt, daß die PRV-1-mRNA nicht mehr zu einem Polypeptid translatiert werden kann. In derart behandelten Zellen entsteht dann kein PRV-1-Protein.One possibility of therapy is the so-called "antisense therapy". In this method, an "antisense" RNA molecule, that is an RNA that is complementary to the PRV RNA, is used. Since the PRV-1 RNA initially has the sequence 5 '-AAAAGCAGAAAGAGATTACCAGCC-3' (Seq. ID-No. 3), the required antisense RNA against this sequence would have the following nucleotide sequence: 5'-GGCTGGTAATCTCTTTCTGCTTTT-3 '(Seq. ID-No. 4). This antisense RNA is inserted into a vector and introduced into P. vera cells. This RNA is introduced, for example, via transfection, the one used for the transfection Vector is preferably designed so that it is specifically introduced into the P. vera cells. The expression of the antisense RNA means that the PRV-1 mRNA can no longer be translated into a polypeptide. No PRV-1 protein is then produced in cells treated in this way.
Ein weiterer Gegenstand der Erfindung ist daher ein Verfahren zum Nachweis von P. vera, das dadurch gekennzeichnet ist, daß man das PRV-1-Polypeptid oder ein Epitop davon nachweist und das Ausmaß der Expression bestimmt.Another object of the invention is therefore a method for the detection of P. vera, which is characterized in that the PRV-1 polypeptide or an epitope thereof is detected and the extent of expression is determined.
Eine Überexpression dieses Rezeptors auf reifen Zellen außerhalb des Knochenmarks, z.B. auf Granulozyten, ist ein starker Hinweis auf das Vorliegen der Erkrankung P. vera. Der Nachweis erfolgt geeigneterweise mit einem Immunoassay unter Verwendung von Antikörpern, die gegen den PRV-1-Rezeptor gerichtet sind. Als Testverfahren eignen sich die bekannten Varianten von Immunoassays, bei denen für das PRV-1-Polyρeptid spezifische Antikörper eingesetzt werden zusammen mit weiteren markierten Antikörpern, die immobilisiert oder in Lösung sein können. Die Markierung kann in an sich bekannter Weise erfolgen, z.B. mit radioaktiven Isotopen, durch Fluoreszenz oder Lumineszenz, mit Enzymen, durch farbbildende Reaktionen oder sonstige zur Bestimmung geeigneten Gruppen. Diese Varianten sind dem Fachmann bekannt und bedürfen hier keiner näheren Erläuterung. Erfindungsgemäß werden ELISA-Tests besonders bevorzugt .Overexpression of this receptor on mature cells outside the bone marrow, e.g. on granulocytes, is a strong indication of the presence of P. vera. The detection is suitably carried out with an immunoassay using antibodies which are directed against the PRV-1 receptor. The known variants of immunoassays are suitable as test methods, in which specific antibodies are used for the PRV-1 polyρeptide together with other labeled antibodies, which can be immobilized or in solution. The marking can take place in a manner known per se, e.g. with radioactive isotopes, through fluorescence or luminescence, with enzymes, through color-forming reactions or other groups suitable for determination. These variants are known to the person skilled in the art and do not require any further explanation here. According to the invention, ELISA tests are particularly preferred.
Die zum spezifischen Nachweis des PRV-1-Rezeptors erforderlichen Antikörper können ebenfalls in an sich bekannter Weise hergestellt werden. Geeignet sind sowohl monoklonale als auch polyklonale Antikörper, wobei die Verwendung monoklonaler Antikörper bevorzugt ist.The antibodies required for the specific detection of the PRV-1 receptor can also be produced in a manner known per se. Both monoclonal and polyclonal antibodies are suitable, the use of monoclonal antibodies being preferred.
Für die Herstellung von Antikörpern können auch aus demFor the production of antibodies can also from the
Protein hergeleitete Peptide benutzt werden. Im Rahmen der vorliegenden Erfindung wurden erfolgreich die Peptide mit den Sequenzen: a) KVSDLPRQWTPKN (Aminosäuren 34 bis 46) [Seq. ID-No. 5] undProtein derived peptides can be used. In the context of the present invention, the peptides with the sequences: a) KVSDLPRQWTPKN (amino acids 34 to 46) [Seq. Reg. 5] and
b) SAREKRDVQPPASQH (Aminosäuren 391 bis 405) [Seq. ID-No. 6]b) SAREKRDVQPPASQH (amino acids 391 to 405) [Seq. Reg. 6]
eingesetzt .used.
Die polyklonalen Antikörper werden üblicherweise erzeugt, indem ein geeigneter Wirt (Kaninchen) mit dem PRV-1- Polypeptid, gegebenenfalls gebunden an einem immunologischen Träger (Adjuvans), immunisiert und eine Immunantwort hervorgerufen wird. Monoklonale Antikörper können in an sich bekannter Weise mit der Hybridoma-Technik erzeugt werden. Die Antikörper können durch Affinitätsreinigung gereinigt werden. Herstellung und Reinigung von Antikörpern sind beispielsweise beschrieben in "Antibodies: A Laboratory Manual" von Harlow und Lane, Cold Spring Harbor Laboratory Press.The polyclonal antibodies are usually generated by immunizing a suitable host (rabbit) with the PRV-1 polypeptide, optionally bound to an immunological carrier (adjuvant), and eliciting an immune response. Monoclonal antibodies can be generated in a manner known per se using the hybridoma technique. The antibodies can be purified by affinity purification. The production and purification of antibodies are described, for example, in "Antibodies: A Laboratory Manual" by Harlow and Lane, Cold Spring Harbor Laboratory Press.
Weiterhin können derartige polyklonale oder monoklonale gegen PRV-1 gerichtete Antikörper auch zur Therapie der Krankheit verwendet werden .Furthermore, such polyclonal or monoclonal antibodies directed against PRV-1 can also be used for the therapy of the disease.
In einer weiteren Ausführungsform kann der Nachweis des PRV-1- Rezeptors mit einem RT-PCR-Verfahren erfolgen. Dazu wird zunächst aus den PRV-1 überexprimierenden Zellen, in der Regel Granulozyten, RNA isoliert. Dann wird in an sich bekannter Weise mit einem RT-Primer eine reverse Transkription vorgenommen. Der RT-Primer ist bevorzugt ein Primer mit der folgenden Nucleotidsequenz (SEQ ID-No. 7)In a further embodiment, the PRV-1 receptor can be detected using an RT-PCR method. For this purpose, RNA is first isolated from the PRV-1 overexpressing cells, usually granulocytes. Then reverse transcription is carried out in a manner known per se using an RT primer. The RT primer is preferably a primer with the following nucleotide sequence (SEQ ID No. 7)
ATTAGGTTATGAGGTCAGAGGGAGGT .ATTAGGTTATGAGGTCAGAGGGAGGT.
Dadurch wird die spezifische PRV-1-RNA in DNA umgewandelt. Diese DNA wird dann in einer PCR-Reaktion in an sich bekannter Weise amplifiziert . Für die Amplifikationszyklen werden bevorzugt die folgenden beiden Primer eingesetzt.This will convert the specific PRV-1 RNA into DNA. This DNA is then amplified in a PCR reaction in a manner known per se. The following two primers are preferably used for the amplification cycles.
Als Primer sense (SEQ ID-No. 8) GCAGAAAGAGATTACCAGCCACAGACGG .As primer sense (SEQ ID No. 8) GCAGAAAGAGATTACCAGCCACAGACGG.
Primer antisense (SEQ ID-No. 9)Antisense primer (SEQ ID-No. 9)
GAATCGTGGGGGTAATAGAGTTAGCAGG .GAATCGTGGGGGTAATAGAGTTAGCAGG.
Mit der offenbarten Sequenz kann der Fachmann ohne weiteres andere ebenfalls geeignete Primer auffinden.With the sequence disclosed, the person skilled in the art can readily find other primers which are also suitable.
Da die RNA als Ausgangsmaterial für dieses Verfahren verwendet wird, ist das PCR-Signal nur in solchen Fällen positiv, in denen das PRV-1-Gen auch exprimiert wird. Wie oben ausgeführt, ist dies nur dann der Fall, wenn der Patient unter P. vera leidet. Bei gesunden Patienten erfolgt keine PRV-Expression in den Granulozyten. Die Abwesenheit eines RT-PCR-Signals deutet also daraufhin, daß keine P. vera vorliegt. Vorzugsweise erfolgt die Quantifizierung in dem RT-PCR-Verfahren mit Hilfe der TaqMane-Technologie. Für diese Quantifizierung wird neben Primern auch eine "probe" benötigt. Die bevorzugte Sequenz der "probe" ist 5 ' -TTCTTGTTGAACCACACCAGACAAATCGG-3 'Since the RNA is used as the starting material for this method, the PCR signal is only positive in those cases in which the PRV-1 gene is also expressed. As stated above, this is only the case if the patient has P. vera. PRV expression does not occur in the granulocytes in healthy patients. The absence of an RT-PCR signal indicates that there is no P. vera. The quantification in the RT-PCR method is preferably carried out using TaqMan e technology. In addition to primers, a "sample" is also required for this quantification. The preferred sequence of the "probe" is 5 '-TTCTTGTTGAACCACACCAGACAAATCGG-3'
(SEQ ID NO: 10). Daher ist die quantitative RT-PCR zum Nachweis des PRV-1-Transkripts ebenfalls Gegenstand dieser Erfindung.(SEQ ID NO: 10). The quantitative RT-PCR for the detection of the PRV-1 transcript is therefore also the subject of this invention.
