WO1997032886A1 - Ecl labels having improved nsb properties - Google Patents

Ecl labels having improved nsb properties Download PDF

Info

Publication number
WO1997032886A1
WO1997032886A1 PCT/US1997/004150 US9704150W WO9732886A1 WO 1997032886 A1 WO1997032886 A1 WO 1997032886A1 US 9704150 W US9704150 W US 9704150W WO 9732886 A1 WO9732886 A1 WO 9732886A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
analyte
bipyridine
ruthenium
interest
Prior art date
Application number
PCT/US1997/004150
Other languages
French (fr)
Inventor
Jonathan K. Leland
Satyanarayana R. Gudibande
Lihong Shen
Original Assignee
Igen International, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Igen International, Inc. filed Critical Igen International, Inc.
Priority to AU25309/97A priority Critical patent/AU2530997A/en
Publication of WO1997032886A1 publication Critical patent/WO1997032886A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/533—Production of labelled immunochemicals with fluorescent label

Definitions

  • the present invention is particularly directed to modified
  • electrochemiluminescent compounds having improved nonspecific binding properties.
  • the modifications comprises substituent groups which have replaced at least one hydrogen atom on at least one of the aromatic pyridine rings in the unmodified parent compound (typically, ruthenium (II) (2'2'-bipyridine) 3 +2 ).
  • ruthenium (II) (2'2'-bipyridine) 3 +2 typically, ruthenium (II) (2'2'-bipyridine) 3 +2 .
  • the presence of these materials can often be determined by binding methods which exploit the high degree of specificity which characterizes many biochemical and biological systems. Frequently used methods are based on, for example, antigen- antibody systems, nucleic acid hybridization techniques, and protein-ligand systems. In these methods, the existence of a complex of diagnostic value is typically indicated by the presence or absence of an observable "label" which has been attached to one or more of the complexing materials.
  • a preferred label should be inexpensive, safe, and capable of being attached efficiently to a wide variety of chemical, biochemical, and biological materials without changing the important binding
  • the label should give a highly characteristic signal, and should be rarely, and preferably never, found in nature.
  • the label should be stable and detectable in aqueous systems over periods of time ranging up to months. Detection of the label should be rapid, sensitive, and reproducible without the need for expensive, specialized facilities or personnel. Quantification of the label should be relatively independent of variables such as temperature and the composition of the mixture to be assayed. Most advantageous are labels which can be used in homogeneous systems, i.e., systems in which separation of the complexed and uncomplexed labeled material is not necessary. This is possible if the detectability of the label is modulated when the labeled material is incorporated into a specific complex.
  • radioactive labels are quite versatile and can be detected at very low concentrations. However, they are expensive, hazardous, and their use requires sophisticated equipment and trained personnel. Furthermore, the sensitivity of radioactive labels is limited by the fact that the detectable event can, in its essential nature, occur only once per radioactive atom in the labeled material. Moreover, radioactive labels cannot be used in homogenous methods.
  • non-radioactive labels include molecules observable by spectrophotometric, spin resonance, and luminescence techniques, as well as enzymes which produce such molecules.
  • organometallic compounds are useful non-radioactive labeling materials. Because of the rarity of some metals in biological systems, methods which specifically assay the metal component ofthe organometallic compounds can be successfully exploited. For example, Cais, U.S. Patent No. 4,205,952 (1980) discloses the use of immunochemically active materials labeled with certain organometallic compounds for use in quantitating specific antigens.
  • any general method of detecting die chosen metals can be used with these labels, including emission, absorption and fluorescence spectroscopy, atomic absorption, and neutron activation. These methods often suffer from lack of sensitivity, can seldom be adapted to homogeneous system, and as with atomic absorption, sometimes entail destruction of the sample.
  • labels which can be made to luminesce through photochemical, chemical, and electrochemical means are labels which can be made to luminesce through photochemical, chemical, and electrochemical means.
  • Photoluminescence is the process whereby a material is induced to luminesce when it absorbs electromagnetic radiation. Fluorescence and phosphorescence are types of photoluminescence.
  • the present invention is concerned with electrochemiluminescent labels.
  • Suitable labels comprise electrochemiluminescent compounds, including organic compounds and organometallic compounds. Electrochemiluminescent methods of determining the presence of labeled materials are preferred over other methods for many reasons. They are highly sensitive to the presence of a particular labeled analyte, nonhazardous, inexpensive, and can be used in a wide variety of applications including diagnostics. Many organometallic compounds are suitable electrochemical labels, but of particular use are Ru-containing and Os-containing compounds.
  • the present invention is concerned with the use of Ru- containing labels, Os-containing labels and/or related electrogenerated chemiluminescent labels (e.g., Re-containing labels, Ir-containing labels, Rh-containing labels, Pt- containing labels, Pd-containing labels, Mb-containing labels, Tc-containing labels, etc.) which can be detected by a wide variety of methods.
  • Ru-containing labels e.g., Re-containing labels, Ir-containing labels, Rh-containing labels, Pt- containing labels, Pd-containing labels, Mb-containing labels, Tc-containing labels, etc.
  • electrogenerated chemiluminescent labels e.g., Re-containing labels, Ir-containing labels, Rh-containing labels, Pt- containing labels, Pd-containing labels, Mb-containing labels, Tc-containing labels, etc.
  • Ru-containing and Os-containing organometallic compounds have been discussed in the literature. Cais discloses that any metal element or combination of metal elements, including nobel metals from group VIII such as Ru, would be suitable components of organometallic labels detectable by atomic absorption methods. (Cais, column 11, line 20). However, ruthenium is not a preferred metal in Cais, osmium is not specifically mentioned, no data are presented on the efficiency of using Ru oi Os in any of the methods disclosed and the preferred method of detection, atomic absorption. entails destruction of the sample.
  • Weber U.S. Patent No. 4,293,310 (1981), discloses the use of Ru-containing and Os-containing complexes as electrochemical labels for analytes in immunoassays.
  • the disclosed complexes are linked to amino groups on the analytes through a thiourea linkage.
  • Weber also suggests the possibility of forming carboxylate esters between the labels and hydroxy groups on other analytes.
  • the presence of the labeled materials can be determined with an apparatus and method which comprises a quencher and an electrochemical flow cell with light means.
  • the photoelectrochemically active label upon photoexcitation transfers an electron to a quencher molecule; the oxidized molecule is subsequently reduced with an electron from an electrode of the flow cell which is held at suitable potential. This electron is measured as photocurrent.
  • the amount of free labeled analyte in the system is determined by the photocurrent signal. Note that this method is the reverse of electrochemiluminescent detection of luminescent materials.
  • Table 3 of Weber lists dimethylalkyl amines, EDTA, N- methylmorpholine, N,N'-dimethylpiperazine, hydroxide, oxalate, ascorbate, uric acid, and serum as interferents which would presumably raise the practical detection limits substantially above 1.1 x 10 -10 moles/L. These studies were performed with a simple Ru-containing compound. No studies were reported in Weber or Weber et al. regarding the limits of detection of complex substances labeled with Ru-containing labels, or whether the thiourea linkage between the labeled material and label is stable under conditions of the assay.
  • Electrochemiluminescent labels are the focus of the present invention. They can often be excited to a luminescent state without their oxidation or reduction by exposing the compounds to electromagnetic radiation or to a chemical energy source such as that created by typical oxalate-H 2 O 2 systems. In addition, luminescence of these compounds can be induced by electrochemical methods which do entail their oxidation and reduction.
  • a third mechanism for production or electrochemiiuminescence from Ru(bpy) 3 2+ involves the oscillation of an electrode potential between a potential sufficiently negative to produce Ru(bpy) 3 1+ and sufficiently positive to produce Ru(bpy) 3 3+ .
  • These three methods are called, respectively, “oxidative-reduction,” “reductive- oxidation”,” and “the Ru(bpy) 3 3+/+ regenerative system”.
  • the oxidative-reduction method can be performed in water, and produces an intense, efficient, stable luminescence, which is relatively insensitive to the presence of oxygen or impurities.
  • This luminescence from Ru(bpy) 3 2+ depends upon the presence of oxalate or other organic acids such as pyruvate, lactate, malonate, tartrate and citrate, and means of oxidatively producing Ru(bpy) 3 3+ species.
  • This oxidation can be performed chemically by such strong oxidants as PbO 2 or Ce(IV) salt. It can be performed electrochemically by a sufficiently positive potential applied either continuously or intermittently.
  • Suitable electrodes for the electrochemical oxidation or Ru(bpy) 3 2+ are, for example, Pt, pyrolytic graphite, and glassy carbon.
  • chemiluminescence for many hours can be achieved by the presence of an excess ofthe consumed material, or by a continuous supply of the consumed material to the reaction chamber.
  • the reductive-oxidation method can be performed in partially aqueous solutions containing an organic co-solvent such as, for example, acetonitrile.
  • This luminescence depends upon the presents of peroxydisulfate and a means of reductively producing Ru(bpy) 3 1+ species.
  • the reduction can be performed chemically by strong reductants such as, for example, magnesium or other metals. It can be performed electrochemically by a sufficiently negative potential applied either continuously or intermittently.
  • a suitable electrode for the electrochemical reduction of Ru(bpy) 3 2+ is, for example, a polished glassy-carbon electrode.
  • continuous, intense luminescence can be achieved for many hours by inclusion of excess reagents, or by continuous addition of the consumed reagents to the reaction mixture.
  • the Ru(bpy) 3 3+/+ regenerative system can be performed in organic solvents such as acetonitrile or in partially aqueous systems, by pulsing an electrode potential between a potential sufficiently negative to reduce Ru(bpy) 3 2+ and a potential sufficiently positive to oxidize Ru(bpy) 3 2 + .
  • a suitable electrode for such a regenerative systems is, for example, a Pt electrode. This system does not consume chemical reagents and can proceed, in principle, for an unlimited duration.
  • Curtis et al. reports only unpublished observations that Ru complexes can be induced to emit light when chemically excited by an oxalate/H 202 system (Curtis et al. p. 350).
  • analytes of interest and chemical moieties that bind to analytes of interest may be conveniently attached to Ru-containing or Os-containing labels through amide or amine linkages.
  • the labeled materials may then be determined by any of a wide variety of means, but by far the most efficient, reliable, and sensitive means are photoluminescent, chemiluminescent, and electrochemiluminescent means. It is also disclosed herein that
  • electrochemiluminescent labels including Ru-containing and Os-containing labels are particularly versatile and advantageous. The great advantage of the use of these novel labeled materials, and of the methods of detecting them, are further discussed
  • the present invention provides a method of detecting in a predetermined volume of a multicomponent, liquid sample an analyte of interest present in the sample at a concentration below about 10 -3 molar which comprises: a) contacting a sample with a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of combining with the analyte of interest, the contact being effected under appropriate conditions such that the analyte and the reagent combine; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) detecting electromagnetic radiation so emitted and thereby detecting the presence of the analyte of interest in the sample.
  • the invention still further provides electrochemiluminescent compounds and associated processes wherein the compounds have modifications thereon. These modifications are believed to be responsible for the improved performance characteristics of these compounds. These characteristics include decreased nonspecific binding (NSB) of each electrochemiluminescent label in contrast to an unmodified parent label.
  • NSB nonspecific binding
  • the decreased NSB of the modified electrochemiluminescent compounds of the present invention yields more accurate results in assays by decreasing false readings (e.g., false positives or negatives).
  • the modified electrochemiluminescent compounds ofthe present invention are typically derivatives of ruthenium (II) (2,2'-bipyridine) 3 +2 wherein at the 4 position of the chelating ring(s) (expressed in the nomenclature as the 4,4'- positions of the 2,2'-bipyridine ring system), a substituent group has replaced at least one ofthe hydrogen atom on at least one of the aromatic pyridine rings.
  • Figure 1 depicts electrochemiluminescent measurements made for a homogeneous immunoassay for the determination of the concentration of an antigen in solution.
  • Figure 2 graphically depicts the results of a homogeneous ECL theophylline assay.
  • Figure 3 graphically depicts the results of a homogeneous theophylline assay in various sera.
  • Figure 4 graphically depicts the results of an ECL theophylline assay compared to the results of a fluorescence polarization theophylline assay.
  • FIG. 6 graphically depicts the modulation of an ECL signal generated in an ECL digoxin immunoassay.
  • FIG. 7 graphically depicts the results of an ECL digoxin immunoassay.
  • Figure 8 graphically depicts the ECL signal generated by various concentrations of MB I 38-Compound I.
  • Figure 9 shows the results of a Hybridization/Sensitivity Study of MBI 38-Compound I.
  • Figure 10 shows the results of a Specificity Study of MBI 38-Compound I. Description of the Invention
  • ECL moiety "metal-containing ECL moiety” "label,” “label compound,” and “label substance.” are used interchangeably. It is within the scope ofthe invention for the species termed “ECL moiety,” “metal-containing ECL moiety,” “organo-metallic,” “metal chelate.” “transition metal chelate” "rare earth metal chelate,” “label compound.” "label substance” and “label” to be linked to molecules such as an analyte or an analog thereof, a binding partner of the analyte or an analog thereof, and further binding partners of such aforementioned binding partner, or a reactive component capable of binding with the analyte, an analog thereof or a binding partner as mentioned above. The above-mentioned species can also be linked to a combination of one or more binding partners and/or one or more reactive components. Additionally, the
  • aforementioned species can also be linked to an analyte or its analog bound to a binding partner, a reactive component, or a combination of one or more binding partners and/or one or more reactive components. It is also within the scope of the invention for a plurality of the aforementioned species to be bound directly or through other molecules as discussed above, to an analyte or its analog. For purposes of brevity, these ligands are referred to as an assay-performance-substance.
  • detection and quantitation are referred to as "measurement", it being understood that quantitation may require preparation of reference compositions and calibrations.
  • collection and concentration of complex may be used interchangeably to describe the concentration of complex within the assay composition and the collection of complex at, e.g., an electrode surface.
  • molar means the concentration of an analyte in solution in moles per liter or the amount of particulate matter present in a liquid sample in particles or units per liter. For example, 1 x 10 particles per liter may be expressed as 1 molar.
  • heterogeneous assays i.e., assays in which unbound labeled reagent is separated from bound labeled reagent prior to exposure of the bound labeled reagent to electrochemical energy
  • homogeneous assays i.e., assays in which unbound labeled reagent and bound labeled reagent are exposed to electrochemical energy together.
  • the electromagnetic radiation emitted by the bound labeled reagent is distinguishable from the electromagnetic radiation emitted by the unbound labeled reagent, either as an increase or as a decrease in the amount of electromagnetic radiation emitted by the bound labeled reagent in comparison to the unbound labeled reagent, or as electromagnetic radiation of a different wavelength.
  • any reagent which is not combined with the analyte of interest is separated from the sample, which had been contacted with the reagent, prior to exposure of the sample to electrochemical energy.
  • the sample prior to contacting the sample with the reagent, is treated so as to immobilize the analyte of interest.
  • Means for immobilizing analytes of interest are well known within the an and include contacting the sample with a polystyrene, nitrocellulose or nylon surface, or a surface coated with whole cells, subcellular particles, viruses, prions.
  • viroids lipids, fatty acids, nucleic acids, polysaccharides, proteins, lipoproteins, lipopolysaccharides, glycoproteins, peptides, cellular metabolites, hormones, pharmacological agents, tranquilizers, barbiturates, alkaloids, steroids, vitamins, amino acids, sugars, nonbiological polymers, synthetic organic molecules, organometallic molecules or inorganic molecules. Additionally, the analyte of interest may be any of these substances.
  • the analyte of interest is theophylline. In another embodiment of the invention, the analyte of interest in digoxin. In still another embodiment of the invention, the analyte of interest is human chorionic gonadotropin (hCG).
  • the analyte of interest may be a whole cell, subcellular particle, virus, prion, viroid, nucleic acid, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, hormone, pharmacological agent, nonbiological polymer, synthetic organic molecule, organometallic molecule or an inorganic molecule present in the sample at a concentration below about 10 -12 molar.
  • the analyte of interest may be whole cell, subcellular particle, virus, prior, viroid or nucleic acid present in the sample at a concentration below about 10 -15 molar.
  • the reagent which is contacted with the sample may comprise an
  • the agent is an electrochemiluminescent moiety conjugated to an antibody, antigen, nucleic acid, hapten. ligand or enzyme, or biotin avidin or streptavidin.
  • the electrochemiluminescent chemical moiety may comprise a metal -containing organic compound wherein the metal is selected from the group consisting of ruthenium, osmium, rhenium, iridium, rhodium, platinum, palladium, molybdenum and technetium.
  • the metal is ruthenium or osmium.
  • modified electrochemiluminescent compounds of the present invention typically comprise derivatives of compound (a) identified below.
  • compound (a) is not itself a modified compound of the present invention
  • compounds (b) through (1) set forth below represent compounds encompassed by the present invention and/or candidate compounds for inclusion within the present invention:
  • R 1 and R 2 may be the same or different, and each of R 1 and R 2 is selected from the group consisting of H, CH 3 , CH 2 CH 3 , and
  • R 1 and R 2 may be the same or different, and each of R 1 and R 2 is selected from the group consisting of H, CH 3 , CH 2 CH 3 , and CH 2 CH 2 CH 3 ;
  • n is an integer ranging from 1 to 10, inclusive;
  • the modified electrochemiluminescent compound exhibits decreased nonspecific binding relative to ruthenium (II) (2,2'-bipyridine) 3 +2 .
  • the common characteristic of the modified electrochemiluminescent compounds of the present invention is that, for at least one hydrogen atom at the 4-position of at least one of the pyridine rings, that hydrogen atom has been replaced by a substituent group.
  • corresponding salts In addition to the above-identified compounds, applicants' invention includes the conesponding salts thereof. As explained below, the skilled artisan would understand the term "corresponding salts" to have the following two distinct yet related meanings: First, note mat the charge on the central ruthenium metal cation is positive two (+2). Consequently, when all of the substituent groups possess neutral valence (i.e., they are not charged either positive (+) or negative (-)), then the term “corresponding salts” encompasses anions. externally located relative to the central metal - ligand complex, which counterbalance the noted positive two charge. Anions such as PF 6 -1 and Cl -1 are examples of species which could form the remaining portion of the salt having the central ruthenium metal cation.
  • a substituent group may exist in one or more different valences then the claimed compound encompass all such variants of that substituent group.
  • Two examples of this are identified below.
  • -COOH represents a carboxylic acid group having a neutral valence (0)
  • -COO -1 represents a carboxylate group having a negative one (-1) valence due to the donation of a proton (H +1 ).
  • - NH 2 represents an amine group having a neutral valence (0) while -NH 3 + 1 represents an ammonium group having a positive one (+1) valence due to the acceptance of H +l .
  • the primary trait thought to be attributable to the presence of the substituent groups is that the compound as a whole exhibits decreased nonspecific binding.
  • the noted substituent groups may somehow prevent or diminish at least one of the six (6) aromatic pyridine rings from participating in interactions which culminate in nonspecific binding of the electrochemiluminescent label. This in turn may contribute to and/or cause the claimed compounds as a whole to exhibit decreased nonspecific binding relative to ruthenium (II) (2,2'-bypridine) 3 +2 .
  • the above symbol represents the analyte of interest having two distinct and noninterfering epitopes of interest: namely, a left portion and a right portion.
  • the above symbol represents a modified electrochemiluminescent label ofthe present invention. Specifically, the "*" left portion represents the
  • electrochemiluminescent portion while the right portion represents a detection binding partner of the analyte of interest.
  • the above symbol represents a magnetic bead (MB) coated with streptavidin (SA) with the streptavidin binded to a capture binding partner of the analyte of interest.
  • SA streptavidin
  • the far left portion of this drawing represents a capture binding partner of the analyte of interest and having a biotinylated (BT) far right portion suitable for biotin streptavidin interaction with the coated magnetic beads as illustrated.
