WO1999002174A1

WO1999002174A1 - Non-human pdgf-b-deficient transgenic animals with reduced or non-existent numbers of pericytes

Info

Publication number: WO1999002174A1
Application number: PCT/US1998/012572
Authority: WO
Inventors: Per Lindahl; Per Leveen; Christer Betsholtz
Original assignee: Ludwig Institute For Cancer Research
Priority date: 1997-07-11
Filing date: 1998-06-17
Publication date: 1999-01-21
Also published as: AU8147398A

Abstract

Transgenic animals, preferably mice, having a phenotype characterized by the absence of pericytes, otherwise naturally present in the animal, are disclosed. In particular, the transgenic mouse carries a disruption of a gene encoding PDGF-B such that levels of PDGF-B are at a reduced or non-existent level. The disruption of the gene causes a loss in the number of pericytes, which, in turn, results in damage to the microvessels of the animal. The results suggest that the animal may be used as a model for studying diabetic vascular disease and other vascular related diseases.

Description

Non-Human PDGF-B-deficient Transgenic Animals With Reduced or Non-

Existent Numbers of Pericytes

FIELD OF THE INVENTION The present invention provides for transgenic animals having a targeted disruption of the gene encoding PDGF-B. As a consequence of the gene disruption, pericytes fail to develop either in whole or in part. The resulting absence or reduction in the number of pericytes in turn results in damage to the microvessels of the animal. In a preferred embodiment, the damage includes the formation and rupture of microaneurysms in the capillaries of the animal. It is preferred that the animal be a rodent, such as a mouse. The transgenic mouse is useful as a model system for studying diabetes vascular disease.

BACKGROUND AND PRIOR ART

In higher animal cells, the interaction between ligands such as peptide hormones, growth factors and their cognate receptors is of great importance in the transmission of and response to a variety of extracellular signals. Indeed, growth factors and their receptors play an important role in the regulation of cell division, development, and differentiation.

Growth factors exert their biological effects by interacting with high-affinity receptors located on the plasma membrane. This interaction, in turn, triggers the activation of a number of signal transduction pathways, whose end point resides in the regulation of gene expres sion.

The major biological consequence of the interaction between a growth factor and its cognate receptor growth factor action is the induction of DNA synthesis.

The role of PDGF in cell differentiation is well characterized in the prior art. For a brief review, see Betsholtz, "Role of platelet-derived growth factors in mouse development" Int. J. Dev. Biol. 39:817-825 (1995), which is incorporated by reference.

PDGF was first recognized as a component of platelet α granules, which had growth promoting activity for smooth muscle cells and fibroblasts (Heldin et al., CellRegl. 1: 555-566

(7-90)). It has also been implicated in the stimulation of connective tissue - derived cells in vitro (Ostman et al., J. Biol. Chem. 263 (31): 16202-16208 (11-88)), as the major mitogenic protein for mesenchymal cells (Murray et al. , U.S. Patent Nos. 4,889,919 and 4,845,075), and as an inducer of cell multiplication and DNA synthesis in cultured muscle cells, fibroblasts and glial cells (Kelly et al., PCT Application WO 90/14425 (11-29-90)). It has also been shown to be involved in the wound healing response (Ross et al., N. Eng. J. Med. 295: 369 (1976)), and may be involved in a causative role for the development of proliferative lesions of atherosclerosis (Ross, supra). Others have suggested that this molecule may be a mediator of tumor development, as well as, in non-malignant proliferative disorders (Heldin et al., supra). Thus, PDGF besides being mitogenic is also known to stimulate numerous cell functions, such as cell migration, contraction, survival and the production of extracellular matrix molecules. The PDGF molecule has been very well characterized. It is known to exist as a heterodimer of an "A" chain and a "B" chain, connected to each other via disulfide bonds. The dimer, sometimes referred to as "PDGF-AB," has a mass of about 30 kDa. Amino acid sequences are known for both the A and B chains, as shown, e.g., by Murray et al., U.S. Patent Nos. 4,889,919 and 4,848,075, the disclosures of which are incorporated by reference. The mature chains contain slightly more than 100 amino acids, and are about 60% homologous. Heldin et al., supra.

Dimer PDGF-AA and PDGF-BB have been produced via recombinant means, and have also been isolated from natural sources (see Murray et al., supra; Heldin et al., supra). The various dimers, or "isoforms" differ in functional properties and secretory behavior. Variants of these PDGF monomers and dimers are known. See in this regard U.S. Patent No. 5,326,695, which is incorporated by reference.

The three isoforms of PDGF bind with different affinities to two related tyrosine kinase receptors, denoted as PDGF-α and PDGF-β receptor. The α receptor binds all isoforms, whereas the B receptor does not bind PDGF-AA, binds PDGF-AB with low affinity, and PDGF-BB with high affinity (Heldin et al., supra; Ostman et al., supra). Available information suggests that PDGF is a divalent ligand; the various isoforms therefore binds to dimeric complexes, the composition of which is specified by the isoform of the ligand. The human receptor has 1089 amino acids including a 23 amino-acid leader sequence while the human β receptor has 1106 amino acids including a 32 amino aid leader sequence. The predicted molecular weights of the human and β receptors based upon their amino acid sequences are 120 kDa and 121 kDa respectively. However, they each appear to have a molecular weight of 170 kDa and 180 kDa as determined by SDS-gel electrophoresis. The apparent discrepancy can be explained by the glycosylation and other post-translational modifications. cDNA for both receptors has also been isolated (Heldin et al., supra; Kelly et al., supra). The receptors both comprise five immunoglobulin like domains (extracellular portion) , and intracellular portions containing protein tyrosine kinase domains with characteristic insert sequences, which have no homology to kinase domains (Yarden et al., Nature 323: 226-232 (1986); Matsui et al., Science 243: 800-803 (1989); Claesson-Welsh et al., PNAS 86: 4917- 4921 (1989). When PDGF binds to these receptors, dimerization of the receptor molecules is induced, followed by kinase activation and autophosphorylation of the receptors (Heldin et al., J. Biol. Chem. 264: 8905-8912 (1989); Seifert et al., J. Biol. Chem. 264: 8771-8778 (1989); Bishayee et al., J. Biol. Chem. 264: 11699-11705 (1989)).