In einer weiteren Alternative kann auch ein Blotting- Verfahren, bevorzugt ein Northern Blot, zur Diagnose einer P. vera benutzt werden. Für ein derartiges Verfahren wird die RNA aus Granulozyten isoliert und dann mit einem Blotting- Verfahren, z.B. Northern Blot, auf die Expression von PRV-1 untersucht. Als Sonde kann die cDNA-Sequenz von SEQ ID Nr. 1 oder ein Abschnitt der Sequenz verwendet werden. Eine Hybridisierung tritt nur dann auf, wenn die Granulozyten von einem Patienten mit P. vera stammen, da nur dann eine Expression auf den Granulozyten vorhanden ist. Die Abwesenheit einer Hybridisierung deutet daraufhin, daß die Person, von der die Granulozyten stammen, keine P. vera hat.In a further alternative, a blotting method, preferably a Northern blot, can also be used to diagnose P. vera. For such a procedure, the RNA is isolated from granulocytes and then blotted, e.g. Northern blot, examined for the expression of PRV-1. The cDNA sequence of SEQ ID No. 1 or a section of the sequence can be used as a probe. Hybridization only occurs if the granulocytes come from a patient with P. vera, since only then is there an expression on the granulocytes. The absence of hybridization indicates that the person from whom the granulocytes are derived has no P. vera.
Für die Northern Blot-Hybridisierung kann auch ein Fragment des Gens eingesetzt werden. Ein derartiges Fragment ist üblicherweise mehr als 100 Basen lang, vorzugsweise mehr als 300 Basen lang. Alternativ hierzu können durch Verdau des Gens mit Restriktionsendonukleasen verschiedene unterschiedliche Fragmente des Gens hergestellt werden, die als Sonden im Northern Blot verwendet werden können. Wenn die Fragmente von der cDNA herstammen, liegen sie als Doppelstränge vor, die für die Hybridisierung in die Einzelstränge aufgetrennt werden müssen. Geeignete Beispiele sind das Bam HI-Pstl-Fragment von Basenpaar 420 bis Basenpaar 831 oder das Pstl-Pstl-Frag ent von Basenpaar 831 bis Basenpaar 1900.A fragment of the gene can also be used for Northern blot hybridization. One such fragment is usually more than 100 bases long, preferably more than 300 bases long. Alternatively, by digesting the gene with restriction endonucleases, various different fragments of the gene can be produced which can be used as probes in the Northern blot. If the fragments originate from the cDNA, they are present as double strands, which have to be separated into the single strands for hybridization. Suitable examples are the Bam HI-Pstl fragment from base pair 420 to base pair 831 or the Pstl-Pstl fragment ent from base pair 831 to base pair 1900.
Der Nachweis von PRV-1-mRNA und damit der PRV-1-Expression kann auch dadurch erfolgen, daß zunächst in einer RT-PCR- Reaktion die mRNA revers transkribiert wird und die cDNA anschließend amplifiziert wird und dann die amplifizierte DNA mit einer Sonde in einem Hybridisierungsverfahren nachgewiesen wird.The detection of PRV-1 mRNA and thus the PRV-1 expression can also be carried out by first transversely transcribing the mRNA in an RT-PCR reaction and then amplifying the cDNA and then amplifying the DNA with a probe in a hybridization process is detected.
Bei einer positiven Diagnose muß die Krankheit behandelt werden, da sie ansonsten in relativ kurzer Zeit zum Tod führt. Hierzu können spezifische gegen PRV-1 gerichtete Antikörper verwendet werden, an die gegebenenfalls zytotoxische Komponenten gebunden sein können.If the diagnosis is positive, the disease must be treated, otherwise it will lead to death in a relatively short time. For this purpose, specific antibodies directed against PRV-1 can be used, to which cytotoxic components may be bound.
Ein weiterer Gegenstand der Erfindung ist daher ein Arzneimittel, das neben üblichen Trägern gegen den PRV-1- Rezeptor gerichtete Antikörper enthält.The invention therefore furthermore relates to a medicament which, in addition to conventional carriers, contains antibodies directed against the PRV-1 receptor.
Da bei der P. vera der PRV-1-Rezeptor überexprimiert wird, kommt es bei Kontakt mit dem Anti-PRV-1-Antikörper zur Bindung von vielen Antikörpern auf der Oberfläche der befallenen Granulozyten. Die Bindung vieler Antikörper an diesen Zellen ist ein Anreiz für die immunologischen Zellen, diese Zellen zu zerstören. Auf diese Weise ist eine spezifische Eliminierung der P. vera-Zellen möglich.Since the PRV-1 receptor is overexpressed in P. vera, many antibodies bind to the surface of the affected granulocytes when they come into contact with the anti-PRV-1 antibody. The binding of many antibodies to these cells is an incentive for the immunological cells to destroy these cells. In this way, specific elimination of the P. vera cells is possible.
Überraschenderweise wurde auch gefunden, daß das PRV-1- Polypeptid hämatopoietische Aktivität aufweist. Das PRV-1- Polypeptid ist in der Lage, bestimmte hämatopoietische Vorläuferzellen zur Bildung erythroider Kolonien anzuregen. Vor allem die N-glycosylierten Polypeptide von PRV-1 weisen diese Funktion auf. Von den erfindungsgemäßen Polypeptiden sind daher die N-glycosylierten PRV-1-Polypeptide und Fragmente davon, die die Wachstumsfaktoraktivität aufweisen, bevorzugt .Surprisingly, it has also been found that the PRV-1 polypeptide has hematopoietic activity. The PRV-1- Polypeptide is able to stimulate certain hematopoietic progenitor cells to form erythroid colonies. The N-glycosylated polypeptides of PRV-1 in particular have this function. Of the polypeptides according to the invention, therefore, the N-glycosylated PRV-1 polypeptides and fragments thereof which have the growth factor activity are preferred.
Ein weiterer Aspekt der Erfindung ist daher ein Arzneimittel, das neben einem pharmazeutisch verträglichen Träger das PRV-1- Polypeptid oder ein biologisch aktives Fragment davon enthält. Bevorzugt handelt es sich um glycosyliertes PRV-1-Polyρeptid, noch bevorzugter um N-glycosyliertes PRV-1-Polypeptid oder ein biologisch aktives Fragment davon. Die Erfindung betrifft auch Arzneimittel, die wenigstens ein erfindungsgemäßes Polynucleotid enthalten.Another aspect of the invention is therefore a medicament which, in addition to a pharmaceutically acceptable carrier, contains the PRV-1 polypeptide or a biologically active fragment thereof. It is preferably a glycosylated PRV-1 polypeptide, more preferably an N-glycosylated PRV-1 polypeptide or a biologically active fragment thereof. The invention also relates to medicaments which contain at least one polynucleotide according to the invention.
Die vorliegende Erfindung betrifft weiterhin die Verwendung von PRV-1-Polypeptid oder einem biologisch aktiven Fragment davon oder einer biologisch aktiven Variante davon als Wachstumsfaktor in vivo und ex vivo. Das PRV-1-Polypeptid oder ein biologisch aktives Fragment davon oder eine biologisch aktive Variante davon kann verwendet werden zur Behandlung sämtlicher pan-Zytopenien und pan-Zytopathien im Knochenmark und in der Zirkulation (Änderung der zellulären Bestandteile des peripheren Blutes und des Knochenmarks). Die Polypeptide der vorliegenden Erfindung können beispielsweise verwendet werden zur Behandlung von Anämien bei Nierenversagen, Chemotherapie oder Ganzkörperbestrahlung, zur Behandlung von Neutropenien und Thrombozytopenien unter Chemotherapie oder Ganzkörperbestrahlung, zur ex vivo Behandlung von peripheren oder Knochenmarks-Stammzellen zur Expansion (Vermehrung) und Retransfusion in den Patienten, und zur Behandlung von Sepsis, "systemic inflammatory response syndrome" (SIRS) oder regionaler Entzündungsreaktion. Die Polypeptide der vorliegenden Erfindung oder diese enthaltende Arzneimittel können auf verschiedenste Weise appliziert werden. Die Darreichungsformen umfassen intravenöse, intramuskuläre, subkutane, intraperitoneale, orale, transdermale und transmukosale Verabreichung.The present invention further relates to the use of PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof as a growth factor in vivo and ex vivo. The PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof can be used to treat all pan-cytopenias and pan-cytopathies in the bone marrow and in the circulation (change in the cellular components of the peripheral blood and the bone marrow). The polypeptides of the present invention can be used, for example, for the treatment of anemia with kidney failure, chemotherapy or whole body radiation, for the treatment of neutropenia and thrombocytopenia under chemotherapy or whole body radiation, for the ex vivo treatment of peripheral or bone marrow stem cells for expansion (reproduction) and retransfusion in the Patients, and for the treatment of sepsis, "systemic inflammatory response syndrome" (SIRS) or regional inflammatory response. The polypeptides of the present invention or medicaments containing them can be applied in various ways. The dosage forms include intravenous, intramuscular, subcutaneous, intraperitoneal, oral, transdermal and transmucosal administration.
Auch die erfindungsgemäßen Polynucleotide können zur Behandlung von pan-Zytopenien und pan-Zytopathien verwendet werden. Ziel ist dabei die Expression eines PRV-1-Polypeptids oder eines funktionellen Fragments davon in Zellen des betroffenen Patienten. Dabei kommen vor allem Verfahren der Gentherapie zur Anwendung. Zellen des Patienten können isoliert werden und mit einem erfindungsgemäßen Polynucleotid transfiziert werden (ex vivo-Manipulation) , um dann dem Patienten wieder zugeführt zu werden. Es sind auch Verfahren denkbar, bei denen die erfindungsgemäßen Polynucleotide durch viralen Transfer in die Zielzellen gelangen. Expression der eingeführten Nucleinsäuren führt dann zu hämatopoietischer Aktivität .The polynucleotides according to the invention can also be used for the treatment of pan-cytopenias and pan-cytopathies. The aim is the expression of a PRV-1 polypeptide or a functional fragment thereof in cells of the patient concerned. In particular, gene therapy procedures are used. Cells from the patient can be isolated and transfected with a polynucleotide according to the invention (ex vivo manipulation) in order to then be returned to the patient. Methods are also conceivable in which the polynucleotides according to the invention reach the target cells by viral transfer. Expression of the introduced nucleic acids then leads to hematopoietic activity.
