WO1995004824A1

WO1995004824A1 - Generation of dna libraries and retroviral vectors for same

Info

Publication number: WO1995004824A1
Application number: PCT/AU1994/000443
Authority: WO
Inventors: Mathew Alexander Vadas; Thomas John Gonda; John Robert Rayner
Original assignee: Medvet Science Pty. Ltd.
Priority date: 1993-08-05
Filing date: 1994-08-04
Publication date: 1995-02-16

Abstract

The present invention relates generally to a method for preparing libraries of DNA clones, to DNA libraries so produced and to vectors useful for same. More particularly, the present invention provides a retroviral expression vector and its use in a novel and efficient cloning strategy for generating DNA expression libraries. The method involves cloning DNA downstream of a promoter in a retroviral vector and generating a population of stable retrovirus-producing cells.

Description

GENERATION OF DNA LIBRARIES AND RETROVIRAL VECTORS FOR SAME

The present invention relates generally to a method for preparing libraries of DNA clones, to DNA libraries so produced and to vectors useful for same. More particularly, the present invention provides a retroviral expression vector and its use in a novel and efficient cloning strategy for generating DNA expression libraries.

Bibliographic details of the publications referred to in this specification are collected at the end of the description. SEQ ID NOs. for the nucleotide sequences referred to in the specification are defined following the bibliography.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

DNA expression cloning, and in particular cDNA expression cloning, is a particularly convenient method for the rescue and identification of genes that are able to confer a readily identifiable phenotype on specific cells. Although expression cloning techniques, notably those developed by Seed and his collaborators (1,2), have been successful in isolating genes encoding certain molecules, the techniques cannot be universally applied.

One major limitation is the generally low rate of transfection of indicator cell lines making adequate representation of genes in a complex cDNA library difficult. In the normal mammalian cell, for example, from approximately 30,000 to 120,000 different mRNA species may be present in the cytoplasm (3,4,5). Adequate representation in a cDNA expression library is likely to require at least one order of magnitude more clones than the estimated number of mRNA species since synthesis of large full length cDNAs is relatively inefficient. Although in some cases it is routine to generate libraries of this complexity in plasmids or phage in Escherichia coli, the generation of similarly complex libraries in eukaryotic cells is generally more difficult. As a result, isolation of many mammalian genes by current expression cloning strategies may be difficult because of the low abundance of the corresponding rnRNAs; this problem is compounded if a rare cell type is being targeted for selection. Another disadvantage of conventional cDNA cloning techniques is that the use of transient gene expression for phenotypic selection of target cells limits the assay/selection period to 2-3 days so that assays requiring longer periods are not practical.

In work leading up to the present invention, the inventors sought an expression cloning system which addressed many of the shortcomings of conventional cloning systems. The expression cloning system of the present invention is based on a retrovirus expression vector. In contrast to transfection, retroviruses can efficiently infect and transfer genes to a wide range of cell types including primary haemopoietic cells (6,7). Moreover, the viral DNA is stably integrated in a predictable configuration in the infected cells at one or a few copies per cell allowing for expansion of individual infected cells displaying a particular phenotype and facilitating recovery of sequences inserted into a provirus.

Accordingly, the present invention contemplates a method for generating a DNA expression library, said method comprising cloning DNA downstream of a promoter in a retroviral vector and generating a population of stable retrovirus-producing cells.

The virus-producing cells may be ecotropic retroviral packaging cells or amphotropic retroviral packaging cells.

More particularly, the present invention provides a method for generating a DNA expression library, said method comprising ligating DNA into a retroviral expression vector such that said DNA is operably linked to a promoter; transfecting the DNA- inserted vector into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting the other of said amphotropic retroviral packaging cells or ecotropic retroviral packaging cells with the recombinant virus and selecting infected cells by a suitable selectable marker. The retrovirus-producing cells constitute the library and the recombinant virus particles produced therefrom are used to infect appropriate target cells for subsequent functional screening. Generally, the DNA is cDNA produced from a pool of mRNA isolated from a particular cell type. In a further embodiment, the DNA is a pool of cDNA mutants randomly or specificly generated by, for example, high error rate PCT. The latter method is described by Caldwell and Joyce (34). The mutated pool of cDNA may contain from 1% to 100% randomly or specifically mutated cDNA molecules. Preferably, the pool will comprise from 30 to 100% or more preferably 70-100% mutated cDNA molecules. For convenience and by way of shorthand notation only, reference hereinafter to "DNA" includes reference to all types of DNA such as cDNA, genomic DNA and mutated DNA. Furthermore, reference herein to DNA ligated "downstream" of a promoter or "operably linked" to a promoter is the placement of a DNA molecule adjacent a promoter such that the DNA molecule is transcribed into mRNA.

Accordingly, another aspect of the present invention provides a method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the cDNA- inserted vector molecules into one of amphotropic packaging cells or ecotropic packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting the other of said amphotropic packaging cells or ecotropic packaging cells with the produced recombinant virus and selecting infected cells by a suitable selection marker; infecting appropriate target cells and selecting for target cells by expression of a particular trait.

A "DNA pool" as contemplated herein includes a population of cDNA molecules from mRNA, genomic DNA fragments and mutated cDNA molecules.

Ecotropic viruses are retroviruses capable of infecting cells of the same species from which they are produced. Amphotropic viruses, on the other hand, are retroviruses capable of infecting cells of the same species from which they are produced as well as other species. For example, and for the purposes of illustration only, murine ecotropic retroviruses are capable of infecting only murine cells. Amphotropic retroviruses, on the other hand, are capable of infecting murine cells as well as cells from other species. It is generally considered that such a difference in host cell infection range is due to the use of different cellular receptors by the individual retroviruses. The cloning strategy may involve transfection of amphotropic packaging cells and the retroviruses obtained therefrom being used to infect ecotropic packaging cells. Alternatively, ecotropic packaging cells may be transfected followed by infection of amphotropic packaging cells.

Accordingly, in one embodiment, the present invention contemplates a method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the DNA- inserted vector molecules into amphotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting ecotropic retroviral packaging cells with recombinant virus and selecting infected cells by a suitable selection marker; infecting appropriate target cells and selecting for target cells by expression of a particular trait.

In an alternative embodiment, the present invention related to a method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the DNA- inserted vector molecules into ecotropic retrovirus packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting amphotropic retrovirus packaging cells with recombinant virus and selecting infected cells by a suitable selection marker; infecting appropriate target cells and selecting for target cells by expression of a particular trait.