The PDGF gene and its receptors are located on human chromosomes 4 and 5, respectively. The expression of PDGF-α and PDGF-β receptors (PDGF-RA and B hereafter) are independently regulated. Disruption of the PDGF-B or -Rβ genes in mice leads to the development of lethal hemorrhage and edema in late embryogenesis and absence of kidney glomerular mesangial cells. See P. Soriano, Genes & Dev. 8, 1888-1996 (1994); D. Schlondorff, FASEB J. 1. 272-279 (1987) and P. Leveen et al., Genes & Dev. 8:1875-1887 (1994).

Pericytes, also known as rouget cells or mural cells, are known to be associated with all vascular capillaries and post-capillary venules. They are contractile cells, similar to smooth muscle, that encircle microvessels in many different tissues. They may differentiate into adipocytes, osteoblasts or phagocytes. Pericytes have also been identified morphologically in the embryonic brain. See K.

Fujimoto, Λnat. Rec. 242, 562-565 (1995). Differences in pericyte morphology and distribution among vascular beds suggest a tissue-specific function.

Pericytes express PDGF receptors and respond to PDGF in vitro. See Bernstein, et al., J. Cell Sci. 56, 71-82 (1982); and P. A. D'Amore, S. R. Smith, Growth factors 8:61-75 (1993), which are incorporated by reference. In addition, smooth muscle cells and myofibroblasts from various sources -vascular and non-vascular- exemplified by arterial muscle cells, glomerular mesangial cells and uterine smooth muscle cells are also known to express the PDGF receptors.

Pericytes have been implicated in the development of a variety of pathologies including hypertension, multiple sclerosis and tumor vascular ization. As set forth in greater detail below, pericyte loss (depletion/reduction) has also been implicated in histological abnormalities attending the cells of the vascular tissues of diabetic patients.

To gain an insight into the physiological role of PDGF-B and to gauge its effect on the development of pericytes in the developing mouse brain, the present inventors have generated mice which are unable to express PDGF-B (PDGF-B -/- mice) by crossing PDGF-B +/- mice .

The present inventors studying PDGF-B -/- mice show for the first time that the underlying cause of hemorrhage in PDGF-B mutant mice can be traced to the loss of micro vascular pericytes, which depend on PDGF-B expression for their development. This loss in the number of pericytes is associated in the long term with the formation and rupture of capillary microaneurysms in such mice. Consequently, pericytes are absolutely required for the mechanical stability of the capillary wall.

Although PDGF -/- knockouts are documented by P. Leveen et al., supra, the reference fails to specifically teach a link between PDGF-B depletion, loss/reduction in pericyte number, and vascular damage. A PDGF-A null mouse is also described by Bostrom et al., in Cell, 85:863-873 (1996).

However, this reference is devoid of any teaching suggesting a PDGF-B knockout mouse or that pericyte loss causes vascular damage.

OBJECTS AND SUMMARY OF THE INVENTION According to one aspect of the invention, there is provided a non-human transgenic animal carrying a disruption of a gene encoding platelet derived growth factor B, such that expression of the platelet derived growth factor B is at a reduced or non-existent level, wherein the disruption causes the animal to display a phenotype characterized by damage to the microvessels and a loss or reduction in the number of pericytes in the animal. Preferably the animal is a rodent, for example a mouse, rat, or hamster, and more preferably is a mouse.

Preferably, the vascular damage is the formation and rupture of microaneurysms in the capillaries of the animal. According to a second aspect, the novel animals of the invention, especially mice, provide a convenient model system for studying vascular diseases associated with or caused by pericyte loss, and for the testing of putative therapeutic agents for the treatment or prevention of these diseases. It is contemplated that these diseases include, but are not limited to diabetes related diabetic vascular disease. Also, preferably the animal is a PDGF-B -/- mouse.

The person skilled in the art will recognize that such animal presenting models of disease provide a suitable system in which to test putative therapeutic agents for treatment or prevention of these diseases. Agents identified thereby may be used therapeutically as may therapeutic methods relating to gene therapy using the PDGF-B gene. A variety of viral vectors for use in gene therapy are known in the art. For example, herpes virus, and retrovirus vectors have been used. In addition, in at least some situations bare DNA can be injected or applied directly.

In a further aspect, the invention provides a method of diagnosis of a disease associated with or caused by PDGF-B deficiency, comprising the step of testing a tissue or cell sample from a subject suspected of suffering from such a deficiency for the presence of the gene product of the gene encoding PDGF-B. The test may suitably be carried out using cells, but may also use tissue obtained by biopsy from the subject. Such tests may be carried out using methods known per se, such as reaction with a probe labeled with a detectable marker, for example using in situ hybridization. It is contemplated that this diagnostic method of the invention will be particularly useful in the diagnosis of diabetic vascular disease, and other abnormalities of the vasculature. This approach provides a new way to diagnose diseases, such as diabetic vascular disease.

A still further embodiment contemplates a method for testing whether an agent is useful for correcting a condition associated with reduced or non-existent level of PDGF-B comprising administering the agent to the non-human transgenic animal, and deterrnining a level (number) of pericytes in said non-human transgenic animal, wherein a change in the number of pericytes toward a normal level is indicative of the efficacy of the agent.

A cell-line derived from the non-human transgenic animal is also provided. A further embodiment of the invention concerns a method for determining the efficacy of a material in treatment of a condition characterized by reduced levels or non-existent levels of PDGF-B. The method includes administering to a non-human transgenic animal having a reduced or non-existent level of PDGF-B, an amount of the material and determining a number of pericytes in the non-human transgenic animal following the administration, wherein an increase in the number of pericytes is indicative of the efficacy in treatment of the disease. Preferably, the condition is diabetic vascular disease.

An alternative embodiment contemplates a method for screening for the presence of diabetic vascular disease in a subject. The method involves assaying a sample from the subject and determining the level of PDGF-B in the sample, wherein a decrease in the determined level relative to a normal level is indicative of diabetic vascular disease in the subject. Another feature contemplated by the invention is a method for screening for the presence of diabetic vascular disease, comprising determining number of pericytes in a sample taken from a subject, wherein a reduction in the number of pericytes in the sample compared to a number of pericytes in a normal subject is indicative of the presence of the diabetic vascular disease. Preferably, the diabetic vascular disease is selected from the group consisting of proliferative retinopathy, and renal glomerulosclerosis.