Überraschenderweise wurde ebenfalls gefunden, daß das PRV-1- Polypeptid in höherer Konzentration eine hemmende Wirkung auf das Wachstum von Zellen hat. So wurde beispielsweise festgestellt, daß vermehrte Zugabe von PRV-1-Protein die Bildung erythroider und granulozytärer/monozytärer Kolonien praktisch vollkommen unterbindet. Dieser Effekt ähnelt der Wirkung von Interferon-α, welches unter anderem therapeutisch bei der chronischen myeloischen Leukämie (CML) und bei der P. vera verwendet wird. Eine körpereigene inhibitorische Substanz hat große Vorteile gegenüber einem chemischen Zytostatikum wieSurprisingly, it was also found that the PRV-1 polypeptide in higher concentration has an inhibitory effect on the growth of cells. For example, it was found that increased addition of PRV-1 protein practically completely prevented the formation of erythroid and granulocytic / monocytic colonies. This effect is similar to the effect of interferon-α, which is used therapeutically in chronic myeloid leukemia (CML) and in P. vera. A body's inhibitory substance has great advantages over a chemical cytostatic like
Hydroxyharnstoff , der verwendet wurde, als Interferon-α noch nicht verfügbar war und zum Teil immer noch verwendet wird. Ein Nachteil von Interferon-α ist, daß dieser Wirkstoff sehr schwere Nebenwirkungen hat. Die Patienten fühlen sich, als würden sie an einer schlimmen Grippe leiden. Die vorliegende Erfindung stellt eine die Hämatopoese inhibierende Substanz zur Verfügung, wobei die hemmende Aktivität konzentrationsabhängig ist. Ein weiterer Aspekt der Erfindung ist daher die Verwendung eines in dieser Anmeldung beschriebenen PRV-1-Polypeptids zur Hemmung des Wachstums von Zellen, insbesondere die Verwendung als Zytostatikum. Bevorzugt wird das Polypeptid zur Hemmung des Wachstums von hämatopoietischen Zellen eingesetzt. Die Erfindung betrifft auch die Verwendung eines erfindungsgemäßen Polypeptids zur Herstellung eines Arzneimittels zur Behandlung von proliferativen Erkrankungen. Solche Erkrankungen sind insbesondere die myeloproliferativen Erkrankungen, P. vera, Essentielle Thrombozythämie, Myelofibrose, CML sowie sämtliche Leukämien und Lymphome sowie solide Tumoren.Hydroxyurea that was used when interferon-α was not yet available and is still partially used. A disadvantage of interferon-α is that this active ingredient has very serious side effects. Patients feel like they have bad flu. The present invention provides a hematopoiesis-inhibiting substance, the inhibitory activity being concentration-dependent. Another aspect of the invention is therefore the use of a PRV-1 polypeptide described in this application for inhibiting the growth of cells, in particular the use as a cytostatic. The polypeptide is preferably used to inhibit the growth of hematopoietic cells. The invention also relates to the use of a polypeptide according to the invention for the manufacture of a medicament for the treatment of proliferative diseases. Such diseases are in particular myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML and all leukemias and lymphomas as well as solid tumors.
Ein weiterer Aspekt der Erfindung ist die Verwendung eines in dieser Anmeldung beschriebenen Polynucleotids , eines biologisch aktiven Fragments oder einer biologisch aktiven Variante davon zur Hemmung des Wachstums von Zellen. Das Polynucleotid kann in einen geeigneten Vektor eingebaut werden und in geeignete Zielzellen transfiziert werden. Nach Expression des PRV-1-Polypeptids oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon in entsprechender Konzentration kommt der wachstumsinhibierende Effekt zur Geltung. Ebenso kann das Polynucleotid in einen viralen Vektor eingebaut werden, wonach entsprechende Zielzellen viral infiziert werden, was zur Expression von PRV-1 führt. Die Erfindung betrifft auch die Verwendung eines Polynucleotids dieser Anmeldung zur Herstellung eines Arzneimittels zur Behandlung von proliferativen Erkrankungen wie z.B. die myeloproliferativen Erkrankungen, P. vera, Essentielle Thrombozythämie, Myelofibrose, CML sowie sämtliche Leukämien und Lymphome sowie solide Tumoren.Another aspect of the invention is the use of a polynucleotide described in this application, a biologically active fragment or a biologically active variant thereof to inhibit the growth of cells. The polynucleotide can be incorporated into a suitable vector and transfected into suitable target cells. After expression of the PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof in an appropriate concentration, the growth-inhibiting effect comes into play. The polynucleotide can also be incorporated into a viral vector, after which corresponding target cells are infected virally, which leads to the expression of PRV-1. The invention also relates to the use of a polynucleotide of this application for the manufacture of a medicament for the treatment of proliferative diseases such as e.g. the myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML as well as all leukaemias and lymphomas as well as solid tumors.
Die Erfindung betrifft auch Kits zum Nachweis entweder von Polycythaemia vera oder von Störungen des hämatopoietischen Systems. Diese enthalten ein erfindungsgemäßes Polynucleotid und/oder ein erfindungsgemäßes Polypeptid und/oder einen oder mehrere erfindungsgemäße Antikörper. Darüber hinaus kann das Kit noch einen Behälter oder Zusammensetzungen, die zur Durchführung von Nachweisreaktionen geeignet sind, enthalten. Beispiele für solche Zusammensetzungen sind Pufferlösungen, Reagenzien zum Blockieren von Membranen, Hybridisierungslösungen, sekundäre Antikörper,The invention also relates to kits for the detection of either polycythemia vera or disorders of the hematopoietic system. These contain a polynucleotide according to the invention and / or a polypeptide according to the invention and / or one or more antibodies according to the invention. In addition, the kit can also contain a container or compositions that are used for Carrying out detection reactions are included. Examples of such compositions are buffer solutions, reagents for blocking membranes, hybridization solutions, secondary antibodies,
Substratlösungen für Nachweisreaktionen und andere. Das Kit wird bevorzugt zur Durchführung von PCR-Reaktionen, RT-PCR, Northern Blots, Southern Blots, Western Blots, ELISA, RIA oder ähnlichen Reaktionen verwendet.Substrate solutions for detection reactions and others. The kit is preferably used to carry out PCR reactions, RT-PCR, Northern blots, Southern blots, Western blots, ELISA, RIA or similar reactions.
Zur Erläuterung werden folgende Beispiele angegeben.The following examples are given for explanation.
Beispiel 1example 1
Charakterisierung des PRV-GensCharacterization of the PRV gene
Die folgenden Experimente wurden durchgeführt, um das Gen zu charakterisieren:The following experiments were carried out to characterize the gene:
- Granulozyten wurden aus Blutkonserven oder Aderlässen von P. vera Patienten nach folgendem Protokoll isoliert:- Granulocytes were isolated from the blood or bloodletting of P. vera patients according to the following protocol:
- Blut wurde mit einem gleichem Volumen an 3% Dextran- Lösung in 0.9% NaCl versetzt und 20 Minuten bei Raumtemperatur (RT) stehengelassen.- Blood was mixed with an equal volume of 3% dextran solution in 0.9% NaCl and left to stand for 20 minutes at room temperature (RT).
- Der Ansatz trennte sich in zwei Phasen. Die obere helle Phase wurde abgenommen und 10 Minuten bei 1800g und RT zentrifugiert .- The approach separated into two phases. The upper bright phase was removed and centrifuged for 10 minutes at 1800 g and RT.
- Der Überstand wurde verworfen und das Zellpellet im gleichen Volumen 0.9% NaCl resuspendiert.- The supernatant was discarded and the cell pellet was resuspended in the same volume 0.9% NaCl.
- Jeweils 35 ml der Zellen in NaCl wurden auf 15 ml Ficoll-Hypaque geschichtet.- In each case 35 ml of the cells in NaCl were layered on 15 ml of Ficoll-Hypaque.
- Dann wurde 60 Minuten bei 1800g und RT ohne Bremse zentrifugiert .- Then centrifuged at 1800g and RT without brake for 60 minutes.
- Es bildeten sich ein Zellpellet und zwei Schichten mit einer Interphase.- A cell pellet and two layers with an interphase were formed.
Schichten und Interphase wurden abgesaugt und das Zellpellet 30 Sekunden lang in 10 ml eiskalter 0.2% NaCl resuspendiert und nach 30 Sekunden wurden sofort 10 ml eiskalte 1.6% NaCl zugegeben.Layers and interphase were aspirated and the cell pellet in 10 ml ice-cold 0.2% NaCl for 30 seconds resuspended and after 30 seconds 10 ml of ice-cold 1.6% NaCl were added immediately.
Die Zellen wurden 10 Minuten bei 1800g und RT abzentrifugiert .The cells were centrifuged at 1800 g and RT for 10 minutes.
Dann wurde einmal in 10 ml PBS gewaschen und abzentrifugiert .Then it was washed once in 10 ml of PBS and centrifuged.
- Das Zellpellet enthielt 95-99% reine Granulozyten.- The cell pellet contained 95-99% pure granulocytes.
- Aus diesen Zellen wurde mit Standardmethoden RNA isoliert .- RNA was isolated from these cells using standard methods.