The cloning procedure of the present invention is particularly applicable to the cloning of a vast range of mammalian genes. By way of example only, such genes include structural and regulatory genetic sequences from cells of the haemopoietic system including haemopoietic growth factors, haemopoietic differentiation factors and oncogenes from haemopoietic malignancies. Other mammalian genes include genes encoding surface antigens and genes encoding cellular adhesion molecules. Mammals contemplated by this aspect of the present invention include humans, livestock animals (e.g. sheep, cattle, goats, pigs and horses), laboratory test animals (e.g. mice, rats, rabbits and guinea pigs), companion animals (e.g. dogs and cats) and captive or free wild animals. However, the present invention also extends to the cloning of genetic sequences (such as those referred to above) from non-mammalian animals such as avian species (including poultry, caged birds and game birds), reptilian species (including lizards and snakes) and various insect species and non-insect species including spiders.

The cloning of genetic sequences from mammalian and non-mammalian species will be limited by the availability of suitable indicator cell lines and the requirement for the selected genetic sequence being capable of expression into a functional protein in the indicator cell line. For example, the cloning strategy of the present invention is particularly useful for cloning haemopoietic growth factors using, as a functional assay, a factor-dependent cell line. Other types of suitable indicator cell lines include cell lines lacking particular cell adhesion molecules and thus incapable of adhesion under certin conditions (for cloning adhesion genes) and cells incapable of synthesizing particular surface antigens (for cloning surface antigen genes).

The use of amphotropic retroviral packaging cells provides the advantage of being able to generate recombinant viral particles capable of infecting ecotropic retroviral packaging cells. Furthermore, in this step of the protocol, transiently generated retrovirus (48hr post transfection and before integration of the retroviral DNA) is used to infect the ecotropic packaging cells to be used for the library in order to maintain the representivity of the original cDNA library. Integration itself can modify the expression of retroviral genetic sequences and lead to over- or under- representation of specific sequences, potentially reducing the chances of finding rare or low abundance genes. The inherent efficiency of retroviral infection provides a significant advantage over transfection as the method to be employed for the generation of large expression libraries and it has further been shown that there is a higher titre of virus production by infected cells when compared with transfected cells (26). Additionally, infection of the virus producing cell line is the method preferred since each infected cell will generally carry only a few copies (e.g. 1-3 copies) of the retroviral DNA. In contrast, transfection can lead to cells with an unpredictable number of copies of the DNA. Thus, the clonal nature of the individual cells comprising the libraries produced by infection allows for accurate assessment of the complexity of such libraries, a step which is vital for ensuring the production of truly representative libraries.

However, notwithstanding the advantages of using amphotropic retroviral packaging cells, the present invention extends to transfecting ecotropic retroviral packaging cells directly to generate ecotropic virus-producing cells. This embodiment is particularly useful where the recipient cells can be transfected at high efficiency.

Preferred amphotropic retroviral packaging cells include PA317(8) and Ψ_crip (9) cells. Preferred ecotropic retroviral packaging cells are murine cells such as Ψ2(10) cells.

The retroviral vector of the present invention is capable of receiving a DNA molecule such that it is operably linked to a promoter. Generally, the DNA molecule is inserted into a multi-cloning site (MCS). The vector also contains long terminal repeats (LTRs) to facilitate integration and expression of inserted DNA into a genome together with suitable proviral DNA including, for example, a gag gene or part thereof to increase titre of virus by enhancing packaging.

According to this aspect of the present invention there is provided a retroviral expression vector comprising a multi-cloning site adjacent a promoter such that ligation of a DNA sequence into said multi-cloning site permits expression of said DNA sequence, said vector capable of transfection into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells to enable generation of recombinant viral particles carrying DNA, said recombinant viral particles capable of infection of the other of amphotropic packaging or ecotropic packaging cells and stable integration into the genome of said cells. Such cells are then used to infect suitable indicator cell lines. Preferably, the retroviral vector in plasmid form is also capable of replication in prokaryotic cells such as E. coli. This latter feature is particularly useful as a means for amplifying the clones prior to transfection into the amphotropic cells.

In a particularly preferred embodiment, the retroviral expression vector is designated "pRUFweo" and is derivable from the MPZen vector of Johnson et al. (11). Modifications of this vector may be made without departing from the scope of the present invention. Two examples of modified vectors are designated herein "pRUFweoΔNcoI" and "pRUFpwrø". The present invention extends to all such vectors which are functionally related to pRUFweo.

Accordingly, another aspect of the present invention provides a method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector and in particular pRUFweo or similar vector such that said DNA molecules are operably linked to a promoter; transferring ligated molecules into prokaryotic cells such as E. coli by transformation or electroporation and growing said cells for a time and under suitable conditions prior to isolation of recombinant DNA therefrom (e.g. by alkaline lysis followed by purification on a CsCl gradient); transfecting the isolated cDNA-inserted vector molecules into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting the other of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells with the recombinant virus and selecting infected cells by a suitable selection marker; infecting appropriate target cells and selecting for target cells by expression of a particular trait; cloning of the selected genetic sequences from the genome of the target cell line. This latter feature is conveniently accomplished using PCR with primers which correspond to elements of the pro- viral DNA (e.g. gag sequence, neo gene and/or multi-cloning site of retroviral vector).

Yet another aspect of the present invention provides a DNA (e.g. cDNA) expression library as hereinbefore described packaged for sale in kit form. The library may be a composition of recombinant viral particles, an ecotropic retrovirus packaging cell line carrying recombinant provirus or a prokaryotic host (e.g. E. coli) carrying the recombinant vector molecule. Alternatively, the kit may comprise only the retrovirus vector alone or in a particular cell (such as E. coli). Where the library is included in the kit, it may be from any of a range of mammalian or non-mammalian cell types as hereinbefore described.

A further embodiment of the present invention is directed to a gene, preferably a mammalian gene and even more preferably a haemopoietic gene, adhesion gene, surface antigen gene or oncogene when cloned in accordance with the cloning strategy and/or retroviral vector herein described.

The invention is further described by reference to the following non limiting figures and exaπ es.

In the figures:

Figure 1 is a schematic representation of one embodiment of the cloning strategy of the present invention.

Figure 2 is a schematic representation showing the structure of the RUFweσ retroviral plasmid (pRUFneø) showing 'landmark' restriction endonuclease cleavage sites, the cloning sites in the polylinker (multi-cloning site [MCS]) and other major features including the splice donor (SD) and splice acceptor (SA) sites used to generate the subgenomic mRNA. The nucleotide sequence numbers of the retroviral portions of the plasmid are derived from the sequence of the Moloney murine leukaemia virus (31).

