WO2000058351A2 - Genes de zwittermicine a a partir de bacillus cereus - Google Patents

Genes de zwittermicine a a partir de bacillus cereus Download PDF

Info

Publication number
WO2000058351A2
WO2000058351A2 PCT/US2000/007570 US0007570W WO0058351A2 WO 2000058351 A2 WO2000058351 A2 WO 2000058351A2 US 0007570 W US0007570 W US 0007570W WO 0058351 A2 WO0058351 A2 WO 0058351A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
acid fragment
aminopolyol
antibiotic
Prior art date
Application number
PCT/US2000/007570
Other languages
English (en)
Other versions
WO2000058351A3 (fr
Inventor
Jo Handelsman
Jocelyn L. Milner
Elizabeth A. Stohl
Elizabeth A. Emmert
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Priority to JP2000608050A priority Critical patent/JP2003528569A/ja
Priority to EP00950199A priority patent/EP1163347A2/fr
Priority to AU63337/00A priority patent/AU6333700A/en
Publication of WO2000058351A2 publication Critical patent/WO2000058351A2/fr
Publication of WO2000058351A3 publication Critical patent/WO2000058351A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)

Definitions

  • ZWITTERMICIN A BIOSYNTHETIC GENE FROM BACILLUS CEREUS
  • phytopathogens Plants routinely become infected by disease-causing fungi and bacteria (referred to herein-as "phytopathogens"). Many microbial phytopathogen species have evolved to utilize different modes of infection, such as introduction of air-born phytopathogens through foliar surfaces, introduction from plant-to-plant contact, or introduction by various vectors. Other phytopathogens are soil-borne and preferentially infect roots and newly germinated seedlings. In addition to infection by fungi and bacteria, many plant diseases are caused by soil-borne nematodes that infect roots, typically causing serious damage when the same crop species is cultivated for successive years on the same area of ground.
  • Plant diseases cause considerable crop loss from year to year, which causes economic hardship to farmers and nutritional deprivation for local populations in many parts of the world.
  • the severity of the destructive process of disease depends on the aggressiveness of the phytopathogen and the response of the host.
  • Various attempts have been made to inhibit or decrease the distribution of phytopathogens.
  • One aim of most plant breeding programs is to increase the resistance of host plants to disease.
  • the development of plants resistant to disease has typically had only a limited period of success in many crop-pathogen systems due to the rapid evolution of phytopathogens to overcome resistance genes.
  • nematicides have a relatively high toxicity to mammals.
  • Most nematicides used to control soil nematodes are of the carbamate, organochlorine, or organophosphorous groups and must be applied to the soil with particular care.
  • Biocontrol organisms i.e., an organism that is capable of affecting the growth of a pathogen such that the ability of the pathogen to cause a disease is reduced, have the advantage of being able to colonize and protect parts of the plant inaccessible to conventional fungicides.
  • This practice developed from the recognition that crops grown in some soils are naturally resistant to certain fungal phytopathogens and that the suppressive nature of these soils is lost by autoclaving. Furthermore, it was recognized that soils that are conducive to the development of certain diseases could be rendered suppressive by the addition of small quantities of soil from a suppressive field.
  • biocontrol was initially believed to have considerable promise as a method of widespread application for disease control, it has found application mainly in the environment of greenhouse crops where its utility in controlling soil-borne phytopathogens is best suited for success.
  • Large-scale field application of naturally-occurring microorganisms has not proven possible due to constraints of microorganism production (they are often slow growing), distribution (they are often short lived), and high cost (the result of the slow growth and short lifetimes of these organisms).
  • biocontrol approaches is also largely limited by the identification of naturally-occurring strains which may have a limited spectrum of efficacy.
  • Nucleic acid fragment refers to a linear polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded DNA and RNA.
  • a nucleic acid fragment may include both coding and non-coding regions that can be obtained directly from a natural source (e.g., a microorganism), or can be prepared with the aid of recombinant or synthetic techniques.
  • a “coding region” is a linear form of nucleotides that encodes a polypeptide, usually via mRNN when placed under the control of appropriate regulatory sequences. The boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end.
  • a “non-coding region” is a linear form of nucleotides that does not encode a polypeptide.
  • Polypeptide refers to a polymer of amino acids and does not refer to a specific length of a polymer of amino acids. Thus, for example, the terms peptide, oligopeptide, protein, and enzyme are included within the definition of polypeptide. This term also includes post-expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like.
  • complement refers to the ability of two single stranded nucleic acid fragments to base pair with each other, where an adenine on one nucleic acid fragment will base pair to a thymine on a second nucleic acid fragment and a cytosine on one nucleic acid fragment will base pair to a gaunine on a second nucleic acid fragment.
  • Two nucleic acid fragments are complementary to each other when a nucleotide sequence in one nucleic acid fragment can base pair with a nucleotide sequence in a second nucleic acid fragment. For instance, 5'-ATGC and 5'-GCAT are complementary, as are 5'- ATGrC and 5'-GCAT.
  • complement and complementary also encompasses two nucleic acid fragments where one nucleic acid fragment contains at least one nucleotide that will not base pair to at least one nucleotide present on a second nucleic acid fragment.
  • the third nucleotide of each of the two nucleic acid fragments 5'-ATTGC and 5 1 - GrCTAT will not base pair, but these two nucleic acid fragments are complementary as defined herein.
  • two nucleic acid fragments are complementary if they hybridize under the standard conditions referred to herein.
  • two nucleic acid fragments are complementary if they have at least about 80% sequence identity, preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity.
  • hybridizes means that a single stranded nucleic acid fragment forms a noncovalent interaction with a second nucleic acid fragment under certain conditions, as described herein.
  • isolated means that a nucleic acid fragment or polypeptide is either removed from its natural environment or synthetically derived.
  • the nucleic acid fragment or polypeptide is purified, i.e., essentially free from any other nucleic acid fragment and associated cellular products or other impurities.
  • “Host cells” refer to, for example, microorganisms including prokaryotic (e.g., bacteria), and eukaryotic (e.g., fungi) cells, and plant cells that can be used as recipients for introduction of a recombinant vector.
  • An "antibody” is an immunoglobulin produced by the immune system of a vertebrate in response to exposure to an antigen and able to bind to that antigen.
  • an antigen is a polypeptide.
  • the epitope of an antigen is the portion of the antigen to which an antibody binds. The epitope can be present on other antigens.