- 10 mg dieser RNA wurden in einem Northern-Blot auf die Expression von PRV-1 untersucht. Als Sonde wurde die gesamte cDNA-Sequenz von SEQ ID Nr. 1 verwendet.- 10 mg of this RNA were examined in a Northern blot for the expression of PRV-1. The entire cDNA sequence of SEQ ID No. 1 was used as the probe.
Dieser Versuch wurde an 39 P. vera Patienten und 29 Kontroll- Blutkonserven durchgeführt. Es wurde eine starke Hybridisierung der PRV-1 Sonde bei P. vera Patienten gefunden. Bei gesunden Kontrollen wurde keine Hybridisierung beobachtet.This experiment was carried out on 39 P. vera patients and 29 control blood supplies. A strong hybridization of the PRV-1 probe was found in P. vera patients. No hybridization was observed in healthy controls.
Beispiel 2Example 2
PRV-1 hat Wachstumsfaktor-AktivitätPRV-1 has growth factor activity
Aus einer schwangeren Maus wurden Embryos am Tage 13,5 nach Befruchtung entnommen. Die fötalen Lebern wurden entnommen. Die darin enthaltenen Zellen wurden mittels Antikörper angefärbt und durch Säulen-Chromatographie für bestimmte Zellen angereichert, für andere Zellsorten depletiert. Es resultiert ein Zellgemisch, das für bestimmte hämatopoietische Vorläuferzellen (sog. colony forming units-erythroid, CFU-E) angereichert ist. So sind in der fötalen Leber insgesamt ungefähr 2% CFU-E, in den angereicherten Zellen aber 30-40% CFU-E.Embryos were removed from a pregnant mouse on day 13.5 after fertilization. The fetal livers were removed. The cells contained therein were stained with antibodies and enriched for certain cells by column chromatography and depleted for other cell types. The result is a cell mixture that is enriched for certain hematopoietic progenitor cells (so-called colony forming units-erythroid, CFU-E). There is a total of approximately 2% CFU-E in the fetal liver, but 30-40% CFU-E in the enriched cells.
Diese CFU-E wurden retroviral transfiziert . Dazu wurde 48 Stunden vorher eine sogenannte "packaging cell line", genannt 293-T, ihrerseits transfiziert . 293-T-Zellen sind eine etablierte humane embryonale Nieren-Zellinie . 293-T-Zellen sind stabil mit mehreren Genen eines Retrovirus transfiziert. Werden nun diese 293-T-Zellen mit zwei Plasmiden, genannt pOS und pKAT, transfiziert, produzieren die 293-T-Zellen ein Retrovirus, das murine fötale Leberzellen infizieren kann. Transfiziert man die 293-T-Zellen mit einem leeren pOS-Vektor und pKAT, wird ein "wild typ" Retrovirus produziert, das nur retrovirale Proteine exprimiert. Hat man hingegen in den pOS- Vektor ein humanes Gen einkloniert, z.B. PRV-1, wird ein Retrovirus produziert, das, wenn es Zellen infiziert hat, dieses Protein exprimiert. Das Retrovirus wird von den 293-T- Zellen in das Zellkultur-Medium sezerniert.These CFU-E were transfected retrovirally. For this purpose, a so-called "packaging cell line", called 293-T, was in turn transfected 48 hours beforehand. 293 T cells are one established human embryonic kidney cell line. 293 T cells are stably transfected with several genes of a retrovirus. If these 293-T cells are transfected with two plasmids called pOS and pKAT, the 293-T cells produce a retrovirus that can infect murine fetal liver cells. If the 293 T cells are transfected with an empty pOS vector and pKAT, a "wild type" retrovirus is produced which only expresses retroviral proteins. If, on the other hand, a human gene has been cloned into the pOS vector, for example PRV-1, a retrovirus is produced which, when it has infected cells, expresses this protein. The retrovirus is secreted by the 293 T cells into the cell culture medium.
Nach zwei Tagen wird das Zellkultur-Medium der transfizierten 293-T-Zellen, welches das Retrovirus enthält, geerntet und einmal durch einen 0,45 μm Filter filtriert. Um die fötalen Leberzellen zu transfizieren, werden diese Zellen mit dem filtrierten Zellkultur-Medium, welches das Retrovirus enthält, vermischt und 2 Stunden bei 1800 rpm, 20°C unter Zugabe von Polybren zentrifugiert . Anschließend werden die transfizierten fötalen Leberzellen in einem Medium kultiviert (Methocult, der Firma Cell Systems), welches zusätzlich zu den üblichen Salzen und Aminosäuren, fötales Kälberserum, 0,0001-0,4 IU/ml Erythropoetin (EPO) und Methylcellulose (0,8%) enthält. Das EPO benötigen die CFU-E, um hämatopoetische Kolonien auszubilden. Durch die Methylcellulose wird das Medium Geleeartig fest, und es gelingt, einzelne Zellen in diesem Gelee zu fixieren, so daß sie sich, anders als in flüssigem Medium, nicht bewegen können. Daher kann beobachtet werden, ob sich aus einer einzelnen Zelle eine hämatopoetische Kolonie formt oder nicht. CFU-Es bilden erythroide Kolonien, also Kolonien, die rote Blutzellen und deren Vorläuferzellen enthalten.After two days, the cell culture medium of the transfected 293 T cells, which contains the retrovirus, is harvested and filtered once through a 0.45 μm filter. In order to transfect the fetal liver cells, these cells are mixed with the filtered cell culture medium which contains the retrovirus and centrifuged for 2 hours at 1800 rpm, 20 ° C. with the addition of polybrene. The transfected fetal liver cells are then cultivated in a medium (Methocult, from Cell Systems) which, in addition to the usual salts and amino acids, fetal calf serum, 0.0001-0.4 IU / ml erythropoietin (EPO) and methyl cellulose (0, 8%) contains. The EPO requires the CFU-E to form hematopoietic colonies. The methyl cellulose makes the medium jelly-like, and it is possible to fix individual cells in this jelly so that, unlike in a liquid medium, they cannot move. It can therefore be observed whether or not a hematopoietic colony is formed from a single cell. CFU-It form erythroid colonies, i.e. colonies that contain red blood cells and their progenitor cells.
Nach drei Tagen wird gezählt, wie viele hämatopoietische Kolonien sich entwickelt haben. Verschiedene Ansätze werden verglichen. Nicht in jedem Experiment wurden alle Ansätze überprüft; Ansätze 1-3 sind sehr ähnliche Kontrollen und können jeweils einzeln mit Ansatz 4 verglichen werden. Ansatz 1: Zellen, die nicht retroviral transfiziert wurden; Ansatz 2: Zellen, die mit einem leeren pOS-Vektor transfiziert wurden; Ansatz 3: Zellen, die mit einem "green fluorescent Protein"After three days, it is counted how many hematopoietic colonies have developed. Different approaches are compared. Not all approaches were checked in every experiment; Approaches 1-3 are very similar controls and can be compared individually with approach 4. Approach 1: cells that were not retrovirally transfected; Approach 2: cells transfected with an empty pOS vector; Approach 3: cells with a "green fluorescent protein"
(GFP), einem nicht hämatopoietisch aktiven Protein, transfiziert wurden. Ansatz 4: Zellen, die mit pOS-PRV-1 (Vektor + erfindungsgemäßes Gen) transfiziert wurden.(GFP), a non-hematopoietically active protein. Approach 4: Cells transfected with pOS-PRV-1 (vector + gene according to the invention).
Tabelle 1: Die Ergebnisse von drei wie beschrieben durchgeführten Versuchen sind aufgeführt. Die Zahlen geben jeweils die Anzahl der Kolonien an.Table 1: The results of three tests carried out as described are shown. The numbers indicate the number of colonies.
Figure imgf000019_0001
Figure imgf000019_0001
Die Versuche zeigen, daß CFU-E, die mit PRV-1 transfiziert waren, sehr viel mehr Kolonien (bis zu 3-fach erhöht) bilden, als die diversen Kontroll-CFU-E. Dieses Ergebnis deutet darauf hin, daß PRV-1 einen Wachstumsfaktor für CFU-E darstellt.The experiments show that CFU-E transfected with PRV-1 form much more colonies (up to 3-fold increased) than the various control CFU-E. This result indicates that PRV-1 is a growth factor for CFU-E.
Beispiel 3Example 3
Löslichkeit des Wachstumsfaktors PRV-1Solubility of the growth factor PRV-1
Um zu untersuchen, ob PRV-1 einen löslichen Wachstumsfaktor darstellt, oder Zell-Zell-Kontakt notwendig ist, wurde ein weiteres Experiment durchgeführt. Die "Verpackungs-Zellinie" , 293-T, produziert nicht nur nach Transfektion mit den pOS- und pKAT-Vektoren ein Retrovirus. Zusätzlich synthetisieren die 293-T-Zellen auch das von dem in pOS klonierten Gen kodierte Protein, also im vorliegenden Fall PRV-1. Ist das Genprodukt ein lösliches Protein, wird es in das Medium, das die "Verpackungs-Zellinie" , 293-T, umgibt, sezerniert. Transfiziert man die 293-T-Zellen nur mit dem pOS-Vektor, ohne pKAT, entstehen keine Retroviren. Das Zellkultur-Medium enthält dann nur das lösliche, von den Zellen produzierte Protein. Es wird Medium von pOS-PRV-1-transfizierten Zellen, ohne Retrovirus, mit CFU-Es vermischt, und im Methylcellulose- Medium ausplattiert und die entstandenen Kolonien gezählt.Another experiment was carried out to investigate whether PRV-1 is a soluble growth factor or whether cell-cell contact is necessary. The "packaging cell line", 293-T, produces a retrovirus not only after transfection with the pOS and pKAT vectors. In addition, the 293 T cells also synthesize the protein encoded by the gene cloned in pOS, in this case PRV-1. Is the gene product a soluble protein, it is secreted into the medium surrounding the "packaging cell line", 293-T. If the 293 T cells are transfected only with the pOS vector, without pKAT, no retroviruses are produced. The cell culture medium then contains only the soluble protein produced by the cells. Medium from pOS-PRV-1 transfected cells, without retrovirus, is mixed with CFU-Es, and plated out in the methyl cellulose medium and the colonies formed are counted.