Figure 3(A) is a schematic representation of pRUFweo showing the position of the cleavage sites for BamHI and Sad and the distance (3.2kb) between the unique Sad sites in the viral LTRs (derived from Myeloproliferative Sarcoma Virus [MPSV]). Figure 3(B) is a photographic representation showing Southern blot analysis using a neo^R probes of genomic DNA of a number of factor-independent FDC-Pl clones (as indicated at the top of each photograph) after digestion with BamHI or SacL The positions of the molecular weight markers (λ DNA digested with Hindlll) are shown on the right. Figure 4(A) is a schematic representation of pRXJFneo showing the splice donor (SD) and splice acceptor (SA) sites. Figure 4(B) is a schematic representation of the messages arising from transcription of the retroviral genome (see also ref. 12). Figure 4(C) is a photographic representation of Northern blot analysis using a neo^R probe of poly A+ RNA from FDC-Pl cells infected with either the parental vector (pRUFneo) or with retroviruses carrying either GM-CSF cDNA (Cl) or IL-3 cDNA (B4). The bands, from top to bottom, represent the unspliced, spliced and neo transcripts, respectively. The neo transcript is generated from its own promoter in the MClweo cassette (see Figure 2).

Figure 5 is a photographic representation of a PCR analysis of factor-independent FDC- Pl clones. (A) PCR fragments from a number of factor-independent clones, as identified at the top of the figure, were separated on a 1.2% w/v agarose gel. Amplification was performed on genomic DNA using primers complementary to retroviral sequences flanking the MCS; the position of a DNA marker corresponding to a MW of 1070 bp is shown on the right. (B)and (C) Southern blots of the gel shown in (A) probed with ³²P- end labelled oligonucleotides specific for either GMCSF (B) or IL-3 (C).

Figure 6 is a schematic representation of pRUFneoΔNcoI. Notes: (i) Unique sites in polylinker: BamH I, Xho I, Hpa I, Hind III, Bgl II; (ii) Kpn I and Sma I sites in LTRs not shown; (iii) 'SD' and 'SA' are splice donor and acceptor sites, respectively; (iv) Unit proviral length (one LTR) = 3248 bp.; (v) Derivation: MClNeo cassette inserted between Bgl II and Cla I sites of pRUF. A map of the pRUF plasmid is shown in Figure 8.

Figure 7 is a schematic representation of pRUFPuro. Notes: (i) Unique sites in polylinker: BamH I, Xho I, Hpa I, EcoR I, SnaB I, Bst I, Sal I; (ii) Kpn I and Sma I sites in LTRs not shown; (iii) 'SD' and 'SA' are splice donor and acceptor sites, respectively; (iv) Unit proviral length (one LTR) = 3224 bp.; (v) Derivation: SN40/Puromycin cassette inserted between Bgl II and Cla I sites of pRUFneo (Bgl II site destroyed). Figure 8 is a schematic representation of pRUF. Notes: (i) All sites in p;olylinker unique; (ii) Kpn I and Sma I sites in LTRs not shown; (iii) 'SD' and 'SA' are splice donor and acceptor sites, respectively; (iv) Unit proviral length (one LTR) = 2648 bp; (v) Derivation: nucleotides 5015 to 1535 and 2059 - 2614 from MPSN; other viral sequences from MoMLN.

EXAMPLE 1 VECTOR CONSTRUCTION

pRUFneo (see Figure 2) was derived in part from the MPZen vector described by Johnson et al. (11) and a rearranged M3Neo(myb) provirus present in the U22.4 cell line (12). Briefly, the multi-cloning site shown in Figure 2 was inserted into the unique Xhol sits of MPZen, and the sequence from the Sad site in the 5' LTR to the BamHI site in the MCS was replaced by a 1570bp fragment that encompasses a portion of the LTR (5' of the Sad site), 5 '-untranslated sequences, and the indicated (Figure 2) gag sequences all derived originally from the myeloproliferative sarcoma virus (MPSN)-based M3Νeo retroviral vector (32). The rearrangement resulted in a partial deletion of sequences from the proviral gag and pol genes and a complete loss of the neo gene (12). The sequence between the Bglll site in the MCS and the Clal site in MPZen was replaced by the 1090bp Xhol-Ddel neo fragment of pMClweo (14).

EXAMPLE 2 cDNA SYNTHESIS AND CLONING

cDNA was synthesised essentially as described by Huse and Hansen (15) with the following modifications. First strand synthesis. Two micrograms of poly A+ mRNA (isolated as described by Gonda et al. (13)) from lectin stimulated cells of the murine T- cell line LB3 was incubated for lhr at 37°C in a 25μl reaction mixture containing 50mM Tris-HCl (pH8.3), 75mM KCl, 3mM MgCl₂, 8mM DTT, 4mM Na pyrophosphate, 36U RNA Guard (Pharmacia), 400μM each dATP, dTTP, dGTP, 200μM 5-methyl-2-deoxy- cytidine-5 triphosphate (5-methyl-dCTP; Boehringer) and 200U Superscript Reverse Transcriptase (Gibco). The reaction was primed with a synthetic oligonucleotide of the following sequence: (GA)₁₀ CTC GAG CGG CCG CTT (T)₁₆ (SEQ ID NO.l). Second strand synthesis. The reaction from the first strand synthesis was made up to a final volume of 160μl by the addition of 32μl of 5x reaction buffer (94mM Tris-HCl, 453mM KCl, 23 inM MgCl₂ and 50mM (NH₄)₂SO₄), 4μl second strand dNTP (lOmM each dATP, dTTP, dGTP and 26mM dCTP), 6μl lOOmM DTT and water to 160μl. The reaction was started by adding 32U of E. coli DNA Polymerase I (Pharmacia) and 0.8U E.coli RNase H (Pharmacia) and incubation was carried out at 16°C for 2hr at which time the double stranded cDNA was ethanol precipitated. To blunt the ends of the cDNA, the pellet was resuspended in 50μl T4 Polymerase buffer (33mM Tris- Acetate (pH 8.5), 66mM K Acetate, lOmM Mg Acetate, 0.5mM DTT and lOOμg/ml BSA) and the mixture was made up to 0.2mM with respect to dNTP; the reaction was initiated by the addition of 8U T4 DNA Polymerase I (Promega). Incubation was for lOmin at 37°C, following which the enzyme was heat-inactivated at 75°C for 30 min. After cooling on ice, the reaction was supplemented with ATP to a final concentration of ImM; 0.1 OD₂₆₀U of a BamHI-Notl adaptor (Pharmacia) and 8U of T4 DNA ligase were added and the mixture incubated overnight at 16°C. The ligase was heat inactivated at 65°C for 30min and the adaptored cDNA phosphorylated with 15-20U of T4 Polynucleotide Kinase at 37°C for 30 min. The cDNA was then digested for 2hr with Xhol after adjusting the total salt concentration to 150mM. The digest was phenol extracted and the cDNA passed through a Sephacryl S-400 spin column (Pharmacia) to select for cDNA fragments > 500 bp.

