WO2001016305A2 - Nucleotide sequences encoding an insectidal protein complex from serratia - Google Patents

Nucleotide sequences encoding an insectidal protein complex from serratia Download PDF

Info

Publication number
WO2001016305A2
WO2001016305A2 PCT/NZ2000/000174 NZ0000174W WO0116305A2 WO 2001016305 A2 WO2001016305 A2 WO 2001016305A2 NZ 0000174 W NZ0000174 W NZ 0000174W WO 0116305 A2 WO0116305 A2 WO 0116305A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
insecticidal
nucleic acid
seq
acid molecule
Prior art date
Application number
PCT/NZ2000/000174
Other languages
French (fr)
Other versions
WO2001016305A3 (en
Inventor
Travis Robert Glare
Mark Robin Holmes Hurst
Trevor Anthony Jackson
Original Assignee
Agresearch Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agresearch Limited filed Critical Agresearch Limited
Priority to AU74619/00A priority Critical patent/AU7461900A/en
Priority to NZ517478A priority patent/NZ517478A/en
Publication of WO2001016305A2 publication Critical patent/WO2001016305A2/en
Publication of WO2001016305A3 publication Critical patent/WO2001016305A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50—Isolated enzymes; Isolated proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present applicant has now found that three regions of the pADAP plasmid are required for full insecticidal function. Sequence analysis of these three regions has shown that the present applicant has isolated and identified a novel toxin from Serratia species that belongs to a new family of insecticidal toxins. It is broadly to this toxin that the present invention is directed.
  • an isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 1 which encodes an insecticidal protein complex, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
  • the invention also provides an isolated nucleic acid molecule comprising the nucleotide sequence 1995-18937 of SEQ ID NO: 1 which encodes an insecticidal protein complex, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
  • the invention also provides an isolated nucleic acid molecule comprising one or more of the nucleotide sequences 2411-9547, 9589-13883 or 14546-17467 of SEQ ID NO: 1 which encode insecticidal proteins, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
  • the nucleic acid molecule comprises all of nucleotide sequences 2411-9547, 9598-13884 and 14546-17467 of SEQ ID NO: 1.
  • the invention further relates to an isolated nucleic acid molecule comprising a sequence of SEQ ID NO: 1, nucleotides 1955-18937 of SEQ ID NO: 1 or one or more of nucleotides 2411-9547, 9598-13884 or 14546-17467 of SEQ ID NO: 1, operably linked to at least one further nucleotide sequence which encode an insecticidal protein.
  • the at least one further nucleotide sequence may be the nucleotide sequence which codes for the Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and or Photorhabadus luminescens toxins and so forth.
  • the nucleic acid molecule may comprise DNA, cDNA or RNA.
  • said fragment, neutral mutation or homolog thereof is capable of hybridising to said nucleic acid molecule under stringent hybridisation conditions.
  • the invention further relates to nucleic acid molecules which hybridise to the nucleotide sequence of SEQ ID NO: 1, or nucleotides 1955-18937, 2411-9547, 9598-13884 or 14546- 17467 of SEQ ID NO: 1 if there is at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity between the sequences.
  • the nucleic acid molecule may be isolated from Serratia entomophila or Serratia proteamaculans strains.
  • Also provided by the present invention are recombinant expression vectors containing the nucleic acid molecule of the invention and hosts transformed with the vector of the invention capable of expressing a polypeptide of the invention.
  • the vector may be selected from any suitable natural or artificial plasmid/vector.
  • pUC 19 Yamamoto et al. 1995
  • pProEX HT Gaithersburg, MD, USA
  • pBR322 Bolivar et al. 1977
  • pACYC184 Chang et al. 1978
  • pLAFR3 Staskowicz et al. 1987
  • the invention provides a method of producing a polypeptide of the invention comprising the steps of:
  • An additional aspect of the present invention provides a ligand that binds to a polypeptide of the invention.
  • the ligand is an antibody or antibody binding fragment.
  • Such ligands also form a part of this invention.
  • probes and primers comprising a fragment of the nucleic acid molecule of the invention capable of hybridising under stringent conditions to a native insecticidal gene sequence.
  • probes and primers are useful, for example, in studying the structure and function of this novel gene and for obtaining homologs of the gene from bacteria other than Serratia sp.
  • a polypeptide having insecticidal activity encoded by the nucleic acid molecule of the invention, or a functional fragment, neutral mutation or homolog thereof.
  • the polypeptide may comprise the amino acid sequence of SEQ ID NO: 1 or a functional fragment, neutral mutation or homolog thereof.
  • the polypeptide may comprise amino acids 32-5118 of SEQ ID NO: 1.
  • the polypeptide may comprise at least one amino acid sequence of SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 or SEQ ID NO: 6.
  • polypeptide comprises amino acid sequence SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6.
  • polypeptide comprises all of SEQ ID NOs: 2-6.
  • the polypeptide of the invention is obtained by expression of a DNA sequence coding therefore in a host cell or organism.
  • the polypeptide may comprise the amino acid sequence of SEQ ID NO: 1 linked to at least one further amino acid sequence encoding an insecticidal protein.
  • the at least one further amino acid sequence may be the amino acid sequence which codes for Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins etc.
  • the invention further relates to polypeptides comprising at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity to SEQ ID NO: 1.
  • the polypeptide may be produced by expression of a vector comprising the nucleic acid molecule of the invention or a functional fragment, neutral mutation or homolog thereof, in a suitable host cell.
  • an insecticidal composition comprising at least the polypeptide of the invention and an agriculturally acceptable carrier such as would be known to a person skilled in the art. More than one polypeptide of the invention can of course, be included in the composition.
  • the composition may comprise one or more additional pesticides, for example, compounds known to possess herbicidal, fungicidal, insecticidal or nematicidal activity.
  • composition may further comprise other known insecticidally active agents, such as Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins
  • insecticidally active agents such as Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins
  • a method of combating pests especially insects at a locus or host for the pest infested with or liable to be infested therewith, said method comprising applying to a locus, host and/or the pest, an effective amount of the polypeptide of the invention that has functional insecticidal activity against said pest.
  • the invention provides a method of inducing amber disease or like condition in insects comprising delivery to an insect an effective amount of the polypeptide of the invention that has functional insecticidal activity against said insect.
  • the insect may be selected from the order comprising Coleoptera (such as the black beetle, Heteronychus arator (F.), or the black vine weevil, Otiorhynchus sulcatus (F.)); Dictyoptera ⁇ eg. The German cockroach, Blattella germanica (L.), or the subterranean termite Coptotermes spp,); Diptera (eg. the housefly Musca domestica L. or the blowfly Lucillia cuprina (Wiedermann); Orthoptera (eg. The black field cricket Telleogryllus commodus (Walker) or the migratory locust Locusta migratoria L.); Hymenoptera (eg.
  • Coleoptera such as the black beetle, Heteronychus arator (F.), or the black vine weevil, Otiorhynchus sulcatus (F.)
  • Dictyoptera ⁇ eg.
  • Hemiptera such as the green vegetable bug Nezara viridula (L.) or the green peach aphid Myzus persicae (Sulzer)
  • the Lepidoptera eg. the tomato fruitworm, Helicoverpa armigera (Walker), or the codling moth, Laspeyresia pomonella (L.)
  • the Lepidoptera eg. the tomato fruitworm, Helicoverpa armigera (Walker), or the codling moth, Laspeyresia pomonella (L.)
  • the insecticidal polypeptide may be delivered to the insect orally either as a solid bait matrix, as a sprayable insecticide sprayed onto a substrate upon which the insect feeds, applied directly to the soil subsurface or as a drench or is expressed in an transgenic plant, bacterium, virus or fungus upon which the insect feeds, or by any other suitable method which would be obvious to a person skilled in the art.
  • the invention provides a transgenic plant, bacterium virus or fungus, incorporating in its genome, a nucleic acid molecule of the invention providing the plant, bacterium virus or fungus with an ability to express an effective amount of an insecticidal polypeptide.
  • nucleic acid or polypeptide refers to a naturally-occurring nucleic acid or polypeptide, including, wild-type sequence and alleles thereof.
  • a “homolog” has at least one of the biological activities of the nucleic acid or polypeptide of the invention and comprises at least 50-70% identical amino acid or nucleic acid sequence thereto, preferably 75-85% and most preferably 90-95% identical amino acid or nucleic acid sequence thereto.
  • neutral mutation means a mutation, (that is - a change in the nucleotide or polypeptide sequence such as by deletion, substitution, inversion or insertion, any of which have no effect on the function of the encoded protein).
  • variants of the polypeptide or peptide that differ from the native amino acid sequence by insertion, substitution or deletion of one or more amino acids.
  • the nucleotide sequence of the native DNA is altered appropriately. This alteration can be made through elective synthesis of the DNA, or by modification of the native DNA by, for example, site specific or cassette mutagenesis.
  • site-directed synthesis of the DNA or by modification of the native DNA by, for example, site specific or cassette mutagenesis.
  • portions of cDNA or genomic DNA require sequence modifications, site-
  • the present invention consists in replicable transfer vector suitable for use in preparing a polypeptide of the invention.
  • replicable transfer vectors suitable for use in preparing a polypeptide of the invention.
  • These vectors may be constructed according to techniques well known in the art, or may be selected from cloning vecotrs available in the art.
  • the cloning vector may be selected according to the host or host cell to be used.
  • Useful vectors will generally have the following characteristics:
  • (c) desirably, carry genes for a readily selectable marker such as antibiotic resistance.
  • vectors Two major types of vector possessing these characteristics are plasmids and bacterial viruses (bacteriophages or phages).
  • plasmids include plasmids pMOS- Blue, pGem-T and pUC8.
  • nucleic acids of the present invention can be free in solution, or attached by conventional means to a solid support, or present in an expression vector or any other type of plasmid.
  • isolated means substantially separated or purified away from contaminating sequences in the cell or organism in which the nucleic acid naturally occurs and includes nucleic acids purified by standard purification techniques as well as nucleic acids prepared by recombinant technology and those chemically synthesised.
  • DNA construct means a construct incorporating the nucleic acid molecule of the present invention, or a fractional fragment, neutral mutation or homolog thereof in a position whereby the protein coding sequence is under the control of an operably linked promoter capable of expression in a plant cell.
  • promoters are well known in the art.
  • a fragment of a nucleic acid molecule according to the present invention is a portion of the nucleic acid that is less than full length and comprises at least a minimum length capable of hybridising specifically with a nucleic acid molecule according to the present invention (or a sequence complementary thereto) under stringent conditions as defined below.
  • a fragment according to the present invention has at least one of the biological activities of the nucleic acid or polypeptide of the present invention.
  • Nucleic acid probes and primers can be prepared based on nucleic acids according to the present invention (for example, the sequence of SEQ ID NO: 1).
  • a "probe” comprises an isolated nucleic acid attached to a detectable label or reporter molecule well known in the art. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes.
  • Primer pairs are short nucleic acids, preferably DNA oligonucleotides 15 nucleotides or more in length, which are annealed to a complementary target DNA strand by nucleic acid hybridisation to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, preferably a DNA polymerase. Primer pairs can be used for amplification of a nucleic acid sequence, (for example, by the polymerase chain reaction (PCR) or other nucleic acid amplification methods well known in the art).
  • PCR polymerase chain reaction
  • PCT-primer pairs can be derived from the sequence of a nucleic acid according to the present invention, (for example, by using computer programs intended for that purpose such as Primer (Version 0.5 ⁇ 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA)).
  • Probes or primers can be free in solution or covalently or noncovalently attached to a solid support by standard means.
  • operably linked means a first nucleic acid sequence linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
  • the DNA molecules of the invention may be expressed by placing them in operable linkage with suitable control sequences in a replicable expression vector.
  • Control sequences may include origins of replication, a promoter, enhancer and transcriptional terminator sequences, amongst others.
  • the selection of the control sequence to be included in the expression vector is dependent on the type of host or host cell intended to be used for expressing the DNA.
  • a "recombinant" nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids (for example, by genetic engineering techniques).
  • nucleic acid according to the present invention can be produced by recombinant means well known in the art or by chemical synthesis.
  • Natural or synthetic nucleic acids according to the present invention can be incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in a host cell.
  • DNA constructs will be suitable for replication in a unicellular host, such as E. coli or other commonly used bacteria, but can also be introduced into yeast, mammalian, plant or other eukaryotic cells.
  • such a nucleic acid construct is a vector comprising a replication system recognised by the host.
  • a vector comprising a replication system recognised by the host.
  • well known compositions and techniques for preparing and using vectors, host cells, introduction of vectors into host cells and so forth., are employed, as discussed, inter alia, in Sambrook et al (1989).
  • a cell, tissue, organ, or organism into which has been introduced a foreign nucleic acid, such as a recombinant vector, is considered “transformed” or "transgenic".
  • the DNA construct comprising a DNA sequence according to the present invention that is present in a transgenic host cell, particularly a transgenic plant, is referred to as a "transgene”.
  • transgenic or “transformed” when referring to a cell or organism, also includes;
  • procaryotic, yeast, insect, or mammalian cells are useful hosts.
  • plasmid vectors include E. coli, Bacillus species and various species of Pseudomonas.
  • Commonly used promoters such as ⁇ -lactamase (penicillinase) and lactose (lac) promoter systems are all well known in the art. Any available promoter system compatible with the host of choice can be used.
  • Vectors used in yeast are also available and well known. A suitable example is the 2 micron origin
  • vectors for use in mammalian cells are also well known.
  • Such vectors include well known derivatives of SV-40, adenovirus, retrovirus-derived DNA sequences, Herpes simplex virus, and vectors derived from a combination of plasmid and phage DNA.
  • the expression vectors useful in the present invention contain at least one expression control sequence that is operatively linked to the DNA sequence or fragment to be expressed.
  • the control sequence is inserted in the vector in order to control and to regulate the expression of the cloned DNA sequence.
  • useful expression control sequences are the lac system, the trp_ system, the tac system, the trc system, major operator and promoter regions of phage lambda, the glycolytic promoters of yeast acid phosphatase, (for example, Pho5), the promoters of the yeast alpha-mating factors, and promoters derived fron polyoma, adenovirus, retrovirus, and simian virus (for example, the early and late promoters of SV-40), and other sequences known to control the expression of genes of prokaryotic and eucaryotic cells and their viruses or combinations thereof.
  • Reporter systems useful in such assays include reported genes, and other detectable labels which produce measurable colour changes, antibiotic resistance and the like.
  • the ⁇ -galactosidase reporter gene is used, which gene is detectable by clones exhibiting a blue phenotype on X-gal plates. This facilitates selection.
  • the ⁇ -galactosidase gene may be replaced by a polyhedrin-encoding gene; which gene is detectable by clones exhibiting a white phenotype when stained with X-gal.
  • This blue-white colour selection can serve as a useful marker for detecting recombinant vectors.
  • the vectors may be isolated from the culture using routine procedures such as freeze-thaw extraction followed by purification.
  • vectors containing the DNA of the invention to be expressed and control signals are inserted or transformed into a host or host cell.
  • Some useful expression host cells include well-known prokaryotic and eucaryotic cells.
  • Some suitable prokaryotic hosts include, for example, E. coli, such as E. coli, S G-936, E. coli HB 101, E. coli W3110, E. coli XI 776, E. coli, X2282, E. coli DHT and E. coli MR01, Pseudomonas, Bacillus ⁇ such as Bacillus subtilis and Streptomyces.
  • Suitable eucaryotic cells include yeast and other fungi, insect, animal cells, such as COS cells and CHO cells, human cells and plant cells in tissue culture.
  • transformation is performed according to standard techniques appropriate to such cells.
  • the calcium treatment process (Cohen, S N Proceedings, National Academy of Science, USA 69 21 10 (1972)) may be employed.
  • the calcium phosphate precipitation method of Graeme and Van Der ⁇ b, Virology 52:546 (1978) is preferred. Transformations into plants may be carried out using Agrobacterium tumefaciens (Shaw et al., Gene 23:315 (1983)) or into yeast according to the method of Van
  • polypeptide, or peptide encoded can be produced, often in the form of fusion protein, by culturing the host cells.
  • the polypeptide, or peptide, of the invention may be detected by rapid assays as indicated above.
  • the polypeptide, or peptide is then recovered and purified as necessary. Recovery and purification can be achieved using any of those procedures known in the art, for example by absorption onto the elution from an anion exchange resin. This method of producing a polypeptide, or peptide, of the invention constitutes a further aspect of the present invention.
  • Host cells transformed with the vectors of the invention also form a further aspect of the present invention.
  • nucleic acids Methods for chemical synthesis of nucleic acids are well known and can be performed, for example, on commercial automated oligonucleotide synthesisers.
  • stringent conditions is functionally defined with regard to the hybridisation of a nucleic acid probe to a target nucleic acid (for example, to a particular nucleic acid sequence of interest) by the hybridisation procedure discussed in Sambrook et al. (1989) at 9.52-9.55 and 9.56-9.58.
  • stringent conditions are conditions that permit the primer pair to hybridise only to the target nucleic acid sequence to which a primer having the corresponding wild type sequence (or its complement) would bind.
  • Nucleic acid hybridisation is affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary
  • the term "specific for (a target sequence)" indicates that the probe or primer hybridises under stringent conditions only to the target sequence in a given sample comprising the target sequence.
  • protein refers to a protein encoded by the nucleic acid molecule of the invention including fragments, mutations and homologs having the same biological activity (for example, insecticidal activity).
  • the polypeptide of the invention can be isolated from a natural source, produced by the expression of a recombinant nucleic acid molecule or be chemically synthesised.
  • substantially sequence identity means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80% sequence identity, preferably at least 90% sequence identity, more preferably at least 95% sequence identity or more.
  • residue positions that are not identical differ by conservative amino acid substitutions. For example, the substitution of amino acids having similar chemical properties such as charge or polarity are not likely to effect the properties of a protein. Examples include glutamine for asparagine, or glutamic acid for aspartic acid.
  • Figure 1 shows restriction maps of clones used to isolate the pathogenic region and maps of the two pathogenic variants pMH32 and pMH41, in accordance
  • Figure 2 shows deletion derivatives used in the study, restriction maps of the mutated constructs and recombinants, the phenotype of each mutation, the schematic diagram of the sequenced region, and a nucleotide sequence in accordance v with a preferred embodiment of the present invention
  • Figure 3 shows hydrophobicity plots of SepC and its closest homologue TccC, in accordance with a preferred embodiment of the present invention.
  • Figure 4 shows the comparison of protein sequences of the SepA and P. luminescens toxins, TcdA, TcaB and TccB Putative RGD motif is boxed, plus the site of proteolytic cleavage is illustrated, in accordance with a preferred embodiment of the present invention.
  • Figure 5 shows the comparison of protein sequences of the SepC and P. luminescens toxin TccC, in accordance with a preferred embodiment of the present v invention.
  • Figure 6 shows the plasmid pADAP, in accordance with a preferred embodiment of the present invention.
  • Figure 1 shows restriction maps of clones used to isolate the pathogenic region and maps of the two pathogenic variants pMH32 and pMH41, where:
  • Map of pBG35 showing relative position of pGLA-20-35 mutation and the location of the 2.2kb EcoRi used as a probe to screen the pADAP BamHI library;
  • Restriction enzymes are abbreviated as follows: B, BamHI, Bg, BglR; E, Ec ⁇ RI: H, HindiS; and X, Xbal.
  • Restriction enzymes are abbreviated as follows: B, BamHI, Bg, BglR; E, EcoRI; H, HindSl; and X, Xbal.
  • BI Denotes sequenced region.
  • (E) Is a nucleotide sequence of the 5 times 12bp repeat and the palindrome.
  • Restriction enzymes are abbreviated as follows: B, ⁇ HI, Bg, BglR; E, EcoRI; H, HindSl; and X, Xbal.
  • Figure 4 shows the comparison of protein sequences of the SepA and P. luminescens toxins, TcdA, TcaB and TccB. Putative RGD motif is boxed. The site of proteolytic cleavage is reported by Bowen et al. (1998) (Residue 1933 of TcdA) is indicated by an arrow.
  • Figure 5 shows the comparison of protein sequences of the SepC and P. luminescens toxin TccC; and Figure 6 shows the plasmid pADAP.
  • Table 1 lists bacterial isolates and plasmids used in the present invention. Bacteria were grown in LB broth or on LB agar (Sambrook et al. 1989), at 37° for Escherichia coli and 30°C for S. entomophila. Antibiotic concentrations used ( ⁇ g/ml) for Serratia were kanamycin 100, chloramphenicol 90, tetracycline 30 and for E. coli strains were kanamycin 50, chloramphenicol 30, tetracycline 15, and ampicillin 100.
  • pADAP DNA was isolated from a 50ml overnight culture of bacteria using QIAGEN ® plasmid maxi kit (Qiagen, Hilden, Germany), as per the manufacturer's instructions. Standard DNA techniques were carried out as described by Sambrook et al. (1989). Radioactive probes were made using the Amersham Megaprime DNA labeling system (Amersham, ⁇ Buckinghamshire, UK). Southern and colony hybridisations were performed as outlined in Sambrook et al. (1989). The plasmid pADAP is shown in Figure 6.
  • pADAP BamHI library was constructed using a Sigma 'Gigapack ® ⁇ LXL packaging extract, as specified by the manufacturer (Stratagene, California, USA).
  • pLAFR3 based derivatives were introduced into S. entomophilia by tripartite matings on solid media as described previously (Finnegan & Sheratt, 1982) using the pRK2013 helper plasmid (Figorski & Helanski, 1979).
  • pACYC184 and ⁇ BR322 based plasmids were electroporated into E. coli and S. entomophilia strains, using a Biorad Gene Pulser (2 ⁇ F, 2.5KV, and 200 abns) (Dower et al. 1988).
  • Transposon insertions were generated in recombinant plasmids using the mmi-TnlO derivative 103 (kanamycin resistant) as described by Kleckner et al. (1991). Insertions were recombined into pADAP by transforming A1MO2 (refer to Table 1) with the described construct. After growth in non-selective media, bacteria were screened for resistance to kanamycin and loss of the pLAFR3 tetracycline resistance marker.
  • Infection of C. zealandica larvae was determined by a standard bioassay where the healthy larvae, collected from the field, were individually fed squares of carrot which had been rolled in colonies of bacteria grown overnight on solid media (resulting in approximately 10 5 cells/carrot square). Twelve, second or third instar larvae were used for each treatment. Inoculated larvae were maintained at 15°C, in ice-cube trays. Larvae were left feeding on treated carrot for 3-4 days, then transferred to fresh trays and provided with untreated carrot for 10-14 days. The occurrence of gut clearance and loss of feeding was recorded every 3-4 days. Strains were considered disease-causing if greater than 70% of larvae showed disease symptoms by day 14. Known pathogenic and non pathogenic controls were included in all bioassays. Typically cessation of feeding occurs within 2-3 days while clearance of the larvae gut may take 4-6 days.
  • a 9-kb BamHI -EcoRl fragment derived from the pBM32-8 mutation (Fig 2b) and the 8kb HindRl fragment of pBM32 were separately cloned into the appropriate site of the deletion factory plasmid pDELTAl. Deletions were generated using the Delection factoryTM system (GIBCO BRL, MD, USA), as outlined in the manufacturers instructions. To identify the precise location of mini-7hi0 mutations, the peripheral -TnlO BamHI sites were used in conjunction with the BamHI sites of the pathogenic region to subclone the mini-7ni0 flanking regions into either pACYC184 or pUC19. Sequences were generated using the mini-TnlO specific primer 5 ⁇ TGACAAGATGTGTATCCACC3' (Kleckner et al. 1991).
  • Plasmids for sequencing were prepared by Wizard ® (Promega, Madison, USA) or Quantum Prep ® (Bio-Rad, California, USA) miniprep kits. Sequences were determined on both strands, by using combinations of subcloned fragments, custom primers and deletion products derived from the deletion factory system (Gibco BRL, Madison, USA). The DNA was sequenced using either 3 P dCTP and the Thermosequenase cycle sequencing kit (Amersham, Buckinghamshire, UK), or by automated sequencing using an Applied Biosystem 373A or 377 autosequencer. Sequence data were assembled using SEQMAN (DNASTAR Inc., Madison, USA). ORF's were analysed by Gene Jockey.
  • the resultant digest was ligated into the BamHI site of bBR322 to form the construct pBG35 (containing 12.8kb BglR - mm ' i-TnlO fragment).
  • pBG35 was placed separately in trans with pADK-10 and pGLA-20, and the resultant strains bioassayed against grass grub larvae. Results showed that pBG35 was able to complement the pADK-10 mutant, but was unable to induce any symptoms of amber disease when placed in trans with pGLA-20, indicating that there must be another region on pADAP needed to induce amber disease.
  • the plasmids pMH32 and pMH41 were subsequently introduced into a S. entomophilia strain cured of pADAP (5.6RC) and the strains bioassayed against grass grub larvae. The strains gave the same disease progression as wild type and no larvae recovered, suggesting that the region cloned in pMH32 contained all the pathogenic determinants of pADAP.
  • the 23kb BamHI fragment from pMH32 was cloned into the medium copy plasmid pBR322 to give pBM32.
  • a bioassay comparing the ability of pMH32 and pBM32 to induce amber disease against grass grub was undertaken. Results showed that there were no visual differences in the progression of amber disease between pBM32 and pMH32.
  • the construct pBM32 was mutated with the mini-7n70 transposon derivative 103, and insertions mapped (Fig 2b). Bioassays of E. coli strains containing plasmids of the resultant mutants, showed that the disease determinants were confined within a central 16.9kb region (nucleotides 1955-18937 of SEQ ID NO: 1).
  • pBM32 based insertions were transferred into pADAP.
  • DNA fragments containing the inserted transposon and flanking DNA were cloned as independent fragments into pLAFR3 and the inserts recombined back into pADAP by marker exchange (Fig 2c). The resultant recombinant S.
  • the large BamHI fragment (18937 bp) derived from the pBM32-8 was sequenced on both strands using a combination of constructed detections, plasmid subclones and custom made primers.
  • a total continuous sequence of 18937 bp has been deposited in Gene Bank (Accession Number AF 135182).
  • Structural analysis of the DNA sequence using DNAMAN showed that there was a 12-bp sequence repealed five times between positions 683 and 743. The repeat is flanked by an upstream 13 base pair palindrome (669-682-bp), and a degenerate 34-bp downstream palindrome (765-799-bp)(Fig 2d,e).
  • ORF's open reading frames
  • the protein product of sepA had high similarity to the P. luminescents insecticidal toxin complex protein TcbA, TcdA, TcaB and TccB. These proteins shared three significant tasks
  • SepB and the P. luminescens insecticidal toxin complex protein TcaC shared similarity throughout their length, and both SepA and TcaC showed high amino-terminal similarity to the Salmonella virulence protein spvB (Gullig et al. 1992) (Fig. 5).
  • the similarity of SepB and TcaC to SprB diminishes after SpvB amino acid residue 356.
  • SepC showed strong similarity to the amino-terminal of the insecticidal toxin complex protein TccC, up to amino-acid residue 663 of SepC.
  • a number of putative bacterial cell wall proteins also have high similarity to SepC, including the wall associated protein precursor B. subtilis (WAP A) and members of the E. coli Rhs (recombinant hot spot) elements. Strong similarity of SepC was also observed with hypothetical wall-associated proteins from Coxiella burnetti and Bacillus subtilis (Table 4).
  • ORF1 and ORF2 showed no similarity to sequences in the current databases.
  • ORF3 shared significant similarity to the morphogenesis protein of the Bacillus subtilis bacteriophage B103, a member of bacteriophage muramidase-type lysis proteins (Pecenkova et al. 1996). However, relative to size, the gpl9 protein of S. typhimurium phage ⁇ S18 (146 amino-acid residues) or the nucD/regB phage lysozymes of S. marcescens (179 amino-acid residues) are more similar.
  • ORF4 showed similarity to E. coli bacteriophage N15gp 55 protein, a protein of unknown function (Zimmer et al. 1998).
  • 27 termination codon is a 204 base pair region assigned ORF5, which has high similarity to a S. typhimurium revol vase/in vertase protein.
  • ORF5 is disrupted by two stop codons at amino-acid residues 19 and 64, making it unlikely that an active resolvase/invertase protein, is encoded by this region.
  • a 256-bp region of encompassed by ORF5 (17498-17754) showed high similarity (77% identity) to the region (AF020806; 1629-1885 bp) encoding S. typhimurium DNA invertase gene (Valdivia et al. 1997) suggesting a similar ancestral origin. ⁇
  • ORF6 Downstream of ORF5 and oriented in the opposite direction from 18935-18163 was a 870 base pair region of DNA designated ORF6 whose product showed high amino-acid similarity over two different reading frames to the insertion element IS9 ⁇ of E. coli (Mendiola et al. 1992). The translated sequence is interrupted at amino-acid residue 149 of the IS9 ⁇ element and later resumed on a second reading frame, before its similarity switched back to the original reading frame. Swtiching of ORF's is a common feature of members of the IS3 family where the transposase is encoded by this overlapping ORF's (Prere et al. 1990). However, the switch back to the initial strand is atypical. ORF6 may therefore be a dysfunctional relic of an ancestral IS element. It is unknown whether ORF6 contains a ribosomal binding site as its predicted location would lie outside the sequenced region. There was no DNA similarity to the 7591 element.
  • RGD tripeptide cell-binding motif Asp-Gly-Arg
  • the RGD motif is present in cell surface adhesions produced by the human pathogen Bordetella pertussis, namely the filamentous heamagglutinin (220 kDa) (Relman et al. 1989), and the outer membrane protein pertactin (69 kDa) (Leininger et al. 1991).
  • Bordetella pertussis namely the filamentous heamagglutinin (220 kDa) (Relman et al. 1989), and the outer membrane protein pertactin (69 kDa) (Leininger et al. 1991).
  • These motifs have been implicated in enhancing the binding of B. pertussis to eukaryotic cells. Because the RGD motif found in SepA falls in a
  • SepB and TcaC shared similarity to the Salmonella virulence protein SpvB, the amino-terminil of SepB and TcaC were hydrophilic as opposed to the hydrophobic nature of SpvB.
  • the profile of SepC and its Photorhabadus counterpart TccC differed in that SepC had a slightly hydrophilic amino- terminus, whereas TccC lacked a hydrophilic amino-terminus and had a significantly hydrophobic carboxyl terminus from amino-acid residue 717 onwards (Fig. 3).
  • the large conjugative plasmid, pADAP, of S. entomophilia encodes the genes responsible for cessation of feeding and gut clearance, characteristics of amber disease in the New Zealand grass grub C. zealandica.
  • This plasmid is present in all S. entomophilia and S. proteamaculans strains capable of causing amber disease (Glare et al. 1993) and had been implicated in disease processes (Grkovic et al. 1995).
  • the applicant has defined a 16.9 kb region of kADAP that is sufficient to confer pathogenicity towards C. zealandica on pADAP-cured strains of S. entomophilia and on strains of E. coli.
  • the region confers all the essential pathogenicity genes of S. entomophilia responsible for amber disease.
  • Nucleotide sequence and mutagenesis analysis of the region revealed three genes, SepA, SepB and SepC, that together are sufficient for pathogenicity. Mutations in any of the three genes completely abolished the disease process and partial disease states were not detected, suggesting that the three genes may interact to exert an effect.
  • ambl A putative anti-feeding gene, ambl, has already been isolated from the genomic DNA of S. entomophilia (Nunez- Valdez and Mahanty, 1996). Recent data indicate that the ambl locus resides at an as yet to be identified location on pADAP that is remote from the region identified herein (Hurst, unpublished data).
  • the similarity shared between the sep and tc gene products suggests that they are members of a new family of insecticidal toxins.
  • the Photorhabadus toxins were isolated as a composite of proteins which are hypothesised to interact synergistically to form a toxin complex.
  • the toxins are also able to exert an anti-feeding effect (Bowen et al. 1998; Bowen and Ensign, 1998). This is consistent with the results we obtained with the sep mutants.
  • pADAP-cured S. entomophilia strains containing the pathogenicity clone pBM32 exert an anti-feeding effect on the grass grub and individual mutations within any of the sep genes have an identical phenotype, completely abolishing pathogenicity.
  • the Photorhabadus toxins have a wide host range, affecting Lepidoptera, Coleoptera and Dictyoptera and undergo post translational
  • the Photorhabdus toxin TcbA shares weak similarity to the Clostridium difficile A and B toxins (Bowen, 1998), but no such similarities were found to SepA.
  • C. difficile A and B toxins belong to the RTX (repeats in toxin) family of toxins which are noted for the presence of several carboxyl terminal repeats (von Eichel-Streiber et al. 1992).
  • a search of the sep proteins and their P. luminescens homologues for protein repeats showed that only the P. luminescens TcaC protein contained a repeat-type signature.
  • the TcaC carboxy- terminal repeat bears little resemblance in size or number of repeats found in RTX toxins (von Eichel-Streiber et al. 1992). SepA does not show weak similarity to the mosquitocidal toxin Cbm71 of C. bifermentans (Barloy et al. 1996). However when this region is compared with the relevant Photorhabdus homologues, it is a region with little similarity.
  • SepB has strong similarities to both P. luminescens TccC and the Salmonella virulence gene product SpvB (Gulig et al. 1992). SpvB is believed to enhance the survival of virulent Salmonella in macrophages (Libby et al. 1997). It has been suggested that TcaC may act by attacking insect haemocytes (Bowen et al. 1998). However, haemocytes reside within the insect haemocoel and S. entomophilia does not invade the haemocoel until late in the infection process (Jackson et al. 1993), suggesting that SepB may act in some other way.
  • the SepC protein shows high similarity to a family of cell wall-associated bacterial proteins such as the B. subtilis wall-associated protein (WAP A) and members of the E. coli rhs element family.
  • WAP A B. subtilis wall-associated protein
  • the function of the Rhs proteins has yet to be established, but they are believed to be cell surface ligand-binding proteins (Hill et al. 1994).
  • the Rhs proteins and the B. subtilis was-associated protein contain a characteristic repetitive peptide motif, but no such motif was observed in SepC.
  • a feature of rhs elements is the presence of a downstream IS element (Wang et al. 1998).
  • a degenerate IS91-type transposase element (ORF6) is present downstream of SepC.
  • the IS91 element has been found associated with plasmids or chromosomal genes involved in ⁇ -haemolysin synthesis, and has been postulated to play a pivotal role in the spread of the ⁇ -haemolysin genes by means of the IS91 -mediated recombinational activity (Zabala et al. 1984). It seems possible an IS element adjacent to SepC may have been involved in the acquisition of the sep genes by S. entomophilia.
  • the S. entomophilia pathogenicity region endows pathogenicity on members of the Enterobacteraceae such as Klebsiella spp., Enterobacter agglomerans, E. coli, and Serratia
  • the Sep proteins are the major virulence determinants, that the promoters of the sep genes are expressed constitutively or under the control of conserved regulatory genes, or a negative regulatory gene present in the pathogenicity region, and that export of the toxin proteins is carried out by a conserved chromosomally encoded system, or is an intrinsic property of the sep proteins.
  • the Sep proteins have no obvious amino terminal signal sequences, a facet shared with E-Group colicins.
  • the release of cloacin DF13 is mediated through a small lipoprotein designated BRP, for bacteriocin-release protein.
  • ORF3 may have an as yet to be determined important functional role. Protein similarity searches show that it has high similarity to the bacteriophage lysozyme family. In relation to amino-acid size, ORF3 closely resembles the LZBP22 lysozyme of the Salmonella P2 bacteriophage, a protein essential for the lysis of the bacterial cell wall (Rennell and Poteete, 1985).
  • ORF3 may facilitate the release of the sep proteins by lysing the bacterial cell wall.
  • a low level expression of ORF3 might, as in the case of BRP, allow the passage of the sep proteins across the cell wall without causing cell death.
  • the reason that the pBM32-9 and -24 mutations were unable to abolish the disease process could be due to a masking of ORF3 function by natural cell lysis of the bacteria.
  • a region of repetitive DNA was identified between nucleotides 683 to 743, centered within a 1.2-kb AT rich stretch of DNA that contains no potential ORF's.
  • the repeat motif is flanked by an upstream 13-bp palindrome and a degenerate downstream 33-bp palindrome. Repeats have been found to be common sites for recombination (Allgood et al. 1988), or to facilitate the binding of proteins.
  • a 66-bp DNA sequence termed the rsk element for reduced serum killing, of the S. typhimurium 95-kb virulence plasmid, comprises of a series
  • the initiation codon ATG of the three sep genes (sepA, sepB and sepC) were individually placed into the unique Ndel site (restriction enzyme site CATGG) of the HIS-tag arabinose expression vector pAV2-10 (obtained from Chuck Shoemaker -AgResearch). Because large proteins i.e. greater than 50 kda are limited in their ability to bind to HIS tag affinity columns the carboxyl terminus of each of the Sep proteins did not need to be in frame with the HIS-tag site.
  • the use of the chloramphenicol resistant marker provided by the vector pACYC184 enhances the stability to each of the expression constructs i.e. -the antibiotic ampicilin to which the pAV2-10 is resistant too is cleaved in the media to an inactive form leading to possible plasmid free segregants arising. Conversely the antibiotic chloramphenicol is not cleaved heightening the level of plasmid stability under conditions of arabinose induction.
  • sepB and sepC genes were placed as derived from pADAP downstream of sepA. Also sepA, sepB and sepC were placed as in pADAP downstream of orf3. This simulated wildtype conditions (i.e. the arrangement of the sep genes on pADAP) and hopefully get the production of the sep genes and the complex driven off the one upstream promoter. A method which Western analysis has shown to be successful -with moderate levels of sepA, sepB and sepC being detected.
  • the arabinose expression system is one of the tightest systems known with almost complete abolition of gene product under arabiniose free conditions Guzman et al. (1995), this abolition can be enhanced by providing glucose to the medium. In contrast providing arabinose at the concentration of 0.2% will switch the arabinose promoter on express any genes under its control e.g. sepA etc.
  • an overnight culture of the E. coli strain was set up the next day an 100 ⁇ l of the culture was suspended in fresh media supplemented with chloramphenicol (30 ⁇ g/ml) the culture was grown until an OD of 400 at which time arabinose was added to the culture to a final concentration of 0.2% and the culture left shaking at 30 °C for 18 hours.
  • Each of the following Coleopteran species were mouth injected with 3-5 ⁇ l of an overnight suspension of induced bacteria (E. coli strain DHB101) containing either SepA, SepB and SepC or orf3, SepA, SepB and SepC.
  • E. coli strain DHB101 induced bacteria
  • the region containing pathogenic determinants of the disease has been cloned, and further defined by mutagenesis and deletion analysis to a 16.9 kb region. Sequence analysis of the minimal pathogenic encoding region showed significant protein homology, but little sequence homology to a group of newly described toxins from a member of the Enterobacteriaceae, Photorhabadus luminescens.
  • This pathogenicity-encoding region from S. entomophilia plasmid pADAP is the subject of the invention.
  • the proteins encoded by the genes (sepA, sepB, sepC) within the 16.9 kb region can be used for insect control whether as an inundative pesticide, within baits or expressed in other organisms such as plants or microbes.
  • Salmonella typhimurium virulence plasmid Salmonella typhimurium virulence plasmid. Mol. Microbiol. 6 : 1395-1411.
  • Max efficiency DH10BTM A host for cloning methylated DNA.
  • amb2 locus from Serratia entomophila confers anti-feeding effect on larvae of
  • Bacteriophage B103 complete DNA sequence of its genome and relationship to other
  • Rhs elements comprise three subfamilies which diverged prior to acquisition by
  • M13 phage cloning vectors and host strains nucleotide sequence of M13mpl8 and pUC 19 vectors. Gene 33, 103-119.
  • Lysis gene modules in the phage P22 gene pool Zimmer A Institute for Genetics and Microbiology, University of Kunststoff, Maria-Ward-Str. la, Muenchen D-80638, Germany XI 67137. Accession number (AF064539).
  • Percent identities and similarities were calculated in relation to the deduced gene products of the sequenced ORF. 'indicates position of amino-acid similarity in relation to sequence generated in this study. ⁇ indicates position of amino-acid similarity in relation to data base protein sequence. * reading frame. ⁇ similarities were considered potentially significant if the BlastP score exceeded e' 5 . 48
  • a purified and isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ED NO: 1 that encodes at least one of:
  • a purified and isolated nucleic acid molecule as claimed in Claim 1 comprising the nucleotide sequence 1995-18937 of SEQ ID NO: 1.
  • a purified and isolated nucleic acid molecule as claimed in Claim 1 comprising one or more of the nucleotide sequences 2411-9547, 9589-13883 or 14546-17467 of SEQ ID NO: 1.
  • a purified and isolated nucleic acid molecule as claimed in Claim 3 comprising all of nucleotide sequences 241 1-9547, 9598-13884 and 14546-17467 of SEQ ID NO: 1.
  • a purified and isolated nucleic acid molecule as claimed in Claim 1 comprising a sequence of SEQ ID NO: 1, operably linked to at least one further nucleotide sequence which encode an insecticidal protein.
  • a purified and isolated nucleic acid molecule as claimed in Claim 2 comprising nucleotides 1955-18937 of SEQ ID NO: 1 , operably linked to at least one further nucleotide sequence which encode an insecticidal protein.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Pest Control & Pesticides (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Environmental Sciences (AREA)
  • Dentistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Agronomy & Crop Science (AREA)
  • Cell Biology (AREA)
  • Insects & Arthropods (AREA)
  • Physics & Mathematics (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The present invention concerns novel nucleotide sequences encoding proteins from the Enterobacteriaceae, Serratia entomophila and Serratia proteamaculans, and the use of said nucleotide sequences and proteins for inherent insecticidal and potentially metazoacidal properties. The invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an insecticidal protein complex, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with the nucleic acid molecule under standard hybridisation conditions. The nucleotide sequences include a pathogenicity-encoding region cloned from bacteria Serratia entomophilia and S. proteamaculans. The region contain pathogenic determinants of a disease that affect the grass grub, Costelytra zealandica Coleoptera: Scarabaeidae, an important insect pasture pest in New Zealand. The proteins encoded by determined genes may be used for insect control whether as an inundative pesticide, within baits or expressed in other organisms such as plants or microbes.

Description

common function.
The present applicant has now found that three regions of the pADAP plasmid are required for full insecticidal function. Sequence analysis of these three regions has shown that the present applicant has isolated and identified a novel toxin from Serratia species that belongs to a new family of insecticidal toxins. It is broadly to this toxin that the present invention is directed.
DISCLOSURE OF INVENTION
According to a first aspect of the present invention, there is provided an isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 1 which encodes an insecticidal protein complex, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
The invention also provides an isolated nucleic acid molecule comprising the nucleotide sequence 1995-18937 of SEQ ID NO: 1 which encodes an insecticidal protein complex, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
The invention also provides an isolated nucleic acid molecule comprising one or more of the nucleotide sequences 2411-9547, 9589-13883 or 14546-17467 of SEQ ID NO: 1 which encode insecticidal proteins, or a functional fragment, neutral mutation, or homolog thereof capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
Preferably the nucleic acid molecule comprises all of nucleotide sequences 2411-9547, 9598-13884 and 14546-17467 of SEQ ID NO: 1. The invention further relates to an isolated nucleic acid molecule comprising a sequence of SEQ ID NO: 1, nucleotides 1955-18937 of SEQ ID NO: 1 or one or more of nucleotides 2411-9547, 9598-13884 or 14546-17467 of SEQ ID NO: 1, operably linked to at least one further nucleotide sequence which encode an insecticidal protein. For example, the at least one further nucleotide sequence may be the nucleotide sequence which codes for the Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and or Photorhabadus luminescens toxins and so forth.
The nucleic acid molecule may comprise DNA, cDNA or RNA.
Preferably said fragment, neutral mutation or homolog thereof is capable of hybridising to said nucleic acid molecule under stringent hybridisation conditions.
The invention further relates to nucleic acid molecules which hybridise to the nucleotide sequence of SEQ ID NO: 1, or nucleotides 1955-18937, 2411-9547, 9598-13884 or 14546- 17467 of SEQ ID NO: 1 if there is at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity between the sequences.
The nucleic acid molecule may be isolated from Serratia entomophila or Serratia proteamaculans strains.
Also provided by the present invention are recombinant expression vectors containing the nucleic acid molecule of the invention and hosts transformed with the vector of the invention capable of expressing a polypeptide of the invention.
The vector may be selected from any suitable natural or artificial plasmid/vector. For example, pUC 19 (Yannish-Perron et al. 1995), pProEX HT (GibcoBRL, Gaithersburg, MD, USA), pBR322 (Bolivar et al. 1977), pACYC184 (Chang et al. 1978), pLAFR3 (Staskowicz et al. 1987), and so forth.
4 In a further aspect, the invention provides a method of producing a polypeptide of the invention comprising the steps of:
(a) culturing a host cell which has been transformed or transfected with a vector as defined above to express the encoded polypeptide or peptide; and
(b) recovering the expressed polypeptide or peptide.
An additional aspect of the present invention provides a ligand that binds to a polypeptide of the invention. Most usually, the ligand is an antibody or antibody binding fragment. Such ligands also form a part of this invention.
According to a further aspect of the present invention there are provided probes and primers comprising a fragment of the nucleic acid molecule of the invention capable of hybridising under stringent conditions to a native insecticidal gene sequence. Such probes and primers are useful, for example, in studying the structure and function of this novel gene and for obtaining homologs of the gene from bacteria other than Serratia sp.
According to a still further aspect of the present invention there is provided a polypeptide having insecticidal activity encoded by the nucleic acid molecule of the invention, or a functional fragment, neutral mutation or homolog thereof.
The polypeptide may comprise the amino acid sequence of SEQ ID NO: 1 or a functional fragment, neutral mutation or homolog thereof.
The polypeptide may comprise amino acids 32-5118 of SEQ ID NO: 1.
The polypeptide may comprise at least one amino acid sequence of SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 or SEQ ID NO: 6.
Preferably the polypeptide comprises amino acid sequence SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6.
More preferably the polypeptide comprises all of SEQ ID NOs: 2-6.
Conveniently, the polypeptide of the invention is obtained by expression of a DNA sequence coding therefore in a host cell or organism.
The polypeptide may comprise the amino acid sequence of SEQ ID NO: 1 linked to at least one further amino acid sequence encoding an insecticidal protein. For example, the at least one further amino acid sequence may be the amino acid sequence which codes for Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins etc.
The invention further relates to polypeptides comprising at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity to SEQ ID NO: 1.
The polypeptide may be produced by expression of a vector comprising the nucleic acid molecule of the invention or a functional fragment, neutral mutation or homolog thereof, in a suitable host cell.
According to a further aspect, there is provided an insecticidal composition comprising at least the polypeptide of the invention and an agriculturally acceptable carrier such as would be known to a person skilled in the art. More than one polypeptide of the invention can of course, be included in the composition. In addition, the composition may comprise one or more additional pesticides, for example, compounds known to possess herbicidal, fungicidal, insecticidal or nematicidal activity.
The composition may further comprise other known insecticidally active agents, such as Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins
6 and so forth.
According to a further aspect, there is provided a method of combating pests, especially insects at a locus or host for the pest infested with or liable to be infested therewith, said method comprising applying to a locus, host and/or the pest, an effective amount of the polypeptide of the invention that has functional insecticidal activity against said pest.
According to a further aspect the invention provides a method of inducing amber disease or like condition in insects comprising delivery to an insect an effective amount of the polypeptide of the invention that has functional insecticidal activity against said insect.
The insect may be selected from the order comprising Coleoptera (such as the black beetle, Heteronychus arator (F.), or the black vine weevil, Otiorhynchus sulcatus (F.)); Dictyoptera {eg. The German cockroach, Blattella germanica (L.), or the subterranean termite Coptotermes spp,); Diptera (eg. the housefly Musca domestica L. or the blowfly Lucillia cuprina (Wiedermann); Orthoptera (eg. The black field cricket Telleogryllus commodus (Walker) or the migratory locust Locusta migratoria L.); Hymenoptera (eg. The German wasp, Vespula germanica ¥.)); Hemiptera (such as the green vegetable bug Nezara viridula (L.) or the green peach aphid Myzus persicae (Sulzer)) the Lepidoptera (eg. the tomato fruitworm, Helicoverpa armigera (Walker), or the codling moth, Laspeyresia pomonella (L.)).
The insecticidal polypeptide may be delivered to the insect orally either as a solid bait matrix, as a sprayable insecticide sprayed onto a substrate upon which the insect feeds, applied directly to the soil subsurface or as a drench or is expressed in an transgenic plant, bacterium, virus or fungus upon which the insect feeds, or by any other suitable method which would be obvious to a person skilled in the art.
According to a further aspect, the invention provides a transgenic plant, bacterium virus or fungus, incorporating in its genome, a nucleic acid molecule of the invention providing the plant, bacterium virus or fungus with an ability to express an effective amount of an insecticidal polypeptide.
DEFINITIONS AND METHODS
The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention.
Definitions of common terms in molecular biology may also be found in Lewin, Genes V, Oxford University Press: New York, 1994.
The term "native" refers to a naturally-occurring nucleic acid or polypeptide, including, wild-type sequence and alleles thereof.
A "homolog" has at least one of the biological activities of the nucleic acid or polypeptide of the invention and comprises at least 50-70% identical amino acid or nucleic acid sequence thereto, preferably 75-85% and most preferably 90-95% identical amino acid or nucleic acid sequence thereto.
The term "neutral mutation" means a mutation, (that is - a change in the nucleotide or polypeptide sequence such as by deletion, substitution, inversion or insertion, any of which have no effect on the function of the encoded protein).
As indicated above, also possible are variants of the polypeptide or peptide that differ from the native amino acid sequence by insertion, substitution or deletion of one or more amino acids. Where such a variant is desired, the nucleotide sequence of the native DNA is altered appropriately. This alteration can be made through elective synthesis of the DNA, or by modification of the native DNA by, for example, site specific or cassette mutagenesis. Preferably, where portions of cDNA or genomic DNA require sequence modifications, site-
8 specific primer directed mutagenesis is employed using techniques standard in the art.
In a further aspect, the present invention consists in replicable transfer vector suitable for use in preparing a polypeptide of the invention. These vectors may be constructed according to techniques well known in the art, or may be selected from cloning vecotrs available in the art.
The cloning vector may be selected according to the host or host cell to be used. Useful vectors will generally have the following characteristics:
(a) the ability to self-replicate;
(b) the possession of a single target for any particular restriction endonuclease; and
(c) desirably, carry genes for a readily selectable marker such as antibiotic resistance.
Two major types of vector possessing these characteristics are plasmids and bacterial viruses (bacteriophages or phages). Presently preferred vectors include plasmids pMOS- Blue, pGem-T and pUC8.
The nucleic acids of the present invention can be free in solution, or attached by conventional means to a solid support, or present in an expression vector or any other type of plasmid. *
The term "isolated" means substantially separated or purified away from contaminating sequences in the cell or organism in which the nucleic acid naturally occurs and includes nucleic acids purified by standard purification techniques as well as nucleic acids prepared by recombinant technology and those chemically synthesised.
The terms "DNA construct" means a construct incorporating the nucleic acid molecule of the present invention, or a fractional fragment, neutral mutation or homolog thereof in a position whereby the protein coding sequence is under the control of an operably linked promoter capable of expression in a plant cell. Such promoters are well known in the art.
A fragment of a nucleic acid molecule according to the present invention is a portion of the nucleic acid that is less than full length and comprises at least a minimum length capable of hybridising specifically with a nucleic acid molecule according to the present invention (or a sequence complementary thereto) under stringent conditions as defined below. A fragment according to the present invention has at least one of the biological activities of the nucleic acid or polypeptide of the present invention.
Nucleic acid probes and primers can be prepared based on nucleic acids according to the present invention (for example, the sequence of SEQ ID NO: 1). A "probe" comprises an isolated nucleic acid attached to a detectable label or reporter molecule well known in the art. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes.
"Primers" are short nucleic acids, preferably DNA oligonucleotides 15 nucleotides or more in length, which are annealed to a complementary target DNA strand by nucleic acid hybridisation to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, preferably a DNA polymerase. Primer pairs can be used for amplification of a nucleic acid sequence, (for example, by the polymerase chain reaction (PCR) or other nucleic acid amplification methods well known in the art). PCT-primer pairs can be derived from the sequence of a nucleic acid according to the present invention, (for example, by using computer programs intended for that purpose such as Primer (Version 0.5© 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA)).
Methods for preparing and using probes and primers are described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed, vol. 1-3, ed Sambrook
10 et al. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY, 1989.
Probes or primers can be free in solution or covalently or noncovalently attached to a solid support by standard means.
The term "operably linked" means a first nucleic acid sequence linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
The DNA molecules of the invention may be expressed by placing them in operable linkage with suitable control sequences in a replicable expression vector. Control sequences may include origins of replication, a promoter, enhancer and transcriptional terminator sequences, amongst others. The selection of the control sequence to be included in the expression vector is dependent on the type of host or host cell intended to be used for expressing the DNA.
A "recombinant" nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids (for example, by genetic engineering techniques).
Techniques for nucleic acid manipulation are described generally in, for example, Sambrook et al. (1989).
Large amounts of a nucleic acid according to the present invention can be produced by recombinant means well known in the art or by chemical synthesis.
11 Natural or synthetic nucleic acids according to the present invention can be incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in a host cell. Usually the DNA constructs will be suitable for replication in a unicellular host, such as E. coli or other commonly used bacteria, but can also be introduced into yeast, mammalian, plant or other eukaryotic cells.
Preferably, such a nucleic acid construct is a vector comprising a replication system recognised by the host. For the practice of the present invention, well known compositions and techniques for preparing and using vectors, host cells, introduction of vectors into host cells and so forth., are employed, as discussed, inter alia, in Sambrook et al (1989).
A cell, tissue, organ, or organism into which has been introduced a foreign nucleic acid, such as a recombinant vector, is considered "transformed" or "transgenic". The DNA construct comprising a DNA sequence according to the present invention that is present in a transgenic host cell, particularly a transgenic plant, is referred to as a "transgene". The term "transgenic" or "transformed" when referring to a cell or organism, also includes;
(1) progeny of the cell or organism, and
(2) plants produced from a breeding program employing such a "transgenic" plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of the recombinant DNA construct.
Generally, procaryotic, yeast, insect, or mammalian cells are useful hosts. Also included within the term hosts are plasmid vectors. Suitable procaryotic hosts include E. coli, Bacillus species and various species of Pseudomonas. Commonly used promoters such as β-lactamase (penicillinase) and lactose (lac) promoter systems are all well known in the art. Any available promoter system compatible with the host of choice can be used. Vectors used in yeast are also available and well known. A suitable example is the 2 micron origin
12 of replication plasmid.
Similarly, vectors for use in mammalian cells are also well known. Such vectors include well known derivatives of SV-40, adenovirus, retrovirus-derived DNA sequences, Herpes simplex virus, and vectors derived from a combination of plasmid and phage DNA.
Further eucaryotic expression vectors are known in the art (for example in P.J. Southern and P. Berg, J. Mol. Appl. Genet. 1 327-341 (1982); S. Subramani et al., Mol. Cell. Biol. 1, 854-864 (1981); R.J. Kaufmann and P. A. Sharp, "Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reducase Complementary DNA Gene, J. Mol. Biol. 159, 601-621 (1982); R.J. Kaufmann and P.A. Sharp, Mol. Cell. Biol. 159, 601-664 (1982); S.L Scahill et al., "Expressions and Characterisation of the Product of a Human Immune Interf eron DNA Gene in Chinese Hamster Ovary Cells," Proc. Natl. Acad. Sci. USA. 80, 4654-4659 (1983); G. Urlaub and L.A. Chasin, Proc. Natl. Acad. Sci. USA. 77, 4216-4220, (1980).
The expression vectors useful in the present invention contain at least one expression control sequence that is operatively linked to the DNA sequence or fragment to be expressed. The control sequence is inserted in the vector in order to control and to regulate the expression of the cloned DNA sequence. Examples of useful expression control sequences are the lac system, the trp_ system, the tac system, the trc system, major operator and promoter regions of phage lambda, the glycolytic promoters of yeast acid phosphatase, (for example, Pho5), the promoters of the yeast alpha-mating factors, and promoters derived fron polyoma, adenovirus, retrovirus, and simian virus (for example, the early and late promoters of SV-40), and other sequences known to control the expression of genes of prokaryotic and eucaryotic cells and their viruses or combinations thereof.
In the construction of a vector it is also an advantage to be able to distinguish the vector incorporating the foreign DNA from unmodified vectors by a convenient and rapid assay.
13 Reporter systems useful in such assays include reported genes, and other detectable labels which produce measurable colour changes, antibiotic resistance and the like. In one preferred vector, the β-galactosidase reporter gene is used, which gene is detectable by clones exhibiting a blue phenotype on X-gal plates. This facilitates selection. In one embodiment, the β-galactosidase gene may be replaced by a polyhedrin-encoding gene; which gene is detectable by clones exhibiting a white phenotype when stained with X-gal.
This blue-white colour selection can serve as a useful marker for detecting recombinant vectors.
Once selected, the vectors may be isolated from the culture using routine procedures such as freeze-thaw extraction followed by purification.
For expression, vectors containing the DNA of the invention to be expressed and control signals are inserted or transformed into a host or host cell. Some useful expression host cells include well-known prokaryotic and eucaryotic cells. Some suitable prokaryotic hosts include, for example, E. coli, such as E. coli, S G-936, E. coli HB 101, E. coli W3110, E. coli XI 776, E. coli, X2282, E. coli DHT and E. coli MR01, Pseudomonas, Bacillus^ such as Bacillus subtilis and Streptomyces. Suitable eucaryotic cells include yeast and other fungi, insect, animal cells, such as COS cells and CHO cells, human cells and plant cells in tissue culture.
Depending on the host used, transformation is performed according to standard techniques appropriate to such cells. For prokaryotes or other cells that contain substantial cell walls, the calcium treatment process (Cohen, S N Proceedings, National Academy of Science, USA 69 21 10 (1972)) may be employed. For mammalian cells without such cell walls the calcium phosphate precipitation method of Graeme and Van Der Εb, Virology 52:546 (1978) is preferred. Transformations into plants may be carried out using Agrobacterium tumefaciens (Shaw et al., Gene 23:315 (1983)) or into yeast according to the method of Van
14 Solingen et al. J. Bact. 130:946 (1977) and Hsiao et al. Proceedings, National Academy of
Science, 76:3829 (1979).
Upon transformation of the selected host with an appropriate vector the polypeptide, or peptide encoded can be produced, often in the form of fusion protein, by culturing the host cells. The polypeptide, or peptide, of the invention may be detected by rapid assays as indicated above. The polypeptide, or peptide, is then recovered and purified as necessary. Recovery and purification can be achieved using any of those procedures known in the art, for example by absorption onto the elution from an anion exchange resin. This method of producing a polypeptide, or peptide, of the invention constitutes a further aspect of the present invention.
Host cells transformed with the vectors of the invention also form a further aspect of the present invention.
Methods for chemical synthesis of nucleic acids are well known and can be performed, for example, on commercial automated oligonucleotide synthesisers.
The term "stringent conditions" is functionally defined with regard to the hybridisation of a nucleic acid probe to a target nucleic acid (for example, to a particular nucleic acid sequence of interest) by the hybridisation procedure discussed in Sambrook et al. (1989) at 9.52-9.55 and 9.56-9.58.
Regarding the amplification of a target nucleic acid sequence (for example,, by PCR) using a particular amplification primer pair, stringent conditions are conditions that permit the primer pair to hybridise only to the target nucleic acid sequence to which a primer having the corresponding wild type sequence (or its complement) would bind.
Nucleic acid hybridisation is affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary
15 strands, and the number of nucleotide base mismatches between the hybridising nucleic acids, as will be readily appreciated by those skilled in the art.
When referring to a probe or primer, the term "specific for (a target sequence)" indicates that the probe or primer hybridises under stringent conditions only to the target sequence in a given sample comprising the target sequence.
The term "protein (or polypeptide)" refers to a protein encoded by the nucleic acid molecule of the invention including fragments, mutations and homologs having the same biological activity (for example, insecticidal activity). The polypeptide of the invention can be isolated from a natural source, produced by the expression of a recombinant nucleic acid molecule or be chemically synthesised.
Peptides having substantial sequence identity to the above-mentioned peptides can also be employed in preferred embodiments. Here, "substantial sequence identity" means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80% sequence identity, preferably at least 90% sequence identity, more preferably at least 95% sequence identity or more. Preferably, residue positions that are not identical differ by conservative amino acid substitutions. For example, the substitution of amino acids having similar chemical properties such as charge or polarity are not likely to effect the properties of a protein. Examples include glutamine for asparagine, or glutamic acid for aspartic acid.
BRIEF DESCRIPTION OF DRAWINGS
The invention will be further defined by reference to the specification and the following examples and figures herein.
Figure 1 shows restriction maps of clones used to isolate the pathogenic region and maps of the two pathogenic variants pMH32 and pMH41, in accordance
16 with a preferred embodiment of the present invention; and
Figure 2 shows deletion derivatives used in the study, restriction maps of the mutated constructs and recombinants, the phenotype of each mutation, the schematic diagram of the sequenced region, and a nucleotide sequence in accordance v with a preferred embodiment of the present invention; and
Figure 3 shows hydrophobicity plots of SepC and its closest homologue TccC, in accordance with a preferred embodiment of the present invention; and
Figure 4 shows the comparison of protein sequences of the SepA and P. luminescens toxins, TcdA, TcaB and TccB Putative RGD motif is boxed, plus the site of proteolytic cleavage is illustrated, in accordance with a preferred embodiment of the present invention; and
Figure 5 shows the comparison of protein sequences of the SepC and P. luminescens toxin TccC, in accordance with a preferred embodiment of the present v invention; and
Figure 6 shows the plasmid pADAP, in accordance with a preferred embodiment of the present invention.
BEST MODES FOR CARRYING OUT THE INVENTION
The invention will be further defined by reference to the specification and the following examples and figures herein in the ensuing description by way of example only where:
Figure 1 shows restriction maps of clones used to isolate the pathogenic region and maps of the two pathogenic variants pMH32 and pMH41, where:
(A) Is the pADAP HindQi clone pGLA-20 showing locations of the pGLA-20 mutations -
17 10, -13, and 35, which when recombined back into pADAP and bioassayed against grass grub, result in either a pathogenic phenotype, shown by full flag, or a healthy but non- feeding phenotype indicated by half filled flag. Map of pBG35 showing relative position of pGLA-20-35 mutation and the location of the 2.2kb EcoRi used as a probe to screen the pADAP BamHI library; and
(B) Illustrated restriction enzyme maps of the pathogenic clones pMH32 and pMH41, area of deletion is indicated by Δ.
ESS pBR322 vector DNA;
WM ρLAFR3 vector DNA.
Restriction enzymes are abbreviated as follows: B, BamHI, Bg, BglR; E, EcøRI: H, HindiS; and X, Xbal.
Figure 2 shows:
(A) Which are Mini-Tni pACYC184 based deletion derivatives used in the study,
is the pACYC184 vector,
Δ indicates deletion + pathogenic,
loss of pathogenicity; and
(B) Illustrates restriction maps of the mutated constructs pBM32 and the pADK recombinants; and
(C) Where the phenotype of each mutant is indicated by flags.
Blocked flags indicates mutations that did not affect the disease process.
Open flags indicate mutations that abolish disease symptoms.
18 Half-filled flags denote mutations that abolish visual disease symptoms but are unable to feed.
* indicates pADK mutations obtained by Grkovic et al. (1995).
Restriction enzymes are abbreviated as follows: B, BamHI, Bg, BglR; E, EcoRI; H, HindSl; and X, Xbal.
(D) Is a schematic diagram of the sequenced region, where:
BI Denotes sequenced region.
Arrows indicate ORFs and their direction
Ε23 region homologous to spvB ... location of repeat.
(E) Is a nucleotide sequence of the 5 times 12bp repeat and the palindrome.
Restriction enzymes are abbreviated as follows: B, βα HI, Bg, BglR; E, EcoRI; H, HindSl; and X, Xbal.
In Figure 3 hydrophobicity plots of SepC and its closest homologue TccC are shown. The scale is disproportional to size and has a scanning window of 17 amino-acid residues.
Figure 4 shows the comparison of protein sequences of the SepA and P. luminescens toxins, TcdA, TcaB and TccB. Putative RGD motif is boxed. The site of proteolytic cleavage is reported by Bowen et al. (1998) (Residue 1933 of TcdA) is indicated by an arrow.
Figure 5 shows the comparison of protein sequences of the SepC and P. luminescens toxin TccC; and Figure 6 shows the plasmid pADAP.
19 PROTOCOL
Bacterial isolates and methods of culture
Table 1 lists bacterial isolates and plasmids used in the present invention. Bacteria were grown in LB broth or on LB agar (Sambrook et al. 1989), at 37° for Escherichia coli and 30°C for S. entomophila. Antibiotic concentrations used (μg/ml) for Serratia were kanamycin 100, chloramphenicol 90, tetracycline 30 and for E. coli strains were kanamycin 50, chloramphenicol 30, tetracycline 15, and ampicillin 100.
DNA isolation and manipulations
pADAP DNA was isolated from a 50ml overnight culture of bacteria using QIAGEN® plasmid maxi kit (Qiagen, Hilden, Germany), as per the manufacturer's instructions. Standard DNA techniques were carried out as described by Sambrook et al. (1989). Radioactive probes were made using the Amersham Megaprime DNA labeling system (Amersham, ^Buckinghamshire, UK). Southern and colony hybridisations were performed as outlined in Sambrook et al. (1989). The plasmid pADAP is shown in Figure 6.
pADAP BamHI library was constructed using a Sigma 'Gigapack®πLXL packaging extract, as specified by the manufacturer (Stratagene, California, USA).
Introduction of plasmid DNA into E. coli and 5. entomophilia
pLAFR3 based derivatives were introduced into S. entomophilia by tripartite matings on solid media as described previously (Finnegan & Sheratt, 1982) using the pRK2013 helper plasmid (Figorski & Helanski, 1979). pACYC184 and ρBR322 based plasmids were electroporated into E. coli and S. entomophilia strains, using a Biorad Gene Pulser (2μF, 2.5KV, and 200 abns) (Dower et al. 1988).
20 Mutagenesis
Transposon insertions were generated in recombinant plasmids using the mmi-TnlO derivative 103 (kanamycin resistant) as described by Kleckner et al. (1991). Insertions were recombined into pADAP by transforming A1MO2 (refer to Table 1) with the described construct. After growth in non-selective media, bacteria were screened for resistance to kanamycin and loss of the pLAFR3 tetracycline resistance marker.
Bioassay against Costelytra zealandica larvae
Infection of C. zealandica larvae was determined by a standard bioassay where the healthy larvae, collected from the field, were individually fed squares of carrot which had been rolled in colonies of bacteria grown overnight on solid media (resulting in approximately 105 cells/carrot square). Twelve, second or third instar larvae were used for each treatment. Inoculated larvae were maintained at 15°C, in ice-cube trays. Larvae were left feeding on treated carrot for 3-4 days, then transferred to fresh trays and provided with untreated carrot for 10-14 days. The occurrence of gut clearance and loss of feeding was recorded every 3-4 days. Strains were considered disease-causing if greater than 70% of larvae showed disease symptoms by day 14. Known pathogenic and non pathogenic controls were included in all bioassays. Typically cessation of feeding occurs within 2-3 days while clearance of the larvae gut may take 4-6 days.
Recovery of bacteria from larvae
To isolate bacteria from inoculated grubs, larvae were surface sterilised by submerging in 70% methanol for 30 seconds. The larvae were then shaken in sterile DH 0, removed and individually macerated in a 1.5ml microcentrifuge tube. The macerate was serial diluted and plated on LB media containing antibiotics selective for the host S. entomophilia strain. To assess the stability of the bioassayed plasmid, colonies were patched onto a plate
21 containing antibiotics either selective for the recombinant plasmid or the S. entomophilia strain. Identity of plasmids in the recovered strain was checked by restriction enzyme profile.
Nucleotide Sequencing
A 9-kb BamHI -EcoRl fragment derived from the pBM32-8 mutation (Fig 2b) and the 8kb HindRl fragment of pBM32 were separately cloned into the appropriate site of the deletion factory plasmid pDELTAl. Deletions were generated using the Delection factory™ system (GIBCO BRL, MD, USA), as outlined in the manufacturers instructions. To identify the precise location of mini-7hi0 mutations, the peripheral -TnlO BamHI sites were used in conjunction with the BamHI sites of the pathogenic region to subclone the mini-7ni0 flanking regions into either pACYC184 or pUC19. Sequences were generated using the mini-TnlO specific primer 5ΑTGACAAGATGTGTATCCACC3' (Kleckner et al. 1991).
Plasmids for sequencing were prepared by Wizard® (Promega, Madison, USA) or Quantum Prep® (Bio-Rad, California, USA) miniprep kits. Sequences were determined on both strands, by using combinations of subcloned fragments, custom primers and deletion products derived from the deletion factory system (Gibco BRL, Madison, USA). The DNA was sequenced using either 3 P dCTP and the Thermosequenase cycle sequencing kit (Amersham, Buckinghamshire, UK), or by automated sequencing using an Applied Biosystem 373A or 377 autosequencer. Sequence data were assembled using SEQMAN (DNASTAR Inc., Madison, USA). ORF's were analysed by Gene Jockey. Databases at the National Center for Biotechnology Information were searched by using BLASTN and BLASTX via the www.ncbi.nlm.gov BLAST. Searches for DNA palindromes, repeats and inverted repeats were undertaken using DNAMAN (Lynnon Biosoft, Quebec, Canada). Protein motifs were searched using Blocks (http://www.blocks.flicrc.org/), ExPASy (http://www.expasy.ch/), and Gene Quiz (http://columba.ebi.ac. uk:8765/gqsrv/submit).
22 The sequences determined in this study have been deposited in Gene Bank under Accession
Number AF1335182.
RESULTS
Cloning the disease encoding region from pADAP
Previously, Grkovic et al. (1995) have shown taht the pADK-13 mutation can be complemented with the pADAP 1 1 kb HindRl fragment (pGLA-20). However, the pADK- 10 mutation was unable to be complemented with pGLA-20. In an attempt to isolate the region that may complement the pADK-10 mutation the previously described pGLA-20 derived, pADK-35 null mutation (Grkovic et al. 1995) was used as a selective marker (Fig 1), to select the BglR fragment encompassing both the pADK-10 and pADK-35 mutations. pADK-35 DNA was isolated and digested with the restriction enzyme BglR. The resultant digest was ligated into the BamHI site of bBR322 to form the construct pBG35 (containing 12.8kb BglR - mm' i-TnlO fragment). pBG35 was placed separately in trans with pADK-10 and pGLA-20, and the resultant strains bioassayed against grass grub larvae. Results showed that pBG35 was able to complement the pADK-10 mutant, but was unable to induce any symptoms of amber disease when placed in trans with pGLA-20, indicating that there must be another region on pADAP needed to induce amber disease.
Restriction enzyme data of pGLA-20 and pBG35 suggested that the entire pathogenic region may reside within one of the large BamHI fragments of pADAP. A cosmid BamHI library of pADAP was made and screened using the 2.2kb EcσRI fragment derived from pBG35 (Fig 1) as the probe. Several probe positive clones were isolated; all shared similar restriction enzyme profiles. However, one (designated pMH32) was found to be smaller, measuring osjly 23kb in size compared with the 33kb of the other clones (eg. pMH41; Fig lb). The difference between pMH32 and pMH41 was found to be a lOkb deletion at the left most end of pMH32 encompassing the one HindRl site (Fig 1). E. coli strains
23 containing pMH32 or pMH41 were bioassays against grass grub larvae and found to induce the full symptoms of amber disease (that is - gut clearance and antifeeding activity). However, about ten days after infection a proportion of grass grubs fed the E. coli strains were found to recover from a diseased to a healthy phenotype.
The plasmids pMH32 and pMH41 were subsequently introduced into a S. entomophilia strain cured of pADAP (5.6RC) and the strains bioassayed against grass grub larvae. The strains gave the same disease progression as wild type and no larvae recovered, suggesting that the region cloned in pMH32 contained all the pathogenic determinants of pADAP.
Effect of copy number and mini-7nl0 insertions in pBM32 on disease-causing ability
To facilitate mutagenesis and assess the effect of copy number on the disease process, the 23kb BamHI fragment from pMH32 was cloned into the medium copy plasmid pBR322 to give pBM32. A bioassay comparing the ability of pMH32 and pBM32 to induce amber disease against grass grub was undertaken. Results showed that there were no visual differences in the progression of amber disease between pBM32 and pMH32. The construct pBM32 was mutated with the mini-7n70 transposon derivative 103, and insertions mapped (Fig 2b). Bioassays of E. coli strains containing plasmids of the resultant mutants, showed that the disease determinants were confined within a central 16.9kb region (nucleotides 1955-18937 of SEQ ID NO: 1).
All strains were non-pathogenic or fully pathogenic, and no partial disease phenotypes such as antifeeding, or gut clearance were noted.
To confirm that no sequences at either end of the cloned fragment influenced the disease process, several deletion plasmids were made (Fig 2a). The large fragments resulting from cleavage of the pBM32 -4, -8, -10, -20, -23, -24 and -35 plasmids with BamHI were cloned into the analogues site of pACYC184. The resultant plasmids were transformed into the
24 non-pathogenic S. entomophilia strain 5.6RKm and assessed for pathogenicity. This analysis confirmed that the central 16.9kb region (Fig 2a) was sufficient to induce the disease.
Effect of mini-Tniø insertions in pADAP on disease-causing ability
Grkovic et al. (1995) recombined by marker exchange the pGLA-20 based mutations - 10 and -13 into pADAP (Fig 2a). When bioassayed, S. entomophilia strains containing either of these mutant plasmids caused a partial condition including cessation of feeding but not gut clearance or amber colouration. This was in contrast to the complete abolition of disease observed in pADAP-cured 5. entomophilia strains containing mutant pBM32 plasmids with similar insertions.
To determine the disease phenotype of the pBM32-based insertions in a pADAP background, the pBM32 based insertions were transferred into pADAP. pBM32 -1, -2, -4, -5, -6, -8, -9, -10, -21, -24, -30, -31 and -35 DNA fragments containing the inserted transposon and flanking DNA were cloned as independent fragments into pLAFR3 and the inserts recombined back into pADAP by marker exchange (Fig 2c). The resultant recombinant S. entomophilia strains were checked by Southern analysis to confirm that recombination had occurred as expected and no pLAFR3 vector sequences were present (data not shown). Mutations that did not affect the disease process in pBM32 also had no effect when recombined back into pADAP. However, strains with the pADAP mutants that totally abolished the disease process when in the pBM32 clone caused non-feeding but not gut clearance of the grubs (Fig 2b, c). Hence, none of the pADAP recombinant strains completely abolished the disease process. This suggests that, while the 16.9kb fragment contains all genes required for pathogenicity, other genes contributing to the antifeeding effect are present on some other part of pADAP.
Assessment of plasmid stability during the course of the bioassay showed that greater than
25 90% of the recombinant Serratia strains contained the clone of interest.
Nucleotide Sequence Analysis of the pathogenic region
The large BamHI fragment (18937 bp) derived from the pBM32-8 was sequenced on both strands using a combination of constructed detections, plasmid subclones and custom made primers. A total continuous sequence of 18937 bp has been deposited in Gene Bank (Accession Number AF 135182). Structural analysis of the DNA sequence using DNAMAN showed that there was a 12-bp sequence repealed five times between positions 683 and 743. The repeat is flanked by an upstream 13 base pair palindrome (669-682-bp), and a degenerate 34-bp downstream palindrome (765-799-bp)(Fig 2d,e).
Translation of the nucleotide sequence revealed nine significant open reading frames (ORF's). These together with their putative ribosomal binding sites and their base composition are listed in Table 2. Eight of the ORF's were oriented in the same direction and the other two in the opposite direction (Fig 2d). Sequence similarity searches showed that the deduced products of seven of these ORF's shared similarity with known proteins (Table 3). Products of three of the ORF's showed similarity to different protein components of insecticidal toxins of Photorhabadus luminescents (Bowen et al. 1998).
These ORF's have been designated sep. (sepA, sepB and sepC) for Serratia entomophilia pathogenicity.
Similarities of deduced amino-acid sequences to proteins in current database
Results of database searches for homologues proteins are listed in Table 4.
With reference to Fig 2d and Table 4, the following protein similarities were identified:
The protein product of sepA, had high similarity to the P. luminescents insecticidal toxin complex protein TcbA, TcdA, TcaB and TccB. These proteins shared three significant
26 regions of predicted amino-acid similarity, at the amino-terminal region (SepA amino-acid residues (121-178), a central region (SepA amino-acid residues 960-1083) and, with greatest similarity, at the carboxyl terminus (SepA amino-acid residues 1630-2376) Fig. 4). However, there was little amino acid conservation around the putative proteolytic cleavage site of TcaB, TcbA and TcdA identified by Bowen et al. (1998). SepA also contained a region (residues 1057-1345) with weak similarity to the Clostridium bifermentans mosquitocidal toxin cbm71 (Barloy et al., 1996).
SepB and the P. luminescens insecticidal toxin complex protein TcaC shared similarity throughout their length, and both SepA and TcaC showed high amino-terminal similarity to the Salmonella virulence protein spvB (Gullig et al. 1992) (Fig. 5). The similarity of SepB and TcaC to SprB diminishes after SpvB amino acid residue 356.
SepC showed strong similarity to the amino-terminal of the insecticidal toxin complex protein TccC, up to amino-acid residue 663 of SepC. A number of putative bacterial cell wall proteins also have high similarity to SepC, including the wall associated protein precursor B. subtilis (WAP A) and members of the E. coli Rhs (recombinant hot spot) elements. Strong similarity of SepC was also observed with hypothetical wall-associated proteins from Coxiella burnetti and Bacillus subtilis (Table 4).
The translated sequences of ORF1 and ORF2 showed no similarity to sequences in the current databases. ORF3 shared significant similarity to the morphogenesis protein of the Bacillus subtilis bacteriophage B103, a member of bacteriophage muramidase-type lysis proteins (Pecenkova et al. 1996). However, relative to size, the gpl9 protein of S. typhimurium phage ΕS18 (146 amino-acid residues) or the nucD/regB phage lysozymes of S. marcescens (179 amino-acid residues) are more similar. ORF4 showed similarity to E. coli bacteriophage N15gp 55 protein, a protein of unknown function (Zimmer et al. 1998).
Located in the same orientation as the sep genes and 134bp downstream of the SepC
27 termination codon is a 204 base pair region assigned ORF5, which has high similarity to a S. typhimurium revol vase/in vertase protein. However ORF5 is disrupted by two stop codons at amino-acid residues 19 and 64, making it unlikely that an active resolvase/invertase protein, is encoded by this region. A 256-bp region of encompassed by ORF5 (17498-17754) showed high similarity (77% identity) to the region (AF020806; 1629-1885 bp) encoding S. typhimurium DNA invertase gene (Valdivia et al. 1997) suggesting a similar ancestral origin. ^
Downstream of ORF5 and oriented in the opposite direction from 18935-18163 was a 870 base pair region of DNA designated ORF6 whose product showed high amino-acid similarity over two different reading frames to the insertion element IS9\ of E. coli (Mendiola et al. 1992). The translated sequence is interrupted at amino-acid residue 149 of the IS9\ element and later resumed on a second reading frame, before its similarity switched back to the original reading frame. Swtiching of ORF's is a common feature of members of the IS3 family where the transposase is encoded by this overlapping ORF's (Prere et al. 1990). However, the switch back to the initial strand is atypical. ORF6 may therefore be a dysfunctional relic of an ancestral IS element. It is unknown whether ORF6 contains a ribosomal binding site as its predicted location would lie outside the sequenced region. There was no DNA similarity to the 7591 element.
Analysis for* protein motifs showed that a tripeptide cell-binding motif Asp-Gly-Arg (RGD), implicated in the binding of various adhesion proteins produced by parasites and viruses to eukaryotic cells (Leininger et al. 1991), is present in SepA and the P. luminescens TcdA, and TcaB proteins (Fig. 4). The RGD motif is present in cell surface adhesions produced by the human pathogen Bordetella pertussis, namely the filamentous heamagglutinin (220 kDa) (Relman et al. 1989), and the outer membrane protein pertactin (69 kDa) (Leininger et al. 1991). These motifs have been implicated in enhancing the binding of B. pertussis to eukaryotic cells. Because the RGD motif found in SepA falls in a
28 region of high similarity between SepA and its P. luminescens counterparts, it may play a role in meditating the attachment of the protein and/or the bacteria to the insect cell wall.
The hydropathicity profile of each of the Sep proteins was examined using the Kyte and Doolittle algorithm (Kyte and Doolittle, 1982) and compared to the relevant P. luminescens homologues. None of the Sep proteins contained a positively charged amino terminus followed by a hydrophobic region, characteristic of a signal sequence (Gierasch, 1989). The profiles of SepA, TcbA and TcdA were very similar (data not shown) and each exhibited a steep hydrophilic peak at the carboxyl terminus (residues 2055-2061 of SepA), specifically the protein sequence RRRRE (Fig. 4). Although both SepB and TcaC shared similarity to the Salmonella virulence protein SpvB, the amino-terminil of SepB and TcaC were hydrophilic as opposed to the hydrophobic nature of SpvB. The profile of SepC and its Photorhabadus counterpart TccC differed in that SepC had a slightly hydrophilic amino- terminus, whereas TccC lacked a hydrophilic amino-terminus and had a significantly hydrophobic carboxyl terminus from amino-acid residue 717 onwards (Fig. 3).
Analysis to detect repetitive motifs characteristic of the RTX family of toxins (Welch, 1991) using DOTPLOT showed only P. luminescens TccC contained a plot characteristic of a repeat motif present at the carboxy terminal (data not shown).
Analysis of DNA composition (%GC) and similarity
Comparisons of the GC content (Table 3) showed that the SepA and SepB genes were more GC-rich than their P. luminescens counterparts, while SepC and tcaC had similar GC content. The high GC content of SepC may be attributed to the close relationship of these protein products to the rhs family of wall-associated proteins which have a GC-rich core of 62% (Wang et al. 1998). Comparisons of the GC content of the Sep genes with that of the S. entomophilia genome shows that they are rather similar, suggesting that the sep genes were not recently acquired by S. entomophilia.
29 Identification of mini-rn/0 location by sequence analysis
Analysis of the insertion points of the previously isolated mini-TnlO insertions (Fig. 2) within the putative ORF's (Table 4) revealed that ORF3 and ORF4 were interrupted by the -9, -23, -24 (ORF3) and -35 (ORF4) mutations. These insertions had no effect on the pathogenicity process, suggesting that ORF3 and ORF4 do not play a significant role in pathogenicity. However, the pADAP-35 mutation was at the 3' end of ORF4, resulting in the truncation of the final 1 1 amino-acid residues of ORF4 (Fig. 4), which may not have affected protein function. Further mutagenesis of ORF4 is therefore required to confirm that it has no role in pathogenicity. The mutations that caused loss of pathogenicity all resided within SepA, SepB or SepC. No mutation mapped to ORFl , ORF2 or ORF5.
Complementation analysis of the sep proteins
Following sequence data each of the Sep ORF's were excised as closely as possible with restriction enzymes, placed into pLAFR3 and placed in trans with the appropriate pADAP mutation. Complementation of SepA was undertaken through the use of the 8.5 kb HindRl clone (pMH45) which encompasses both ORFl and SepA. SepB was excised as a 5.4 kb Stul fragment and SepC was excised as a 4.6 kb fragment using one of the peripheral; BamHI sites from the pBH32-13 mutation and the Stul site of pBM32 (Fig. 2b).
Complementation analysis showed that pLAFR3 based SepB and SepC are able to complement their mutated pADK- counterparts. Grkovic et al. (1995) had already previously shown that SepC could complement itself. However, this was achieved through using the entire 1 1 kb HindSl, pGLA-20 fragment.
Whether SepA is able to complement itself has yet to be fully established. It was found that -98% of the pMH45 construct was lost during the course of the bioassay. This latter result was sporadic and occasionally a repeated experiment would show the presence of diseased
30 grubs. Analysis of the macerates of these grubs showed that pMH45 was present indicating that pMH45 can possible complement SepA. However before further complementation analysis of SepA can be undertaken, measures to ensure the complementation plasmids stability are needed.
DISCUSSION
The large conjugative plasmid, pADAP, of S. entomophilia encodes the genes responsible for cessation of feeding and gut clearance, characteristics of amber disease in the New Zealand grass grub C. zealandica. This plasmid is present in all S. entomophilia and S. proteamaculans strains capable of causing amber disease (Glare et al. 1993) and had been implicated in disease processes (Grkovic et al. 1995). The applicant has defined a 16.9 kb region of kADAP that is sufficient to confer pathogenicity towards C. zealandica on pADAP-cured strains of S. entomophilia and on strains of E. coli. Hence, the region confers all the essential pathogenicity genes of S. entomophilia responsible for amber disease. Nucleotide sequence and mutagenesis analysis of the region revealed three genes, SepA, SepB and SepC, that together are sufficient for pathogenicity. Mutations in any of the three genes completely abolished the disease process and partial disease states were not detected, suggesting that the three genes may interact to exert an effect.
The 23-kb region cloned into pBR322 to make pBM32 conferred pathogenicity in pADAP- cured S. entomophilia strains with all symptoms of amber disease being observed. Insertion mutants in pBM32 that abolished pathogenicity were transferred to pADAP. The resultant strains showed a partial disease phenotype, including anti-feeding but not gut clearance, suggesting that an additional anti-feeding gene may be present elsewhere on pADAP. The occurrence of two different anti-feeding genes on pADAP also supports data of Grkovic et al. (1995) who found that suppression of feeding was stronger in the wild- type pADK-6 strain, compared to the partial disease state (pADK-10, pADK-13) of
31 inducing antf-feeding but no gut clearance. A putative anti-feeding gene, ambl, has already been isolated from the genomic DNA of S. entomophilia (Nunez- Valdez and Mahanty, 1996). Recent data indicate that the ambl locus resides at an as yet to be identified location on pADAP that is remote from the region identified herein (Hurst, unpublished data).
Sequence analysis and comparison of the products of the sep genes showed that they share significant similarity to the proteins TcbA (TcdA, TcaB, TccB), TcaC and TccC that comprise the toxin complexes of P. luminescens. Like the P. luminescens genes that sep genes of Serratia share a similar organisational pattern of three genes ordered in succession in the same orientation, and opposed by a terminil gene transcribed in the opposite direction. However, the order of sep genes differ, are slightly smaller in size, and comprise constituents of each of the P. luminescens loci tea (tcaB=sepA, tcaC=sepB), luminescens toxin gene ted (Ensign et al. 1997) is also similar to SepA. The similarity shared between the sep and tc gene products suggests that they are members of a new family of insecticidal toxins. The lack of DNA similarity as opposed to protein similarity between sep and P. luminescens tc genes together with the differnce in GC content of the sep A and sepB genes compared to the tc genes, suggests that these genes were present in the common enterobacterial ancestor of P. luminescens and S. entomophilia and were not acquired by a more recent horizontal transfer event.
The Photorhabadus toxins were isolated as a composite of proteins which are hypothesised to interact synergistically to form a toxin complex. The toxins are also able to exert an anti-feeding effect (Bowen et al. 1998; Bowen and Ensign, 1998). This is consistent with the results we obtained with the sep mutants. pADAP-cured S. entomophilia strains containing the pathogenicity clone pBM32 exert an anti-feeding effect on the grass grub and individual mutations within any of the sep genes have an identical phenotype, completely abolishing pathogenicity. The Photorhabadus toxins have a wide host range, affecting Lepidoptera, Coleoptera and Dictyoptera and undergo post translational
32 proteolytic processing (Bowen et al. 1998). No similarities of sep proteins were found to the Photorhabadus toxin component TccA, and only the amino-terminus of TcaA shared similarity to SepA. This and the difference in the hydrophobicity profiles of SepC and TccC, may account for specificity of the sep proteins towards C. zealandica. However the sep proteins have yet to be purified and it is unknown whether the sep genes are expressed when S. entomophilia is ingested by other insects. Therefore the possibility that these newly-described toxins may exhibit a broader host range cannot be ruled out.
The Photorhabdus toxin TcbA shares weak similarity to the Clostridium difficile A and B toxins (Bowen, 1998), but no such similarities were found to SepA. C. difficile A and B toxins belong to the RTX (repeats in toxin) family of toxins which are noted for the presence of several carboxyl terminal repeats (von Eichel-Streiber et al. 1992). A search of the sep proteins and their P. luminescens homologues for protein repeats showed that only the P. luminescens TcaC protein contained a repeat-type signature. The TcaC carboxy- terminal repeat bears little resemblance in size or number of repeats found in RTX toxins (von Eichel-Streiber et al. 1992). SepA does not show weak similarity to the mosquitocidal toxin Cbm71 of C. bifermentans (Barloy et al. 1996). However when this region is compared with the relevant Photorhabdus homologues, it is a region with little similarity.
SepB has strong similarities to both P. luminescens TccC and the Salmonella virulence gene product SpvB (Gulig et al. 1992). SpvB is believed to enhance the survival of virulent Salmonella in macrophages (Libby et al. 1997). It has been suggested that TcaC may act by attacking insect haemocytes (Bowen et al. 1998). However, haemocytes reside within the insect haemocoel and S. entomophilia does not invade the haemocoel until late in the infection process (Jackson et al. 1993), suggesting that SepB may act in some other way. The similarity of SepB and TcaC is high to SpvB but diminishes ten amino-acid residues upstream of the proline-rich region found in SpvB that is postulated to divide the protein into separate domains (Roudier et al. 1992). This may indicate a vital role for the amino-
33 terminus of both SepB and SpvB in interacting with an evolutionarily-conserved eukaryotic protein.
The SepC protein shows high similarity to a family of cell wall-associated bacterial proteins such as the B. subtilis wall-associated protein (WAP A) and members of the E. coli rhs element family. The function of the Rhs proteins has yet to be established, but they are believed to be cell surface ligand-binding proteins (Hill et al. 1994). The Rhs proteins and the B. subtilis was-associated protein contain a characteristic repetitive peptide motif, but no such motif was observed in SepC. A feature of rhs elements is the presence of a downstream IS element (Wang et al. 1998). A degenerate IS91-type transposase element (ORF6) is present downstream of SepC. The IS91 element has been found associated with plasmids or chromosomal genes involved in α-haemolysin synthesis, and has been postulated to play a pivotal role in the spread of the α-haemolysin genes by means of the IS91 -mediated recombinational activity (Zabala et al. 1984). It seems possible an IS element adjacent to SepC may have been involved in the acquisition of the sep genes by S. entomophilia.
Blackburn et al. (1998) undertook histological examinations of the lepidopteran Manduca sexta after treatment with the P. luminescens Tea toxin complex introduced by feeding or haemcoelic injection. They found blebbing of the midgut epithelium into the lumen, resulting in lysis and formation of cavities. Similar histological studies have been undertaken at various stages throughout the infection cycle of S. entomophilia in C. zealandica, and reveal a visible deterioration in the number of fat cells to almost minimal levels, and an emptying of the larval gut. However no blebbing of the midgut epithelium was observed (Jackson et al. 1993).
The S. entomophilia pathogenicity region endows pathogenicity on members of the Enterobacteraceae such as Klebsiella spp., Enterobacter agglomerans, E. coli, and Serratia
34 species (Glare et al. 1996). From this we can infer that the Sep proteins are the major virulence determinants, that the promoters of the sep genes are expressed constitutively or under the control of conserved regulatory genes, or a negative regulatory gene present in the pathogenicity region, and that export of the toxin proteins is carried out by a conserved chromosomally encoded system, or is an intrinsic property of the sep proteins. The Sep proteins have no obvious amino terminal signal sequences, a facet shared with E-Group colicins. The release of cloacin DF13 is mediated through a small lipoprotein designated BRP, for bacteriocin-release protein. Low level expression of BRP in conjunction with phospholipase A leads to the release of cloacin DF13, along with bacterial periplasmic proteins. However if expressed in high amounts, BRP causes cell death by cell lysis (vad der Wal, 1998). The close proximity and similar orientation pattern of ORF3 to the sep genes indicate that ORF3 may have an as yet to be determined important functional role. Protein similarity searches show that it has high similarity to the bacteriophage lysozyme family. In relation to amino-acid size, ORF3 closely resembles the LZBP22 lysozyme of the Salmonella P2 bacteriophage, a protein essential for the lysis of the bacterial cell wall (Rennell and Poteete, 1985). It is possible that ORF3 may facilitate the release of the sep proteins by lysing the bacterial cell wall. A low level expression of ORF3 might, as in the case of BRP, allow the passage of the sep proteins across the cell wall without causing cell death. The reason that the pBM32-9 and -24 mutations were unable to abolish the disease process could be due to a masking of ORF3 function by natural cell lysis of the bacteria.
A region of repetitive DNA was identified between nucleotides 683 to 743, centered within a 1.2-kb AT rich stretch of DNA that contains no potential ORF's. The repeat motif is flanked by an upstream 13-bp palindrome and a degenerate downstream 33-bp palindrome. Repeats have been found to be common sites for recombination (Allgood et al. 1988), or to facilitate the binding of proteins. A 66-bp DNA sequence termed the rsk element for reduced serum killing, of the S. typhimurium 95-kb virulence plasmid, comprises of a series
35 of direct 10-bp repeats with a 21 nucleotide periodicity. The rsk element is believed to titrate out a trans-acting factor, enhancing the expression of the Salmonella serum resistance gene (Vandenbosch et al. 1989). It is not known whether these repeats and/or flanking palindromes have a role in the pathogenicity process. The deletion derivative pAC24, which encompasses this region, was still pathogenic towards the grass grub. However, this deletion could also unknowingly remove the complete regulatory circuit of the pathogenicity region, leading to constitutive expression.
THE ARABINOSE EXPRESSION SYSTEM
Methodology
Using the polymerase chain reaction (PCR) the initiation codon ATG of the three sep genes (sepA, sepB and sepC) were individually placed into the unique Ndel site (restriction enzyme site CATGG) of the HIS-tag arabinose expression vector pAV2-10 (obtained from Chuck Shoemaker -AgResearch). Because large proteins i.e. greater than 50 kda are limited in their ability to bind to HIS tag affinity columns the carboxyl terminus of each of the Sep proteins did not need to be in frame with the HIS-tag site. Instead wild type DNA (non PCRd) containing a downstream chloramphenicol resistance gene was ligated into the appropriate restriction enzyme site (sepA Sunl; sepB HindRl; sepC BstXT) of the pAV2-10- sep derived vectors :-
-the use of the chloramphenicol resistant marker provided by the vector pACYC184 enhances the stability to each of the expression constructs i.e. -the antibiotic ampicilin to which the pAV2-10 is resistant too is cleaved in the media to an inactive form leading to possible plasmid free segregants arising. Conversely the antibiotic chloramphenicol is not cleaved heightening the level of plasmid stability under conditions of arabinose induction.
36 To validate the legitimacy of the fused genes to the arabinose expression vector, PCR generated products and the ligation junctions were verified by DNA sequencing.
Concurrent to this the sepB and sepC genes were placed as derived from pADAP downstream of sepA. Also sepA, sepB and sepC were placed as in pADAP downstream of orf3. This simulated wildtype conditions (i.e. the arrangement of the sep genes on pADAP) and hopefully get the production of the sep genes and the complex driven off the one upstream promoter. A method which Western analysis has shown to be successful -with moderate levels of sepA, sepB and sepC being detected.
The arabinose expression system is one of the tightest systems known with almost complete abolition of gene product under arabiniose free conditions Guzman et al. (1995), this abolition can be enhanced by providing glucose to the medium. In contrast providing arabinose at the concentration of 0.2% will switch the arabinose promoter on express any genes under its control e.g. sepA etc. Typically an overnight culture of the E. coli strain was set up the next day an 100 μl of the culture was suspended in fresh media supplemented with chloramphenicol (30 μg/ml) the culture was grown until an OD of 400 at which time arabinose was added to the culture to a final concentration of 0.2% and the culture left shaking at 30 °C for 18 hours.
To date Western analysis has shown that each of the proteins is expressed and expressed to its correct predicted size:
SepA 262.7 kdal
SepB 156.6 kdal
SepC 107 kdal
37 SepC is expressed at high levels with minor levels of proteolytic cleavage. However both SepA and SepB though expressed are cleaved in high amounts by endogenous E. coli proteases. Alternative strains of E. coli are going to be assessed for loss of proteolytic activity against SepA and SepB
It has also been shown that placing all three of the sep genes under the control of a single arabinose promoter will result in the production of basil levels of the SepA, SepB, SepC toxin complex.
Each of the following Coleopteran species were mouth injected with 3-5 μl of an overnight suspension of induced bacteria (E. coli strain DHB101) containing either SepA, SepB and SepC or orf3, SepA, SepB and SepC.
Each larvae was then given a 3mm3 piece of carrot coated with a 50% solution (dH20) of arabinose. Observations were noted each day and the larvae refed with a 3mm piece of carrot coated with a 50% solution (dH20) of arabinose
Red headed cock chaffer
Tasmanian grass grub
Odontara
Grass grub (positive control)
Under these conditions it has been found that the arabinose expressed toxin complex SepA, SepB and SepC is active against grass grub but not any of the other species of scarabs tested (see above). It is therefore thought unlikely that the toxin complex will have activity to other insect orders.
38 SUMMARY
The bacteria Serratia entomophilia and S. proteamaculans cause amber disease in the grass grub, Costelytra zealandica (Coleoptera: Scarabaeidae), an important pasture pest in New Zealand. Larval disease symptoms include amber colouration, clearance of the gut and rapid cessation of feeding, before eventual death. The region containing pathogenic determinants of the disease has been cloned, and further defined by mutagenesis and deletion analysis to a 16.9 kb region. Sequence analysis of the minimal pathogenic encoding region showed significant protein homology, but little sequence homology to a group of newly described toxins from a member of the Enterobacteriaceae, Photorhabadus luminescens. This pathogenicity-encoding region from S. entomophilia plasmid pADAP is the subject of the invention. The proteins encoded by the genes (sepA, sepB, sepC) within the 16.9 kb region can be used for insect control whether as an inundative pesticide, within baits or expressed in other organisms such as plants or microbes.
Aspects of the present invention have been described by way of example only and it should be appreciated that modifications and additions may be made thereto without departing from the scope thereof as defined in the appended claims.
39 40
REFERENCES
Barloy F; Delecluse A; Nicolas L and Lecadet M M (1996)
Cloning and expression ofthe first anaerobic toxic gene from Clostridium bifermentans subsp. malaysia, encoding a new mosquitocidal protein with homologues to Bacillus thuringirnsis delta-endotoxins. J. Bact. 178 : 3099-3105.
Blackburn M; Golubeva E; Bowen D and Ffrench-Constant R H (1998) A novel insecticidal toxin from Photorhabdus luminescens, Toxin complex a (Tea), and Its Histopthological Effects on the Midgut of Manduca sexta. Applied and Environmental Microbiology 64: pp 3036-3041.
Bolivar F; Rodriguez R L; Greene P J; Betlach M C; Heyneker H L and Boyer H W
(1977)
Construction and characterisation of new cloning vehicles II. A multipurpose cloning system. Gene 2: 95-113.
Bowen D J and Ensign J C (1998)
Purification and characterisation of a High-Molecular- Weight Insecticidal Protein Complex produced by the Entomopathogenic Bacterium Photorhabdus luminescens Applied and Environmental Microbiology 64: pp 3029-3035.
Bowen D; Rocheleau; Blackburn M; Andreev O; Golubeva E; Bharia R and Ffrench-Constant R H (1998)
Insecticidal Toxins from the Bacterium Photorhabdus luminescens Science 280: pp 2129-2132.
Casabadan M J and Cohen S N (1980)
Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol.
Biol. 138 : 179-207.
Chang A C Y and Cohen S N (1978)
Construction and characterisation of amplifiable multicopy DNA cloning vehicles derived from the pl5A cryptic miniplasmid. J. Bact 134(3) : 1141-1156.
Corbett (unpublished) 41
Ditta G; Stanfield S; Corbin D and Helinski D R (1980)
Broad host range cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA. 27 : 7347-7351
Dower W J; Miller J F and Ragsdale C W (1988)
High efficacy transformation oϊE.coli by high voltage electroporation. Nucleic Acids
Res. 16 : 6127-6145.
Figurski D H and Helinski D R (1979)
Replication of an origin-containing derivative ofplasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA. 76 : 1648-1652.
Finnegan J and Sherrat D (1982) Plasmid ColEl conjugal mobility: the nature of bom, a region required in cis for transfer. Mol. Gen. Genet. 185, 344-351.
Gierasch, L M (1989) Signal sequences. Biochem 28: 923-930
Glare T R; Corbett G E and Sadler A J (1993)
Association of a large plasmid with amber disease of the New Zealand grass grub, Costelytra zealandica, caused by Serratia entomophila and Serratia proteamaculans. Journal of Invertebrate Pathology 62, 165-170.
Glare T R; Hurst M R H and Grkovic S (1996)
Plasmid transfer among several members ofthe family Enterobacteriaceae increases the number of species capable of causing experimental amber disease in grass grub. FEMS Microbiology Letters 139: 117-120.
Grimont P A D; Jackson T A; Ageron E and Noonan M J (1988)
Serratia entotnophila sp. nov. associated with amber disease in the New Zealand grass grub, Costelytra zealandica Int. J. System. Bacteriol, 38 : 1-6.
Grkovic S; Glare T R; Jackson T A and Corbett G E (1995)
Genes essential for amber disease in grass grub are located on the large plasmid found in Serratia entomophila and Serratia proteamaculans. Applied and Environmental Microbiology 61, 2218-2223. 42
Gulig P A; Caldwell A L and Chiodo V A (1992) .
Identification, genetic analysis and DNA sequence of a 7.8-kb virulence region of the
Salmonella typhimurium virulence plasmid. Mol. Microbiol. 6 : 1395-1411.
Hanahan D (1983)
Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166 : 557.
Jackson T A; Huger A M and Glare T R (1993)
Pathology of amber disease in the New Zealand grass grub, Costelytra zealandica
(Coleoptera: Scarabaeidae). J Invertebr. Pathol., 61: 123-130.
Jackson T A (1995)
Amber disease reduces trypsin activity in midgut of Costelytra zealandica larvae. J.
Invent. Pathol. 65: 68-69.
Kleckner N; Bender J and Gottesman S (1991)
Uses of transposons with emphasis on TnlO. Methods Enzymol 204: 139-179.
Kyte J and Doolittle R F (1982) A simple method for displaying the hydropathic character of a protein. J Mol Biol 157: 105-132
Leininger E, Roberts M, Kenimer J G, Charles IG, Fairweather N, Novotny P, and Brennan M J (1991) Pertactin, an Arg-Gly- Asp-containing Bordetella pertussis surface protein that promotes adherence to mammalian cells. Proc NatlAcad Sci USA 88: 345- 349
Lorrow D and Jesse J (1990)
Max efficiency DH10B™: A host for cloning methylated DNA.
Focus 12: 19.
Mendiola M V; Jubete Y and de la Cruz F (1992)
DNA sequence of IS91 and identification of the Transposase Gene. Journal of
Bacteriology 174: 1345-1351.
Nunez- Valdez M E and Mahanty H K (1996)
The amb2 locus from Serratia entomophila confers anti-feeding effect on larvae of
Costelytra zealandica (Coleoptera: Scarabaeidae). Gene 172: 75-79. 43
Pecenkova T; Benes V; Paces J; Vlcek C and Paces V (1996)
Bacteriophage B103: complete DNA sequence of its genome and relationship to other
Bacillus phages. Gene 199 157-163.
Prere M F, Chandler M and Fayet O (1990) Transposition in Shigella dysenteriae isolation and analysis of IS0//, a new member ofthe IS3 group of insertion sequences. JBacteriol 111: 4090-4099.
Relman D A, Domenighini M, Tuomanen E, Rappuoli R and Falkow S (1989) Filamentous hemagglutinin of Bordetella pertussis: nucleotide sequence and crucial role in adherence. Proc Natl Acad Sci USA 86: 2637-2641.
Sambrook J; Fritsch E F and Maniatis T (1989)
Molecular cloning, 2nd edition, Cold Springs Harbour Laboratory Press, Cold Spring
Harbour
Staskawicz B; Dahlbeck D; Keen N and Napoli C (1987)
Molecular characterization of cloned avirulence genes from Race 0 to Race 1 of
Pseudomonas syringae pv slycinea. J. Bacteriol 169 : 5789-5794.
Stucki G; Jackson T A and Noonan M J (1984)
Isolation and characterisation of Serratia strains pathogenic for larvae ofthe New Zealand grass grub Costelytra zealandica. NZ J Science 27: 255-260.
Trought T E T; Jackson T A and French R A (1982)
Incidence and transmission of a disease of grass grub (Costelytra zealandica) in
Canterbury. NZ J. Exp. Agriα 10: 79-82.
Upadhyaya N M; Glare T R and Mahanty H K (1992)
Identification of a Serratia entomophila genetic locus encoding amber disease in New
Zealand grass grub (Costelytra zealandica). J. Bacteriol 174: 1020-1028.
Valdivida R H and Falkow S (1997) Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277 (5334), 2007-2011.
Wang Y D; Zhao S and Hill C H (1998)
Rhs elements comprise three subfamilies which diverged prior to acquisition by
Escherichia coli J. Bacteriol. 180 : 4102-10. 44
Welch R A (1991)
Pore-forming cytolysins of Gram-negative bacteria. Mol. Microbiol 5 : 521-528.
Yanisch-Perron C; Vieira J and Messing J (1985)
Improved M13 phage cloning vectors and host strains: nucleotide sequence of M13mpl8 and pUC 19 vectors. Gene 33, 103-119.
Zimmer A and Schmieger H.
Lysis gene modules in the phage P22 gene pool Zimmer A; Institute for Genetics and Microbiology, University of Munich, Maria-Ward-Str. la, Muenchen D-80638, Germany XI 67137. Accession number (AF064539).
Guzman L-M., Belin, D., Carson, M.J., and Beckwith, J. (1995): Tight regulation, modulation , and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol. 177: 4121-4130.
45
Table 1 Bacterial strains, plasmids and bacteriophage used in the study
Bacteria Description Reference
Escherichia coli DH5α Fφ80d lacZpM\5 p(lacZY A-αrgF)U 169 recAl Hanahan (1983) endAl supE44
DH10B FmcrA p(mrr-hsdRMS-mcrBC)$SOd lacZpMIS Lorow and Jessee, placX74 endAl recAl deoRp(ara, leu) 7697 (1990) arάD 139 gaflj galK upG rps λ".
DF1 γδ transposase(ftj/7 ) Gibco BRL MC1061 sup0 hsdR mcrB araDl39 p(araA BC-leu)7619 Casadaban and Cohen, p/αcX74 galUgalK rpsL thi (1980)
MC4100 araD139 p(/αcZYA- rgF)U169 rpsLlSO Silhavy et al. Sr* relAlflbB5301 deoCl ptsF25 (1984) rbsR.
XLl-BlueMRA p(mcrA)ϊ%3 p(mcrCB-hsdSMR-rnrr)173 endAl Stratagene supE44 thi-1 reAI gyrA96 relAl Serratia entomophila A 1 M02 ApR, pADAP, pathogenic. Grimont etal. (1988)
5.6 heat cured p ADAP minus derivative of A 1 M02 Glare etal. (1993)
5.6RC CmR recA' pADAP minus strain Grkovic et al. (1996)
5.6RK KnR recA'p ADAP minus strain this study
Plasmids pACYC184 CmR TcR Chang and Cohen,
(1978) pADAP Amber disease associated plasmid Glare et at 1993) pBR322 ApR, TcR Bolivar et al. (1977) pBM32 23-kb BamHI fragment from pMH32 cloned in this study
* pBR322 pBM32-l -40 pBM32 containing mini-rπ/0 insertions this study pDELTA 1 ApR, SmR, KnR, sucroseR Gibco BRL pLAFR3 TcR pRK290 with λcos, lacZa. and multi- Staskawicz et al. (1987) cloning site from pUC8. pRK2013 IncP, KnR Tra RK2 repRK2 repEl Oitt& et al. (1980) pGLA20 10.6-kb Hind pADAP fragment cloned in Corbett (unpublished)
PLAFR3 pACp4 19-kb BamHI fragment from pBM32-4 cloned in this study pACYC184 pACpδ 17-kb BamΗl fragment from pBM32-8 cloned in this study pACYC184 pACplO 19.5-kb BamHI fragment from pBM32-10 this study cloned in pACYC 184 pACp20 20-kb BamHI fragment from pBM32-20 cloned this study in pACYC184 p ACp23 21 -kb BamHI fragment from pBM32-23 cloned this study in pACYC184 pACp24 21.2-kb BamHI fragment from pBM32-24 this study cloned in p AC YC 184 pADK-10 pADAP::mini-Tn/0 insertion in 10.6-kb Hindlll Grkovic et l. (1995) fragment, KnR non-pathogenic pADK-13 pADAP::mini-Tn/0 insertion in 10.6-kb Grkovic et α/.(1995)
Hindlll fragment, KnR non-pathogenic pADK-35 pADAP::mini-Tn/0 insertion in 10.6-kb Hindlll Grkovic et al. (1995) 46
fragment, nR, pathogenic pMH32 23-kb BamHI frgament of pADAP cloned into this study pLAFR3 pMH41 33-kb BamHI fragment of pADAP cloned into this study pLAFR3 pBM32 23-kb BamHI fragment of pMH32 cloned into this study pBR322 pUC19 ApR, /αcZα, multi-cloning site Yannish-Perron, et al. (1985)
Bacteriophage λNK1316 mini-Tn/0 derivative 103 donor λb522 cl857 Kleckner et α/. (1991) Pam80 nin5
Table 2 Position of genes and features of the predicted gene products encoded by sep genes
Figure imgf000046_0001
* Putative ribosome-binding sites are underlined, and potential start codons are in boldface; nt, nucleotides; ? degenerate or incomplete ORF. * ORF transcribed in opposing direction.
Table 3. Comparisons of GC content between the Sep and P. lummescen genes
Figure imgf000046_0002
47
Figure imgf000047_0001
Percent identities and similarities were calculated in relation to the deduced gene products of the sequenced ORF. 'indicates position of amino-acid similarity in relation to sequence generated in this study. ♦ indicates position of amino-acid similarity in relation to data base protein sequence. * reading frame. ■ similarities were considered potentially significant if the BlastP score exceeded e'5. 48
Table 5 Positions of mini-Tn/0 insertions
Figure imgf000048_0001
49
THE CLAIMS DEFINING THE INVENTION ARE:
1. A purified and isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ED NO: 1 that encodes at least one of:
(i) an insecticidal protein complex, or
(ii) a functional fragment of said complex, or
(iii) a neutral mutation of said complex, or
(iv) a homolog of said complex,
each of which are capable of hybridising with said nucleic acid molecule under standard hybridisation conditions.
2. A purified and isolated nucleic acid molecule as claimed in Claim 1 comprising the nucleotide sequence 1995-18937 of SEQ ID NO: 1.
3. A purified and isolated nucleic acid molecule as claimed in Claim 1 comprising one or more of the nucleotide sequences 2411-9547, 9589-13883 or 14546-17467 of SEQ ID NO: 1.
4. A purified and isolated nucleic acid molecule as claimed in Claim 3 comprising all of nucleotide sequences 241 1-9547, 9598-13884 and 14546-17467 of SEQ ID NO: 1.
5. A purified and isolated nucleic acid molecule as claimed in Claim 1 comprising a sequence of SEQ ID NO: 1, operably linked to at least one further nucleotide sequence which encode an insecticidal protein.
6. A purified and isolated nucleic acid molecule as claimed in Claim 2 comprising nucleotides 1955-18937 of SEQ ID NO: 1 , operably linked to at least one further nucleotide sequence which encode an insecticidal protein.

Claims

50
7. A purified and isolated nucleic acid molecule as claimed in Claim 3 comprising a sequence of SEQ ID NO: l,or one or more of nucleotides 2411-9547, 9598-13884 or 14546-17467 of SEQ ID NO: 1, operably linked to at least one further nucleotide sequence which encode an insecticidal protein.
8. A purified and isolated nucleic acid molecule as claimed in any one of claims 4 through 6 wherein the said nucleotide sequence includes the nucleotide sequence which codes for at least one of the Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescens toxins.
9. A purified a d isolated nucleic acid molecule as claimed in claim 1 wherein nucleic acid molecule may comprise DNA, cDNA or RNA.
10. A purified and isolated nucleic acid molecule as claimed in claim 1 wherein the nucleic acid molecules said fragment, neutral mutation or homolog thereof capable of hybridising to said nucleic acid molecule, hybridise to the nucleotide sequence of SEQ ID NO: 1, or nucleotides 1955-18937, 241 1-9547, 9598-13884 or 14546-17467 of SEQ ID NO: 1 if there is at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity between the sequences.
11. A purified and isolated nucleic acid molecule as claimed in claim 1 wherein the nucleic acid molecule may be isolated from Serratia entomophila or Serratia proteamaculans strains of bacteria.
12. A recombinant expression vector(s) containing the nucleic acid molecule as claimed in Claim 1 and host transformed with the vector expressing a polypeptide.
13. A recombinant expression vector(s) as claimed in claim 11 wherein the vector is selectable from any suitable natural or artificial plasmid/vector.
14. A recombinant expression vector(s) as claimed in claim 13 wherein said suitable natural or 51 artificial plasmid/vector, including, pUC 19 (Yannish-Perron et al. 1995), pProEX HT (GibcoBRL, Gaithersburg, MD, USA), pBR322 (Bolivar et al. 1977), pACYC184 (Chang et al. 1978), pLAFR3 (Staskowicz et al. 1987).
15. A polypeptide resulting from the transformation or transfection of a host cell with a recombinant expression vector as claimed in any one of Claims 12 through 14.
16. A method of producing a polypeptide of claim 15 comprising the steps of:
(a) culturing a host cell which has been transformed or transfected with said vector as defined above to express the encoded polypeptide or peptide; and
(b) recovering the expressed polypeptide or peptide.
17. A ligand that binds to a polypeptide of Claim 15.
18. A ligand as claimed in claim 17 wherein the ligand is an antibody or antibody binding fragment.
19. Probes and primers comprising a fragment of the nucleic acid molecule as claimed in Claim 1 wherein said fragment is hybridisable under stringent conditions to a native insecticidal gene sequence.
20. Probes and primers comprising a fragment of the nucleic acid molecule as claimed in claim 19 wherein said probes and primers enable the structure and function of the gene to be determined and homologs of the gene to be obtained from bacteria other than Serratia sp.
21. A polypeptide as claimed in Claim 15 wherein the polypeptide has insecticidal activity encoded by the nucleic acid molecule of claim 1, or a functional fragment, neutral mutation or homolog thereof.
22. A polypeptide having insecticidal activity as claimed in claim 21 wherein the polypeptide 52 comprises the amino acid sequence of SEQ ID NO: 1 or a functional fragment, neutral mutation or homolog thereof.
23. A polypeptide having insecticidal activity as claimed in claim 21 wherein the polypeptide comprises amino acids 32-5118 of SEQ ID NO: 1.
24. A polypeptide having insecticidal activity as claimed in claim 21 wherein the polypeptide comprises at least one amino acid sequence of SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID
NO: 4; SEQ ID NO: 5 or SEQ ID NO: 6.
25. A polypeptide having insecticidal activity as claimed in claim 24 wherein the polypeptide preferably comprises amino acid sequence SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6.
26. A polypeptide having insecticidal activity as claimed in claim 24 wherein the polypeptide preferably comprises all of SEQ ID NOs: 2-6.
27. A polypeptide having insecticidal activity as claimed in claim 21 wherein the polypeptide is obtained by expression of a DNA sequence coding therefore in a host cell or organism.
28. A polypeptide having insecticidal activity as claimed in claim 27 wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1 linked to at least one further amino acid sequence encoding an insecticidal protein.
29. A polypeptide having insecticidal activity as claimed in claim 28 wherein the at least one further amino acid sequence includes the amino acid sequence which codes for Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins.
30. A polypeptide having insecticidal activity as claimed in claim 28 wherein the polypeptides comprise at least 50%, preferably 60%, more preferably 70% and most preferably 90-95% or greater identity to SEQ ID NO: 1. 53
31. A polypeptide having insecticidal activity as claimed in claim 21 wherein the polypeptide is produced by expression of a vector comprising the nucleic acid of SEQ ID No: 1 or a functional fragment, neutral mutation or homolog thereof, in a suitable host cell.
32. An insecticidal composition comprising at least the polypeptide as claimed in claim 21 and an agriculturally acceptable carrier.
33. An insecticidal composition as claimed in claim 32 wherein more than one polypeptide is included in the composition.
34. An insecticidal composition as claimed in claim 32 or 33 wherein the composition comprises additional pesticides, including compounds known to possess herbicidal, fungicidal, insecticidal or nematicidal activity.
35. An insecticidal composition as claimed in claim 34 wherein the composition comprises other known insecticidally active agents, including Bacillus delta endo toxins, vegatative insecticidal proteins (vips), cholesterol oxidases, Clostridium bifermentens mosquitocidal toxins and/or Photorhabadus luminescents toxins.
36. A method of combating pests, said method comprising applying to a locus, host and/or the pest, an effective amount of the polypeptide as claimed in Claim 21 that has functional insecticidal activity against said pest.
37. A method of inducing amber disease or like condition in insects comprising delivery to an insect an effective amount of the polypeptide as claimed in Claim 21 that has functional insecticidal activity against said insect.
38. A method of inducing amber disease or like condition in insects as claimed in claim 37 comprising delivery to an insect an effective amount of the polypeptide wherein the insect is selected from the order comprising Coleoptera.
39. A method of inducing amber disease or like condition in insects as claimed in Claim 38 54 comprising delivery to an insect an effective amount of the polypeptide wherein the insect includes Costelytra zealandica (Coleoptera: Scarabaeidae).
40. A method Of delivering the insecticidal polypeptide to induce amber disease or like condition in insects including delivery of the insecticidal polypeptide as claimed in Claim 39 to the insect by any one of presenting the insecticidal polypeptide orally as a solid bait matrix, as a sprayable insecticide sprayed onto a substrate upon which the insect feeds, applied directly to the soil subsurface or as a drench or is expressed in an transgenic plant, bacterium, virus or fungus upon which the insect feeds.
41. A transgenic plant, bacterium virus or fungus, incorporating in its genome, a nucleic acid molecule as claimed in Claim 1 for providing the plant, bacterium virus or fungus with an ability to express an effective amount of an insecticidal polypeptide.
Figure imgf000055_0001
1/8
PCT/NZ2000/000174 1999-09-02 2000-09-04 Nucleotide sequences encoding an insectidal protein complex from serratia WO2001016305A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU74619/00A AU7461900A (en) 1999-09-02 2000-09-04 Nucleotide sequences
NZ517478A NZ517478A (en) 1999-09-02 2000-09-04 Nucleotide sequences encoding an insecticidal protein complex from serratia

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NZ337610 1999-09-02
NZ33761099 1999-09-02

Publications (2)

Publication Number Publication Date
WO2001016305A2 true WO2001016305A2 (en) 2001-03-08
WO2001016305A3 WO2001016305A3 (en) 2002-01-10

Family

ID=19927486

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NZ2000/000174 WO2001016305A2 (en) 1999-09-02 2000-09-04 Nucleotide sequences encoding an insectidal protein complex from serratia

Country Status (2)

Country Link
AU (1) AU7461900A (en)
WO (1) WO2001016305A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011002992A1 (en) * 2009-07-02 2011-01-06 Athenix Corp. Axmi-205 pesticidal gene and methods for its use
CN102899304A (en) * 2011-07-26 2013-01-30 中国科学院上海生命科学研究院 Protein having phytopathogen killing activity, and coding gene and application thereof
US9394345B2 (en) 2013-03-15 2016-07-19 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US9862965B2 (en) 2011-07-28 2018-01-09 Athenix Corp. AXMI205 variant proteins and methods of use
US10023877B2 (en) 2013-03-15 2018-07-17 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997017432A1 (en) * 1995-11-06 1997-05-15 Wisconsin Alumni Research Foundation Insecticidal protein toxins from photorhabdus
WO1998008388A1 (en) * 1996-08-29 1998-03-05 The Minister Of Agriculture Fisheries & Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain & Northern Ireland Pesticidal agents
WO1998008932A1 (en) * 1996-08-29 1998-03-05 Dow Agrosciences Llc Insecticidal protein toxins from $i(photorhabdus)
WO1999042589A2 (en) * 1998-02-20 1999-08-26 Novartis Pharma Ag. Insecticidal toxins from photorhabdus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997017432A1 (en) * 1995-11-06 1997-05-15 Wisconsin Alumni Research Foundation Insecticidal protein toxins from photorhabdus
WO1998008388A1 (en) * 1996-08-29 1998-03-05 The Minister Of Agriculture Fisheries & Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain & Northern Ireland Pesticidal agents
WO1998008932A1 (en) * 1996-08-29 1998-03-05 Dow Agrosciences Llc Insecticidal protein toxins from $i(photorhabdus)
WO1999042589A2 (en) * 1998-02-20 1999-08-26 Novartis Pharma Ag. Insecticidal toxins from photorhabdus

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BOWEN D ET AL: "INSECTICIDAL TOXINS FROM THE BACTERIUM Photorhabdus liminescens" SCIENCE,AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,,US, vol. 280, 26 June 1998 (1998-06-26), pages 2129-2132, XP002115650 ISSN: 0036-8075 cited in the application *
GLARE TRAVIS R ET AL: "Plasmid transfer among several members of the family Enterobacteriaceae increases the number of species capable of causing experimental amber disease in grass grub." FEMS MICROBIOLOGY LETTERS, vol. 139, no. 2-3, 1996, pages 117-120, XP000998482 ISSN: 0378-1097 cited in the application *
GRKOVIC STEVE ET AL: "Genes Essential for Amber Diseae in Grass Grubs Are Located on the Large Plasmid Found in Serratia entomophila and Serratia proteamaculans." APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 61, no. 6, 1995, pages 2218-2223, XP000994573 ISSN: 0099-2240 cited in the application *
HURST MARK R H ET AL: "Plasmid-located pathogenicity determinants of Serratia entomophila, the causal agent of amber disease of grass grub, show similarity to the insecticidal toxins of Photorhabdus luminescens." JOURNAL OF BACTERIOLOGY, vol. 182, no. 18, September 2000 (2000-09), pages 5127-5138, XP002166799 ISSN: 0021-9193 *
JACKSON T A ET AL: "PATHOGEN TO PRODUCT DEVELOPMENT OF SERRATIA-ENTOMOPHILA ENTEROBACTERIACEAE AS A COMMERCIAL BIOLOGICAL CONTROL AGENT FOR NEW ZEALAND GRASS GRUB COSTELYTRA-ZEALANDICA" JACKSON, T. A. AND T. R. GLARE (ED.). USE OF PATHOGENS IN SCARAB PEST, 1992, pages 191-198, XP000997900 0-946707-35-9. 1992 *
NUNEZ-VALDEZ M E ET AL: "The amb2 locus from Serratia entomophila confers anti-feeding effect on larvae of Costelytra zealandica (Coleoptera: Scarabaeidae)" GENE,NL,ELSEVIER BIOMEDICAL PRESS. AMSTERDAM, vol. 172, no. 1, 12 June 1996 (1996-06-12), pages 75-79, XP004042712 ISSN: 0378-1119 cited in the application *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102648281B (en) * 2009-07-02 2017-04-05 阿森尼克斯公司 205 killing genes of AXMI and its using method
CN102648281A (en) * 2009-07-02 2012-08-22 阿森尼克斯公司 AXMI-205 pesticidal gene and methods for its use
US8575425B2 (en) 2009-07-02 2013-11-05 Athenix Corporation AXMI-205 pesticidal gene and methods for its use
US9221883B2 (en) 2009-07-02 2015-12-29 Athenix Corp. AXMI-205 pesticidal gene and method for its use
US9260487B2 (en) 2009-07-02 2016-02-16 Athenix Corp. AXMI-205 pesticidal gene and method for its use
WO2011002992A1 (en) * 2009-07-02 2011-01-06 Athenix Corp. Axmi-205 pesticidal gene and methods for its use
CN102899304A (en) * 2011-07-26 2013-01-30 中国科学院上海生命科学研究院 Protein having phytopathogen killing activity, and coding gene and application thereof
US9862965B2 (en) 2011-07-28 2018-01-09 Athenix Corp. AXMI205 variant proteins and methods of use
US10875897B2 (en) 2011-07-28 2020-12-29 Basf Agricultural Solutions Seed, Us Llc AXMI205 variant proteins and methods for their use
US9394345B2 (en) 2013-03-15 2016-07-19 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US9951348B2 (en) 2013-03-15 2018-04-24 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US10023877B2 (en) 2013-03-15 2018-07-17 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US10337026B2 (en) 2013-03-15 2019-07-02 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US10577626B2 (en) 2013-03-15 2020-03-03 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US11091771B2 (en) 2013-03-15 2021-08-17 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US11180775B2 (en) 2013-03-15 2021-11-23 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use
US11697821B2 (en) 2013-03-15 2023-07-11 Pioneer Hi-Bred International, Inc. PHI-4 polypeptides and methods for their use

Also Published As

Publication number Publication date
WO2001016305A3 (en) 2002-01-10
AU7461900A (en) 2001-03-26

Similar Documents

Publication Publication Date Title
OH et al. The Hrp pathogenicity island of Erwinia amylovora and identification of three novel genes required for systemic infection
Preston et al. Type III secretion in plant growth‐promoting Pseudomonas fluorescens SBW25
DE69333980T2 (en) TRIGGER OF SENSITIVITY REACTIONS IN PLANTS
Ruffner et al. Oral insecticidal activity of plant‐associated pseudomonads
Ankenbauer et al. FptA, the Fe (III)-pyochelin receptor of Pseudomonas aeruginosa: a phenolate siderophore receptor homologous to hydroxamate siderophore receptors
Gutterson Microbial fungicides: recent approaches to elucidating mechanisms
US7696340B2 (en) Nucleotide and amino acid sequences from Xenorhabdus and uses thereof
Tang et al. Molecular cloning of protease gene (s) from Xanthomanas campestris pv. campestris: Expression in Escherichia coli and role in pathogenicity
RU2225114C2 (en) Recombinant dna encoding protein that represents insecticide agent, insecticide agent (variants), strain of microorganism xenorhabdus nematophilus (variants), insecticide composition, method for control of insect-pests
BRPI0617496A2 (en) bacillus thuringiensis isolated crystal insecticidal protein gene, recombinant DNA construct, microorganism and bacillus thuringiensis crystal insecticidal protein
CA2957803A1 (en) Chromobacterium subtsugae genome
KR20010022649A (en) Hypersensitive response elicitor from erwinia amylovora, its use, and encoding gene
CA2117270A1 (en) Use of bacillus thuringiensis isolates for controlling pests in the family aphididae
Breil et al. DNA sequence and mutational analysis of genes involved in the production and resistance of the antibiotic peptide trifolitoxin
Rohmer et al. Nucleotide sequence, functional characterization and evolution of pFKN, a virulence plasmid in Pseudomonas syringae pathovar maculicola
Servant et al. Production of Cry11A and Cry11Ba toxins in Bacillus sphaericus confers toxicity towards Aedes aegypti and resistant Culex populations
Benson et al. An iron uptake operon required for proper nodule development in the Bradyrhizobium japonicum-soybean symbiosis
Ezra et al. The dual function in virulence and host range restriction of a gene isolated from the pPATHEhg plasmid of Erwinia herbicola pv. gypsophilae
KR20230078719A (en) Mu-diguetoxin-Dc1a mutant polypeptide for pest control
WO2001016305A2 (en) Nucleotide sequences encoding an insectidal protein complex from serratia
US6841165B1 (en) Insecticidal agents
NZ517478A (en) Nucleotide sequences encoding an insecticidal protein complex from serratia
Kim et al. Identification of genes for biosynthesis of antibacterial compound from Pseudomonas fluorescens Bl6, and its activity against Ralstonia solanacearum
US6071877A (en) Polypeptides having a toxic activity against insects of the dipterae family
Traore Characterization of type three effector genes of A. citrulli, the causal agent of bacterial fruit blotch of cucurbits

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 517478

Country of ref document: NZ

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
WWP Wipo information: published in national office

Ref document number: 517478

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 517478

Country of ref document: NZ

NENP Non-entry into the national phase

Ref country code: JP