Folgende Ergebnisse wurden erzielt:The following results were achieved:
Tabelle 2: Löslichkeit von PRV-1. Die Zahlen geben jeweils die Anzahl der Kolonien an.Table 2: Solubility of PRV-1. The numbers indicate the number of colonies.
Figure imgf000020_0001
Figure imgf000020_0001
Auch in diesem Versuch haben CFU-E, die mit PRV-1-haltigem Medium versetzt waren, sehr viel mehr hämatopoietische Kolonien ausgebildet, als Kontroll-Zellen. Aus diesem Ergebnis kann geschlossen werden, daß PRV-1 einen löslichen Wachstumsfaktor darstellt.In this experiment, too, CFU-E, which were mixed with PRV-1-containing medium, formed much more hematopoietic colonies than control cells. From this result it can be concluded that PRV-1 is a soluble growth factor.
Beispiel 4Example 4
PRV-1 hat auch inhibitorische, zytostatische Wirkung.PRV-1 also has inhibitory, cytostatic effects.
Die Versuche wurden an peripheren Blutzellen durchgeführt. Da auch in gesunden Menschen eine geringe Anzahl von Vorläuferzellen im peripheren Blut zirkuliert, können aus peripheren Blutzellen in einem geeigneten Medium (Methylcellulose) hämatopoetische Kolonien gezüchtet werden. Einem gesunden Spender wurden 40 ml peripheres, venöses Blut entnommen (unter Vorlage von Heparin oder EDTA als Anti- Koagulans). Das Blut wurde mit 15 ml Ficoll/Hypaque versetzt und 40 Minuten bei 1600 rpm ohne Bremse zentrifugiert . Dadurch wird ein Dichtegradient erzeugt, der das Blut in seine zellulären Bestandteile auftrennt. Die sogenannten "mononukleären Zellen", unter denen sich auch die Stammzellen befinden, sind nach der Zentrifugation an der Interphase zwischen Serum und Ficoll zu finden. Diese Interphase wurde abgenommen, in PBS (isotonische Salzlösung) gewaschen. Dadurch erhält man gereinigte mononukleäre Zellen, in denen sich ungefähr 0,1% hämatopoietische Stammzellen befinden.The experiments were carried out on peripheral blood cells. Since a small number of progenitor cells circulate in peripheral blood even in healthy people, hematopoietic colonies can be grown from peripheral blood cells in a suitable medium (methyl cellulose). 40 ml of peripheral venous blood was taken from a healthy donor (with the presentation of heparin or EDTA as an anti-coagulant). 15 ml of Ficoll / Hypaque were added to the blood and centrifuged at 1600 rpm without brake for 40 minutes. This creates a density gradient that separates the blood into its cellular components. The so-called "mononuclear cells", among which the stem cells are located, can be found after centrifugation on the interphase between serum and Ficoll. This interphase was removed, washed in PBS (isotonic saline). This results in purified mononuclear cells in which there are approximately 0.1% hematopoietic stem cells.
Die mononukleären Zellen wurden in einem besonders reichhaltigen Medium (IMDM), welches mit 3% FCS (fötalem Kälberserum) versetzt war, aufgenommen. Dieses 3%FCS/IMDM hat im weiteren die Modifikationen enthalten, das heißt, es war entweder mit PRV-1 versetzt oder nicht.The mononuclear cells were taken up in a particularly rich medium (IMDM) containing 3% FCS (fetal calf serum). This 3% FCS / IMDM also contained the modifications, which means that it was either PRV-1 or not.
Die mononukleären Zellen in IMDM wurden in einer Dichte von 7 x 105 Zellen/ml zu einem käuflich erhältlichen Medium der Firma Stem Cell Technologies gegeben (Methocult), welches IMDM und 30% FCS, 1% BSA (Bovine Serum Albumin), Mercaptoethanol,The mononuclear cells in IMDM were added at a density of 7 × 10 5 cells / ml to a commercially available medium from Stem Cell Technologies (Methocult), which contains IMDM and 30% FCS, 1% BSA (Bovine Serum Albumin), mercaptoethanol,
2 mM L-Glutamin, 3 IU EPO (Erythropoietin) /ml und 1,0% Methylcellulose enthielt. In diesem Medium wuchsen die Zellen 14 Tage. Die wenigen, in diesem Gemisch enthaltenen Stammzellen können sich zu hämatopoietischen Kolonien entwickeln. Pro angesetzten 7 x 105 Zellen entwickeln sich üblicherweise zwischen 100 und 200 hämatopoietische Kolonien.Contained 2 mM L-glutamine, 3 IU EPO (erythropoietin) / ml and 1.0% methyl cellulose. The cells grew in this medium for 14 days. The few stem cells contained in this mixture can develop into hematopoietic colonies. Between 100 and 200 hematopoietic colonies usually develop per 7 x 10 5 cells.
Es wurde auch eine Zellinie konstruiert, die eine sehr hohe Menge an PRV-1 exprimiert. Das PRV-1, welches von diesen Zellen produziert wird, ist derart verändert, daß es keinen Lipidanker mehr besitzt. Das Expressionsprodukt besteht aus den Aminosäuren 1-401 der Sequenz SEQ ID NO: 2, es fehlen also die Aminosäuren 402-437. Dieses veränderte PRV-1 wird daher nicht, wie Wildtyp-PRV-1 , mittels eines Lipidankers in die Zellmembran eingebaut, sondern wird vollständig aus den Zellen sezerniert. Bei der Zellinie handelte es sich wie in BeispielA cell line was also constructed that expresses a very high amount of PRV-1. The PRV-1, which is produced by these cells, is modified in such a way that it no longer has a lipid anchor. The expression product consists of amino acids 1-401 of the sequence SEQ ID NO: 2, so amino acids 402-437 are missing. This modified PRV-1 is therefore not, like wild-type PRV-1, built into the cell membrane by means of a lipid anchor, but is completely secreted from the cells. The cell line was as in example
3 um 293-Zellen, die kein Retrovirus produzieren, aber Protein (PRV-1) exprimieren. Für die hämatopoietischen Kolonie-Assays wurden nun die mononukleären Blutzellen entweder in IMDM-Medium, welches 48 Stunden mit nicht transfizierten Zellen (293) inkubiert worden war, aufgenommen, oder in Medium, welches 48 Stunden mit Zellen, die das veränderte PRV-1 exprimierten (293-GPI-less- PRV-1), inkubiert worden war. Dann wurde die Fähigkeit dieser Zellen, hämatopoietische Kolonien auszubilden, untersucht. Nach 14 Tagen wurde die Zahl der erythroiden (roten) und myeloiden (weißen) Blutzellkolonien bestimmt. Der Versuch wurde dreifach wiederholt, sowie an unterschiedlichen Tagen und mit unterschiedlichen Blutspendern durchgeführt. Zudem wurden innerhalb des Versuchs Duplikate ausgewertet. Folgende Ergebnisse wurden erhalten:3 um 293 cells that do not produce retrovirus but express protein (PRV-1). For the hematopoietic colony assays, the mononuclear blood cells were either taken up in IMDM medium which had been incubated for 48 hours with non-transfected cells (293) or in medium which had been 48 hours with cells which expressed the altered PRV-1 (293-GPI-less-PRV-1). The ability of these cells to form hematopoietic colonies was then examined. After 14 days, the number of erythroid (red) and myeloid (white) blood cell colonies was determined. The experiment was repeated three times, as well as on different days and with different blood donors. In addition, duplicates were evaluated within the experiment. The following results were obtained:
Versuch 1Trial 1
Figure imgf000022_0001
Figure imgf000022_0001
Versuch 2Trial 2
Figure imgf000022_0002
Versuch 3
Figure imgf000022_0002
Trial 3
Figure imgf000023_0001
Figure imgf000023_0001
Aus diesen Daten kann geschlossen werden, daß eine höhere Dosis an PRV-1, als sie in Beispiel 3 eingesetzt wurde, zytostatische Wirkung besitzt.From these data it can be concluded that a higher dose of PRV-1 than that used in Example 3 has a cytostatic effect.
Beispiel 5Example 5
Der Wachstumsfaktor PRV-1 ist N-glycosyliertThe growth factor PRV-1 is N-glycosylated
Aus einer Patientin mit P. vera wurden Granulozyten isoliert und aus diesen Zellen mittels Standardprotokoll Proteinextrakte angefertigt. Diese Proteinextrakte wurden nach dem Protokoll des "N-Glycosidase F Deglycosylation Kits" der Firma Boehringer Mannheim behandelt. Im einzelnen bedeutet dies, daß die Proteinextrakte mit einem "Denaturierungs Puffer" versetzt wurden, 3 Minuten bei 95°C erhitzt wurden und dann entweder nur mit "Reaktions Puffer" oder mit "Reaktions Puffer" plus N-Glycosidase versetzt wurden. Der Ansatz wurde über Nacht bei 37 °C inkubiert und die Proteine auf einer PAGE- Gel Elektrophorese mit anschließendem Western Blot analysiert. Das PRV-1 Protein wurde mit einem Antikörper gegen ein Protein mit der Aminosäuresequenz ID-No. 5 detektiert. Die Ergebnisse zeigen, daß aus Granulozyten gereinigtes PRV-1 Protein 60-65 kDa groß ist, während es nach N-Glycosidase-Verdau nur noch 40 kDa groß ist. Dies beweist eindeutig, daß PRV-1 an Asparagin- Resten (Asparagin = N) glycosyliert ist. Granulocytes were isolated from a patient with P. vera and protein extracts were prepared from these cells using the standard protocol. These protein extracts were treated according to the protocol of the "N-Glycosidase F Deglycosylation Kit" from Boehringer Mannheim. Specifically, this means that the protein extracts were mixed with a "denaturing buffer", heated for 3 minutes at 95 ° C. and then either only with "reaction buffer" or with "reaction buffer" plus N-glycosidase were added. The mixture was incubated at 37 ° C. overnight and the proteins were analyzed on a PAGE gel electrophoresis with subsequent Western blot. The PRV-1 protein was raised with an antibody against a protein with the amino acid sequence ID-No. 5 detected. The results show that PRV-1 protein purified from granulocytes is 60-65 kDa, whereas after N-glycosidase digestion it is only 40 kDa. This clearly proves that PRV-1 is glycosylated on asparagine residues (asparagine = N).