EXAMPLE 3 CLONING INTO pRUFneo

pRUFneo containing a lkb "stuffer" sequence cloned into the unique BamHI and Xhol sites (Figure 2) was cut with these two enzymes. In the present case, the stuffer fragment may be any fragment of DNA that has unique BamHI and Xhol sites at either terminus and which is of a size such that it can be clearly resolvable from the vector on an agarose gel. This fragment is cloned into a vector so as to be able to recover same which has been cleaved at both the BamHI and Xhol sites in the polylinker. The vector was separated from the stuffer fragment on a 0.8% w/v low melting point agarose gel (FMC) and recovered from the agarose by digestion of the melted gel with Agarase (New England Biolabs). An aliquot of 40ng of the size selected cDNA (average size approximately 1500bp) was ligated into 30ng of the gel purified vector in a 20μl reaction mixture consisting of ImM ATP, lxOne-Phor-All Plus buffer (Pharmacia) and 0.8U of T4 DNA ligase (Pharmacia). After ligation, the reaction was made up to 100 μl with TE, phenol extracted and ethanol precipitated in the presence of 20 μg of glycogen (Boehringer). The pellet was washed in 70% v/v ethanol and resuspended in lOμl deionized water in preparation for electroporation.

EXAMPLE 4

AMPLIFICATION OF THE LIBRARY

Aliquots of lμl (approx 5ng) of the resuspended ligation mix (Example 3) were electroporated into E.coli DH10B (Gibco) using a Gene Pulser apparatus (BioRad). The electroporated cells were grown for lhr at 37°C in 1ml SOC medium, plated out on 150mm LB/Ampicillin plates (100 mg/ml) and grown overnight at 37°C. The resulting colonies were scraped from the plates into LB medium and the total cells from all the plates for a particular experiment were pooled. The cells were pelleted and supercoiled plasmid DNA was prepared from the pellet by alkaline lysis followed by purification on a CsCl gradient. When necessary, more DNA was generated by re-electroporation of E.coli DH10B with aliquots of this DNA.

EXAMPLE 5 CELL LINES AND TRANSFECTION INFECTION PROCEDURES

PA317 (8), Ψ2 (10) and Ψ_crip cells (9) were maintained in Dulbecco's Modified Eagles Medium (DMEM) supplemented with 10% v/v heat inactivated fetal calf serum (FCS), 2mM L-Glutamine and antibiotics. Infected cells were selected in DMEM/FCS containing G418 at 400μg/ml and thereafter were maintained in DMEM/FCS containing G418 at 200μg/ml. FDC-P 1 cells ( 16) were maintained in DMEM/FCS supplemented with 80U/ml of murine GM-CSF (FD medium). The Lectin stimulated T-cells where as previously described (LB3; 17, 18). Amphotropic retrovirus packaging cell lines (PA317, Ψ_crip) were transfected by a standard calcium phosphate transfection procedure essentially as described by Miller et al. (19) using 40μg retroviral plasmid per 10cm dish (seeded with 10⁶ cells the previous day). After overnight incubation, the medium containing the calcium phosphate-DNA co-precipitate was removed and the cells "shocked" with 2.5ml 15% v/v glycerol in DME for 4 min. The glycerol was removed by aspiration and gentle rinsing with DMEM and replaced with 10ml DMEM/10% v/v FCS. Following a further 24 hr incubation, the virus-containing supernatant was harvested from the culture dishes, filtered through a 0.45μm NML filter (Sartorius) and stored at -70°C. Aliquots of these supernatants, supplemented with 5μg/ml polybrene, were used to infect Ψ2 cells plated the previous day at 10⁶/10cm dish. After 24 hours, infected cells were transferred to 225cm² tissue culture flasks and selected in G418 at 400μg/ml, and used to infect FDC- Pl cells by co-cultivation. Briefly, pools of 10⁶ infected Ψ2 cells were irradiated (25Gy) and co-cultivated with 5x10⁵ FDCP-1 cells in FD medium (see above) for 2 days in 25cm² flasks. The FDCP-1 cells were then separated from the adherent Ψ2 cells and selected for factor-independence either as pools in liquid culture (by growth in factor-free DMEM/10% v/v FCS) or as clones by plating in soft agar as described by Johnson (11) in the absence of GM-CSF. Additionally, infected cells were selected in FD medium containing lmg/ml G418 and maintained in this medium at a reduced G418 concentration (200ug/ml).

EXAMPLE6 GENOMICDNAISOLATIONANDPCROF GENOMICDNA

Genomic DNA was isolated from cells using a proteinase K/SDS procedure essentially as described by Hughes et al. (21). PCR reactions containing lμg of genomic DNA were performed essentially as described by Saiki (22). The primers used for amplification were: RCFl (TTGGGGACTCTGCTGACCAC) [SEQ ID NO. 2] which corresponds to the vector gag sequence approximately 80 bp 5' of the MCS and primer RCRl (CTTGCAAAACCACACTGCTCG) [SEQ ID NO. 3] which corresponds to the MClneo sequence immediately adjacent to the 3' end of the MCS. The reactions were performed in a Perkin Elmer Thermocycler and the cycling parameters were: 35 cycles - denaturation at 94°C for 1 minute, annealing at 60°C for 2 minutes, extension at 72°C for 2.5 minutes with a final 7 minute extension at 72°C in cycle 35. Reactions were denatured at 94°C for 4 minutes before cycling commenced and the 72°C extension cycle was increased by 5 seconds per cycle.

EXAMPLE 7

SOUTHERNANDNORTHERNBLOTS

Genomic DNA digested with either BamHI or Sad was fractionated on a 0.7% w/v agarose gel, transferred to Hybond N+, UN crosslinked at 0.75 J/cm² and probed with a [³²P] labelled 1090 bp Xhol-Ddel neo fragment from pMClneo according to the manufacturer's recommended protocol. DΝA from PCR of genomic DΝA (see above) was fractionated on a 1.2% w/v agarose gel and prepared for probing as described above.