  • the above symbol represents a "sandwich” assay wherein the analyte of interest is sandwiched between (a) on the left side, an electrochemiluminescent label having its corresponding detection binding partner for that analyte: and (b) on the right side, a capture binding partner for that analyte which is linked to a magnetic bead through biotin - streptavidin interactions.
  • the illustrated binding interaction between the electrochemiluminescent label and the analyte represents a desired specific binding.
  • specifically bound labels are related to the quantity of detectable signal generated for that assay (i.e., the light emitted through electrochemiluminescence).
  • nonspecific binding covers the undesired situation when the label binds to a component of the assaying system other than the analyte of interest.
  • nonspecific binding may include this label binding with any one of the following components:
  • solid phase material such as a magnetic bead having a streptavidin coating
  • Nonspecific binding of the electrochemiluminescent label effects the measured signal by introducing a source of error in the measured signal.
  • nonspecific binding may cause the experimentally measured signal to be either higher or lower than its true value.
  • the true value would represent the electrochemiluminescence which would be produced by an ideal electrochemiluminescent label that only participates in sought-for specific binding interactions and does not participate in any nonspecific binding interactions.
  • the sample may be derived from a solid, emulsion, suspension, liquid or gas. Furthermore, the sample may be derived from water, food, blood, serum, urine, feces, tissue, saliva, oils, organic solvents or air. Moreover, the sample may comprise acetonitrile, dimethylsulfoxide. dimethyl formamide, n-methyl-pyrrolidinone or tert-butyl alcohol. The sample may comprise a reducing agent or an oxidizing agent.
  • the present invention also provides a competitive method for detecting in a predetermined volume of a multicomponent.
  • liquid sample an analyte of interest present in the sample at a concentration below about 10 -3 molar which comprises: a) contacting the sample with a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of competing with the analyte of interest for binding sites on a complementary material not normally present in the sample, and with the complementary material, the contact being effected under appropriate conditions such that the analyte of interest and the reagent
  • the contact being effected under appropriate conditions such that the analyte of interest and the reagent competitively bind to the complementary material; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effected to induce the reagent to
  • the reagent may be the analyte of interest conjugated to an
  • electrochemiluminescent chemical moiety or an analogue of the analyte of interest conjugated to an electrochemiluminescent moiety.
  • the analyte of interest may be theophylline, digoxin or hCG.
  • the complementary material may be a whole cell, subcellular particle, virus, prion, viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, cellular metabolite, hormone, pharmacological agent, tranquilizer.
  • the present invention provides a method for quantitatively determining in a predetermined volume of a multicomponent, liquid sample, the amount of an analyte of interest present in the sample which comprises: a) contacting the sample with a known amount of a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of combining with the analyte of interest, the contact being effected under appropriate conditions such that the analyte and reagent combine; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) quantitatively determining the amount of radiation so emitted and thereby quantitatively
  • This method may be performed as a heterogeneous assay or as a homogeneous assay.
  • any reagent which is not combined with the analyte of interest is separated from the sample, which had been contacted with a known amount of the reagent, prior to the exposure of the sample to an amount of
  • the sample prior to contacting the sample with the reagent, is treated so as to immobilize the analyte of interest.
  • the analyte of interest may be a whole cell, subcellular particle, virus, prion. viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein,
  • the analyte of interest is theophylline.
  • the analyte of interest is digoxin.
  • the analyte of interest is hCG.
  • the reagent with which the sample is contacted may be an
  • the reagent is a electrochemiluminescent chemical moiety conjugated to an antibody, antigen, nucleic acid, hapten, ligand or enzyme, or biotin. avidin or streptavidin.
  • the electrochemiluminescent moiety may be a metal-containing organic compound wherein the metal is selected from the group consisting of ruthenium, osmium, rhenium, iridium. rhodium, platinum, palladium, molybdenum and technetium. In one embodiment of the invention the metal is ruthenium or osmium.
  • the sample may be derived from a solid, emulsion, suspension, liquid or gas.
  • samples which comprise the analyte of interest may be derived from water, food, blood, serum, urine, feces. tissue, saliva, oils, organic solvents or air. Additionally, samples may comprise acetonitrile. dimethylsulfoxide, dimethylformamide. n- methylpyrrolidinone or tert-butyl alcohol, furthermore, the sample may comprise a reducing agent or an oxidizing agent.
  • the invention also provides a competitive method for quantitatively determining in a predetermined volume of a multicomponent, liquid sample the amount of an analyte of intere?; present in the sample.
  • This method comprises: a) contacting the sample with a known amount of a reagent (i) capable of being induced to repeatedly emit
  • electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of competing with the analyte of interest for binding sites on a complementary material not normally present in the sample, and with a known amount of the
  • the contact being effected under appropriate conditions such that the analyte of interest and the reagent competitively bind to the complementary material; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) quantitatively determining the amount of radiation so emitted and thereby quantitatively determining the amount of the analyte of interest present in the sample.
  • the analyte of interest may be theophylline, digoxin or hCG.
  • the reagent is the analyte of interest conjugated to an electrochemiluminescent chemical moiety or an analogy of the analyte of interest conjugated to an electrochemiluminescent chemical moiety.
  • the complementary material may be a whole cell, subcellular particle, virus. prion, viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein.
  • lipopolysaccharide glycoprotein, peptide, cellular metabolite, hormone, pharmacological agent, tranquilizer, barbiturate, alkaloid, steroid, vitamin, amino acid, sugar, nonbiological polymer, synthetic organic molecule, organometallic molecule or inorganic molecule.
  • This compound may comprise a composition of matter having the structure X-(Y) n -Z wherein X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and Z represents the compound provided by this invention.
  • the invention provides a compound having the structure
  • n is an interger .
  • n is 2 wherein R is an anion and n is an integer. In one embodiment of the invention, n is 2.
  • the compound may comprise a composition of matter having the structure
  • X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and z represents the compound provided by this invention.
  • the invention further provides a compound having the structure
  • R is an ion and m and n are integers. In one embodiment of the invention, m is 5 and n is 3.
  • This compound may comprise a composition of matter having the structure
  • X-(Y) n -z wherein X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and z represents the compound provided by this invention.
  • X is theophylline.
  • X is digoxigenin.
  • X is a peptide derived from hCB.
  • X represents one or more nucleotides which may be the same or different
  • z represents an electrochemiluminescent chemical moiety
  • n an integer greater than or equal to 1 ;
  • n represents an integer greater than or equal to 1.
  • x is thymidine attached to CH at carbon 5
  • n is 7 and m is 3.
  • z is bis (2,2' - bipyridine) [4 -(butan-1- al)-4' methyl 1-2,2'-bipyridine] ruthenium (II).
  • the thymidine nucleotide is a 3' terminal nucleotide attached to the nucleotide sequence
  • composition of matter having the structure
  • T represents theophylline
  • Y represents a linker group attaching T to Z
  • Z represents bis-(2,2'- bipyridine) [4-methyl-2,2'-bipyridine-4'-yl] ruthenium (II)
  • R represents an anion.
  • Y is attached to the carbon at position 8 of T.
  • Y has the structure
  • Y has the structure
  • n and r represent an integer, which may be the same or different, greater than or equal to 1. In one embodiment of the invention, m is 1, n is 1 and r is 4.
  • Y has the structure
  • n, r represent an integer, which may the same or different, greater or equal to 1. In one embodiment of the invention, m is 1, n is 1 and r is 4.
  • Y is attached to the nitrogen at position 7 of T. In one embodiment of the invention. Y has the structure
  • n is 4.
  • hexahydrate was measured in a 15 ml three-neck, round bottom flask containing 10 ml of a solution prepared as described below; a 1.5mm x 10 mm magnetic stir bib; a 1.0mm diameter silver wire quasi-reference electrode; a combination 28 gauge platinum wire counter electrode; and a working electrode consisting of a 22 gauge platinum wire welded to a 1 cm x 1 cm square piece of 0.1 mm thick, highly polished platinum foil. (The working platinum foil electrode was shaped into 3/16 of an inch diameter semicircle surrounding the 28 gauge platinum wire counter electrode by 3/32 of an inch equidistantly.)
  • the silver wire was connected to the EG&G Model 178 electrometer probe of the EG&G Model 173 potentiostat/galvanostat.
  • the platinum wire counter electrode and the platinum working electrode were connected to the anode and cathode respectively ofthe EG&G Model 173 potentiostate.
  • the device was grounded.
  • Cyclic voltammetry was performed with the EG&G Model 173 potentiostat to which an EG&G Model 175 universal programmer was attached.
  • the programmer was set or 100 mV/second sweeps between +1.75 volt anodic and 180 volt cathodic potentials.
  • Electrochemiluminescence was detected using a Hamamatsu R928 photomultiplier tube, set inside a Products for Research Model PR1402RF photomultiplier tube housing which was fitted with a Kodak #23 A gelatin (red) filter.
  • the multiplier tube housing was connected to an Oriel Model 7070 photomultiplier detection system.
  • the cyclic voltammogram was recorded on a Houston Instruments Model X-Y recorder.
  • Cyclic voltammograms were generated for ImM tris (2,2' - bipyridyl) ruthenium (II) chloride hexahydrate (Aldrich Chemical Company), 0.1M tetrabutylammonium tetrafluoroborate (TBABF 4 ) (Aldrich Chemical Company) solutions prepared with the following organic solvents: acetonitrile, n-dimethylformamide; dimethyl-sulfoxide and 1 -methyl, 2-pyrrolidinone (Aldrich Chemical Company). Tert-butyl alcohol and deionized.
  • distilled water (1 :1, v/v) also was used to make a solution containing 1 mM tris (2, 2'-bipyridyI) ruthenium (( chloride hexahydrate and 0.1 M TBABF 4 .
  • the resulting voltammograms did not indicate any change in the redox potential of the tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate upon variation of the organic solvent.
  • solutions were prepared as follows: sufficient amounts of tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate and TBABF 4 were dissolved in the spectroscopic grade organic solvents (Aldrich chemical Company) described above to provide final concentrations of ImM and 0.1M, respectively. 10ml of the resulting solution was then added to the 15 ml three-neck round bottom flask. The electrodes were immersed in the solution and the working electrode pulsed between a +1.75 and -1.45 volt potential to generate
  • Electrochemiluminescence was visually observed in each of the solutions described above.
  • electrochemiluminescence solutions were prepared as follows: sufficient amounts of tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate and TBABF 4 were added to the organic solvents described above to provide final concentrations of 2mM and 0.2M respectively. To an aliquot of this solution was added an equal volume of deionized, distilled water containing a strong oxidizing ammonium persulfate. at a concentration of 36 mM. Control solutions that did not contain the tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate were prepared. 10M ⁇ ml of the resulting solution was then added to the 15 ml three-neck round bottom flask. Electrochemiluminescence was accomplished by pulsing for one second intervals, between zero and -2.0 volts cathodic potential.
  • Electrochemiluminescent measurements were performed by integrating the resulting electrochemiluminescent photomultiplier tube signal using an integrator connected to a Micronta Model 22191 digital multimeter. The electrochemiluminescent signal was integrated for 10 seconds during the pulsing and recorded in millivolts. The results are shown in Table I and indicate that variation of solvents effects quantum efficiency of the ruthenium (II) chloride.
  • the silver wire was connected to the EG&G Model 178 electrometer probe of the EG&G Model 173 potentiostat/galvanostat.
  • the platinum wire counter electrode and the platinum working electrode were connected to the anode and cathode respectively of the EG&G Model 173 potentiostate.
  • the device was grounded.
  • the electrochemiluminescence emitted from the ruthenium-labeled rabbit anti-mouse IgG antibody solution was detected using an Hammatsu R928 photomultiplier tube, set inside a Products for Research Model PR1402RF photomultiplier tube housing which was fitted with a Kodak #23A gelatin (red) filter.
  • the photomultiplier tube housing was connected to an Oriel Model 7070 photomultiplier detection system.
  • Electrochemiluminescence was induced by pulsing for one second intervals, between zero and -2.0 olts cathodic potential. Electrochemiluminescent measurements were performed by integrating the resulting electrochemiluminescent photomultiplier tube signal using an integrator connected to a Micronta Model 22191 digital multimeter. The electrochemiluminescent signal was integrated for 10 seconds during the pulsing and recorded in millivolts.
  • a stock solution of 1.25 x 10 -7 M ruthenium-labeled rabbit anti-mouse IgG antibody was prepared from a concentrated solution (2 mg/ml, 7.5 Ru/antibody) of the labeled antibody by dilution in phosphate-buffered saline (PBS). An aliquot of this solution (80 microliters) was added to 10 ml of dimethylsulfoxide (DMSO)/deionized. distilled water (1 :1) containing 0.1 M tetrabutylammonium tetrafluoroborate (TBABF 4 ) and 18 mM ammonium persulfate in the reaction vessel. The final ruthenium-labeled antibody concentration was 1 x 10 -9 M. Electrochemiluminescence was measured as described above.
  • a solution containing 7.8 X 10 -6 M bovine serum albumin (BSA) labeled with 4,4' - (dichloromethyl) - 2,2'-bipyridyl, bis (2,2' bipyridyl) ruthenium (II) (ruthenium-labeled bovine serum albumin) was prepared from a stock solution of ruthenium-labeled BSA (2.0 mg/ml, 6 Ru/BSA) by dilution in phosphate-buffered saline. 26 microliters of this solution were added to 10 ml of DMSO/deionized. distilled water (1 :1) containing 0.1 M TBABF 4 and 18 mM ammonium persulfate in the reaction vessel. The final ruthenium- labeled BSA concentration was 2 x 10 -8 M. Electrochemiluminescence was measured as described in Example V.
  • a solution containing 1.25 x 10 -6 M rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl) - 2,2' - bipyridyl, bis(2,2' bipyridyl) ruthenium (II) (ruthenium- labeled, rabbit anti-mouse IgG antibody) was prepared from a stock solution of ruthenium-labeled, rabbit anti-mouse IgG antibody (2mg/ml, 7.5 Ru/antibody) by dilution in phosphate-buffered saline. 80 microliters of this solution were added to 10 ml ofDMS)/deionized. distilled water ( 1 : 1) containing 0.1M TBABF 4 and 18mM
  • Electrochemiluminescent measurements are shown in Table VIII for covalently-coupled, ruthenium-labeled rabbit anti-mouse IgG antibody and unlabeled rabbit anti-mouse IgG antibody.
  • a solution containing 7.8 x 10 -6 M bovine serum albumin (BSA) labeled with 4,4' - (dichloromethyl-) - 2,2' bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) (ruthenium- labeled bovine serum albumin) was prepared from a stock solution of ntthenium-labeled BSA (2.5 mg/ml, 6 Ru/BSA) by dilution in phosphate-buffered saline (PBS).
  • a solution containing 3.75 x 10 -5 M rabbit anti-BSA antibody was prepared from a stock solution of rabbit anti-BSA antibody (6.0 mg/ml) by dilution in PBS, and an aliquot (26 microliters) was added to the solution of ruthenium-labeled BSA in the reaction vessel to give a final rabbit anti-BSA antibody concentration of 1 x 10 -7 M.
  • electrochemiluminescent immunoassay for detecting other analytes of interest may be developed.
  • a solution containing 6.25 x 10 -6 M rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl-) - 2,2' bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) (ruthenium- labeled rabbit anti-mouse IgG antibody) was prepared from a stock solution of ruthenium-labeled rabbit anti-mouse IgG antibody (2 mg/ml, 7.5 Ru/antibody) by dilution in phosphate-buffered saline (PBS). 80 microliters of this solution were added to 10 ml of DMSO/deionized.
  • a solution containing 2.5 x 10 -5 mouse IgG was prepared from a stock solution of mouse (IgG (4.0 mg/ml) by dilution in PBS, and different aliquots (20 microliters and 40 microliters) of this solution ere added to the solution of ruthenium-labeled, anti-mouse IgG antibody in the reaction vessel to give final mouse IgG concentrations of 5 x 10 -8 and 1 x 10 -7 M, respectively.
  • Example 7 Heterogeneous Electrochemiluminescent Immunoassay for Legionella Using a Mouse Anti-Legionella Immunoglobulin G (IgG) Antibody and Ruthenium-Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
  • a formalinized suspension of the bacterium Legionella micdadei was adjusted to an optical density (at 425nm) of 1.00 by dilution with PBS buffer. Approximately 3 x 10 9 cells were added to a conical microcentrifuge tube. The cells were centrifuged (10 minutes. 10.000 RPM). the supernatant decanted, and the cells resuspended in a 1 :50 dilution of a mouse monoclonal IgG antibody, (1.45 mg/ml) specific for Legionella micdadei. in PBD ( 1 ml).
  • the cells were centrifuged, the supernatant decanted, the cells resuspended in PBS buffer and centrifuged again. Following decantation of the supernatant, the cells were resuspended in a 1:50 dilution (in PBS) of rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl) - 2,2' - bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) i.e. ruthenium- labeled rabbit anti-mouse IgG antibody, (2 mg/ml, 7.5 Ru/antibody). After incubation at room temperature for 1 hour, the cells were centrifuged, the supernatant decanted, and the cells resuspended in PBS and washed twice, with centrifugation. as before.
  • the cells were resuspended in 200 microliters of PBS.
  • 100 microliters of the cell suspension was added to the reaction vessel containing 10 ml of DMSO/deionized, distilled water (1 : 1) containing 0.1 M TBABF 4 and 19mM ammonium persulfate and transferred to the reaction vessel.
  • the electrochemiluminescence was measured for the cell suspension.
  • Another 100 microliters of the cell suspension was added to the reaction vessel and electrochemiluminescence measured.
  • Electrochemiluminescence was measured for the solution without cells as a control according to the method described in Example 2.
  • the results shown in Table IX indicate a heterogeneous electrochemiluminescent immunoassay for Legionella using ruthenium- labeled rabbit anti-mouse IgG antibody has been successfully carried out.
  • Example 8 Homogeneous Electrochemiluminescent Immunoassay for Legionella Using a Mouse Anti-Legionella Immunoglobulin G (IgG) Antibody and Ruthenium-Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
  • a suspension of the bacterium Legionella micdadej was prepared and incubated with a mouse monoclonal IgG antibody specific for Legionella as described in Example 9.
  • the cells were centrifuged, washed, and resuspended in 0.2 ml of PBS.
  • ruthenium-labeled rabbit anti-mouse IgG antibody (1.25 x 10 -6 M) was added to the cell suspension, and the mixture was incubated for 2 hours at room temperature.
  • ruthenium-labeled, rabbit anti-mouse IgG antibody was incubated in the same way in the absence of the cell suspension.
  • the solution of labeled antibody was added to 10 ml of DMSO/deionized, distilled water (1:1) containing 0.1 m TBABF 4 and 18mM ammonium persulfate in the reaction vessel to give a final ruthenium-labeled, rabbit anti-mouse IgG antibody concentration of 1 x 10 -8 M.
  • the electrochemiluminescence was measured as described in Example 2. The same procedure was followed for the cell suspension with added ruthenium-labeled rabbit anti- mouse IgG antibody.
  • a formalinized suspension of the bacterium Legionella micdadei was adjusted to an optical density (at 425nm) of 1.00 by dilution with PBS buffer and 2 ml of this suspension were added to a conical microcentrifuge tube. The cells were centrifuged (10 minutes, 10,000 RFM), the supernatant decanted, and the cells were resuspended in a 1 :10 dilution in PBS (0.5 ml) of a mouse monoclonal IgG antibody, (1.45 mg/ml) specific for Legionella micdadei.
  • the cells were centrifuged as before, the supernatant was decanted, and the cells resuspended in PBS and washed twice, with centrifugation as before. Following the last wash the cells were resuspended in 100 microliters of either PBS or 1.0M acetic acid - 0.9%NaCl (normal saline) solution and incubated at room temperature for 40 minutes. After centrifugation, 100 microliters of the cell supernatant fluid was transferred into the reaction vessel along with 10 ml of DMS)-deionized, distilled water (1 :1) containing 0.1 M TBABF 4 and 18 mM ammonium persulface.
  • the electrochemiluminescence ofthe acetic acid/normal saline cell supernatant fluid and for the supernatant fluid from the PBS washed cells was measured according to the method described in Example 2.
  • the electrochemiluminescence measurements are shown in Table XI, and demonstrate that the elution of the ruthenium-labeled, rabbit anti-mouse IgG from the monoclonal antibody coated Legionella bacteria by treating the cells with 1.0M acetic acid-normal saline (Ref.23) results in an increase in the electrochemiluminescence generated by the unbound ruthenium-labeled antibody.
  • These results also show that the ruthenium labeled antibody is bound to the monoclonal antibody-coated Legionella, and that the PBS wash did not result in an increase in ECL in comparison to the background signal.
  • a blood sample containing Hepatitis B surface antigen (Hbsag) is contacted for a suitable time with an antibody specific for the Hbsag and labeled with dextranase.
  • the antibody not bound to Hbsag is removed and the antigen-antibody complex is contacted with a dextran polymer labeled with an electrochemiluminescent moiety. Action ofthe dextranase on the labeled polymers will result in the production of fragments each labeled with the electrochemiluminescent moiety.
  • the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the
  • electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of Hepatitis B surface antigen present in the sample determined therefrom.