Claims

Patentansprüche claims
1. N-glycosyliertes Polypeptid umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:1. N-glycosylated polypeptide essentially comprising one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2Amino acids 1-437 of sequence No. 2
Aminosäuren 1-409 von Sequenz Nr. 2Amino acids 1-409 of sequence No. 2
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2 oder ein Fragment davon mit wenigstens 50 Aminosäuren.Amino acids 22-401 of sequence No. 2 or a fragment thereof with at least 50 amino acids.
Polypeptid im wesentlichen bestehend aus einer der folgenden Aminosäuresequenzen:Polypeptide consisting essentially of one of the following amino acid sequences:
Aminosäuren 1-409 von Sequenz Nr. 2;Amino acids 1-409 of sequence No. 2;
Aminosäuren 1-401 von Sequenz Nr. 2;Amino acids 1-401 of sequence No. 2;
Aminosäuren 22-409 von Sequenz Nr. 2;Amino acids 22-409 of sequence No. 2;
Aminosäuren 22-401 von Sequenz Nr. 2Amino acids 22-401 of sequence No. 2
Antikörper gegen ein Polypeptid nach Anspruch 1.Antibodies against a polypeptide according to claim 1.
Antikörper nach Anspruch 3, dadurch gekennzeichnet, daß es ein monoklonaler Antikörper ist.Antibody according to claim 3, characterized in that it is a monoclonal antibody.
Verfahren zum Nachweis von Polycythaemia vera, dadurch gekennzeichnet, daß man das PRV-1-Polypeptid mit einem oder mehreren Antikörpern nach Anspruch 3 oder 4 in einem Immunoassay umsetzt.Method for the detection of polycythemia vera, characterized in that the PRV-1 polypeptide is reacted with one or more antibodies according to claim 3 or 4 in an immunoassay.
Verfahren nach Anspruch 5, dadurch gekennzeichnet, daß man als Antikörper einen polyklonalen oder monoklonalen Antikörper nach Anspruch 3 oder 4 verwendet. Arzneimittel zur Behandlung von Polycythaemia vera, dadurch gekennzeichnet, daß es neben üblichen Trägern Antikörper nach Anspruch 3 oder 4 enthält.A method according to claim 5, characterized in that a polyclonal or monoclonal antibody according to claim 3 or 4 is used as the antibody. Medicament for the treatment of polycythemia vera, characterized in that it contains antibodies according to claim 3 or 4 in addition to conventional carriers.
Arzneimittel enthaltend ein Polypeptid nach Anspruch 1 oder ein Polypeptid umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:Medicament containing a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2Amino acids 1-437 of sequence No. 2
Aminosäuren 1-409 von Sequenz Nr. 2Amino acids 1-409 of sequence No. 2
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2 und wenigstens einen pharmazeutisch verträglichen Träger,Amino acids 22-401 of sequence No. 2 and at least one pharmaceutically acceptable carrier,
Arzneimittel enthaltend ein Polynucleotid umfassend im wesentlichen eine der folgenden Nucleotidsequenzen:Medicament containing a polynucleotide essentially comprising one of the following nucleotide sequences:
Nucleotide 1-1600 von Sequenz Nr. 1;Nucleotides 1-1600 of sequence # 1;
Nucleotide 36-1346 von Sequenz Nr. 1Nucleotides 36-1346 of Sequence No. 1
Nucleotide 36-1262 von Sequenz Nr. 1Nucleotides 36-1262 of Sequence No. 1
Nucleotide 36-1238 von Sequenz Nr. 1Nucleotides 36-1238 of Sequence No. 1
Nucleotide 39-1346 von Sequenz Nr. 1Nucleotides 39-1346 of Sequence No. 1
Nucleotide 39-1262 von Sequenz Nr. 1Nucleotides 39-1262 of Sequence No. 1
Nucleotide 39-1238 von Sequenz Nr. 1Nucleotides 39-1238 of Sequence No. 1
Nucleotide 99-1346 von Sequenz Nr. 1Nucleotides 99-1346 of Sequence No. 1
Nucleotide 99-1262 von Sequenz Nr. 1Nucleotides 99-1262 of Sequence No. 1
Nucleotide 99-1238 von Sequenz Nr. 1 und wenigstens einen pharmazeutisch verträglichen Träger.Nucleotides 99-1238 of Sequence No. 1 and at least one pharmaceutically acceptable carrier.
10. Verwendung eines Polypeptids nach Anspruch 1 oder eines Polypeptids umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:10. Use of a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2;Amino acids 1-437 of sequence No. 2;
Aminosäuren 1-409 von Sequenz Nr. 2 ,Amino acids 1-409 of sequence No. 2,
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2,Amino acids 22-409 of sequence No. 2,
Aminosäuren 22-401 von Sequenz Nr. 2; oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon als Wachstumsfaktor.Amino acids 22-401 of sequence No. 2; or a biologically active fragment thereof or a biologically active variant thereof as a growth factor.
11. Verwendung eines Polypeptids nach Anspruch 1 oder eines Polypeptids umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:11. Use of a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2;Amino acids 1-437 of sequence No. 2;
Aminosäuren 1-409 von Sequenz Nr. 2;Amino acids 1-409 of sequence No. 2;
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2;Amino acids 22-437 of sequence No. 2;
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2; oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon zur Herstellung eines Arzneimittels zur Behandlung von pan-Zytopenien und pan- Zytopathien im Knochenmark und in der Zirkulation.Amino acids 22-401 of sequence No. 2; or a biologically active fragment thereof or a biologically active variant thereof for the manufacture of a medicament for the treatment of pan-cytopenias and pan-cytopathies in the bone marrow and in the circulation.
12. Verwendung eines Polynucleotids umfassend im wesentlichen eine der folgenden Nucleotidsequenzen:12. Use of a polynucleotide essentially comprising one of the following nucleotide sequences:
Nucleotide 1-1600 von Sequenz Nr. 1Nucleotides 1-1600 of Sequence No. 1
Nucleotide 36-1346 von Sequenz Nr. 1Nucleotides 36-1346 of Sequence No. 1
Nucleotide 36-1262 von Sequenz Nr. 1Nucleotides 36-1262 of Sequence No. 1
Nucleotide 36-1238 von Sequenz Nr. 1Nucleotides 36-1238 of Sequence No. 1
Nucleotide 39-1346 von Sequenz Nr. 1Nucleotides 39-1346 of Sequence No. 1
Nucleotide 39-1262 von Sequenz Nr. 1Nucleotides 39-1262 of Sequence No. 1
Nucleotide 39-1238 von Sequenz Nr. 1Nucleotides 39-1238 of Sequence No. 1
Nucleotide 99-1346 von Sequenz Nr. 1Nucleotides 99-1346 of Sequence No. 1
Nucleotide 99-1262 von Sequenz Nr. 1Nucleotides 99-1262 of Sequence No. 1
Nucleotide 99-1238 von Sequenz Nr. 1 oder eines Fragments davon oder einer Variante davon zur Herstellung eines Arzneimittels zur Behandlung von pan- Zytopenien und pan-Zytopathien im Knochenmark und in der Zirkulation.Nucleotides 99-1238 of sequence No. 1 or a fragment thereof or a variant thereof for the manufacture of a medicament for the treatment of pan-cytopenias and pan-cytopathies in the bone marrow and in the circulation.
13. Verwendung eines Polypeptids nach Anspruch 1 oder eines Polypeptids umfassend im wesentlichen eine der folgenden Aminosäuresequenzen: Aminosäuren 1-437 von Sequenz Nr. 213. Use of a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences: Amino acids 1-437 of sequence No. 2
Aminosäuren 1-409 von Sequenz Nr. 2;Amino acids 1-409 of sequence No. 2;
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2 oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon zur Behandlung und/oder Vermehrung körpereigener Zellen und/oder etablierter Zellinien ex vivo oder in vitro.Amino acids 22-401 of sequence No. 2 or a biologically active fragment thereof or a biologically active variant thereof for the treatment and / or multiplication of endogenous cells and / or established cell lines ex vivo or in vitro.
14. Verwendung eines Polypeptids nach Anspruch 1 oder eines Polypeptids umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:14. Use of a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2Amino acids 1-437 of sequence No. 2
Aminosäuren 1-409 von Sequenz Nr. 2Amino acids 1-409 of sequence No. 2
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2 oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon zur Hemmung des Wachstums von Zellen.Amino acids 22-401 of sequence No. 2 or a biologically active fragment thereof or a biologically active variant thereof for inhibiting the growth of cells.
15. Verwendung nach Anspruch 14, dadurch gekennzeichnet, daß das Polypeptid als Zytostatikum verwendet wird.15. Use according to claim 14, characterized in that the polypeptide is used as a cytostatic.
16. Verwendung eines Polypeptids nach Anspruch 1 oder eines Polypeptids umfassend im wesentlichen eine der folgenden Aminosäuresequenzen:16. Use of a polypeptide according to claim 1 or a polypeptide comprising essentially one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2Amino acids 1-437 of sequence No. 2
Aminosäuren 1-409 von Sequenz Nr. 2Amino acids 1-409 of sequence No. 2