Blots were probed as described by Mason and Williams (23) with [³²P] labelled oligonucleotides specific for either:

IL-3 (GATAACGTATCTGTCCTCAGGATC) [SEQ ID NO. 4] or

GM-CSF (ATCTTCAGGCGGGTCTGCACACATG) [SEQ ID NO. 5].

For Northern blots, poly A+ RNA was isolated from factor-independent clones as described by Gonda et al. (13). An aliquot of lμg of this RNA was fractionated on a formaldehyde-agarose gel and blotted to a Hybond N membrane (Amersham) as per manufacturer's instructions. The blot was dried UN crosslinked in at 0.4 J/cm² and probed with the neo probe described above for genomic DΝA.

EXAMPLE 8 CLONING PROTOCOL

An outline of the cloning protocol of the present invention is presented in Figure 1. The cloning strategy begins with the generation of cDNA from a source that is appropriate for the isolation of the gene(s) in question. The cDNA is directionally cloned into the retroviral vector (see below) and amplified in E.coli. The vector DNA thus obtained is used to generate a representative pool of virus-producing cells. This is done by first transfecting the library into an amphotropic packaging cell line (e.g. Ψ_cri or PA317) and then using the transiently generated virus (48 hr post transfection) to infect an ecotropic packaging cell line (e.g. Ψ2). The infected ecotropic packaging cells are selected for the expression of a drug resistance gene («eo^R), carried by the retroviral vector, and are then used to infect a suitable target cell population. Target cells displaying the desired phenotype are isolated and the gene is subsequently recovered, for example, by using the polymerase chain reaction (PCR), from the retroviral DNA integrated in those cells. The retroviral vector constructed in accordance with the present invention is pRUFneo and is shown in Figure 2. The salient features of the vector are: (i) a multiple cloning site (MCS) to allow directional cloning; (ii) the Myeloproliferative Sarcoma Virus (MPSV) LTR which is known to function well in haemopoietic cells (24, 25); (iii) the MClneo cassette containing the neo^R gene driven by the f9 polyoma enhancer (14). MClneo was chosen in preference to tkneo because preliminary experiments showed that it was efficiently expressed in a variety of cell types, including fibroblasts, primary haemopoietic cells (from foetal liver) and in haemopoietic cell lines; and (iv) sequences from the rearranged gag/pol genes of the M3neo(myb) provirus integrated in the U22.4 cell line described by Gonda et al. (12). This rearrangement resulted in increased expression of the myb gene carried by the provirus, and experiments indicated that it functions similarly in the pRUFneo vector. Expression of myb from the U22.4 provirus, and of cDNAs inserted into the multiple cloning site of pRUFneo, occurs via a subgenomic mRNA generated by splicing between the normal retroviral splice donor (at nucleotide 206) and a 'cryptic' splice acceptor (at nucleotide 1353) described in refs. 12 and 33 (see Figures 2 and 4B). EXAMPLE 9 GENERATION OF THE LIBRARY

Retroviral vector containing the cDNA was electroporated into E.coli and cells grown overnight on Ampicillin plates in order to amplify the library. By this method, it was possible to obtain 1.5x10⁶ colonies from approximately 40ng of cDNA, an efficiency of about 3.75x10⁷/μg of cDNA. Libraries contained cDNAs ranging in size from about 0.4 to 6kb although sizes beyond this range may be possible with further minor experimental manipulation. A major concern for the generation of cDNA libraries is the need for adequate representation, in the final library, of all the genes expressed in the source. The protocol of the present invention is designed to provide adequate representation of genetic sequences. The initial steps in this protocol involve (i) transfection of the DNA obtained from the amplification of the library into an amphotropic packaging cell line (e.g. PA317) and (ii) using the transiently generated retrovirus (48 hours post transfection) to infect an ecotropic packaging cell line. Infection is a more desirable way to transfer genes into the cells that will constitute the final library of (ecotropic) virus-producing cells, since it has been shown to yield substantially higher viral titres from these cells (19,26). Moreover, infection generally results in a smaller number of proviral integrations per cell (ie. low copy number), which means that each infected cell in the total pool represents a single (or at most a only a few) cDNA species in the library. In this manner, several populations - ie libraries - of virus-producing cells were derived expressing a complement of retroviruses that should represent all the mRNA species present in the original cells from which the cDNA was derived. The results from several experiments indicate that the generation of sufficient numbers of virus-producing cells is dependent on at least two factors: the particular amphotropic cell line used to produce the transient retrovirus as well as the volume of virus-containing supernatant used to infect the ecotropic packaging cells (Table 1). In pilot experiments, it was found that the Ψ_cri cell line generated approximately a quarter of the number of infectious units as did PA317 in the same experiment. Furthermore, determining the titre of the transient supernatants obtained from the PA317 cells and establishing that under limiting dilution assay conditions titres in the vicinity of l-3xl0⁴/ml could be obtained, showed that a Ψ2 library of a complexity of approximately 10⁶ could be generated from 100ml of viral supernatant. However, when larger scale experiments were performed, it appeared that the actual number of colonies obtained was strongly influenced by the volume of the supernatant used to carry out the infection. Table 1 (Experiment 3) shows that when 2ml of supernatant was used to infect one dish of Ψ2 cells, approximately 46,000 colonies were recovered whereas 8ml of the same supernatant yielded only 32,000 colonies. This indicates that the infection frequency under the conditions used here is more a function of virus concentration than of the absolute number of infectious units. Experiments 4 and 5 (Table 1) show the numbers of infected cells obtained during the generation of libraries from a different source, in this case a bone marrow stromal cell library. Experiment 4 clearly demonstrates the effect of volume described above, while at the same time showing that the method can be extremely efficient and is capable of generating libraries of substantial complexity. The results shown in Table 1 clearly demonstrate that, by infecting as few as 12 dishes of Ψ cells, the method of the present invention is capable of generating libraries of complexities that approximate those required to represent the entire mRNA complement of a mammalian cell.

EXAMPLE 10 ISOLATION OF FACTOR INDEPENDENT CLONES OF TARGET CELLS

In order to test the retroviral library constructed from LB-3 T-cells, virus-producing Ψ2 cells were co-cultivated with FDC-P 1 cells, which were then assayed for infection and CSF independence; introduction of retrovirally expressed GM-CSF and IL-3 genes into FDC-Pl cells has previously been shown to confer autonomous growth (27,28,29). The efficiency of infection of the FDC-Pl cells was 30%-50%, as estimated by agar plating of the infected cells in the presence of G418 (Table 2). Every pool (ie, the virus- producing cells derived from infecting 10 Ψ2 cells) in each experiment gave rise to factor-independent FDC-Pl cells, indicating that clones capable of conferring factor independence are present at a frequency of at least 1 in 3000 (Table 1, Experiment 1). However, estimates of the frequency of factor-independent clones obtained by plating the infected cells in agar (Table 2) suggest that it is in fact somewhat higher (1 in 200 to 1 in 400). A number of these factor-independent clones were isolated from agar plates and analyzed for the presence and expression of proviral DNA (Example 11); additionally, the sequence of the cDNA carried by each provirus was also determined (see Example 13).

EXAMPLE 11 ANALYSIS OF PROVIRAL INTEGRATION

Southern blot analysis, using a neo^R probe, of BamHI and Sad cut genomic DNA from several of the factor-independent clones (see Example 10) provided information about the structure of the retrovirus(es) carried by these clones. BamHI cuts at a unique site within the retrovirus (Figures 2 and 3(A)) and gives an estimate of the number of proviruses carried by each clone. This number varies between one and four (Figure 3(B)) co-nfirming the relatively low copy number of the virus in these cells. Sad cuts at unique sites within the retroviral LTRs (Figures 2 and 3(A)) and estimates the size of the retrovirus. The sizes observed are consistent with a retrovirus carrying an insert of about 950 +/- lOObp in each case except for clone 14, which in addition appears to carry a provirus with a smaller insert plus two proviruses lacking inserts.

EXAMPLE 12 ANALYSIS OF THE RETROVIRAL TRANSCRIPTS

Figure 4(C) shows the result of probing a Northern blot of polyA+ RNA from two of the factor-independent cell lines (Example 10) with a neo^R probe. One of these clones was subsequently shown to contain a proviral insert coding for IL-3 whilst the other codes for GM-CSF (see Example 13). This blot confirms the size estimates of the cDNA inserts as suggested by the Southern blots of the genomic DNA (ie. the transcripts arising from each of the clones are approximately lkb larger than those of the parental vector) and also demonstrates that the proviral sequences are expressed. EXAMPLE 13

POLYMERASE CHAIN REACTION (PCR) ANALYSIS OF

GENOMIC DNA FROM FACTOR-INDEPENDENT CLONES

The polymerase chain reaction was used to rescue the cDNA sequences from the genomic DNA of a number of factor independent FDC-Pl clones (Example 4). The primers used were complementary to sequences adjacent to the MCS in the retroviral vector. A fragment of between 800-1000 bp was amplified in almost every case (Figure 5(A)). Similarly, a Southern blot of the gel shown in Figure 5(A), probed with oligonucleotides specific for either IL-3 or GM-CSF, showed that in most instances one PCR product hybridized with one or the other of the probes (Figures 5(B) and (C)). The length of the processed messages for IL-3 and GM-CSF, which are the only T-cell growth factors that are known to stimulate and maintain FDC-Pl proliferation, are approximately 850 nucleotides (30) and 780 nucleotides (20), respectively (excluding the poly A+ tail). These observations indicate that, with the exception of clone 14, the retrovirally-mediated factor independence that was observed is the result of infection with a virus carrying the gene for one of these CSFs. Clone 11 hybridizes with both probes; while the reason is not entirely clear, the most likely explanation is that two adjacent clones were picked together from the agar plate in the initial isolation procedure. One component (IL-3) seems to be a minor one (compare the intensities in Figures 5(B) and (C)) and may be the result of slower growth of this clone in culture. The amplified fragment from clone 14 is much smaller than that of the other clones and it hybridized with neither the IL-3 nor GM-CSF probe. A possible reason for factor-independence in this case is that retroviral integration has activated the endogenous gene for one of these factors.

Functional expression of the CSFs was also demonstrated by experiments in which uninfected FDC-Pl cells were incubated for 3-4 days in conditioned medium obtained from individual factor independent clones. In every case, the medium supported growth of the FDC-Pl cells. EXAMPLE 14 SEQUENCE ANALYSIS OF THE cDNA INSERT CARRIED BY PROVIRUSES IN FACTOR-INDEPENDENT FDC-Pl CLONES

Sequence analysis of the subcloned PCR products from several of the factor independent clones described in Example 4, confirmed the presence of either the IL-3 or GM-CSF cDNA in these clones. All of the sequences determined conformed to the published sequences for these genes and showed that the authentic translational initiation and termination codons are present. They also indicated that the entire 3 '-untranslated region of each mRNA was present indicating that cDNA synthesis was primed, as expected, from the poly(A) tract; since all of the recovered GM-CSF and IL-3 inserts were of similar sizes (Figure 5), it is assumed they also contained the entire 3 '-untranslated regions.

EXAMPLE 15

CONSTRUCTION OF MODD7IED pRUF VECTORS

A modified pRUFneo vector was made by deleting the Ncol restriction endonuclease site in the polylinker. This vector is 5650bp in length and as is designated pRUFneoA-Vco/ (Figure 6). The vector was originally derived by inserting the MClneo cassette between Bglll and Clal site, of pRUF. A map of pRUF is shown in Figure 8. Such a vector without a Ncol site is useful to prevent potential inhibition of translation sequences (e.g. cDNAs) inserted downstream (i.e. 3') of the Ncol site. Since the Ncol site contains a potential initiation codon (ATG) translation could start at that position rather than ATG initiation codon of the inserted cDNA.

Another modified vector is shown in Figure 7 and is designated p JFpuro. This vector contains a different selectable marker (puromycin resistance) compared to pRUFneo and is useful in selecting cells that are already resistant to G418, i.e. that already have a Neo^ gene. EXAMPLE 16 CONSTRUCTION OF MUTANT cDNA LD3RARIES

cDNA libraries carrying mutant cDNA molecules are generated using the high error rate PCR procedure of Caldwell and Joyce (34). The mutated cDNA pool are then cloned as hereinbefore described.

TABLE 1 Numbers of clones derived by infection of Ψ2 cells with amphotropic supematants

Experiment Number of Supernatant Clones/dish⁵ Total Clones dishes² per dish⁴

1 12(ΨCRIP)³ 10ml 3,270 39,200

2 10(PA317) 10ml 7,000 70,000

3 3(PA317) 8ml 32,500 97,500

3 1(PA317) 2ml 46,000 46,000

4 1(PA317) 10ml 360,000 360,000

4 1(PA317) 2ml 360,000 360,000

1. Experiments 1-3 were carried out with LB-3 library and Experiment 4 with a stromal cell library.

2. Total number of dishes of Ψ 2 cells used in each experiment.

3. Amphotropic cell line used to derive transient supernatant is shown in parentheses.

4. Volume of transient amphotropic supernatant used to infect each 10cm petri dish of Ψ 2 cells.

5. Number of infected Ψ 2 clones derived from each dish; these were maintained as separate pools for subsequent use.

TABLE 2 Occurrence of factor independent FDC-Pl cells following infection with the retroviral

LB3 cDNA library.

Plating Conditions Colonies¹ Generated Following Co-Cultivation with:

Ψ2 Ψ2 Pool A² Ψ2 Pool B² Ψ2 Pool E²

No Factor o³ 15 18 11

GM-CSF+G418 0 6167 7875 2000

GM-CSF 17500 19417 15500 5624

Ratio Factor Independent : total 1:411 1:437 1:182 infected cells

Infected FDC-Pl cells were plated in soft agar and colonies (>50 cells) counted one week later.

The pools used contained approximately 32,500 independently infected Ψ 2 clones and were those obtained from Experiment 3, Table 1.

3. Numbers represent colonies per 50,000 cells plated. In practice, fewer cells were plated in GM-CSF than in the absence of factor to ensure that the cells could be counted.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. References:

1. Aruffo, A., and B. Seed. 1987. Proc. Natl. Acad. Sci. USA 84:8573-8577.

2. Seed, B., and A. Aruffo, 1987. Proc. Natl. Acad. Sci. USA 3365-3369.

3. Bishop, J. O., J. G. Morton, M. Rosbash, and M. Richardson. 1974. Nature 250:199-204.

4. Chikaraishi, D. M. 1979 Biochem. 18:3249-3256.

5. Ryffel, G.U., and B.J. McCarthy. 1975. Biochemistry 14: 1379-1385.

6. Lemischka, I. R., D. H. Raulet, and R. C. Mulligan. 1986. Cell 45:917-927.

7. Magli, M-C, J.E. Dick, D. Hauszer, A. Bernstein, and R.A. Phillips. Proc. Natl. Acad. Sci. USA 84: 789-793.

8. Miller, A.D., and C. Buttimore. 1986. Mol. Cell. Biol. 6:2895-2902.

9. Danos, O., and R. C. Mulligan. 1988. Proc. Natl. Acad. Sci. USA 85:6460-6464.

10. Mann, R., R.C. Mulligan, and D. Baltimore. 1983. Cell 33: 153-159.

11. Johnson, G. R., T. J. Gonda, D. Metcalf, I. K. Hariharan, and S. Cory. 1989. EMBO J. 8:441-448.

12. Gonda, T. J., R. G. Ramsay, and G. R. Johnson. 1989. EMBO J. 8:1767-1775.

13. Gonda, T.J., D.K. Sheiness, and J.M. Biship. 1982 Mol. Cell. Biol. 2: 617-624.

14. Thomas, K.R., and M.R. Capecchi. 1987. Cell 51: 503-512. 15. Huse, W. D., and C. Hansen. 1988. cDNA cloning redefined. Strategies in Molecular Biology 1:1-2.

16. Dexter, T. M., J. Garland, D. Scott, E. Scolnick, and D. Metcalf. 1980. J. Exp. Med. 152:1036-1047.

17. Kelso, A., and D. Metcalf. 1985. J. Cell. Physiol. 123: 101-110

18. Kelso, A., and A. Munck. 1984. J. Immunol. 133:784-791.

19. Miller, A. D., D. R. Trauber, and C. Buttimore. 1986. Som. Cell and Mol. Genet. 12:175-183.

20. DeLamarter, J. F., Mermod, J. -J., Liang, C. -M., Eliason, J. F., and Thatcher, D. R. 1985. EMBO J. 4:2575-2581

21. Hughes, S. H., F. Payvar, D. Spector, R. T. Schimke, H. L. Robinson, G. S. Payne, J. M. Bishop, and H. E. Varmus. 1979. Cell 18:347-359.

22. Saiki, R. K. 1990. Amplification of genomic DNA. In: M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.). PCR protocols, pp.13-20 Academic Press, Inc., San Diego.

23. Mason, P.J., and J. G. Williams. 1986. In: B. D. Hames and S. J. Higgins (ed.), Nucleic acid hybridisation, a practical approach., pp. 113-136., IRL Press, Oxford.

24. Bo tell, D. D. L., S. Cory, G. R. Johnson, and T. J. Gonda. 1988. J. Virol. 62:2464-2473.

25. Stocking, C, R. Kollek, U. Bergholz, and W. Ostertag. 1985. Proc. Natl. Acad. Sci. USA 82:5746-5750. 26. Hwang, L-H. S, and E. Gilboa. 1984. J. Virol. 50: 417-424. ^'

27. Chang, J. M., D. Metcalf, R. A. Lang, T. J. Gonda, and G. R. Johnson. 1989. Blood 73:1487-1497.

28. Lang, R.A., D. Metcalf, N.M. Gough, A. R. Dunn, and T. J. Gonda. 1985. Cell 43:531-542.

29. Wong, P.M.C., S-W Chung, and A.W. Nienhuis. 1987 Genes & Develop. 1: 358- 365.

30. Morris, C. F., I. G. Young, and A. J. Hapel. 1990. In: T. M. Dexter, J. M. Garland and N. G. Testa (ed.). Molecular and Cellular Biology, pp. 177-214. Marcel Dekker, Inc, New York.

31. Shinnick, T.M., R.A.Lerner and J.G.Sutcliffe. 1981. Nature 293: 543-548.

32. Laker, C, C.Stocking, V.Bergholz, N.Hess, J.F.De Lamarter and W.Ostertag.

1987 Proc. Natl. Acod. Sci. U.S.A. 84: 8458-8462.

33. Gonda, T.J., S.Cory, P.Sobieszczuk, D.Holtzman and J.M.Adams. 1987. J.Virol. 61 : 2754-2763.

34. Caldwell, R.C. and G.F. Joyce. 1992. PCR Methods and Applications 2: 28-33.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: MEDNET SCIENCE PTY. LTD.

INVENTORS: Gonda, T.J., Rayner, J.R. & Vadas, M.A.

(ii) TITLE OF INVENTION: "Generation of DNA libraries and vectors useful for same"

(iii) NUMBER OF SEQUENCES: 5

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Davies Collison Cave

(B) STREET: 1 Little Collins Street

(C) CITY: Melbourne

(D) STATE: Victoria

(E) COUNTRY: Australia

(F) ZIP: 3000

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 5.25" floppy disc

(B) COMPUTER: IBM compatible

(C) OPERATING SYSTEM: MS-DOS 5.0

(D) SOFTWARE: WordPerfect 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: International PCT Application

(B) FILING DATE: 04-AUG-1994

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: PM0389/93

(B) FILING DATE: 05-AUG- 1993 - AUSTRALIA

(C) APPLICATION NUMBER: PM3520/94

(D) FILING DATE: 25-JAN- 1994 - AUSTRALIA

(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Dr E. John L. Hughes (C) REFERENCE/DOCKET NUMBER: EJH/EK

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: +61 3 254 2777

(B) TELEFAX: +61 3 254 2770 (2) INFORMATION FOR SEQ ID NO. 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 51

(B) TYPE: nucleotides

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 1:

GAGAGAGAGA GAGAGAGAGA CTCGAGCGGC CGCTTTTTTT _{ττττττττττ τ}

(3) INFORMATION FOR SEQ ID NO. 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20

(B) TYPE: nucleotides

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 2:

TTGGGAACTC TGCTGACCAC

(4) INFORMATION FOR SEQ ID NO. 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21

(B) TYPE: nucleotides

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 3:

CTTGCAAAAC CACACTGCTC G (5) INFORMATION FOR SEQ ID NO. 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24

(B) TYPE: nucleotides

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 4:

GATAACGTAT CTGTCCTCAG GATC

(6) INFORMATION FOR SEQ ID NO. 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25

(B) TYPE: nucleotides

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 5:

ATCTTCAGGC GGGTCTGCAC ACATG

Claims

CLAIMS:

1. A method for generating a DNA expression library, said method comprising cloning DNA downstream of a promoter in a retroviral vector and generating a population of stable retrovirus producing cells.

2. A method according to claim 1 wherein the retrovirus-producing cells are ecotropic retroviral packaging cells.

3. A method according to claim 1 wherein the retrovirus-producing cells are amphotropic retroviral packaging cells.

4. A method according to claim 1 wherein the ecotropic retroviral packaging cells are Ψ2 cells.

5. A method according to claim 3 wherein the amphotropic retroviral packaging cells are PA317 or Ψ_crip cells.

6. A method according to claim 1 wherein the retroviral vector comprises a multi- cloning site adjacent a promoter such that ligation of a DNA sequence into said multi- cloning site permits expression of said DNA sequence, wherein said vector is capable of transfection into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells to enable generation of recombinant viral particles carrying DNA, said recombinant viral particles capable of infection of the other of amphotropic packaging or ecotropic packaging cells and stable integration into the genome of said cells.

7. A method according to claim 6 wherein the retroviral expression vector is pRUF, pRUFneo, pRUFneo ΔNcol or pRUFpuro or a related vector.

8. A method for generating a DNA expression library, said method comprising ligating DNA into a retroviral expression vector such that said DNA is operably linked to a promoter; transfecting the DNA-inserted vector into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus infecting the other of said amphotropic retroviral packaging cells or ecotropic packaging cells with the recombinant virus and selecting infected cells by a suitable selectable marker.

9. A method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the DNA-inserted vector molecules into one of amphotropic packaging cells or ecotropic packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting the other of said amphotropic packaging cells or ecotropic packaging cells with the produced recombinant virus and selecting infected cells by a suitable selection marker; infecting target cells and selecting for target cells by expression of a particular trait.

10. A method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the DNA-inserted vector molecules into amphotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting ecotropic retroviral packaging cells with recombinant virus and selecting infected cells by a suitable selection marker; infecting target cells and selecting for target cells by expression of a particular trait.

11. A method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into a retroviral expression vector such that said DNA molecules are operably linked to a promoter; transfecting the DNA-inserted vector molecules into ecotropic retrovirus packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting amphotropic retrovirus packaging cells with recombinant virus and selecting infected cells by a suitable selection marker; infecting target cells and selecting for target cells by expression of a particular trait.

12. A method according to any one of claims 8 to 12 wherein the ecotropic retroviral packaging cells are Ψ2 cells.

13. A method according to any one of claims 8 to 12 wherein the amphotropic cells are PA317 or Ψ_crip cells.

14. A method according to any one of claims 8 to 12 wherein the retroviral expression vector is pRUF, pRUFneo, pRUFneoΔNcol or pRUFpwro or a related vector.

15. A retroviral expression vector comprising a multi-cloning site adj acent a promoter such that ligation of a DNA sequence into said multi-cloning site permits expression of said DNA sequence, said vector capable of transfection into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells to enable generation of recombinant viral particles carrying DNA, said recombinant viral particles capable of infection of the other of amphotropic packaging or ecotropic packaging cells and stable integration into the genome of said cells.

16. A retroviral expresion vector according to claim 15 wherein the retroviral vector in plasmid form is also capable of replication in prokaryotic cells.

17. A retroviral expression vector according to claim 15 or 16 wherein said vector is pRUF or a related vector.

18. A retroviral expression vector according to claim 17 wherein the related vector is pRUFneo, pRUFneoΔNcol or pRUFpwro.

19. A method for cloning and identifying a particular gene, said method comprising generating a DNA pool putatively containing said gene and ligating DNA molecules from said pool into pRUF or related vector such that said DNA molecules are operably linked to a promoter; transferring ligated molecules into prokaryotic cells by transformation or electroporation and growing said cells for a time and under suitable conditions prior to isolation of recombinant DNA therefrom; transfecting the isolated cDNA-inserted vector molecules into one of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells and maintaining said cells for a time and under conditions sufficient to permit generation of recombinant virus; infecting the other of amphotropic retroviral packaging cells or ecotropic retroviral packaging cells with the recombinant virus and selecting infected cells by a suitable selection marker; infecting target cells and selecting for target cells by expression of a particular trait; cloning of the selected genetic sequences from the genome of the target cell line.

20. A method according to claim 19 wherein a vector related to pRUF is pRUFneo, pRUFneoΔNcol or pRUFpuro.

21. A method according to claim 19 wherein the prokaryotic cells are E. coli.

22. A method according to claim 19 wherein the ecotropic retroviral packaging cells are Ψ2 cells.

23. A method according to claim 19 wherein the amphotropic retroviral packaging cells are PA317 or Ψ_crip cells.

24. A gene or other genetic sequence when cloned in accordance with any one of claims 1 or 8 to 12 or 19.

25. A kit comprising in compartmental form a first compartment comprising a retroviral expression vector; a second compartment comprising ecotropic retrovirus packaging cells; a third compartment comprising amphotropic retrovirus packaging cells; and optionally a fourth compartment comprising prokaryotic cells.