  • a sample containing nucleic acid hybrids, such as double stranded RNA is contacted with an electrochemiluminescent moiety that specifically intercalates into nucleic acid hybrids. After a suitable amount of time the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of nucleic acid hybrids present in the sample determined therefrom.
  • a saliva sample containing HTLV-III complexed to antibody is contacted with a solution containing a chaotopic agent to disrupt the antigen-antibody complexes. This solution is then contacted with an antibody specific for HTLV-III and labeled with an
  • electrochemiluminescent moiety The chaotopic agent is removed allowing the labeled and unlabeled antibodies to recombine with antigen. After a suitable amount of time the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the
  • electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of human T-cell leukemia virus III (HTLV- III) antigen present in the sample determined therefrom.
  • HTLV- III human T-cell leukemia virus III
  • the yellow oil was purified on a solica gel column using ethyl acetate/toluene (1 :1) as the eluant, the impurity being eluted with methanol.
  • the precipitate was dissolved in hot water and recrystallized by adding perchloric acid to the solution to produce bright orange crystals which were then filtered, washed with cold water and dried. This recrystallization procedure was reported, yielding a total of 150 mg bright orange crystals.
  • the resulting residue was dissolved in approximately 1-3 ml of methanol, loaded onto a Sephadex LH-20 chromatography column (75 cm x 3 cm) and eluted at a flow rate of about 0.4-0.7 ml/min.
  • a bright red band (product) was closely followed by a brown, nonluminescent band (impurity) and two luminescent bands.
  • the red product band was found to be contaminated with a small amount of the material from the brown, nonluminescent band. This contaminating material was separated from the product by running the sample on a second Sephadex LH-20 column under similar conditions.
  • the red product was obtained by stripping the solvent off by rotoevaporation.
  • the resulting solid material was dissolved in approximately 1 ml of methanol and reprecipitated in approximately 75 ml of diethyl ether to yield an orange powder which was collected by titration.
  • the Ru(II)-Compound III Conjugate described in Example 33 was diluted to a final concentration of 150 nM using 0.1M phosphate buffer. pH 6.0, containing 0.35 M sodium fluoride (PBF Buffer).
  • Monoclonal antibody (clone number 9-49. ascites lot number WO399, cat number 046) specific for theophylline was obtained from Kallestad Laboratories, Inc. (Chaska. MN).
  • the monoclonal antibody was diluted to different concentrations using PBF Buffer (between 21.9 micrograms of protein/ml to 700 micrograms/ml).
  • control MAB Another monoclonal antibody that was not reactive wim theophylline was obtained from Sigma (St. Louis. MO) and was diluted to different concentrations between 21.9 micrograms of protein/ml to 700 micrograms/ml using PBF Buffer.
  • a standard solution of theophylline was prepared using theophylline obtained from Aldrich Chemical Co., (Milwaukee. WI, cat number 26-140-8, M.W. 180.17). Theophylline was dissolved in PBF Buffer to give a final concentration of 75 micromolar and was diluted with PBF Buffer to 6 micromolar for use in assays.
  • Electrochemiluminescence The electrodes were cleaned between measurements by rinsing with a buffer at pH 4.? containing 0.1 M phosphate. 0.1 M citrate, 0.025 M oxalic acid, and 1% Triton X-100; pulsing the electrodes in this solution between +2.2 to -2.2 volts for 60 sec; and followed by +2.2 volts for 10 seconds. Next die electrodes were removed from this solution, rinsed in distilled water and wiped dry. The experiment was carried out as outlined in Table XIV.
  • a solution of control monoclonal antibodies, antibodies to theophylline or PBF Buffer was added to a set of test tubes (Step 1 ).
  • a solution of theophylline or PBF Buffer was added (Step 2).
  • the solutions were mixed by briefly shaking the test tubes and allowed to react for 25 min at room temperature.
  • a solution of Ru(II)- Compound III Conjugate was added to the tubes (Step 3).
  • the test tubes were shaken and kept at room temperature for 15 min.
  • 100 microliters of the ECL solution was added to each tube and electrochemiluminescence was measured as described above. The results are listed in Table XV.
  • Example 19 Assay for Theophylline in Serum Based on a Homogeneous
  • theophylline was developed using antibody to theophylline and die Ru (II) - Compound III Conjugate described in Example 33 in a competitive binding format.
  • the materials used were described in Example 34 except the PBF buffer was 0.1M phosphate buffer, ph 6.0. containing 0.1 M sodium fluoride.
  • a specific concentration of monoclonal antibody to theophylline was chosen. The antibody concentration was 55 micrograms/ml.
  • the Ru (II) - Compound III Conjugate concentration was adjusted to 175 nM. theophylline was added to human serum to give final concentrations of 2.5, 5, 10, 20 and 40 micrograms of theophylline/ml of serum.
  • the assay was performed by adding 10 microliters of serum to 290 microliters of anti- theophylline monoclonal antibody and holding the solution at room temperature for 25 min. Then 100 microliters Ru (II) - Compound III Conjugate were added to each tube to give a final concentration of 35 NM and holding this solution at room temperature for 15 min. 100 microliters of the ECL solution described in Example 34 were then added to each tube and electrochemiluminescent properties of the solutions were measured as previously described using a sweep mode for 1.5 volts to 2.5 volts at 50 mv/sec. The data are shhown in Fugure 2 and demonstrate that there is a correlation between me concentration of theophylline in a serum sample and the amount of
  • Example 20 Assay for Theophylline in Serum Based on a Homogeneous
  • Theophylline (1, 3-dimethylxanthine) was separated from serum proteins by precipitation of the latter with acetonitrile.
  • the supernatant fluid containing theophylline was run on an HPLC system equipped with a Waters Associates Micro Bondapak C18 column, (3.9 mm x 30 cm). The chromatogram was completely resolved in less man 10 min.
  • the following reagents were used: sodium acetate (reagent grade), deionized water (purified by the Millipore Milli Q • system), acetonitrile (HPLC grade) and theophylline standard, (Sigma).
  • the solvent used for precipitating the serum proteins was a 20 mM sodium acetate buffer, pH 4.0, containing 14% (v/v) acetonitrile.
  • the HPLC mobile phase buffer was 10 mM sodium acetate buffer, pH 4.0, containing 7% (v/v) acetonitrile.
  • the flow rate was 1.5 ml/min., and the eluant was monitored by a UV spectrophotometer set at 270 nm.
  • the sensitivity of the UV absorbance detector was set at 0.02 Absorbance units Full Scale (AUFS).
  • the ambient temperature ranged typically between 22°C and 24°C.
  • the slope of the curve was 1.197, demonstrating excellent recovery of the theophylline from the serum sample for the homogeneous electrochemiluminescent immunoassay compared to a standard mediod based on HPLC.
  • the homogeneous electrochemiluminescence assay offers advantages over the HPLC mediod because of the speed, sensitivity and ability to easily handle multiple samples. Based on these results, one skilled in the art would know that homogeneous electrochemiluminescent immunoassays for detecting analytes of interest, which may be detected by HPLC and similar methods, may be developed.
  • Biomag • -amine particles Advanced Magnetic. Inc., Cambridge. MA
  • PBS phosphate buffered saline
  • NP-40 Nonidet P-40
  • the activated Biomag • particles were washed as described above for a total of 4 washes and transferred to a T-flask.
  • the activated Biomag • wet cake was washed 3 times with 20 ml of 1% BSA/0.15M PBS/0.1% azide (pH 7.4), the first wash lasting for approximately 30 min. using a rotary mixer.
  • Example 22 Assay for theophylline in serum based on a heterogeneous electrochemiluminescent assay.
  • a heterogeneous assay for theophylline was developed using a Compound I labeled anti-theophylline antibody and theophylline BSA immobilized on Biomag • magnetic particles.
  • the antibody concentration was 20 micrograms/ml.
  • the magnetic particle concentration was 1% solids (wt/vol).
  • Theophylline was added to a final concentration of 10 and 40 micrograms/ml of serum.
  • the theophylline serum standards were diluted 1000 fold in PBF Buffer (sodium phosphate buffer, pH 7.0. 0.1 M sodium fluoride) containing 0.1% BSA.
  • the assay was performed by the addition of 75 microliters of the diluted serum standards to 75 microliters of antibody conjugated to Compound I and incubating the solution at room temperature for 20 min. Then 50 microliters of the theophylline-BSA- Biomag • particles were added and the suspension was allowed to stand for 5 min. The particles were separated magnetically and 100 microliters of the supernatant was measured for electrochemiluminescence as described in Example 48.
  • Monoclonal antibody to digoxin was diluted to the following concentrations in immunoassay buffer:
  • Compound II-Digoxigenin conjugate (50 micromolar) was diluted to 150 nM in immunoassay buffer (0.1 M phosphate buffer, pH 6.0. containing 0.1M sodium fluoride).
  • a homogenous electrochemiluminescent immunoassay for digoxin may be developed using antibody to digoxin and the
  • Compound II-Digoxigenin conjugate using a competitive binding assay format the reagents which may be used have been described in Example 23.
  • a specific concentration of monoclonal antibody to digoxin would be chosen, the antibody concentration may be between 75 to 100 micrograms per ml.
  • the Compound II- digoxigenin conjugate concentrations may be between 5-15 nM (Final concentration).
  • digoxin Standard would be added to human serum to give a final concentration of 0.1, 0.5, 1, 2, 4, 8 and 16 nanograms of digoxin per ml of serum.
  • the assay may be performed by adding 10-30 microliters of serum to 300 microliters of anti-digoxin monoclonal antibody and holding the solution at room temperature of 30 min. Then 100 microliters of the Compound II-Digoxigenin conjugate may be added to each tube to give a final concentration within the range of 5 to 15 nM and incubating the solution at room temperature for 20 min. 100 microliters of me ECL solution previously described may be added to each tube and ECL may be measured as previously described.
  • ECL Buffer concentrations in 0.15 M phosphate buffer, pH 7.0. containing 0.1% BSA and 0.15 M NaF (hereinafter ECL Buffer): 80 ng/ml. 40 ng/ml. 20 ng/ml. 10 ng/ml. 5 ng/ml and 0 ng/ml.
  • the sample was placed into a Berthold instrument and the electrochemiluminescence was measured as previously described except the procedure was modified by stepping the applied potential from open circuit to 2.2V and integrating the photon counts for 10 sec.
  • the electrode was cleaned between measurements using phosphate-citrate buffer as follows:
  • Example 26 Labeling DNA with an electrochemiluminescent moiety
  • DNA eluted in fractions 9 and 10 were well separated from unreacted ruthenium bipyridyl complex, the collected DNA sample exhibited typical UV absorption and additionally showed a fluorescent emission spectrum at 620 nm when excited at 450 nm.
  • the fluorescent emission shows the presence of the ruthenium bipyridyl moiety in the DNA sample.
  • the product travels as a single orange fluorescent band on polyacrylamide gel electrophoresis.
  • the electrophoretic mobility of the labeled DNA (MBI 38-Compound I Conjugate) is approximately the same as the unlabeled DNA.
  • the ruthenium complex was first converted into an N-hydroxysuccinimide derivative by dissolving 3 mg in 60 microliters of anhydrous dimethvlformamide and treating it with a solution of N-hydroxysuccinimide (52 mg) in 200 microliters of anhydrous DMF in the presence of 94 mg dicyclohexyicarbodiimide (DCC). The reaction was allowed to proceed for 4 hrs at 0°C. Precipitated dicyclohexylurea was removed by centrifugation and the supernatant (200 microliters) was added to the solution of amino-linked DNA (described in Synthesis A) in .01 M phosphate buffer pH 8.77 (2A 260 in 100 microliters of buffer).
  • the labeled DNA sample from Example 26, Synthesis A (MBI 38-Compound I) was used to study its electrochemiluminescent properties.
  • Various concentrations of labeled DNA were dissolved in 0.5 ml of 0.1 M phosphate buffer, pH 4.2, containing 0.1 M citrate 25 nM oxalate and 1.0% Triton X-l 00 and measured on a modified Berthold luminometer.
  • Figure 8 shows the response of the electrochemiluminescent signal to various DNA concentrations.
  • the complementary strand to the 38 mer described in Example 27 was synthesized using the ABI model 380 B DNA Synthesizer and was designated MGEN-38.
  • Concentrations of MGEN-38 DNA ranging from 50 ng down to 0.05 ng, were spotted on a nylon membrane and allowed to air dry. Duplicate membranes were set up. The blots were treated for 2 min each in : 1.5M NaCl-0.5M NaOH to fully denature the DNA; 1.5M. NaCl-0.5M TRIS to neutralize the blot, and finally in 2X SSC. The blot was baked in a vacuum oven at 80°C for 2 hrs.
  • the hybridization probe was prepared as follows: 3 micrograms of MBI 38 and MBI 38- Compound I were kinased with 10 units of T4 kinase and 125 microcuries of gamma 32 P- ATP. The percentage of isotope incorporation into DNA was determined and shown below.
  • Prehybridization and hybridization solutions were prepared according to Maniatis (24). Blots were prehybridized for 4 hrs at 53°C widi 50 micrograms/ml of calf thymus DNA. The blots were then placed in hybridization solution containing the respective probes at 10,000,000 cpm, and allowed to hybridize overnight (12 hrs) at 53°C. the following day, die blots were washed as follows:
  • the blots were then air dried and exposed to Kodak X-omat • film at -70°C.
  • the CH 2 Cl 2 extracts were washed with six 200 ml portions o water. The water layers were tested for fluorescence (red) after each washing and washing was continued if necessary until no fluorescence could be detected in the aqueous layer.
  • the CH 2 Cl 2 extracts were dried over anhydrous Na 2 SO 4 .
  • the product was isolated by evaporation of the CH 2 Cl 2 solution of the product into a stirred 10-fold volume excess of anhydrous diethyl ether.
  • the product is analytically pure.
  • the dialyzed protein was added dropwise to die tag-aldehyde while gently stirring at room temperature for 2 hrs.
  • a 100 molar excess (to protein) of sodium borohydride 100 microliters of a 1.24 mg/ml solution in deionized water was added to the solution and gently stirred for an additional 30 min at room temperature, the conjugate was loaded onto a Sephadex G-25 column (1.0 cm x 18.0 cm) equilibrated at room temperature with 0.2M Tris, pH 8.0, and the eiuant was monitored at 280 nm. the void volume peak was collected, pooled, and dialyzed against 2 liters of the Tris buffer. The conjugate was tested for immunological activity by standard ELISA methods, and stored at 4°C until used.
  • Compound I-human IgG conjugate was diluted 1:50 in 0.15M phosphate buffer containing 0.1 % BSA and aliquoted at 250 microliters/tube.
  • 150 microliters of diluent (PB w/BSA as above) were added per tube, followed by the addition of either various dilutions of analyte (human IgG) or diluent (negative controls).
  • PB w/BSA as above
  • analyte human IgG
  • diluent negative controls
  • a nonspecific analyte goat anti-rabbit IgG
  • 50 microliters of 1 % Biomag • coupled with goat anti-human IgG (H&L) were added to each tube.
  • the tubes were mixed on a vortex and incubated at room temperature for 15 min with gentle shaking, the particles were magnetically removed fro solution and 100 microliters of the resulting supernatant were transferred to a Berthold tube to which 400 microliters of a citrate-oxalate-Triton X-100 solution were added.
  • the tube was mixed on a vortex and read in a modified Berthold luminometer fitted with an R-268 photomultiplier tube and a 0.29 inch diameter circular 52 gauge double platinum mesh electrode supported by a conductive paint covered polycarbonate support and connected to the voltage source through a 0.01 inch diameter platinum wire/silver paint contact. The potential applied was stepped from +1.4 to +2.15 V while a 10 second integration was done.
  • the electrode was electrochemically cleaned by rinsing with deionized water, then immersing in 0.1 M phosphate-citrate buffer containing oxalic acid and Triton X-100 and stepping the applied potential from -2.2V to +2.2V (with 3 seconds at each potential) for 2 min and 20 seconds followed by pausing the potential at +2.2V for 10 seconds.
  • the electrode was removed from the cleaning solution, rinsed with deionized water and blotted dry with an absorbent wiper. In this format the electrochemiluminescent signal was directly proportional to the analyte concentration.
  • Example 34 Labeling of hCG Peptide with Compound IV
  • hCG human chorionic gonadotropin
  • the sample was then loaded onto a Bio-Gel P-2 column (Bio-Rad; 1 cm X 45 cm) which was equilibrated at room temperature with 0.2 M Tris-base, pH 8.5 at a flow rate of 15 ml/hr and the eluant was monitored at 280 nm.
  • the void volume of the run was collected, pooled, and loaded onto a QAE-Sephadex A-25 column (Pharmacia; 1 cm x 10 cm) which was equilibrated at room temperature with 50 mM Tris-HCl, pH 7.0.
  • Ru(II) -Compound III conjugate was diluted to 300 nM in 0.1 M phosphate-citrate buffer, pH 6.1, either with or without 1% normal human serum (NHS). One of each buffer type was incubated at 4°, 20°, 37° and 55°C and sampled on incubation days 3, 4 and 5. The samples were equilibrated at room temperature and evaluated for their
  • electrochemiluminescence signal output 400 microliters of sample was mixed with 100 microliters of 125mM oxalic acid-5% Triton X-100 in a tube and placed in a modified Berthold luminometer with a Hamamatsu R-268 photomultiplier tube and a double mesh platinum gauze electrode. The reading was made by sweeping the applied potential from +1.5V to +2.5V at 50 mV/second for 3 cycles and the height of the second cycle peak was recorded and converted into electrochemiluminescent counts.
  • the electrode was cleaned electrochemically by rinsing with deionized water, immersing the electrode in 0.1 M phosphate-citrate buffer containing 25 mM oxalate and 1% Triton X- 100 and pulsing the potential from -2.2V for 10 and 50 sec. the potential was poised at +2.2V for 10 sec and then removed, the electrode was removed from the cleaning solution, rinsed with deionized water and blotted dry with absorbent toweling.
  • the results show that there was consistent signal in each buffer type over the course ofthe study. This indicates the stability of the reagent and its capability of generating an electrochemiluminescent signal.
  • the Ru(II)-Compound III conjugate was diluted and incubated under the conditions as described in Example 66. Samples were taken on days 3. 4. and 5 cooled to room temperature and tested for immunoreactivity by Particle Concentration Fluorescent Immunoassay (PCFIA) using a Pandex Screen Machine obtained from Pandex. Inc., Mundelein, IL. the PCFIA was run in a competitive assay format. The latex particles (Pandex) were conjugated with theophylline-BSA.
  • PCFIA Particle Concentration Fluorescent Immunoassay
  • Example 37 Electrochemiluminescence of various ruthenium and osmium compounds
  • the electrochemistry of various osmium and ruthenium compounds was measured as 1 mM solutions in 10 ml of nitrogen-purged acetonitrile with 0.1 M tetrabutylammonium tetrafluoroborate as an electrolyte.
  • the working electrode was a platinum disk electrode obtained from Bioanaiytical systems, Inc.. West Lafayette, IN.
  • a platinum wire counter electrode and a 1.0 mm silver wire was used as a reference electrode. Measurements were made by scanning from -2.2V to +2.2V (vs SCE) at a scan rate of 100 mV/second. After each electrochemical measurement the potential difference between a Saturated Calomel Reference electrode (SCE) and the silver wire was determined. Thus, the values reported are corrected to the potential versus SCE.
  • SCE Saturated Calomel Reference electrode
  • Electrochemiluminescent (ECL) measurement were made in 0.5 ml aqueous solutions containing 0.1 M phosphate-citrate buffer (pH 4.2), 25 mM oxalic acid, and 1% Triton X- 100.
  • the electrode system used consisted of two platinum gauze (52 gauge) electrodes connected to a Radio Shack transistor socket (#276-548) by a 0.1 mm platinum wire.
  • the electrodes were mounted on the outside of a 60 ml thick piece of cellulose acetate plastic. This plastic was machined so that a 1/4 inch diameter hole allows solution to easily flow between the working and counter-reference electrodes.
  • the electrodes were connected to the potentiostat so that one electrode functioned as a working electrode (which was closer to the photomultiplier tube) and one electrode functioned as the counter and reference electrode. Measurements were made by sweeping from 1.5V to 2.5 V (bias potential) at a scan rate of 50 mV/second.
  • the ECL measurements are reported as the signal to noise ratio, i.e.. or signal to background ratio for a given concentration of compound. Background is defined as the luminescent counts observed with buffer and no ECL compounds added. Luminescent measurements were the peak light output observed during the first or second linear sweep.
  • Fluorescence measurements were made with 50 micromolar solutions of the desired compound in 3.0 ml of ECL solution , or when insoluble in ECL solution, in
  • Spectrophotometer Prescans of the solutions' excitation and emission spectra were performed before the excitation and emission spectra were recorded so that the emission spectrum could be measured while irradiating at the maximum excitation wavelength and conversely, the excitation spectrum could be recorded while monitoring the maximum emission wavelength.
  • S/N is the signal to noise ratio, where the signal is defined as the ECL output (luminescent counts) of a compound at a given concentration, and noise is the luminescent counts of the buffer in which the compound was dissolved.
  • the first molecule that was synthesized in the series was compound (II). This compound was difficult to purify because of undesirable hydrolysis of die ester groups. The presence of more than one carboxy functional group on the label might result in inter and intra molecular cross linking of functional groups within proteins. Since this modified electrochemiluminescent label had undergone partial hydrolysis, a study ofthe hydrolysis of the material in aqueous medium did not provide valuable information.
  • Compound (II) was produced according to Reaction Scheme 1 reproduced below.
  • Compound (I) is the fully hydrolyzed form of compound (II).
  • the synthetic route is shown below in Reaction Scheme 2. Purification of the material by conventional ion- exchange and desalting columns proved to be a difficult task because of the extreme hydrophilic nature of the product. Although the purity of the material was satisfactory by 1H-NMR analysis, the material was associated with NaCl and NH 4 + PF 6 - salts.
  • Reaction Scheme 5 shows the steps involved in the synthesis of die compound (VI). This label's ECL intensity was 4 times less than that of compound (IV). The ECL intensity of label (VI) was 2 times greater than that of compound (III) when the molecules were excited by ramping the voltage.
  • Compound (VII) has an ECL intensity very similar to the ECL intensity of compound (IV).