  • Transgenic refers to any cell, cell line, tissue plant part or plant the genotype of which has been altered by the presence of a foreign coding region. Typically, the foreign coding region was introduced into the genotype by a process of genetic engineering, or was introduced into the genotype of a parent cell or plant by such a process and is subsequently transferred to later generations by sexual crosses or asexual propagation.
  • FIG. 1 is a map of the B. cereus UW85 genome. Arrows indicate the direction of transcription of the genes.
  • FIG. 2 is a map of p ⁇ zmaR showing insertional inactivation of zmaR. Dotted lines indicate deleted DNA. Spr designates that the plasmid confers resistance to spectinomycin. All other abbreviations as in Fig. 1.
  • FIG. 3 is a map of p ⁇ or 2 showing insertional inactivation of or/ Dotted lines indicate deleted DNA. All abbreviations as in Figs. 1 and 2.
  • FIG. 4 is a gel demonstrating expression of zmaR in B. cereus UW85 and
  • UW85 ⁇ z m ⁇ i? Cultures of UW85 and UW85 ⁇ z/w ⁇ ⁇ were e grown in 50% TSB. Time points consisting of 3.0 mL culture were taken at 6, 12, 24, 48, and 72 hours. SDS-PAG ⁇ gels containing 20 ⁇ g total protein per lane were run, and protein was transferred to PVDF membrane, with subsequent western blot analysis using the ⁇ CL kit. Production of zwittermicin A is first detected after 48 hours. The limit of detection for zwittermicin A is 0.33 ⁇ g mL (Milner et al., Appl. Microbiol. Biotechnol. 43 :685-691 (1995)).
  • SEQ. ID. NO: 1 is the nucleotide sequence of a 3.9-kb DNA region containing zmaR, orfl, orf2, and orf3.
  • the locations of zmaR, orfl, orf2, and orf3 are noted in the "features" fields, as are various restriction enzyme recognition sites, the putative ribosome binding sites, and the acyltransferase (AT) active site motif in orfl.
  • SEQ. LD. NOS: 42 & 43 orfl gene and Orfl protein, respectively
  • SEQ. LD. NOS: 44 & 45 ((orfi gene and Orf2 protein, respectively)
  • SEQ. ID. NOS: 46 & 47 orf3 gene and Orf3 protein, respectively
  • SEQ. ID. NOS: 48 & 49 zmaR gene and zmaR protein, respectively.
  • SEQ. ID. NOS: 2-25 are the PCR primers presented in Table 2.
  • SEQ. ID. NO: 26 is the R. cereus mutant designated 11.35
  • SEQ. ID. NO: 27 is the R. cereus mutant designated 32.18 SEQ. ID. NO: 28 is the B. cereus mutant designated 52.6
  • SEQ. ID. NO: 29 is the R. cereus mutant designated 56.34
  • SEQ. ID. NO: 30 is the R. cereus mutant designated 64.27
  • SEQ. ED. NO: 31 is the R. cereus mutant designated 78.24 SEQ. ID. NO: 32 is the R. cereus mutant designated 89.3 SEQ. ID. NO: 33 is the B. cereus mutant designated 96.3 SEQ. ED. NO: 34 is the R. cereus mutant designated 101.19 SEQ. ID. NO: 35 is the R. cereus mutant designated 120.4 SEQ. ED. NO: 36 is a consensus transcription initiation sequence for plants.
  • SEQ. ED. NO: 37 is another consensus transcription initiation sequence for plants.
  • SEQ. ED. NOS: 38-41 are the PCR sequencing primers used to sequence the R. cereus mutants.
  • Zwittermicin A is the only known aminopolyol antibiotic:
  • peptide and polyketide antibiotics also has structural features in common with peptide and polyketide antibiotics.
  • the alternating hydroxyl groups on the carbon backbone are similar to a partially reduced polyketide structure; the nitrogen-rich end of zwittermicin A may be derived from an amino acid, possibly citrulline, similar to a polypeptide antibiotic.
  • polypeptide antibiotic biosynthetic pathways have been described from Bacillus spp. Although the polyketidic antibiotics dif icidin and aurantinin have been identified from species of Bacillus, nothing is known about the genes necessary for their biosynthesis. In fact, the vast majority of genetic studies of polyketide antibiotic biosynthesis have been conducted in Streptomyces spp.
  • Polyketide antibiotics share a common pattern of biosynthesis.
  • the molecules are built up from two carbon building blocks, the ⁇ -carbon of which always carries a keto group, thus the name polyketide.
  • Polyketides include many important antibiotics, immunosuppressants, and other compounds possessing a broad range of biological properties.
  • the tremendous structural diversity of polyketides derives from the different lengths of the polyketide chain and the different side-chains introduced, either as part of the two carbon building blocks, or after the polyketide backbone is formed.
  • the keto groups may also be reduced to hydroxyls or removed altogether.
  • Each round of two carbon addition is carried out by a complex of enzymes called the polyketide synthases (PKS) in a manner similar to fatty acid biosynthesis.
  • PKS polyketide synthases
  • the biosynthetic genes for an increasing number of polyketide antibiotics have been isolated and sequenced and it is believed that the PKS genes are structurally conserved.
  • the encoded proteins generally fall into two types: type I proteins are polyfunctional, with several catalytic domains carrying out different enzymatic steps covalently linked together (e.g. PKS for eiythromycin, soraphen, and avermectin; whereas type II proteins are monofunctional.
  • coding regions involved in the individual steps of secondary metabolite biosynthesis are usually organized in the form of coding region clusters on the bacterial chromosome. It is believed that large multi-functional peptide synthetase enzymes catalyze the sequential condensation of amino acids through a thiotemplate. It is further believed that the sequence of events may be primarily determined by the spatial arrangement of catalytic domains of the protein, which include activities of the activation of the amino acid as an acyladenylate, the attachment of the amino acid as a thioester to a site on the enzyme, and the transpeptidation and formation of the peptide bond.
  • bioactive molecules synthesized via a hybrid polyketide/polypeptide biosynthetic pathway There are few examples of bioactive molecules synthesized via a hybrid polyketide/polypeptide biosynthetic pathway.
  • a locus encoding putative polypeptide/polyketide functions is mutated in a strain of Proteus mirabilis defective in swarming (Gaisser, S., et al., Mol. Gen. Genet. 253, 415-427 (1997)).
  • a polypeptide with homology to polypeptide synthetase enzymes which is believed to function in the incorporation of L-pipecolate into and cyclization of rapamycin, cooperates with the PKS largely responsible for the biosynthesis of rapamycin (Schwecke, T., et al., Proc. ⁇ atl. Acad. Sci.
  • nucleic acid molecules in accordance with the present invention can be cloned using a variety of techniques.
  • the invention provides isolated nucleic acid fragments encoding at least one polypeptide necessary for the biosynthesis of an aminopolyol antibiotic wherein the nucleic acid fragment includes at least the following: orfl, orfl, and or/3.
  • the nucleic acid fragment encodes at least one polypeptide necessary for the biosynthesis of zwittermicin A. More preferably, the nucleic acid fragment has the sequence of SEQ. ID. NO: 1.
  • a nucleic acid fragment complementary to the nucleic acid fragment encoding at least one polypeptide necessary for the biosynthesis of an aminopolyol antibiotic hybridizes to SEQ. ED. NO: 1.
  • SEQ. ED. NO: 1 contains three coding regions of the present invention, referred to as or/1, orfl, and or/3. Each individual or/is shown in isolation in the Sequence Listing at SEQ. ED. NOS: 42 (orfl), 44 (orfl), and 46 (orf 3).
  • the polypeptides encoded by these coding regions are Orfl, Orf2, and Orf3, respectively.
  • the amino acid sequences of Orfl, Orf2, and O ⁇ f3 are depicted in SEQ. ED. NOS: 43, 45, and 47, respectively.
  • These polypeptides display similarity with acyl-CoA dehydrogenases, polyketide synthases, and polypeptide synthetases, respectively.
  • One method of cloning nucleic acid fragment of the invention involves a standard technique that can be used to clone nucleic acid fragments encoding polypeptides involved in the biosynthesis of aminopolyol antibiotics is the use of transposon mutagenesis to generate "knockout" mutants; that is, an aminopolyol antibiotic-producing organism which, after mutagenesis, fails to produce the aminopolyol antibiotic.
  • transposon mutagenesis to generate "knockout" mutants; that is, an aminopolyol antibiotic-producing organism which, after mutagenesis, fails to produce the aminopolyol antibiotic.
  • one preferred transposon can be classified as a class II transposon isolated from Bacillus ssp.
  • One more preferred transposon has been designated Tn5401 and described by Baum, J., J. of Bacter., 176, 2835-2845 (1994).
  • the region of the genome responsible for aminopolyol antibiotic production is tagged by the transposon and can
  • Screening methods include, for instance, hybridization of a detectably labeled probe with a nucleic acid fragment.
  • Hybridizing conditions are appreciated by those with skill in the art, such as those described by Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, 9.47-9.55 (2 n ed, Cold Spring Harbor Laboratory Press 1989).
  • the probe does not have to be complementary to all the nucleotides of the nucleic acid fragment as long as there is hybridization under the above-stated conditions.
  • Preferred probes are nucleic acid fragments complementary to a coding region or another nucleotide sequence which plays a part in the synthesis of an aminopolyol antibiotic.
  • a probe can comprise a consecutive series of nucleotides complementary to a portion of SEQ. ED. NO: 1.
  • Methods of detectably labeling a probe are well known to the art.
  • the nucleic acid fragment that is identified by the probe is further analyzed to determine if it encodes a polypeptide involved in the biosynthesis of an aminopolyol antibiotic by, for example, polymerase chain reaction (PCR) technology.
  • PCR polymerase chain reaction
  • the antibody is directed to a polypeptide involved in the biosynthesis of zwittermicin N where the polypeptide is encoded by a nucleic acid fragment, the complement of which hybridizes to SEQ. ED. NO: 1.
  • the antibody is directed to a polypeptide involved in the biosynthesis of zwittermicin A where the polypeptide is Ofrl (SEQ. ID. NO: 43), Orf2 (SEQ. DD. NO: 45), or Orf3 (SEQ. ID. NO: 47).
  • Hybridization of a probe to a coding region present in individual wild-type microorganisms can be used as a method to identify a coding region identical or similar to a coding region present in SEQ. ID. NO: 1.
  • the coding region can then be isolated and ligated into a vector as described below.
  • Two nucleic acid sequences are "similar” if the two nucleic acid sequences can be aligned so that a percentage of corresponding residues are identical.
  • two nucleotide acid sequences have at least about 60% ⁇ , more preferably at least about 70%, most preferably at least about 80% identity when no gaps are permitted in aligning the sequences.
  • a "gap” refers to a space inserted in a nucleic acid sequence to permit better alignment of the two nucleic acid sequences being compared.
  • two nucleotide acid sequences have at least about 80%, more preferably at least about 90%, most preferably at least about 95% identity when gaps are permitted in aligning the sequences.
  • a nucleic acid fragment of the invention can be inserted in a vector.
  • Construction of vectors containing a nucleic acid fragment of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) or Ausubel, R.M., ed. Current Protocols in Molecular Biology (1994).
  • a vector can provide for further cloning (amplification of the nucleic acid fragment), i.e., a cloning vector, or for expression of the polypeptide encoded by the coding region, i.e., an expression vector.
  • vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors.
  • a vector is a vector capable of replication in a bacterial host, for instance E. coli or B. cereus.
  • the vector is a plasmid.
  • Suitable plasmids for expression in a bacterial host include, for example, pUC(X), pKK223-3, pKK233-2, pTrc99N and pET-(X) wherein (X) denotes a vector family in which numerous constructs are available.
  • pUC(X) vectors can be obtained from Pharmacia Biotech (Piscataway, ⁇ H) or Sigma Chemical Co. (St. Louis, MO).
  • pKK223-3, pKK233-2 and pTrc99A can be obtained from Pharmacia Biotech.
  • pET-(X) vectors can be obtained from Promega (Madison, WI), Stratagene (La Jolla, CA), and ⁇ ovagen (Madison, WI).
  • the vector preferably includes an origin of replication (known as an "ori") or replicon.
  • an origin of replication known as an "ori"
  • ColEl and P15A replicons are commonly used in plasmids that are to be propagated in E. coli.
  • An expression vector optionally includes regulatory regions operably linked to the coding region. "Regulatory region” refers to a nucleic acid fragment that regulates expression of a coding region to which a regulatory region is operably linked.
  • Non-limiting examples of regulatory regions include promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators.
  • "Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a regulatory element is "operably linked" to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory region.
  • the invention is not limited by the use of any particular promoter, and a wide variety are known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3' direction) coding region.
  • the promoter used in the invention can be a constitutive or an inducible promoter.
  • Preferred promoters for bacterial transformation include lac, lacUV5, tac, trc, T7, SP6, and ara.
  • An expression vector can optionally include a Shine Dalgarno site (e.g., a ribosome binding site), and a start site (e.g., the codon ATG) to initiate translation of the transcribed message to produce the enzyme. It can also include a termination sequence to end translation. A termination sequence is typically a codon for which there exists no corresponding aminoacetyl-tRNN thus ending polypeptide synthesis.
  • the nucleic acid fragment used to transform the host cell can optionally further include a transcription termination sequence.
  • the rrnB terminator which is a stretch of D ⁇ A that contains two terminators, TI and T2, is an often-used terminator that is incorporated into bacterial expression systems (J. Brosius et al., J. Mol. Biol, 148: 107-127 (1981)).
  • the nucleic acid fragment used to transform the host cell optionally includes one or more marker sequences, which typically encode a polypeptide that inactivates or otherwise detects or is detected by a compound in the growth medium.
  • a marker sequence can render the transformed cell resistant to an antibiotic, or it can confer compound-specific metabolism on the transformed cell.
  • Examples of a marker sequence are sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, and tetracycline.
  • the operon can be inserted into a vector such as pKK223-3 in transcriptional fusion, allowing the wild-type ribosome binding site of the heterologous coding regions to be used.
  • the present invention also provides for polypeptides involved in the biosynthesis of an aminopolyol antibiotic.
  • the antibiotic is zwittermicin A.
  • a polypeptide includes an amino acid sequence wherein at least a portion of the amino acid sequence is encoded by a nucleic acid fragment, such that a complement of the nucleic acid fragment hybridizes to SEQ. ED. NO: 1.
  • the polypeptides are selected from the group consisting of SEQ. ED. NO: 43, SEQ. ED. NO: 45, and SEQ. ED. NO: 47.
  • isolated nucleic acid fragments of the invention can be expressed in heterologous bacterial or fungal hosts to enable the production of the aminopolyol antibiotic with greater efficiency than might be possible from native hosts, which may increase the efficacy of a biocontrol aspect of the microorganism.
  • heterologous bacterial or fungal hosts are host cells containing a nucleic acid fragment encoding polypeptides involved in the biosynthesis of aminopolyol antibiotics, where the host cell is not the organism from which the nucleic acid fragment was isolated.
  • Isolated aminopolyol biosynthesis coding regions can also be expressed in heterologous bacterial and fungal hosts with the aim of increasing the efficacy of biocontrol strains of such bacterial and fungal hosts.
  • a "biocontrol strain,” “biocontrol agent,” or “biocontrol organism” is an organism that is capable of affecting the growth of a pathogen such that the ability of the pathogen to cause a disease is reduced.
  • a "pathogen” is an organism that causes a deleterious effect on a second organism under appropriate conditions. When the second organism is a plant, the pathogen is typically referred to as a
  • pathogen is intended to include fungi, bacteria, nematodes, viruses, viroids, and insects.
  • Biocontrol agents for plants include microorganisms which are capable of colonizing plants or the rhizosphere. Organisms may act as biocontrol agents in their native state or when they are modified to express an aminopolyol antibiotic, preferably zwittermicin A.
  • Biocontrol agents can be modified to express an aminopolyol antibiotic, wherein the biocontrol agent is a microorganism which is capable of colonizing plants or the rhizosphere. Such microorganisms can be brought into contact with phytopathogenic fungi, phytopathogenic bacteria and phytopathogenic nematodes. Preferably, contact with a biocontrol agent inhibits the growth of a phytopathogen.
  • Suitable biocontrol agents that can be modified include gram-negative microorganisms such as Pseudomonas, Enterobacter and Serratia, the gram-positive microorganism Bacillus and the fungi Trichoderma and Gliocladium.
  • Bacillus ssp. containing a mutation, preferably a single insertion mutation, within an aminopolyol antibiotic pathway can be applied directly to an area to be cultivated can act as a biocontrol agent.
  • the Bacillus ssp. contains a mutation such that the mutant Bacillus ssp. produces the aminopolyol in an amount greater than the wild type Bacillus ssp.(i.e., the same Bacillus ssp. that does not contain the mutation), as determined by a zone of inhibition assay based on Erwinia herbicola (defined in detail in the Examples).
  • the microorganism produces the aminopolyol in an amount greater than about 1.1 times that of the wild type microorganism, and more preferably in an amount of about 2 times greater than the wild type microorganism.
  • the mutant Bacillus ssp. is R. cereus containing a single insertion mutation within a portion of the genome encoding a transcriptional regulator, preferably including a nucleic acid fragment comprising SEQ. ED. NO: 29.
  • the biocontol agent is a homologous host with respect to the nucleic acid fragment encoding the desired affect, i.e., the nucleic acid fragment is derived from Bacillus.
  • the nucleic acid fragment containing the mutation might be derived from Bacillus cereus and the biocontol agent might be Bacillus subtilis or Bacillus cereus including the mutant nucleic acid fragment.
  • heterologous hosts can also be used and suitable hosts are Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas cepacia, Pseudomonas aureofaciens, Pseudomonas aurantiaca, Enterobacter cloacae, Serratia marscesens, Trichoderma viride, Trichoderma harzianum, and Gliocladium virens.
  • the nucleic acid fragments of the present invention are transferred to a preferred heterologous host listed above.
  • the biosynthetic coding regions for zwittermicin A are transferred to and expressed in Pseudomonas fluorescens strain CGA267356 (described in U.S. Pat. No. 5,348,742), which has biocontrol utility due to its production of pyrrolnitrin.
  • the nucleic acid fragments are transferred to Pseudomonas aureofaciens strain 30-84, which has biocontrol characteristics due to its production of phenazine.
  • Expression in heterologous bacterial or fungal hosts requires the selection of vectors appropriate for replication in the chosen host and a suitable choice of promoter. Techniques are well known in the art for expression in gram-negative and gram-positive bacteria and fungi and are described herein.
  • Nucleic acid fragments of this invention can be expressed in plants, preferably transgenic plants, thus causing the biosynthesis of an aminopolyol antibiotic, such as zwittermicin A. In this way, transgenic plants with enhanced resistance to phytopathogenic fiingi, phytopathogenic bacteria and phytopathogenic nematodes are generated.
  • the nucleic acid fragments of the present invention may be modified in ways known to one of skill in the art to optimize their expression in transgenic plants. For instance, it is known in the art that all organisms have specific preferences for codon usage, and the codons of the coding regions of the invention can be changed to conform with plant preferences while maintaining the amino acid sequence of the encoded polypeptide.
  • High expression of transgenic coding regions in plants is best achieved from coding regions having at least 35%> GC content, and preferably more than 45%>.
  • Changes to nucleic acid fragments and coding regions described herein can be made using well known techniques of site directed mutagenesis, PCR, and synthetic gene construction. See, e.g., U.S. Patent 5,716,849 (Ligon et al.), which describes that preferred nucleotide sequences may be modified to account for the specific codon preferences and/or GC content preferences of monocotyledons or dicotyledons to increase coding region expression.
  • Dicot and monocot plants that can be genetically manipulated can be used in the present invention.
  • a plant that can be genetically manipulated is a plant into which foreign coding regions can be introduced, expressed, stably maintained, and transmitted to subsequent generations of progeny.
  • Transgenic plants may be obtained from transgenic seeds set by parental transgenic plants.
  • Methods of making a transgenic plant of the invention typically involve the transformation of a cell of a plant with a nucleic acid fragment comprising a coding region encoding a polypeptide involved in aminopolyol biosynthesis.
  • the nucleic acid fragment is typically present on a vector.
  • the vector can replicate autonomously, i.e., extrachromosomally, which can allow for high numbers of the vector to be maintained and potentially result in higher polypeptide production, or can be integrated into the genomic DNA.
  • the vector is integrated into the genomic DNA of a plant cell.
  • Vectors are preferably circular, but can be linear.
  • a coding region present in a nucleic acid fragment of the invention is typically flanked by operably linked regulatory regions that regulate expression of a coding region in a transformed plant cell.
  • a typical regulatory region operably linked to the coding region includes a promoter.