A still further embodiment contemplates a method for screening for the presence of diabetic vascular disease, comprising assaying a tissue from a subject to determine level of expression of mRNA of a gene encoding PDGF-B, wherein the absence of or reduced level of expression of the mRNA compared to a normal level is an indication of the presence of diabetic vascular disease in the subject.

A still further embodiment includes a method for preventing or delaying onset of a condition associated with reduced or non-existent levels of PDGF-B in a subject prone thereto comprising administering an effective amount of PDGF-B to said subject sufficient to prevent or delay onset of said condition. Alternatively, analogs of PDGF-B or PDGF-β receptor agonists may be administered or compounds that mimic PDGF-B activity may also be administered.

A still further embodiment includes a method for preventing or delaying onset of a condition associated with an absence or reduction in a number of pericytes in a subject prone thereto comprising administering an effective amount of PDGF-B to the subject sufficient to prevent or delay onset of said condition. Alternatively, analogs of PDGF-B or PDGF- β receptor agonists may be administered or compounds that mimic PDGF-B activity may also be administered.

Another feature attending the present invention is a method of treating a condition associated with reduced or non-existent level of PDGF-B, comprising administering to a subject in need thereof a therapeutically effective amount of PDGF-B sufficient to alleviate the condition. Alternatively, analogs of PDGF-B or PDGF-β receptor agonists may be administered or compounds that mimic PDGF-B activity may also be administered (agonists).

An alternative embodiment contemplates a method of treating a condition associated with reduced or non-existent numbers of pericytes, comprising administering to a subject in need thereof a therapeutically effective amount of PDGF-B sufficient to increase the number of pericytes in the subject. Preferably, the diabetic vascular disease is selected from the group consisting of renal glomerulosclerosis and proliferative retinopathy. Alternatively, analogs of PDGF-B or PDGF-β receptor agonists may be administered or compounds that mimic PDGF- B activity may also be administered.

Another aspect of the invention is a method for monitoring the efficacy of an agent in increasing levels of PDGF-B or the number of pericytes in a subject having reduced or nonexistent level of PDGF-B or pericytes comprising administering an effective amount of the agent to the subject and deteπ ning said level of PDGF-B or pericytes in the subject following the administration, wherein an increase in the level of PDGF-B or pericytes is indicative of the efficacy of the agent.

A final aspect of the invention concerns a method for determining whether an agent is useful for restoring the number of pericytes in a subject. The method includes administering to a subject in need thereof an effective amount of the agent and determining a number of pericytes following the administration, wherein an increase in the number of pericytes is indicative of the effect of said agent.

The above, and other objects, features and advantages of the present invention will become apparent from the following description read in conjunction with the accompanying drawings, in which like reference numerals designate the same elements.

BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1 presents electron micrograph of cross sectioned capillaries showing varying levels of pericytes in different cerebral tissues. In particular, Figure 1(a) shows the presence of pericytes in the deep brain cortex of PDGF-B +/+ in E16.5 embryos (embryonic brain at day 16.5). Note the pericyte (P) with a nucleus. Figure 1(b) shows the absence of pericyte in the deep brain cortex of PDGF-B -/-El 6.5 embryos. Bars = 2.5 μm.

Figures 2(a-j)show non-radioactive in situ hybridization of 14 μm tissue sections derived from PDGF-B +/+ (a, b, c, e, g, and i) and PDGF-B -/- (d, f, h, and j) using PDGF- B and PDGF-Rβ sense and antisense probes. r

Figure 2(a) shows PDGF-B mRNA expression in the brain and perineural plexus of an E14.5 PDGF-B +/+ embryo.

Figure 2(b) shows PDGF-Rβ expression in an E14.5 PDGF-B +/+ brain. A longitudinally sectioned erythrocyte-containing capillary is shown (arrows) as are several cross-sectioned capillaries (arrowheads).

Figures 2(c-d) show the differences in PDGF-Rβ mRNA expression in the brains of PDGF-B +/+ and PDGF-B -/- E14.5 embryos respectively. The presence of capillaries is indicated in the PDGF-B -/- brain (arrowheads).

Figures 2(e-f) show the difference in PDGF-Rβ mRNA expression in the heart of PDGF-B +/ + and PDGF-B -/- E14.5 embryos respectively. PDGF-Rβ positive mesenchymal cells surrounding a small artery in the diaphragm (D) are also shown (arrowhead).

Figures 2(g-j) show the differences in the spreading pattern of PDGF-Rβ positive mesenchymal cells in response to PDGF-B in El 25 PDGF-B +/+ and PDGF-B -/- embryos. Figures 2(g-h) demonstrate the differences in PDGF-Rβ expression (presence of PDGF- Rβ positive mesenchymal cells) in the internal carotid artery and surrounding mesenchyme of PDGF-B +/+ and PDGF-B -/- embryos respectively.

Figures 2(i-j) show PDGF-B expression in the perineural plexus and a capillary extending from the plexus vasculature (PV) into the developing brain in PDGF-B +/+ and

PDGF-B -/- E12.5 embryos respectively. Bars = 40 μm.

Figures 3(a-f) show a magnified view of PDGF-Rβ expression in the small blood vessels of E14.5 PDGF-B +/+ embryos. The tissue sections used in the non-radioactive in situ hybridization were derived from E 14.5 PDGF-B +/+ embryos. Figure 3(a) shows PDGF-Rβ mRNA expression in brain microvessels.

Figure 3(b) shows PDGF-Rβ mRNA expression in skin microvessels.

Figure 3(c) shows PDGF-Rβ mRNA expression in capillaries in myocardium tissues.

Figure 3(d) shows PDGF-Rβ mRNA expression in a skeletal muscle capillary tissues.

Figure 3(e) shows PDGF-Rβ mRNA expression in a tissue derived from a small artery in the lung.

Figure 3(f) shows PDGF-Rβ mRNA expression in the intercostal artery and vein tissues. A: artery, V: vein, e: erythrocyte. Bar = 20 μm.

Figures 4(a, c, and e) show the capillary morphology and expression of tie^Icz in PDGF +/+ (a, c, and e) embryos, while Figures 4(b, d, and f) show the capillary morphology and expression of tie^lcz in PDGF -/- embryos.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention reflects the discovery that capillary endothelial cells in PDGF-B deficient mice embryos are unable to maintain their architecture because they fail to recruit PDGF-Rβ positive mesenchymal cells (microvascular pericytes), which require PDGF for their development.