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Pyridine Compounds (AREA)

Abstract

The present invention is directed to modified electrochemiluminescent compounds and to associated processes for performing assays using these compounds wherein, in comparison to their corresponding unmodified counterparts, these compounds have decreased nonspecific binding properties.

Description

ECL LABELS HAVING IMPROVED NSB PROPERTIES
Cross-references to Related Applications
This application is a continuation-in-part of U.S. Ser. No. 08/415,756, filed April 3, 1995, which is a continuation of U.S. Ser. No. 08/195,825, filed February 10, 1994, which is a continuation of U.S. Ser. No. 07/369,560, filed December 18, 1987. which is a continuation-in-part (U.S. National Phase of Intl. App. No. PCT/US87/00987) of U.S. Ser. No. 06/858,354. filed April 30. 1986. The subject matter of these applications are incorporated herein by reference.
Background of the Invention
1. Field of the Invention
The present invention is particularly directed to modified
electrochemiluminescent compounds having improved nonspecific binding properties. The modifications comprises substituent groups which have replaced at least one hydrogen atom on at least one of the aromatic pyridine rings in the unmodified parent compound (typically, ruthenium (II) (2'2'-bipyridine)3 +2). Process for performing assays using these compounds as detectable labels are also disclosed and claimed.
2. Description of Related Art
Within this application several publications are referenced by Arabic numerals within parentheses. Full citations for these references may be found at the end ofthe specification immediately preceding the claims. The disclosures of these publications in their entirety are hereby incorporated by reference into this application in order to more fully describe the state of the an to which this invention pertains. There is a continuous and expanding need for rapid, highly specific methods of detecting and quantifying chemical, biochemical, and biological substances. Of particular value are methods for measuring small quantities of pharmaceuticals, metabolites, microorganisms and other materials of diagnostic value. Examples of such materials include narcotics and poisons, drugs administered for therapeutic purposes, hormones, pathogenic microorganisms and viruses, antibodies, metabolites, enzymes and nucleic acids.
The presence of these materials can often be determined by binding methods which exploit the high degree of specificity which characterizes many biochemical and biological systems. Frequently used methods are based on, for example, antigen- antibody systems, nucleic acid hybridization techniques, and protein-ligand systems. In these methods, the existence of a complex of diagnostic value is typically indicated by the presence or absence of an observable "label" which has been attached to one or more of the complexing materials.
The specific labeling method chosen often dictates the usefulness and versatility of a particular system for detecting a material of interest. A preferred label should be inexpensive, safe, and capable of being attached efficiently to a wide variety of chemical, biochemical, and biological materials without changing the important binding
characteristics of those materials. The label should give a highly characteristic signal, and should be rarely, and preferably never, found in nature. The label should be stable and detectable in aqueous systems over periods of time ranging up to months. Detection of the label should be rapid, sensitive, and reproducible without the need for expensive, specialized facilities or personnel. Quantification of the label should be relatively independent of variables such as temperature and the composition of the mixture to be assayed. Most advantageous are labels which can be used in homogeneous systems, i.e., systems in which separation of the complexed and uncomplexed labeled material is not necessary. This is possible if the detectability of the label is modulated when the labeled material is incorporated into a specific complex.
A wide variety of labels have been developed, each with particular advantages and disadvantages. For example, radioactive labels are quite versatile and can be detected at very low concentrations. However, they are expensive, hazardous, and their use requires sophisticated equipment and trained personnel. Furthermore, the sensitivity of radioactive labels is limited by the fact that the detectable event can, in its essential nature, occur only once per radioactive atom in the labeled material. Moreover, radioactive labels cannot be used in homogenous methods.
Thus, there is wide interest in non-radioactive labels. These include molecules observable by spectrophotometric, spin resonance, and luminescence techniques, as well as enzymes which produce such molecules. Among the useful non-radioactive labeling materials are organometallic compounds. Because of the rarity of some metals in biological systems, methods which specifically assay the metal component ofthe organometallic compounds can be successfully exploited. For example, Cais, U.S. Patent No. 4,205,952 (1980) discloses the use of immunochemically active materials labeled with certain organometallic compounds for use in quantitating specific antigens. Any general method of detecting die chosen metals can be used with these labels, including emission, absorption and fluorescence spectroscopy, atomic absorption, and neutron activation. These methods often suffer from lack of sensitivity, can seldom be adapted to homogeneous system, and as with atomic absorption, sometimes entail destruction of the sample. Of particular interest are labels which can be made to luminesce through photochemical, chemical, and electrochemical means. "Photoluminescence" is the process whereby a material is induced to luminesce when it absorbs electromagnetic radiation. Fluorescence and phosphorescence are types of photoluminescence.
"Chemiluminescent" processes entail the creation of the luminescent species by a chemical transfer of energy. "Electrochemiluminescence" entails the creation ofthe luminescent species electrochemically.
These luminescent systems are of increasing importance. For example, Mandle, U.S. Patent No. 4,372.745 (1983) discloses the use of chemiluminescent labels in immunochemical applications. In the disclosed systems, the labels are excited into a luminescent state by chemical means such as by reaction of the label with H2O2 and an oxalate. In these systems, H2O2 oxidatively converts the oxalate into a high energy derivative, which then excites the label. This system will, in principle, work with any luminescent material that is stable in the oxidizing conditions of the assay and can be excited by the high energy oxalate derivative. Unfortunately, this very versatility is the source of a major limitation of the technique: typical biological fluids containing the analyte of interest also contain a large number of potentially luminescent substances that can cause high background levels of luminescence.
Another example of the immunochemical use of chemiluminescence which suffers from the same disadvantages is Oberhardt et al., U.S. Patent No. 4,280,815, (1981) which discloses the in situ electrochemical generation of an oxidant (e.g., H2O2) in close proximity to an immunoreactant labeled with a chemiluminescent species. The electrogenerated oxidant diffuses to the chemiluminescent species and chemically oxidizes it, resulting in the net transfer of one or more electrons to the electrogenerated oxidant. Upon oxidation, the chemiluminescent species emits a photon. In contrast, the subject invention requires the direct transfer of electrons from a source of electrochemical energy to a chemiluminescent species which is capable of repeatedly emitting photons.
The present invention is concerned with electrochemiluminescent labels.
Suitable labels comprise electrochemiluminescent compounds, including organic compounds and organometallic compounds. Electrochemiluminescent methods of determining the presence of labeled materials are preferred over other methods for many reasons. They are highly sensitive to the presence of a particular labeled analyte, nonhazardous, inexpensive, and can be used in a wide variety of applications including diagnostics. Many organometallic compounds are suitable electrochemical labels, but of particular use are Ru-containing and Os-containing compounds.
Thus, in one embodiment, the present invention is concerned with the use of Ru- containing labels, Os-containing labels and/or related electrogenerated chemiluminescent labels (e.g., Re-containing labels, Ir-containing labels, Rh-containing labels, Pt- containing labels, Pd-containing labels, Mb-containing labels, Tc-containing labels, etc.) which can be detected by a wide variety of methods. These labels are advantageous for many reasons that will be discussed herein.
Ru-containing and Os-containing organometallic compounds have been discussed in the literature. Cais discloses that any metal element or combination of metal elements, including nobel metals from group VIII such as Ru, would be suitable components of organometallic labels detectable by atomic absorption methods. (Cais, column 11, line 20). However, ruthenium is not a preferred metal in Cais, osmium is not specifically mentioned, no data are presented on the efficiency of using Ru oi Os in any of the methods disclosed and the preferred method of detection, atomic absorption. entails destruction of the sample.
Weber, U.S. Patent No. 4,293,310 (1981), discloses the use of Ru-containing and Os-containing complexes as electrochemical labels for analytes in immunoassays. The disclosed complexes are linked to amino groups on the analytes through a thiourea linkage. Weber also suggests the possibility of forming carboxylate esters between the labels and hydroxy groups on other analytes.
According to Weber, the presence of the labeled materials can be determined with an apparatus and method which comprises a quencher and an electrochemical flow cell with light means. The photoelectrochemically active label upon photoexcitation transfers an electron to a quencher molecule; the oxidized molecule is subsequently reduced with an electron from an electrode of the flow cell which is held at suitable potential. This electron is measured as photocurrent. The amount of free labeled analyte in the system is determined by the photocurrent signal. Note that this method is the reverse of electrochemiluminescent detection of luminescent materials.
In subsequent reports, Weber et al. discussed the problems associated with the use of this method to detect Ru-containing labels (1). In Table 2 of Weber et al. (1), the extrapolated detection limit for tris(bipyridyl)ruthenium(II) is 1.1 x 10-10 moles/L under optimal conditions. In anticipating that the actual use of these labels would entail measurements in the presence of complex mixtures, Weber et al. tested for potential interferenjs in their system. Table 3 of Weber lists dimethylalkyl amines, EDTA, N- methylmorpholine, N,N'-dimethylpiperazine, hydroxide, oxalate, ascorbate, uric acid, and serum as interferents which would presumably raise the practical detection limits substantially above 1.1 x 10-10 moles/L. These studies were performed with a simple Ru-containing compound. No studies were reported in Weber or Weber et al. regarding the limits of detection of complex substances labeled with Ru-containing labels, or whether the thiourea linkage between the labeled material and label is stable under conditions of the assay.
Electrochemiluminescent labels are the focus of the present invention. They can often be excited to a luminescent state without their oxidation or reduction by exposing the compounds to electromagnetic radiation or to a chemical energy source such as that created by typical oxalate-H2O2 systems. In addition, luminescence of these compounds can be induced by electrochemical methods which do entail their oxidation and reduction.
Extensive work has been reported on methods for detecting Ru (2,2'- bipyridine)32+ using photoiuminescent, chemiluminescent, and electrochemiluminescent means (2, 3). This work demonstrates that bright orange chemiluminescence can be based on the aqueous reaction of chemically generated or electrogenerated Ru(bpy)3 3+ (where "bpy" represents a bipyridyl ligand) with strong reductants produced as intermediates in the oxidation of oxalate ions or other organic acids. Luminescence also can be achieved in organic solvent-H2O solutions by the reaction of electrogenerated, or chemically generated, Ru(bpy)3 1+ with strong oxidants generated during reduction of peroxydisulfate. A third mechanism for production or electrochemiiuminescence from Ru(bpy)3 2+ involves the oscillation of an electrode potential between a potential sufficiently negative to produce Ru(bpy)3 1+ and sufficiently positive to produce Ru(bpy) 3 3+. These three methods are called, respectively, "oxidative-reduction," "reductive- oxidation"," and "the Ru(bpy)3 3+/+ regenerative system". The oxidative-reduction method can be performed in water, and produces an intense, efficient, stable luminescence, which is relatively insensitive to the presence of oxygen or impurities. This luminescence from Ru(bpy)3 2+ depends upon the presence of oxalate or other organic acids such as pyruvate, lactate, malonate, tartrate and citrate, and means of oxidatively producing Ru(bpy)3 3+ species. This oxidation can be performed chemically by such strong oxidants as PbO2 or Ce(IV) salt. It can be performed electrochemically by a sufficiently positive potential applied either continuously or intermittently. Suitable electrodes for the electrochemical oxidation or Ru(bpy)3 2+ are, for example, Pt, pyrolytic graphite, and glassy carbon. Although the oxalate or other organic acid is consumed during chemiluminescence, a strong, constant
chemiluminescence for many hours can be achieved by the presence of an excess ofthe consumed material, or by a continuous supply of the consumed material to the reaction chamber.
The reductive-oxidation method can be performed in partially aqueous solutions containing an organic co-solvent such as, for example, acetonitrile. This luminescence depends upon the presents of peroxydisulfate and a means of reductively producing Ru(bpy)3 1+ species. The reduction can be performed chemically by strong reductants such as, for example, magnesium or other metals. It can be performed electrochemically by a sufficiently negative potential applied either continuously or intermittently. A suitable electrode for the electrochemical reduction of Ru(bpy)3 2+ is, for example, a polished glassy-carbon electrode. As with the oxidative-reduction method, continuous, intense luminescence can be achieved for many hours by inclusion of excess reagents, or by continuous addition of the consumed reagents to the reaction mixture.
The Ru(bpy)3 3+/+ regenerative system can be performed in organic solvents such as acetonitrile or in partially aqueous systems, by pulsing an electrode potential between a potential sufficiently negative to reduce Ru(bpy)3 2+ and a potential sufficiently positive to oxidize Ru(bpy)3 2 + . A suitable electrode for such a regenerative systems is, for example, a Pt electrode. This system does not consume chemical reagents and can proceed, in principle, for an unlimited duration.
These three methods of producing luminescent Ru-containing compounds have in common the repetitive oxidation-reduction or reduction-oxidation of the Ru-containing compound. The luminescence of solutions containing these compounds is therefore highly dependent on the electric potential of the applied energy source, and is therefore highly diagnostic of the presence of the Ru-containing compound.
Mandle cites Curtis et al. (4) as a possible label in chemiluminescent applications. Curtis et al. reports only unpublished observations that Ru complexes can be induced to emit light when chemically excited by an oxalate/H202 system (Curtis et al. p. 350).
Neither Mandle nor Curtis recognized the exceptional utility of ruthenium and osmium complexes in chemiluminescent applications or the utility of
electrochemiluminescent systems. Sprintschnik, G. et al. (5) have described complexes of tris (2,2,-bipyridine)ruthenium(II) esterified with octadecanol or dehydrocholesterol, and have created monolayer films of these surfactant complexes. The complexes were photoluminescent. But when the films were exposed to water, and then to light, the Ru- complexes failed to photoluminesce. This was attributed to photohydrolysis of ester groups in the presence of light.
It has been discovered, and is disclosed herein, that a wide variety of analytes of interest and chemical moieties that bind to analytes of interest may be conveniently attached to Ru-containing or Os-containing labels through amide or amine linkages. The labeled materials may then be determined by any of a wide variety of means, but by far the most efficient, reliable, and sensitive means are photoluminescent, chemiluminescent, and electrochemiluminescent means. It is also disclosed herein that
electrochemiluminescent labels, including Ru-containing and Os-containing labels are particularly versatile and advantageous. The great advantage of the use of these novel labeled materials, and of the methods of detecting them, are further discussed
hereinbelow.
SUMMARY OF THE INVENTION
The present invention provides a method of detecting in a predetermined volume of a multicomponent, liquid sample an analyte of interest present in the sample at a concentration below about 10-3 molar which comprises: a) contacting a sample with a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of combining with the analyte of interest, the contact being effected under appropriate conditions such that the analyte and the reagent combine; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) detecting electromagnetic radiation so emitted and thereby detecting the presence of the analyte of interest in the sample.
The invention still further provides electrochemiluminescent compounds and associated processes wherein the compounds have modifications thereon. These modifications are believed to be responsible for the improved performance characteristics of these compounds. These characteristics include decreased nonspecific binding (NSB) of each electrochemiluminescent label in contrast to an unmodified parent label. The decreased NSB of the modified electrochemiluminescent compounds of the present invention yields more accurate results in assays by decreasing false readings (e.g., false positives or negatives). The modified electrochemiluminescent compounds ofthe present invention are typically derivatives of ruthenium (II) (2,2'-bipyridine)3 +2 wherein at the 4 position of the chelating ring(s) (expressed in the nomenclature as the 4,4'- positions of the 2,2'-bipyridine ring system), a substituent group has replaced at least one ofthe hydrogen atom on at least one of the aromatic pyridine rings.
BRIEF DESCRIPTION OF FIGURES
Figure 1 depicts electrochemiluminescent measurements made for a homogeneous immunoassay for the determination of the concentration of an antigen in solution.
Figure 2 graphically depicts the results of a homogeneous ECL theophylline assay.
Figure 3 graphically depicts the results of a homogeneous theophylline assay in various sera.
Figure imgf000013_0001
Figure 4 graphically depicts the results of an ECL theophylline assay compared to the results of a fluorescence polarization theophylline assay. A. Normal sera: n = 4; slope = .986; r = 1.00
B. Hemolyzed sera: n = 3; slope - .878; r = 1.00
C. Lipemic sera: n = 5; slope = .872; 4 = 0.99
D. Icteric sera: n = 4; slope = 2.14; r = 1.00
Figure 5 graphically depicts the results of an ECL theophylline assay compared to the results from a high pressure liquid chromatography assay. n = 9; slope = 1.197; r = 0.98.
Figure 6 graphically depicts the modulation of an ECL signal generated in an ECL digoxin immunoassay.
Figure 7 graphically depicts the results of an ECL digoxin immunoassay.
■ = Blank
● == Digoxin
Figure 8 graphically depicts the ECL signal generated by various concentrations of MB I 38-Compound I.
Figure 9 shows the results of a Hybridization/Sensitivity Study of MBI 38-Compound I.
TAG = Compound I
Figure 10 shows the results of a Specificity Study of MBI 38-Compound I. Description of the Invention
1. Definition of Terms
The term "ECL moiety," "metal-containing ECL moiety" "label," "label compound," and "label substance." are used interchangeably. It is within the scope ofthe invention for the species termed "ECL moiety," "metal-containing ECL moiety," "organo-metallic," "metal chelate." "transition metal chelate" "rare earth metal chelate," "label compound." "label substance" and "label" to be linked to molecules such as an analyte or an analog thereof, a binding partner of the analyte or an analog thereof, and further binding partners of such aforementioned binding partner, or a reactive component capable of binding with the analyte, an analog thereof or a binding partner as mentioned above. The above-mentioned species can also be linked to a combination of one or more binding partners and/or one or more reactive components. Additionally, the
aforementioned species can also be linked to an analyte or its analog bound to a binding partner, a reactive component, or a combination of one or more binding partners and/or one or more reactive components. It is also within the scope of the invention for a plurality of the aforementioned species to be bound directly or through other molecules as discussed above, to an analyte or its analog. For purposes of brevity, these ligands are referred to as an assay-performance-substance.
The terms detection and quantitation are referred to as "measurement", it being understood that quantitation may require preparation of reference compositions and calibrations. The terms collection and concentration of complex may be used interchangeably to describe the concentration of complex within the assay composition and the collection of complex at, e.g., an electrode surface.
Within this application "molar" means the concentration of an analyte in solution in moles per liter or the amount of particulate matter present in a liquid sample in particles or units per liter. For example, 1 x 10 particles per liter may be expressed as 1 molar.
2. Preferred Embodiments of the Invention
The methods provided by the present invention may be performed as
heterogeneous assays, i.e., assays in which unbound labeled reagent is separated from bound labeled reagent prior to exposure of the bound labeled reagent to electrochemical energy, and homogeneous assays, i.e., assays in which unbound labeled reagent and bound labeled reagent are exposed to electrochemical energy together. In the new homogeneous assays of the present invention the electromagnetic radiation emitted by the bound labeled reagent is distinguishable from the electromagnetic radiation emitted by the unbound labeled reagent, either as an increase or as a decrease in the amount of electromagnetic radiation emitted by the bound labeled reagent in comparison to the unbound labeled reagent, or as electromagnetic radiation of a different wavelength.
Accordingly, in one embodiment of the invention any reagent which is not combined with the analyte of interest is separated from the sample, which had been contacted with the reagent, prior to exposure of the sample to electrochemical energy. In another embodiment of the invention, prior to contacting the sample with the reagent, the sample is treated so as to immobilize the analyte of interest. Means for immobilizing analytes of interest are well known within the an and include contacting the sample with a polystyrene, nitrocellulose or nylon surface, or a surface coated with whole cells, subcellular particles, viruses, prions. viroids, lipids, fatty acids, nucleic acids, polysaccharides, proteins, lipoproteins, lipopolysaccharides, glycoproteins, peptides, cellular metabolites, hormones, pharmacological agents, tranquilizers, barbiturates, alkaloids, steroids, vitamins, amino acids, sugars, nonbiological polymers, synthetic organic molecules, organometallic molecules or inorganic molecules. Additionally, the analyte of interest may be any of these substances.
In one embodiment of the invention, the analyte of interest is theophylline. In another embodiment of the invention, the analyte of interest in digoxin. In still another embodiment of the invention, the analyte of interest is human chorionic gonadotropin (hCG). Furthermore, the analyte of interest may be a whole cell, subcellular particle, virus, prion, viroid, nucleic acid, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, hormone, pharmacological agent, nonbiological polymer, synthetic organic molecule, organometallic molecule or an inorganic molecule present in the sample at a concentration below about 10-12 molar. Moreover the analyte of interest may be whole cell, subcellular particle, virus, prior, viroid or nucleic acid present in the sample at a concentration below about 10-15 molar.
The reagent which is contacted with the sample may comprise an
electrochemiluminescent chemical moiety conjugated to a whole cell, subcellular particle, virus, prior, viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, cellular metabolite, hormone, pharmacological agent, tranquilizer, barbiturate, alkaloid, steroid, vitamin, amino acid, sugar, nonbiological polymer, synthetic organic molecule, organometallic molecule, inorganic molecule, biotin, avidin or streptavidin. In one embodiment of the invention the agent is an electrochemiluminescent moiety conjugated to an antibody, antigen, nucleic acid, hapten. ligand or enzyme, or biotin avidin or streptavidin.
The electrochemiluminescent chemical moiety may comprise a metal -containing organic compound wherein the metal is selected from the group consisting of ruthenium, osmium, rhenium, iridium, rhodium, platinum, palladium, molybdenum and technetium. In one embodiment of the invention the metal is ruthenium or osmium.
The modified electrochemiluminescent compounds of the present invention typically comprise derivatives of compound (a) identified below. Although compound (a) is not itself a modified compound of the present invention, compounds (b) through (1) set forth below represent compounds encompassed by the present invention and/or candidate compounds for inclusion within the present invention:
(a) ruthenium (II) (2,2'-bipyridine)3 +2;
(b) ruthenium (II) (2,2'-bipyridine-4,4'-dicarboxylic acid)3 +2;
(c) ruthenium (II) (2,2'-bipyridine-4.4'-dimethyl-dicarboxylate)3 +2;
(d) ruthenium (II) (2,2,-bipyridine-4.4'-diethyl-dicarboxylate)3 +2;
(e) ruthenium (II) (2,2'-bipyridine-4,4'-dipropyl-dicarboxylate)3 +2;
(f) ruthenium (II) (2,2'-bipyridine-4,4'-dipropyldicarboxamide)3 +2;
(g) ruthenium (II) (2,2'-bipyridine)2 (2,2'-bipyridine-4,4'-dicarboxylic acid)1 +2;
(h) ruthenium (II) (2,2'-bipyridine)2 (2,2'-bipyridine-4-methyl-4'- propyl- [-3-carboxylic acid])1 +2;
(i) ruthenium (II) (2,2'-bipyridine-4,4'-diethyl-dicarboxylate)2 (2,2'- bipyridine-4-methyl-4'-propyl-[-3-carboxylic acid])1 +2; (j) ruthenium (II) (2,2'-bipyridine-4,4'-dimethyl-dicarboxylate)2 (2,2'-bipyridine-4,4'-dicarboxylic acid)1 +2;
(k) ruthenium (II) (2,2'-bipyridine-4,4'-di-(CH2)n-dicarboxylate)3 +2 where n is an integer ranging from 1 to 5, inclusive:
(l) ruthenium (II) (2,2'-bipyridine-4-X-4'-Y) where X and Y may be the same or different, and each of X and Y is selected from the group consisting of H, COOH, COOCH3, COOCH2CH3,
COOCH2CH2CH3, OH, CH,OH. CF3, NO2, Br, CI, I, F, CN;
NR1R2 where R1 and R2 may be the same or different, and each of R1 and R2 is selected from the group consisting of H, CH3, CH2CH3, and
CH2CH2CH3
CONR1R2 where R1 and R2 may be the same or different, and each of R1 and R2 is selected from the group consisting of H, CH3, CH2CH3, and CH2CH2CH3;
(-OCH2CH2)n-OH where n is an integer ranging from 1 to 10, inclusive;
provided that at least one of X or Y is other than H; and further provided that the modified electrochemiluminescent compound exhibits decreased nonspecific binding relative to ruthenium (II) (2,2'-bipyridine)3 +2.
Compounds encompassed by the present invention include those depicted by the following structures:
Figure imgf000020_0001
Figure imgf000021_0001
Figure imgf000022_0001
Figure imgf000023_0001
Figure imgf000024_0001
As indicated above, the common characteristic of the modified electrochemiluminescent compounds of the present invention is that, for at least one hydrogen atom at the 4-position of at least one of the pyridine rings, that hydrogen atom has been replaced by a substituent group.
In addition to the above-identified compounds, applicants' invention includes the conesponding salts thereof. As explained below, the skilled artisan would understand the term "corresponding salts" to have the following two distinct yet related meanings: First, note mat the charge on the central ruthenium metal cation is positive two (+2). Consequently, when all of the substituent groups possess neutral valence (i.e., they are not charged either positive (+) or negative (-)), then the term "corresponding salts" encompasses anions. externally located relative to the central metal - ligand complex, which counterbalance the noted positive two charge. Anions such as PF6 -1 and Cl-1 are examples of species which could form the remaining portion of the salt having the central ruthenium metal cation.