  • the invention is not limited by the use of any particular promoter, and a wide variety are known. Plant-specific promoters are preferred. These include, but are not limited to, constitutive promoters, inducible promoters, and tissue-specific promoters. It can be, but need not be, heterologous with respect to the host. Promoters may be obtained from Ti- or Ri-plasmids, from plant cells, plant viruses or other hosts where the promoters are found to be functional in plants.
  • Illustrative promoters include the octopine synthetase promoter, the nopaline synthase promoter, the manopine synthetase promoter, etc., as illustrative of promoters of bacterial origin functional in plants.
  • Viral promoters include the cauliflower mosaic virus full length (CaMV35S) and region VI promoters, etc.
  • Endogenous plant promoters include the ribulose-l,6-biphosphate (RUBP) carboxylase small subunit (ssu) promoter, the b -conglycinin promoter, the phaseolin promoter, the ADH promoter, GPAL2 promoter, GPAL3 promoter, heat-shock promoters, tissue specific promoters, e.g., promoters associated with fruit ripening, etc.
  • RUBP ribulose-l,6-biphosphate
  • su carboxylase small subunit
  • a suitable promoter is selected from the group consisting of a wound inducible promoter, a green tissue specific promoter, a root specific promoter, a stem specific promoter, and a flower specific promoters.
  • Another typical regulatory region operably linked to a coding region includes a terminator, i.e., a nucleic acid fragment that can cause the termination of transcription of the exogenous coding region, present 3' of the exogenous coding region.
  • a terminator i.e., a nucleic acid fragment that can cause the termination of transcription of the exogenous coding region, present 3' of the exogenous coding region.
  • the invention is not limited by the use of any particular terminator, and a wide variety are known. Plant-specific terminators are preferred. These include, but are not limited to, a nopaline synthase terminator derived from the Agrobacterium tumefaciens Ti plasmid (nos ter).
  • nucleotide sequences 5' to the initiating coding of the polypeptide encoded by the coding region can be modified to increase expression. Modifications include the inclusion of sequences known to be effective in plants. For instance the sequence GTCGACCATGGTC (SEQ. ID. NO: 36) (Joshi, Nuc. Acids Res., 15:6643- 6653 (1987)) has been suggested as a consensus translation initiator for the expression of the E. coli-uidA coding region in plants.
  • Another potential translation initiation sequence that can be used adjacent to the initiating codon is AAACAATGGCT (SEQ. ED. NO: 37) (Joshi, Nuc. Acid Res., 15:6643-6653 (1987)). These translation initiation sequences may be used with the coding regions of the invention. The sequences are incorporated into the nucleic acid fragment upstream of the initiating codon.
  • Synthesis of a aminopolyol antibiotic, such as zwittermicin N in a transgenic plant will frequently require the simultaneous overexpression of multiple genes encoding the aminopolyol antibiotic biosynthetic enzymes. This can be achieved by transforming the individual aminopolyol biosynthetic coding regions into different plant lines individually, and then crossing the resultant lines. Selection and maintenance of lines carrying multiple coding regions is facilitated if each the various transformation constructions utilize different selectable markers. A line in which all the required aminopolyol biosynthetic coding regions are present will synthesize the aminopolyol antibiotic, whereas other lines will not. This approach may be suitable for hybrid crops such as maize in which the final hybrid is necessarily a cross between two parents.
  • a variety of techniques are available for the introduction of the nucleic acid fragment into a plant cell.
  • the particular manner of introduction of the nucleic acid fragment into the host cell is not critical to the practice of the present invention, and any method which provides for efficient transformation may be employed.
  • alternative methods can be used for the introduction of the nucleic acid fragment into a plant cell.
  • Such conventional methods may include, for example, the use of liposomes, transformation using viruses or pollen, chemicals that increase the direct uptake of DNN microinjection, electroporation, or high-velocity microprojectiles.
  • tissue source or cultured plant cells for transformation will depend on the nature of the host plant and the transformation protocol.
  • Useful tissue sources include callus, suspension culture cells, protoplasts, leaf segments, stem segments, tassels, pollen, embryos, hypocotyls, tuber segments, meristematic regions, and the like.
  • the tissue source is regenerable, in that it will retain the ability to regenerate whole, fertile plants following transformation.
  • the transformation is carried out under conditions directed to the plant tissue of choice. Buffers and media used will also vary with the plant tissue source and transformation protocol.
  • the plant cells or tissue may be cultivated for varying lengths of time prior to selection, or may be immediately exposed to a selective agent such as those described hereinabove. Protocols involving exposure to Agrobacterium may also include an agent inhibitory to the growth of the Agrobacterium cells. Commonly used compounds are antibiotics such as cefotaxime and carbenicillin.
  • the media used in the selection may be formulated to maintain transformed callus or suspension culture cells in an undifferentiated state, or to allow production of shoots from callus, leaf or stem segments, tuber disks, and the like.
  • Cells or callus observed to be growing in the presence of normally inhibitory concentrations of the selective agents are presumed to be transformed and may be subcultured several additional times on the same medium to remove non-resistant sections.
  • the cells or calli can then be assayed for the presence of the nucleic acid fragment, or may be subjected to known plant regeneration protocols.
  • those shoots appearing on the selective media are presumed to be transformed and may be excised and rooted, either on the selective medium suitable for the production of roots, or by simply dipping the excised shoot in a root-inducing compound and directly planting it in vermiculite. Production of Aminopolyol Antibiotics.
  • the present invention also provides methods for obtaining aminopolyol antibiotics such as zwittermicin A from heterologous hosts transformed with the appropriate aminopolyol biosynthetic coding regions.
  • aminopolyol antibiotics may be effective in the inhibition of growth of microbes, particularly phytopathogenic microbes.
  • the aminopolyol antibiotics can be produced from organisms in which the aminopolyol biosynthetic coding regions have been overexpressed, and suitable organisms for this include gram-negative and gram-positive bacteria and yeast, as well as plants.
  • the significant criteria in the choice of host organism are its ease of manipulation, rapidity of growth (i.e.
  • the aminopolyol antibiotic is typically produced by the biocontrol agent of the present invention.
  • the composition is a suspension or concentrate of the biocontrol agent.
  • the active ingredient is homogeneously mixed with one or more compounds or groups of compounds described herein.
  • the present invention also relates to methods of treating plants, which comprise application of the composition to plants.
  • the active ingredients of the present invention are normally applied in the form of compositions and can be applied to the crop area or plant to be treated, simultaneously or in succession, with further compounds.
  • These compounds can include fertilizers or micronutrient donors, selective herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides or mixtures of several of these preparations.
  • the compositions can further include carriers, surfactants, and adjuvants. A description of the formulation of antipathogenic compositions can be found in U.S. Patent 5,716,849.
  • E. coli strains were grown at 37°C on Luria-Bertani (LB) broth or agar. Unless otherwise indicated, Bacillus strains were grown at 28°C on 50% trypticase soy broth (TSB) or agar (TSA) (Difco Laboratories, Detroit, MI).
  • TTB trypticase soy broth
  • TSA agar
  • the media 100MH8.1 was prepared by amending Mueller-Hinton medium (Difco) with 40 mM 3-(morpholino)propane-sulfonic acid (MOPS) and 40 mM tris(hydroxymethyl)aminomethane (Tris) and adjusting the pH to 8.1 with NaOH.
  • Antibiotics were added at the following levels for E. coli: ampicillin, 50 mg/L; spectinomycin, 100 mg/L; chloramphenicol, 12 mg/L, and at the following levels for Bacillus: spectinomycin, 150 mg/L or 200 mg/L; eiythromycin, 10 mg/L; chloramphenicol 5 mg/L. Table 1. Bacterial strains and plasmids used in this study Strain or plasmid Description Source or reference
  • Em r Plasmid confers resistance to erythromycm
  • Plasmid DNA was isolated from strains of E. coli using Wizard minipreps (Promega Corp , Madison, WI) or Qiagen (Chatsworth, CA) plasmid kits Plasmid DNA was isolated from strains of Bacillus using a modified alkaline lysis extraction described elsewhere (Milner et al , 1996) Total genomic DNA was isolated from R.
  • SEQ. ID. NO: 1 shows the 3,934- nucleotide sequence of the zm R-flanking region, which includes the previously published nucleotide sequence of a 1.2-kb Sphl-BamHl fragment (bases 1438 to 2665). Analysis of the sequence, applying codon usage typical of Bacillus spp., identified three open reading frames (orfs) having the same orientation of transcription as zmaR. Two orfs were identified upstream of zmaR, and one orf was identified downstream. The three open reading frames, or/7 (bases 338 to 1486 of SEQ. ED. NO: 1), orfl, (bases 2630 to 3847 of SEQ.
  • ED. NO: 1 and orf 3, (bases 78 to 341 of SEQ. ED. NO: 1) all have putative ribosome binding sites 7 to 9 bp upstream of the potential ATG translational start sites.
  • Orfl, orf 3, and zmaR terminate with a TGA stop codon.
  • Orfl terminates with a TAG stop codon.
  • the TGA stop codon of orf 3 overlaps the ATG start codon of orfl, and is shifted one reading frame in relation to orfl.
  • a similar overlapping structure is apparent for the TGA stop codon of orfl and ATG start codon of zmaR.
  • the ATG start codon of orfl is 20 bases downstream of the TGA stop codon of zmaR.
  • Orfl SEQ. ID. NO: 43
  • Orfl has a high degree of sequence similarity to acyl-CoA dehydrogenase enzymes from diverse organisms, including B.
  • Acyl-CoA dehydrogenases are typically involved in the oxidative breakdown of fatty acids. Non-polyketide synthase- associated enzymic activities, such as dehydrogenases (Brown et al., 1996) and methyltransferases (Molnar et al, 1996) have also been implicated in the production of polyketides. Therefore Orfl, which has sequence similarity to acyl-CoA-dehydrogenases, is likely also involved in the biosynthesis of zwittermicin A.
  • Orf2 is predicted to encode a 45.6 kDa protein (SEQ. YD. NO: 45) with a predicted isoelectric point of 5.3.
  • Orf 2 has sequence similarity to both polyketide and fatty acid synthase enzymes over parts of the predicted protein sequence.
  • Orf2 has 36% to 60% nucleotide identity 51% to 75% amino acid similarity to polyketide synthase enzymes (Schwecke et al, 1995), and 37% to 48% nucleotide identity, 55% to 74% amino acid similarity to fatty acid synthase enzymes, specifically the acyltransferase portion of polyketide synthases and the transacylase of fatty acid synthases.
  • the region of homology includes active site sequences (bases 2897 to 291 1 of SEQ. ED. NO: 1, which correspond to residues 90-94 of the amino acid sequence shown in SEQ. ED. NO: 45) identified for acyltransferases (AT), transacylases, and thioesterases (Cortes et al., 1990).
  • AT acyltransferases
  • transacylases transacylases
  • thioesterases Cortes et al., 1990.
  • Orf2 protein has high sequence similarity to the acyltransferase domain of only type I PKSs, the orfl gene appears to encode a single polypeptide, suggesting that it may have more in common with the monofunctional type II PKS enzymes.
  • Orf3 is predicted to encode a 10.2 kDa protein (SEQ. ED.
  • Orfl has regions of sequence similarity to polypeptide synthetase enzymes, including gramicidin S synthetase (Turgay et al, 1992) and surfactin synthetase (Cosmina et al, 1993). The known active sites of these enzymes are not included in the region of homology. Polypeptide synthetase enzymes activate and catalyze the formation of peptide bonds between successive amino acids via a thiotemplate mechanism (Marahiel, 1992). As polypeptide synthetase enzymes are typically large, it was surprising that orf 3 is predicted to encode a small protein.
  • Orf3 protein may be a unique sort of polypeptide synthetase enzyme (similar to what is observed with the type I versus II polyketide synthetases, where the peptide synthetases are generally large, multifunctional enzymes).
  • Example 2
  • pGEMdSH was constructed by digesting pGEM-3Zf(+) (Promega Corp.) with Sm ⁇ l and Hindlll, creating blunt ends with Klenow enzyme, and self-ligating the DNA.
  • a 5.5-kb EcoRl fragment from HM11 containing orfl, zmaR, and orfl was subcloned into pGEMdSH, yielding pZM ⁇ 5.5. It is believed that HMl 1 does not likely contain the entire biosynthetic pathway because sequence analysis indicated that the very end of the insert appears to contain biosynthetic pathway sequence.
  • the strategy for creating a plasmid construct for insertional inactivation of zmaR was to delete 754 bp of DNA internal to zmaR and insert a 1.2-kb spectinomycin resistance (Sp r ) cassette from plasmid pDG1726 (Table 1) in the same transcriptional orientation as zmaR at the site of the deletion.
  • pZMG6 was digested with Bglil and Blpl, blunt-ended with Klenow, and ligated to a 1.2-kb, blunt-ended PstY fragment containing the (Sp r ) cassette, yielding pZMG6S+.
  • the plasmid pAorfl was constructed by digesting pZM ⁇ 6R with Bglll and Hindlll, gel-purifying the 1.7-kb fragment containing orfl, and ligating this to R ⁇ mHI/Hw ⁇ II-digested and CEP-treated vector p ⁇ T304 (Table 1).
  • the strategy for creating a plasmid construct for insertional inactivation of orfl was to delete 881 bp of DNA internal to orfl, and insert a Sp r cassette in the same transcriptional orientation as orfl at the site of the deletion.
  • pZME5.5 was digested with R ⁇ mHI and EcoKV and ligated to the Sp r cassette prepared as described above, yielding pZME5.5 ⁇ or/2. Clones were sequenced with primer 1721 to identify constructs with the Sp r cassette in the same predicted transcriptional orientation as orfl. The EcoRl fragment from pZM ⁇ 5.5 ⁇ or/2 was ligated into pl4B', yielding p ⁇ or/2 (Fig. 3).
  • Plasmid p AzmaR or p ⁇ or/2 was transformed into B. cereus UW85. Cultures were grown without antibiotic selection at 42°C, a non-permissive growth temperature for pl4B'-derived plasmids. Putative single integrants were identified by plating at 42°C on media containing chloramphenicol and spectinomycin, and integration was confirmed by Southern blot analysis. Single integrants were grown without antibiotic selection for 48 hours at 42°C with repeated subculturing to promote excision and loss of the plasmid, and plated on non-selective media.
  • UW85 ⁇ zm ⁇ R was sensitive to zwittermicin A; UW85 Aorfl was resistant to zwitte ⁇ nicin N as determined by radial streak assay.
  • UW85 ⁇ or/2 did not produce detectable zwittermicin N as shown by a plate assay for inhibition of Erwinia herbicola and direct isolation of zwittermicin A from culture supernatants, whereas UW85 ⁇ zm R did produce zwittermicin A (Table 3).
  • Zwittermicin A resistance to 300 ⁇ g of zwittermicin A was measured by radial streak assay on at least three independent cultures. R (resistant) indicates no zone of inhibition; S
  • ⁇ Zwittermicin A production was measured by bioassay against a lawn of Erwinia herbicola and by biochemical purification of zwittermicin A using Sep-Pak cation exchange columns and subsequent high-voltage paper electrophoresis. The results reported are representative of at least three independent cultures.
  • c pZMS7 contains zmaR in plasmid pHT304.
  • d pORF2 contains orfl in plasmid pHT304. When zmaR was introduced in trans on plasmid pZMS7, it restored zwittermicin A resistance to UW85 ⁇ z7w ⁇ R (Table 3).
  • pHT304 the plasmid vector, does not confer zwittermicin A resistance on sensitive strains of B. cereus (Milner et al., 1996).
  • orfl was introduced in trans on plasmid pORF2, it restored zwittermicin A production to UW85 ⁇ or/2.
  • pHT304 did not restore zwittermicin A production to UW85 ⁇ or/2 (Table 3). Together the data indicate that zmaR is necessary for zwittermicin A resistance, and that orfl is necessary for zwittermicin A production.
  • the sample was incubated at 30°C for 15 minutes after the addition of 0.6 mg lysozyme and 2.5 mL 1% Triton X-100 to the sample.
  • Cells were disrupted by sonication and inclusion bodies were purified initially as described previously (Milner et al., 1996). Inclusion bodies were further purified by repeated washing with increasing concentrations of urea, and were subsequently solubilized in 5 mL 8 M urea, 1%) SDS, 20 mM Tris-acetate pH 8.0. After addition of 5x SDS sample buffer, the sample was stored at -20°C. Inclusion bodies were further purified on preparative 12% polyacrylamide gels, prepared and run by standard methods (Laemmli, 1970).
  • Protein was visualized by staining the gel with cupric chloride (Deutscher, 1990), and the 43.5-kDa protein band was excised from the gel and stored at 4°C. Protein was electroeluted from the gel using a undirectional electroelutor as directed by the operating manual (EBI, New Haven, CT). Protein concentration and buffer exchange to 20 mM Tris (pH 8.0) was achieved through ultrafiltration using Centriplus MWCO10 and Centricon 10 columns (Amicon, Inc., Beverly, MA). Protein concentration was determined by the bicinchoninic acid assay (Pierce Chemicals, Rockford, IL) (Smith et al., 1985).
  • coli DH5r ⁇ FTQ (Stratagene, La Jolla. CA) carrying pGEM- 3Zf(+) and cell extracts of B. cereus UW030 prepared by standard methods (Harlow and Lane, 1988). Isolation of total protein from B. cereus. Three milliliters of culture was pelleted by centrifugation (16,000 xg, 5 min), and the supernatant was removed. Pellets were resuspended in 200 mL protein extraction buffer (10 mM Tris-Cl (pH 8.0), 100 mM EDTN 100 mM DTT, 1% SDS), 50 mL 0.1 mm silica beads were added, and samples were agitated for 4 min at room temperature.
  • protein extraction buffer (10 mM Tris-Cl (pH 8.0), 100 mM EDTN 100 mM DTT, 1% SDS), 50 mL 0.1 mm silica beads were added, and samples were agitated for 4 min at room temperature.
  • Zwittermicin A was identified in culture supernatants of sporulated cultures of R. cereus UW85 and UW85- derived mutant constructs by cation exchange chromatography using CM SEP-PAK cartridges (Millipore) followed by high voltage paper electrophoresis (HVPE) as described elsewhere (Milner et al., Appl. Microbiol. Biotechnol. 43:685-691 (1995)).
  • Zwittermicin A production was also tested in a plate bioassay for inhibition of Erwinia herbicola LS005 (Silo-Suh et al, 1994) with the modifications that 0.1% TSA plates were used, and plates were incubated for 24 h at 28°C before scoring for the presence or absence of a zone of inhibition.
  • the zwittermicin A-resistance phenotype of strains of E. coli and R. cereus was determined by radial streak assay on 100MH8.1 agar using 100 mg and 300 mg of zwittermicin A for each organism, respectively, as described elsewhere (Milner et al., 1996).
  • ZmaR in B. cereus UW85 and UW85 AzmaR.
  • B. cereus UW85 and UW85 ⁇ zm R To determine the pattern of expression of ZmaR in B. cereus UW85 and UW85 ⁇ zm R, we performed a western blot analysis. From the nucleotide sequence of zm ⁇ R and the expression of ZmaR inE. coli (Milner et al., 1996), ZmaR was predicted to migrate as a 43.5 kDa protein. A 43.5 kDa band was detected in cell extracts of UW85, but not in UW85 ⁇ zm ⁇ R, the mutant in which zm ⁇ R had been deleted.
  • the plasmid pEG922 (Baum, J., J. Bact., 176, 2835-2845 (1994)) was transformed into Bacillus cereus 101C using the method of Silo-Suh et al., Appl. Environ. Micro., 60, 2023-2030 (1994).
  • the plasmid pEG922 is a shuttle vector containing a Gram-positive origin of replication and carries the Tn5401 transposable element.
  • Bacillus cereus 10 IC is a derivative ofR. cereus UW85 that has been subjected to Tn917 mutagenesis and is lacking the native plasmid, pBC85. See, Silo-Suh, L.N, Ph.D. thesis (1994).
  • Transformants were selected on half-strength tryptic soy agar (TSA) containing 10 ⁇ g/ml tetracycline. Plasmid preparations were performed to confirm the presence of pEG922 in the 101C selected transformants. To construct Tn5401 mutants in 101C, individual colonies of 101C carrying pEG922 were inoculated into half-strength tryptic soy broth (TSB) containing 10 ⁇ g ml tetracycline and the cultures were grown overnight at 28°C.
  • TSA half-strength tryptic soy agar
  • TAB half-strength tryptic soy broth
  • coli DH5 cells and transformants were selected on LB agar containing 5 ⁇ g/ml tetracycline. Using this method, the transposon and flanking DNA was cloned out for the five mutants 11.35, 32.18, 56.34, 64.27, and 89.3. PCR sequencing was performed using primers synthesized by the University of Wisconsin
  • Biotechnology Center designed to each end of the transposon Tn5401 and reading into the unique Hpal site of Tn5401 and used in the following pairs:
  • P2 CCCAGAAGAAGTAAAAGATGGG SEQ. ED. NO: 40
  • P4 CCACCTGCGAGTACAAACTGG SEQ. ID. NO: 41
  • PI and P2 were complementary to the ends of Tn5401 and P3 and P4 were complementary to a region surrounding the unique, internal Hpal site.
  • Genomic DNA from each mutant was used as a template for PCR amplification using Taq Plus Long polymerase from Stratagene, La Jolla, CN PCR conditions were as follows: initial hot melt at 95°C for 3 min., followed by 30 cycles of 30 sec. At 95°C, 30 sec. At 55°C, and 5 min. at 72°C, and a final extension at 72°C for 7 min.).
  • PCR products were obtained for each of the five mutants. For mutants 52.6 and 78.24, only one PCR product was obtained with the P2 - P4 primer set. For mutants 96.3, 101.19, and 120.4, PCR products were obtained with primer sets PI - P3 and P2 - P4.
  • the PCR products were purified from the reaction mix using a purification kit commercially available under the trade designation QIAQUICK PCR Purification Kit, from Qiagen Inc., Valencia, CA.
  • Cycle sequencing was then performed using these purified PCR products as a template to generate sequence information, that was subsequently compared to non-redundant GenBank sequences, and the BLAST results are shown herein for the mutants 11.35, 32.18, 52.6, 56.34, 64.27, 78.24, 89.3, 96.3, 101.19, and 120.4.
  • the following table summarizes the homology for each mutant identified by BLAST.

Abstract

La présente invention concerne une construction d'ADN isolée codant les enzymes nécessaires à la biosynthèse de la zwittermicine A, un antibiotique d'aminopolyol unique produit par le Bacillus cereus présentant une activité vis-à-vis de diverses bactéries et des eucaryotes inférieurs. L'invention concerne également des hôtes transformés pour contenir et exprimer la construction d'ADN, et un procédé de production de zwittermicine A mettant en oeuvre ladite construction et les hôtes transformés.
PCT/US2000/007570 1999-03-23 2000-03-22 Genes de zwittermicine a a partir de bacillus cereus WO2000058351A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2000608050A JP2003528569A (ja) 1999-03-23 2000-03-22 バチルス・セレアス由来のゼッターマイシンａの生合成遺伝子
EP00950199A EP1163347A2 (fr) 1999-03-23 2000-03-22 Genes de zwittermicine a a partir de bacillus cereus
AU63337/00A AU6333700A (en) 1999-03-23 2000-03-22 Zwittermicin a biosynthetic gene from bacillus cereus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12576999P 1999-03-23 1999-03-23
US60/125,769 1999-03-23

Publications (2)

Publication Number Publication Date
WO2000058351A2 true WO2000058351A2 (fr) 2000-10-05
WO2000058351A3 WO2000058351A3 (fr) 2001-10-04

Family

ID=22421339

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/007570 WO2000058351A2 (fr) 1999-03-23 2000-03-22 Genes de zwittermicine a a partir de bacillus cereus

Country Status (4)

Country Link
EP (1) EP1163347A2 (fr)
JP (1) JP2003528569A (fr)
AU (1) AU6333700A (fr)
WO (1) WO2000058351A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080254508A1 (en) * 2007-04-12 2008-10-16 Thomas Michael G Type i polyketide synthase extender units

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8437622B2 (en) 2011-08-23 2013-05-07 Echostar Technologies L.L.C. Altering presentation of received content based on use of closed captioning elements as reference locations

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008504A1 (fr) * 1994-09-12 1996-03-21 Wisconsin Alumni Research Foundation Gene de resistance a la zwittermicine et bacterie de lutte biologique possedant ce gene
WO1996039532A1 (fr) * 1995-06-06 1996-12-12 Wisconsin Alumni Research Foundation Nouvelle souche as4-12 de bacillus cereus
WO1996039483A1 (fr) * 1995-06-06 1996-12-12 Wisconsin Alumni Research Foundation Nouvelle souche dga34 de bacillus cereus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008504A1 (fr) * 1994-09-12 1996-03-21 Wisconsin Alumni Research Foundation Gene de resistance a la zwittermicine et bacterie de lutte biologique possedant ce gene
WO1996039532A1 (fr) * 1995-06-06 1996-12-12 Wisconsin Alumni Research Foundation Nouvelle souche as4-12 de bacillus cereus
WO1996039483A1 (fr) * 1995-06-06 1996-12-12 Wisconsin Alumni Research Foundation Nouvelle souche dga34 de bacillus cereus

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CUNDLIFFE E: "HOW ANTIBIOTIC-PRODUCING ORGANISMS AVOID SUICIDE" ANNUAL REVIEW OF MICROBIOLOGY, 1989, pages 207-234, XP000979961 ISSN: 0066-4227 *
MILNER JOCELYN L ET AL: "Zwittermicin a resistance gene from Bacillus cereus." JOURNAL OF BACTERIOLOGY, vol. 178, no. 14, 1996, pages 4266-4272, XP002159148 ISSN: 0021-9193 *
STOHL E A ET AL: "Zwittermicin A biosynthetic cluster" GENE,NL,ELSEVIER BIOMEDICAL PRESS. AMSTERDAM, vol. 237, no. 2, 17 September 1999 (1999-09-17), pages 403-411, XP004183533 ISSN: 0378-1119 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080254508A1 (en) * 2007-04-12 2008-10-16 Thomas Michael G Type i polyketide synthase extender units
US8759031B2 (en) * 2007-04-12 2014-06-24 Wisconsin Alumni Research Foundation Type I polyketide synthase extender units

Also Published As

Publication number Publication date
JP2003528569A (ja) 2003-09-30
EP1163347A2 (fr) 2001-12-19
AU6333700A (en) 2000-10-16
WO2000058351A3 (fr) 2001-10-04

Similar Documents

Publication Publication Date Title
US5679560A (en) Genes for the synthesis of antipathogenic substances
CN108330116B (zh) 除草剂耐受性蛋白质、其编码基因及用途
US7888493B2 (en) Bacterial strains, genes and enzymes for control of bacterial diseases by quenching quorum-sensing signals
CN113461789B (zh) 一种来源于伯克霍尔德氏菌的LysR家族转录调控蛋白、基因及应用
US7700827B2 (en) Metal resistant plants and phytoremediation of environmental contamination
WO1997001572A1 (fr) Sequences pour la production de la 2,4-diacetylphloroglucinol et procedes d'utilisation
KR20200106171A (ko) 스타필로코쿠스 박테리아의 영양 요구성 균주
AU778146B2 (en) Biological control of nematodes
US6280722B1 (en) Antifungal Bacillus thuringiensis strains
AU2000276976A1 (en) Bacterial strains, genes and enzymes for control of bacterial diseases by quenching quorum-sensing signals
WO2000058351A2 (fr) Genes de zwittermicine a a partir de bacillus cereus
JP2011103864A (ja) デオキシニバレノール及びニバレノールの分解活性を有するタンパク質をコードする遺伝子
DK2142638T3 (en) Process for the production of secondary metabolites
CN106794232B (zh) 修饰的vip3多肽
Kim et al. Identification of genes for biosynthesis of antibacterial compound from Pseudomonas fluorescens Bl6, and its activity against Ralstonia solanacearum
JP5054267B2 (ja) 新規トキシン
JP2003093069A (ja) リゾビトキシン生産遺伝子ｒｔｘＣ
Zhang et al. Involvement of gacA gene in the suppression of tomato bacterial wilt by Pseudomonas fluorescens FPT9601
US6399858B1 (en) Chitinase gene from stenotrophomonas maltophilia
JP4431581B2 (ja) 植物に植物病原菌及び害虫に対する多重抵抗性を誘導するタンパク質
Yong-Sung Molecular characterization of biosynthetic genes of an antifungal compound produced by Pseudomonas fluorescens MC07
EP1930440A1 (fr) Souches, gènes et enzymes de bactéries pour le contrôle de maladies bactériennes par désactivation des signaux de mesure de quorum
Arrebola-Díez et al. Genes Involved in the Production of Antimetabolite Toxins by Pseudomonas syringae Pathovars.
Streit et al. Are Key Growth Factors for Alfalfa Root Colonization by Rhizobium meliloti 1021
KR20120129835A (ko) 토양 메타게놈 유래의 식물병 저항성 관련 유전자 및 이의 용도

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref country code: JP

Ref document number: 2000 608050

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2000950199

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000950199

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000950199

Country of ref document: EP