WO2001004298A1

WO2001004298A1 - Novel physiologically active substance, process for producing the same and use thereof

Info

Publication number: WO2001004298A1
Application number: PCT/JP2000/004484
Authority: WO
Inventors: Tsukasa Sugo; Mika Kurihara; Chieko Kitada; Masaaki Mori
Original assignee: Takeda Chemical Industries, Ltd.
Priority date: 1999-07-08
Filing date: 2000-07-06
Publication date: 2001-01-18
Also published as: AU5848400A

Abstract

A urotensin II-like peptide originating in rat or mouse which is an SENR ligand or its salt; a nucleic acid encoding this SENR ligand; a method/kit for screening a compound capable of altering the binding properties of the SENR ligand to SENR, etc. DNA encoding the above-described polypeptide or the polypeptide is usable in: (1) searching the physiological effects of the above polypeptide; (2) constructing synthetic oligonucleotide probes or PCR primers; (3) acquiring DNA encoding an SENR ligand or a precursor protein; (4) developing a receptor-binding assay system and screening candidate compounds for drugs by using a recombinant receptor protein expression system; (5) acquiring an antibody and an antiserum; (6) developing diagnostics with the use of the DNA, RNA, antibody or antiserum; (7) developing drugs such as central nervous function controlling agents, circulatory function controlling agents and heart function controlling agents; (8) gene therapy; and the like.

Description

Description New bioactive substances, their production methods and applications Technical fields

The present invention relates to a novel polypeptide against SNR (sensory epithelium neuropeptide-1 ike receptor), which is a G protein-coupled receptor protein, and a DNA encoding the same. Background art

Many hormones and neurotransmitters regulate the functions of living organisms through specific receptors on cell membranes. Many of these receptors transduce intracellular signals through the activation of conjugated guanine nucleotide-binding proteins (hereinafter sometimes abbreviated as G proteins), and have seven transmembrane domains. Because they have a common structure, they are collectively referred to as G protein-coupled receptors and one or seven transmembrane receptors.

The interaction of these hormones and neurotransmitters with the G protein-coupled receptor Yuichi maintains homeostasis in the living body, reproduction, individual development, metabolism, growth, the nervous system, the circulatory system, and the immune system. Important functions such as regulation of digestive system, metabolic system, and sensory perception are important for living organisms. In this way, it is known that the regulation of biological functions involves the receptor proteins for various hormones and neurotransmitters, and plays an important role in regulating their functions. And neurotransmitters) and whether there is a receptor for it is often unknown.

In recent years, utilizing the fact that G protein-coupled receptor proteins show similarity in amino acid sequence to a part of their structure, polymerase chain reaction

(Polymerase Chain Reaction, hereinafter abbreviated as PCR), a method for searching for a DNA encoding a novel receptor protein has been carried out, and a number of so-called orphan G proteins whose ligands are unknown have been developed. Conjugated receptor Yuichi protein (Libert, F., et al. Science, 244, 569-572, 1989, Welch, SK, et al., Biochem. Biophys. Res. Commun., 209, 606-613, 1995, Marc ese, A., et al., Genomics, 23, 609-618, 1994, Marchese, A., Genomics, 29, 335-344, 1995). In addition, new G protein-coupled receptor proteins have been found one after another by random sequencing of genomic DNA or cDNA (Nomura, N., et al., DA Research 1, 27-35, 1994). The only general means to determine the ligands of these protein G protein-coupled receptor proteins was to infer from the similarity in the primary structure of the G protein-coupled receptor protein. However, many of the orphan G protein-coupled receptor proteins have low homology to known receptors, and in fact, except for the receptor subtype of known ligands, only similarity in primary structure. It was difficult to estimate the ligand. On the other hand, it has been presumed from genetic analysis that many unknown ligands still exist due to the fact that many orphan G protein-coupled receptors have been found. Few examples have identified a type I receptor ligand.

Recently, there has been reported an example in which cDNA encoding an orphan G protein-coupled receptor protein was introduced into animal cells to search for a novel opioid peptide (Reinsheid, RK et al., Science, 270, 792- 794, 1995, Menular, J. -C., Et al., Nature 377, 532-535, 1995). However, in this case, the ligand was easily expected to belong to the family of opioid peptides, based on the similarity and tissue distribution with known G protein-coupled receptor proteins. The history of research and development of substances acting on living organisms through opioid receptors has been long, and various types of gonist and agonist have been developed. Therefore, we found an agonist for this receptor from among a group of artificially synthesized compounds, and used it as a probe to verify the expression of the receptor in the receptor cDNA-introduced cells, and then used the same intracellular signaling system as the agonist. We are searching for an activator, purifying it, and determining the structure of the ligand.

In addition, cDNA encoding the receptor G protein-coupled receptor G-104 (GRL104) was introduced into CHO cells and the specific expression in the receptor-expressing cells was confirmed. A case has been reported in which a new bioactive peptide was identified using an increase in intracellular free calcium as an index (Cox, KJA, et al., J. Neurosci., 17 (4), 1197-1205, 1997). However, this novel bioactive peptide had high homology with known leucokinin, and GRL104 also had reactivity with known leucokinin. As described above, almost no ligand can be estimated from the orphan G protein-coupled receptor protein. In particular, when the similarity to a known G protein-coupled receptor protein protein family is low, the ligand Little information was available and it was difficult to estimate the ligand.

One of the reported orphan G protein-coupled receptors is S ENR (Tal, M. et al., Biochem. Biophys. Res. Commun., 209, 752-759, 995). Although S ENR has a low homology with Somatos and Chin-Recep (SSTR4), it has not been known what its ligand is. GPR14 (Marchese, A., Genomics, 29, 335-344, 1995) reported by Marchese, A. et al. Is the same receptor as SENR.

The ligand for S ENR, a G protein-coupled receptor expressed in the central nervous system, circulatory system, reproductive system, immune system, digestive system, urinary system, sensory organs, etc., is useful as a pharmaceutical. It is thought that there is, but its structure and function have not been clarified so far. Disclosure of the invention

The present inventors used cells expressing cDNA encoding SENR by an appropriate means, and measured the specific cell stimulation (signal transduction) activity as an index. We successfully screened a polypeptide that recognizes as a ligand.

Furthermore, the present inventors have found that it is possible to screen for a compound that alters the binding between the ligand as the activator and the above-mentioned SENR.

That is, the present invention

(1) identical to the amino acid sequence represented by SEQ ID NO: 14 or A polypeptide having an amino acid residue or a pyroglutamic acid residue and substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 14, or an amide or an ester or a salt thereof;

(2) A substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34 The polypeptide according to the above (1),

(3) The above (1) having the amino acid sequence represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34 ) Described polypeptide,

(4) a precursor protein of the polypeptide according to (1) or an amide or an ester or a salt thereof;

(5) the precursor protein according to the above (4), which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26;

(6) a DNA containing a DNA having a nucleotide sequence encoding the polypeptide according to (1),

(7) The above (6) having the base sequence represented by SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38 ) Described DNA,

(8) DNA containing DNA having a nucleotide sequence encoding the precursor protein according to (4),

(9) The DNA according to the above (8), which has a base sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25,

(10) a recombinant vector containing the DNA of (6) or (8), (11) a transformant transformed with the recombinant vector of (10),

(12) Culturing the transformant as described in (11) above to produce and accumulate the polypeptide as described in (1) or the precursor protein as described in (4) above, and collecting this. Production of the polypeptide according to the above (1) or the precursor protein according to the above (4) or an amide or an ester or a salt thereof, Construction method,

(13) an antibody against the precursor protein or the amino acid thereof according to (1),

(14) Above (1)

A pharmaceutical comprising the precursor protein or an amino acid or a salt thereof according to the above.

(1 5) a medicament comprising the DNA according to (6) or (8) above,

(16) the medicament according to the above (14) or (15), which is a central function regulator, a circulatory function regulator, a heart function regulator, a kidney function regulator, a urinary function regulator or a sensory organ function regulator;

(17) SENR characterized by using the polypeptide according to (1) or the precursor protein according to (4) or an amide or ester thereof or a salt thereof, and the polypeptide according to (1). Or a method for screening a compound or a salt thereof that alters the binding property to the precursor protein or an amide or an ester or a salt thereof according to the above (4),

(18) The polypeptide according to (1), wherein the polypeptide according to (1) or the precursor protein according to (4) or an amide or ester thereof or a salt thereof is used. Or a kit for screening a compound or a salt thereof that alters the binding property to the precursor protein or the amide or ester thereof or the salt thereof according to (4) above,

(19) SENR and the polypeptide according to (1) or the precursor according to (4), which are obtained by using the screening method according to (17) or the screening kit according to (18). A compound or a salt thereof that alters the binding property to a protein or its amide or its ester or its salt,

(20) A method for quantifying the polypeptide according to (1) or the precursor protein according to (4) or an amide or an ester or a salt thereof, which comprises using the antibody according to (13); and

(21) The polypeptide according to (1), the precursor protein according to (4), or an amide thereof, which comprises the antibody according to (13). Or a diagnostic agent for a disease associated with the ester or a salt thereof.

Further, the present invention provides

(22) the polypeptide according to the above (1), which is derived from a mammal, or the precursor protein according to the above (4), and

(23) The above (14) or (15) which is an agent for treating or preventing diseases such as hypertension, hypotension, renal disease, heart disease, pollakiuria, urinary incontinence, hearing loss, olfactory abnormalities, and visual abnormalities. ).

Regarding the S ENR for the polypeptide in the present invention, specifically, not only the above-mentioned known S ENR or a salt thereof, but also the like,

(24) S ENR or a salt thereof comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 29 or SEQ ID NO: 30, or

(25) an amino acid in which one or more, preferably one or more and ten or less amino acids in the amino acid sequence represented by SEQ ID NO: 29 or SEQ ID NO: 30 are deleted; An amino acid having one or more, preferably one or more and no more than 10 amino acids added (or inserted) to the amino acid sequence represented by the sequence SEQ ID NO: 29 or SEQ ID NO: 30 1 to 30 amino acids, preferably 1 to 10 amino acids in the amino acid sequence represented by the sequence or SEQ ID NO: 29 or SEQ ID NO: 30 is replaced with another amino acid SENR or a salt thereof according to the above (24), which is a protein containing the amino acid sequence thus identified. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the entire nucleotide sequence of rat urotensin 1 ike peptide precursor protein cDNA isolated from rat spinal cord cDNA and the entire amino acid sequence of rat urotensin like peptide precursor protein translated therefrom.

FIG. 2 shows the entire nucleotide sequence of mouse urotensin like peptide precursor protein cDNA isolated from mouse spinal cord cDNA and the entire amino acid sequence of mouse urotensin like peptide precursor protein translated therefrom. Figure 3 shows the Araki Don acid metabolite release activity against synthetic rat hurot ens inli ke pep ti de- 2 of CH0 / RSE ^T R cell lines. BEST MODE FOR CARRYING OUT THE INVENTION

As used herein, “substantially the same” means that the activity of the protein, for example, the binding activity between the ligand and the receptor (SENRR), the physiological characteristics, and the like are substantially the same. Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the polypeptide, in which case the substitution, deletion, addition or insertion of the polypeptide is made. The peptide will be substantially identical to one without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, norin, proline, phenylalanine, tryptophan, methionine and the like. Polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of positively charged (basic) amino acids include arginine, lysine, and histidine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

The polypeptide of the present invention is a ligand for SENR. Specifically, the polypeptide has the same amino acid sequence as SEQ ID NO: 14 or has a glutamine residue or a pyroglutamic acid residue at the N-terminus. And polypeptides containing an amino acid sequence substantially identical to the amino acid sequence represented by 4, amides thereof, esters thereof and salts thereof (hereinafter, may be abbreviated as the polypeptide of the present invention).

The polypeptide of the present invention, its production method and use are described in more detail below.

Examples of the polypeptide of the present invention include human tissues from warm-blooded animals (eg, guinea pigs, rats, mice, bush, higgies, horses, monkeys, etc.) (for example, Such as pituitary gland, kidney, brain, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract, blood vessel, heart, etc. Having the same amino acid sequence as SEQ ID NO: 14 or having a glutamine residue or pyroglutamic acid residue at the N-terminus and having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 14 Any polypeptide may be used. For example, as the polypeptide of the present invention, in addition to the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 and the like, and having a glutamine residue or a pyroglutamic acid residue at the N-terminus, SEQ ID NO: 14 A polypeptide having substantially the same activity as the polypeptide containing the represented amino acid sequence (eg, SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or a polypeptide containing the amino acid sequence represented by SEQ ID NO: 34). Substantially the same activity includes, for example, receptor binding activity, signal transduction activity and the like. "Substantially the same quality" means that the receptor binding activity and the like are the same in nature. Therefore, quantitative factors such as the strength of the receptor binding activity and the molecular weight of the polypeptide may be different.

As a polypeptide having a glutamine residue or a pyroglutamic acid residue at the N-terminus and having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14, for example, (1) ① It has a glutamine residue or pyroglutamic acid residue at the N-terminus, ② Amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 14 from the 8th (Al a) to the 17th (lie) Contains a sequence, ③ a polypeptide consisting of 14 to 17 amino acid residues, or (2) ① has a glutamine or pyroglutamic acid residue at the N-terminus, and ② has a SEQ ID NO: 14 The amino acid sequence contains the amino acid sequence from the 8th (Al a) to the 17th (lie) from the N-terminus of the amino acid sequence, and ③ a polypeptide consisting of 14 to 17 amino acid residues. N-terminal poly (amino acid) with an additional 3 to 10 amino acid residues Examples include peptides.

Above all, it contains the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34 Preferred examples include polypeptides.

In the present specification, the polypeptide has a N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide labeling. ① The amino acid sequence represented by SEQ ID NO: 14; ② The amino acid sequence represented by SEQ ID NO: 15; ③ The amino acid sequence represented by SEQ ID NO: 27; ④ The amino acid sequence represented by SEQ ID NO: 31 The polypeptide containing the amino acid sequence, ⑤ the amino acid sequence represented by SEQ ID NO: 32, ⑥ the amino acid sequence represented by SEQ ID NO: 33, ⑦ the amino acid sequence represented by SEQ ID NO: 34, is a C-terminal there usually a carboxyl group (-C00H) or carboxylate (- C00-) a but, C-terminal, is not good even amide (-C0N ^T H ₂₎ or ester (-C00R). As R of the ester, such as methyl, Echiru, n- propyl, C I ₆ alkyl group such as isopropyl or 11 one-butyl, cyclopentyl, C ₃ _ _s cycloalkyl group such as key sill cycloheteroalkyl, phenyl, shed one naphthyl C ₂ § aryl group such as benzyl, phenethyl, phenylene Lou (^ such as benzhydryl - 2 Al kill, or alpha-C ₇ _ _{1 4} 7 aralkyl group such as flying one Nafuchiru C Interview _ ₂ alkyl, such as naphthylmethyl And a pivaloyloxymethyl group commonly used as an ester for oral use.

As a salt of the polypeptide of the present invention, a salt with a physiologically acceptable base (eg, alkali metal or the like) or an acid (organic acid or inorganic acid) is used. Addition salts are preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) , Tartaric acid, cunic acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid).

The polypeptide of the present invention can be produced by a method for purifying a polypeptide from a tissue or a cell of a human warm-blooded animal, or can be produced according to a polypeptide synthesis method described later. It can also be produced by culturing a transformant containing a DNA encoding a polypeptide described below. Organization Alternatively, after homogenizing the cells, extraction is performed with an acid, an organic solvent, or the like, and the extracted solution is subjected to chromatography such as salting out, dialysis, gel filtration, reverse phase chromatography, ion exchange chromatography, affinity chromatography, etc. Purification and isolation can be achieved by combining the above.

As described above, the polypeptide of the present invention can be produced according to a polypeptide synthesis method known per se, or by cleaving a polypeptide containing the polypeptide of the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the objective peptide is produced by condensing a partial peptide or amino acid capable of constituting the polypeptide of the present invention with the remaining portion, and when the product has a protecting group, removing the protecting group to produce the desired peptide. can do. Known methods for condensation and elimination of the protecting group include, for example, the methods described in the following ① to ⑤.

®M. Bodanszky and M.A. Ondetti, Peptide Synthesis, Interscience Publ ishers, New York (1966)

② Schroeder and Luebke, The Peptide, Academic Press, New York (1965)

(3) Nobuo Izumiya et al. Basics and experiments on peptide synthesis, Maruzen Co., Ltd. (1975)

洽 Kajima Yajima and Shunpei Sakakibara, Laboratory of Biochemical Experiments 1, Protein Chemistry IV, 205, (1977)

治 Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten

After the reaction, the polypeptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when the polypeptide is obtained as a salt, it is converted to a free form by a known method. be able to.

As the amide form of the polypeptide, a commercially available resin for peptide synthesis suitable for amide formation can be used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, Benzoxy benzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl) Hydroxymethyl) phenoxy resin; 4- (2 ′, 4′-dimethoxyphenyl—Fmoc aminoethylyl) phenoxy resin; Using such a resin, amino acids having a suitably protected amino group and side chain functional group are condensed on the resin in accordance with the sequence of the target peptide in accordance with various known condensation methods. At the end of the reaction, the peptide is cleaved from the resin, and at the same time, various protecting groups are removed. If necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the desired polypeptide.

Regarding the condensation of the above protected amino acids, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Examples of carbodiimides include DCC, Ν, Ν′-diisopropylcarboimide, and Ν-ethyl-Ν ′-(3-dimethylaminopropyl) carbodiimide. For these activations, the protected amino acid may be added directly to the resin along with a racemization inhibitor (eg, HOB and HOOBt) or may be pre-protected as a symmetrical acid anhydride or H0B1 ester or HOOBt ester. The activated amino acids can be added to the resin after activation. The solvent used for the condensation of the protected amino acid with the activated resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, and N-methylpyrrolidone; halogenated hydrocarbons such as methylene chloride and chloroform; alcohols such as trifluoroethanol; Sulfoxides such as dimethyl sulfoxide; tertiary amines such as pyridine; ethers such as dioxane and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; or an appropriate mixture thereof. Etc. are used. The reaction temperature is appropriately selected from the range known to be usable for the disulfide bond formation reaction, and is usually selected from the range of about 120 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. Ninhydrite As a result of the test using the reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. If sufficient condensation is not obtained even after repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so that the subsequent reaction is not affected.

Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tert-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, CutZ, Br-Z, and adamantyl. Examples thereof include xycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, and Fmoc. The protecting group for the carboxyl group is, for example, R as described above. . Other alkyl groups, C ₃ _ _s cycloalkyl group, C ₇ _ _{1 4} Ararukiru group, 2-Adamanchiru, 4-nitro-base Nji le, 4-methoxybenzyl, 4-black port benzyl, Fuenashiru group and downy Nji Ruokishi Carbonyl hydrazide, evening butoxycarbonyl hydrazide, trityl hydrazide and the like.

The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Suitable groups for this esterification include, for example, lower alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbon such as benzyloxycarbonyl group and ethoxycarbonyl group. Examples of groups suitable for etherification include a benzyl group, a tetrahydrobiranyl group, and a butyl group.

The protecting group of the phenolic hydroxyl group of tyrosine include _{Bz l, C l 2 -Bz K} 2- two Torobenjiru, Br-Z, and the like evening over tert-butyl.

Examples of the imidazole protecting group of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DT, benzyloxymethyl, Buiii, Bo Tr K Fmoc and the like.

Activated carboxyl groups of the raw materials include, for example, the corresponding acid anhydrides, azides, and active esters [alcohols (eg, phenol phenol, 2,4,5-trichloromouth phenol, 2,4- Dinitrophenol, Alcohol, paranitrophenol, H0NB, N-hydroxysuccinimide, N-hydroxyfurimide, HOBt) and the like. The activated amino group of the raw material includes, for example, the corresponding phosphoric amide. Methods for removing (eliminating) the protecting group include catalytic reduction in the presence of a catalyst such as Pd black or Pd carbon in a stream of hydrogen, as well as anhydrous hydrogen fluoride, methanesulfonic acid, and trifluorosulfonic acid. Examples include acid treatment with an acid, trifluoroacetic acid or a mixture thereof, treatment with a base using diisopropylethylamine, triethylamine, piperidine, piperazine, or the like, and reduction with sodium in liquid ammonia. The elimination reaction by the above acid treatment is generally carried out at a temperature of 120 ° C to 40 ° C. In the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1 It is effective to add a cation scavenger such as 1,4-butanedithiol or 1,2-ethanedithiol. Also, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butanedithiol, etc. In addition to the deprotection by acid treatment in the presence of sulfur, it is also removed by alkaline treatment with dilute sodium hydroxide, dilute ammonia and the like. The protection of the functional group which should not be involved in the reaction of the raw material and the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.

As another method for obtaining an amide form of a polypeptide, first, after amidating the α-hydroxyl group of the carboxyl terminal amino acid, the peptide chain is extended to a desired chain length on the amino group side, and Ν A peptide is prepared by removing only the protecting group of the terminal amino amino group and a peptide (or amino acid) is obtained by removing only the protecting group of the C-terminal carboxyl group, and these peptides are mixed in the above-mentioned mixed solvent. To condense. Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. This crude polypeptide is purified using various known purification methods, and the main polypeptide is freeze-dried to obtain the desired polypeptide. Can be obtained.

To obtain an ester of the polypeptide, the α-carboxy group of the carboxy-terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then the ester of the desired polypeptide is prepared in the same manner as the amide of the polypeptide. You can get your body.

The polypeptide of the present invention may be the same as the amino acid sequence represented by the above-mentioned SEQ ID NO: 14 or an amino acid sequence having a glutamine residue or a pyroglutamic acid residue at the Ν-terminal and represented by SEQ ID NO: 14 Contains substantially the same amino acid sequence, and has the same action as the polypeptide, for example, a central nervous function controlling action, a circulatory function controlling action, a heart function controlling action, a kidney function controlling action, a urinary function controlling action or a sensory organ Any polypeptide may be used as long as it has a function of regulating functions.

The polypeptide of the present invention can be further used as an antigen for preparing an antibody against the polypeptide. As the polypeptide as such an antigen, in addition to the above-described polypeptide of the present invention, a partial peptide such as a Ν-terminal peptide, a C-terminal peptide, or a peptide at the center of the polypeptide of the present invention is used. You.

As the partial peptide, a peptide containing each domain individually may be used, but a peptide containing a plurality of domains at the same time may be used.

The partial peptide in this specification also has an amide (—C0NH ₂ ) or ester at the C-terminus.

(-C00R). Here, examples of the ester group are the same as in the case of the polypeptide described above. When the partial peptide has a lipoxyl group or lipoxylate other than at the C-terminus, those in which those groups are amidated or esterified are also included in the partial peptide of the present invention. As the ester at this time, for example, the above-mentioned C-terminal ester and the like are used.

Specific examples of the partial peptide of the present invention include, for example, 2 to 16 amino acids including the fifth (His) and sixth (Gly) from the N-terminal of the amino acid sequence represented by SEQ ID NO: 14. And a base comprising an amino acid sequence containing an amino acid. The polypeptide of the present invention or its partial peptide may be a fusion protein with a protein whose function or property is well known.

As the salt of the partial peptide of the polypeptide of the present invention, the same salts as the above-mentioned salts of the polypeptide are used.

The partial peptide of the polypeptide of the present invention or its amide, ester or salt thereof is produced according to the same synthetic method as in the above-mentioned polypeptide, or by cleaving the polypeptide of the present invention with an appropriate peptidase. be able to.

The DNA encoding the polypeptide of the present invention may be the same as the amino acid sequence represented by SEQ ID NO: 14 or an amino acid having a glutamine residue or a pyrrodal acid residue at the N-terminus and represented by SEQ ID NO: 14 Any DNA may be used as long as it contains DNA encoding a polypeptide containing an amino acid sequence substantially identical to the sequence (hereinafter, may be abbreviated as the DNA of the present invention). Further, it may be any of genomic DNA, genomic DNA library, the aforementioned tissue-cell derived cDNA, the aforementioned tissue / cell derived cDNA library, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using an RNA fraction prepared from the above-mentioned tissues and cells.

Here, examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 include, for example, DNA containing the DNA having the base sequence represented by SEQ ID NO: 16 Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 15 include, for example, a DNA having the base sequence represented by SEQ ID NO: 17 Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 27 include, for example, the base sequence represented by SEQ ID NO: 28 Such as DNA having the amino acid sequence represented by SEQ ID NO: 31. Examples of the DNA containing the DNA encoding the DNA include DNA containing the nucleotide sequence represented by SEQ ID NO: 35, and the like. The DNA containing the amino acid sequence represented by SEQ ID NO: 32 is included. Examples of a DNA containing a DNA encoding the polypeptide of the present invention include a DNA containing a DNA having a base sequence represented by SEQ ID NO: 36, and an amino acid represented by SEQ ID NO: 33. Examples of the DNA containing the DNA encoding the polypeptide containing the sequence include DNA containing the DNA having the base sequence represented by SEQ ID NO: 37, and the like. Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by 34 include DNA containing the DNA having the base sequence represented by SEQ ID NO: 38, and the like.

Examples of DNA having a glutamine residue or a pyroglutamic acid residue at the N-terminal and containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 include, for example, (1) from the 5 'end 3 bases are CAA and have about 80% or more, preferably about 90% or more, more preferably about 95% or more, and more preferably about 98% or more homology with the base sequence represented by SEQ ID NO: 16. Examples include DNA containing a DNA having a base sequence and (2) DNA having 9 to 30 bases added to the 5 'end.

Examples of DNA having a glutamine residue or a pyroglutamic acid residue at the N-terminus and containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 include, for example, 1) SEQ ID NO: 16; SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or 1 or 2 or more (preferably 1 to 30) in the nucleotide sequence represented by SEQ ID NO: 38 Sequence, more preferably about 1 to 10, more preferably several (one or two) bases deleted, (2) SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 28 , SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38 One or more or more (preferably about 1 to 30, more preferably 1 to 10) About, more preferably several (one or two) bases Nucleotide sequences, ③ SEQ ID NO: 1 6, SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38 salt represented by A base sequence into which one or more bases have been inserted (preferably about 1 to 30, more preferably: about! 10 to about 10, and more preferably several (1 or 2)) in the base sequence ④ 番号 SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38 A base sequence substituted with one or more (preferably about 1 to 30, more preferably about 1 to 10, and more preferably several (1 or 2)) other bases, or DN This also includes DNAs containing DNAs having base sequences obtained by combining them.

More specifically, (j) the amino acid sequence represented by SEQ ID NO: 14 which is identical to the amino acid sequence represented by SEQ ID NO: 14 under stringent conditions or has a glutamine residue or pyrodaltamic acid residue at the N-terminus A mammal-derived DNA that hybridizes with a DNA-containing sequence capable of binding to a receptor protein containing an amino acid sequence substantially identical to the sequence; (2) a sequence due to degeneracy of the genetic code; Receptor protein having the same amino acid sequence as the amino acid sequence represented by No. 14 or having a glutamine residue or a pyroglutamic acid residue at the N-terminus and containing the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 14 A sequence that contains DNA and a sequence that does not hybridize with the sequence defined in (1). Etc. DN A to co one de the One also acid sequence Poribe peptide is used. Hybridization can be performed according to a method known per se or a method analogous thereto. As the stringent conditions, for example 42 ° C, 50% formamide, 4 XS S PE (1 XSSPE = 150m.M aCl, lOm.M aH 2 P0, · Η 2 0, ImM EDTA pH7.4), 5 X Denhardt's solution, 0.1% SDS.

A protein having the same amino acid sequence as SEQ ID NO: 14 or having a daltamine residue or a pyroglutamic acid residue at the N-terminus and containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 The DNA that hybridizes with the sequence of the DNA containing the coding DNA includes, for example, CAA consisting of 3 bases from the 5 'end and about 70% of the base sequence represented by SEQ ID NO: 16. Or more, preferably about 80% or more, more preferably about 90% or more, most preferably More preferably, DNA containing a nucleotide sequence having about 95% or more homology is used.

The DNA fragment containing the partial nucleotide sequence of DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 and the like of the present invention is also preferably used as a DNA detection probe.

DNA encoding the polypeptide of the present invention can also be produced by the following genetic engineering techniques.

As a means for cloning DNA that completely encodes the polypeptide of the present invention, the DNA library and the like can be cloned by a PCR method known per se using a synthetic DNA primer having a partial nucleotide sequence of the polypeptide of the present invention. From the target DNA, or the DNA incorporated into an appropriate vector, for example, labeled using a DNA fragment or a synthetic DNA having a partial or entire region of the polypeptide of the present invention. It can be sorted by hybridization. Hybridization is performed according to, for example, the method described in Molecular Cloning C 2nd ed .; J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When using a commercially available library, perform the procedure described in the attached instruction manual.

The cloned DNA encoding the polypeptide of the present invention can be used as it is depending on the purpose, or can be used after digestion with a restriction enzyme or addition of a linker if desired. The DNA may have ATG as a translation initiation codon at the 5 'end, and TAA, TGA or TAG as a translation termination codon at the 3' end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter.

The expression vector of the polypeptide of the present invention can be prepared by, for example, (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (mouth) converting the DNA fragment into an appropriate expression vector. It can be produced by ligating downstream of one of the promoters.

Examples of vectors include Escherichia coli-derived plasmids (eg, pBR322, pBR325, pUC12, pUC13) and Bacillus subtilis-derived plasmids (eg, pUB11). 0, pTP5, pC194), yeast-derived plasmids (eg, pSHl9, pSH15), bacteriophages such as λ phage, and animal viruses such as retrovirus, vaccinia virus, and baculovirus. .

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.

When the host used for the transformation is an animal cell, promoters derived from SV40, retrovirus promoter, metamouth thionein promoter, heat shock promoter, cytomegalovirus promoter, SRa promoter, etc. Available. If the host is Escherichia, the trp promoter, T7 promoter, lac promoter, recA promoter, λPL promoter, 1 pp promoter, etc., and if the host is Bacillus, S When the host is yeast, such as the PO1 promoter, the SPO2 promoter, and the penP promoter, the PH5 promoter, the PGK promoter, the GAP promoter, the ADH1 promoter, and the GAL promoter are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

In addition to the above, the expression vector optionally contains an enhancer, a splicing signal, a poly-A addition signal, a selection marker, and an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori). Can be used. Examples of the selection marker include a dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], an ampicillin resistance gene (hereinafter sometimes abbreviated as Ampr), Neomycin resistance gene (hereinafter sometimes abbreviated as Neo, G418 resistance) and the like. In particular, when the DHFR gene is used as a selective agent in CH〇 (cl hfr−) cells, selection can be made even on a thymidine-free medium. In addition, if necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. If the host is Escherichia, the phoA-signal sequence and the immediate A / signal sequence, etc. However, if the host is yeast, the mating factor a (MFα) signal sequence, invertase signal sequence, etc.If the host is an animal cell, for example, insulin signal sequence, Hi-interferon A signal sequence, an antibody molecule 'signal sequence and the like can be used.

Using the vector containing the DNA encoding the polypeptide thus constructed, a transformant can be produced.

As a host, for example, a bacterium belonging to the genus Escherichia, a bacterium belonging to the genus Bacillus, a yeast, an insect or an insect cell, an animal cell and the like are used.

Examples of the genus Escherichia include Escherichia coli K12. DH1 [Prosings 'ob' The National Academy Obb-Schencies ob Ob The USA. Sci. USA), 60, 160 (1968)], JM 103 [Nucleic Acids Research, Vol. 9, 309 (1981)], JA 221 [ Journal of Molecular Biology (Journal of Molecular Biology)], 120, 5 17 (1 978)], HB 101 (Journal of Molecular Biology) Molecule's biology, 41, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like are used.

Examples of Bacillus bacteria include, for example, Bacillus subtilis MI 114 (Gene, Vol. 24, 255 (1983)), 207—21 [Journal ォ ob 'Biochemistry (Journal οί Biochemistry), 95, 87 (1 984)).

As yeast, for example, Saccharomyces cerevisiae AH22AH22R-, NA87-11A, DKD-5D, 20B-12 are used.

As insects, for example, silkworm larvae are used [Maeda et al.

(Nature), 315, 592 (1985)].

As insect cells, for example, when the virus is Ac NPV, a cell line derived from night larvae of moth larvae (Spodoptera frugiperda cell; Sf cell), Trichoplusia ni (7) MG1 cell derived from the midgut, Trichoplusia ni egg High Five ^TM cells of origin, Mamestra A cell derived from brassicae or a cell derived from Estigmena acrea is used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. Examples of the Sf cells include, for example, Sf9 cells (ATCC CRL1711), Sί21 cells [Vaughn, JL et al., In vitro, Vol. 13, 21-3-21] Page 7 (1977)].

Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese Hams Yuichi cell CH 0, DHFR gene-deficient Chinese Hams Yuichi cell CH 〇 (dhfi "—CHO cell), mouse L cell, mouse 3 T 3 cells, mouse myeoma cells, human 293 cells, human FL cells, 293 cells, C127 cells, BALB 3T3 cells, Sρ-2— cells, etc. are used.

For example, to transform a microorganism belonging to the genus Escherichia, for example, Prossings of the National Academy of Sciences, Inc. (Pro Natl. Acad. Sci. USA), 69 Vol., 211 (1972) and Gene, Vol. 17, 107 (1982). Transformation of Bacillus spp. Is performed, for example, according to the method described in Molecular & General Genetics, Volume 168, 11 (179).

To transform yeast, for example, Pro Natl. Acad. Sci. USA, 75, 1 This is performed according to the method described in 929 (19978).

Transformation of insect cells or insects is performed, for example, according to the method described in Bio / Technology. 6, 47-55 (1988).

Transformation of animal cells is performed, for example, according to the method described in Virology, 52, 456 (1973).

Methods for introducing an expression vector into cells include, for example, the lipofection method [Feigner, PL et al. Proceedings of "National Academy of Sciences", "Prof. the National Academy of Sciences of the United States of America), 84, 74 13 6 4 6 7 page (1 9 7 3 years)], electroporation ^{[i \ T uemann, E. et al} . Enbo 'journal (EMBO J.), 1 vol., 8 4 1 one 84 page 5 (1 982 years)].

Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide of the present invention is obtained.

As a method for stably expressing the polypeptide of the present invention using animal cells, the above-described method for selecting cells by clonal selection of cells in which the expression vector introduced into the animal cells is integrated into the chromosome is used. is there. Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the polypeptide of the present invention can be obtained by repeatedly performing clone selection on the animal cells obtained using the selection marker as described above. When the dhfr gene is used as a selection marker, the polypeptide of the present invention or a partial peptide thereof can be encoded together with the dhfr gene by culturing the cells at a gradually increased MTX concentration and selecting a resistant strain. The resulting DNA can be amplified intracellularly to obtain even higher expression animal cell lines.

The polypeptide of the present invention can be produced by culturing the above transformant under conditions capable of expressing DNA encoding the polypeptide of the present invention and producing and accumulating the polypeptide of the present invention.

When culturing a transformant whose host is a bacterium belonging to the genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for culturing, and a carbon source necessary for the growth of the transformant is contained therein. , Nitrogen sources, inorganic substances and others. Examples of carbon sources include glucose, dextrin, soluble starch, and sucrose.Examples of nitrogen sources include ammonium salts, nitrates, corn chip liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like. Examples of the inorganic or organic substance include, for example, calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8. As a medium for culturing the genus Rhichia, for example, an M9 medium containing glucose and casamino acid (Miller, Journal 'Ob'Experiment in Mole 1,000 Yra-Jetetics ( Journal of Experiments in Molecular Genetics), 431-43, Cold Spring Harbor Laboratory, New York 1972]. Here, if necessary, a drug such as 3 / 3-indolylacrylic acid can be added to make the promoter work efficiently.

When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.

When the host is a bacterium belonging to the genus Bacillus, cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours, and if necessary, aeration and stirring may be added.

When culturing a transformant in which the host is yeast, for example, Burkholder's minimal medium [Bostian, KL et al., "Procedures of the National Academy of Sciences" is used. S.A. (Pro Natl. Acad. Sci. USA), 77, 450 (1980)] or an SD medium containing 0.5% casamino acid [BiUer, GA "Pro-Natl. Acad. Sci. USA", 81, 53, 30 (19), "Processings of the National Academy of Sciences of the United States" The pH of the medium is preferably adjusted to about 5 to 8. Cultivation is usually performed at about 20 ° C to 35 ° C for about 24 to 72 hours, and if necessary. Add aeration and agitation.

When culturing a transformant whose host is an insect cell, the culture medium was immobilized in Grace's Insect Medium (Grace.raceC., Nature, 195, 788 (1962)). For example, those to which additives such as serum and the like are appropriately added are used. Preferably, ρΗ of the medium is adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and agitation are added as necessary.

When culturing a transformant in which the host is an animal cell, the culture medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122 vol., 501 (19) 5 2)]. DMEM medium [Vology, Vol. 8, 3 96 (1 959)], RPM I 1640 medium [The Journal of the American Medical Association, Vol. 199, 5 19 (1 967)], 199 medium [Proceding of the Society for the Biological Medicine, 73, 1 (1950)] . Preferably, the pH is about 6-8. Culture is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours, and if necessary, aeration and / or agitation are added.

In particular, when CHO (dhfr ") cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal serum containing almost no thymidine.

The polypeptide of the present invention can be separated and purified from the above culture by, for example, the following method.

When extracting the polypeptide of the present invention from cultured cells or cells, the cells or cells are collected by a known method after culturing, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme and Z or After the cells or cells are destroyed by freeze-thawing or the like, a method of obtaining a crude polypeptide extract by centrifugation or filtration may be used as appropriate. The buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, sometimes abbreviated as TM hereinafter). .

When the polypeptide is secreted into the culture solution, after the culture is completed, the bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected.

Purification of the polypeptide of the present invention contained in the culture supernatant or extract obtained in this manner can be carried out by appropriately combining known separation and purification methods. These known separation and purification methods mainly include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis. Method using difference in molecular weight, Method using charge difference such as ion exchange chromatography, Method using specific affinity such as affinity chromatography, Hydrophobicity such as reverse phase high performance liquid chromatography Using the difference between A method utilizing the difference between isoelectric points, such as to focusing, is used.

When the thus-obtained polypeptide of the present invention is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide of the present invention is obtained in a salt, it is a known method Alternatively, it can be converted into a free form or another salt by a method analogous thereto.

The polypeptide of the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. . As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, proteinase, glycosidase and the like are used.

The presence of the polypeptide of the present invention thus produced can be measured by enzyme immunoassay using a specific antibody or the like.

The DNA encoding the polypeptide of the present invention or the polypeptide of the present invention includes (1) searching for the physiological action of the polypeptide of the present invention, (2) preparing a synthetic oligonucleotide probe or a primer for PCR, and (3) a ligand for SENR.入手 Acquisition of DNA encoding the precursor protein, 開発 Development of a receptor binding assay system using a recombinant receptor protein expression system and screening of drug candidate compounds, 入手 Acquisition of antibodies and antisera, ⑥ DNA , Development of diagnostic drugs using RNA, antibodies or antisera, の central nervous function regulators, circulatory function regulators, heart function regulators, kidney function regulators, urinary function regulators, sensory organ function regulators, etc. It can be used for drug development and gene therapy.

In particular, a SENR agonist or antagonist specific to a warm-blooded animal such as a human can be screened by a receptor-binding assay system using a recombinant SENR expression system described below. Evening gonists can be used as preventive and therapeutic agents for various diseases.

Further, regarding the above item (2), the polypeptide of the present invention or the DNA encoding the same are those recognized as ligands by SENR expressed in the central nervous system, circulatory system, heart, kidney, urinary system or sensory system. Therefore, it is useful as a safe and low toxic drug. The polypeptide of the present invention or a DN encoding the same A is involved in central nervous function regulation, circulatory function regulation, heart function regulation, kidney function regulation, urinary function regulation or sensory organ regulation, such as senile dementia and cerebrovascular dementia. Degenerative, degenerative, high (low) blood pressure, renal disease (eg, chronic renal failure, nephritis, etc.), degenerative diseases caused by phylogenetic degenerative metamorphic diseases (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.), heart It can be used as a therapeutic or prophylactic agent for diseases such as heart failure, acute myocardial infarction, urinary frequency, urinary incontinence, hearing loss, olfactory abnormalities, and visual abnormalities.

When the polypeptide of the present invention or DNA encoding the same is used as the above-mentioned medicament, it can be carried out in a conventional manner. For example, a sterile solution orally as tablets, capsules, elixirs, microcapsules, and the like, coated with a sugar coating or an enteric coating as necessary, or with water or another pharmaceutically acceptable liquid. Or parenteral use in the form of injections such as suspensions. For example, the compound or a salt thereof may be combined with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc. in a unit dosage form required for generally accepted pharmaceutical practice. It can be manufactured by mixing. The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.

When the DNA of the present invention is used, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. Can be implemented.

Examples of additives that can be mixed with tablets and capsules include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Useful bulking agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry are used. When the unit dosage form is a capsule, the above type of material can further contain a liquid carrier such as an oil or fat. Sterile compositions for injection include active substances in vehicles such as water for injection, sesame oil, coconut oil It can be formulated according to the usual formulation practice such as dissolving or suspending naturally produced vegetable oils such as.

Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80, HCO-50) may be used in combination. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.

In addition, buffers (eg, phosphate buffer, sodium acetate buffer), analgesic IJ (eg, benzalkonium chloride, proforce hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), It may be blended with preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection solution is usually filled in a suitable ampoule.

The preparations obtained in this way are safe and have low toxicity, so they can be used, for example, in humans and mammals (for example, mice, rats, guinea pigs, egrets, higgs, bush dogs, dogs, cats, dogs, monkeys, etc.). Can be administered.

The dosage of the polypeptide of the present invention or the DNA encoding the same varies depending on the condition and the like. However, in the case of oral administration, generally, for an adult (assuming a body weight of 60 kg), it is about 0.1 per day. To 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. For parenteral administration, the single dose varies depending on the subject of administration, target organ, symptoms, administration method, etc. For example, in the form of injection, adult heart failure patients (with a body weight of 60 kg) Is administered by intravenous injection at a dose of about 0.01 to 30 mg / day, preferably about 0.1 to 2 mg / day, more preferably about 0.1 to 1 mg / day. Is convenient. In the case of other animals, the dose can be administered in terms of 60 kg.

The precursor protein of the polypeptide of the present invention, its production method and use are described below. This will be described in more detail.

Examples of the precursor protein of the polypeptide of the present invention, its amide, its ester or its salt (hereinafter, sometimes referred to as the precursor protein of the present invention) include, for example, the N-terminus of the aforementioned protein of the present invention or ( And) a tamper having one or more, preferably about 1 to 200, more preferably about 1 to 120, and more preferably about 50 to 120 amino acids bonded to the C-terminus. Quality.

Specifically, as the precursor protein of the present invention, a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 is used.

More specifically, a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 is represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 31 or As an example of a precursor of the polypeptide containing the amino acid sequence represented by SEQ ID NO: 32, a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 26 Examples of the precursor of the polypeptide containing the amino acid sequence represented by SEQ ID NO: 27, SEQ ID NO: 33 or SEQ ID NO: 34 are given.

In addition, the precursor protein of the present invention can be used in any tissue of human warm-blooded animals (for example, guinea pigs, rats, mice, bush, higgies, horses, monkeys, etc.) A protein derived from kidney, liver, gonad, thyroid gland, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc.) or a cell, etc. SEQ ID NO: 13 or SEQ ID NO: Any protein may be used as long as it has the same or substantially the same amino acid sequence as the amino acid sequence represented by 26. Examples of substantially equivalent activities include, for example, receptor-binding activity, signal transduction activity, and the like. The term “substantially the same” means that the receptor binding activity and the like are the same in properties. Therefore, strength factors such as the strength of the receptor binding activity and quantitative factors such as the molecular weight of the protein may be different.

Substantially the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 More specifically, the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 is about 50% or more, preferably about 60% or more, more preferably about 70% or more, More preferably, the amino acid sequence has about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more homology. The precursor protein of the present invention includes, for example, No. 1 or 2 or more in the amino acid sequence represented by SEQ ID NO: 26 (preferably about 1 to 30, preferably about 1 to 10, more preferably about 1 to 10) Or 2)) amino acid sequence in which the amino acid has been deleted, (2) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 30) in the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 , About 1-10 pieces, more preferred Or an amino acid sequence to which several (one or two) amino acids have been added, and ③ one or more (preferably one or more) in the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26. An amino acid sequence having about 30 to about 30, preferably about 1 to 10, and more preferably several (one or two) amino acids; ④ SEQ ID NO: 13 or SEQ ID NO: 2 One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably several (1 or 2)) amino acids in the amino acid sequence represented by 6 And amino acids having amino acid sequences obtained by combining the amino acid sequences with amino acids substituted with アミノ酸 ′.

In the present specification, the precursor protein has an N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide notation. For example, the precursor protein of the present invention containing the amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26, etc. is usually a protein having a carboxyl group (-C00H) or carboxy group at the C-terminus. rate (- C00-) in a force C-terminal amino-de (- C0NH ₂₎ or an ester (-C00R). As R of the ester, for example methylation, Echiru, n - C ^ such as butyl - - propyl, isopropyl or n e al Kill group, cyclopentyl, cyclohexylene, such as cyclohexyl (: _{3 8} cycloalkyl group, Hue alkenyl, Facial C _6, such as single-naphthyl - _{1 2} Ariru group, benzyl, phenethyl, phenylene Lou C Tsu alkyl such benz hydryl, Moshikuwahi such as single naphthylmethyl In addition to C _{7 1 4} Ararukiru groups such as α- Nafuchiru C physicians ₂ alkyl, such as pivaloyl Ruo carboxymethyl group which is generally used as an oral es ether and the like.

Examples of the salt of the precursor protein of the present invention include the same salts as those exemplified above as the salt of the polypeptide of the present invention.

The precursor protein of the present invention can be produced by a method for purifying tissues or cells of human warm-blooded animals, or can be produced according to the protein synthesis method described later. Alternatively, it can be produced by culturing a transformant containing DNA encoding a protein described below. When producing from tissues or cells of human warm-blooded animals, the tissues or cells of human warm-blooded animals are homogenized, and then extracted with an acid or an organic solvent.The extract is subjected to salting out, dialysis, and gel filtration. It can be purified and isolated by combining chromatography such as reverse phase chromatography, ion exchange chromatography, affinity chromatography and the like.

As described above, the precursor protein of the present invention can be produced according to a known method for synthesizing a protein, or by cleaving a protein containing the protein of the present invention with an appropriate peptidase. . As a method for synthesizing the peptide, the same method as described above is used.

As the amide form of the precursor protein of the present invention, a commercially available resin for peptide synthesis suitable for amide formation can be used. As such a resin, for example, the above-mentioned resin for peptide synthesis or the like is used. Using such a resin, amino acids having a suitably protected amino group and side chain functional group are condensed on the resin in accordance with the sequence of the target peptide according to various condensation methods known per se. At the end of the reaction, the peptide is cleaved from the resin and, at the same time, various protecting groups are removed.If necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the desired precursor protein of the present invention. get.

The precursor protein of the present invention contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26, and comprises the polypeptide of the present invention. The same effects as, for example, central nervous function regulation, circulatory function regulation, heart function regulation, kidney function regulation, urinary function The precursor protein itself may have a regulatory action or a sensory organ function regulating action.

The precursor protein of the present invention can be further used as an antigen for preparing an antibody against the precursor protein. As the protein as such an antigen, in addition to the above-described precursor protein of the present invention, partial peptides such as the N-terminal peptide, C-terminal peptide, and central peptide of the precursor protein of the present invention are used.

As the salt of the partial peptide of the precursor protein of the present invention, the same salts as the above-mentioned salts of polypeptide of the present invention are used.

The partial peptide of the precursor protein of the present invention or its amide, ester or salt thereof can be prepared by the same synthetic method as in the case of the above-mentioned precursor protein, or by converting the precursor protein of the present invention into an appropriate peptidase. It can be manufactured by cutting at

The DNA encoding the precursor protein of the present invention includes a DNA encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26. Any DNA may be used as long as it is a DNA. In addition, any of genomic DNA, genomic DNA library, the above-described tissue / cell-derived cDNA, the above-described tissue / cell-derived cDNA library, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as R-PCR method) using an RNA fraction prepared from the above-mentioned tissue * cells.

Here, examples of the DNA containing a DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 include, for example, SEQ ID NO: 12 Or a DNA containing a DNA having the base sequence represented by SEQ ID NO: 25, and the like. About 50% or more, preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 50% or more of the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25. Examples include DNAs containing DNAs having a nucleotide sequence having a homology of about 90% or more, most preferably about 95% or more. Examples of DNA containing DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 include, for example, 1) SEQ ID NO: 1 or 2 or more in the base sequence represented by SEQ ID NO: 25 (preferably about 1 to 30, preferably about 1 to 10, more preferably several (1 or 2 )) The base sequence in which the base is deleted, ② One or two or more (preferably about 1 to 30, preferably about 1 to 30, in the base sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25) A nucleotide sequence to which about 1 to 10 nucleotides have been added, and more preferably several (one or two) nucleotides; ③ one or more nucleotides in the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25 2 or more (preferably about 1 to 30, preferably about 1 to 10 And more preferably one or two or more (preferably one or two or more (preferably one or two or more) of the nucleotide sequences represented by SEQ ID NO: 12 or SEQ ID NO: 25). Is an amino acid sequence in which about 1 to 30, preferably about 1 to 10, and more preferably several (1 or 2) bases have been replaced with other bases, or a base sequence combining them And DNA containing DNA having the same.

More specifically, (1) a DN encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 under stringent conditions A DNA derived from a mammal that hybridizes with the sequence of the DNA containing A, (2) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 due to degeneracy of the genetic code. DNA that encodes a protein that has an identical amino acid sequence, and that encodes a protein that does not hybridize with the sequence of the DNA that contains the DNA and a sequence that does not hybridize with the sequence defined in (1) but has the same amino acid sequence Are used. Hybridization is performed by a method known per se or a method based thereon. It can be done according to law. As the stringent Bok conditions, for example 42 ° C, 5 0% formamide, 4 XSSPE (1 XSSPE = 150mM NaCl, lOmM NaH 2 P0 4 · Η 2 0, ImM EDTA pH7.4), 5 X Denhardt's solution, 0.1% SDS having a DNA containing a DNA encoding a protein having the same or substantially the same amino acid sequence as that represented by SEQ ID NO: 13 or SEQ ID NO: 26 Examples of the DNA that hybridizes with the sequence include, for example, about 70% or more, preferably about 80% or more, and more preferably about 90% of the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25. As described above, most preferably, a DNA containing a nucleotide sequence having a homology of about 95% or more is used.

In addition, the DNA fragment containing the partial base sequence of DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 of the present invention is DNA It is also preferably used as a detection probe.

DNA encoding the precursor protein of the present invention can also be produced by a genetic engineering technique in the same manner as the above-described polypeptide of the present invention.

The DNA encoding the precursor protein of the present invention or the precursor protein of the present invention includes (1) a search for a physiological action of the precursor protein (or the polypeptide of the present invention); (2) a synthetic oligonucleotide probe. Alternatively, preparing a primer for PCR, ③ obtaining a DNA encoding the polypeptide of the present invention, 開発 developing a receptor binding system using a recombinant receptor protein expression system and screening for candidate drug compounds ⑤ ⑤ Acquisition of antibodies and antisera, ⑥ Development of diagnostic agents using DNA, RNA, antibodies or antisera, central nervous function regulators, circulatory function regulators, heart function regulators, renal function regulators, urology It can be used for the development of drugs such as function regulators and sensory organ function regulators, and gene therapy.

In particular, a S ENR agonist or antagonist specific to a warm-blooded animal such as human can be screened by a receptor binding assay using a recombinant S ENR expression system described below. Alternatively, an angel gonist can be used as a preventive or therapeutic agent for various diseases. Further, regarding the above (2), the precursor protein of the present invention or the DNA encoding the same are those recognized as ligands by SENR expressed in the central nervous system, circulatory system, heart, kidney, urinary system or sensory organ system, etc. Therefore, it is useful as a safe and low toxic drug. The precursor protein of the present invention or the DNA encoding the same are involved in central nervous system function control, circulatory function control, heart function control, kidney function control, urinary function control, sensory organ control, etc. For example, dementia due to senile dementia, cerebrovascular dementia, dysgenesis due to phylogenic transformation (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.), high (low) blood pressure, renal disease (Eg, chronic renal failure, nephritis, etc.), heart disease (eg, heart failure, acute myocardial infarction, etc.), pollakiuria, urinary incontinence, hearing loss, olfactory abnormalities, visual abnormalities, etc. it can.

When the precursor protein of the present invention or DNA encoding the same is used as the above-mentioned medicament, it can be carried out in a conventional manner. For example, sterility with tablets or capsules, elixirs, microcapsules, etc. coated with sugar coating or enteric coating as needed, or with water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections, such as solutions or suspensions. For example, the compound or a salt thereof may be used together with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, and the like in a unit dosage form required for generally accepted drug practice. It can be manufactured by mixing. The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.

As additives that can be mixed with tablets, capsules, and the like, the same additives as those described above can be used.

Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80 (™), HC) -50) may be used in combination. Oily liquids include sesame oil, soybean oil, etc. May be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.

The preparations obtained in this way are safe and low toxic, so they can be used, for example, in human mammals (eg, mice, rats, guinea pigs, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.). Can be administered.

The dosage of the precursor protein of the present invention or the DNA encoding the same may vary depending on the symptoms and the like. However, in the case of oral administration, in general, for an adult (assuming a body weight of 60 kg), about 0. 1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration target, target organ, symptoms, administration method, etc.For example, in the case of injection, administration to adult patients with heart failure (with a body weight of 60 kg) In this case, it is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg per day by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

The use of the polypeptide of the present invention, its precursor protein, DNAs and antibodies encoding the polypeptide or precursor protein will be specifically described below.

(1) Prevention and treatment of polypeptide deficiency

Depending on the effects of the polypeptide of the present invention and its precursor protein on S ENR, the DNA encoding the polypeptide of the present invention can be used to prevent or treat the DNA or S ENR deficiency. It can also be used as an agent.

For example, in vivo, since the polypeptide of the present invention, its precursor protein or S ENR is reduced, the physiological actions of ligands (modulation of central nervous function) , Circulatory function control, heart function control, kidney function control, urinary function control or sensory organ function control) in some patients. By administering and expressing the DNA encoding the body protein to the patient, or (mouth) after inserting and expressing the DNA encoding the polypeptide of the present invention or its precursor protein in brain cells or the like, By increasing the amount of polypeptide or its precursor protein in brain cells of the patient by transplanting the cells into the patient, etc., the effect of the polypeptide or its precursor protein is fully exerted be able to . Therefore, the DNA encoding the polypeptide of the present invention or its precursor protein can be used as a safe and low-toxicity agent for preventing or treating a deficiency of the polypeptide or its precursor protein.

When the above-mentioned DNA is used as the above-mentioned therapeutic agent, the DNA is used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like. Can be carried out according to the same means as in the case of using a DNA encoding the above polypeptide or its precursor protein or a partial peptide thereof as a medicine.

(2) Quantitative method of SENR for polypeptide

The polypeptide or its precursor protein of the present invention has SENR or a salt thereof, which has a binding property to a partial peptide of the receptor protein or a salt thereof. Alternatively, the concentration of the SENR partial peptide or a salt thereof can be quantified with high sensitivity.

This quantification method can be used, for example, in combination with a competition method. That is, by contacting the sample with the polypeptide of the present invention or its precursor protein, the concentration of SENR or a salt thereof, or a partial peptide of SENR or a salt thereof in the sample can be measured.

Specifically, for example, it can be used according to a method known per se described in (1) or (2) below or a method analogous thereto.

(1) Hiro Irie "Radio No Tsutsui" (Kodansha, published in 1949) 2) Hiroshi Irie, "Radio Imano Tsutsui" (Kodansha, published in 1979)

(3) Alters the binding between SENR and the polypeptide of the present invention, its precursor protein, or its amide, ester or salt thereof (hereinafter sometimes abbreviated as ligand or polypeptide). Compound screening method

By using SENR or a salt thereof, the partial peptide or a salt thereof, or constructing a recombinant S ENR expression system and using a receptor-binding assay system using the expression system, a polypeptide or a salt thereof is obtained. Compounds (eg, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc.) that alter the binding between the precursor protein and SENR or their salts can be screened. Such compounds have cell stimulatory activity via S ENR (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production A compound having an activity of promoting or suppressing cell membrane potential fluctuations, phosphorylation of intracellular proteins, activation of c-os, and reduction of ρΗ (ie, SENR agonist) and the cell stimulating activity. Compounds (ie, S ENR antenna gonist). “Altering the binding to a ligand” includes both the case of inhibiting the binding to the ligand and the case of promoting the binding to the ligand.

That is, the present invention relates to (i) a case where the polypeptide of the present invention or its precursor protein is brought into contact with S ENR or a salt thereof or a partial peptide or a salt thereof, and (Π) The present invention is characterized in that a comparison is made with the case where the polypeptide of the present invention or its precursor protein and a test compound are brought into contact with S ENR or a salt thereof or the partial peptide of the SENR or a salt thereof. It is intended to provide a method for screening a compound or a salt thereof that alters the binding property between the polypeptide or its precursor protein and the above-mentioned SENR.

In the screening method of the present invention, (i) a case where the polypeptide or the precursor thereof of the present invention is brought into contact with the SENR or the partial peptide of the S ENR, and (ii) the S ENR or Part of the S ENR When the polypeptide of the present invention or its precursor protein and a test compound are brought into contact with the SENR, for example, the amount of binding of the ligand to the SENR or a partial peptide of the SENR, the cell stimulating activity, etc. are measured and compared. .

Specifically, the screening method of the present invention

① The labeled polypeptide of the present invention or its precursor protein is contacted with the above-mentioned S ENR or its salt or the partial peptide of S ENR or its salt, and the labeled polypeptide of the present invention or its precursor is When the body protein and the test compound are contacted with SENR or a salt thereof or a partial peptide of SENR or a salt thereof, the labeled S ENR of the polypeptide of the present invention or its precursor protein or a salt thereof, or the partial peptide Or a method for screening a compound or a salt thereof that alters the binding between the polypeptide of the present invention or its precursor protein and SENR, wherein the amount of binding to the salt is measured and compared.

(2) When the labeled polypeptide or its precursor protein of the present invention is brought into contact with a cell containing SENR or a membrane fraction of the cell, and when the labeled polypeptide or its precursor protein of the present invention is contacted. When the test compound is contacted with a cell containing SENR or a membrane fraction of the cell, the amount of the labeled polypeptide of the present invention or its precursor protein bound to the cell or the membrane fraction is measured. A method for screening a compound or a salt thereof, which alters the binding property between the polypeptide of the present invention or its precursor protein and SENR,

(3) When the labeled polypeptide of the present invention or its precursor protein is brought into contact with SENR expressed on the cell membrane by culturing a transformant containing DNA encoding SENR, The polypeptide of the invention or its precursor protein and a test compound were labeled when they were brought into contact with S ENR expressed on the cell membrane by culturing a transformant containing DNA encoding S ENR. The amount of binding of the polypeptide of the present invention or its precursor protein to SENR is measured and compared, and a compound that changes the binding between the polypeptide of the present invention or its precursor protein and S ENR Screening method for a substance or a salt thereof,

場合 When a compound that activates S ENR (for example, the polypeptide of the present invention or its precursor protein) is brought into contact with cells containing S ENR, the compound that activates SENR and the test compound contain SENR. SENR-mediated cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca2 ⁺ release, intracellular CAMP generation, intracellular cGMP generation, inositol The activity of promoting or inhibiting the production of phosphoric acid, the fluctuation of cell membrane potential, the phosphorylation of intracellular proteins, the activation of c-fos, the decrease of pH, etc.) A method for screening a compound or a salt thereof that alters the binding property between a polypeptide or its precursor protein and S ENR, and

SE SENR expressed on the cell membrane by culturing a transformant containing DNA encoding SENR with a compound that activates SENR (eg, the polypeptide of the present invention or its precursor protein). And when the compound that activates SENR and the test compound are brought into contact with SENR expressed on the cell membrane by culturing a transformant containing DNA encoding SENR. S ENR-mediated cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorus Or the activity of promoting or suppressing oxidation, activation of c-fos, and lowering of pH, etc.), and comparing them. A method of screening a compound or its salt that alters the binding property between the precursor protein and SENR the like.

The specific description of the screening method of the present invention is as follows.

First, the SENR used in the screening method of the present invention may be any as long as it contains the above-described SENR or a partial peptide of SENR. Minutes are preferred. However, since it is extremely difficult to obtain human-derived organs, S ENR expressed in large amounts using recombinants is suitable for screening. To manufacture the S ENR, the above-described method is used.

In the screening method of the present invention, when cells containing SENR or the cell membrane fraction are used, the preparation method described later may be followed.

When a cell containing SENR is used, the cell may be immobilized with dataraldehyde, formalin, or the like. The immobilization method can be performed according to a method known per se.

SENR-containing cells refer to host cells expressing SENR. The host cells include the aforementioned Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like.

The membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se. Cells can be disrupted by crushing the cells with a Po 11 er—E 1 veh jem-type homogenizer, crushing with a Warinda blender Polytron (Kinematica), crushing with ultrasonic waves, or pressing with a French press. While crushing by ejecting cells from a thin nozzle. For cell membrane fractionation, centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically about 1 to 10 minutes), and the supernatant is further centrifuged at a higher speed (15000 rpm to 30000 rpm). Centrifuge for 30 minutes to 2 hours, and use the resulting precipitate as the membrane fraction. The membrane fraction is rich in the expressed SENR and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of S ENR in the cell or membrane fraction containing the S ENR is preferably 10 ³ to 10 ^s molecules per cell, and more preferably 10 ⁵ to 10 ⁷ molecules per cell. In addition, the higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system but also to measure a large number of samples in the same lot. Become.

In order to carry out the above-mentioned steps (1) to (3) for screening a compound that alters the binding property between the polypeptide of the present invention or its precursor protein and SENR, the appropriate SENR fraction and the labeled present invention are used. Polypeptide or its precursor protein is used. The SENR fraction may be a natural SENR fraction, or A recombinant S ENR fraction having the same activity as the above is desirable. Here, the equivalent activity indicates equivalent ligand binding activity and the like. As the labeled ligand, a labeled ligand, a labeled ligand analog compound, or the like is used. For example, ligands labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like can be used.

Specifically, to screen for a compound that alters the binding between the polypeptide of the present invention or its precursor protein and SENR, cells or membrane fractions of cells containing SENR are first suitable for screening. Prepare a sample of the receptor by suspending in a buffer. Any buffer may be used as long as the buffer does not inhibit the binding between the ligand and the receptor, such as a phosphate buffer having ρΗ4 to 10 (preferably ρΗ6 to 8) or a tris-hydrochloride buffer. In addition, CHAPS, Tween-8

Surfactants such as 0 ™ (Kao Atlas), digitonin, and dexcholate can also be added to the buffer. Furthermore, protease inhibitors such as PMS F, louptin, E-64 (manufactured by Peptide Research Institute), and pepstatin can be added for the purpose of suppressing the degradation of the receptor of the present invention and the polypeptide of the present invention by a protease. . To the receptions evening over a solution of 0. 0 lml~ 10m l, a fixed amount (500 0 c pm~ 500000 cm) of the labeled polypeptide of the present invention was added, 10- ^{1 Q} ~1 0- ⁷ M simultaneously The test compound is allowed to coexist. A reaction tube containing a large excess of an unlabeled polypeptide of the present invention is also prepared to determine the non-specific binding amount (NSB). The reaction is carried out at 0 ° C to 50 ° C (preferably at 4 ° C to 37 ° C for 20 minutes to 24 hours, preferably 30 minutes to 3 hours. After washing with buffer, the radioactivity remaining on the glass fiber filter paper is measured with a liquid scintillation counter or a counter, and the count obtained by subtracting the non-specific binding amount (NSB) from the count when there is no antagonist (B.) When (B.-NSB) is set to 100%, a test compound having a specific binding amount (B-NSB) of, for example, 50% or less can be selected as a candidate substance capable of competitive inhibition.

The binding between the polypeptide of the present invention or its precursor protein and SENR In order to carry out the above-mentioned methods (1) to (4) for screening a compound to be changed, a cell stimulating activity via SENR (for example, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP) Production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to promote or suppress pH reduction, etc.) by known methods or The measurement can be performed using a commercially available measurement kit. In particular

First, cells containing S ENR are cultured in a multiwell plate or the like. Before performing screening, replace the cells with a fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, etc., incubate for a certain period of time, and then extract cells or remove supernatant. Collect and quantify the product produced according to each method. When the production of a substance (for example, arachidonic acid) as an indicator of cell stimulating activity is difficult to be assayed by a degrading enzyme contained in a cell, an inhibitor for the degrading enzyme may be added to perform the assay. In addition, screening for cAMP production inhibitory activity can be detected as a production inhibitory effect on cells whose basal production has been increased by forskolin or the like. Requires cells that have expressed the appropriate S ENR. The cells expressing the SENR of the present invention are preferably the above-mentioned recombinant SENR-expressing cell lines.

Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.

The kit for screening a compound or a salt thereof that alters the binding property between the polypeptide or its precursor protein and S ENR of the present invention comprises S ENR or a salt thereof, a partial peptide of S ENR or a salt thereof, and S ENR. Or the membrane fraction of cells containing SENR, and the polypeptide of the present invention or its precursor protein.

Examples of the screening kit of the present invention include the following. 1. Screening reagent ①Measurement buffer and washing buffer

Hanks' Balanced Salt Solution (manufactured by Gibco) plus 0.05% serum albumin (manufactured by Sigma).

The solution may be sterilized by filtration through a 0.45 / m pore size filter and stored at 4 ° C, or may be prepared as needed.

② S ENR standard

CHO cells expressing S ENR were subcultured on a 12-well plate with 5 × 10 ⁵ Z-holes, and cultured for 2 days at 37 ° 5% C〇 ₂ and 95% air.

③ Labeled ligand

Ligand labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc. Occasionally dilute to 1 M with assay buffer.

④Ligand standard solution

The polypeptide of the present invention or a precursor protein thereof is dissolved in PBS containing 0.1% serum albumin (manufactured by Sigma) so as to be ImM, and stored at −20 ° C.

2. Measurement method

(1) Wash cells expressing SENR cultured in a 12-well tissue culture plate twice with 1 ml of measurement buffer, and then add 4901 of measurement buffer to each well.

② 1 0- ³ After adding ~ 1 0- ^{1 Q} test compound solution 5 1 M, the peptide or its precursor protein of the present invention labeled 5 1 addition, Ru reacted at room temperature for 1 hour. To determine the amount of non-specific binding, add 10 to ³ M of ligand instead of the test compound.

③ Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled ligand bound to the cells is dissolved in 0.2 N NaOH—1% SDS, and mixed with 4 ml of liquid scintillator overnight A (manufactured by Wako Pure Chemical Industries).

放射 Measure radioactivity using a liquid scintillation counter (manufactured by Beckman), and determine Percent Maximum Binding (PMB) by the following formula [Equation 1]. (Equation 1)

PMB = [(B-NS B) / (B. One NSB)] X 100

PMB: Percent Maximum Binding

B: Value when the sample is added

NSB: Non-specific Binding

b 0: Tori?

The compound or its salt obtained by using the screening method or the screening kit of the present invention alters the binding between the polypeptide of the present invention or its precursor protein and SENR (inhibits or promotes the binding). A) a compound, specifically, a compound having a cell stimulating activity via S ENR or a salt thereof (so-called S ENR agonist) or a compound having no such stimulating activity (so-called S ENR agonist) . Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, and the like. These compounds may be novel compounds or known compounds.

The specific method of evaluating whether a person is an SENR agonist or an evening gonist should follow (i) or (ii) below.

(i) A compound that changes the binding property (particularly, inhibits the binding) of the polypeptide of the present invention or its precursor protein to S ENR by performing the binding 'at least one of the screening methods described in (1) to (3) above. After obtaining, it is determined whether the compound has the above-mentioned SENR-mediated cell stimulating activity. The compound having a cell stimulating activity or a salt thereof is a S ENR agonist, and the compound having no such activity or a salt thereof is a S ENR antagonist.

(ii) (a) The test compound is brought into contact with a cell containing SENR, and the cell stimulating activity via the SENR is measured. The compound having a cell stimulating activity or a salt thereof is a S ENR agonist.

(b) when a compound that activates S ENR (for example, the polypeptide of the present invention, its precursor protein, or S ENR agonist) is brought into contact with a cell that contains S ENR; Measures SENR-mediated cell stimulating activity when a test compound is brought into contact with cells containing SENR And compare. A compound or a salt thereof capable of decreasing the cell stimulating activity of a compound that activates SENR is an SENR antagonist.

Since the SENR agonist has an activity similar to the physiological activity of the polypeptide of the present invention or its precursor protein on SENR, it is safe and has low toxicity similarly to the polypeptide of the present invention or its precursor protein. It is useful as a new drug.

Conversely, SENR agonist can suppress the physiological activity of the polypeptide of the present invention against SENR, and is therefore useful as a safe and low-toxic drug for suppressing the receptor activity.

Since the polypeptide of the present invention or its precursor protein is involved in central nervous function regulation, circulatory function regulation, heart function regulation, kidney function regulation, urinary function regulation or sensory organ regulation, etc. SENR agonists include, for example, senile dementia, cerebrovascular dementia, degenerative and metamorphic diseases of phylogenic variants (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.), high (low) blood pressure. , Renal diseases (eg, chronic renal failure, nephritis, etc.), heart diseases (eg, heart failure, acute myocardial infarction, etc.), frequent urination, urinary incontinence, hearing loss, olfactory abnormalities, visual abnormalities, etc. Can be used.

As the salt of the compound obtained by using the above-described screening method or screening kit, for example, a pharmaceutically acceptable salt and the like are used. Examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids.

Suitable examples of the salt with an inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt.

Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, jenoanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine. Salts with silamine, N, N'-dibenzylethylenediamine and the like. Preferred examples of salts with inorganic acids include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid And the like.

Suitable examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid And salts with acids and the like.

Preferred examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, and olutinine. Preferred examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. .

When a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned medicine, it is the same as when the above-mentioned polypeptide of the present invention or its precursor protein is used as a medicine. It can be implemented.

(4) Production of an antibody or antiserum against the polypeptide of the present invention or its precursor protein

Antibodies (for example, polyclonal antibodies, monoclonal antibodies) or antisera against the polypeptide of the present invention or its precursor protein can be obtained by using the polypeptide of the present invention or its precursor protein or its partial peptide as an antigen, and It can be produced according to a method for producing an antibody or antiserum. For example, a polyclonal antibody can be produced according to the method described below.

[Preparation of polyclonal antibody]

The polyclonal antibody against the polypeptide of the present invention or its precursor protein can be produced according to a method known per se or a method analogous thereto. For example, a complex of an immunizing antigen (antigen such as a polypeptide) and a carrier protein is formed, and a warm-blooded animal (for example,

Immunity to mammals (eg, egrets, sheep, sheep, goats, rats, mice, guinea pigs, lions, lions, horses), birds (eg, chicks, birds, wildlife, ducks, geese, geese) Then, the antibody-containing substance against the polypeptide of the present invention is collected from the immunized animal, and the antibody is separated and purified.

Combination of immunizing antigens and carrier proteins used to immunize mammals Regarding the body, the type of carrier protein and the mixing ratio between the carrier and the hapten (the polypeptide of the present invention or its partial peptide) may be determined as long as antibodies can be efficiently produced against the hapten immunized by crosslinking with the carrier. Crosslinking may be carried out at any ratio.For example, 血清 serum albumin, ゥ psiloglobulin, keyhole ぺ linpet へ hemocyanin, etc. in a weight ratio of about 0.1 to 20 with respect to 1 hapten, Preferably, a method of coupling at a ratio of about 1 to 5 is used.For power coupling between the hapten and the carrier, various condensing agents can be used, but daltaraldehyde, carposimide, maleimide active ester, thiol group, Condensation products in which active ester reagents containing a dithiopyridyl group are used Against itself Oh Rui to the site that can produce the antibody carriers, it is administered with a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.

The polyclonal antibody is preferably collected from blood, ascites, and the like, of the mammal immunized by the above method.

The antibody titer against the polypeptide of the present invention or its precursor protein in the antiserum can be measured in the same manner as the measurement of the antibody titer of the hybridoma culture supernatant described later. The antibody can be separated and purified according to the same method for separating and purifying immunoglobulin as described later for the monoclonal antibody.

Moreover, a monoclonal antibody can be produced according to the method described below. [Preparation of monoclonal antibody]

(a) Preparation of monoclonal antibody-producing cells

The polypeptide of the present invention or a precursor protein thereof may be a warm-blooded animal (for example, a mammal warm-blooded animal (eg, a heron, a sheep, a goat, a rat, a mouse, a guinea pig, a horse, a horse, a bush), a bird ( Eg, chickens, birds, birds, birds, ducks, geese, quail) etc.) Administered with excipients. Complete Freund's adjuvant / incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 26 weeks, for a total of about 210 times.

When preparing monoclonal antibody-producing cells, select an individual with an antibody titer from the above-mentioned warm-blooded animal, such as a mouse, immunized with the antigen, and collect spleen or lymph nodes 25 days after the final immunization. By fusing the antibody-producing cells contained in the above with myeloma cells, a monoclonal antibody-producing hybrid can be prepared. The antibody titer in the antiserum is measured, for example, by reacting the labeled polypeptide of the present invention, its precursor protein or a partial peptide thereof described below with the antiserum, and then measuring the labeling agent bound to the antibody. This is done by measuring the activity. The fusion operation can be performed according to a known method, for example, the method of Koehler and Milstein [Nature, 256 495 (1975) 3]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus. PEG is preferably used.

Examples of myeloma cells include NS-1P3U1SP2Z0AP-1 and the like, and P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells to be used is about 1: 120: 1, and PEG (preferably PEG 1 000 PEG 6000) is added at a concentration of about 80%. By incubating at 20 40 ° C, preferably 30 37 ° C for 110 minutes, cell fusion can be carried out efficiently.

Various methods can be used for screening an antibody-producing hybridoma against the polypeptide of the present invention or its precursor protein.For example, the polypeptide antigen of the present invention or the precursor protein antigen thereof can be directly or in a carrier. The hybridoma culture supernatant is added to the solid phase (eg, microplate) to which both have been adsorbed, and then an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (cytolysis U. Mouse immunoglobulin antibody is used) or protein A is added, and a monoclonal antibody against the polypeptide of the present invention or its precursor protein bound to a solid phase is detected. Anti-immunoglobulin antibody or protein A is adsorbed. Add the hybrid culture supernatant to the solid phase In addition, a method of adding a polypeptide of the present invention labeled with a radioactive substance, an enzyme, or the like, and detecting a monoclonal antibody against the polypeptide of the present invention or its precursor protein bound to a solid phase can be used.

The selection of the monoclonal antibody against the polypeptide of the present invention or its precursor protein can be carried out according to a method known per se or a method analogous thereto. It is usually performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a medium for selection and breeding, any medium may be used as long as it can grow a hybridoma. For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal calf serum, GIT medium containing 1-10% fetal calf serum (Wako Pure Chemical Industries, Ltd.) ) Or serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.). The culture temperature is usually 20 to 40, preferably about 37 ° C. The cultivation time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. Culture is usually performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as in the measurement of the antibody titer to the polypeptide of the present invention in the antiserum.

(b) Purification of monoclonal antibodies

Separation and purification of the monoclonal antibody against the polypeptide or its precursor protein of the present invention can be carried out in the same manner as in the separation and purification of normal polyclonal antibodies, by the method of separating and purifying immunoglobulin (e.g., salting out method, alcohol precipitation method, Isoelectric point precipitation, electrophoresis, adsorption / desorption with ion exchangers (eg DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or active adsorbents such as protein A or protein G Specific purification method in which only the antibody is collected and the bond is dissociated to obtain the antibody].

Antibodies against the polypeptide of the present invention or its precursor protein produced according to the methods (a) and (b) above can specifically recognize the polypeptide of the present invention or its precursor protein, respectively. Since it can be used, it can be used for quantification of the polypeptide of the present invention or its precursor protein in a test solution, particularly for quantification by a sandwich immunoassay. That is, the present invention provides, for example,

(i) An antibody that reacts with the polypeptide of the present invention or its precursor protein is allowed to react competitively with a test solution and a labeled polypeptide or its precursor protein of the present invention, and labeled with the antibody. A method for quantifying the polypeptide of the present invention or its precursor protein in a test solution, comprising measuring the ratio of the polypeptide of the present invention or its precursor protein,

(Iii) A test method comprising simultaneously or continuously reacting a test wave with an antibody insolubilized on a carrier and a labeled antibody, and then measuring the activity of a labeling agent on the insolubilized carrier. In the method for quantifying the polypeptide of the present invention or its precursor protein in a liquid, one of the antibodies is an antibody that recognizes the N-terminal of the polypeptide of the present invention or its precursor protein, and the other antibody is the present antibody. The present invention provides a method for quantifying the polypeptide of the present invention or its precursor protein in a test solution, which is an antibody that reacts with the C-terminal of the polypeptide of the present invention or its precursor protein. The polypeptide of the present invention or its precursor protein can be measured using a monoclonal antibody that recognizes the polypeptide of the present invention or its precursor protein, and can also be detected by tissue staining or the like. For these purposes

Alternatively, the antibody molecule itself may be used, or F (ab ') ₂ , Fab', or Fab fraction of the antibody molecule may be used. The measuring method using the antibody of the present invention is not particularly limited, and the amount of the antibody, the antigen, or the antibody-antigen complex corresponding to the amount of the antigen (eg, the amount of the polypeptide) in the liquid to be measured is determined chemically or Any measurement method may be used as long as it is detected by a physical means and is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, a competitive method, an immunometric method, and a sandwich method are preferably used, but a sandwich method described later is particularly preferable in terms of sensitivity and specificity.

Examples of the labeling agent used in the measurement method using the labeling substance include a radioisotope, an enzyme, a fluorescent substance, and a luminescent substance. Examples of radioisotopes include

^{[1 2 5} I], ^{[1 3 1} I], ^[3 H], and ^{[1 4} C] As the enzyme, large preferably stable and specific activity, e.g. beta - galactopyranoside Bok oxidase, beta One Darco Fern, alkaline phosphatase, peroxidase, malate dehydrogenase, etc .; fluorescent substances such as fluorescamine and fluorescein isothiocyanate; and luminescent substances such as luminol, luminol derivatives, luciferin And lucigenin, respectively. Furthermore, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass.

In the sandwich method, a test solution is reacted with an insolubilized anti-polypeptide antibody (primary reaction), and further reacted with a labeled anti-polypeptide antibody (secondary reaction). By measuring the activity, the amount of polypeptide in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times.

The labeling agent and the method of insolubilization can be in accordance with those described above. In addition, in the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily required to be one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may.

In the method for measuring the polypeptide of the present invention or its precursor protein by the sandwich method of the present invention, the anti-polypeptide or its precursor protein antibody used in the primary reaction and the secondary reaction is the polypeptide of the present invention. Antibodies with different binding sites for the peptide or its precursor protein are preferably used. That is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention or its precursor protein, the antibody used in the primary reaction and the secondary reaction The antibody used is preferably an antibody that recognizes other than the C-terminal part, for example, the N-terminal part.

An antibody against the polypeptide of the present invention or its precursor protein may be assayed using a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nematic method. It can be used for flowmetry. In the competitive method, the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, and then the unreacted labeled antigen is separated from (F) and the labeled antigen (B) bound to the antibody. Then, the amount of B or F is measured to determine the amount of antigen in the test solution. In this reaction method, a soluble antibody is used as the antibody, BZF separation is performed using polyethylene glycol, a liquid phase method using a second antibody against the antibody, or a solid phase antibody is used as the first antibody. A solid phase method using a soluble first antibody and an immobilized antibody as the second antibody is used.

In the immunometric method, the antigen in the test solution and the immobilized antigen are subjected to a competitive reaction with a certain amount of the labeled antibody, and then the solid phase and the liquid phase are separated. The antigen is allowed to react with an excessive amount of the labeled antibody, then the immobilized antigen is added, and the unreacted labeled antibody is bound to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in either phase is measured to quantify the amount of antigen in the test solution.

In nephelometry, the amount of insoluble sediment generated as a result of the antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test liquid is small and only a small amount of sediment is obtained, laser nephrometry utilizing scattering by a laser is preferably used.

In applying each of these immunological assay methods to the assay method of the present invention, no special conditions, operations, and the like need to be set. It is advisable to construct a measurement system for the polypeptide of the present invention, its precursor protein or a partial peptide thereof by adding ordinary technical considerations to those skilled in the art to the ordinary conditions and procedures in each method. For details of these general technical means, it is possible to refer to reviews, written books, etc. [For example, Hiroshi Irie “Radio Nonotsusei” (Kodansha, published in Showa 49), Hiroshi Irie “ Continuing Radio Imnoatssey] (Kodansha, published in 1974), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Shoin, published in 1953), Eiji Ishikawa, et al., "Enzyme Immunoassay" (No. 2nd edition) (Medical Shoin, published in 1977), edited by Eiji Ishikawa et al. “Enzyme immunoassay” (3rd edition) (Medical Publishing, published in 1962), ["Methods in E ZYMOLOGYj Vol. 70 ( Immunochemi cal Techniques (Part A)), ibid.Vol. 73 (Immunochemi cal Techniques (Part B)), ibid.Vol. 74 (Immunochemi cal Vol. 84 (Immunochemical Techniques (Part D: Selected Immunoassays))> Same Vol. 92 (Immunochemical Techniques (Part E: Monoclonal Antibodies and Genera! Immunoassay Methods)), Same Vol. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies)) (see Academic Press).

As described above, the polypeptide of the present invention or its precursor protein can be quantified with high sensitivity by using an antibody against the polypeptide of the present invention or its precursor protein.

By quantifying the polypeptide of the present invention or its precursor protein in the test solution, a disease involving the polypeptide of the present invention or its precursor protein can be diagnosed. Diseases involving the polypeptide of the present invention or the precursor protein thereof include, for example, senile dementia, cerebrovascular dementia, regressive metamorphic disease of phylogenic transformation (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease) Disease), dementia, high (low) blood pressure, kidney disease (eg, chronic renal failure, nephritis, etc.), heart disease (eg, heart failure, acute myocardial infarction, etc.), frequent urination, urinary incontinence, hearing loss, smell Diseases such as abnormalities and visual abnormalities. A test solution can be prepared from a mammal to be tested (eg, human, egret, sheep, goat, rat, mouse, guinea pig, porcupine, porcine, bush) by a method known per se. Examples of the test liquid include blood, lymph, urine, and the like.

In the present specification and the drawings, bases, amino acids, and the like are indicated by abbreviations based on tags or common abbreviations in the art according to the IUPAC-IUB Commission on Biochemical Nomenclature, examples of which are described below. When amino acids may have optical isomers, L-form is indicated unless otherwise specified.

DNA Deoxyribonucleic acid

c DNA complementary deoxyribonucleic acid

A

Ding Chimin

G Guanin c

Y thymine or cytosine

N Thymine, cytosine, adenine or gua. R Adenine or guanine

M cytosine or a 7 "nin

W thymine or adenine

S cytosine or guanine

RNA ribonucleic acid

mRNA messenger ribonucleic acid

d AT P Deoxyadenosine triphosphate

d TTP Deoxythymidine triphosphate

d GTP Deoxyguanosine triphosphate

d CTP -ΓΆ ~ Xishishitino triphosphate

ATP Adenosine triphosphate

EDTA ethylenediaminetetraacetic acid

S D S Sodium dodecyl sulfate

TF A trifluoroacetic acid

E I A Enzymimnoassy

G 1 y or G glycine

A la or A alanine

V a 1 or V Palin

L e u or L leucine

I 1 e or I isoleucine

S e r or S serine

T h r or T threonine

Cys or C system

M e t or M

G 1 u or E glutamic acid

As or D aspartic acid Lys or K lysine

A r g or R Arginine

H is or H histidine

P he or F Phenylylalanine

Ty r or Y tyrosine

T r p or W Tributuan

Pro or P proline

Asn or Nasparagine

G 1 n or Q glutamine

p G 1 u

M e methyl group

E tethyl group

B u butyl group

P h phenyl group

TC thiazolidine:-4 (R) carboxamide group

B om -oxymethyl

NMP N-methylpyrrolidone

P AM phenylacetamidomethyl

Further, substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols.

T os: p-toluenesulfonyl

HONB: N-hydroxy-5-one 2,3-dicarboxy

B z 1: benzyl

Z: benzyloxycarbonyl

B r-Z: 2-bromobenzyloxycarbonyl

C 1 -Z: 2-chlorobenzyloxycarbonyl

B 0 c: t-butyloxycarbonyl

HOB t: 1-hydroxybenztriazole DCC: N, N'-dicyclohexylcarposimide

TF A: trifluoroacetic acid

Fmo c: N-9-Fluorenylmethoxycarbonyl

DNP: dinitrophenyl

B um: Evening butyoxymethyl

Trt: Trityl

Me B z 1: 4-Methylbenzyl

CHO: Formyl

NMP: N-methylpyrrolidone

The sequence numbers in the sequence listing in the present specification indicate the following sequences.

[SEQ ID NO: 1]

The synthetic DNA used to obtain the partial sequence of the cDNA encoding the rat urotensin II like peptide precursor protein is shown.

[SEQ ID NO: 2]

The synthetic DNA used to obtain the partial sequence of the cDNA encoding the rat urotensin II 1 ikepeptide precursor protein is shown.

[SEQ ID NO: 3]

Shows the nucleotide sequence of cDNA encoding a part of the rat urotensin II like peptide precursor protein.

[SEQ ID NO: 4]

The synthetic DNA used for RACE-PCR to obtain the 5 'partial sequence of the cDNA encoding the rat urotensin II like peptide precursor protein is shown. -[SEQ ID NO: 5]

Fig. 3 shows a synthetic DNA used for RACE-PCR for obtaining a 5 'partial sequence of a cDNA encoding rat urotensin II 1 ike peptide precursor protein.

[SEQ ID NO: 6]

1 shows the nucleotide sequence of the 5 ′ partial sequence of cDNA encoding rat urotensin II like peptide precursor protein.

[SEQ ID NO: 7] Shows the synthetic DNA used for RACE-PCR to obtain the 3 'partial sequence of cDNA encoding rat urotensin II like pepU de precursor protein.

[SEQ ID NO: 8]

The synthetic thigh used as a radiolabeled probe for obtaining the 3 ′ partial sequence of cDNA encoding rat urotensin II like pep de precursor protein is shown. [SEQ ID NO: 9]

This shows the base sequence of the 3 'end partial sequence of the cDNA ^T A encoding rat urotensin II like pept ide precursor protein.

[SEQ ID NO: 10]

The synthetic DNA used to obtain the full-length sequence of the cDNA encoding the rat urotensin II 1 ike peptide precursor protein is shown.

[SEQ ID NO: 11]

The synthetic DNA used to obtain the full-length sequence of the cDNA encoding the rat urotensin II like peptide precursor protein is shown.

[SEQ ID NO: 12]

1 shows the entire nucleotide sequence of rat urotensin II like peptide precursor protein cDNA. [SEQ ID NO: 13]

1 shows the entire amino acid sequence of rat urotensin II like peptide precursor protein. [SEQ ID NO: 14]

Amino acids of rat urotensin 11 1 ike peptide-1 :;

[SEQ ID NO: 15]

2 shows the amino acid sequence of rat urotensin II 1 ike peptide-2.

[SEQ ID NO: 16]

This shows the DNA sequence of SEQ ID NO: 14 (rat urotensin II like peptide-1).

[SEQ ID NO: 17]

The DNA sequence of SEQ ID NO: 15 (rat urotensin II like peptide-2) is shown.

[SEQ ID NO: 18]

The synthetic DNA used to obtain the 5 ′ partial sequence of the cDNA encoding the mouse uroiensin II like peptide precursor protein is shown. [SEQ ID NO: 19]

The synthetic DNA used to obtain the 5 ′ partial sequence of the cDNA encoding the mouse urotensin II like peptide precursor protein is shown.

[SEQ ID NO: 20]

1 shows the 5′-side partition sequence of cDN ^: A encoding mouse urotensin II 1 ike pepiide precursor protein.

[SEQ ID NO: 21]

This shows a synthetic DNA used to acquire the 3 'end partial sequence of the cD ^T A encoding mouse urotensin II like peptide precursor protein.

[SEQ ID NO: 22]

[Fig. 3] Fig. 3 shows a synthetic DNA used to obtain a partial sequence and a full-length sequence of a cDNA encoding a mouse urotensin II like peptide precursor protein.

[SEQ ID NO: 23]

3 shows the 3′-side distribution sequence of cDNA encoding mouse urotensin II like peptide precursor protein.

[SEQ ID NO: 24]

The synthetic DNA used to obtain the full-length sequence of the cDNA encoding the mouse urotensin II 1 ike pepUde precursor protein is shown.

[SEQ ID NO: 25]

1 shows the entire nucleotide sequence of mouse urotensin II 1 ike peptide precursor protein cDNA. [SEQ ID NO: 26]

1 shows the entire amino acid sequence of mouse urotensin II like peptide precursor protein.

[SEQ ID NO: 27]

2 shows the amino acid sequence of mouse uroiensin II 1 ike peptide.

[SEQ ID NO: 28]

SEQ ID NO: 27 shows the DNA sequence of mouse urotensin II 1 ike peptide.

[SEQ ID NO: 29]

2 shows the amino acid sequence of rat SENR protein.

[SEQ ID NO: 30] 1 shows the amino acid sequence of human SENR protein.

[SEQ ID NO: 31]

The amino acid sequence of the mature peptide of rat urotensin II like peptide deduced from the amino acid sequence of the precursor protein is shown.

[SEQ ID NO: 32]

2 shows the amino acid sequence of the mature peptide of rat urotensin II like peptide deduced from the amino acid sequence of the precursor protein.

[SEQ ID NO: 33]

2 shows the amino acid sequence of the mature peptide of mouse urotensin II like peptide deduced from the amino acid sequence of the precursor protein.

[SEQ ID NO: 34]

[SEQ ID NO: 35]

The DNA sequence of SEQ ID NO: 31 (mature peptide of rat urotensin II 1 ike pepUde) is shown.

[SEQ ID NO: 36]

This shows the DNA sequence of SEQ ID NO: 32 (mature peptide of rat urotensin II 1 ike peptide).

[SEQ ID NO: 37]

This shows the DNA sequence of SEQ ID NO: 33 (mature peptide of mouse urotensin II 1 ike peptide).

[SEQ ID NO: 38]

The DNA sequence of SEQ ID NO: 34 (mature urotensin II 1 ike peptide mature peptide) is shown.

The transformant Escherichia coli XLlO-Gold / pcrl I-rUII like obtained in Example 3 described below is 1-3-1, Tsukuba East, Ibaraki, Japan since June 2, 2001.

(Postal Code 305-8566) at the National Institute of Advanced Industrial Science and Technology (NI BH) of the Ministry of International Trade and Industry under the deposit number FERAi BP-6740, Yodogawa, Osaka, Japan Deposit No. IF0 16285 with the Fermentation Research Institute (IF〇) of Jusanhoncho 2-chome 17-885, ward (zip code 532-28686) It has been deposited as Example

Hereinafter, the present invention will be described in more detail with reference to Reference Examples and Examples, but these examples do not limit the scope of the present invention. Reference Example 1 Amplification of human SENR (= GPR14) receptor cDNA by PCR using cDNA derived from human brain

Using human brain-derived poly (A) ⁺ RNA (Clontech) as type III, perform a reverse transcription reaction using a random primer. For the reverse transcription reaction, use the reagent of the evening RNA PCR ver. 2 kit. Next, using this reverse transcription product as type I, amplification by PCR is performed using the synthetic DNA primers of SEQ ID NOS: 23 and 24. The synthetic DNA primer is constructed so that the gene in the region translated into the receptor protein is amplified. At that time, a nucleotide sequence recognized by the restriction enzyme SalI is added to the 5 ′ side of the gene. Recognition sequences of the respective restriction enzymes are added to the 5 'and 3' sides such that the base sequence recognized by the restriction enzyme Spe I is added to the 3 'side. The composition of the reaction solution, cDNA铸型5 1, synthetic DM primer one each] M, with 0. 2 mM dNTPs, 1 mM MgC l 2, KOD DNA polymerase 1 1 and buffer attached to the enzyme, the total reaction volume Let it be 50 u 1. The cycle for amplification was performed using a thermal cycler (PerkinElmer), heating at 94 ° C for 60 seconds, followed by a cycle of 94 ° C for 30 seconds, 59 ° C for 30 seconds, and 74 ° C for 60 seconds. Is repeated 35 times. Confirmation of the amplification product is performed by 0.8; agarose gel electrophoresis and then staining with ethidium umide. Reference Example 2 Subcloning of PCR product into plasmid vector and insertion Confirmation of amplified cDNA sequence by decoding base sequence of cDNA

The reaction product after PCR performed in Reference Example 1 was separated using a low melting point agarose gel of 0.8 mm; the band was cut out with a force razor, and then fragmented, extracted with phenol, and extracted with phenol. The DNA is recovered by phenol-form extraction with ethanol and ethanol precipitation. The recovered DNA is subcloned into the plasmid vector pCR-Scrii A immediate SK (+) according to the prescription of PCR-Script ™ A immediate SK (+) cloning kit (Stratagene). This was introduced into Escherichia coli JM109 competent eel 1 (Takara Shuzo), transformed, and clones containing the cDNA insert were selected on LB agar medium containing ampicillin and X-gal, and appeared white. Only clones are separated using a sterilized toothpick to obtain a transformant E. coli JM109 / SENR. Individual clones are cultured in LB medium containing ampicillin, and plasmid DNA is prepared using QIA prep8 mini prep (Qiagen). Using a portion of the prepared DNA, cut with restriction enzymes Sal I and Spe I to confirm the size of the inserted receptor cDNA fragment. The reaction for determining the nucleotide sequence is performed using the DyeDeoxy Terminator Cycle Sequence Kit (PerkinElmer) and decoding is performed using a fluorescent automatic sequencer. The sequence of the obtained clone was analyzed, and a Sai I recognition sequence was added to the 5 'side of the sequence of the human GPR14 (= SENR) gene (EP 0859052 A1), for which all sequences were reported, and Spe Confirm that the I recognition sequence matches the added gene sequence. Reference Example 3 Preparation of human SENR-expressing CH0 cells

A gene encoding the full-length amino acid sequence of human brain-derived SENR whose sequence is confirmed in Reference Example 2 and having a SalI recognition sequence added to the 5 'side and an SpeI recognition sequence added to the 3' side was introduced. Plasmids are prepared using the Plasmid Midi Kit (Qiagen) from the ^ coli clones transformed with the plasmid and cut with the restriction enzymes Sail and SpeI to cut out the insert portion. The insert DNA is cut out of the agarose gel with a force razor after electroswimming, and then recovered by fragmentation, phenol extraction, phenol / chloroform extraction, and ethanol precipitation. Vector plasmid pAKKO-1ΠΗ for animal cell expression obtained by digesting this insert DNA with Sal I and Spe I (Hi painting a, S. et al. Biochim. Biophys. Acta, Vol. In addition to pAKKOl.llH described above, ligation was performed using T4 ligase (Takara Shuzo), and plasmid for protein expression was ligated. Build pAKKO-hSENR.

After culturing E. coli DH5 (Toyo-Ibo) transformed with pAKKO-hSENR, plasmid DM of pAKKO-SENR is prepared using Plasmid Midi Kit (Qiagen). This is introduced into CHO dhfr-cells using Cel! Phect Transfection Kit (Amersham Pharmacia Biotech) according to the attached protocol. 10 mg of DNA is made into a coprecipitation suspension with phosphoric acid and added to a 10 cm dish inoculated with ⁵ × 10 ⁵ or 1 × 10 ⁶ CHO dhfr ”cells 24 hours ago. After culturing for 1 day in MEMa medium containing fetal serum, subculture, and culturing in nucleic acid-free MEMa medium containing 10% dialyzed fetal serum, which is a selective medium, human SENR growing in the selective medium Select colonies of transformed cells (CHO / hSENR) that are expressing CH0 cells Reference Example 4 Amplification of rat SENR (= GPR14) receptor cDNA by PCR using rat brain-derived cDNA

Using a rat brain-derived poly (A) + RNA (Clonetech) as type II, a reverse transcription reaction was performed using a random primer. The reverse transcription reaction used the reagents of the evening RNA PCR ver. 2 kit. Next, this reverse transcription product was used as type I, and amplification was performed by PCR using the synthetic DNA primers of SEQ ID NOS: 1 and 2. The synthetic DA primer was designed to amplify the gene in the region translated into the receptor protein. At that time, a nucleotide sequence recognized by the restriction enzyme Sai I was added to the 5 'side of the gene. Recognition sequences for the respective restriction enzymes were added to the 5 'and 3' sides so that the nucleotide sequence recognized by the restriction enzyme Spe I was added to the 'side. The composition of the reaction mixture was 5 m of cDNA 铸 type, 1 M each of synthetic DNA primers, 0.2 mM dTPs, 1 mM MgCl ₂ , K0D (King of DNA) DNA polymerase 11 and the buffer supplied with the enzyme, and the total reaction volume Was set to 50 ll. The cycle for amplification is the thermal cycler. After heating at 94 ° C for 60 seconds, a cycle of 94 ° C for 30 seconds, 59 ° C for 30 seconds, and 74 ° C for 60 seconds was repeated 35 times. Confirmation of the amplification product was carried out by electrophoresis on a 0.8% agarose gel followed by ethidium umbide staining. Reference Example 5 Subcloning and insertion of PCR product into plasmid vector Amplification by decoding the base sequence of cDNA part Confirmation of cDNA sequence

The reaction product after the PCR performed in Reference Example 4 was separated using a 0.8% low-melting point agarose gel, and the band was cut out with a force razor, followed by fragmentation, phenol extraction, and phenol-cloth form extraction. The DNA was recovered by ethanol precipitation. The recovered DNA was subcloned into the plasmid vector pCR-Script Amp SK (+) according to the procedure of the PCR-Script ™ Amp SK cloning kit (Stratagene). This was introduced into Escherichia coli (Escherichia coli) M109 competent eel 1 (Takara Shuzo), transformed, and clones having cDNA inserts were selected in LB agar medium containing ampicillin and) (-gal, Only the white clones were separated using a sterilized toothpick to obtain a transformant E. coli] M109 / SE1VR Individual clones were cultured in LB medium containing ampicillin, and QIA prep8 mini prep ( Plasmid DNA was prepared using Qiagen Corporation. A portion of the prepared DNA was digested with restriction enzymes Sal I and Spe I to confirm the size of the inserted receptor cDNA fragment. The reaction for the determination of the sequence was performed using a DyeDeoxy Terminator Cycle Sequence Kit (PerkinElmer, Inc.) and read using a fluorescent automatic sequencer. The sequence is reported and the DNA of SENR (sensory epithelial neuropeplide-1 ike receptor) is reported (Tal, M. et al. Biochem. Biophys. Res.Commun., Vol. 209, pp. 752-759 (1995)), it was confirmed that the Sal I recognition sequence was added on the 5 'side and that the sequence matched the Spe I recognition sequence on the 3 side. (Marchese, A. et al. Genomics, vol. 29, pp. 335-344 (1995)) shows the sequence of the force SENR, which is the 945th force ¾ when A of the starting codon is the first. And the sequence determined above is C. Reference Example 6 Preparation of SE-expressing CH0 cells

The full-length amino acid sequence of the rat brain-derived SENR whose sequence was confirmed in Reference Example 5 was coded, and a SalI recognition sequence was added to the 5 'side, and a gene with an SpeI recognition sequence added to the 3' side was introduced. Plasmid was prepared from the ^ 丄 clone transformed with the plasmid using Plasmid Midi Kit (Qiagen), and the restriction enzyme Sal I And Spe I to cut out the insert. After electrophoresis, the insert DNA was cut out from the agarose gel with a force razor, and then recovered by performing fragmentation, phenol extraction, phenol / chloroform extraction, and ethanol precipitation. This insert DNA was digested with Sai 1 and Spe I and expressed in animal cell expression vector plasmid pAKKO-111H (Hinuma, S. et al. Biochim. Biophys. Acta, Vol. 1219, pp. 251-259 (] 994). In addition to the same vector plasmid as pAKKO11.H, pAKKO-SENR was constructed by ligation using T4 ligase (Takara Shuzo).

After culturing ^ coll DH5 (I ^ ^ ^ ^) transformed with pAKKO-SENR, plasmid DNA of pAKKO- SENR was prepared using Plasmid idi Kit (Qiagen). This was transfected into CHO dhfr cells using the CellPhect Transfection Kit (Amersham Pharmacia Biotech) according to the attached protocol. 10 DNAs were co-precipitated with calcium phosphate and added to a 10 cm Petri dish seeded with ⁵ × 10 ⁵ or 1 × 10 ⁶ CHO dhfr-cells 24 hours before. After culturing for 1 day in ΜΕΜα medium containing 10% fetal bovine serum, the cells were subcultured and cultured in nucleic acid-free MEMα medium containing 10% dialyzed fetal bovine serum as a selective medium. 68 colonies of transformed cells that were SENR-expressing CH0 cells growing in the selection medium were selected. Example 1 Preparation of rat spinal cord c thigh

After preparing total RNA from rat spinal cord using Isogen kit (Futtsubon Gene), poly (AVRNA fraction) was prepared using Oligotex (dT) ₃₀ (Takara Shuzo) ThermoScripi reverse transcriptase from this poly (A) RNA Reverse transcription was performed at 50 ° C using the 3'-RACE adapter primer (GGCCACGCGTCGACTAGTAC (T) _1T : Gibco BRL) as a primer according to the manual, and the single-stranded rat spinal cord cDNA was prepared. Similarly, reverse-transcribed cDNA from the same poly (A) ⁺ RNA at 50 ° C using random hexamer using ThermoScript reverse transcriptase (Gibco BRL) according to the manual. The second strand was synthesized according to the manual (Clontech) to obtain a double-stranded cD'A, and a Marathon cDNA adapter sequence included in the kit was added. Example 2 Determination of partial sequence of cDNA encoding rat urotensin II 1 ike peptide precursor protein by PCR

SEQ ID NO: 1 and SEQ ID NO: 1 prepared based on the nucleotide sequence at positions 265-287 and 352-375 from ATG, which is the initiation codon of the nucleotide sequence encoding the human urotensin II precursor protein (GenBank accession No. AF104118) Using the primer (2) (synthesized by Japan Bioservice), the single-stranded cDNA obtained in Example 1 from the rat spinal cord was subjected to a PCR reaction using the single-stranded cDNA as type III. The composition of the reaction solution was 2.5 M MgCl ₂ , dTP 0.2 mM, AmpliTaq Gold (PerkinElmer) 1/200 vome, 10-fold concentrated AmpliTaq Gold Buffer 1 / The volume was 10 volumes and the volume was 25 μl. PCR conditions are: 95 ° C for 9 minutes, 3 cycles of 94 ° C • 20 seconds, 60 ° C · 15 seconds, 80 ° C · 20 seconds, 94 ° C · 20 seconds, 58 ° C 15 seconds, 80 ° C 20 seconds 5 cycles, 94 ° C 20 seconds, 55 ° C 15 seconds, 80 ° C 7 cycles 20 seconds, 94 ° C '20 seconds, A cycle of 53 ° C for 15 seconds and 80 ° C for 20 seconds was repeated 30 times. The PCR reaction solution was subjected to 3.5-ml sieve electrophoresis using GTG Agarose (Takara Shuzo), and DNA was extracted with a GeneClean Spin kit (Bio 101) from a band of about 110 bp detected by staining with ethidium umide. This was subcloned into a plasmid vector pcrli using T0P0 TAcloningkit (Invitrogen) and introduced into E. coli XL10-Gold (Stratagene). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen). The reaction for determining the nucleotide sequence was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer), and was decoded using a fluorescent automatic sequencer. As a result, the nucleotide sequence shown in SEQ ID NO: 3 was obtained. This sequence had homology to the nucleotide sequence of the human urotensin II precursor protein gene, suggesting that it encodes a peptide precursor protein similar to urotensin 11. However, it was different from the partial sequence of the rat urotensin II (rat SENR ligand) precursor protein gene determined from the rat chromosome sequence (described in W000 / 32627). Therefore, this sequence is not a precursor protein of rat urotensin II, but encodes another precursor protein of a peptide similar to rat urotensin II. It was concluded that this was a partial sequence of the cDNA. This papna similar to rat urotensin II was named rat urotens in II 1 ike peptide. Example 3 Determination of cDM sequence encoding rat urotensin II like peptide precursor protein by RACE (rapid amplification of cDNA ends) method

To determine the sequence at the 5 'end of the gene encoding the rat urotensin II like peptide precursor protein, use the double-stranded cDNA preparation obtained in Example 1 as directed by the Marathon cDNA amplification kit (Clontech). A 2.5-fold dilution was made to form 2.51, and PCR was performed using the primer of SEQ ID NO: 4 (consigned to Japan Bioservices) and the adapter primer API provided with the kit. The composition of the reaction solution was as follows: Primer concentration: SEQ ID NO: 4, 0.4 M, API: 0.2 M, 2.5 mM MgCl ₂ , dNTP 0.2 mM, AmliTaq Gold (Perkin Elmer) 1/100 volume, 10-fold concentration AmpliTaq Gold Buffer 1/10 volume, liquid volume was 25 1. The PCR conditions were: 95 ° C for 9 minutes, 3 cycles of 94 ° C for 20 seconds, 70 ° C for 1 minute, 94 ° C for 20 seconds, 68 ° C for 1 minute. Five cycles of 94 ° C for 20 seconds and 66 ° C for 1 minute were repeated 25 times. This reaction solution 1a1 was made into type III, and PCR was performed again using the primer of SEQ ID NO: 5 (synthesized by Nippon Bioservices) and the adapter primer AP2 included in the kit. The composition of the reaction mixture was as follows: Primer concentration: SEQ ID NO: 5: 0.4 M, AP2: 0.2 M, 2.5 mM MgCl ₂ , dNTP 0.2 mM, AmpliTaq Gold (Perkin Elmer) 1/100 volume, 10-fold concentrated AmpliTaq Gold Buffer 1/10 volume, liquid volume was 25 n 1. The PCR conditions were as follows: after incubating at 95 ° C for 9 minutes, a cycle of 94 ° C for 20 seconds and 64 ° C for 30 seconds was repeated 35 times, and then incubated at 72 ° C for 7 minutes. The PCR reaction solution was subjected to electrophoresis using 3.5% usieve GTG Agarose (Takara Shuzo), and DNA was extracted from the band near 420 bp detected by staining with ethidium mouth mouth using the GeneClean Spin kit (Bio 101). Subcloning was performed using a T0P0 TA cloning kit (Invitrogen). Plasmid DNA was purified from the resulting transformant using QIA prepS mini prep kit (Qiagen). The reaction for base sequence determination is performed using the DyeDeoxy Terminator Cycle Sequence kit (Hikin Elma) and using a fluorescent automatic sequencer. Upon decoding, the sequence shown in SEQ ID NO: 6 was obtained. This sequence contained the 5'-terminal sequence including the initiation codon of the cDNA encoding the rat urotensin II like peptide precursor protein.

In order to determine the sequence at the 3 'end of the cDM encoding rat urotensin II like peptide precursor protein, 50 ng of the rat spinal cord-derived single-stranded cDNA prepared in Example 1 was converted into type III, and SEQ ID NO: 7 (Japan PCR was performed using the primers of Bioservice Co., Ltd.) and Abridged Universal Amp] ificalion Primer (Gibco BRL). The volume of the reaction solution was 501, and the composition of the reaction solution was a primer concentration of 0.2 M, dNTP 0.2 mM, Advantage2 (Kokuntech) 1/50 volume, and 10-fold concentrated Advantage2 Buffer 1/10 volume. PCR conditions are: 1 minute incubation at 94 ° C, 30 cycles of 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes, and 30 minutes at 72 ° C for 10 minutes. It was kept warm. A part of the reaction solution was electrophoresed on 1.6 Seakem GTG Agarose (Takara Shuzo), denatured with 0.4 N NaOH, and subjected to force re-blotting on BY0DYNE B Transmembrane (Paul Bio Support). The membrane was neutralized with 0.2 M phosphate buffer (pH 6.8), air-dried, and heated to 80 ° C for 30 minutes by applying ultraviolet rays of 0.12] / cm ² . This membrane was hybridized with a probe of SEQ ID NO: 8 labeled with [ ³² P] ATP by T4 kinase, washed with 0.2 X SSC (Futtsu Gene) containing 0.1% SDS at 65 ° C, and then washed with BAS2000 ( When the position where the radioactivity was hybridized was examined by Fuji Film Co., Ltd., it was confirmed that an amplification product considered to be derived from the rat urotensin II 1 ike peptide precursor protein gene was migrated at 300 to 400 bp. Therefore, DNA was extracted from this part of the gel using the QIAGEN Gel Extraction kit (Qiagen), and this was subcloned into the plasmid vector peril using the T0P0 TA cloning kit (Invitrogen), and Escherichia coli XL10-Gold (Stratagene) was used. Company). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen). The reaction for determining the nucleotide sequence was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer) and read using a fluorescent automatic sequencer. As a result, SEQ ID NO: 9, which is a 3'-terminal sequence containing a termination codon of cDNA encoding rat urotensin II like peptide precursor protein, was obtained. Sequence containing the full-length cDNA encoding the rat urotensin II like peptide precursor protein predicted from the 5'-terminal and 3'-terminal sequence information obtained using the RACE method as described above. In order to obtain PCR, the single-strand cDNA derived from the spinal cord obtained in Example 1 was used as type I, and PCR was performed using primers of SEQ ID NO: 10 and SEQ ID NO: 11 (synthesized by Amersham Pharmacia Biotech). Done. For the composition of the reaction solution, the primer concentration was set to 0.2 M for each, dNTP was 0.2 mM, Advantage2 (Clontech) 1/50 volume, 10-fold concentrated AdvaiUage2 Buffer 1/10 volume, and the volume was 251. PCR conditions are: 1 minute incubation at 94 ° C, 30 cycles of 94 ° C for 30 seconds, 57 ° C-30 seconds, 72 ° C for 30 seconds, then 10 minutes at 72 ° C Insulated.

The R reaction mixture was subjected to electrophoresis using 1.6% Seakem GTG Agarose (Takara Shuzo), and DNA was detected using a QIAGEN Gel Extraction kit (Qiagen) from the 450 bp DNA detected by staining with Cyba I Green (Futatsu Gene). Was extracted and subcloned using a T0P0 TA cloning kit (Invitrogen). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen). The reaction for base sequence determination was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer) and read using a fluorescent automatic sequencer. As a result, the sequence shown in SEQ ID NO: 12 was obtained. This sequence contained the full-length sequence including the start and stop codons of the cDNA encoding the rat urotensin II 1 ike peptide precursor protein. Escherichia coli XL10-Gold (Stratagene) is transformed with plasmid pcrll-rUII 1 ike into which the cDNA encoding the rat urotensin II like peptide precursor protein has been inserted to transform Escherichia coli XL10-Gold / pcrll-rUII like. Obtained.

The amino acid sequence of the rat urotensin II like peptide precursor protein translated from the nucleotide sequence of SEQ ID NO: 12 is shown as SEQ ID NO: 13. FIG. 1 shows the DNA sequence of the rat urotensin II like peptide precursor and the corresponding amino acid sequence. The urotensin II like peptide, which is a mature peptide predicted from this precursor protein sequence, is different from rat urotensin II, which consists of two amino acids, as predicted from the chromosomal sequence. Residue or 2 residues N-terminal, so it was estimated to be 7 or 14 residues. 17 residues The urotensin II 1 ike peptide consisting of urotensin II is called rat urotensin II like tide -1 and the urotensin II like peptide consisting of 14 residues is called rat urotensin 11 like peptide-2. In addition, since the N-terminal of the predicted mature peptide is glutamine, the N-terminal of the actual peptide was considered to be pyroglutamic acid. The sequences of the expected rat urotensin II like peptide-1 and -2 in SEQ ID NOs: 14 and 15 are shown. However, since the cleavage site of the mature peptide assumed here is atypical, if the Arg residue at position 103 or 99 in the amino acid sequence of the precursor protein is used as the cleavage site, the longer N-terminal 20 The sequence shown in SEQ ID NO: 31 consisting of residues or the sequence shown in SEQ ID NO: 32 consisting of 24 residues is considered as the structure of the mature peptide. Example 4 Preparation of mouse spinal cord cDNA

After preparing total MA from mouse spinal cord using isogen kit (Futtsubon Gene), poly (AVRNA fraction) was prepared using Oligotex (dT) ₃₀ (Takara Shuzo). ThermoScript reverse transcription from this poly (A) ⁺ RM Using the enzyme (Gibco BRL), reverse transcription was performed at 60 ° C using 01 igo dT primer according to the manual to produce mouse spinal cord cDNA Example 5 Mouse urotensin II 1 ike peptide by PCR Determination of partial sequence of cDNA encoding precursor protein

To determine the sequence at the 5 'end of the cDNA encoding the mouse urotensin II like peptide precursor protein, upstream of the start codon of the 5' untranslated region of the rat urotensin II 1 ike pept ide precursor protein cDNA 14 Reverse transcription was performed in Example 4 using a primer (SEQ ID NO:〗 8) corresponding to a sequence of 35 bases from the base and a primer (SEQ ID NO: 19) created with reference to the C-terminal region of rat urotensin II like peptide. PCR was performed using 30 ng mRNA equivalents of mouse spinal cord cDNA as type III. The composition of the reaction mixture was set to 0.4 M for both primer concentration and 2.5 mM MgCh, dNTP 0.2 mM, AmpliTaq Gold (PerkinElmer) 1/100 volume, 10-fold concentrated AmpliTaq Gold Buffer 1/10 volume, volume 20 1 PCR conditions are: After incubating at 95 ° C for 9 minutes, 5 cycles of 95 ° C for 10 seconds, 57 ° C for 15 seconds, 72 ° C for 30 seconds, 95 ° C for 10 seconds, 54 ° C for 15 seconds, The cycle of 72 ° C for 30 seconds was repeated 40 times, and kept at 72 ° C for 7 minutes. The PCR reaction mixture was electrophoresed on 3.5 µm; Nusieve GTG Agarose (Takara Shuzo), and DNA was extracted from the 420 bp band detected by ethidium bromide staining using GeneClean Spin kit (Bio 101). did. This was subcloned into the plasmid vector pcr2.1 using T0P0 TA cloning kit (Invitrogen) and introduced into E. coli TOP10. Plasmid DNA was purified from the resulting transformant using Q1A prep8 mini prep kit (Qiagen). The reaction for base sequence determination was performed using dRhodamine Terminalor Cycle Sequence kit (PerkinElmer) and decoded using a fluorescent automatic sequencer. As a result, the nucleotide sequence represented by SEQ ID NO: 20 was obtained. This sequence had high homology to the base sequence of the rat urotensin II like peptide precursor protein gene, and was considered to be a 5 ′ terminal partial sequence of the mouse urotensin II like peptide precursor protein gene.

In addition, the cDNA encoding the mouse urotensin II 1 ike peptide precursor protein

3 'primer that created Gly ^M -Arg ^M region of rat urotensin II 1 ike peptide precursor protein as a reference to determine the sequence of the terminal side (SEQ ID NO: 21) and rat urotensin II like peptide precursor protein Using a primer (SEQ ID NO: 22) corresponding to the sequence from 1 to 43 bases downstream of the termination codon of the 3 'end untranslated region of the cDNA, 30 ng mRNA equivalent of the cDNA reverse transcribed in Example 4 was used. PCR reaction was performed as type 錶. The composition of the reaction solution was such that the primer concentration was 0.4 M for both, dNTP 0.2 mM, ExTaq (Takara Shuzo) 1/50 vol, 10-fold concentrated ExTaq Buffer 1/10 volume, and the liquid volume was 201. The PCR conditions were: incubation at 95 ° C for 1 minute, followed by 40 cycles of 95 ° C for 10 seconds, 47 ° C for 15 seconds, and 72 ^{eC for} 30 seconds, and incubation at 72 ° C for 7 minutes. . The KR reaction solution was subjected to electrophoresis using 3.5% Nusieve GTG Agarose (Takara Shuzo), and DM was extracted from a band at around 170 bp detected by staining with ethidium umide (Mermaid Spin kit Hiyo 101). This was subcloned into the plasmid vector pcr2.1 using T0P0 TA cloning kit (Invitrogen) and introduced into E. coli TOP10. QIA prepS from the resulting transformant Plasmid DNA was purified using mini prep kit (Qiagen). The reaction for nucleotide sequence determination was performed using dRhodamine Terminator Cycle Sequence kit (Perkin Elemer Co., Ltd.) and read using a fluorescent automatic sequencer. As a result, the nucleotide sequence represented by SEQ ID NO: 23 was obtained. This sequence corresponds to SEQ ID NO: 20 obtained above over about 50 bases, and has high homology to the base sequence of rat urotensin II like peptide precursor protein gene. It was considered to be a partial sequence at the 3 'end of the ide precursor protein gene. Example 6 Obtaining full-length sequence of cD'A encoding mouse urolensin II like peptide precursor protein by PCR

In order to obtain a sequence containing the entire length of the cDNA encoding the mouse urotensin II like peptide precursor protein predicted from the sequence information on the 5′-end and 3′-end obtained as described above, No. 24 and 30 ng mRNA equivalent of the mouse spinal cord cDNA reversely transcribed in Example 4 using the primer of SEQ ID NO: 22 used to obtain the 3 ′ terminal partial sequence described in Example 5 The PCR reaction was carried out using the 錶 as a type. The composition of the reaction solution was such that both the primer concentration was 0.4 iM, dNTP was 0.2 mM, ExTaq (Takara Shuzo) 1/50 volume, 10-fold concentrated ExTaq Buffer 1/10 volume, and the liquid volume was 201 1 1. The PCR conditions were as follows: After incubating at 94 ° C for 1 minute, a cycle of 95 ° C for 10 seconds, 47 ° C for 15 seconds, 72 ° C for 30 seconds was repeated 40 times, and incubated at 72 ° C for 10 minutes. . The PCR reaction solution was subjected to electrophoresis using 3.eve Nusieve GTG Agarose (Takara Shuzo), and DNA was extracted from a band around 430 bp detected by staining with ethidium promide by GeneClean Spinkii (Bio 101). This was subcloned into a plasmid vector pcr2.1 using T0P0 TA cloning k (Invitrogen) and introduced into E. coli TOP10. Plasmid DNA was purified from the resulting transformant using QlAprep8mini pre kil (Qiagen). The reaction was performed using a reaction for nucleotide sequence determination (Rhodamine Terminator Cycle Sequence kit (No, Kin-Ile-Rima), and the sequence was read using a fluorescent automatic sequencer, and as a result, the sequence shown in SEQ ID NO: 5 was obtained. This sequence contains the mouse urotensin II like peptide It contained the full-length sequence including the start and stop codons of the cDNA encoding the precursor protein. Escherichia coli XL10-Gold / pcr2.1-mULP was obtained by transforming E. coli TOPI0 (Invitrogen) with the plasmid pcr2.mULP into which the cDNA encoding the mouse urotensin II like peptide precursor protein was inserted.

The amino acid sequence of the rat urotensin II like peptide precursor protein translated from the nucleotide sequence of SEQ ID NO: 25 is shown as SEQ ID NO: 26. FIG. 2 shows the DNA sequence of the mouse urotensin II 1 ike peptide precursor and the corresponding amino acid sequence. The mouse urotensin II like peptide, which is a mature peptide predicted from this precursor protein sequence, was estimated to have 17 residues, similar to rat urotensin II like Sir tide-1. Also, since the N-terminal of the predicted mature peptide is dalmin, the N-terminal of the actual peptide was considered to be pyroglutamic acid. The sequence of mouse urotensin II like peptide predicted by SEQ ID NO: 27 is shown.

However, as in the case of the rat, the cleavage site of the mature peptide assumed here is atypical, so if the Arg residue at position 103 or 99 in the amino acid sequence of the precursor protein is used as the cleavage site, Furthermore, the sequence shown in SEQ ID NO: 33 consisting of 20 residues long at the N-terminus or the sequence shown in SEQ ID NO: 34 consisting of 24 residues can be considered as a mature peptide structure. Example 7 Rat urotens in 11 like peptide-1: Glu-Arg-Lys-Gln-His-Gly- Thr-Ala-Pro-Glu-Cys-Phe-T 卬 -Lys-Tyr-Cys-Ile-0H ( Production of SEQ ID NO: 14) Commercially available Boc-Ile-OCH Factory PAM resin (0.746m mole / g resin) 0.5m mole is put into the reaction soda of peptide synthesizer ABI 430A, and Boc-strategy (ΝΜΡ-ΗΟΒί) Boc-Cys (MeBzl), Boc-Tyr (Br-Z), Boc-Lys (Cl-Z), Boc-Tr (CH0), Boc Phe, Boc-Cys (MeBzl), Boc-Glu ( OcHex), Boc-Pro, Boc-Ala, Boc-Thr (Bzl), Boc-Gly, Boc-His (Bom), Boc-Gin, Boc-Lys (Cl-Z), Boc-Arg (Tos), Z -pGlu was introduced into the river page to obtain the desired protective peptide resin. After stirring this resin in anhydrous hydrogen fluoride at 0 ° C for 60 minutes together with p-cresol and 1,4-butanedithiol, hydrogen fluoride was distilled off under reduced pressure, and ethyl ether was added to the residue to precipitate. Filtered. 5 to this precipitate The extract was concentrated by adding 0% acetic acid aqueous solution to remove the insoluble portion. The extract was concentrated and then applied to a Sephadex ™ G-25 column (2.0 x 80 cm) filled with 50% aqueous acetic acid. Develop, collect major fractions, attach to a reversed-phase chromatography column (2.6 x 60 cm) packed with LiChroprep ™ RP-18, wash with 200 ml of 0.1 ml water, 0. 300 ml of TFA water and 300 ml of 40% acetonitrile water containing 0.1% TFA The linear gradient used was eluted, and the main fraction was collected and concentrated.此Re was dissolved at a concentration of about 5x1 (gamma ⁵ mol / L in 2% aqueous acetic acid, was adjusted to PH7.5 with aqueous ammonia was gently stirred included blown air. The reaction was tracked with HPLC, After confirming that all the peaks of the SH peptide changed to the disulfide form, acetic acid was added to adjust the pH of the solution to 3, and the solution was adsorbed to the LiChroprep ^T¾RP -18 column described above. Thereafter, a linear gradient elution was performed using 300 ml of 0.1% TFA water and 300 ml of 5% water containing 0.1% TFA (Wasetonitrile water). The main fractions were collected and lyophilized to obtain a white powder.

By mass spectrometry (M + H) ⁺ 2076.12 (calculated 2075.96)

HPLC elution time 18.3 min

Column conditions

Column Wakosil 5C18T 4.6 x 100mm

Eluent: A solution-0. TFA water, B solution _ Using 0.1% TFA-containing acetonitrile, A / B: 95/5 to 45/55, linear concentration gradient elution (25 minutes)

Flow rate: 1.0 ml / min Example 8 Raurotensin 11 like Sir tide-1: Gin-Arg-Lys-Gin-His-Gly- Thr-Al-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys- Production of Ile-OH (SEQ ID NO: 14) Z-pGlu in Production Example 7 was changed to Boc-Gin, and the same solid phase peptide synthesis, deprotection reaction, disulfide formation, and purification were performed. The product was dissolved in 1 / 100N --- HC1 and the peptide was lyophilized as a hydrochloride to obtain a white powder.

By mass spectrometry (M + H 2093.20 (calculated value 2092.99)

HPLC elution time 17.8 min

Column conditions

Column Wakosi 1 5C18T 4.6 x 100mm Eluent: Solution A-0. \% TFA water, Solution B-0.1 A FA-containing acetonitrile A / B: 95/5 to 45/55 linear gradient elution (25 minutes)

Flow rate: 1. Q ml / min Example 9 rat urotensin II like peplide-2: pGlu-His-Gly-Thr-Ala-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys-Ile-OH ( Production of SEQ ID NO: 5)

A commercially available Boc-lie- 0C¾-PAM resin (0.746 mmole / g resin) 0.5 mmo 1 e portion is placed in a reaction solution of a peptide synthesizer ABI 430A, and Boc-strate (BMP-Strategy (KMP-HOBt) peptide synthesis method). MeBzl), Boc-Tyr (Br-Z), Boc-Lys (Cl-Z), Boc-Trp (CH0), Boc-P e, Boc-Cys (MeBzl), Boc-Glu (OcHex), Boc- Pro, Boc-Al, Boc-Thr (Bz1), Boc-Gly, Boc-His (Bom), and Z-pGlu were sequentially introduced to obtain a target protected peptide resin. After stirring 0.45 g of this resin together with P-cresol and 1,4-butanedithiol in anhydrous hydrogen fluoride at 0 ° C for 60 minutes, hydrogen fluoride was distilled off under reduced pressure, and getyl ether was added to the residue to precipitate. It was filtered. The precipitate was extracted with 50% acetic acid aqueous solution to remove the insoluble portion. The extract was concentrated sufficiently and then applied to a Sephadex (trade name) G-25 column (2.0 X 80 cm) filled with 50% acetic acid aqueous solution. Then, develop with the same solvent, collect the main fractions, and attach them to a reversed-phase chromatography column (2.6 60 cm) packed with LiChroprep (trade name) RP-18. Water 2001)], and linear gradient elution was performed using 300 ml of 0.1% TFA water and 300 ml of 0.1% TFA-containing 40% acetonitrile. The main fractions were collected and concentrated. This was dissolved in about 4 ml of acetic acid, diluted to 240 ml with distilled water, adjusted to pH 7.5 with aqueous ammonia, and gently blown with air and stirred. The reaction was followed by HPLC, and after confirming that all the peaks of the SH peptide had changed to the SS form, acetic acid was added to adjust the pH of the solution to 3, and the solution was adsorbed on the LiChroprep (trade name) RP-18 column. . After washing the column with 200 ml of 0.1% TFA water, a linear gradient elution was performed using 300 ml of 0.1% TFA water and 300 ml of 50% acetonitrile water containing 0.1% TFA, and the main fractions were collected and lyophilized to give a white powder. Obtained. By mass spectrometry (M + H) ⁴ 1664.1 (calculated 1663.7)

HPLC elution time 19.9 min

Column conditions

Wakosi 1 5C18T 4.6 100mm Eluent: A solution 0. TFA water, B solution-Acetonitrile containing 0.1% TFA, A / B: 95/5 to 45/55, linear gradient elution (25 minutes)

Flow rate: 1.0 ml / min Example 10 Rat urotensin II 1 ike peptide-2: Gln-His-Gly-Tr-Ala-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys-Ile- Production of OH (SEQ ID NO: 15)

After changing the Z-pGlu in the solid-phase peptide synthesis of the above-mentioned Production Example 9 to Boc-Gln and performing the same deprotection reaction, disulfide formation, and purification, the target compound was dissolved in 1 / 100N-HC1. The peptide was lyophilized as a hydrochloride to give a white powder.

By mass spectrometry (M + H) ⁺ 1680.92 (calculated value 1680.73)

HPLC elution time 19.3 min

Column conditions

Column Wakosil 5C18T 4.6 100mm

Eluent: A solution _0. TFA water, B solution-0.1% FA-containing acetonitrile A / B: 95/5 to 45/55 linear gradient elution (25 minutes)

Flow rate: 1.0 ml / min Example 1 1 mouse urotensin II like peptide: pGlu-His-Lys-Gln-His-Gly-Ala-Ala-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys- Production of Ile (SEQ ID NO: 27) Boc-during production of rat urotensin II like peptide-1 described in Example 7

The same solid-phase peptide synthesis, deprotection reaction, disulfide formation, purification, and purification were performed by replacing Thr (Bzl) with Boc-Ala and Boc-Arg (Tos) with Boc-His (Bom), followed by lyophilization to obtain a white powder. By mass spectrometry (M + H) ⁺ 2027.11 (calculated value 2026.91)

HPLC elution time 1 8.9 minutes

Column conditions

Column Wakosii 5C18T 4.6 x 100mm

Eluent Solution A 0. TFA water, Solution B 0. Linear concentration gradient elution from 95/5 to 45/55 using Acetonitrile containing TFA (25 min) Flow rate: 1.0 ml / min Example 1 2 mouse urotensin II 1 ike peptide: Gln-His-Lys-Gln-His-Gly-Ala-Ala-Pro-Glu-Cys-Pe-Trp-Lys-Tyr-Cys Preparation of -Ile (SEQ ID NO: 27) Boc- during production of rat urotensin II 1 ike peptide-1 described in Example 8

Substitute Thr (Bzl) for Boc-Ala and Boc-Arg (Tos) for Boc-His (Bom), and perform the same solid-phase peptide synthesis, deprotection reaction, disulphide formation, and purification. / 100X-HC1 and lyophilized peptide as hydrochloride to obtain white powder.

By mass spectrometry (M + H) ⁴ 2044.07 (calculated value 2043.93)

HPLC elution time 18.5 min

Column conditions

Column Wakosil 5C18T 4.6 100mm

Eluent: A solution-0.1¾ TFA water, B solution-Q. Using 1% TFA-containing acetonitrile, A / B: linear concentration gradient elution from 95/5 to 45/55 (25 minutes)

Flow rate: 1.0 ml / min. Example 13 3 Synthetic rat urotensin II 1 ike peptide-1 and urotensin II 1 ike peptide-2 promoting arachidonic acid metabolite release activity on CHO / rSENR cell line The arachidonic acid metabolite releasing activity of rat urotensin II like peptide-2 (SEQ ID NO: 15) synthesized in 9 against rat SENR-expressing CH0 cells was measured by the following method.

CHO / rSENR cells (same cells as CH0 / SENR cells described in 000/32627) were seeded at 5 × 10 ⁴ cells / well on a 24-well plate, and cultured for 24 hours. The solution was added to be well. [¾] Sixteen hours after the addition of arachidonic acid, the cells were washed with Hanks' solution (HBSS) containing 0.05% serum albumin (BSA), and the synthetic rat urotensin II! HBSS 5001 containing 0.05% BSA to which the ike peptide was added was added. After incubating at 37 ° C. for 30 minutes, 500 1 to 350 11 of the reaction solution was added to the scintillator, and the amount of [¾] arachidonic acid metabolite released during the reaction was measured by scintillation counting. As a result, rat urotensin II The release of arachidonic acid metabolites into the medium was confirmed by the like peptide in a peptide concentration-dependent manner (Fig. 3). EC _{5 at} this time. The value was 1.1 nM. A similar activity was also confirmed when the rat urotensin II like peplide-1 (SEQ ID NO: 14) synthesized in Example 7 was administered (EC _5, value: 1.7 nM). Further, the same activity is confirmed when the mouse urotensin II like peptide (SEQ ID NO: 27) is administered. Also confirmed when rat urotensin II 1 ike peptide-1 and -2 or mouse urotensin II like peptide were administered to human SENR expressing CH0 cells (CHO / hSENR cells described in TO 00/32627). Is done. Example 14 Effect of Synthetic Rats urotensin II 1 ike Sir and urotensin II 1 ike peptide-2 on Blood Pressure of Rats Under Anesthesia

The effect of the rat urotensin II 1 ike peptide-2 (SEQ ID NO: 15) synthesized in Example 9 on blood pressure in anesthetized rats was measured by the following method. Anesthetized 8-9-week-old male Wistar rat (purchased from Nippon Chars River) with Nembutal Injection (Dainippon Pharmaceutical, 50 mg / ml sodium pentobarbital, 50 mg / kg intraperitoneally) and connected to transducer The catheter for blood pressure measurement (SP-55) was inserted into the left carotid artery, and the catheter for intravenous administration (SP-35) was inserted into the left femoral artery. Synthetic rat urotensin II like peptide-2 was dissolved in physiological saline containing 0.05% BSA and administered to the left femoral vein so as to be 10 nmo1 / kg. Blood pressure was recorded continuously with a polygraph (NEC Saneisha). The blood pressure of the rats was reduced by the administration of the peptide, and the rat urotensin 11 1 ike Sir tide-2 showed a hypotensive effect. When the rat urotensin 111 ike peptide-2 was administered at a dose of 10 nmol / kg, the reduced blood pressure compared to the mean blood pressure before administration was about 35 mniHg. Similar activity was also confirmed when the rat urotensin II like peptide-1 (SEQ ID NO: 14) synthesized in Example 7 was administered. When the rat urotensin II 1 ike peptide-1 was administered at 10 nniol / kg, the decreased blood pressure was about 33 mmH compared to the mean blood pressure before administration. Further, the same activity is confirmed when the mouse uroten sin II like peptide (SEQ ID NO: 27) is administered. Example 15 Synthetic rat urotensin II 1 ike peptid-1 against rat carotid artery Shrink action

The effect of rat urotensin II like peptide-1 (SEQ ID NO: 14) synthesized in Example 7 on rat thoracic aorta is measured by the following method. 9-] 2-week-old male Wis tar rat (purchased from Nippon Charls River) was anesthetized with Nembutal Injection (Dainippon Pharmaceutical, 50 mg / ml sodium pentobarbital, 50 mg / kg intraperitoneally), and abdominal aorta. More blood is collected and blood is killed. The thoracic aorta is excised from this rat and a 5 mm wide ring specimen is prepared. Sample mixed gas _{_{(95% 0 2 -5 C0 2}} ) was bubbled through 37. And kept at C Krebs- Henselei ml solution (NaC1 118mM, KC14.7 mM, CaCU 2. δ mM, KH 2 P0 4 1.2 mM, NaHC0 3 25 m'M, MgS0 4 1.2 mM, glucose 10.0 mM) 3 ml Suspended in a full organ bus, and record the isometric contraction tension with a polygraph (NEC Saneisha) via a micro load transducer (UL-10GR, Minebea). The static tension shall be approximately 0.5 g. The presence of endothelium, l (T ^fi M norepinephrine was induced by administration shrinkage is confirmed by observing that the relaxation by 10 ⁵ M acetylcholine administration. Rats urotensin II 1 ike pept ide- 1 final concentration 10- ^{1 (1} -.. cumulatively administered so as to 10- ⁷ M rat carotid striae ring specimens rat urotensin II like dose-dependent manner to contract by the addition of peptide-1 the same activity rat urotensin II It is also confirmed when 1 ike peptide-2 (SEQ ID NO: 15) or mouse urotensin II 1 ike peptide (SEQ ID NO: 27) was administered Example 16 Rat SERO induced by rat urotensin Π like peptide-1 Measurement of GTP r S binding activity to expressed CH0 cell membrane fraction

The activity of rat urotensin II likepepiide-1 (SEQ ID NO: 14) synthesized in Example 7 for promoting the binding of S] -guanosine 5 '(7' thio) in osphate to the rat SENR-expressing CH0 cell membrane fraction was determined by the following method. Measured by First, the method for preparing the membrane fraction is described. 1 X 10 ^s number of CHO / rSENR cells 10 ml of Homojinetoba' fur _{(10 mM NaHC0 3, 5 mM} EDTA, 0. δ mM PMSF, 1 11 / ml peps tat in, 4 g / ml E64, 20 ug / ml leupeptin) and crush using a polytron (12,000 rpn) for 1 minute. Centrifuge the cell lysate (1,000 g, 15 minutes) to obtain the supernatant. Next, the supernatant was ultracentrifuged (Beckman type 30 rotor, 30. Q00 rpm, 1 hour) to obtain The resulting precipitate is used as a rat SENR-expressing CH0 cell membrane fraction.

The measurement of GTPτS binding activity is as follows. Rat SE ^T R expressing CH0 cells membrane fraction The membrane dilution buffer (50 mM Tris-HCl buffer (pH 7.4), 5 mM.MgCl 150 m.MNaCl, 1 a M GDP) was diluted with a protein concentration 30 it g Make a 1 / ml cell membrane fraction solution for the assay. To the membrane fraction solution for Atsusei 200 a 1 was added 21.5 of 51.5 n concentration of S] -guanosine 5 thiotriphosphate (NEN) and 21 of rat urotensin II like peptide at various concentrations and mixed. Incubate the solution at 25 ° C for 1 hour. The mixture was filtered through a filter, further filters washing buffer (50 mM Tris-HCl buffer (H 7.4), 5 mM MgCl 2, 1 mM EDTA, 0.)% BSA) was washed twice with 1.5 ml, of the filter Radioactivity is measured with a liquid scintillation counter. Rat urotensin II like peptide- 1 in a dose dependent manner, to binding to the membrane fraction ^[35 S] -guanosine 5'- increase (§ -thio) triphosphate amount. Similar activity is also confirmed when rat urotensin II like peptide-2 (SEQ ID NO: 15) or mouse urotensin II 1 ike peptide (SEQ ID NO: 27) is administered. Rat urolensin II 1 ike lord tide-1 and -2 are also confirmed when mouse urotensin II like peptide is administered to the membrane fraction of human SENR-expressing CH0 cells prepared in the same manner as above. Is done. Example 17 Preparation of Isotope-Labeled Rat urotensin II iike Peptide-1 An isotope-labeled rat urotensin II like peptide-1 for use in a binding inhibition experiment was prepared as follows. 5 μg of rat urolensin II like peptide-1 (SEQ ID NO: 14) synthesized in Example 7 was dissolved in 25 1 of 0.4 M sodium acetate (pH 5.6), and 200 ng of lactoperoxidase (Wako Pure Chemical Industries, Ltd.) was added thereto. After addition of 薬 mCi, 'mCi [' ²⁵ 1] -sodium iodide (Amersham Pharmacia Biotech) and 200 ng of hydrogen peroxide (10a1) were added. After allowing to stand at room temperature for 10 minutes, 200 ng of hydrogen peroxide (101) was further added and allowed to stand for 10 minutes. This TSKgel 0DS- 80T _S column (4.6 mm x 25 cm, Tosoh) and purified by HPLC using to give ⁵ 1] labeled rat urotensin II 1 ike pepi i de- 1 . The same ^[5 iota] labeled peptide rat urotensin II 1 ike peptide- 2 (SEQ ID NO: 15) Oh Alternatively, mouse urotensin II like peptide (SEQ ID NO: 27) can be produced by performing the same operation. Example 18 Binding inhibition experiment using urotensin II like peptide-1 and CHO / rSENR cells

The method of a binding inhibition experiment using the [ ^| 251] -labeled rat urotensin II like peptide-1 and rat SENR-expressing CH0 cells prepared in Example 17 is described below. CHO / rSENR cells are seeded at 5 × 10 ⁴ cells / well on a 24-well plate, cultured for 48 hours, and then the cells are washed with 0.5 ml of MEM α medium containing 0.05¾ BSA (hereinafter referred to as MEM a containing 0.05¾ BSA). The medium is called a reaction buffer). 10 pM to examine the total binding [ ^'25 1] labeled rat urotensin II like peptide-1 reaction buffer containing, non-specific binding for the regulating bell 10 Romyu [' ²⁵ 1] labeled rat urotensin II 1 A reaction buffer containing ike peptide-1 and 1 M non-isotopically labeled rat urotensin II like peptide-1, and a sample to be tested for binding activity to rat SENR and a reaction containing 10-labeled rat urotensin II 1 ike peptide-1 Add 0.5 ml of buffer and 0.5 ml each to the cells, and incubate at room temperature for 30 minutes. After washing the cells with the reaction buffer, add 0.2 ml of 0.5 N NaOH to lyse the cells, and measure the radioactivity of the lysate by gamma force. Specific binding is the value of total binding minus non-specific binding. The rat SENR binding activity of the test sample is expressed as a ratio of the value obtained by subtracting the radioactivity of the cell lysate to which the sample was added from the total binding to the specific binding. A similar binding inhibition experiment can also be performed using [ ^| 251] -labeled rat urotensin II like peptide-2 (SEQ ID NO: 15) or mouse urotensin II 1 ike peptide (SEQ ID NO: 27). . Also, ^{[| 25} 1], labeled rat Bok urotensin II like peptide-1 and - can be implemented using two or mouse urotensin II like peptide and human SEN-R expression CH0 cells. Example 19 Binding Inhibition Experiment Using Isotope-Labeled Rat urolensin II 1 ike peptide-1 and CHO / rSENR Cell Membrane Fraction

Produced in Example 1 7 ^[125 1] -labeled rat urotensin II] ike peptide- 1 and rack G The method of a binding inhibition experiment using the membrane fraction of CHO cells expressing SENR is described below. The membrane fraction prepared from the CHO / rSENR cells described in Example 16 was treated with a membrane dilution buffer (50 mM Tris-HCl buffer (H7.4), 5 mM MgC, 0. \% BSA, 5 mM EDTA, After dilution with 0.5 mM PMSF, 1 g / ml pepsiatin, 4 ng / ml E64, 20 ug / ml leupeptin), a cell membrane fraction solution for Atsushi having a protein concentration of 60 g / ml was prepared. 20 μM [ ¹²⁵ 1] -labeled rat diluent buffer containing urotensin II like peptide-1 to examine total binding to 20 IX 1 membrane fraction solution 100 IX 1, 20 pM [ ¹²⁵ 1] labeled rat urotensin II like peptide-1 and 2 n M non Aisotopu labeled rat urotensin II like peptide-1 membrane dilution buffer containing sample and 20 ρΜ [ ^'25 1 further investigate the binding activity against rat SENR ] 1001 each of a membrane dilution buffer containing a labeled rat urotensin II like peptide-1 was added and reacted at room temperature for 60 minutes. The mixture was filtered through a filter, and the filter was further washed twice with 1.5 ml of membrane dilution buffer. Then, the radioactivity of the filter was measured by a gamma counter. Specific binding is the value of total binding minus non-specific binding. The rat SENR binding activity of the test sample is shown as a ratio of the value obtained by subtracting the radioactivity of the cell membrane fraction to which the sample was added from the total binding to the specific binding. Binding inhibition by unlabeled rat urotensin II] ike peptide-1 in this experiment were observed, the IC _5. The value was 1.2 nM. A similar binding inhibition experiments [ ^'25 1] labeled rat urotensin II l ike peptide-2 (SEQ ID NO: 15) or mouse urotensin II like peptide (SEQ ID NO: 27) can also be carried out with . Alternatively, the method can be carried out using a [ ^| 251] -labeled rat urotensin 11 like peptide-1 and -2 or a mouse urotensin II 1 ike peptide and a membrane fraction of human SENR-expressing CH0 cells. (Sequence list free text)

SEQ ID NO: 1 4

Other information about the sequence:] The first and 16th Cys residues form an intramolecular disulfide bond.

SEQ ID NO: 1 5

Additional sequence information: The 8th and 3rd] Cys residues form an intramolecular zide bond. SEQ ID NO: 2 7

Additional sequence information: The two 11th and 16th Cys residues form an intramolecular di: sulfide bond.

SEQ ID NO: 3 1

Other sequence information: The two Cys residues at positions 14 and 19 form an intramolecular disulfide bond.

SEQ ID NO: 3 2

Additional sequence information: The two Cys residues at positions 18 and 23 form an intramolecular disulfide bond.

SEQ ID NO: 33

SEQ ID NO: 3 4

Additional sequence information: The two Cys residues, 18th and 23rd, form an intramolecular disulfide bond. Industrial applicability

The DNA encoding the polypeptide of the present invention or the polypeptide of the present invention can be obtained by (1) searching for the physiological action of the polypeptide of the present invention; (2) preparing a synthetic oligonucleotide probe or PCR primer; Ligand DNA Acquisition of DNA encoding precursor protein ④ Development of receptor-binding assay system using recombinant receptor protein expression system and screening of drug candidate compounds 入手 Acquisition of antibodies and antisera ⑥ Development of diagnostic drugs using DNA, RNA, antibodies or antisera, ⑦Central nervous function regulators, circulatory function regulators, heart function regulators, kidney function regulators, urinary function regulators, sensory organ function regulators, etc. It can be used for the development of medicines, and gene therapy.

Claims

The scope of the claims

1. Contains the same amino acid sequence as SEQ ID NO: 14 or has an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 having a daltamine residue or a pyroglutamic acid residue at the N-terminus Or an amide or an ester or a salt thereof.

2. The substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34 The polypeptide according to 1 above.

3. An amino acid sequence represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34. The polypeptide as described.

4. A precursor protein of the polypeptide according to claim 1, or an amide or ester thereof, or a salt thereof.

5. The precursor protein according to claim 4, which contains an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26.

6. A DNA comprising a DNA having a nucleotide sequence encoding the polypeptide of claim 1.

7. The method according to claim 6, which has a base sequence represented by SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38. DNA.

8. A DNA containing DNA having a nucleotide sequence encoding the precursor protein according to claim 4.

9. The DNA according to claim 8, which has the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25.

10. A recombinant vector containing the DNA of claim 6 or claim 8.

1 1. A transformant transformed with the recombinant vector according to claim 10.

1 2. A transformant according to claim 11, which is cultured to produce and accumulate the polypeptide according to claim 1 or the precursor protein according to claim 4, and collect this. 5. A method for producing the polypeptide described in claim 4 or the precursor protein described in claim 4, or an amide or ester thereof or a salt thereof.

1 3. An antibody against the polypeptide according to claim 1 or the precursor protein according to claim 4, or an amide or an ester or a salt thereof.

1 4. A pharmaceutical comprising the polypeptide according to claim 1 or the precursor protein according to claim 4, or an amide thereof, an ester thereof, or a salt thereof.

1 5. A medicament comprising the DNA of claim 6 or claim 8.

1 6. Claim 14 or Claim which is a central function regulator, a circulatory function regulator, a heart function regulator, a kidney function regulator, a urinary function regulator or a sensory organ function regulator.

15. The medicament according to 15.

1 7. Use of the polypeptide according to claim 1 or the precursor protein according to claim 4 or an amide thereof, an ester thereof or a salt thereof. A method for screening a compound or a salt thereof that alters the binding property between a SENR and the polypeptide according to claim 1 or the precursor according to claim 4 or a amide or an ester or a salt thereof.

18. A SENR characterized by using the polypeptide according to claim 1 or the precursor protein according to claim 4 or an amide or ester thereof or a salt thereof, and the polypeptide according to claim 1 or the claim 4. A kit for screening a compound or a salt thereof that alters the binding property of the precursor protein or the amide or an ester or a salt thereof as described above.

19. The SENR and the polypeptide according to claim 1 or the precursor protein according to claim 4, which are obtained by using the screening method according to claim 17 or the screening kit according to claim 18. Compounds or salts thereof that change the binding to amide or its ester or its salt.

20. A method for quantifying the polypeptide according to claim 1, or the precursor protein according to claim 4, or an amide thereof, an ester thereof, or a salt thereof, wherein the antibody according to claim 13 is used.

21. A diagnostic agent for a disease associated with the polypeptide according to claim 1 or the precursor protein according to claim 4, or an amide or a salt thereof, which comprises the antibody according to claim 13.