Second, if for any particular compound, a substituent group may exist in one or more different valences then the claimed compound encompass all such variants of that substituent group. Two examples of this are identified below. First, -COOH represents a carboxylic acid group having a neutral valence (0) while -COO-1 represents a carboxylate group having a negative one (-1) valence due to the donation of a proton (H+1). Second, - NH2 represents an amine group having a neutral valence (0) while -NH3 + 1 represents an ammonium group having a positive one (+1) valence due to the acceptance of H+l. Thus, even if a claimed compound explicitly depicts only one such variant of a substituent group, then that claimed compound additionally encompasses all other variants of the substituent group as being subsumed within the term "corresponding salt".
As noted previously, the primary trait thought to be attributable to the presence of the substituent groups is that the compound as a whole exhibits decreased nonspecific binding. The noted substituent groups may somehow prevent or diminish at least one of the six (6) aromatic pyridine rings from participating in interactions which culminate in nonspecific binding of the electrochemiluminescent label. This in turn may contribute to and/or cause the claimed compounds as a whole to exhibit decreased nonspecific binding relative to ruthenium (II) (2,2'-bypridine)3 +2.
To understand the benefits of decreased nonspecific binding, applicants provides the description below of the a typical sandwich assay:
Figure imgf000026_0001
The above symbol represents the analyte of interest having two distinct and noninterfering epitopes of interest: namely, a left portion and a right portion.
Figure imgf000026_0003
The above symbol represents a modified electrochemiluminescent label ofthe present invention. Specifically, the "*" left portion represents the
electrochemiluminescent portion while the right portion represents a detection binding partner of the analyte of interest.
Figure imgf000026_0002
The above symbol represents a magnetic bead (MB) coated with streptavidin (SA) with the streptavidin binded to a capture binding partner of the analyte of interest. Specifically, the far left portion of this drawing represents a capture binding partner of the analyte of interest and having a biotinylated (BT) far right portion suitable for biotin streptavidin interaction with the coated magnetic beads as illustrated.
Figure imgf000027_0001
The above symbol represents a "sandwich" assay wherein the analyte of interest is sandwiched between (a) on the left side, an electrochemiluminescent label having its corresponding detection binding partner for that analyte: and (b) on the right side, a capture binding partner for that analyte which is linked to a magnetic bead through biotin - streptavidin interactions.
The illustrated binding interaction between the electrochemiluminescent label and the analyte represents a desired specific binding. Note that specifically bound labels are related to the quantity of detectable signal generated for that assay (i.e., the light emitted through electrochemiluminescence).
However, with respect to this electrochemiluminescent label, the term nonspecific binding covers the undesired situation when the label binds to a component of the assaying system other than the analyte of interest. Examples of nonspecific binding may include this label binding with any one of the following components:
(a) a working electrode;
(b) a counter electrode;
(c) a reference electrode;
(d) solid phase material such as a magnetic bead having a streptavidin coating;
(e) the interior surfaces of the walls which define the fluid flow path and which are exposed to and in contact with various fluids used in performing assays; and
(f) species, other than the analyte of interest, either dissolved or
suspended within the various fluids involved in the assays. Nonspecific binding of the electrochemiluminescent label effects the measured signal by introducing a source of error in the measured signal. Depending upon the assay format being implemented, nonspecific binding may cause the experimentally measured signal to be either higher or lower than its true value. For the purposes of discussion, the true value would represent the electrochemiluminescence which would be produced by an ideal electrochemiluminescent label that only participates in sought-for specific binding interactions and does not participate in any nonspecific binding interactions.
The sample may be derived from a solid, emulsion, suspension, liquid or gas. Furthermore, the sample may be derived from water, food, blood, serum, urine, feces, tissue, saliva, oils, organic solvents or air. Moreover, the sample may comprise acetonitrile, dimethylsulfoxide. dimethyl formamide, n-methyl-pyrrolidinone or tert-butyl alcohol. The sample may comprise a reducing agent or an oxidizing agent.
The present invention also provides a competitive method for detecting in a predetermined volume of a multicomponent. liquid sample an analyte of interest present in the sample at a concentration below about 10-3 molar which comprises: a) contacting the sample with a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of competing with the analyte of interest for binding sites on a complementary material not normally present in the sample, and with the complementary material, the contact being effected under appropriate conditions such that the analyte of interest and the reagent
competitively bind to the complementary material, the contact being effected under appropriate conditions such that the analyte of interest and the reagent competitively bind to the complementary material; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effected to induce the reagent to
repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) detecting electromagnetic radiation so emitted and thereby detecting the presence of the analyte of interest in the sample.
The reagent may be the analyte of interest conjugated to an
electrochemiluminescent chemical moiety or an analogue of the analyte of interest conjugated to an electrochemiluminescent moiety. Additionally, the analyte of interest may be theophylline, digoxin or hCG.
The complementary material may be a whole cell, subcellular particle, virus, prion, viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, cellular metabolite, hormone, pharmacological agent, tranquilizer. barbiturate, steroid, vitamin, amino acid, sugar, non-biological polymer, synthetic organic molecule, organometallic molecule or inorganic molecule
It is within the scope of this application that the methods provided herein may be performed so as to quantify an analyte of interest. Accordingly, the present invention provides a method for quantitatively determining in a predetermined volume of a multicomponent, liquid sample, the amount of an analyte of interest present in the sample which comprises: a) contacting the sample with a known amount of a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of combining with the analyte of interest, the contact being effected under appropriate conditions such that the analyte and reagent combine; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) quantitatively determining the amount of radiation so emitted and thereby quantitatively determining the amount of the analyte of interest present in the sample.
This method may be performed as a heterogeneous assay or as a homogeneous assay. In one embodiment of the invention any reagent which is not combined with the analyte of interest is separated from the sample, which had been contacted with a known amount of the reagent, prior to the exposure of the sample to an amount of
electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation. In yet another embodiment of the invention, prior to contacting the sample with the reagent, the sample is treated so as to immobilize the analyte of interest.
The analyte of interest may be a whole cell, subcellular particle, virus, prion. viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein,
lipopolysaccharide. glycoprotein, peptide. cellular metabolite, hormone, pharmacological agent, tranquilizer. barbiturate, alkaloid, steroid, vitamin, amino acid, sugar, nonbiological polymer, synthetic organic molecule, organometallic molecule or inorganic molecule. In one embodiment of the invention, the analyte of interest is theophylline. In another embodiment of the invention, the analyte of interest is digoxin. In yet another embodiment of the invention, the analyte of interest is hCG.
The reagent with which the sample is contacted may be an
electrochemiluminescent chemical moiety conjugated to a whole cell, subcellular particle, virus, prion. viroid, prion, viroid, lipid, fatty acid, nucleic acid, polysaccharide. protein, lipoprotein, lipopolysaccharide. glycoprotein, peptide. cellular metabolite, hormone, pharmacological agent, tranquilizer, barbiturate, alkaloid, steroid, vitamin, amino acid, sugar, non-biological polymer, synthetic organic molecule, organometallic molecule or inorganic molecule.
In one embodiment of the invention the reagent is a electrochemiluminescent chemical moiety conjugated to an antibody, antigen, nucleic acid, hapten, ligand or enzyme, or biotin. avidin or streptavidin.
The electrochemiluminescent moiety may be a metal-containing organic compound wherein the metal is selected from the group consisting of ruthenium, osmium, rhenium, iridium. rhodium, platinum, palladium, molybdenum and technetium. In one embodiment of the invention the metal is ruthenium or osmium.
The sample may be derived from a solid, emulsion, suspension, liquid or gas. samples which comprise the analyte of interest may be derived from water, food, blood, serum, urine, feces. tissue, saliva, oils, organic solvents or air. Additionally, samples may comprise acetonitrile. dimethylsulfoxide, dimethylformamide. n- methylpyrrolidinone or tert-butyl alcohol, furthermore, the sample may comprise a reducing agent or an oxidizing agent.
The invention also provides a competitive method for quantitatively determining in a predetermined volume of a multicomponent, liquid sample the amount of an analyte of intere?; present in the sample. This method comprises: a) contacting the sample with a known amount of a reagent (i) capable of being induced to repeatedly emit
electromagnetic radiation upon exposure to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation and (ii) capable of competing with the analyte of interest for binding sites on a complementary material not normally present in the sample, and with a known amount of the
complementary material, the contact being effected under appropriate conditions such that the analyte of interest and the reagent competitively bind to the complementary material; b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit radiation, the exposure being effected under suitable conditions so as to induce the reagent to repeatedly emit electromagnetic radiation; and c) quantitatively determining the amount of radiation so emitted and thereby quantitatively determining the amount of the analyte of interest present in the sample.
The analyte of interest may be theophylline, digoxin or hCG.
In one embodiment of the invention, the reagent is the analyte of interest conjugated to an electrochemiluminescent chemical moiety or an analogy of the analyte of interest conjugated to an electrochemiluminescent chemical moiety.
The complementary material may be a whole cell, subcellular particle, virus. prion, viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein.
lipopolysaccharide, glycoprotein, peptide, cellular metabolite, hormone, pharmacological agent, tranquilizer, barbiturate, alkaloid, steroid, vitamin, amino acid, sugar, nonbiological polymer, synthetic organic molecule, organometallic molecule or inorganic molecule.
This compound may comprise a composition of matter having the structure X-(Y)n-Z wherein X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and Z represents the compound provided by this invention.
Also, the invention provides a compound having the structure
Figure imgf000033_0001
where n is an interger . In one embodiment , n is 2 wherein R is an anion and n is an integer. In one embodiment of the invention, n is 2.
3. Examples
The compound may comprise a composition of matter having the structure
X-(Y)n-Z wherein X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and z represents the compound provided by this invention.
The invention further provides a compound having the structure
Figure imgf000035_0001
wherein R is an ion and m and n are integers. In one embodiment of the invention, m is 5 and n is 3.
This compound may comprise a composition of matter having the structure
X-(Y)n-z wherein X represents one or more nucleotides which may be the same or different, one or more amino acids which may be the same or different, an antibody, an analyte of interest or an analogue of an analyte of interest, n represents an integer, and z represents the compound provided by this invention. In one embodiment of the invention, X is theophylline. In another embodiment of the invention. X is digoxigenin. In a further embodiment of the invention, X is a peptide derived from hCB.
Also provided by the invention is a composition of matter having the structure X-CH=CH-CO-NH-(CH2)n-NH-CO-(CH2)m-z wherein:
X represents one or more nucleotides which may be the same or different;
z represents an electrochemiluminescent chemical moiety;
n represents an integer greater than or equal to 1 ; and
m represents an integer greater than or equal to 1.
In one embodiment of the invention, x is thymidine attached to CH at carbon 5, n is 7 and m is 3.
In another embodiment of the invention z is bis (2,2' - bipyridine) [4 -(butan-1- al)-4' methyl 1-2,2'-bipyridine] ruthenium (II).
In yet another embodiment of the invention, the thymidine nucleotide is a 3' terminal nucleotide attached to the nucleotide sequence
TCACCAATAAACCGCAAACACCATCCCGTCCTGCCAG
Also provided is a composition of matter having the structure
[T-Y-Z]2+(R)2 wherein T represents theophylline, Y represents a linker group attaching T to Z, Z represents bis-(2,2'- bipyridine) [4-methyl-2,2'-bipyridine-4'-yl] ruthenium (II) and R represents an anion. In one embodiment of the invention, Y is attached to the carbon at position 8 of T. In another embodiment of the invention. Y has the structure
(CH2)m-CO-NH-(CH2)n wherein m and n represent an integer, which may be the same or different, greater than or equal to 1. In another embodiment of the invention, m is 3 and n is 4. In another embodiment of the invention, m and n are both 3.
In yet another embodiment of the invention, Y has the structure
Figure imgf000038_0001
wherein m. n and r represent an integer, which may be the same or different, greater than or equal to 1. In one embodiment of the invention, m is 1, n is 1 and r is 4.
In still a further embodiment of the invention, Y has the structure
Figure imgf000038_0002
wherein m, n and r represent an integer, which may the same or different, greater or equal to 1. In one embodiment of the invention, m is 1, n is 1 and r is 4.
In yet another embodiment of the invention. Y is attached to the nitrogen at position 7 of T. In one embodiment of the invention. Y has the structure
(CH2)n wherein n is an integer greater than or equal to 1. In still another embodiment of the invention, n is 4.
Example 1 - Electrochemiluminescence in Various Organic Solvents
The electrochemiluminescence of tris (2,2'-bipyridyl) ruthenium (II) chloride
hexahydrate was measured in a 15 ml three-neck, round bottom flask containing 10 ml of a solution prepared as described below; a 1.5mm x 10 mm magnetic stir bib; a 1.0mm diameter silver wire quasi-reference electrode; a combination 28 gauge platinum wire counter electrode; and a working electrode consisting of a 22 gauge platinum wire welded to a 1 cm x 1 cm square piece of 0.1 mm thick, highly polished platinum foil. (The working platinum foil electrode was shaped into 3/16 of an inch diameter semicircle surrounding the 28 gauge platinum wire counter electrode by 3/32 of an inch equidistantly.)
The silver wire was connected to the EG&G Model 178 electrometer probe of the EG&G Model 173 potentiostat/galvanostat. The platinum wire counter electrode and the platinum working electrode were connected to the anode and cathode respectively ofthe EG&G Model 173 potentiostate. The device was grounded.
Cyclic voltammetry was performed with the EG&G Model 173 potentiostat to which an EG&G Model 175 universal programmer was attached. The programmer was set or 100 mV/second sweeps between +1.75 volt anodic and 180 volt cathodic potentials.
Electrochemiluminescence was detected using a Hamamatsu R928 photomultiplier tube, set inside a Products for Research Model PR1402RF photomultiplier tube housing which was fitted with a Kodak #23 A gelatin (red) filter. The multiplier tube housing was connected to an Oriel Model 7070 photomultiplier detection system. The cyclic voltammogram was recorded on a Houston Instruments Model X-Y recorder. Cyclic voltammograms were generated for ImM tris (2,2' - bipyridyl) ruthenium (II) chloride hexahydrate (Aldrich Chemical Company), 0.1M tetrabutylammonium tetrafluoroborate (TBABF4) (Aldrich Chemical Company) solutions prepared with the following organic solvents: acetonitrile, n-dimethylformamide; dimethyl-sulfoxide and 1 -methyl, 2-pyrrolidinone (Aldrich Chemical Company). Tert-butyl alcohol and deionized. distilled water (1 :1, v/v) also was used to make a solution containing 1 mM tris (2, 2'-bipyridyI) ruthenium (( chloride hexahydrate and 0.1 M TBABF4. The resulting voltammograms did not indicate any change in the redox potential of the tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate upon variation of the organic solvent.
For visual determination of electrochemiluminescence, solutions were prepared as follows: sufficient amounts of tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate and TBABF4 were dissolved in the spectroscopic grade organic solvents (Aldrich chemical Company) described above to provide final concentrations of ImM and 0.1M, respectively. 10ml of the resulting solution was then added to the 15 ml three-neck round bottom flask. The electrodes were immersed in the solution and the working electrode pulsed between a +1.75 and -1.45 volt potential to generate
electrochemiluminescence. Electrochemiluminescence was visually observed in each of the solutions described above.
For quantitative measurements of the effect of solvent variation on
electrochemiluminescence, solutions were prepared as follows: sufficient amounts of tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate and TBABF4 were added to the organic solvents described above to provide final concentrations of 2mM and 0.2M respectively. To an aliquot of this solution was added an equal volume of deionized, distilled water containing a strong oxidizing ammonium persulfate. at a concentration of 36 mM. Control solutions that did not contain the tris (2,2'-bipyridyl) ruthenium (II) chloride hexahydrate were prepared. 10M\ml of the resulting solution was then added to the 15 ml three-neck round bottom flask. Electrochemiluminescence was accomplished by pulsing for one second intervals, between zero and -2.0 volts cathodic potential.
Electrochemiluminescent measurements were performed by integrating the resulting electrochemiluminescent photomultiplier tube signal using an integrator connected to a Micronta Model 22191 digital multimeter. The electrochemiluminescent signal was integrated for 10 seconds during the pulsing and recorded in millivolts. The results are shown in Table I and indicate that variation of solvents effects quantum efficiency of the ruthenium (II) chloride.
Figure imgf000042_0001
Example 2 - Sensitivity of Detection of Electrochemiluminescence of Ruthenium- Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
The electrochemiluminescence of rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl) - 2,2' - bipyridyl, bix(2,2' - bipyridyl) ruthenium (II) (ruthenium- labeled rabbit anti-mouse IgG antibody) was measured in a 15 ml three-neck, round bottom flash containing 10 ml of a solution prepared as described below: a 1.5mm x 10mm magnetic stir bar: a 1.0 mm diameter silver wire quasi-reference electrode: a combination 28 gauge platinum wire counter electrode, and a working electrode consisting of a 22 gauge platinum wire welded to a 1 cm x 1 cm square piece of 0.1 mm thick, highly polished platinum foil. (The working platinum foil electrode was shaped into a 3/16 of an inch diameter semi-circle surrounding the 28 gauge platinum wire counter electrode by 3/32 of an inch equidistantly.)
The silver wire was connected to the EG&G Model 178 electrometer probe of the EG&G Model 173 potentiostat/galvanostat. The platinum wire counter electrode and the platinum working electrode were connected to the anode and cathode respectively of the EG&G Model 173 potentiostate. The device was grounded.
The electrochemiluminescence emitted from the ruthenium-labeled rabbit anti-mouse IgG antibody solution was detected using an Hammatsu R928 photomultiplier tube, set inside a Products for Research Model PR1402RF photomultiplier tube housing which was fitted with a Kodak #23A gelatin (red) filter. The photomultiplier tube housing was connected to an Oriel Model 7070 photomultiplier detection system.
Electrochemiluminescence was induced by pulsing for one second intervals, between zero and -2.0 olts cathodic potential. Electrochemiluminescent measurements were performed by integrating the resulting electrochemiluminescent photomultiplier tube signal using an integrator connected to a Micronta Model 22191 digital multimeter. The electrochemiluminescent signal was integrated for 10 seconds during the pulsing and recorded in millivolts.
A stock solution of 1.25 x 10-7 M ruthenium-labeled rabbit anti-mouse IgG antibody was prepared from a concentrated solution (2 mg/ml, 7.5 Ru/antibody) of the labeled antibody by dilution in phosphate-buffered saline (PBS). An aliquot of this solution (80 microliters) was added to 10 ml of dimethylsulfoxide (DMSO)/deionized. distilled water (1 :1) containing 0.1 M tetrabutylammonium tetrafluoroborate (TBABF4) and 18 mM ammonium persulfate in the reaction vessel. The final ruthenium-labeled antibody concentration was 1 x 10-9 M. Electrochemiluminescence was measured as described above.
Additional solutions representing various dilutions of the ruthenium-labeled rabbit anti- mouse IgG antibody stock solution were made and aliquots (in microliters) of these solutions were added to the same solution of ruthenium-labeled antibody in the reaction vessel in increments which resulted in the following concentrations of labeled antibody: 5 x 10 -9-M. 1x 10-8 M, and 5 x 10 -8 M. Electrochemiluminescence measurements were made for each solution as described. These measurements are listed in Table II below. These results indicate the sensitivity of electrochemiluminescent detection of labeled antibody (1 x 10 -9 M), and the dependence of the intensity of electrochemiluminescence on the concentration of the ruthenium-labeled anti-mouse IgG antibody.
Figure imgf000045_0001
Example - 3 Electrochemiluminescence of Ruthenium-Labeled Bovine Serum
Albumin (BSA)
A solution containing 7.8 X 10-6 M bovine serum albumin (BSA) labeled with 4,4' - (dichloromethyl) - 2,2'-bipyridyl, bis (2,2' bipyridyl) ruthenium (II) (ruthenium-labeled bovine serum albumin) was prepared from a stock solution of ruthenium-labeled BSA (2.0 mg/ml, 6 Ru/BSA) by dilution in phosphate-buffered saline. 26 microliters of this solution were added to 10 ml of DMSO/deionized. distilled water (1 :1) containing 0.1 M TBABF4 and 18 mM ammonium persulfate in the reaction vessel. The final ruthenium- labeled BSA concentration was 2 x 10-8 M. Electrochemiluminescence was measured as described in Example V.
In an analogous manner, a solution containing 7.8 x 10-6M unlabeled BSA was prepared and added to the reaction vessel to give a final unlabeled BSA concentration of 2 x 10- 8M. The electrochemiluminescence of this solution and of a similar solution without BSA was measured. Electrochemiluminescence measurements are shown in Table V for covalently coupled, ruthenium-labeled BSA and unlabeled BSA.
Figure imgf000046_0001
Example 4 - Electrochemiluminescence of ruthenium-Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
A solution containing 1.25 x 10-6 M rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl) - 2,2' - bipyridyl, bis(2,2' bipyridyl) ruthenium (II) (ruthenium- labeled, rabbit anti-mouse IgG antibody) was prepared from a stock solution of ruthenium-labeled, rabbit anti-mouse IgG antibody (2mg/ml, 7.5 Ru/antibody) by dilution in phosphate-buffered saline. 80 microliters of this solution were added to 10 ml ofDMS)/deionized. distilled water ( 1 : 1) containing 0.1M TBABF4 and 18mM
ammonium persulfate in the reaction vessel. The final ruthenium-labeled antibody concentration was 1 x 10 M. Electrochemiluminescence was measured as described in Example 2.
In an analogous manner, a solution containing 1.25 x 10-6M unlabeled. rabbit anti-mouse IgG antibody was prepared and added to the reaction vessel to five a final unlabeled antibody concentration of 1 x 10-8 M. The electrochemiluminescence of this solution and ofthe solution without added antibody was also measured as described.
Electrochemiluminescent measurements are shown in Table VIII for covalently-coupled, ruthenium-labeled rabbit anti-mouse IgG antibody and unlabeled rabbit anti-mouse IgG antibody.
Figure imgf000048_0001
Example 5 - Homogeneous Electrochemiluminescent Immunoassay for Antibody to Bovine Serum Albumin
A solution containing 7.8 x 10-6 M bovine serum albumin (BSA) labeled with 4,4' - (dichloromethyl-) - 2,2' bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) (ruthenium- labeled bovine serum albumin) was prepared from a stock solution of ntthenium-labeled BSA (2.5 mg/ml, 6 Ru/BSA) by dilution in phosphate-buffered saline (PBS). 26 microliters of this solution were added to 10 ml of DMSO/deionized, distilled water (1:1) containing 0.1M TBABF4 and 18mM ammonium persulfate in the reaction vessel. The final ruthenium-labeled BSA concentration was 2 x 10-8M. Electrochemiluminescence was measured as described in Example 2.
In an analogous manner, a solution containing 7.8 x 10-6M unlabeled BSA was prepared and added to the reaction vessel to give a final unlabeled BSA concentration of 5 x 10- 8M. The electrochemiluminescence of this solution and of a similar solution without BSA were measured.
A solution containing 3.75 x 10-5 M rabbit anti-BSA antibody was prepared from a stock solution of rabbit anti-BSA antibody (6.0 mg/ml) by dilution in PBS, and an aliquot (26 microliters) was added to the solution of ruthenium-labeled BSA in the reaction vessel to give a final rabbit anti-BSA antibody concentration of 1 x 10-7M.
The electrochemiluminescence of the resulting mixture of ruthenium-labeled BSA antigen and antibody (rabbit anti-BSA) was measured. The results shown in Table VII indicate a reduction in the electrochemiluminescence of the ruthenium-labeled BSA upon addition of rabbit anti-BSA antibody and demonstrate that a homogeneous
electrochemiluminescent detection of antibody to BSA may be achieved. Based upon these results one skilled in the art would know that a homogeneous
electrochemiluminescent immunoassay for detecting other analytes of interest may be developed.
Figure imgf000050_0001
Example 6 - Homogeneous Electrochemiluminescent Immunoassay for Mouse Immunoglobulin G (IgG)
A solution containing 6.25 x 10-6 M rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl-) - 2,2' bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) (ruthenium- labeled rabbit anti-mouse IgG antibody) was prepared from a stock solution of ruthenium-labeled rabbit anti-mouse IgG antibody (2 mg/ml, 7.5 Ru/antibody) by dilution in phosphate-buffered saline (PBS). 80 microliters of this solution were added to 10 ml of DMSO/deionized. distilled water (1 :1) containing 0.1M TBABF4 and 18mM ammonium persulfate in the reaction vessel. The final ruthenium-labeled antibody concentration was 5 x 10-8 M. Electrochemiluminescence was measured as described in Example 2.
In an analogous manner, a solution containing 6.25 x 10-6M unlabeled rabbit, anti-mouse IgG antibody was prepared and added to the reaction vessel to give a final unlabeled antibody concentration of 5 x 10-8 M. The electrochemiluminescence of this solution and of a similar solution without antibody were measured.
A solution containing 2.5 x 10-5 mouse IgG was prepared from a stock solution of mouse (IgG (4.0 mg/ml) by dilution in PBS, and different aliquots (20 microliters and 40 microliters) of this solution ere added to the solution of ruthenium-labeled, anti-mouse IgG antibody in the reaction vessel to give final mouse IgG concentrations of 5 x 10-8 and 1 x 10-7M, respectively.
The electrochemiluminescence of the resulting mixture of ruthenium-labeled, anti-mouse IgG antibody and the antigen (mouse IgG) was measured. The results are shown in Table VIII. The dependence of the electrochemiluminescence measurements upon the concentration of the mouse IgG antigen is shown in Figure 1. These results demonstrate a reduction in the electrochemiluminescence of the ruthenium-labeled antibody upon addition of antigen. Based upon these results one skilled in the art would know that a homogeneous electrochemiluminescent immunoassay for determining the concentration of other analytes of interest may be developed.
Figure imgf000052_0001