As a result of the gene disruption, the microvascular pericytes fail to develop in whole or in part, which, in turn, leads to the development of abnormal capillaries, as well as, the formation and rupture of microaneurysms in the microvessels of the mutant mice. As a consequence of the absence or reduction in the number of pericytes, the mutant mice die at late gestation. The various vasculature related complications resulting from the reduction or absence of pericytes includes edema, hemorrhage, and microaneurysms etc.

As used herein, diabetic vascular disease encompasses damage to the microvessels, such as proliferative retinopathy, microaneurysms, and renal glomerulosclerosis.

As used herein, the term "animal'' may further comprise ruminants, such as ovine and bovine species. Other animals that can be used for experimentation include rat, hamster and rabbit. As used herein E followed by a number represents the embryonic age. For example an El 6.5 embryo means that the embryo is 16.5 days old.

The invention is described hereafter with reference to the following examples.

EXAMPLE 1

Generation of PDGF-B deficient Mice

PDGF-B +/- mouse line 3.22, bred as 129 sv/C57BI6 hybrids, were crossed and embryos delivered by caesarean section at E16.5 tissue was used for mRNA from the tail or yolk sac tissue was used to generate cDNA, which, in turn, was used for genotyping by a three-primer PCR. The forward primer 5'GGGTGGGACTTTGGTGTAGAGAAG (SEQ. ID. NO. 1) and the two reverse primers 5'TTGAAGCGTGCAGAATGCC (SEQ. ID. NO. 2) and 5'GGAACGGATTTTGGAGGTAGTGTC (SEQ. ID. NO. 3) yielded 265 bp wild type and 624 bp mutant allele products in a 40 cycle reaction. The PCR amplification of cDNA was carried out by sequential cycling for 40 cycles at 96°C for 30 seconds, 59.5°C for 30 seconds and 64°C for 120 seconds.

Embryonic brain tissue from a 16.5 (E16.5) day old embryo at which most PDGF-B deficient (PDGF-B -/-) embryos remain alive and without signs of hemorrh aging were chosen for the experiments.

Histology

Embryo heads, divided by a coronal section at the level of the external auditory meatus , were prepared for light microscopy by immersion in 2.5% glutaraldehyde, 2% paraformaldehyde, 0.02% Na azide in 0.05 M Na cacodylate, pH 7.2 for 24 hours. About 1 mm thick slices of fixed tissue were treated with 0.5 % OsO₄. 1 % potassium ferrocyanate in 0.1 M Na cacodylate for 3 hours, followed by 1 % tannic acid in water for 30 minutes.

The tissue slices were dehydrated and flat embedded. Ultrathin sections encompassing cortical and subcortical regions were stained with uranyl acetate and lead citrate and examined in a Zeiss CEM 902 electron microscope.

Capillaries derived from the brains of El 6.5 embryos were scored for the presence or absence of pericytic cell bodies and cytoplasmic processes. The data derived from the above analysis are presented in Table 1.

Microvessels with whole lumina from the electron microscope sections were counted and classified into the following categories: (a) Naked endothelial tubes, (b) Pericyte processes present (c) Microvessels with pericytes sectioned through the nucleus, (d) Lumina are part of a clear sprout, and (e) Miscellaneous.

Table 1.

Quantification of pericyte elements in association with microvessels in El 6.5 mouse brains.

Microvessel Category

Embrvos

1 (-/-) 50 6 0 4 0

2 (-/-) 47 0 0 4 1

3 (-/-) 46 1 0 2 2

Sum 143 7 0 10 3 Total number of PDGF-B -/- microvessels analyzed 163

4. (+/+ or +/-) 2 42 11 5 0

5. (+/+ or +/-) 2 35 14 4 5

6. (+/+ or +/-) 4 21 6 2 0

7. (+/+ or +/-) 5 37 9 7 2 Sum 13 135 40 18 7

Total number of PDGF-B +/+ or +/- microvessels analyzed 213

Referring to Table 1, 40 out of 213 sectioned PDGF-B +/+ or +/- capillaries show associated pericytes sectioned through the nucleus, whereas the corresponding figure for

PDGF-Bβ -/- capillaries is 0 out of 173. When including capillaries with associated cytoplasmic processes (pericytic or endothelial) 175 out of 213 sectioned PDGF-B +/+ or +/- capillaries show associated pericytes sectioned through the nucleus, whereas 7 out of 163 sectioned PDGF-B -/- capillaries show associated pericytes sectioned through the nucleus. Naked endothelial tubes were scored in 13 out of 213 cases in PDGF-B +/+ or +/- capillaries, and in 153 out of 173 cases in PDGF-B -/- capillaries.

Figure 1 is demonstrative of the observations noted supra, i.e., the absence of brain pericytes in PDGF-B -/- mice. In particular, the sectioned capillaries illustrate the differences in the deep brain cortex from PDGF-B +/+ and -/- E16.5 embryos. Notably, the capillaries from the PDGF-B +/+ E16.5 embryos show two endothelial cell profiles while the capillaries from PDGF-B -/- E16.5 embryo exhibit four endothelial cell profiles.

IN SITU HYBRIDIZATION STUDIES

In situ hybridization studies were carried out in accordance with the methods described by H. Bostrom, et al., Cell 85: 863-873 (1996) and D. Henrique, et al., Nature, 375: 787-790

(1995) with slight modifications. These references are incorporated herein in their entirety.

Briefly, PDGF-B +/+ and PDGF-B -/- embryos were fixed overnight in 4% buffered paraformaldehyde (PFA), cryo-sectioned and stored at -20°C. Prior to hybridization, tissue sections from the above embryos were treated with 10 μg/ml of proteinase K and refixed in PFA for 15 min. Prehybridization occurred in a solution containing 50-55% deionized formamide (55% deionized formamide was used for the PDGF-β probe and 50% deionized formamide was used for all other probes), 10% dextran sulphate, I mg/ml yeast tRNA, 1 x

Denhardt's solution, 5 mM EDTA, 0.2 M NaCl; 0.013 M Tris-HCI, 5mM NaH₂PO₄, 5 mM

NaHPO₄, pH 7.5. Posthybridization washes were carried out in 1 x SSC, 50-55 % formamide, and 0.1 % Tween 20. The entire process from pre- to posthybridization was performed at a temperature ranging from about 65 to about 72.5°C, with the higher stringency being used for the PDGF-B probe. Digoxygenin (DIG) labeled RNA probes were prepared following standard procedures and detected using DIG -specific alkaline phosphates labeled antibodies.

PDGF-B sense and antisense probes were generated from a 0.8 kbp mouse cDNA containing the full length coding sequence cloned in PBS-SK. PDGF-Rβ sense and antisense probes were generated from a 461 bp Sad fragment cloned in Pgem-2. Preheated probes were added to the tissue section obtained above at a concentration of 3-8 μg/ml hybridization solution, and the sections were incubated overnight.

Control: That PDGF-B -/- embryos did not express PDGF-B mRNA was confirmed by the lack of hybridization when PDGF-B -/- embryos were hybridized with PDGF-B sense and antisense probes. PDGF-B expression was studied in 108 sections derived from two (2) PDGF-B

+ /+ embryos and one (1) PDGF-B -/-embryo. PDGF-Rβ expression was studied on 206 sections taken from seven (7) literate pairs of PDGF-B +/+ and -/- embryos.

Figures 2(a-j) show PDGF-B and PDGF-Rβ mRNA expression using the PDGF-B and PDGF- Rβ antisense probes hybridized to 14 μm thick tissue sections. A nikon photo microscope was used for photographing the results. Unstained sections in combination with Normaski optics were used to enhance sensitivity and resolution.

Referring to Figure 2(a), PDGF-B mRNA is found in the brain and perineural plexus of an E14.5 PDGF-B +/+ embryo. PDGF-B mRNA is also found in the endothelium of many capillaries and small arteries through gestational days E12.5 to E16.5 (arrows) and in larger blood vessels of the perineural plexus (arrowheads). As well, PDGF-B is expressed in liver megakaryocyte at E14.5 and later. However, PDGF-B mRNA expression was absent in the venous endothelium or in the endocardium or in aortic endothelium.

Referring to Figure 2(b), PDGF-Rβ mRNA is present in the brain of an E 14.5 PDGF-

B +/+ embryo. A longitudinally sectioned erythrocyte-containing capillary is shown (arrows) as are several cross-sectioned capillaries (arrowheads). More than 95% of the PDGF-Rβ positive mesenchymal cells are seen in close proximity to capillaries. Note the difference between the capillary endothelial staining for PDGF-B seen in Figure 2(a) versus the pericapillary, pericytic staining for PDGF-Rβ seen in Figure 2(b). The latter is more pronounced. Referring to Figures 2(c-d), which show PDGF-Rβ expression in the brain tissue of

E14.5 PDGF-B +/+ and PDGF-B -/- embryos respectively, pericapillary staining for PDGF- Rβ is conspicuously absent in the PDGF-B -/- brain tissue while PDGF-Rβ staining in the perineural plexus (P) is observed in both genotypes. The presence of capillaries is indicated in the PDGF-B -/- brain (arrowheads). Referring to Figures 2(e-f), which show the differences in PDGF-Rβ expression in the heart tissue of E14.5 PDGF-B +/+ and PDGF-B -/- embryos respectively, while PDGF-Rβ mRNA is present in the heart tissue of the PDGF-B +/+ embryo, it is completely absent in the heart tissue of the PDGF-B -/- embryo, as is evident from the complete absence of pericapillary PDGF-Rβ staining. PDGF-Rβ positive mesenchymal cell surrounding a small artery in the diaphragm (D) is shown (arrowhead). See Figure 2(f).

The thin and hypertrabeculated myocardium in the PDGF-B -/- section is a hallmark of the phenotype of the PDGF-B -/- mouse. See, Leveen et al. , supra.

Referring to Figures 2(g) which shows PDGF-Rβ expression in the tissues derived from the internal carotid artery and surrounding mesenchyme of E12.5 PDGF-B +/ + embryos, PDGF-Rβ positive mesenchymal cells are mainly expressed in developing arterial walls, as a scattered population of cells in close contact with neighboring microvessels. These cells appear to have migrated to these sites from the arterial wall location.

In sharp contrast, in the same tissues derived from a PDGF-B -/- E12.5 embryo, PDGF-Rβ expression is only detected in the arterial walls, while the scattered population of PDGF-Rβ positive mesenchymal cells in the surrounding microvessels that were so prevalent in the wild type PDGF-B embryos are absent. See Figure 2(h).

Referring to Figures 2(i-j), shown therein are data suggesting that PDGF-Rβ positive mesenchymal cells are expressed in the plexa of both the E12.5 PDGF-B +/+ and PDGF-B -/- embryos. However, PDGF-Rβ positive mesenchymal cell expression is absent when in contact with the ingrowing capillary in the PDGF-B -/- embryo (arrowheads). The figures clearly show that PDGF-Rβ positive mesenchymal cells, which normally migrate into the brain together with capillaries growing from the perineural vascular plexus, are absent in the El 2.5 PDGF-B -/- embryos. However, PDGF-Rβ positive mesenchymal cells are observed in the plexus of both embryos. Referring to Figures 3(a-d), which shows a higher magnification of PDGF-Rβ expression in E14.5 PDGF-B +/+ embryos, PDGF-Rβ positive mesenchymal cells (arrows) are observed in the microvessels of the brain and skin, the capillaries of the myocardium and skeletal muscle, small arteries of the lung and the intercostal artery and vein. Notably, the presence of PDGF-B positive mesenchymal cells in the capillaries of the myocardium and skeletal muscles, and the microvessels of the skin and brain coincide with the observation that theses are the sites where pericytes normally reside, i.e., located outside PDGF-Rβ negative endothelial cells (arrowheads). Although the above observed pericyte expression conflicts with that of the prior art, which suggest PDGF-B expression in developing capillary endothelium, it is postulated that the conclusions reached by the prior art are based upon radioactive in situ hybridization which invariably fails to distinguish PDGF-Rβ expression in the capillary endothelium from pericytic expression.

In sum, the above data demonstrate that PDGF-Rβ mRNA is expressed in developing vascular walls. For example, larger arteries, but not veins, are surrounded by several layers of PDGF-Rβ positive mesenchymal cells, while smaller arteries were surrounded by single layers PDGF-Rβ positive mesenchymal cells and capillaries were surrounded by a non- continuous layer of PDGF-Rβ positive mesenchymal cells. The location and distribution of the PDGF-Rβ positive mesenchymal cells are also typical of pericytes.

More, PDGF-Rβ positive mesenchymal cells are abundant in the capillary plexa, such as the perineural plexus, in developing endocrine organs and in plexus choroideus. PDGF-Rα is expressed at various sites in the mesenchyme at El 2.5- 16.5 without specific association with developing blood vessels. These embryonic expression patterns of PDGF-B and PDGF-Rβ imply the existence of paracrine signaling, involving the PDGF-B and PDGF-Rβ complex, from vascular endothelium to vascular wall progenitors.

As well, the data show that PDGF-Rβ expression is altered in some, but not all tissues of PDGF-B -/- embryos. For example, at E14.5-17.5, PDGF-Rβ positive pericytes normally found in wild type embryos are absent from PDGF-B -/- brain, heart, lung and brown adipose tissue. The PDGF-Rβ expression at other sites, i.e., in arterial walls and in the vascular plexus appear unaffected. Refer to Figures 2(c-f).

EXAMPLE 2

Many tissues in PDGF-B -/- embryos, at late gestation, exhibit dilated microvessels. To highlight the architecture of the capillaries and to study the capillary morphology in more detail, mice carrying one copy of the PDGF-B null allele were crossed with mice carrying a lacZ reporter gene driven by the tiel promoter (tie^la). Tie^lcz mice are heterozygous carriers of a lacZ coding sequence integrated in the tiel locus and, hence, under the transcriptional control of tiel regulatory elements. Tie^lcz mice were propagated by heterozygous breeding and tie'^cz carriers were identified by lacZ staining of their tail tissue.

Tie^lcz heterozygotes were then crossed with PDGF-B +/- mice to generate double heterozygotes, which were subsequently crossed with PDGF-B +/- mice.

From subsequent intercrosses, tie'^cz heterozygous embryos which were PDGF-B +/+ , +/-, or -/- were selected and identified by PCR. Mindful that PDGF-B -/- mice show abrupt onset of hemorrhaging at late gestation, only non-hemorrhaging embryos were selected at time points prior to the suspected onset of hemorrhaging For analyzing the capillary morphology and expression of tie^lcz in the brain stem sections of PDGF-B +/+ and -/- E18.5 embryos, horizontal or frontal brain stem sections (50 μm) were stained for lacZ expression. The lacZ staining was developed at different time points and some sections were counter stained with erythrosin. Tissues were selected from 296 sections analyzed in 15 embryos, 5 each of the genotypes PDGF-B +/ + , tie^lcz/tie ^ PDGF-B -/-, tie'^cz/tie^wt; PDGF-B +/ + , tie^wt/tie^wt. Considering that tie'^cz up-regulation is expected in PDGF-B -/- brain capillaries, care was exercised in applying PDGF-B +/+ and -/- brain tissues to the same histological glass slides to allow for parallel processing. ( tie^m denotes the wild type tie mice without the lacZ reporter gene.)

Figures 4(a-b) show the capillary morphology and expression of tie¹¹ in the brain stem sections (50 μm) of PDGF-B +/+ and -/- E18.5 embryos. The data show considerable tie^lcz staining in the blood vessels of the perineural plexus as well as in the brain capillaries of the

E18.5 PDGF-B +/+ embryos.

It is worth noting the tortuous appearance of the capillaries in the PDGF-B -/- brain, and the abundance of focal dilations (microaneurysms), which are clearly evident. Referring to Figures 4(c-d), which show a higher magnification of the brain stem capillaries of the above embryos. The capillaries in the PDGF-B +/+ tissues are straight and uniform in diameter. See Figure 4(c). In contrast, the capillaries in the PDGF-B -/- show the formation of numerous microaneurysm (arrows). See Figure 4(d).

Temporal lobe sections (50 μm) from E17.5 PDGF-B +/+ embryos are shown in Figure 4(e), while Figure 4(f) shows the same lobe section from E17.5 PDGF-B -/-embryos.

The tie'^cz stain for Figures 4(a-d) was developed for 24 hours while the same stain shown in

Figures 4(e-f) was developed for 3 hours.

Referring to the data presented in Figures 4(a-f), considerable up-regulation in the tiel expression in the PDGF-B -/- abnormal brain capillaries compared to the brain capillaries of PDGF-B +/+ and +/- embryo is observed. In addition, tiel up-regulation is also observed in the capillaries of lung, heart and adipose tissues of the PDGF-B -/- embryo, i.e., sites where pericyte loss is noticed (data not shown). At other locations, such as in the small arterial endothelium and in capillary plexa, tiel expression is indistinguishable in PDGF-B -/-, 4 -, and +/+ mice. Some small diameter capillaries in the PDGF-B -/- tissues also show low tie¹" expression. The perineural plexus (P) staining is uniformly strong in both PDGF-B +/+ and

-/- embryos.

While the PDGF-B +/+ or +/- capillaries are straight and have an even diameter

(approximately 5 μm), PDGF-B -/- capillaries in contrast are tortuous, and exhibit variable diameter, and numerous microaneurysms, ranging from about 25 to about 100 μm in diameter .

Cylindrical dilations that occur over longer stretches are also observed. Some of the dilations appear to reflect focal distensions in the capillary wall. In addition, increased endothelial cellularity is evident at many dilated sites, which was confirmed by light microscopy and time elapsed microscopy( TEM). The data suggest that the microaneurysm formation includes a component of endothelial cell proliferation. The spatial correlation between tiel up-regulation and pericyte loss seen in the PDGF-B -/- embryos, and the increased cellularity in many microaneurysms, implies that pericytes regulate gene expression and hence the differentiated functions of capillary endothelial cells. Considering that tiel is an endothelial cell receptor tyrosine kinase involved in blood vessel formation during embryogenesis and possibly also in the adult, its up-regulation may relate to the increased proliferation of endothelial cells in the microaneurysms. See M.C. Puri, J. Rossant, K. Alitalom J. Partanen, EMBO J. 14, 5884-5891 (1995).

As noted supra, platelet-derived growth factor PDGF-B, is a high affinity ligand for receptor tyrosine kinases PDGF-Rα and -β. It promotes proliferation and migration of mesenchymal cells in vitro. Studies have also shown that PDGF also acts on the capillary endothelial cells, glial cells and neurons. Studies on the expression patterns of PDGF and its cognate receptor further suggest a functional role for PDGF in embryonic development. See C.-H. Heldin, EMBO J .7:11, 4251-4259 (1992); E. W. Raines, D.F. Bowen-Pope, R. Ross, in Handbook of Experimental Pharmacology, Peptide Growth Factors and Their Receptors M. B. Sporn, A.B. Roberts, Eds. (Springer-Verlag, Heidolberg, 1990), pp. 173-262; and Westermark, Sorg, Biology of Platelet-Derived Growth Factor (Karger, Basel, 1993). Also, PDGF is a known activator for cells of mesenchymal origin.

Endothelial cells form the lining of blood vessels and have a remarkable capacity to adjust their number and arrangement to suit local requirements. They line the entire vascular system. As such, they control the passage of materials into and out of the blood stream.

In the embryo, arteries and veins generally develop from small vessels constructed entirely of an endothelial cells and basal lamina. New blood vessels always originate as capillaries, which sprout from existing small vessels. This process, also known as angiogenesis, occurs in response to specific signals. Generally, the endothelial cells that will form new capillaries grow out from the side of a capillary or small venule by extending long processes or pseudopodia. At first, the cells form a solid sprout which then hollows out to form a tube. The process continues until the sprout encounters another capillary, with which it connects, thereby allowing the blood to flow.

To reiterate, pericytes express PDGF receptors and respond to PDGF in vitro. Pericytes originate from progenitors in arterial walls and vascular plexa and migrate along capillary sprouts which express PDGF-B. Thus, PDGF-B stimulates PDGF-Rβ positive pericyte progenitors, which results in the migration and proliferation of the cells. Development of cell culture methods has provided a great deal of evidence to support the hypotheses that endothelial cells and pericytes interact and that these communications are central to vessel assembly, growth control and normal function.

The distribution of pericytes suggests that they may support capillary structure. Studies of angiogenesis in vivo in response to wounding suggest that the appearance of pericytes in the wound area correlate with inhibition of endothelial cell proliferation. See D. J. Dumont, et al., Oncogene 7, 1471-1480 (1992). Pericytes, and smooth muscle cells also inhibit endothelial cell proliferation and migration in vitro. See Orlidge, et al., J. Cell Biol. 105:

1456-1462 (1987); Sato et al., J. Cell Biol. 109: 309-315 (1989).

The absence of PDGF-Rβ or -Rα mRNA expression in the brain of PDGF-B -/- embryos suggest the existence of at least one additional other endothelium-derived, "inducing factor" whose action leads to PDGF-Rβ up-regulation in mesenchymal cells surrounding arteries and plexus vasculature.

Candidate mediators of such induction may include a tissue factor (TF) since TF- deficient mouse embryos fail to develop vascular wall cells in vitellina blood vessels. See P.

Carmeliet, et al., Nature 383, 73-75 (1996). Alternatively, since angiopoietin-1 is expressed by perivascular mesenchymal cells, and tie2 by endothelial cells, their interaction may lead to endothelial release of the "inducing factor(s). "

That angiopoietin-1 -tiel receptor signaling, may be involved in the recruitment and/or differentiation of vascular smooth muscle cells is evident from the prior art. See S. Davis, et al., Cell 87, 1161-1169 (1996); and M. Vikkula, et al. Cell 97: 1181-1190 (1996).

The development of abnormal capillaries in pericyte-deficient PDGF-B -/- embryo shows that pericytes regulate microvessel structure. In PDGF-B -/- embryos, for example, microaneurysm, hemorrhages and edema occur prenatally, when blood pressure increases.

When comparing the morphology of the microaneurysms formed in PDGF-B -/- embryos to those formed in diabetic individuals, it becomes evident that the microaneurysms formed in the present invention are morphologically similar to those formed in the retinal microvessels of diabetic individual. Diabetic vascular disease has been shown to effect both the micro- and macro vasculature, primarily in the retinal, renal glomeruli, and multiple sites in the microvessels. George L. King, et al., "Cellular and Molecular Abnormalities In the Vascular

Endothelium of Diabetes Mellitus" Ann. Rev. Med. (1994) 45: 179-88, which is incorporated in it entirety.

According to King et al., supra, besides the thickening of the basal membrane, other histological changes in the vascular cells of diabetic individual involve the microvess els of the retina and renal glomeruli. For example, the earliest detectable histological change attending the retinal microvessels is the loss in retinal pericytes. The above observation is further supported by the findings of Cogan et al., Archs.

Opthalmol. 69: 492-501 (1963) that the pericyte to endothelial cell ratio in the retinal vessels of diabetic individuals progressively decreases from 1: 1 to about 1: 10 over time. Additional vascular histological changes or complication attending diabetic individuals as a consequence of pericyte loss include changes in capillary diameter, and the formation of microaneurysms. As a result, the new vessels contain fewer pericytes and fail to form tight retinal-blood barriers, thereby creating the risk of bleeding. In addition, capillaries of diabetic individuals, like those of the mutant mice of the present invention are also spherical and cylindrical, and frequently show an increased endothelial cellularity.

Deserving of mention is the observation that mesangial cells are related to microvascular pericytes, which are contractile cells similar to smooth muscle that encircle microvessels in many different tissues. See D. E. Sims, Tissues and Cell , 18: 153-174 (1986). Thus, therapeutics and diagnostic methods used for conditions associated with reduced or nonexistent numbers of pericytes and/or reduced or non-existent levels of PDGF-B will also find use for conditions associated with reduced or non-existent levels of mesangial cells. The renal glomeruli generally comprises at least three types of vascular cells- endothelial cells, pericyte-like mesangial cells and epithelial cells. In fact, the loss of the pericyte-like mesangial cells has been implicated in renal glomerulosclerosis, another aspect of diabetic vascular disease. Although the reasons for the loss of mesangial cells are unknown , it would appear that it is a consequence of the failure of the paracrine function attending the interactions between endothelial, epithelial, and mesenchyme cells. The loss of mesangial cells in PDGF-B -/- and -Rβ -/- embryo also appears to occur by a mechanism similar to that of pericyte loss: failure of recruitment of PDGF-Rβ positive progenitors into the developing glomerular tuft in glomerulosclerosis, increased deposition of an extracellular matrix (ECM) leading to a thickening of the glomerular basement membrane, and increased deposition of a mesangial matrix.

In view of the above similarities between pericytes loss and loss of mesangial cells, it appears that both pericytes and mesangial cells are involved in the pathogenesis of late complications of diabetes mellitus, in particular diabetic vascular disease. Thus, common pathogenic mechanisms may underlay pericyte and mesangial cell reaction in the pathogenesis of this disease.

Considering that pericytes, mesangial cells and alveolar myofibroblasts, (Bostrom et al, supra) are absent in PDGF-B and -A knockouts, respectively, PDGFs may indeed be critical for the ontogeny of myofibroblasts.

Having described preferred embodiments of the invention with reference to the accompanying drawings, it is to be understood that the inyention is not limited to those precise embodiments, and that various changes and modifications may be affected therein by one skilled in the art without departing from the scope or spirit of the invention as defined in the appended claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANTS: Per LINDAHL; Per LEVEEN; Christer BETSHOLTZ

(ii) TITLE OF INVENTION: NON-HUMAN PDGF-B-DEFICIENT TRANSGENIC ANIMALS WITH REDUCED OR NON-EXISTENT NUMBERS OF PERICYTES

(iii) NUMBER OF SEQUENCES:

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Felfe & Lynch

(B) STREET : 805 Third Avenue

(C) CITY: New York City

(D) STATE : New York

(E) COUNTRY : USA

(F) ZIP: 10022

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette, 3.25 inch, 1.44mb

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: PC-DOS .

(D) SOFTWARE: WordPerfect

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: To Be Assigned

(B) FILING DATE: June 17, 1998

(C) CLASSIFICATION: 435

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/893,421

(B) FILING DATE: July 11, 1997

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Norman D. HANSON

(B) REGISTRATION NUMBER: 30,946

(C) REFERENCE/DOCKET NUMBER: LUD 5470 PCT - JEL/NDH

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (212) 688-9200

(B) TELEFAX: (212) 838-3884 (2) INFORMATION FOR SEQ ID NO: 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1: GGGTGGGACT TTGGTGTAGA GAAG 24

(2) INFORMATION FOR SEQ ID NO : 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2: TTGAAGCGTG CAGAATGCC 19

(2) INFORMATION FOR SEQ ID NO : 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 3: GGAACGGATT TTGGAGGTAG TGTC 24

Claims

WHAT IS CLAIMED:

1. A non-human transgenic animal carrying a disruption of a gene encoding a platelet derived growth factor B, such that expression of the platelet derived growth factor B is at a reduced or non-existent level, wherein the disruption causes said animal to display a phenotype characterized by damaged microvessels and a loss or reduction in the number of pericytes.

2. The non-human transgenic animal according to claim 1, wherein said non- human transgenic animal is selected from the group consisting of a mouse, rat, and a hamster .

3. The non-human transgenic animal according to claim 2, wherein said non- human transgenic animal is a mouse.

4. The non-human transgenic animal according to claim 1, wherein said damaged microvessels are susceptible to the formation of microaneurysms.

5. A method for determining the efficacy of an agent in treatment of a condition characterized by reduced levels or non-existent levels of PDGF-B, comprising administering to a non-human transgenic animal having a reduced or non-existent level of PDGF-B, an amount of said agent and determining a number of pericytes in the non-human animal following the administration, wherein an increase in the number of pericytes is indicative of the efficacy of said agent in the treatment of the disease.

6. The method according to claim 5, wherein said disease is diabetic vascular disease.

7. A method for screening for the presence of diabetic vascular disease in a subject, comprising assaying a sample from said subject and determining level of PDGF-B in said sample, wherein a decrease in the dete╧Çn╧èned level relative to a normal level is indicative of diabetic vascular disease in said subject.

8. A method for screening for the presence of diabetic vascular disease, comprising determining number of pericytes in a sample taken from a subject, wherein a reduction in the number of pericytes in said sample compared to a number of pericytes in a normal subject is indicative of the presence of said diabetic vascular disease.

9. The method according to claim 8, wherein said diabetic vascular disease is selected from the group consisting of proliferative retinopathy, and renal glomerulosclerosis.

10. A method for screening for the presence of diabetic vascular disease, comprising assaying a tissue from a subject to determine level of expression of mRNA of a gene encoding PDGF-B, wherein the absence of or reduced level of expression of said mRNA compared to a normal level is an indication of the presence of diabetic vascular disease in said subject.

11. A method for preventing or delaying onset of a condition associated with reduced or non-existent levels of PDGF-B in a subject prone thereto comprising administering an effective amount of PDGF-B to said subject sufficient to prevent or delay onset of said condition.

12. A method for preventing or delaying onset of a condition associated with an absence or reduction in a number of pericytes in a subject prone thereto comprising administering an effective amount of PDGF-B to said subject sufficient to prevent or delay onset of said condition.

13. The method according to claim 12, wherein said condition is diabetic vascular disease.

14. A method of treating a condition associated with reduced or non-existent level of PDGF-B, comprising administering to a subject in need thereof a therapeutically effective amount of PDGF-B sufficient to alleviate said condition.

15. The method according to claim 14, wherein said condition is diabetic vascular disease.

16. A method of treating a condition associated with reduced or non-existent numbers of pericytes, comprising administering to a subject in need thereof a therapeutically effective amount of PDGF-B sufficient to increase said number of pericytes in said subject.

17. The method according to claim 16, wherein said condition is diabetic vascular disease.

18. The method according to claim 17 wherein said diabetic vascular disease is selected from the group consisting of renal glomerulosclerosis and proliferative retinopathy.

19. A method for monitoring the efficacy of an agent in increasing levels of PDGF- B in a subject having reduced or non-existent level of PDGF-B comprising administering an effective amount said agent to said subject and determining said level of PDGF-B in said subject following the administration, wherein an increase in the level of PDGF-B is indicative of the efficacy of said agent.

20. A method for determining whether an agent is useful for restoring the number of pericytes in a subject comprising administering to a subject in need thereof an effective amount of said agent and determining a number of pericytes following the administration, wherein an increase in the number of pericytes is indicative of the effect of said agent.