Aminosäuren 1-401 von Sequenz Nr. 2Amino acids 1-401 of sequence No. 2
Aminosäuren 22-437 von Sequenz Nr. 2Amino acids 22-437 of sequence No. 2
Aminosäuren 22-409 von Sequenz Nr. 2Amino acids 22-409 of sequence No. 2
Aminosäuren 22-401 von Sequenz Nr. 2 oder eines biologisch aktiven Fragments davon oder einer biologisch aktiven Variante davon zur Herstellung eines Arzneimittels zur Behandlung proliferativer Erkrankungen.Amino acids 22-401 of sequence No. 2 or a biologically active fragment thereof or a biologically active variant thereof for the manufacture of a medicament for the treatment of proliferative diseases.
17. Verwendung nach Anspruch 16, dadurch gekennzeichnet, daß die proliferative Erkrankung ausgewählt ist aus der Gruppe umfassend myeloproliferative Erkrankungen, P. vera, Essentielle Thrombozythämie, Myelofibrose, CML, sämtliche Leukämien und Lymphome sowie solide Tumoren.17. Use according to claim 16, characterized in that the proliferative disease is selected from the group comprising myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML, all leukemias and lymphomas and solid tumors.
18. Verwendung eines Polynucleotids umfassend im wesentlichen eine der folgenden Nucleotidsequenzen:18. Use of a polynucleotide essentially comprising one of the following nucleotide sequences:
Nucleotide 1-1600 von Sequenz Nr. 1Nucleotides 1-1600 of Sequence No. 1
Nucleotide 36-1346 von Sequenz Nr. 1Nucleotides 36-1346 of Sequence No. 1
Nucleotide 36-1262 von Sequenz Nr. 1Nucleotides 36-1262 of Sequence No. 1
Nucleotide 36-1238 von Sequenz Nr. 1Nucleotides 36-1238 of Sequence No. 1
Nucleotide 39-1346 von Sequenz Nr. 1Nucleotides 39-1346 of Sequence No. 1
Nucleotide 39-1262 von Sequenz Nr. 1Nucleotides 39-1262 of Sequence No. 1
Nucleotide 39-1238 von Sequenz Nr. 1Nucleotides 39-1238 of Sequence No. 1
Nucleotide 99-1346 von Sequenz Nr. 1Nucleotides 99-1346 of Sequence No. 1
Nucleotide 99-1262 von Sequenz Nr. 1Nucleotides 99-1262 of Sequence No. 1
Nucleotide 99-1238 von Sequenz Nr. 1 oder eines Fragments davon oder einer Variante davon zur Hemmung des Wachstums von Zellen.Nucleotides 99-1238 of sequence No. 1 or a fragment thereof or a variant thereof for inhibiting the growth of cells.
19. Verwendung eines Polynucleotids umfassend im wesentlichen eine der folgenden Nucleotidsequenzen:19. Use of a polynucleotide essentially comprising one of the following nucleotide sequences:
Nucleotide 1-1600 von Sequenz Nr. 1Nucleotides 1-1600 of Sequence No. 1
Nucleotide 36-1346 von Sequenz Nr. 1Nucleotides 36-1346 of Sequence No. 1
Nucleotide 36-1262 von Sequenz Nr. 1Nucleotides 36-1262 of Sequence No. 1
Nucleotide 36-1238 von Sequenz Nr. 1Nucleotides 36-1238 of Sequence No. 1
Nucleotide 39-1346 von Sequenz Nr. 1Nucleotides 39-1346 of Sequence No. 1
Nucleotide 39-1262 von Sequenz Nr. 1Nucleotides 39-1262 of Sequence No. 1
Nucleotide 39-1238 von Sequenz Nr. 1Nucleotides 39-1238 of Sequence No. 1
Nucleotide 99-1346 von Sequenz Nr. 1;Nucleotides 99-1346 of sequence No. 1;
Nucleotide 99-1262 von Sequenz Nr. 1;Nucleotides 99-1262 of sequence No. 1;
Nucleotide 99-1238 von Sequenz Nr. 1] oder eines Fragments davon oder einer Variante davon zur Herstellung eines Arzneimittels zur Behandlung proliferativer Erkrankungen.Nucleotides 99-1238 of sequence No. 1] or a fragment thereof or a variant thereof for the manufacture of a medicament for the treatment of proliferative diseases.
20. Verwendung nach Anspruch 19, dadurch gekennzeichnet, daß die proliferative Erkrankung ausgewählt ist aus der Gruppe umfassend myeloproliferative Erkrankungen, P. vera, Essentielle Thrombozythämie, Myelofibrose, CML, sämtliche Leukämien und Lymphome sowie solide Tumoren.20. Use according to claim 19, characterized in that the proliferative disease is selected from the group comprising myeloproliferative diseases, P. vera, essential thrombocythemia, myelofibrosis, CML, all leukemias and lymphomas and solid tumors.
21. Kit zum Nachweis von Polycythaemia vera oder von Störungen des hämatopoietischen Systems enthaltend wenigstens ein Polynucleotid umfassend im wesentlichen eine der folgenden Nucleotidsequenzen:21. Kit for the detection of polycythemia vera or disorders of the hematopoietic system containing at least one polynucleotide essentially comprising one of the following nucleotide sequences:
Nucleotide 1-1600 von Sequenz Nr. 1Nucleotides 1-1600 of Sequence No. 1
Nucleotide 36-1346 von Sequenz Nr. 1Nucleotides 36-1346 of Sequence No. 1
Nucleotide 36-1262 von Sequenz Nr. 1Nucleotides 36-1262 of Sequence No. 1
Nucleotide 36-1238 von Sequenz Nr. 1Nucleotides 36-1238 of Sequence No. 1
Nucleotide 39-1346 von Sequenz Nr. 1Nucleotides 39-1346 of Sequence No. 1
Nucleotide 39-1262 von Sequenz Nr. 1Nucleotides 39-1262 of Sequence No. 1
Nucleotide 39-1238 von Sequenz Nr. 1Nucleotides 39-1238 of Sequence No. 1
Nucleotide 99-1346 von Sequenz Nr. 1Nucleotides 99-1346 of Sequence No. 1
Nucleotide 99-1262 von Sequenz Nr. 1Nucleotides 99-1262 of Sequence No. 1
Nucleotide 99-1238 von Sequenz Nr. 1 oder ein Fragment davon oder eine Variante davon und/oder wenigstens ein Polypeptid nach Anspruch 1 oder ein Polypeptid umfassend im wesentlichen eine der folgenden Aminosäuresequenzen :Nucleotides 99-1238 of sequence No. 1 or a fragment thereof or a variant thereof and / or at least one polypeptide according to claim 1 or a polypeptide essentially comprising one of the following amino acid sequences:
Aminosäuren 1-437 von Sequenz Nr. 2;Amino acids 1-437 of sequence No. 2;
Aminosäuren 1-409 von Sequenz Nr. 2;Amino acids 1-409 of sequence No. 2;
Aminosäuren 1-401 von Sequenz Nr. 2;Amino acids 1-401 of sequence No. 2;
Aminosäuren 22-437 von Sequenz Nr. 2;Amino acids 22-437 of sequence No. 2;
Aminosäuren 22-409 von Sequenz Nr. 2;Amino acids 22-409 of sequence No. 2;
Aminosäuren 22-401 von Sequenz Nr. 2; oder ein biologisch aktives Fragment davon oder eine biologisch aktive Variante davon und/oder wenigstens einen Antikörper nach Anspruch 3 oder 4.Amino acids 22-401 of sequence No. 2; or a biologically active fragment thereof or a biologically active variant thereof and / or at least one antibody according to claim 3 or 4.
22. Kit zur Detektion des PRV-1 Proteins nach Anspruch 21, dadurch gekennzeichnet, daß es ein ELISA Test Kit ist.22. Kit for detection of the PRV-1 protein according to claim 21, characterized in that it is an ELISA test kit.
23. Kit nach Anspruch 21 zur Detektion der PRV-1 mRNA, dadurch gekennzeichnet, daß es ein semi-quantitatives oder quantitatives RT-PCR Analyse-Kit ist.23. Kit according to claim 21 for the detection of the PRV-1 mRNA, characterized in that it is a semi-quantitative or quantitative RT-PCR analysis kit.
24. Kit nach Anspruch 21 zur Detektion der PRV-1 mRNA, dadurch gekennzeichnet, daß es ein Northern Blot-Kit ist. 24. Kit according to claim 21 for the detection of the PRV-1 mRNA, characterized in that it is a Northern blot kit.
PCT/EP2000/009594 1999-09-30 2000-09-29 The prv-1 gene and use thereof WO2001023554A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
AU11324/01A AU1132401A (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof
KR1020027004095A KR20020047191A (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof
BR0014444-4A BR0014444A (en) 1999-09-30 2000-09-29 Prv-1 gene and its use
EP00972665A EP1220920A1 (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof
JP2001526936A JP2003510077A (en) 1999-09-30 2000-09-29 PRV-1 gene and use thereof
EA200200286A EA200200286A1 (en) 1999-09-30 2000-09-29 PRV-1 GENE AND ITS APPLICATION
HU0203080A HUP0203080A2 (en) 1999-09-30 2000-09-29 Prv-1 gene and use thereof
IL14877000A IL148770A0 (en) 1999-09-30 2000-09-29 The gene prv-1 and antibodies and pharmaceutical compositions for treating polycythemia vera
SK426-2002A SK4262002A3 (en) 1999-09-30 2000-09-29 The use of a peptide coded by the prv-1 gene or by a fragment thereof in production of a medicament acting as a growth factor
PL00354184A PL354184A1 (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof
EEP200200168A EE200200168A (en) 1999-09-30 2000-09-29 PRV-1 gene and its use
CA002387702A CA2387702A1 (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof
MXPA02002800A MXPA02002800A (en) 1999-09-30 2000-09-29 The prv 1 gene and use thereof.
NO20021498A NO20021498L (en) 1999-09-30 2002-03-26 The gene PRV-1 and its use
BG106554A BG106554A (en) 1999-09-30 2002-03-27 The prv-1 gene and use thereof
HR20020269A HRP20020269A2 (en) 1999-09-30 2002-03-28 The prv-1 gene and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19947010A DE19947010A1 (en) 1999-09-30 1999-09-30 The PRV-1 gene and its use
DE19947010.3 1999-09-30