Example 7 - Heterogeneous Electrochemiluminescent Immunoassay for Legionella Using a Mouse Anti-Legionella Immunoglobulin G (IgG) Antibody and Ruthenium-Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
A formalinized suspension of the bacterium Legionella micdadei was adjusted to an optical density (at 425nm) of 1.00 by dilution with PBS buffer. Approximately 3 x 109 cells were added to a conical microcentrifuge tube. The cells were centrifuged (10 minutes. 10.000 RPM). the supernatant decanted, and the cells resuspended in a 1 :50 dilution of a mouse monoclonal IgG antibody, (1.45 mg/ml) specific for Legionella micdadei. in PBD ( 1 ml). After incubation at room temperature for 1 hour, the cells were centrifuged, the supernatant decanted, the cells resuspended in PBS buffer and centrifuged again. Following decantation of the supernatant, the cells were resuspended in a 1:50 dilution (in PBS) of rabbit anti-mouse IgG antibody labeled with 4,4' - (dichloromethyl) - 2,2' - bipyridyl, bis (2,2' - bipyridyl) ruthenium (II) i.e. ruthenium- labeled rabbit anti-mouse IgG antibody, (2 mg/ml, 7.5 Ru/antibody). After incubation at room temperature for 1 hour, the cells were centrifuged, the supernatant decanted, and the cells resuspended in PBS and washed twice, with centrifugation. as before.
Following the last wash the cells were resuspended in 200 microliters of PBS. 100 microliters of the cell suspension was added to the reaction vessel containing 10 ml of DMSO/deionized, distilled water (1 : 1) containing 0.1 M TBABF4 and 19mM ammonium persulfate and transferred to the reaction vessel. The electrochemiluminescence was measured for the cell suspension. Another 100 microliters of the cell suspension was added to the reaction vessel and electrochemiluminescence measured.
Electrochemiluminescence was measured for the solution without cells as a control according to the method described in Example 2. the results shown in Table IX indicate a heterogeneous electrochemiluminescent immunoassay for Legionella using ruthenium- labeled rabbit anti-mouse IgG antibody has been successfully carried out.
Figure imgf000055_0001
Example 8 - Homogeneous Electrochemiluminescent Immunoassay for Legionella Using a Mouse Anti-Legionella Immunoglobulin G (IgG) Antibody and Ruthenium-Labeled Rabbit Anti-Mouse Immunoglobulin G (IgG) Antibody
A suspension of the bacterium Legionella micdadej was prepared and incubated with a mouse monoclonal IgG antibody specific for Legionella as described in Example 9. The cells were centrifuged, washed, and resuspended in 0.2 ml of PBS. An aliquot (80 microliters) or rabbit, anti-mouse IgG antibody labeled with 4,4'-(dichloromethyl) - 2,2' - bipyridyl, bis (2,2' - bipyridyl) ruthenium (II), i.e. ruthenium-labeled rabbit anti-mouse IgG antibody (1.25 x 10-6 M) was added to the cell suspension, and the mixture was incubated for 2 hours at room temperature. As a control, an identical dilution of ruthenium-labeled, rabbit anti-mouse IgG antibody was incubated in the same way in the absence of the cell suspension. After the incubation period, the solution of labeled antibody was added to 10 ml of DMSO/deionized, distilled water (1:1) containing 0.1 m TBABF4 and 18mM ammonium persulfate in the reaction vessel to give a final ruthenium-labeled, rabbit anti-mouse IgG antibody concentration of 1 x 10-8M. The electrochemiluminescence was measured as described in Example 2. The same procedure was followed for the cell suspension with added ruthenium-labeled rabbit anti- mouse IgG antibody. The results, shown in Table X, indicated a reduction ofthe electrochemiluminescent emission upon the interaction of ruthenium-labeled, anti-mouse IgG antibody with mouse monoclonal antibody bound to Legionella and that a homogeneous electrochemiluminescent immunoassay for Legionella micdadei has been successfully carried out.
Figure imgf000057_0001
Example 9 - Increase in Electrochemiluminescence Upon Release of a Ruthenium- Labeled Antibody Bound to Bacteria
A formalinized suspension of the bacterium Legionella micdadei was adjusted to an optical density (at 425nm) of 1.00 by dilution with PBS buffer and 2 ml of this suspension were added to a conical microcentrifuge tube. The cells were centrifuged (10 minutes, 10,000 RFM), the supernatant decanted, and the cells were resuspended in a 1 :10 dilution in PBS (0.5 ml) of a mouse monoclonal IgG antibody, (1.45 mg/ml) specific for Legionella micdadei. After incubation at room temperature for 1 hour, the cells were centrifuged as before, the supernatant was decanted, and the cells resuspended in PBS and washed twice, with centrifugation as before. Following the last wash the cells were resuspended in 100 microliters of either PBS or 1.0M acetic acid - 0.9%NaCl (normal saline) solution and incubated at room temperature for 40 minutes. After centrifugation, 100 microliters of the cell supernatant fluid was transferred into the reaction vessel along with 10 ml of DMS)-deionized, distilled water (1 :1) containing 0.1 M TBABF4 and 18 mM ammonium persulface. The electrochemiluminescence ofthe acetic acid/normal saline cell supernatant fluid and for the supernatant fluid from the PBS washed cells was measured according to the method described in Example 2. The electrochemiluminescence measurements are shown in Table XI, and demonstrate that the elution of the ruthenium-labeled, rabbit anti-mouse IgG from the monoclonal antibody coated Legionella bacteria by treating the cells with 1.0M acetic acid-normal saline (Ref.23) results in an increase in the electrochemiluminescence generated by the unbound ruthenium-labeled antibody. These results also show that the ruthenium labeled antibody is bound to the monoclonal antibody-coated Legionella, and that the PBS wash did not result in an increase in ECL in comparison to the background signal.
Figure imgf000059_0001
Example 10 - Enzyme Immunoassay for Hepatitis B Surface Antigen Based on
Electrochemiluminescence
A blood sample containing Hepatitis B surface antigen (Hbsag) is contacted for a suitable time with an antibody specific for the Hbsag and labeled with dextranase. The antibody not bound to Hbsag is removed and the antigen-antibody complex is contacted with a dextran polymer labeled with an electrochemiluminescent moiety. Action ofthe dextranase on the labeled polymers will result in the production of fragments each labeled with the electrochemiluminescent moiety. After a suitable time the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the
electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of Hepatitis B surface antigen present in the sample determined therefrom.
Example 11 - Use of an Electrochemiluminescent moiety for Detecting Nucleic Acid Hybrids
A sample containing nucleic acid hybrids, such as double stranded RNA is contacted with an electrochemiluminescent moiety that specifically intercalates into nucleic acid hybrids. After a suitable amount of time the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of nucleic acid hybrids present in the sample determined therefrom.
Example 12 - Detection of Human T-Cell Leukemia Virus III (HTLV-III) Antigen
Complexed to Antibody in Saliva by a Homogeneous Immunoassay using Electrochemilumincescence
A saliva sample containing HTLV-III complexed to antibody is contacted with a solution containing a chaotopic agent to disrupt the antigen-antibody complexes. This solution is then contacted with an antibody specific for HTLV-III and labeled with an
electrochemiluminescent moiety. The chaotopic agent is removed allowing the labeled and unlabeled antibodies to recombine with antigen. After a suitable amount of time the resulting sample may be induced to repeatedly emit electromagnetic radiation upon direct exposure to an electrochemical energy source effective for inducing the
electrochemiluminescent moiety to repeatedly emit electromagnetic radiation. Emitted radiation may be quantified, and the amount of human T-cell leukemia virus III (HTLV- III) antigen present in the sample determined therefrom. These methods are applicable to samples containing other types of antigen-antibody complexes such as hepatitis antigen- antibody complexes, cytomegolavirus-antibody complexes, and non-A, non-B hepatitis- antibody complexes in serum.
Example 13 - Preparation and Purification of 4-(butan-1-aI)-4'-methy 1-2, 2' bipyridine
2g of 2-[3-(4-methy 1-2,2'-bipyridine-4'-yl)-propyl]-1 ,3 dioxolane were dissolved in 50 ml of the 1N HCl and heated for 2 hours at 50 °C. The solution was cooled, adjusted to between pH 7 and 8 with sodium bicarbonate and extracted twice with 100 ml of chloroform.
The combined chloroform phases were washed with a small amount of water, dried over sodium sulfate, filtered and rotoevaporated to yield a yellow oil.
The yellow oil was purified on a solica gel column using ethyl acetate/toluene (1 :1) as the eluant, the impurity being eluted with methanol.
Proton NMR analysis [ 1•96-2•1 1 (m,2H); 2-43 (S,3H); 2-46-2-50) (t,2H); 2•53-2•80 (m,2H); 7• 12-7• 14 (m,2H); 8•17-8•21 (br. s,2H); 8•52-8•58 (m,2H); 9•89 (s,1H)] confirmed that the structure of the reaction product is
Example 14 - Preparation of 4- (4-methy 1-2, 2'-bipyridine-4'-yl) butyric acid
0.5 g of 4-(butan-1-al)-4'-methyl -2, 2'-biprydine (2.0 mmol) were dissolved in 10 ml absolute acetone. 225 mg of finely powdered potassium permanganate (KMnO4; 1.42 mmol) were added in portions to the solution with stirring. The reaction was followed by thin layer chromatography, (silica; ethyl acetate/toluene 50:50), which indicated that while the aldehyde gradually disappeared a bipyridine of low Rf was formed.
After the reaction reached completion, water was added to the MnO2 was filtered and washed with small proportions of Na2CO3(aq.). The acetone was rotoevaporated and the residue extracted with CH2Cl2 to remove nonacidic bipyridines. The aqueous solution was made acidic by careful addition of 1.0N HCl to pH 4.8. The solution became partially cloudy upon reaching this pH, the suspension redissolving at lower pH. The mixture was extracted five times with equal volumes of CH2Cl2 , dried over Na2SO4 and rotoevaporated to an oil which promptly solidified in vacuo. The crude solid was recrystallized from chloroform: petroleum ether to obtain white crystals.
Melting point: 103.5°C-105.5°C; IR: 1704 cm -1. Proton NMR analysis was consistent with the following structure.
Example 15 - Preparation of bis (2, 2' bipyridine) [4-(butan-1-al)-4'-methy 1-2, 2'- bipyridine] ruthenium (II) diperchlorate: Compound I
250 mg of ruthenium bipyridyl dichloride dihydrate (0.48 mmol) (Strem) in 50 ml of ethylene glycol were quickly heated to boiling and the immersed in silicone oil bath (130 °C). To the resulting purple-orange solution were added 150 mg of 2-[3-(4-methy 1-2, 2'-bypridine-4'yl)propyl]-1,3-dioxolane (0.53 mmol) in 10 ml of ethylene glycol. The resulting orange solution was stirred at 130 °C for 30 minutes, cooled to room
temperature and diluted 1 : 1 with distilled water.
A concentrated solution of sodium perchlorate in water was added to the solution, causing the appearance of a very fine orange precipitate. The mixture was refrigerated overnight, filtered and the precipitate washed with water.
The precipitate was dissolved in hot water and recrystallized by adding perchloric acid to the solution to produce bright orange crystals which were then filtered, washed with cold water and dried. This recrystallization procedure was reported, yielding a total of 150 mg bright orange crystals.
NMR analysis indicated the following structure
Within the present application, the above-identified compound is reffered to as
Compound I. Example 16 - Preparation of bis(2.2'-bipyridine) [4-(4-methyl-2,2'-bipyridine-4'-yl)- butyric acid] ruthenium (II) dihexafluorophosphate: Compound II
134 mg of 4-(4-methyl-2,2'-bipyridine-4'-yl)-butyric acid (0.52 mmol) were dissolved in 50 ml of water. The solution was degassed with argon and 250 mg of ruthenium bipyridyl dichloride dihydrate (Strem) (0.48 mmol) were added. The mixture was refluxed under argon for 4 hrs. The water was rotevaporated and the residue redissolved in the minimum amount of water and loaded onto a SP-25-Sephadex ion-exchange column. After eluting impurities with water, the compound was eluted as a red band with 0.2 M NaCl solution and isolated as a hexafluorophosphate by addition of a saturated aqueous solution of NH4PF6. The crude product was reprecipitated twice from hot acetone with diethyl ether. Anal: Calculated; C, 43.80%; H, 3.36%; N, 8.76%. Found; C, 43.82%; H, 3.54%; N, 8.55%.
Proton NMR analysis was consistent with the following structure
Example 17 - Preparation of bis-(2.2'-bipyridine)[theophylline-8-butyric- 4-(4-methyl- 2,2'-bipyridine-4'-yl)-butyl amide] ruthenium (II) dichloride: Ru(II)- Compound III Conjugate
To a mixture of 154 mg (0.296 mmoles) of bis-(2,2' -bipyridine) ruthenium (II) dichloride dihydrate and 175 mg (0.357 mmoles) of Compound III described above were added 40 ml of ethanol/H2O (1 : 1, v/v). This mixture was argon degassed in the dark for 15 min and refluxed in the dark under argon for 3 hrs to produce a clear, cherry red solution. The resulting clear, cherry red solution was allowed to cool to room
temperature and the solvent was stripped off using a rotary evaporator while maintaining the solution in the dark under a temperature less than or equal to 37°C.
The resulting residue was dissolved in approximately 1-3 ml of methanol, loaded onto a Sephadex LH-20 chromatography column (75 cm x 3 cm) and eluted at a flow rate of about 0.4-0.7 ml/min. A bright red band (product) was closely followed by a brown, nonluminescent band (impurity) and two luminescent bands. The red product band was found to be contaminated with a small amount of the material from the brown, nonluminescent band. This contaminating material was separated from the product by running the sample on a second Sephadex LH-20 column under similar conditions.
The red product was obtained by stripping the solvent off by rotoevaporation. The resulting solid material was dissolved in approximately 1 ml of methanol and reprecipitated in approximately 75 ml of diethyl ether to yield an orange powder which was collected by titration.
Anal: Calculated: C, 54.51%; H. 5.72%; N, 13.99%; ?, 10.47%; Cl, 6.44. Found; C, 55.04%; H. 6.35%; H, 13.??; O, 10.62%; Cl. 6.68. Example 18 - Modulation of Electrochemiluminescent Signal Generated By Ru(II)- Compound III Conjugate Using Antibodies Specific For Theophylline
The Ru(II)-Compound III Conjugate described in Example 33 was diluted to a final concentration of 150 nM using 0.1M phosphate buffer. pH 6.0, containing 0.35 M sodium fluoride (PBF Buffer). Monoclonal antibody (clone number 9-49. ascites lot number WO399, cat number 046) specific for theophylline was obtained from Kallestad Laboratories, Inc. (Chaska. MN). The monoclonal antibody was diluted to different concentrations using PBF Buffer (between 21.9 micrograms of protein/ml to 700 micrograms/ml).
Another monoclonal antibody (control MAB) that was not reactive wim theophylline was obtained from Sigma (St. Louis. MO) and was diluted to different concentrations between 21.9 micrograms of protein/ml to 700 micrograms/ml using PBF Buffer. A standard solution of theophylline was prepared using theophylline obtained from Aldrich Chemical Co., (Milwaukee. WI, cat number 26-140-8, M.W. 180.17). Theophylline was dissolved in PBF Buffer to give a final concentration of 75 micromolar and was diluted with PBF Buffer to 6 micromolar for use in assays. Prior to making
electrochemiluminescence measurements a solution containing 250 mM oxalic acid and 5% (v/v) Triton-X 100 (ECL solution) was added to the reaction mixture. Measurements were made using a Berthold luminometer that was modified to allow the placement of two platinum gauze electrodes into the test tube containing the reaction solution. The electrodes were connected to a potentiostat and the electrochemiluminescence measurement was made by sweeping an applied potential across the electrodes from 1.5 to 2.5 volts at a scan rate of 50 mV/sec. The Berthold luminometer used for the measurement had a high gain, red sensitive photomultiplier tube. The luminometer output to the recorder was adjusted to 10 counts/volt. The measurements were recorded on an X-Y-Y' recorder and the peak height was used as the measurement of
electrochemiluminescence. The electrodes were cleaned between measurements by rinsing with a buffer at pH 4.? containing 0.1 M phosphate. 0.1 M citrate, 0.025 M oxalic acid, and 1% Triton X-100; pulsing the electrodes in this solution between +2.2 to -2.2 volts for 60 sec; and followed by +2.2 volts for 10 seconds. Next die electrodes were removed from this solution, rinsed in distilled water and wiped dry. The experiment was carried out as outlined in Table XIV.
A solution of control monoclonal antibodies, antibodies to theophylline or PBF Buffer was added to a set of test tubes (Step 1 ). To the tubes, a solution of theophylline or PBF Buffer was added (Step 2). The solutions were mixed by briefly shaking the test tubes and allowed to react for 25 min at room temperature. Then a solution of Ru(II)- Compound III Conjugate was added to the tubes (Step 3). The test tubes were shaken and kept at room temperature for 15 min. Finally, 100 microliters of the ECL solution was added to each tube and electrochemiluminescence was measured as described above. The results are listed in Table XV.
Figure imgf000070_0001
.
Figure imgf000071_0001
57.200 when measured in buffer without the addition of antibody. The background for the buffer mixture was 5750.
The data show that a monoclonal antibody which specifically recognizes theophylline, when contacted with an analog of theophylline to which a ruthenium compound is attached e.g., Ru (II) - Compound III. will decrease the electrochemiluminescence. The decrease in electrochemiluminescence is proportional to the antibody concentrqation when the Ru ( II) - Compound III Conjugate concentration is held constant. When an antibody is used which does not react with meophylline. only a slight decrease in the electrochemiluminescence is seen at the highest concentration of antibody.
The data also show that when theophylline is contacted with the anti-theophylline antibody and then die Ru (II) - Compound III Conjugate is added to the mixture, the amount of electrochemiluminescence is greater. This demonstrates mat theophylline competes for the binding of antibody to Ru (II) - Compound III Conjugate resulting in a greater amount of Ru (II) - Compound III Conjugate which can generate
electrochemiluminescence.
Example 19 - Assay for Theophylline in Serum Based on a Homogeneous
Electrochemiluminescent Immunoassay
Based on the results described Example 34, a homogenous immunoassay for
theophylline was developed using antibody to theophylline and die Ru (II) - Compound III Conjugate described in Example 33 in a competitive binding format. The materials used were described in Example 34 except the PBF buffer was 0.1M phosphate buffer, ph 6.0. containing 0.1 M sodium fluoride. For this assay, a specific concentration of monoclonal antibody to theophylline was chosen. The antibody concentration was 55 micrograms/ml. The Ru (II) - Compound III Conjugate concentration was adjusted to 175 nM. theophylline was added to human serum to give final concentrations of 2.5, 5, 10, 20 and 40 micrograms of theophylline/ml of serum.
The assay was performed by adding 10 microliters of serum to 290 microliters of anti- theophylline monoclonal antibody and holding the solution at room temperature for 25 min. Then 100 microliters Ru (II) - Compound III Conjugate were added to each tube to give a final concentration of 35 NM and holding this solution at room temperature for 15 min. 100 microliters of the ECL solution described in Example 34 were then added to each tube and electrochemiluminescent properties of the solutions were measured as previously described using a sweep mode for 1.5 volts to 2.5 volts at 50 mv/sec. The data are shhown in Fugure 2 and demonstrate that there is a correlation between me concentration of theophylline in a serum sample and the amount of
electrochemiluminescence that is emitted by the reaction mixture. This observation demonstrates that it is possible to develop as assay for theophylline. Based on these results, one skilled in the art would be able to develop a homogeneous electrochemiluminescence immunoassay for detecting and quantifying an analyte of interest in a biological matrix.
Example 20 - Assay for Theophylline in Serum Based on a Homogeneous
Electrochemiluminescence Immunoassay and Comparison to a High Pressure Liquid Chromatographic (HPLC) Method.
Different amounts of theophylline were added to human serum samples to give final concentrations between 2.5 micrograms theophylline/ml and 40 micrograms theophyl- line/ml. Each sample was then divided into two aliquots and the concentration of theophylline in the sample was determined by a homogeneous electrochemiluminescence immunoassay and compared to the results obtained for the same serum samples using an HPLC method. The immunoassay was a competitive binding assay using a monoclonal antibody specific for theophylline and the Ru (II) - Compound III Conjugate. The reagents and memods for this assay are described in a previous example. The HPLC method used to measure the concentration of theophylline in different serum samples is described as follows.
Theophylline (1, 3-dimethylxanthine) was separated from serum proteins by precipitation of the latter with acetonitrile. The supernatant fluid containing theophylline was run on an HPLC system equipped with a Waters Associates Micro Bondapak C18 column, (3.9 mm x 30 cm). The chromatogram was completely resolved in less man 10 min.
The following reagents were used: sodium acetate (reagent grade), deionized water (purified by the Millipore Milli Q• system), acetonitrile (HPLC grade) and theophylline standard, (Sigma). The solvent used for precipitating the serum proteins was a 20 mM sodium acetate buffer, pH 4.0, containing 14% (v/v) acetonitrile. the HPLC mobile phase buffer was 10 mM sodium acetate buffer, pH 4.0, containing 7% (v/v) acetonitrile. The flow rate was 1.5 ml/min., and the eluant was monitored by a UV spectrophotometer set at 270 nm. The sensitivity of the UV absorbance detector was set at 0.02 Absorbance units Full Scale (AUFS). The ambient temperature ranged typically between 22°C and 24°C.
The results for the homogeneous electrochemiluminescent immunoassay and the HPLC assay for determining the concentration of theophylline in serum are shown in Figure 5. The data were plotted as a scattergram and the data points were analyzed by linear regression. The correlation coefficient was calculated. The coneiation coefficient ® was 0.98, which demonstrates excellent correlation between the two assays.
The slope of the curve was 1.197, demonstrating excellent recovery of the theophylline from the serum sample for the homogeneous electrochemiluminescent immunoassay compared to a standard mediod based on HPLC. The homogeneous electrochemiluminescence assay offers advantages over the HPLC mediod because of the speed, sensitivity and ability to easily handle multiple samples. Based on these results, one skilled in the art would know that homogeneous electrochemiluminescent immunoassays for detecting analytes of interest, which may be detected by HPLC and similar methods, may be developed.
Example 21 - Preparation of Theophylline - BSA Biomag• Particles
A 4 ml volume of Biomag•-amine particles (Advanced Magnetic. Inc., Cambridge. MA) was washed 2-3 times in separate T-flasks with 20 ml of phosphate buffered saline (Sigma) (PBS), pH 7.4, containing 0.008% Nonidet P-40 (NP-40). To the Biomag• wet cake. 10 ml of 5% glutaraldehyde (Sigma) in PBS was added and activation was allowed to proceed for 3 hrs. using a rotary mixer. The activated Biomag• particles were washed as described above for a total of 4 washes and transferred to a T-flask.
6.8 mg of theophylline-BSA prepared as described in Example 38 in 10 ml of PBS/NP- 40 were added to the activated Biomag• wet cake. The reaction was allowed to proceed overnight at 4°C with mixing.
The activated Biomag• wet cake was washed 3 times with 20 ml of 1% BSA/0.15M PBS/0.1% azide (pH 7.4), the first wash lasting for approximately 30 min. using a rotary mixer.
Example 22 - Assay for theophylline in serum based on a heterogeneous electrochemiluminescent assay.
Using an immunometric assay format, a heterogeneous assay for theophylline was developed using a Compound I labeled anti-theophylline antibody and theophylline BSA immobilized on Biomag• magnetic particles. The antibody concentration was 20 micrograms/ml. The magnetic particle concentration was 1% solids (wt/vol). Theophylline was added to a final concentration of 10 and 40 micrograms/ml of serum. The theophylline serum standards were diluted 1000 fold in PBF Buffer (sodium phosphate buffer, pH 7.0. 0.1 M sodium fluoride) containing 0.1% BSA.
The assay was performed by the addition of 75 microliters of the diluted serum standards to 75 microliters of antibody conjugated to Compound I and incubating the solution at room temperature for 20 min. Then 50 microliters of the theophylline-BSA- Biomag• particles were added and the suspension was allowed to stand for 5 min. The particles were separated magnetically and 100 microliters of the supernatant was measured for electrochemiluminescence as described in Example 48.
Figure imgf000078_0001
Based on these results, one skilled in the art would be able to develop a heterogeneous electrochemiluminescence immunoassay for other analytes of interest in a biological matrix.
Example 23 - Electrochemiluminescence (ECL) of compound II-Digoxigenin
Conjugate: Modulation of ECL Signal by anti-digoxin antibody
Monoclonal antibody to digoxin was diluted to the following concentrations in immunoassay buffer:
1, 10, 50. 200, 400 micrograms/ml
Compound II-Digoxigenin conjugate (50 micromolar) was diluted to 150 nM in immunoassay buffer (0.1 M phosphate buffer, pH 6.0. containing 0.1M sodium fluoride).
To 200 microliters of immunoassay buffer in polypropylene tubes (12 mm x 75 mm) were added 100 microliters of various concentrations of digoxin antibody and 100 microliters of Compound II-Digoxigenin conjugate (150 nM). Tubes were mixed on a vortex and incubated at room temperature for 15 min. Following incubation. 100 microliters of ECL solution (previously described) were added and
electrochemiluminescence was measured.
Figure imgf000079_0001
Figure imgf000080_0001
Total ECL Counts for 30 nM Compound II-Digoxigenin Conjugate = 1 13666 (peak height)
At a concentration of 40 micrograms/tube. non-specific antibody modulation of signal was 67.000 counts compared to 36.000 counts in the presence of a specific antibody to digoxin.
As can be seen from Figure 6. an increasing concentration of anti-digoxin antibody when reacted widi a fixed concentration of Compound II-Digoxigenin Conjugate showed increasing modulation of the electrochemiluminescent signal, this characteristic may be used advantageously to develop a homogeneous electrochemiluminescence based assay for the measurement of digoxin in serum or plasma.
Example 24 - Homogeneous Digoxin Assay
Based on the results described in Example 23. a homogenous electrochemiluminescent immunoassay for digoxin may be developed using antibody to digoxin and the
Compound II-Digoxigenin conjugate using a competitive binding assay format, the reagents which may be used have been described in Example 23. for this assay, a specific concentration of monoclonal antibody to digoxin would be chosen, the antibody concentration may be between 75 to 100 micrograms per ml. The Compound II- digoxigenin conjugate concentrations may be between 5-15 nM (Final concentration). digoxin Standard would be added to human serum to give a final concentration of 0.1, 0.5, 1, 2, 4, 8 and 16 nanograms of digoxin per ml of serum.
The assay may be performed by adding 10-30 microliters of serum to 300 microliters of anti-digoxin monoclonal antibody and holding the solution at room temperature of 30 min. Then 100 microliters of the Compound II-Digoxigenin conjugate may be added to each tube to give a final concentration within the range of 5 to 15 nM and incubating the solution at room temperature for 20 min. 100 microliters of me ECL solution previously described may be added to each tube and ECL may be measured as previously described.
Example 25 - Heterogeneous electrochemiluminescent immunoassay for digoxin
10 mg of solid digoxin were dissolved in 10 ml of DMSO:H2O (8:2), to give a digoxin concentration of 1 mg/ml (hereinafter Stock Standard).
Working standards were prepared from the Stock Standard to the following
concentrations in 0.15 M phosphate buffer, pH 7.0. containing 0.1% BSA and 0.15 M NaF (hereinafter ECL Buffer): 80 ng/ml. 40 ng/ml. 20 ng/ml. 10 ng/ml. 5 ng/ml and 0 ng/ml.
75 microliters of anti-digoxin-Compound I conjugate (diluted 1 :90) and 75 microliters of the each standard were pipetted into a class tube, mixed on vortex and incubated at room temperature for 20 min.
50 microliters of prewashed oubain-BSA-Biomag• particles were added to each tube, mixed on a vortex and incubated at room temperature for 5 min. Biomag• particles were separated and supernatant was transferred to a separate tube.
100 microliters of supernatant were mixed with 400 microliters of 0.125 M potassium phosphate 0.125 M citric acid; 32 mM oxalic acid; 1.25% Triton x-100 in a tube.
The sample was placed into a Berthold instrument and the electrochemiluminescence was measured as previously described except the procedure was modified by stepping the applied potential from open circuit to 2.2V and integrating the photon counts for 10 sec. The electrode was cleaned between measurements using phosphate-citrate buffer as follows:
(a) Pulse electrode using 3 sec intervals alternating between -2.2V and +2.2V for 1 min.
(b) Poise the electrode at +2.2V for 10 seconds.
(c) Rinse electrode with deionized water H2O and blot dry.
The results are shown in Figure 7.
Example 26 - Labeling DNA with an electrochemiluminescent moiety
The following two methods have been used to label DNA with an
electrochemiluminescent moiety.
Synthesis A
1.0 A 260 of the custom synthesized 38 mer (MBI 38)
TCACCAATAAACCGCAAACACCATCCCGTCCTGCCAGT* where T* is diymidine modified at carbon 5 with
-CH=CH-CO-NH-(CH2)7-NH2 were dissolved in 100 microliters of 0.01 M phosphate buffer, pH 8.7. 100 microliters of a solution of bis(2.2'-bipyridine)[4-(butan-l -al)-4'-methyl-2,2'-bipyridine]rudιenium (II) diperchlorate (Compound I) (2.3 mg in 300 microliters of 0.01 M potassium phosphate buffer, pH 8.7). The contents were stirred and allowed to stand at room temperature overnight.
100 microliters of a saturated aqueous solution of sodium borohydride was added to the mixture to convert the reversible imine Schiff s base linkage into non-reversible amine linkage, the reaction was allowed to run at room temperature for 2 hrs. The solution was then treated carefully with a few drops of dil. acetic acid to quench excess of sodium borohydride. The reaction solution was loaded onto a P-2 gel filtration column ( 18 inches x 1/2 inch) which had been preequilibrated with 0.1 M triethylammonium acetate. pH 6.77. The column was eluted with the same buffer and 2 ml fractions were collected at a flow rate of 20 mi/hr. DNA eluted in fractions 9 and 10 were well separated from unreacted ruthenium bipyridyl complex, the collected DNA sample exhibited typical UV absorption and additionally showed a fluorescent emission spectrum at 620 nm when excited at 450 nm. The fluorescent emission shows the presence of the ruthenium bipyridyl moiety in the DNA sample. The product travels as a single orange fluorescent band on polyacrylamide gel electrophoresis. The electrophoretic mobility of the labeled DNA (MBI 38-Compound I Conjugate) is approximately the same as the unlabeled DNA.
Synthesis B
The ruthenium complex was first converted into an N-hydroxysuccinimide derivative by dissolving 3 mg in 60 microliters of anhydrous dimethvlformamide and treating it with a solution of N-hydroxysuccinimide (52 mg) in 200 microliters of anhydrous DMF in the presence of 94 mg dicyclohexyicarbodiimide (DCC). The reaction was allowed to proceed for 4 hrs at 0°C. Precipitated dicyclohexylurea was removed by centrifugation and the supernatant (200 microliters) was added to the solution of amino-linked DNA (described in Synthesis A) in .01 M phosphate buffer pH 8.77 (2A260 in 100 microliters of buffer). The reaction was allowed to proceed overnight at room temperature. A considerable amount of solid appeared in the reaction which was removed by filtration through glass wool. The filtrate was concentrated and dissolved in 0.5 ml of 1 M triemylammonium acetate (pH 6.8). The reaction mixture was then chromato graphed as described in Synthesis A. The labeled DNA exhibited all spectral and electrophoretic characteristics as discussed for the material prepared in Synthesis A. Example 27 - Electrogenerated Chemiluminescent Properties of labeled DNA
The labeled DNA sample from Example 26, Synthesis A (MBI 38-Compound I) was used to study its electrochemiluminescent properties. Various concentrations of labeled DNA were dissolved in 0.5 ml of 0.1 M phosphate buffer, pH 4.2, containing 0.1 M citrate 25 nM oxalate and 1.0% Triton X-l 00 and measured on a modified Berthold luminometer. Figure 8 shows the response of the electrochemiluminescent signal to various DNA concentrations.
Example 28 - Hybridization studies of Compound I-labeled oligonucleotide
The complementary strand to the 38 mer described in Example 27 was synthesized using the ABI model 380 B DNA Synthesizer and was designated MGEN-38.
To determine if the covalent attachment of Compound I to the oligonucleotide affected die hybridization properties of the MBI 38 oligonucleotide, the following experiment was devised. Various concentrations of the target fragment (MGEN-38) were spotted on a sheet of Geiman RP nylon membrane, fixed and probed with either MBI 38 or MBI 38- Compound I. Both fragments were treated with T4 polynucieotide kinase and gamma 32P[ATP] and labeled with 32P at the 5' end. The hybridization sensitivities of DNA and Compound I-labeled DNA were then compared.
Concentrations of MGEN-38 DNA, ranging from 50 ng down to 0.05 ng, were spotted on a nylon membrane and allowed to air dry. Duplicate membranes were set up. The blots were treated for 2 min each in : 1.5M NaCl-0.5M NaOH to fully denature the DNA; 1.5M. NaCl-0.5M TRIS to neutralize the blot, and finally in 2X SSC. The blot was baked in a vacuum oven at 80°C for 2 hrs.
The hybridization probe was prepared as follows: 3 micrograms of MBI 38 and MBI 38- Compound I were kinased with 10 units of T4 kinase and 125 microcuries of gamma 32P- ATP. The percentage of isotope incorporation into DNA was determined and shown below.
Figure imgf000087_0001
Figure imgf000088_0001
Prehybridization and hybridization solutions were prepared according to Maniatis (24). Blots were prehybridized for 4 hrs at 53°C widi 50 micrograms/ml of calf thymus DNA. The blots were then placed in hybridization solution containing the respective probes at 10,000,000 cpm, and allowed to hybridize overnight (12 hrs) at 53°C. the following day, die blots were washed as follows:
- twice with 2 X SSC + 0.1%SDS at 53°C for 15 minutes each wash
- twice with 0.2 X SSC + 0.1 %SDS (same as above)
- twice with 0.16 X SSC + 0.1 %SDS (same as above)
The blots were then air dried and exposed to Kodak X-omat• film at -70°C.
Analysis of the X-ray (see Figure 9) showed that very similar hybridization patterns were observed between the MBI 38 and MBI 83-Compound I probe. In both cases hybridization of probe to 0.5 ng of target was observed, and faint traces of hybridization were observed down to 0.05 ng of target DNA. No hybridization activity by the probe was detected for the negative control DNA (phage lambda DNA spotted at 50 ng). Example 29 - Preparation of cis-dichloro-bis-[4,4'-carbomethoxy)-2,2'-bipyridine] ruthenium (II)
Into a 250 ml round bottom flash equipped with stirbar and reflux condenser were added 750 mg (1.55 mmol) of cis-tetra-(dimethylsulfoxide) dichlororuthenium (II)
(Ru(DMSO)4Cl2) and 100 ml ethylene glycol. The contents of the flask were brought to a gentle boil under argon atmosphere and 756 mg (3.09 mmol) of (4,4'-carbomethoxy)- 2,2 '-bipyridine were added. Heating under argon was continued for 5 min. The orange solution became brown/black and 0.75 g of lithium chloride and 50 ml ethylene glycol were added. The solution was heated for anodier 10 min. After cooling to room temperature, approximately 100 ml H2O were added to the mixture. The mixture was extracted with five 200 ml portions of CH2Cl2.
The CH2Cl2 extracts were washed with six 200 ml portions o water. The water layers were tested for fluorescence (red) after each washing and washing was continued if necessary until no fluorescence could be detected in the aqueous layer. The CH2Cl2 extracts were dried over anhydrous Na2SO4. The product was isolated by evaporation of the CH2Cl2 solution of the product into a stirred 10-fold volume excess of anhydrous diethyl ether. The precipitated product was collected by suction filtration, washed once widi 30 ml diemyl ether and dried over CaSO4 overnight in a vacuum desiccator. Yield = 25% dark metallic green crystals.
The product is analytically pure.
Theory: C. 44.57; H, 4.01 ; N. 7.43; Cl, 9.40; O, 21.21. Found: C, 44.16: H. 3.72: N. 7.1 1 : Cl. 9.53; O. 20.15.
MW = 754.5 g/mole.
Figure imgf000090_0001
Example 30 - Preparation of bis[(4,4'-carbomethoxy)-2,2'-bipyridine] 2-[3-(4-methyl- 2,2'-bipyridine-4-yl)propyl]-1,3-dioxoiane rudienium (II) diperchlorate
To 250 mg of bis[(4,4'-carbomethoxy)-2,2'-bipyridine] ruthenium (II) dichloride (0.33 mmol) in 50 ml methanol/water (1 :1) were added 105 mg (0..37 mmol) of 2-[3-(4- methyl-2.2'-bipyridine-4'-yl)-propyl]-1.3-dioxclane (bpyoxal) and die mixture was refluxed for 12 hrs under an argon atmosphere. The solution was cooled and 0.5 ml of 70% H ClO4 were added, the methanol was slowly evaporated. Red crystals precipitated and were collected on a fritted funnel, washed with a small amount of cold water followed by ethanol and ether and dried to vacuo. Similar methods were used to prepare complexes from bis (4.4'-dicarbomethoxy-2,2'-bipyridine) ruthenium (II) dichloride and either 4'(4-methyl-2.2'-bipyridine-4'-yl)-butyric acid or 4-4'-methyl-2,2'-bipyridine.
Figure imgf000091_0001
Example 31 - Compound I Labeling of Human IgG
2 ml of human IgG (2.5 mg/ml) were dialyzed against 2 liters of 0.2M sodium
bicarbonate buffer. pH 9.6. overnight at 4°C with gentle stirring. Compound I was prepared in a 100 molar excess to protein present (2.7 mg/100 microliters
dimethylformamide) and allowed to dissolve. The dialyzed protein was added dropwise to die tag-aldehyde while gently stirring at room temperature for 2 hrs. A 100 molar excess (to protein) of sodium borohydride ( 100 microliters of a 1.24 mg/ml solution in deionized water) was added to the solution and gently stirred for an additional 30 min at room temperature, the conjugate was loaded onto a Sephadex G-25 column (1.0 cm x 18.0 cm) equilibrated at room temperature with 0.2M Tris, pH 8.0, and the eiuant was monitored at 280 nm. the void volume peak was collected, pooled, and dialyzed against 2 liters of the Tris buffer. The conjugate was tested for immunological activity by standard ELISA methods, and stored at 4°C until used.
Example 32 - Biomag•/Goat-Anti-Human IgG Panicle Preparation
A 2.5 ml aliquot of 5% Biomag•-amine terminated particles (Advanced Magnetics. Cambridge, MA) was transferred to a clean T-flask and washed 5 times with phosphate buffered saline (PBS). The wet cake was resuspended in 12.5 ml of 5% fresh
glutaraldehyde (Sigma) and rotated end-over-end at ambient temperature for 3 hrs. The wet cake was transferred to a second T-flask and washed 3 times with PBS. The activated particles were resuspended to 12.5 ml with PBS. and transferred to a 15 ml centrifuge tube. To this suspension were added 12.5 mg of goat ant-human IgG (H+L) (Jackson Labs) in 2 ml of PBS. the tube was rotated end-over-end for 3 hrs at room temperature and then overnight at 4°C. The next day the particles were washed 2 times with PBS containing 1% (w/v) bovine serum albumin (BSA) followed by storage in 12.5 mi of PBS containing 0.1 % BSA at 4°C until use.
Example 33 - Pseudo-Homogeneous Human IgG Electrochemiluminescence Assay Using Biomag• Magnetic Based Particle Assay
Compound I-human IgG conjugate was diluted 1:50 in 0.15M phosphate buffer containing 0.1 % BSA and aliquoted at 250 microliters/tube. 150 microliters of diluent (PB w/BSA as above) were added per tube, followed by the addition of either various dilutions of analyte (human IgG) or diluent (negative controls). Additionally, a nonspecific analyte (goat anti-rabbit IgG) was used in some tubes to check for assay specificity. 50 microliters of 1 % Biomag• coupled with goat anti-human IgG (H&L) were added to each tube. The tubes were mixed on a vortex and incubated at room temperature for 15 min with gentle shaking, the particles were magnetically removed fro solution and 100 microliters of the resulting supernatant were transferred to a Berthold tube to which 400 microliters of a citrate-oxalate-Triton X-100 solution were added. The tube was mixed on a vortex and read in a modified Berthold luminometer fitted with an R-268 photomultiplier tube and a 0.29 inch diameter circular 52 gauge double platinum mesh electrode supported by a conductive paint covered polycarbonate support and connected to the voltage source through a 0.01 inch diameter platinum wire/silver paint contact. The potential applied was stepped from +1.4 to +2.15 V while a 10 second integration was done. Between readings the electrode was electrochemically cleaned by rinsing with deionized water, then immersing in 0.1 M phosphate-citrate buffer containing oxalic acid and Triton X-100 and stepping the applied potential from -2.2V to +2.2V (with 3 seconds at each potential) for 2 min and 20 seconds followed by pausing the potential at +2.2V for 10 seconds. The electrode was removed from the cleaning solution, rinsed with deionized water and blotted dry with an absorbent wiper. In this format the electrochemiluminescent signal was directly proportional to the analyte concentration. Example 34 - Labeling of hCG Peptide with Compound IV
2 mg of human chorionic gonadotropin (hCG) peptide (#109-145, JP141, Vernon Stevens. Ohio State University) were suspended in 1 ml of 0.15M citrate buffer. pH 6.0, and 1.13 mg of Compound IV were dissolved in 300 microliters of dimethylformamide. The peptide solution was added dropwise to the Compound IV solution over a one minute period. The solution was stirred gently at room temperature for 1 hr. The sample was then loaded onto a Bio-Gel P-2 column (Bio-Rad; 1 cm X 45 cm) which was equilibrated at room temperature with 0.2 M Tris-base, pH 8.5 at a flow rate of 15 ml/hr and the eluant was monitored at 280 nm. The void volume of the run was collected, pooled, and loaded onto a QAE-Sephadex A-25 column (Pharmacia; 1 cm x 10 cm) which was equilibrated at room temperature with 50 mM Tris-HCl, pH 7.0. This was done to remove any unlabeled peptides (which will adsorb to the positively charged resin; the positive charge of the labeled peptide allowed it to pass out of the column without further treatment), the eluant was monitored at 280 nm, and the first major peak was collected, pooled, and concentrated by lyophilization. The dried compound was resuspended in a minimal volume of PBF. The hCG peptide-Compound IV conjugate was stored at 4°C until used.
Example 35 - Electrochemiluminescence signal Output: Stability Data of Ru (II) - Compound III Conjugate
Ru(II) -Compound III conjugate was diluted to 300 nM in 0.1 M phosphate-citrate buffer, pH 6.1, either with or without 1% normal human serum (NHS). One of each buffer type was incubated at 4°, 20°, 37° and 55°C and sampled on incubation days 3, 4 and 5. The samples were equilibrated at room temperature and evaluated for their
electrochemiluminescence signal output. 400 microliters of sample was mixed with 100 microliters of 125mM oxalic acid-5% Triton X-100 in a tube and placed in a modified Berthold luminometer with a Hamamatsu R-268 photomultiplier tube and a double mesh platinum gauze electrode. The reading was made by sweeping the applied potential from +1.5V to +2.5V at 50 mV/second for 3 cycles and the height of the second cycle peak was recorded and converted into electrochemiluminescent counts. Between readings the electrode was cleaned electrochemically by rinsing with deionized water, immersing the electrode in 0.1 M phosphate-citrate buffer containing 25 mM oxalate and 1% Triton X- 100 and pulsing the potential from -2.2V for 10 and 50 sec. the potential was poised at +2.2V for 10 sec and then removed, the electrode was removed from the cleaning solution, rinsed with deionized water and blotted dry with absorbent toweling. The results show that there was consistent signal in each buffer type over the course ofthe study. This indicates the stability of the reagent and its capability of generating an electrochemiluminescent signal.
Example 36 - Immunoreactivity Testing of Ru(II)-Compound III Conjugate: Stability Studies
The Ru(II)-Compound III conjugate was diluted and incubated under the conditions as described in Example 66. Samples were taken on days 3. 4. and 5 cooled to room temperature and tested for immunoreactivity by Particle Concentration Fluorescent Immunoassay (PCFIA) using a Pandex Screen Machine obtained from Pandex. Inc., Mundelein, IL. the PCFIA was run in a competitive assay format. The latex particles (Pandex) were conjugated with theophylline-BSA. A constant amount of these particles were mixed with the Ru(II)-Compound III Conjugate test solution to final concentrations of anti-theophylline monoclonal antibody (ascites, Hyclone cat #E-312OM, lot #RD200) and a constant amount of goat anti-mouse IgG-FITC conjugate (Pandex, cat #33-020-1 lot #COl ). After incubation, the samples were processed and read on the Pandex Screen Machine. The results showed that there was no appreciable loss of activity even after 5 days incubation at 55°C.
Example 37 - Electrochemiluminescence of various ruthenium and osmium compounds
The electrochemistry of various osmium and ruthenium compounds was measured as 1 mM solutions in 10 ml of nitrogen-purged acetonitrile with 0.1 M tetrabutylammonium tetrafluoroborate as an electrolyte. The working electrode was a platinum disk electrode obtained from Bioanaiytical systems, Inc.. West Lafayette, IN. A platinum wire counter electrode and a 1.0 mm silver wire was used as a reference electrode. Measurements were made by scanning from -2.2V to +2.2V (vs SCE) at a scan rate of 100 mV/second. After each electrochemical measurement the potential difference between a Saturated Calomel Reference electrode (SCE) and the silver wire was determined. Thus, the values reported are corrected to the potential versus SCE.
Electrochemiluminescent (ECL) measurement were made in 0.5 ml aqueous solutions containing 0.1 M phosphate-citrate buffer (pH 4.2), 25 mM oxalic acid, and 1% Triton X- 100. The electrode system used consisted of two platinum gauze (52 gauge) electrodes connected to a Radio Shack transistor socket (#276-548) by a 0.1 mm platinum wire. The electrodes were mounted on the outside of a 60 ml thick piece of cellulose acetate plastic. This plastic was machined so that a 1/4 inch diameter hole allows solution to easily flow between the working and counter-reference electrodes. The electrodes were connected to the potentiostat so that one electrode functioned as a working electrode (which was closer to the photomultiplier tube) and one electrode functioned as the counter and reference electrode. Measurements were made by sweeping from 1.5V to 2.5 V (bias potential) at a scan rate of 50 mV/second. The ECL measurements are reported as the signal to noise ratio, i.e.. or signal to background ratio for a given concentration of compound. Background is defined as the luminescent counts observed with buffer and no ECL compounds added. Luminescent measurements were the peak light output observed during the first or second linear sweep. Both electrochemiluminescent (ECL) and cyclic voltammetric measurements of each solution were performed with either a EG&G Model 273 potentiostat or a bipotentiostat from Ursar Scientific Instruments. Oxford. England. The photon flux of each ECL measurement was monitored with a Berthold Biolumat LB 9500 luminometer from Wilebad. West Germany, modified so that either a two or three electrode system could be placed in the 0.5 mi measuring solution. Bom electrochemical and
electrochemiluminescent measurements were recorded on a Kipp & Zonen Model BD 91 X. Y, Y' recorder from Delft. Holland.
Fluorescence measurements were made with 50 micromolar solutions of the desired compound in 3.0 ml of ECL solution , or when insoluble in ECL solution, in
Acetonitrile. Measurements were made on a Perkin-Elmer LS-5 Fluorescence
Spectrophotometer. Prescans of the solutions' excitation and emission spectra were performed before the excitation and emission spectra were recorded so that the emission spectrum could be measured while irradiating at the maximum excitation wavelength and conversely, the excitation spectrum could be recorded while monitoring the maximum emission wavelength.
Figure imgf000099_0001
Figure imgf000100_0001
1 (S/N) is the signal to noise ratio, where the signal is defined as the ECL output (luminescent counts) of a compound at a given concentration, and noise is the luminescent counts of the buffer in which the compound was dissolved.
Unlike the ECL of the other compounds which were measured a pH 4.2, compound C) also displays significant ECL at the physiological pH of 7.0. a) Tris (2,2'-bipyridine) ruthenium
b) Tris (4,4'-carboxylate-2,2'-bipyridine ruthenium 2+ c) Tris (4,4'-carboethoxy-2,2'-bipyridine) ruthenium 2+ d) bis(2,2'-bipyridine)[theophylline-8-butyric-4-(4-methyl-2,2 bipyridine)-4\vl)-butyl)amide]mthenium (II) dichloride e) [bis-(2,2'-bipyridine) {monocarbonyl} pyridyl] osmium (II)
dihexafluorophosphate
f) (2,2'-bipyridine[cis-bis(1,2-diphenyphosphine)ethylenej{2- [3- (4-methyl-2,2'-bipuridine-4'-yl)propyl]-1,3-dioxoiane}
osmium
(II) dichloride
Synthesis of Particular Modified Electrochemiluminescent Compounds
The first molecule that was synthesized in the series was compound (II). This compound was difficult to purify because of undesirable hydrolysis of die ester groups. The presence of more than one carboxy functional group on the label might result in inter and intra molecular cross linking of functional groups within proteins. Since this modified electrochemiluminescent label had undergone partial hydrolysis, a study ofthe hydrolysis of the material in aqueous medium did not provide valuable information. Compound (II) was produced according to Reaction Scheme 1 reproduced below.
Figure imgf000101_0001
Compound (I) is the fully hydrolyzed form of compound (II). The synthetic route is shown below in Reaction Scheme 2. Purification of the material by conventional ion- exchange and desalting columns proved to be a difficult task because of the extreme hydrophilic nature of the product. Although the purity of the material was satisfactory by 1H-NMR analysis, the material was associated with NaCl and NH4 +PF6- salts.
Figure imgf000102_0001
Compound (III) was then prepared for labeling purposes according to Reaction Scheme 3 shown below. In order to avoid hydrolyzing the ester groups, the material was not subjected to any form of column chromatography. Instead, it was precipitated as a PF6- salt and washed with water and ether. The purity of compound (III) was found to be satisfactory by 1H-NMR analysis. Compound (III) was used in labeling TSH antibody and its performance was tested in a sandwich assay. Hydrolysis of the ester groups in compound (III) has also been studied along with other analogs in the series. The ECL response of compound (III) is 8 times less than that of analogous label compound (IV) which lacks the carboxy ester groups on the bipyridine ligands.
Figure imgf000103_0001
According to Reaction Scheme 4 set forth below, compound (V) was then synthesized. This compound was also not subjected to column chromatography purification. Hydrolysis of compound (V) gave compound (I). Compound V showed an ECL intensity enhancement of ~13 fold yielding compound (I) in assay buffer in 90 hours. By comparison, hydrolysis of compound (III) yielding according to Reaction Scheme 3 yielded a corresponding compound having an enhancement of ECL signal by
7.5 times in 90 hours in assay buffer.
'
Figure imgf000104_0001
Reaction Scheme 5 set forth below shows the steps involved in the synthesis of die compound (VI). This label's ECL intensity was 4 times less than that of compound (IV). The ECL intensity of label (VI) was 2 times greater than that of compound (III) when the molecules were excited by ramping the voltage.
Figure imgf000104_0002
In order to examine whether the presence of only one 4,4'-dicarboxy 2,2'- bipyridine was sufficient for long ECL lifetimes, compound (VII) was synthesized as depicted below in Reaction Scheme 6. The ECL intensity of this label was found to be closely comparable to the compound (IV) both by ramp and step potential methods.
Figure imgf000105_0001
Compound (VII) has an ECL intensity very similar to the ECL intensity of compound (IV).
REFERENCES
1. Weber. S.G., et al., Photoeiectroanalytical Chemistry: Possible Interference in Serum and Selective Determination of Tris (2,2'-bypyridine) ruthenium (II) in the Presence of Interferants. Clinical Chemistry, 29. 1665-1672 (1983).
2. Rubinstein. I. and Bard. A.J.. Electrogenerated Chemiluminescence. 37.
Aqueous ECL Systems Based on Ru (2,2'-bypyridine)3 +2 and Oxalate or Organic Acids, J. Am. Chem. Soc. 103, 512-516 (1981).
3. White. H.S. and Bard. A.J.. Electrogenerated Chemiluminescence. 41.
Electrogenerated Chemiluminescence and Chemiluminescence of the Ru (2,2'- bpy)3 +2 - S2O8 -2 System in Acetonitrile - Water Solutions. J. Am. Chem. Soc. , 104. 6891 (1982).
4. Curtis, et al.. Chemiluminescence: A New Method for Detecting Fluorescent Compounds Separated by Thin Layer Chromatography, J. Chromatography, 134, 343-350 (1977).
5. Sprintschnik. G., et al., Preparation and Photochemical Reactivity of Surfactant Ruthenium (II) Complexes in Monolayers Assemblies and at Water - Solid Interfaces. J. Am. Chem. Soc, 99. 4947-4954 (1977).
6. Minnich. S.A.. et al., Enzyme Immunoassay for Detection of Salmonellae in Foods. Appl. and Environ. Micro., 43. 1124-1127 (1982).
7. Thomason. B.M., Current Status of Immunofluorescent Methodology for
Salmonellae. J. Food Prod., 44, 381-384 (1981).
8. Mattingly, J.A., An Enzyme Immunoassay for the Detection of All Salmonellae Using a Combination of a Myeloma Protein and a Hybridoma Antibody, J. Immunol. Meth., 73. 147-156 (1984).
9. Thompson, N.E. et al., Detection of Staphylococcal Enterotoxins by Enzyme- Linked Immunosorbent Assays and Radio-immunoassays: Comparison of Monoclonal and Polyclonal Antibody Systems. Appl. and Environ. Micro., submitted publication.
10. American Public Health Association. Standard methods for the examination of water and wastewater. 15th ed. American Public Health Association. Inc., New York (1980).
11. American Public Health Association. Compendium of memods for the
microbiological examination of foods. American Public Health Association.
Washington. D.C. ( 1976).
12. Clark. H.F., Geldreich. E.E., Lester. H.L., and Kabler. P.W., The membrane filter in sanitary microbiology, Public Health Rep. 66: 951-957 (1951).
13. Feng, P., and Hartman. P. A.. Fluorogenic assays for immediate confirmation of Escherichia coli., Appl. Environ. Microbiol., 43: 1320-1329 (1982).
14. Geidreich. E.E., Standard Method Revisions (16th edition) for Conventional Coliform Procedures, in New developments in drinking water microbiology workshop, 85th Annual Meeting of the American Society for Microbiology (1985).
15. Hussong, D., Colwell. R.R.. and Weiner, R.M., Rate of occurrence of false- positive results from total coliform most-probable-number analysis of shellfish and estuaries. Appl. Environ. Microbiol. 40: 981-983 (1980).
16. Hussong, D., Demare. J.M., Weiner. R.M., and Colwell, R.R., Bacteria associated with false-positive most-probable-number coliform test results for shellfish and estuaries, Appl. Environ. Microbiol. 41 : 35-45 (1981).
17. Lin, S., Evaluation of coliform tests for chlorinated secondary effluents, J. Water Pollut. Control Fed. 45: 498-506 (1973).
18. Mckee. J.E., McLaughlin. R.T., and Lesgourgues, P., Application of molecular filter techniques to the bacterial assay of sewage. III. Effects of physical and chemical disinfection. Sewage Ind. Waste 30: 245-252 (1958). 19. Mead, J.A.R., Smith. J.N., and Williams. R.T.. The biosynthesis ofthe
glucuronides of umbelliferone and 4-methylumbeiliferone and their use in fluorimetric determination of beta-glucuronidase. Biochem. J. 61 : 569-574 (1954).
20. Olson, B.H. Enhanced accuracy of coliform testing in seawater by modification of the most-probable-number method. Api. Environ. Microbiol.. 36: 438-444 (1978).
21. Presnell. M. W., Evaluation of membrane filter methods for enumerating coliform and fecal coliforms in estuaries waters, Proc. National Shellfish Sanitation Workshop. 1974: 127-131 (1974).
22. Presswood. W.G. and Strong, D.K., Modification of mFC medium by eliminating rosolic acid. Appl. Environ. Microbiol. 36: 90-94 (1978).
23. Warr, G.W. and Marchasonis, J.J., Purification of Antibodies, in Antibody as a Tool, J.Wiley and Sons, NY, pp. 59-96 (1982).
24. Maniatis. T., Fritsch. E.F., and Sambrook, J., Molecular Cloning: A Laboratory Manual, p. 150-160. Cold Spring Harbor Press. Cold Spring Harbor. NY (1982).
25. U.S. Patent No. 5.061.445 issued October 29, 1991 to Zoski et al.
26. U.S. Patent No. 5.093.268 issued March 3. 1992 to Leventis et al.
27. U.S. Patent No. 5.147.806 issued September 15. 1992 to Kamin et al.
28. U.S. Patent No. 5,221.605 issued June 22. 1993 to Bard et al.
29. U.S. Patent No. 5,238.808 issued August 24. 1993 to Bard et al.
30. U.S. Patent No. 5.247.243 issued September 21 , 1993 to Hall et al.
31. U.S. Patent No. 5.296, 191 issued March 24. 1994 to Hall et al.
32. U.7 Patent No. 5.310. 687 issued May 10. 1994 to Bard et al.
33. U.S. Patent No. 5.453.356 issued September 26. 1995 to Bard et al. 34. PCT Intl. App. having Intl. Filing Date October 31. 1989: Intl. App. No.
PCT/US89/04919: Intl. Pub. Date May 17. 1990: and Intl. Pub. No. WO
90/05301.
35. PCT Intl. App. having Intl. Filing Date February 5, 1992; Intl. App. No.
PCT/US92/00992: Intl. Pub. Date August 20. 1992: and Intl. Pub. No. WO 92/14139.
36. PCT Intl. App. having intl. Filing Date October 30. 1985; Intl. App. No.
PCT/US85/02153: Intl. Pub. Date May 9, 1986; and Intl. Pub. No. WO 86/02734.
Notwidistanding the above specification describing in some detail the present invention, including particular examples, the patent should not be limited by the foregoing.