Publications (1)

Publication Number Publication Date
WO2001023554A1 true WO2001023554A1 (en) 2001-04-05

Family

ID=7923937

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/009594 WO2001023554A1 (en) 1999-09-30 2000-09-29 The prv-1 gene and use thereof

Country Status (21)

Country Link
EP (1) EP1220920A1 (en)
JP (1) JP2003510077A (en)
KR (1) KR20020047191A (en)
CN (1) CN1377408A (en)
AU (1) AU1132401A (en)
BG (1) BG106554A (en)
BR (1) BR0014444A (en)
CA (1) CA2387702A1 (en)
CZ (1) CZ20021094A3 (en)
DE (1) DE19947010A1 (en)
EA (1) EA200200286A1 (en)
EE (1) EE200200168A (en)
HR (1) HRP20020269A2 (en)
HU (1) HUP0203080A2 (en)
IL (1) IL148770A0 (en)
MX (1) MXPA02002800A (en)
NO (1) NO20021498L (en)
PL (1) PL354184A1 (en)
SK (1) SK4262002A3 (en)
WO (1) WO2001023554A1 (en)
ZA (1) ZA200202379B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018229179A1 (en) * 2017-06-14 2018-12-20 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
US11167038B2 (en) 2012-05-21 2021-11-09 Genentech, Inc. Methods for improving safety of blood-brain barrier transport

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL158599A0 (en) * 2003-10-26 2004-05-12 Yeda Res & Dev Methods of modulating hematopoiesis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998050552A1 (en) * 1997-05-06 1998-11-12 Zymogenetics, Inc. Novel tumor antigens
WO1999063088A2 (en) * 1998-06-02 1999-12-09 Genentech, Inc. Membrane-bound proteins and nucleic acids encoding the same
WO2000024886A1 (en) * 1998-10-23 2000-05-04 Universitätsklinikum Freiburg Prv-1 gene and the use thereof
WO2000036102A2 (en) * 1998-12-16 2000-06-22 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998050552A1 (en) * 1997-05-06 1998-11-12 Zymogenetics, Inc. Novel tumor antigens
WO1999063088A2 (en) * 1998-06-02 1999-12-09 Genentech, Inc. Membrane-bound proteins and nucleic acids encoding the same
WO2000024886A1 (en) * 1998-10-23 2000-05-04 Universitätsklinikum Freiburg Prv-1 gene and the use thereof
WO2000036102A2 (en) * 1998-12-16 2000-06-22 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
TEMERINAC S ET AL: "CLONING OF PRV-1, A NOVEL MEMBER OF THE UPAR RECEPTOR SUPERFAMILY WHICH IS OVEREXPRESSED IN POLYCYTHEMIA VERA", BLOOD,US,W.B. SAUNDERS, PHILADELPHIA, VA, vol. 92, no. 10, SUPPL. 01, 15 November 1998 (1998-11-15), pages 426A - Abstr1760, XP000867771, ISSN: 0006-4971 *
TEMERINAC SNEZANA ET AL: "Cloning of PRV-1, a novel member of the uPAR receptor superfamily, which is overexpressed in polycythemia rubra vera.", BLOOD, vol. 95, no. 8, 15 April 2000 (2000-04-15), pages 2569 - 2576, XP002159981, ISSN: 0006-4971 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11167038B2 (en) 2012-05-21 2021-11-09 Genentech, Inc. Methods for improving safety of blood-brain barrier transport
WO2018229179A1 (en) * 2017-06-14 2018-12-20 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
CN111094547A (en) * 2017-06-14 2020-05-01 德国亥姆霍兹慕尼黑中心健康与环境研究中心(有限公司) Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
CN111094547B (en) * 2017-06-14 2024-02-09 德国亥姆霍兹慕尼黑中心健康与环境研究中心(有限公司) Method for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells

Also Published As

Publication number Publication date
NO20021498L (en) 2002-05-23
DE19947010A1 (en) 2001-04-05
CN1377408A (en) 2002-10-30
IL148770A0 (en) 2002-09-12
NO20021498D0 (en) 2002-03-26
JP2003510077A (en) 2003-03-18
EE200200168A (en) 2003-04-15
HRP20020269A2 (en) 2003-06-30
CA2387702A1 (en) 2001-04-05
EP1220920A1 (en) 2002-07-10
HUP0203080A2 (en) 2002-12-28
AU1132401A (en) 2001-04-30
CZ20021094A3 (en) 2002-06-12
ZA200202379B (en) 2003-10-29
PL354184A1 (en) 2003-12-29
SK4262002A3 (en) 2002-09-10
MXPA02002800A (en) 2002-07-22
KR20020047191A (en) 2002-06-21
EA200200286A1 (en) 2002-12-26
BR0014444A (en) 2002-06-11
BG106554A (en) 2003-01-31

Similar Documents

Publication Publication Date Title
DE69017753T3 (en) Tumor necrosis factor binding protein II, its purification and specific antibodies
DE69233421T2 (en) NOVEL RECEPTOR TYROSINE KINASE AND ITS USE
DE69734359T2 (en) RECOMBINANT VASCULAR ENDOTHELIAL CELL GROWTH FACTOR D (VEGF-D)
EP0393438A2 (en) TNF-receptor, TNF-binding protein and DNA coding therefor
DE69931360T2 (en) NEW RECIPE PROTEINS COUPLED TO A G-PROTEIN
DE69934239T2 (en) LY6H GEN
DE4200043A1 (en) Recombinant CD30 antigen (KI-1) and corresp. nucleic acid - for diagnosis of anaplastic large-cell lymphoma, and for prepn. of antibodies and antisera, in immuno-absorption, etc.
DE69233155T2 (en) INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN
EP0805204B1 (en) Epididymis-specific receptor protein and its use
EP1959013B1 (en) Human circulating virus inhibitory peptide (VRIP) and its use
EP0440321B1 (en) Epididymis specific polypeptides and their use
DE69931345T2 (en) GEN, WHICH CODES FOR NEW TRANSMEMBRANE PROTEIN
EP1123392B1 (en) Prv-1 gene and the use thereof
EP1191035A2 (en) Three members of the cytokin-receptor class II family
WO2001023554A1 (en) The prv-1 gene and use thereof
WO2003011907A2 (en) Receptor, the use thereof, and mouse antibodies
DE69533905T2 (en) Interferon alpha / beta binding protein, its production and application
DE69937191T2 (en) Gene encoding organic anion transporter
EP1023445B1 (en) Cadherin derived growth factor and the application thereof
EP1007671B1 (en) Fanconi-gen ii
DE19941897A1 (en) New deletion mutants of Interleukin-6 receptor protein useful for production of cell proliferation inhibitors for treatment of tumors, especially multiple myeloma
EP1112365A2 (en) Human and murine g-protein-coupled edg6 receptor (endothelial differentiation gene) and use of same
EP0939813A1 (en) Breast carcinoma-associated gene
DE10064906A1 (en) New nucleic acid encoding soluble cytokine receptor, useful for diagnosis and treatment of e.g. immune disease, also related protein and antibodies
DE10058907A1 (en) New nucleic acid encoding soluble cytokine receptor, useful for diagnosis and treatment of e.g. immune disease, also related protein and antibodies

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000972665

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: PA/a/2002/002800

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 148770

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2002/02379

Country of ref document: ZA

Ref document number: 2387702

Country of ref document: CA

Ref document number: 517990

Country of ref document: NZ

Ref document number: 200202379

Country of ref document: ZA

Ref document number: 200200286

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 4262002

Country of ref document: SK

ENP Entry into the national phase

Ref document number: 2000 106554

Country of ref document: BG

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PV2002-1094

Country of ref document: CZ

ENP Entry into the national phase

Ref document number: 2001 526936

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: P20020269A

Country of ref document: HR

Ref document number: 11324/01

Country of ref document: AU

Ref document number: IN/PCT/2002/00337/DE

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 1020027004095

Country of ref document: KR

Ref document number: 008135800

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: PV2002-1094

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: 1020027004095

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2000972665

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWR Wipo information: refused in national office

Ref document number: PV2002-1094

Country of ref document: CZ

WWW Wipo information: withdrawn in national office

Ref document number: 2000972665

Country of ref document: EP