Claims

WE CLAIM:
1. A modified electrochemiluminescent compound or its corresponding salt having the structure
Figure imgf000110_0001
wherein X and Y may be the same or different, and each of X and Y is selected from the group consisting of H. COOH. COOCH3, COOCH2CH3,
COOCH2CH2CH3. OH. CH2OH. CF3, NO2, Br. Cl. I, F. CN;
NR1R2 where R1 and R2 may be the same or different, and each of R1 and R2 is selected from the group consisting of H. CH3, CH2CH3, and CH2CH2CH3
CONR'R2 where R1 and R2 may be the same or different, and each of Rl and R2 is selected from the group consisting of H. CH3, CH2CH3, and CH2CH2CH3;
(-OCH2CH2)n-OH where n is an integer ranging from 1 to 10, inclusive;
provided that at least one of X or Y is other than H; and
further provided that the modified electrochemiluminescent compound exhibits decreased nonspecific binding relative to ruthenium (II) (2,2'-bipyridine)3 +2.
2. A compound as in claim 1 having the formula (I)
Figure imgf000111_0001
3. A compound as in claim 1 having the formula (II)
Figure imgf000111_0002
4. A compound as in ciaim 1 having the formula (III)
Figure imgf000112_0001
5. A compound as in claim 1 having the formula (IV)
Figure imgf000112_0002
6. A compound as in claim 1 having the formula (V)
Figure imgf000113_0001
7. A compound as in claim 1 having the formula (VI)
Figure imgf000113_0002
8. A compound as in claim 1 having the formula (VII)
Figure imgf000114_0001
9. A compound or its corresponding salt selected from the group consisting of ruthenium (II) (2.2'-bipyridine-4,4'-dicarboxylic acid)3 +2;
ruthenium (II) (2,2,-bipyridine-4,4'-dimethyl-dicarboxylate)3 +2;
ruthenium (II) (2.2'-bipyridine-4.4'-diethyl-dicarboxylate)3 +2;
ruthenium (II) (2.2'-bipyridine-4.4'-dipropyl-dicarboxylate)3 +2;
ruthenium (II) (2.2'-bipyridine-4.4'-dipropyldicarboxamide)3 +2;
ruthenium (II) (2,2'-bipyridine)2 (2,2'-bipyridine-4,4'-dicarboxylic acid)1 +2; ruthenium (II) (2.2'-bipyridine)2 (2,2'-bipyridine-4-methyl-4'-propyl-[-3- carboxy lie acid])1 +2;
rudienium (II) (2,2'-bipyridine-4,4'-diethyl-dicarboxylate)2 (2,2'-bipyridine-4- methyl-4'-propyl-[-3-carboxylic acid])1 +2;
ruthenium (II) (2,2'-bipyridine-4.4'-dimethyl-dicarboxylate)2 (2,2'-bipyridine-
4,4'-dicarboxylic acid)1 +2; ruthenium (II) (2,2'-bipyridine-4.4'-di-(CH2)n-dicarboxylate)3 +2 where n is an integer ranging from 1 to 5, inclusive;
ruthenium (II) (2,2'-bipyridine-4-X-4'-Y) wherein X and Y may be the same or different, and each of X and Y is selected from the group consisting of H. COOH,
COOCH3, COOCHXH3, COOCH2CH2CH3, OH, CH2OH. CF3, NO2, Br, Cl, I,
F, CN;
NR1R2 where R1 and R2 may be the same or different, and each of R1 and R2 is selected from the group consisting of H, CH3, CH2CH3, and CH2CH2CH3
CONR'R2 where R1 and R2 may be the same or different, and each of R1 and R2 is selected from the group consisting of H. CH3, CH2CH3, and CH2CH2CH3; and
(-OCH2CH2)n-OH where n is an integer ranging from 1 to 10, inclusive;
provided that at least one of X or Y is other than H; and
further provided that the modified electrochemiluminescent compound exhibits decreased nonspecific binding relative to rudienium (II) (2,2'-bipyridine)3 +2.
10. A compound as claimed in claim 1. further comprising:
(a) a substance B which is attached to at least one of the chelating bypyridine ligands: said substance B being capable of binding to an analyte of interest:
(b) said analyte of interest being a whole cell, subcellular particle, virus, prion. viroid, lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein, lipopolysaccharide, glycoprotein, peptide, cellular metabolite, hormone, pharmocoligal agent, tranquilizer, barbituate, alkaloid, steroid, vitamin, amino acid, sugar, non-biological polymer, synmetic organic molecule, organometallic molecule, inorganic molecule, serum-derived antibody, monoclonal antibody, DNA fragment, or RNA fragment.
1 1. The compound of any one of claims 1 through 8. further comprising: (a) a substance B which is attached to at least one of the chelating bypyridine ligands: said substance B being capable of binding to an analyte of interest:
(b) said analyte of interest being a whole cell, subcellular particle, virus, prion. viroid. lipid, fatty acid, nucleic acid, polysaccharide, protein, lipoprotein. lipopolysaccharide, glycoprotein, peptide. cellular metabolite, hormone, pharmocoligal agent, tranquilizer. barbituate, alkaloid, steroid, vitamin, amino acid, sugar, non-biological polymer, synmetic organic molecule, organometallic molecule, inorganic molecule, serum-derived antibody, monoclonal antibody, DNA fragment, or RNA fragment.
12. A method for detecting a compound of claim 1, comprising:
(a) inducing the compound to electrochemiluminescence by exposing a
reagent mixture containing the compound to electrochemical energy; and
(b) detecting the emitted electrochemiluminescence and diereby determining the presence of the compound.
13. A memod for detecting a compound of claim 9, comprising:
(a) inducing the compound to electrochemiluminescence by exposing a
reagent mixture containing the compound to electrochemical energy; and
(b) detecting the emitted electrochemiluminescence and thereby determining die presence of the compound.
14. A mediod for detecting a compound of claim 10, comprising:
(a) inducing the compound to electrochemiluminescence by exposing a reagent mixture containing the compound to electrochemical energy; and
(b) detecting the emitted electrochemiluminescence and thereby determining the presence of the compound.
15. A memod for detecting an analyte of interest using the compound of claim 10. comprising: (a) contacting the compound with the analyte under suitable conditions so as to form a reagent mixture such that the substance B of the compound and the analyte are capable of binding with one another;
(b) inducing the compound to electrochemiluminesce by exposing the reagent mixture to electrochemical energy; and
(c) detecting the emitted electrochemiluminescence and diereby determining the presence of the analyte of interest.
16. A memod for detecting an analyte of interest using the compound of claim 1 1, comprising:
(a) contacting the compound with the analyte under suitable conditions so as to form a reagent mixture such that the substance B of the compound and the analyte are capable of binding with one another;
(b) inducing the compound to electrochemiluminesce by exposing the reagent mixture to electrochemical energy; and
(c) detecting the emitted electrochemiluminescence and thereby determining the presence of the analyte of interest.
17. The method of claim 16. wherein:
(a) said inducing comprises exposing the reagent mixture to electrochemical energy the potential of which oscillates between a potential sufficiently positive to oxidize the compound and a potential sufficiently negative to reduce the compound, or to electrochemical energy such that the compound is oxidized and a precursor forms a reductant, or to
electrochemical energy such that the compound is reduced and a precursor forms an oxidant: wherein
(b) the reagent mixture contains a precursor which upon exposure ofthe
reagent mixture to electrochemical energy forms either a reductant or an oxidant.
18. The method of claim 17. wherein:
(a) said inducing comprises exposing the reagent mixture to electrochemical energy the potential of which oscillates between a potential sufficiently positive to oxidize the compound and a potential sufficiently negative to reduce the compound, or to electrochemical energy such tiiat the compound is oxidized and a precursor forms a reductant, or to electrochemical energy such that the compound is reduced and a precursor forms an oxidant: wherein
(b) the reagent mixture contains a precursor which upon exposure of the reagent mixture to electrochemical energy forms either a reductant or an oxidant.
19. A method for detecting an analyte of interest using the compound of claim 10, comprising:
(a) contacting the compound with the analyte under suitable conditions so as to form a reagent mixture such that the substance B of the compound and the analyte are capable of binding with one anomer:
(b) inducing the compound to electrochemiluminescence by exposing the reagent mixture to electrochemical energy;
(c) detecting the emitted electrochemiluminescence and thereby determining the presence of the analyte of interest.
(d) during steps (a), (b), and (c), preventing the compound from participating in nonspecific binding interactions;
20. An improved ECL luminophore. acting as a label in a binding assay,
which prohibits undesirable binding in the binding reaction (ofthe
binding partners).
21. A method of detecting an analyte of interest in a liquid sample which comprises:
(a) contacting a sample with a reagent (i) capable of being induced to repeatedly emit electromagnetic radiation, and (ii) capable of combing with the analyte of interest;
(b) exposing the resulting sample to an amount of electrochemical energy from a suitable source effective to induce the reagent to repeatedly emit electromagnetic radiation; and
(c) detecting electromagnetic radiation so emitted and thereby
detecting the presence of the analyte of interest in the liquid sample.
PCT/US1997/004150 1996-03-06 1997-03-06 Ecl labels having improved nsb properties WO1997032886A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU25309/97A AU2530997A (en) 1996-03-06 1997-03-06 Ecl labels having improved nsb properties

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US58662796A 1996-03-06 1996-03-06
US08/586,627 1996-03-06

Publications (1)

Publication Number Publication Date
WO1997032886A1 true WO1997032886A1 (en) 1997-09-12

Family

ID=24346511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/004150 WO1997032886A1 (en) 1996-03-06 1997-03-06 Ecl labels having improved nsb properties

Country Status (2)

Country Link
AU (1) AU2530997A (en)
WO (1) WO1997032886A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999062919A1 (en) * 1998-06-01 1999-12-09 Roche Diagnostics Corporation Redox reversible bipyridyl osmium complex conjugates
WO2003003008A1 (en) * 2001-06-29 2003-01-09 7Tm Pharma A/S Chemical libraries useful for drug discovery processes
EP1404655A1 (en) * 2001-05-16 2004-04-07 Dyesol Pty Ltd Method for large-scale manufacture of dye for dye-sensitised solar cells
US6808939B2 (en) 2001-06-29 2004-10-26 Igen International, Inc. ECL labels having improved non-specific binding properties, methods of using and kits containing the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5310687A (en) * 1984-10-31 1994-05-10 Igen, Inc. Luminescent metal chelate labels and means for detection

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5310687A (en) * 1984-10-31 1994-05-10 Igen, Inc. Luminescent metal chelate labels and means for detection

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999062919A1 (en) * 1998-06-01 1999-12-09 Roche Diagnostics Corporation Redox reversible bipyridyl osmium complex conjugates
EP1404655A1 (en) * 2001-05-16 2004-04-07 Dyesol Pty Ltd Method for large-scale manufacture of dye for dye-sensitised solar cells
EP1404655A4 (en) * 2001-05-16 2009-04-22 Dyesol Pty Ltd Method for large-scale manufacture of dye for dye-sensitised solar cells
WO2003003008A1 (en) * 2001-06-29 2003-01-09 7Tm Pharma A/S Chemical libraries useful for drug discovery processes
US6808939B2 (en) 2001-06-29 2004-10-26 Igen International, Inc. ECL labels having improved non-specific binding properties, methods of using and kits containing the same

Also Published As

Publication number Publication date
AU2530997A (en) 1997-09-22

Similar Documents

Publication Publication Date Title
EP0265519B1 (en) Electrochemiluminescent assays
US5716781A (en) Method of calibration of an electrochemiluminescent assay system
US6316607B1 (en) Electrochemiluminescent assays
US5310687A (en) Luminescent metal chelate labels and means for detection
EP0580979B1 (en) Method of detection by inducing electrochemiluminescence
EP0674176B1 (en) Luminescent rhenium complexes and methods of production
US6916606B2 (en) Electrochemiluminescent assays
WO1997032886A1 (en) Ecl labels having improved nsb properties
AU605158C (en) Electrochemiluminescent assays
IL101990A (en) Conjugate of ruthenium- or osmium- containing electrochemiluminescent chemical moieties

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97532052

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase