WO1993020221A1 - Gene therapy using targeted viral vectors - Google Patents

Gene therapy using targeted viral vectors Download PDF

Info

Publication number
WO1993020221A1
WO1993020221A1 PCT/US1993/002957 US9302957W WO9320221A1 WO 1993020221 A1 WO1993020221 A1 WO 1993020221A1 US 9302957 W US9302957 W US 9302957W WO 9320221 A1 WO9320221 A1 WO 9320221A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
envelope
protein
hybrid
domain
Prior art date
Application number
PCT/US1993/002957
Other languages
French (fr)
Inventor
Alexander T. Young
Original Assignee
Young Alexander T
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Young Alexander T filed Critical Young Alexander T
Priority to EP93908659A priority Critical patent/EP0633943A4/en
Priority to JP5517626A priority patent/JPH07505773A/en
Priority to AU39402/93A priority patent/AU3940293A/en
Publication of WO1993020221A1 publication Critical patent/WO1993020221A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/854Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/855Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from receptors; from cell surface antigens; from cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/855Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from receptors; from cell surface antigens; from cell surface determinants
    • C12N2810/856Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from receptors; from cell surface antigens; from cell surface determinants from integrins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/859Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from immunoglobulins

Definitions

  • Gene therapy is an approach to treating a broad range of diseases by delivering therapeutic genes directly into the human body.
  • Diseases that can potentially be cured by gene therapy include 1) diseases associated with the aging population such as cancer, heart disease, Alzheimer's disease, high blood pressure, atherosclerosis and arthritis; 2) viral infectious diseases such as acquired immune deficiency syndrome (AIDS) and herpes; and 3) inherited diseases such as diabetes, hemophilia, cystic fibrosis, and muscular dystrophy.
  • diseases associated with the aging population such as cancer, heart disease, Alzheimer's disease, high blood pressure, atherosclerosis and arthritis
  • viral infectious diseases such as acquired immune deficiency syndrome (AIDS) and herpes
  • AIDS acquired immune deficiency syndrome
  • herpes and 3) inherited diseases such as diabetes, hemophilia, cystic fibrosis, and muscular dystrophy.
  • a favored approach for human gene therapy involves the transplantation of genetically-altered cells into patients (Rosenberg, et al., 1988, New Eng J Medicine 311:570-578).
  • This approach requires the surgical removal of cells from each patient to isolate target cells from nontarget cells. Genes are introduced into these cells via viral vectors or other means, followed by transplantation of the genetically-altered cells back into the patient.
  • transplantation strategies are less likely to be suitable for treating diseases such as cystic fibrosis or cancer, where the diseased cells themselves must be corrected.
  • Double balloon catheterization transduces genes into cells within a defined arterial wall segment.
  • a double balloon catheter is inserted into an artery until the end of the catheter is located within the target area.
  • Inflation of two balloons at the end of the catheter creates an enclosed space into which retrovirus or DNA-loaded liposomes are infused.
  • This method has been successful in the transient expression of ⁇ -galactosidase genes within a defined segment of the ileofemoral artery of pigs (Nabel E.G., et al., 1990, Science 249:1285-1288) .
  • biolistic transfer and double balloon catheterization although locally specific, may be nonspecific in the individual cells that they transduce within the target area, creating a problem of inappropriate gene regulation if the transgene is expressed in nontarget cells.
  • biolistic transfer nor double balloon catheterization have been shown to be effective for the treatment of tissue occupying large volumes such as lungs, muscles, tumors, or cells of the systemic circulation since the majority of the cells would be inaccessible for in situ gene transfer.
  • a third approach to gene therapy is the delivery of genes to cells in vivo.
  • This approach involves the introduction of viral vectors directly into patients by injection, spray or other means.
  • Different species of viruses are engineered to deliver genes to the cells that the viruses normally infect.
  • Adenovirus for example, which normally infects lung cells, has been developed as a vector to target genes to lung cells (Rosenfield, et al., 1992, Cell .68.143-155).
  • Most viral vectors are single purpose vectors since they can only deliver genes to certain cells. Because the target cell specificity of viral vectors is restricted to the normal tropisms of the viruses, viral vectors are generally limited in that they either infect too broad a range of cell types, or they db not infect certain types of cells at all.
  • Liposomes have been designed to deliver genes or drugs to specific target cells in vivo. By chemically conjugating antibodies or ligands to liposomes, liposomes have been targeted to specific cells.
  • antisense env RNA has been delivered to human immunodeficiency virus (HIV)-infected lymphocytes using anti-CD3-conjugated liposomes (Renneisen, K., et al. , 1990, J Biol Chem 265:16337-16342): chloramphenicol transacetylase (CAT) genes have been delivered to H2K k positive lymphomas in H2K k -negative nude mice using anti- H2 k -conjugated liposomes (Wang, C.
  • HV human immunodeficiency virus
  • CAT chloramphenicol transacetylase
  • XGPRT xanthine guanine phosphoribosyltransferase
  • Wu et al. report a method to target naked DNA to specific cells. Asialoglycoprotein-DNA complexes are targeted to hepatocytes expressing the asialoglycoprotein receptor (Wu G.Y., et al., 1991, Biotherapy 3.:87-95). Similar to the problem encountered with immunotoxins, however, this strategy generally limits delivery of DNA to cells expressing receptors that are capable of DNA- internalization.
  • Antisense DNA technology is a method for inhibiting the expression of specific genes with complementary DNA (Moffat, 1991, Science 253:510-511) .
  • antisense DNA is specific in the genes that it affects, it is nonspecific in the types of cells that it gets into. This can create problems in vivo because it is desirable that endogenous genes in normal cells remain unaffected by antisense DNA (e.g., protooncogenes) .
  • the cost of manufacturing and administering antisense DNA may be high because the phosphate moieties of antisense DNA must be chemically modified to allow passage through the plasma membrane, a process which entails expensive organic chemistry.
  • Millimolar concentrations of antisense DNA are required to be effective, posing problems of potential toxicity in vivo.
  • Human gene therapy is therefore limited by-the available technology for gene delivery.
  • Transplantation strategies which require surgery, limit gene therapy to an expensive service industry for a small number of diseases.
  • Targeting of genes in situ through local transduction is generally not precise enough.
  • Viral vectors limit the delivery of genes in vivo to cells that the viruses normally infect. Liposome technologies may be infeasible because of the expense of production. Simple ligand-DNA complexes will not introduce genes into cells unless the receptors, against which the ligands are directed, internalize. Accordingly, currently available gene delivery systems impose severe limitations on the spectrum of diseases that can be treated by gene therapy. Summary of the Invention
  • the invention features a method for expressing a nucleic acid of interest in a heterologous host cell.
  • the method involves providing a virus whose genome comprises i) the nucleic acid of interest, and ii) a hybrid envelope gene.
  • the hybrid gene encodes an envelope fragment joined to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding of its normal host cell but does facilitate efficient incorporation of the virus into a mature viral particle, and whereby the targeting ligand facilitates targeting and binding of the mature viral particle to the surface of the heterologous host cell.
  • the method also involves administering the virus so as to permit viral infection of the cell.
  • the invention features a. virus, the genome of which encodes a hybrid envelope protein, wherein the hybrid protein comprises an envelope fragment joined in frame to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding of its normal host cell but which does facilitate efficient incorporation of the hybrid envelope protein into a mature viral particle and whereby the non-viral protein facilitates targeting and binding of the mature viral particle to the surface of a cell not normally infected by the virus.
  • the invention features a method for % delivering a nucleic acid of interest to a heterologous host cell.
  • the method involves providing a virus that comprises i) the nucleic acid of interest, and ii) a hybrid envelope gene, the hybrid gene encoding an envelope fragment joined to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding to its normal host cell but does facilitate efficient incorporation of the virus into a mature viral particle, and whereby the targeting ligand facilitates targeting and binding of the mature viral particle to the surface of the heterologous host cell.
  • the method also involves administering the virus so as to permit viral infection of the cell.
  • the virus is an enveloped virus, preferably a Herpesviridae, a Paramyxoviridae, or a Retroviridae, most preferably a Moloney murine leukemia virus, or the virus may also preferably be a Hepadnaviridae, a Poxviridae, or an
  • the virus may be a Togaviridae, a Flaviviridae, a Coronaviridae, a Rhabodoviridae, a Filoviridae, an Orthomyxoviridae, a Bunyaviridae, or an Arenaviridae, or any other, yet unclassified, enveloped virus.
  • the- nucleic acid of interest may include, without limitation, an antisense oncogene; a tumor suppressor gene, e.g., a gene encoding p53, or a gene encoding retinoblastoma protein Rb; a toxin gene, e.g., a diphtheria toxin gene; or a gene encoding a cytokine, e.g., a tumor necrosis factor, or an interferon.
  • the nucleic acid of interest may be either DNA or RNA, e.g., antisense DNA, or antisense RNA, or a nucleic acid encoding an antisense RNA.
  • the nucleic acid of interest may also be a gene invoking intracellular immunity, or a nucleic acid therapeutic for an inherited disease, e.g., an insulin gene, or a cystic fibrosis transmembrane regulator gene.
  • a "gene that invokes intracellular immunity” is a gene that confers a dominant negative resistant phenotype to the cell it is in, thereby protecting the cell against an invading agent.
  • the heterologous host cell may be a cell that has acquired mutations that result in a disease state, preferably a cancer cell, e.g., a colon cancer cell.
  • the heterologous host cell may be a cell infected with a second virus, e.g., a human immunodeficiency virus (HIV), a cell infected with an organism, or an infectious agent such as a bacterium or parasite.
  • the infectious agent may be either unicellular or multicellular.
  • the heterologous host cell may also be a cell affected by a hereditary disease, e.g., a pancreatic beta cell, or a lung cell.
  • the targeting ligand may include a protein, preferably a hormone, or an immunoglobulin, more preferably an anti- tumor associated antigen-specific immunoglobulin, most preferably an anti-carcinoembryonic antigen-specific immunoglobulin, or an anti-HIVgpl20 antigen-specific immunoglobulin.
  • the targeting ligand may also be a carbohydrate, or a lipid.
  • the hybrid envelope fragment may consist of a receptor binding domain, an oligomerization domain, a transmembrane domain, a virus budding domain, sorting signals, a signal sequence, and preferably a fusion domain. In some cases the fusion activity of the envelope fragment may be performed by a second protein.
  • the second protein would therefore direct fusion of the virus with the membrane of the targeted cell.
  • the mode of administration may include, but is not limited to, 1) direct injection of the purified virus; or 2) implanting a container enclosing the virus into a patient.
  • the virus is preferably inside a packaging cell.
  • a "packaging cell” is a cell that supplies viral proteins necessary for production of viral vectors.
  • container is meant a virus permeable enclosure containing virus, or containing packaging cells with virus therein.
  • Normal host cell as used herein, is a cell type commonly infected by the naturally occurring virus.
  • heterologous host cell or a “targeted cell”, as used herein, refers to a cell that is recognized as a function of the targeting ligand portion of the hybrid envelope protein, but is not recognized as a function of the envelope portion of the hybrid envelope protein.
  • targeting ligand is meant a molecule that has binding affinity for a molecule on the surface of a desired targeted cell.
  • a “hybrid envelope protein”, as used herein, is a protein that includes a portion of a viral envelope protein (or a biologically active analog thereof) covalently linked to a targeting ligand.
  • hybrid immunoglobulin-env protein a portion of an immunoglobulin covalently linked to a portion of an envelope protein.
  • a “hybrid envelope gene” is a nucleic acid that provides genetic instructions for a hybrid envelope protein.
  • hybrid anti-careinoe bryonic antigen-specific immunoglobulin is meant a hybrid immunoglobulin-env protein that specifically binds to a carcinoembryonic antigen.
  • fragment includes some but not all of the envelope protein.
  • a fragment will ordinarily be at least about about 20 amino acids, typically at least about 30 amino acids, usually at least about 40 contiguous amino acids, preferably at least about 50 amino acids, and most preferably at least about 60 to 80 or more contiguous amino acids in length. Fragments of an envelope protein can be generated by methods known to those skilled in the art (e.g., those described herein).
  • a biologically active fragment of a viral envelope protein is one that possesses at least one of the following activities: a) it can bind to a cell membrane if given the appropriate targeting ligand; b) it can enable fusion with a cell membrane; or c) it can enable incorporation of proteins into a mature viral particle. These three biological activities can be performed by the same envelope protein fragment, or by two separate envelope protein fragments.
  • the envelope fragments of this invention do not facilitate recognition or binding of the virus' normal host cell. This is accomplished by either destroying the activity of the normal receptor binding region by mutation, or by physically deleting it. A new recombinant receptor- binding region is added in its place.
  • the ability of a candidate fragment to exhibit a biological activity of a viral envelope protein can be assessed by methods known to those skilled in the art.
  • the envelope fragment may include the amino acid sequence of a naturally-ocurring viral envelope or may be a biologically-active analog thereof.
  • the biological activity of an envelope analog is assessed using the methods described herein for testing envelope fragments for activity.
  • Applicants have provided an efficient and reliable means for specifically delivering therapeutic genes or antisense nucleic acids to particular animal, plant or human cell types, or to cells of infectious agents. Their method facilitates treatments for mutagenically acquired, infectious, or inherited diseases, e.g. , by either 1) antagonizing the effect of an existing cellular gene; 2) complementing the defect of an existing cellular gene; 3) destroying the target cells through the introduction of new genetic material; or 4) changing the phenotype of the target cells through the introduction of new genetic material.
  • a hybrid envelope protein e.g., an envelope- antibody or envelope-ligand hybrid
  • the viruses itself, through its efficient internalization mechanisms, facilitates efficient uptake of the therapeutic gene.
  • viral vectors are uniquely adapted to deliver genes, RNA, or drugs to cell surface proteins that do not normally internalize.
  • Another advantage of this invention is that it overcomes the problem of gene regulation encountered with other methods of gene therapy. Genetically-altered cells must not only synthesize the gene products at the right location, at the right time, and in the right amounts, but must also be regulated in the same manner as the indigenous tissue. That is, the transduced cells must also have all the proper signal transduction mechanisms to respond to extracellular signals.
  • fibroblasts do not contain the same receptors and signal transduction machinery as pancreatic beta cells, the insulin genes may be expressed differently. Targeting genes to the right cells insures that the genes will be properly regulated.
  • a selection scheme is devised for creation of hybrid envelope protein-containing, viruses. This strategy will be feasible for env proteins fused with immunoglobulins or with any ligand that recognizes specific receptors on cells.
  • FIG. 1 is a representation of a scheme for constructing retroviral vector pLNCX*.
  • FIG. 2 is a representation of a scheme for constructing plasmid LNCenvpA.
  • FIG. 3 is a representation of a scheme for constructing plasmid LNCenv.
  • FIG. 4 is a representation of a scheme for constructing plasmid pUC Star-Sig.
  • FIG. 5 is a representation of a scheme for constructing plasmid LNC-Sig.
  • FIG. 6 is a representation of a scheme for constructing plasmid LNC-antiCEA.
  • FIG. 7 is a representation of plasmids used in the construction of targeted viruses.
  • FIG. 8 is a representation of a strategy for generating targeted retroviruses involving construction of hybrid immunoglobulin-env genes in vitro.
  • FIG. 9 is a representation of a strategy for generating targeted retroviruses involving generation of pooled virus constructions.
  • FIG. 10 is a representation of a strategy for generating targeted retroviruses involving selection and characterization of targeted virus.
  • FIG. 11 is a representation of a plasmid containing a targeted retroviral vector.
  • FIG. 12 is a representation of a scheme for constructing plasmid pUC Star-antiCEA.
  • FIG. 13 is a representation of an alternative scheme for constructing plasmid LNC-antiCEA.
  • the receptor recognition domain of the viral envelope protein is replaced with a ligand directed against a specific cell surface receptor.
  • the hybrid envelope protein is incorporated into the viral envelope during the budding process, producing a hybrid virus in vivo, upon infection of a host, the hybrid virus specifically recognizes its target cell and resultant fusion with that cell facilitates internalization (into the target cell) of viral genes, including the therapeutic gene(s) which are engineered into the viral genome.
  • Such internalization can be extremely important; for example, immunotoxins, although efficient at delivering toxin molecules to target cells, are often clinically ineffective since the cell surface molecules to which they are targeted do not internalize, and internalization is required for entry of the toxin molecules into the cells (Waldmann, T.A. , 1991, Science 252: 1657-1662) .
  • Targeted viruses circumvent this requirement for receptor internalization since the virus itself contains the necessary cell fusion machinery (Gilbert, J.M. , et al., 1990, J Virol 64: 5106-5113; Roizman, B. et al., 1990, in BN Fields, et al., eds. Virology. Raven Press, Ltd. New York) .
  • targeted viruses are constructed by replacing the receptor recognition domain of the viral envelope protein with a ligand directed against a specific cell surface receptor.
  • the ligand can be, without limitation, an immunoglobulin (e.g., FAb, dAb, Fd, or Fc) , a hormone, or any other synthetic or natural protein that can direct the binding of the targeted viruses to a cell surface molecule.
  • the ligand is biologically incorporated into the viral envelope by genetic fusion with that portion of the normal viral envelope protein involved in viral assembly and budding.
  • the envelope portion of the hybrid protein consists of an envelope fragment (or analog thereof) that is sufficient to direct efficient incorporation of the envelope hybrid protein into the viral envelope.
  • the envelope hybrid protein no longer directs an interaction between the virus and its normal host cell.
  • VSV vesicular stomatitis virus
  • virus envelopes can tolerate changes in length or conformation introduced into the envelope protein, e.g., by a conjugated ligand.
  • Gitman et al have shown that Sendai virus envelopes reconstituted with viral envelope glycoproteins, chemically cross-linked to anti-erythrocyte antibodies acquire the ability to bind to erythrocytes that had been stripped of the normal virus receptor.
  • Sendai virus envelopes reconstituted with envelope proteins, chemically cross-linked to insulin molecules were able to bind to receptor-stripped erythrocytes expressing the insulin receptor. In both cases, envelope binding but not fusion occurred with the receptor-stripped erythrocytes.
  • the targeted virus contains 1) a viral envelope derived from a host cellular membrane; 2) a transmembrane hybrid envelope protein that directs the binding and penetration of the virus to specific target cells; 3) a transmembrane envelope protein that directs the fusion of the targeted virus with the cellular membrane of the targeted cell for viral penetration (e.g., the targeting protein itself or another envelope protein) ; 4) viral core proteins; 5) a foreign gene(s) of interest; and 6) all necessary viral and genetic components for penetration and expression of genes contained in the viral genome.
  • the transmembrane hybrid' envelope protein consists of 1) determinants that enable the hybrid protein to become processed and incorporated into viral envelopes; 2) determinants that enable fusion of the viral envelope with the targeted cellular membrane; these are essential for penetration of the targeted virus; 3) a ligand determinant that enables the targeted virus to recognize and bind to specific receptors on target cells.
  • the viral genome may also include bacterial selectable markers (e.g., ampicillin resistance) and/or a mammalian cell selectable marker (e.g., neomycin resistance).
  • the transmembrane hybrid protein is constructed genetically by splicing the cell surface receptor binding domain of a ligand gene to a portion of the viral envelope protein gene.
  • the transmembrane hybrid protein must retain those portions of the envelope protein that direct the efficient post-translational processing, sorting and incorporation of the protein into the viral envelope.
  • the receptor binding domain is that portion of the envelope protein that recognizes and binds to cell surface receptors. In hybrid envelope proteins, this portion of the envelope protein is replaced with ligand sequences.
  • the receptor binding domain of retrovirus envelope proteins has been localized to the SU subunit (Coffin, J.M. , 1990, in BN Fields, et al., eds. Virology r Raven Press, Ltd., New York). Since the SU protein of retroviruses is coded for 5' to the transmembrane protein, replacement of the amino-terminal sequences of the envelope protein with ligand sequences poses no problem for the creation of a functional hybrid ligand- envelope protein.
  • the envelope protein of retroviruses is synthesized as a polyprotein which is later proteolytically cleaved to form SU and TM heterodimers.
  • the proteolytic cleavage site should be eliminated.
  • the proteolytic cleavage site should be eliminated either by deletion or by site directed mutagenesis. Perez and Hunter have demonstrated that elimination of the . proteolytic cleavage site does not block transport or surface expression of Rous sarcoma virus envelope proteins (Perez, L.G., et al. , 1987, J Virol 61:1609- 1614) .
  • trimerization of the envelope protein is thought to be essential for the proper transport and insertion of envelope proteins into the viral envelope (Singh, J. et al., 1990, Embo J 9.:631-639; Kreis, T.E., et al., 1986, Cell 46.:929-937) . Therefore it is important that this domain be retained in the hybrid ligand-envelope protein.
  • the trimerization domain likely resides in the transmembrane TM protein of retroviruses (Einfeld, D.
  • the fusion domain is a hydrophobic stretch of amino acids that is involved in fusion of the virus envelope with the cell membrane (Wiley, D.C., et al., 1990, in Fields, B.N. et al., eds. Virology r 2nd ed. , Raven Press, Ltd., New York). Viral fusion allows entry of the viral core proteins and genome into the cell.
  • influenza virus the fusion domain, located in the amino terminus of the envelope HA2 protein, is sequestered in the hemagglutinin trimer until a low pH-induced conformational change allows presentation of the fusion domain to the cell membrane.
  • Trimerization of the envelope proteins can prevent constitutive expression of fusion activity by sequestering it within an internal hydrophobic pocket.
  • a potential fusion domain has been located within the extracellular portion of the gp37 TM protein of Rous sarcoma virus (Hunter E. et al., 1983, J Virol __ y.920-936) .
  • Similar hydrophobic fusion sequences have been noted in the pl5E protein of Moloney murine leukemia virus (Mo-MuLV) (Chambers, P., et al.,1990, J Gen Virol 71:3075-3080).
  • the first protein is the hybrid ligand-envelope protein which directs targeting of the virus but lacks fusion activity.
  • the second protein is an envelope protein possessing fusion activity but lacking a receptor binding domain. This type of situation is observed for paramyxoviruses where one envelope protein is dedicated to targeting while another carries out fusion (Kingsbury, D.W. , 1990, B.N. Fields, et al., eds. Virology, 2nd ed. , Raven Press, Ltd., New York.). Where it is not necessary to prevent constitutive fusion activity, both activities may be included in one protein. 5. Transmembrane domain
  • the transmembrane domain is a stretch of approximately twenty or more amino acids that anchor the envelope protein to the viral envelope. It is located within the pl5E protein of Moloney murine leukemia virus (Chambers, et al., supra) . Retention of the transmembrane domain is thought to be essential since deletion of the transmembrane domain results in secretion of the synthesized envelope protein (Perez, L.G., et al., 1987, J Virol 11:2981-2988). 6. Virus budding domain
  • Amino acid sequences within the envelope protein may be involved with the exclusive incorporation of viral envelope proteins into viral envelopes and with virus budding.
  • the virus budding domain directs the hybrid ligand-envelope protein into the viral envelope. These sequences are thought to reside within the portion of the envelope protein facing the inside of the virus and may involve specific protein-protein interactions between envelope proteins and viral core or matrix proteins.
  • Sorting signals are determinants that direct the envelope protein to the correct intracellular location during post-translational processing. These sequences insure that the envelope protein passes through the endoplasmic reticulum, Golgi apparatus, and other ⁇ rganelles until it eventually reaches the viral envelope. Other signals that may have to be retained in the hybrid ligand-envelope protein are glycosylation sequences and sequences involved in effective conformation of the envelope protein (e.g., disulfide bonds) .
  • the signal sequence is an amino-terminal hydrophobic stretch of amino acids that directs the envelope protein into the endoplasmic reticulum.
  • the signal sequence which is later proteolytically cleaved. is essential for the hybrid ligand-envelope protein to become located in a membrane.
  • the diversity of signals and domains that must be considered in constructing targeted viruses requires that precise and correct splicing of ligand and envelope genes occur.
  • the present invention describes a selection scheme for constructing targeted viruses whereby the ligand gene is spliced to an envelope gene fragment; this hybrid gene codes for those portions of the envelope protein which are required to direct efficient incorporation of the resultant hybrid envelope-ligand protein into the mature viral particle.
  • cell surface receptor binding domains of ligand genes are randomly ligated to progressive deletions of viral envelope genes.
  • the correct combination of ligand and envelope sequences is determined by a selection scheme for the production of biologically active targeted virus. The selection scheme not only produces targeted virus but simplifies the construction of future targeted viruses.
  • a Specific Example of a Targeted Retrovirus There now follows an example of a recombinant retrovirus which targets and infects particular host cells for the purpose of delivering to those cells a desired therapeutic gene.
  • This example is provided for the purpose of illustrating, not limiting, the invention.
  • Moloney murine leukemia virus (Mo-MuLV) is a mouse ecotropic retrovirus.
  • a recombinant Mo-MuLV based retroviral vector that is targeted to colon cancer cells is constructed.
  • the targeted retroviral vector delivers the neomycin resistance gene to colon cancer cells.
  • Targeting to human colon cancer cells is accomplished by incorporating into the viral envelope hybrid immunoglobulin-env proteins directed against carcinoembryonic antigen.
  • Carcinoembryonic antigen is a tumor associated antigen expressed on the surface of human colon cancer cells but not on the surface of normal adult cells.
  • the CEA glycoprotein possessing multiple membrane spanning alpha helices, does not internalize in response to ligand (Benchimol, S. et al., 1989, Cell 57:327-334).
  • a protein that is homologous to carcinoembryonic antigen has recently been shown to be the receptor for mouse hepatitis virus (Dveksler, G.S., et al, 1991, J Virol 65.:6881-6891) .
  • a single variable region of the heavy chain of anti-CEA is fused to a portion of the env gene.
  • dAb Single variable heavy chain fragments
  • Fb fragmented antibodies
  • dAb's Single variable heavy chain fragments
  • monoclonal antibodies Ward, E.S., et al.. Nature 341:544-546.
  • the function of immunoglobulin-env proteins is not limited, however, to the use of dAb's and can be applied with FAb's, Fv's and mAb's. Modification of the retroviral vector LNCX
  • LNCX is a Moloney murine leukemia virus based retroviral vector contained in the plasmid pLNCX (Miller, A.D., et al., 1989, Biotechniques 2:980-990).
  • pLNCX contains a unique Hindlll and Clal cloning site for expression of inserted genes, a cytomegalovirus (CMV) promoter, a polyadenylation site (pA) , retroviral long terminal repeats (LTR) for retroviral RNA transcription and reverse transcription, a bacterial neomycin resistance gene (Neo) which conveys resistance to both neomycin and G418, a bacterial origin of replication
  • CMV cytomegalovirus
  • pA polyadenylation site
  • LTR retroviral long terminal repeats
  • Neo bacterial neomycin resistance gene
  • LNCX is modified to contain a unique Sail site as shown in Figure 1.
  • pLNCX is linearized with Xbal and subcloned into the Xbal site of the phagemid Bluescriptll SK+ (Stratagene, La Jolla, CA) .
  • Single stranded DNA is purified and the unique BstEII site of LNCX is converted into a Sail site by site directed mutagenesis with the oligonucleotide 5'-GCAGAAGGTCGACCCAACG-3' (SEQ ID NO: 1).
  • the BstEII site is located within the extended packaging signal ( ⁇ +) of Mo-MuLV RNA (Bender, M.A. , et al., 1987, J Virol 61:1639-1646; Adam, M.A., et al., 1988, J Virol 62:3802- 3806; Armentano, D. et al., 1987, J Virol 61:1647-1650) .
  • Conversion of the BstEII site to Sail does not affect packaging since this region has been determined to be dispensable for efficient packaging (Schwartzberg. P., et al., 1983, J Virol 46:538-546; Mann R.
  • the BstEII site is converted into a Sail site because BstEII sites, but not Sail sites, frequently occur in heavy chain genes (Chaudhary, V.K. , et al, 1990, Proc Natl Acad Sci USA 82:1066-1070).
  • the Sail containing plasmid is recircularized with Xbal and DNA ligase to form the plasmid pLNCX*.
  • the Mo-MuLV env gene is cloned into pLNCX*. as shown in Figure 2.
  • the Mo-MuLV env gene is excised from plasmid p8.2 (Shoemaker, C. , et al., 1980, Proc Natl Acad Sci USA 22:3932-3936) as a 1.9kb Scal-Nhel fragment.
  • the 1.9kb Scal-Nhel fragment contains the entire coding region for the pl5E transmembrane protein and the majority of the coding region for the gp70 SU protein.
  • the 5'-protruding ends are digested with Sl-nuclease, and Hindlll linkers (5-CCAAGCTTGG-3'; SEQ ID NO: 2) are added.
  • the env gene is cloned as a Hindlll fragment in the Hindlll site of pLNCX* to form plasmid LNCenvpA.
  • the orientation of the Hindlll env fragment is such that it can be transcribed and expressed from the cytomegalovirus (CMV) promoter. Modification of LNCenvpA to LNCenv
  • LNCenvpA is cloned as an Xbal fragment in phagemid pBluescript II SK+ for additional site directed mutagenesis ( Figure 3) .
  • the env encoding Hindlll fragment contains a polyadenylation signal that may interfere with the polyadenylation signal provided by the viral vector.
  • the AAUAAA polyadenylation signal is therefore changed to AAGAAA by site directed mutagenesis with the oligonucleotide 5'-GTTTTCTTTTATC-3' (SEQ ID NO: 3) .
  • the Hindlll site located at the 3' end of the env gene is eliminated by site directed mutagenesis with the oligonucleotide 5-CAAGCATGGCTTGCC-3' (SEQ ID NO: 4).
  • the env containing retroviral vector is re ⁇ ircularized by Xbal restriction and ligation to form plasmid LNCenv.
  • Molecular cloning of anti-CEA immunoglobulin genes cDNA encoding the mature variable region domain of anti-CEA heavy chain genes is cloned as an Xhol-Spel fragment using the polymerase chain reaction (PCR) and RNA template.
  • RNA is derived from the spleen of mice immunized against purified carcinoembryonic antigen.
  • RNA can be derived from hybridoma cell lines that secrete monoclonal antibodies against CEA, e.g., 1116NS-3d (American Type Culture Collection CRL8019) or CEA 66-E3 (Wagener, C, et al., 1983, J Immunol 130:2308-2315) .
  • the following PCR primers hybridize to cDNA encoding the aminoterminal end of mature heavy chain genes (Stratacyte, Inc.).
  • the degenerate primers introduce an Xhol site which is underlined. 5' AGGTGCAGCTGCTCGAGTCGGG 3' (SEQ ID NO: 5)
  • ImmunoZAP H is a modified lambdaZAP vector that has been modified to express in E.coli immunoglobulin variable heavy chain fragments behind a pelB signal sequence. The procedure could similarly be performed by expressing immunoglobulin variable light chain fragments in a packaging cell line. Identification of high affinity anti-CEA clones Clones expressing high affinity anti-CEA antibodies are identified by a filter binding assay.
  • the anti-CEA phage library is screened by nitrocellulose plaque lifts with [ 125 I]bovine serum albumin conjugated to CEA, as previously described (Huse, W.D., et al., 1989, Science 146:1275-1281). High and intermediate affinity anti-CEA clones are chosen for further manipulation. Construction of plasmid LNC-itnmuno ⁇ loj ulin
  • LNC-antiCEA which codes for an anti-CEA immunoglobulin gene
  • LNC- immunoglobulin vectors encode an immunoglobulin peptide fused to an amino-terminal signal sequence. Some-amino acids at the amino-terminal end of the mature immunoglobulin peptide have been modified by the PCR primers used to generate the immunoZAP library.
  • the design of the LNC-antiCEA plasmid results in the insertion of an extra amino acid at the amino terminal end.
  • amino acid changes do not affect antigen binding because 1) the amino acid changes are conservative; 2) the affected amino acids are normally variable at those sites; and 3) the affected amino acids occur within the framework region of immunoglobulins which has been shown not to participate in antigen binding or conformation of the antibody (Relchman et al. 1988 Nature 332:323-327) . It is for these same reasons that cleavage of the signal sequence from mature peptide will not be affected.
  • pUC119 is a phagemid containing a polylinker cloning site.
  • the multiple cloning sites of pUC119 are replaced with new restriction sites by insertion of the following polylinker into the Hindlll and Xbal sites of pUC119.
  • the modified pUC119 is called pUC Star-1 ( Figure 4) .
  • the restriction sites may be further separated by small linkers, if adjacent restriction sites interfere with one another during digestion.
  • the signal sequence from an anti-NP immunoglobulin heavy chain gene is isolated from plasmid pcDFL.l (Ucker, D.S., et al., 1985, J Immnol JL35:4204-4214) as a ⁇ 330bp PstI fragment.
  • the 330bp PstI fragment is subcloned into pUC Star-1 to yield plasmid pUC Star-Sig ( Figure 4).
  • the PstI fragment is oriented so that the signal sequence can be expressed.
  • LNCX* is converted into a eukaryotic immunoglobulin expression vector ( Figures 4 and 5) .
  • An immunoglobulin heavy chain signal sequence and Xhol-Spel cloning sites are inserted behind the CMV promoter of plasmid LNCX* to allow expression of the PCR amplified immunoglobulin genes.
  • Conversion of LNCX* is as follows. The immunoglobulin heavy chain signal sequence is recovered from pUC Star-Sig as a Hindlll-Clal restriction fragment and cloned into the Hindlll-Clal sites of LNCX*.
  • the resulting plasmid, LNC-Sigr contains a retroviral vector with the immunoglobulin heavy chain signal sequence under control of the CMV promoter ( Figure 5) .
  • An anti-CEA gene from the immunoZAP library is then subcloned into LNC-Sig to form plasmid LNCanti-CEA.
  • This generates an anti-CEA variable heavy chain gene containing a signal sequence ( Figure 6).
  • the anti-CEA gene is first excised from immunoZAP phage DNA as a Bluescript SK- phagemid (see lambdaZAP protocols, Stratagene, Inc. La Jolla, CA) .
  • the anti-CEA gene is purified as an Xhol-Spel fragment and ligated to Xhol- Spel restricted LNC-Sig.
  • LNC-Sig contains three Spel sites. Therefore, to generate plasmid LNCanti-CEA, the ligation mix is transformed into neomycin-sensitive, ampicillin-sensitive E__ coli and neomycin-resistant, ampicillin-resistant transformants are selected for. Plasmid LNCanti-CEA is screened from neomycin-resistant, ampicillin-resistant transformants by using the Spel-Xhol anti-CEA restriction fragment from Bluescript SK-anti-CEA as a probe. The Spel site is used because of dependence upon the available sites in the ImmunoZap expression vector. To simplify construction of LNCanti-CEA, a unique NotI site can be introduced into the ImmunoZap H expression vector so that NotI sites can be used instead of Spel sites.
  • An anti-CEA gene from the immunoZAP library is subcloned into plasmid pUC Star-Sig to form plasmid pUC Star-anti-CEA. This generates an anti-CEA variable heavy chain gene containing a signal sequence ( Figure 12) .
  • the anti-CEA gene is excised from immunoZAP phage DNA as a Bluescript SK-phagemid (see lambdaZAP protocols, Stratagene, Inc., La Jolla, CA) . Bluescript SK-anti-CEA double stranded DNA is prepared and restricted with Xhol and Spel.
  • the anti-CEA containing Xhol-Spel fragment is purified by electroelution and ligated to Xho-Spel restricted pUC Star-Sig to create plasmid pUC Star- antiCEA ( Figure 12) .
  • the antiCEA gene is transferred from pUC Star-anti CEA to LNCX* as a Hindlll-Clal fragment to create plasmid LNC-antiCEA (figure 13) .
  • the antiCEA-containing Hindlll- Clal fragment is purified from pUC Star-antiCEA by electroelution. Phosphatase treated, Hindlll-Clal restricted LNCX* is ligated with the purified Hindlll- Clal antiCEA fragment to generate LNC-antiCEA (figure 13) .
  • LNCenv and LNC-immunoglobulin in this example, LNC-antiCEA
  • Figures 8-11 diagram the general principle for the primary generation of targeted viruses.
  • Hybrid immunoglobulin-env proteins are generated that target viruses to cells expressing carcinoembryonic antigen. Since the location of important determinants for envelope protein sorting (S) , trimerization (T) , and fusion (F) is not known with certainty, the immunoglobulin gene is ligated to progressive deletions of the env gene and functional immunoglobulin-env hybrids are selected for.
  • the envelope portion of the fusion protein may consist of any portion of the envelope protein (or any analog thereof) which is sufficient to direct efficient incorporation of the envelope fusion protein into the viral coat (upon budding of the recombinant virus from a producer cell line) .
  • Such fragments or analogs may be determined using the following general selection scheme which generally involves ligation of cell surface receptor binding domains of ligand genes to progessive deletions of viral envelope genes.
  • the correct combination of ligand and envelope sequences is determined by a selection scheme for the production of biologically active targeted virus. The selection scheme not only produces targeted virus but simplifies the construction of future targeted viruses.
  • LNCenv contains the coding region for the Mo-MuLV env polyprotein ( Figure 8) .
  • LNCenv is first linearized by Hindlll restriction. A range of deletions extending into the env gene is created by collecting aliquots of Exonuclease III treated DNA over time and removing 5'-processive ends with Sl-nuclease (Guo, I.H., et al., 1983, Methods Enzymol 100:60; and Sambrook, J. , et al., 1989, Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor) .
  • NotI linkers (5' AGCGGCCGCT 3' SEQ ID NO: 13) are ligated onto the blunt end termini and restricted with NotI. This results in a NotI restriction overhang at the 5'-border of every deletion within the env gene. The NotI overhangs at the other end of the molecules are removed by Sail restriction of the reaction mixture. The reaction mixture is then treated with phosphatase to prevent circularization of the reaction products. The reaction mixture is ligated to a Sall-NotI restriction fragment from LNC-antiCEA that contains the anti-CEA variable heavy chain gene. This creates a pool of functional retroviral vectors encoding an anti-CEA peptide fused to a series of env deletions. Generation of pooled virus constructions
  • the total reaction mixture from above is transformed into ampicillin-sensitive E. coli and ampicillin resistance is selected for ( Figure 9) .
  • Re ⁇ ombinants containing functional retroviral vectors are selected for since only they contain the ampicillin resistance gene.
  • Plasmid DNA is prepared from transformants grown in liquid culture to create a pool of retroviral vectors containing different immunoglobulin- env fusion genes.
  • the DNA is transfected into the crip2 retroviral packaging cell line (Danos, 0., et al., 1988, Proc Natl Acad Sci USA 85: 6460-6464) .
  • DNA is transfected into a packaging cell line that does not encode wild-type env protein.
  • the transfected packaging cell line synthesizes each of the different hybrid immunoglobulin-env proteins as well as the wild type env protein (encoded by an env gene contained in the cell line) .
  • the transfected packaging cell line secretes a pool of enveloped retroviruses containing the different retroviral genomes encoding hybrid immunoglobulin-env genes. If the hybrid immunoglobulin-env protein retained all of the necessary determinants for efficient incorporation into viral envelopes then the hybrid-env protein can be incorporated into viral envelopes. Wild type env proteins encoded for by the packaging cell line are also incorporated into the viral envelopes. This creates a virus containing both wild type and hybrid env proteins in the viral envelope.
  • This system therefore selects for immunoglobulin-env hybrids that can incorporate their gene products into the viral envelope.
  • Virus pools are harvested from media filtered at 0.45 ⁇ to remove contaminating G418-resistant packaging cells. Selection and characterization of targeted virus G418-sensitive target cells are exposed to virus pools by standard procedures, and G418-resistant cells are selected for.
  • the target cells can be any non-mouse cell line (uninfe ⁇ table by wild type Mo-MuLV) that expresses carcinoembryonic antigen.
  • ATCC COLO 205 a human cell line isolated from the ascites of a patient with carcinoma of the colon (A.T.C.C.#CCL 222); LR-73 CEA, a Chinese hamster ovary cell line transfected with a mouse carcinoembryonic antigen gene (Benchimol, S. et al., supra) ; and HCT48, a human colon adenocarcinoma cell line (Shi, Z.R., et al., 1883, Cancer Res 11:4045-4049).
  • G418-resistant cells can only have arisen from transduction of the neomycin resistance gene by targeted virus. This system therefore selects for recombinant viruses that have hybrid immunoglobulin-env proteins that have retained all the necessary determinants for viral targeting and fusion. Rescue of integrated immunoglobulin-env gene
  • PCR polymerase chain reaction
  • PCR 5' Rescue primer 5 '-CCAGCCTCCGCGGCCCCAAGCTTCTGCA-3' (SEQ ID NO: 14)
  • the retroviral vector produced in the above selection scheme is targeted to both CEA-expressing human cells (directed by the hybrid envelope protein) and normal mouse cells (directed by the wild type envelope protein) when produced in crip2 packaging cells.
  • the retroviral vector will irst be tested to determine if incorporation of the hybrid envelope protein alone is sufficient to direct virus fusion. This is accomplished by transfecting DNA into a modified packaging cell line that does not encode wild type env.
  • targeted viruses will be created as follows.
  • a packaging cell line will be created that encodes an env gene containing mutations in the receptor binding domain.
  • targeted viruses expressing both hybrid ligand-env proteins and env proteins with mutated binding sites will be produced.
  • the viruses will exclusively infect target cells.
  • the targeted viral vector is a universal vector
  • the viral vector that is constructed by the above procedure is a universal targeted vector ( Figure 11) .
  • Targeting to other cells is accomplished by replacing the Xhol-Spel anti-CEA fragment with any Xhol-Spel fragment encoding an in-frame immunoglobulin or ligand directed against specific cell surface proteins.
  • an Xhol-Spel immunoglobulin-containing fragment from an immunoZAP library can be fused in frame behind a signal sequence and subcloned into LNCX* through the pUC Star- Sig plasmid, as outlined above. Substituting a Sall-NotI fragment from another LNC-immunoglobulin plasmid into the universal vector would create another targeted virus vector.
  • Any enveloped virus may be used as a vector for the targeted delivery of a therapeutic gene.
  • Particular examples include both DNA and RNA viruses, such as Herpesviridae, e.g., herpes simplex type 1 or 2, Paramyxoviridae, Retroviridae, Hepadnaviridae, Poxviridae, Iridoviridae, Togaviridae, Flaviviridae, Coronaviridae, Rhabodoviridae, Filoviridae, Orthomyxoviridae, Bunyaviridae, or Arenaviridae, or any other, yet unclassified, enveloped virus.
  • Herpesviridae e.g., herpes simplex type 1 or 2, Paramyxoviridae, Retroviridae, Hepadnaviridae, Poxviridae, Iridoviridae, Togaviridae, Flaviviridae, Coronaviridae, Rhabodoviridae, Filovirid
  • any molecule that is capable of directing specific interaction with a target host cell may be used as the targeting ligand portion of the envelope fusion protein.
  • a target host cell e.g., by specific recognition of and binding to a host cell surface protein
  • a protein is derived from one member of a ligand:receptor pair.
  • the targeting ligands are not limited to proteins. Carbohydrate and lipid moieties can be attached to the envelope protein via protein fragments containing consensus sequences for glycosylation and lipidation.
  • Immunoglobulin genes can be used as ligands, as shown in the example above. Genes for high affinity immunoglobulins are screened from a lambda or bacterial expression library by a filter binding assay with [ 125 I] bovive serum albumin conjugated to antigen, as previously described (Huse, et al. Supra) .
  • Cell surface molecules such as integrins, adhesion molecules or homing receptors can be used as cell- specific ligands since they are involved in cell-cell interactions via receptors on other cells. Genes encoding these molecules can be identified by the panning method of Seed and Aruffo (Seed. B., et al., 1987, Proc Natl Acad Sci USA 84:3365-3369) .
  • Hormones that bind to specific receptors can be used as targeting ligands as well as viral proteins, such as HIV envelope protein gpl20, and modifications of naturally occuring ligands.
  • Therapeutic Genes can be used as targeting ligands as well as viral proteins, such as HIV envelope protein gpl20, and modifications of naturally occuring ligands.
  • Therapeutic genes useful in the invention include the following. 1) Genes that are therapeutic to cancer cells may include a) antisense oncogenes; b) tumor suppressor genes, such as p53 or the retinoblastoma gene product Rb, c) destructive toxin genes such as a diphtheria toxin gene; d) cytokines such as tumor necrosis factor or interferons; or e) any other therapeutic gene. 2) Therapeutic genes targeted to cells that are infected with HIV.
  • antisense DNA complementary to essential genes for HIV e.g., polymerase
  • destructive toxin genes- e.g., diphtheria toxin
  • genes that will invoke intracellular immunity e.g., HIV enhancer sequences that titrate and remove HIV regulatory proteins (Baltimore, D., 1988, Nature 335:395-396) .
  • HIV enhancer sequences that titrate and remove HIV regulatory proteins (Baltimore, D., 1988, Nature 335:395-396) . 3) Genes to correct inherited deficiencies. Examples include, but are not limited to, insulin genes delivered specifically to pancreatic beta cells, or the cystic fibrosis transmembrane regulator (CFTR) gene delivered to the appropriate lung cells of cystic fibrosis patients.
  • the expression of targeted genes can be further accomplished through the use of tissue specific enhancers that regulate the transgene.
  • the appropriate recombinant virus is administered to a patient in a pharmaceutically- acceptable buffer (e.g., physiological saline).
  • a pharmaceutically- acceptable buffer e.g., physiological saline.
  • the therapeutic preparation is administered in accordance with the condition to be treated.
  • the virus is administered by direct injection, e.g., by intravenous, intramuscular, or intraperitoneal injection, at a dosage that provides suitable targeting and lysis of HIV-infected host cells.
  • an appropriate dosage is an amount of therapeutic virus which effects a reduction in the disease.
  • Targeted virus can also be administered by implanting viral packaging cells into a patient.
  • the cells can be enclosed in a semi-permeable container, e.g., permeable to a virus but not permeable to a packaging cell.
  • the implanted container may be removable.
  • the container may be hooked up to a patient intravenously, so that virus enters the patient through a needle or through a catheter. In this way the patient receives a continuous dose of viral gene therapy.
  • replication competent viruses may be used in certain cases.
  • modified packaging cells rather than the targeted virus
  • a non-proliferating dose of recombinant virus is delivered to a local area, and then the virus locates the specific target cell.
  • TIL tumor infiltrating lymphocytes
  • Treatment may be repeated as necessary. Immune response against targeted viruses can be overcome with immunosuppressive drugs.
  • the virus of the invention may be used to target other cancer cells, e.g., ovarian, breast, or lung cancer cells, or cells affected with hereditary diseases such as muscular dystrophy, Huntington's disease, or cells with a defect in adenosine deaminase.
  • Herpesviridae viruses may include Herpes simplex type 1 or type 2, Epstein-Barr virus, or Cytomegalovirus. Sendai virus and Vaccinia virus may also be adapted to this method.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

A general method for delivering genes to specific target cells in vivo is described. Enveloped viruses are genetically engineered to infect specific target cells by replacing the cell surface receptor recognition domain of viral envelope proteins with ligands that direct the binding and fusion of these viruses to specific cell surface molecules.

Description

GENE THERAPY USING TARGETED VIRAL VECTORS Background of the Invention The invention relates to gene therapy methods. Gene therapy is an approach to treating a broad range of diseases by delivering therapeutic genes directly into the human body. Diseases that can potentially be cured by gene therapy include 1) diseases associated with the aging population such as cancer, heart disease, Alzheimer's disease, high blood pressure, atherosclerosis and arthritis; 2) viral infectious diseases such as acquired immune deficiency syndrome (AIDS) and herpes; and 3) inherited diseases such as diabetes, hemophilia, cystic fibrosis, and muscular dystrophy.
Current methods of delivery of new genetic information into cells in vitro include cell fusion, chromosome-mediated insertion, microcell-mediatedT gene transfer, liposome DNA carriers, spheroplast fusion, DNA- mediated gene transfer, microinjection, infection with recombinant RNA viruses, and infection with recombinant DNA viruses (Martin, J.C., 1984, Mol . Cell Biochem . 59;3- 10) . These techniques are not generally applicable, however, for use in animals or humans because of low efficiency, instability of introduced genes, introduction of extraneous or undesirable genetic information, and lack of target specificity.
In one particular example, a favored approach for human gene therapy involves the transplantation of genetically-altered cells into patients (Rosenberg, et al., 1988, New Eng J Medicine 311:570-578). This approach requires the surgical removal of cells from each patient to isolate target cells from nontarget cells. Genes are introduced into these cells via viral vectors or other means, followed by transplantation of the genetically-altered cells back into the patient. Although this approach is useful for purposes such as enzyme replacement therapy (for example, for transplantation into a patient of cells that secrete a hormone that diseased cells can no longer secrete) , transplantation strategies are less likely to be suitable for treating diseases such as cystic fibrosis or cancer, where the diseased cells themselves must be corrected. Other problems commonly encountered with this approach include technical problems, including inefficient transduction of stem cells, low expression of the transgene, and growth of cells in tissue culture which may select for cells that are predisposed to cancer. Finally, inappropriate expression of transplanted genes in nontarget cells may actually be harmful to patients. An alternative approach to gene therapy involves the direct delivery of genes to target tissue in situ. Two methods for in situ delivery of genes have been developed: biolistic transfer and double balloon catheterization. Biolistic transfer of genes involves shooting DNA-coated platinum or gold microprojectiles directly into target tissue. Biolistic transfer has been successful in the transient expression of genes in the ear, skin and surgically-exposed liver of live mice (Johnston, S.A. , 1990, Nature 346:776-777; Williams,
R.S., et al., 1991, Proc Natl Acad Sci USA 81:2726-2730). Double balloon catheterization transduces genes into cells within a defined arterial wall segment. In this approach a double balloon catheter is inserted into an artery until the end of the catheter is located within the target area. Inflation of two balloons at the end of the catheter creates an enclosed space into which retrovirus or DNA-loaded liposomes are infused. This method has been successful in the transient expression of ø-galactosidase genes within a defined segment of the ileofemoral artery of pigs (Nabel E.G., et al., 1990, Science 249:1285-1288) . Both biolistic transfer and double balloon catheterization however, although locally specific, may be nonspecific in the individual cells that they transduce within the target area, creating a problem of inappropriate gene regulation if the transgene is expressed in nontarget cells. Moreover, neither biolistic transfer nor double balloon catheterization have been shown to be effective for the treatment of tissue occupying large volumes such as lungs, muscles, tumors, or cells of the systemic circulation since the majority of the cells would be inaccessible for in situ gene transfer.
A third approach to gene therapy is the delivery of genes to cells in vivo. This approach involves the introduction of viral vectors directly into patients by injection, spray or other means. Different species of viruses are engineered to deliver genes to the cells that the viruses normally infect. Adenovirus, for example, which normally infects lung cells, has been developed as a vector to target genes to lung cells (Rosenfield, et al., 1992, Cell .68.143-155). Most viral vectors, however, are single purpose vectors since they can only deliver genes to certain cells. Because the target cell specificity of viral vectors is restricted to the normal tropisms of the viruses, viral vectors are generally limited in that they either infect too broad a range of cell types, or they db not infect certain types of cells at all. Liposomes have been designed to deliver genes or drugs to specific target cells in vivo. By chemically conjugating antibodies or ligands to liposomes, liposomes have been targeted to specific cells. With this method, antisense env RNA has been delivered to human immunodeficiency virus (HIV)-infected lymphocytes using anti-CD3-conjugated liposomes (Renneisen, K., et al. , 1990, J Biol Chem 265:16337-16342): chloramphenicol transacetylase (CAT) genes have been delivered to H2Kk positive lymphomas in H2Kk-negative nude mice using anti- H2 k-conjugated liposomes (Wang, C. et al., 1987, Proc Natl Acad Sci USA 84.:7851-7855) ; and xanthine guanine phosphoribosyltransferase (XGPRT) genes have been delivered to immunoglobulin-coated cells using staphylococcus protein A-conjugated liposomes (Machy P., et al., 1988, Proc Natl Acad Sci USA 85:8027-8031). The major drawback to this technology can be the expense of mass producing ligand-conjugated liposomes.
Wu et al. report a method to target naked DNA to specific cells. Asialoglycoprotein-DNA complexes are targeted to hepatocytes expressing the asialoglycoprotein receptor (Wu G.Y., et al., 1991, Biotherapy 3.:87-95). Similar to the problem encountered with immunotoxins, however, this strategy generally limits delivery of DNA to cells expressing receptors that are capable of DNA- internalization.
Antisense DNA technology is a method for inhibiting the expression of specific genes with complementary DNA (Moffat, 1991, Science 253:510-511) . Although antisense DNA is specific in the genes that it affects, it is nonspecific in the types of cells that it gets into. This can create problems in vivo because it is desirable that endogenous genes in normal cells remain unaffected by antisense DNA (e.g., protooncogenes) . Moreover, the cost of manufacturing and administering antisense DNA may be high because the phosphate moieties of antisense DNA must be chemically modified to allow passage through the plasma membrane, a process which entails expensive organic chemistry. Millimolar concentrations of antisense DNA are required to be effective, posing problems of potential toxicity in vivo. Human gene therapy is therefore limited by-the available technology for gene delivery. Transplantation strategies, which require surgery, limit gene therapy to an expensive service industry for a small number of diseases. Targeting of genes in situ through local transduction is generally not precise enough. Viral vectors limit the delivery of genes in vivo to cells that the viruses normally infect. Liposome technologies may be infeasible because of the expense of production. Simple ligand-DNA complexes will not introduce genes into cells unless the receptors, against which the ligands are directed, internalize. Accordingly, currently available gene delivery systems impose severe limitations on the spectrum of diseases that can be treated by gene therapy. Summary of the Invention
The invention features a method for expressing a nucleic acid of interest in a heterologous host cell. The method involves providing a virus whose genome comprises i) the nucleic acid of interest, and ii) a hybrid envelope gene. The hybrid gene encodes an envelope fragment joined to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding of its normal host cell but does facilitate efficient incorporation of the virus into a mature viral particle, and whereby the targeting ligand facilitates targeting and binding of the mature viral particle to the surface of the heterologous host cell. The method also involves administering the virus so as to permit viral infection of the cell. By "efficient incorporation", is meant that the hybrid envelope protein is incorporated into a mature viral particle at least 25% as frequently as the corresponding wild-type envelope protein is incorporated into a mature viral particle. In another aspect the invention features a. virus, the genome of which encodes a hybrid envelope protein, wherein the hybrid protein comprises an envelope fragment joined in frame to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding of its normal host cell but which does facilitate efficient incorporation of the hybrid envelope protein into a mature viral particle and whereby the non-viral protein facilitates targeting and binding of the mature viral particle to the surface of a cell not normally infected by the virus.
In a third aspect the invention features a method for% delivering a nucleic acid of interest to a heterologous host cell. The method involves providing a virus that comprises i) the nucleic acid of interest, and ii) a hybrid envelope gene, the hybrid gene encoding an envelope fragment joined to a targeting ligand, whereby the envelope fragment does not facilitate recognition or binding to its normal host cell but does facilitate efficient incorporation of the virus into a mature viral particle, and whereby the targeting ligand facilitates targeting and binding of the mature viral particle to the surface of the heterologous host cell. The method also involves administering the virus so as to permit viral infection of the cell.
In various preferred embodiments the virus is an enveloped virus, preferably a Herpesviridae, a Paramyxoviridae, or a Retroviridae, most preferably a Moloney murine leukemia virus, or the virus may also preferably be a Hepadnaviridae, a Poxviridae, or an
Iridoviridae. Similarly the virus may be a Togaviridae, a Flaviviridae, a Coronaviridae, a Rhabodoviridae, a Filoviridae, an Orthomyxoviridae, a Bunyaviridae, or an Arenaviridae, or any other, yet unclassified, enveloped virus. In other various preferred embodiments the- nucleic acid of interest may include, without limitation, an antisense oncogene; a tumor suppressor gene, e.g., a gene encoding p53, or a gene encoding retinoblastoma protein Rb; a toxin gene, e.g., a diphtheria toxin gene; or a gene encoding a cytokine, e.g., a tumor necrosis factor, or an interferon. The nucleic acid of interest may be either DNA or RNA, e.g., antisense DNA, or antisense RNA, or a nucleic acid encoding an antisense RNA. The nucleic acid of interest may also be a gene invoking intracellular immunity, or a nucleic acid therapeutic for an inherited disease, e.g., an insulin gene, or a cystic fibrosis transmembrane regulator gene. A "gene that invokes intracellular immunity" is a gene that confers a dominant negative resistant phenotype to the cell it is in, thereby protecting the cell against an invading agent.
The heterologous host cell may be a cell that has acquired mutations that result in a disease state, preferably a cancer cell, e.g., a colon cancer cell. The heterologous host cell may be a cell infected with a second virus, e.g., a human immunodeficiency virus (HIV), a cell infected with an organism, or an infectious agent such as a bacterium or parasite. The infectious agent may be either unicellular or multicellular. The heterologous host cell may also be a cell affected by a hereditary disease, e.g., a pancreatic beta cell, or a lung cell.
The targeting ligand, in additional various preferred embodiments, may include a protein, preferably a hormone, or an immunoglobulin, more preferably an anti- tumor associated antigen-specific immunoglobulin, most preferably an anti-carcinoembryonic antigen-specific immunoglobulin, or an anti-HIVgpl20 antigen-specific immunoglobulin. The targeting ligand may also be a carbohydrate, or a lipid. The hybrid envelope fragment may consist of a receptor binding domain, an oligomerization domain, a transmembrane domain, a virus budding domain, sorting signals, a signal sequence, and preferably a fusion domain. In some cases the fusion activity of the envelope fragment may be performed by a second protein. The second protein would therefore direct fusion of the virus with the membrane of the targeted cell. The mode of administration may include, but is not limited to, 1) direct injection of the purified virus; or 2) implanting a container enclosing the virus into a patient. When the virus is administered inside a container, the virus is preferably inside a packaging cell. A "packaging cell" is a cell that supplies viral proteins necessary for production of viral vectors. By "container" is meant a virus permeable enclosure containing virus, or containing packaging cells with virus therein. "Normal host cell" as used herein, is a cell type commonly infected by the naturally occurring virus. In contrast, the term "heterologous host cell" or a "targeted cell", as used herein, refers to a cell that is recognized as a function of the targeting ligand portion of the hybrid envelope protein, but is not recognized as a function of the envelope portion of the hybrid envelope protein. By "targeting ligand" is meant a molecule that has binding affinity for a molecule on the surface of a desired targeted cell. A "hybrid envelope protein", as used herein, is a protein that includes a portion of a viral envelope protein (or a biologically active analog thereof) covalently linked to a targeting ligand. For example, by a "hybrid immunoglobulin-env protein" is meant a portion of an immunoglobulin covalently linked to a portion of an envelope protein. A "hybrid envelope gene" is a nucleic acid that provides genetic instructions for a hybrid envelope protein. By "hybrid anti-careinoe bryonic antigen-specific immunoglobulin" is meant a hybrid immunoglobulin-env protein that specifically binds to a carcinoembryonic antigen.
The term "fragment", as applied to an envelope protein fragment, includes some but not all of the envelope protein. A fragment will ordinarily be at least about about 20 amino acids, typically at least about 30 amino acids, usually at least about 40 contiguous amino acids, preferably at least about 50 amino acids, and most preferably at least about 60 to 80 or more contiguous amino acids in length. Fragments of an envelope protein can be generated by methods known to those skilled in the art (e.g., those described herein).
A biologically active fragment of a viral envelope protein is one that possesses at least one of the following activities: a) it can bind to a cell membrane if given the appropriate targeting ligand; b) it can enable fusion with a cell membrane; or c) it can enable incorporation of proteins into a mature viral particle. These three biological activities can be performed by the same envelope protein fragment, or by two separate envelope protein fragments. As stated above, the envelope fragments of this invention do not facilitate recognition or binding of the virus' normal host cell. This is accomplished by either destroying the activity of the normal receptor binding region by mutation, or by physically deleting it. A new recombinant receptor- binding region is added in its place. The ability of a candidate fragment to exhibit a biological activity of a viral envelope protein can be assessed by methods known to those skilled in the art.
The envelope fragment may include the amino acid sequence of a naturally-ocurring viral envelope or may be a biologically-active analog thereof. The biological activity of an envelope analog is assessed using the methods described herein for testing envelope fragments for activity. Applicants have provided an efficient and reliable means for specifically delivering therapeutic genes or antisense nucleic acids to particular animal, plant or human cell types, or to cells of infectious agents. Their method facilitates treatments for mutagenically acquired, infectious, or inherited diseases, e.g. , by either 1) antagonizing the effect of an existing cellular gene; 2) complementing the defect of an existing cellular gene; 3) destroying the target cells through the introduction of new genetic material; or 4) changing the phenotype of the target cells through the introduction of new genetic material. To specifically target cells for delivery, a hybrid envelope protein (e.g., an envelope- antibody or envelope-ligand hybrid) is utilized which directs specific interaction with a particular target host cell. The viruses itself, through its efficient internalization mechanisms, facilitates efficient uptake of the therapeutic gene. Such viral vectors are uniquely adapted to deliver genes, RNA, or drugs to cell surface proteins that do not normally internalize. Another advantage of this invention is that it overcomes the problem of gene regulation encountered with other methods of gene therapy. Genetically-altered cells must not only synthesize the gene products at the right location, at the right time, and in the right amounts, but must also be regulated in the same manner as the indigenous tissue. That is, the transduced cells must also have all the proper signal transduction mechanisms to respond to extracellular signals. This may be a problem in gene therapy for diabetes, for example, where transplanting fibroblasts with insulin genes can be ineffective or even harmful. As fibroblasts do not contain the same receptors and signal transduction machinery as pancreatic beta cells, the insulin genes may be expressed differently. Targeting genes to the right cells insures that the genes will be properly regulated.
In an additional aspect of the invention, a selection scheme is devised for creation of hybrid envelope protein-containing, viruses. This strategy will be feasible for env proteins fused with immunoglobulins or with any ligand that recognizes specific receptors on cells.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Detailed Description
The drawings will first briefly be described. Drawings
FIG. 1 is a representation of a scheme for constructing retroviral vector pLNCX*. FIG. 2 is a representation of a scheme for constructing plasmid LNCenvpA.
FIG. 3 is a representation of a scheme for constructing plasmid LNCenv.
FIG. 4 is a representation of a scheme for constructing plasmid pUC Star-Sig.
FIG. 5 is a representation of a scheme for constructing plasmid LNC-Sig.
FIG. 6 is a representation of a scheme for constructing plasmid LNC-antiCEA. FIG. 7 is a representation of plasmids used in the construction of targeted viruses.
FIG. 8 is a representation of a strategy for generating targeted retroviruses involving construction of hybrid immunoglobulin-env genes in vitro. FIG. 9 is a representation of a strategy for generating targeted retroviruses involving generation of pooled virus constructions.
FIG. 10 is a representation of a strategy for generating targeted retroviruses involving selection and characterization of targeted virus.
FIG. 11 is a representation of a plasmid containing a targeted retroviral vector.
FIG. 12 is a representation of a scheme for constructing plasmid pUC Star-antiCEA.
FIG. 13 is a representation of an alternative scheme for constructing plasmid LNC-antiCEA.
What follows is a procedure for the delivery of genes to target cells using targeted viral vectors. To create and target a virus, the receptor recognition domain of the viral envelope protein is replaced with a ligand directed against a specific cell surface receptor. The hybrid envelope protein is incorporated into the viral envelope during the budding process, producing a hybrid virus in vivo, upon infection of a host, the hybrid virus specifically recognizes its target cell and resultant fusion with that cell facilitates internalization (into the target cell) of viral genes, including the therapeutic gene(s) which are engineered into the viral genome. Such internalization can be extremely important; for example, immunotoxins, although efficient at delivering toxin molecules to target cells, are often clinically ineffective since the cell surface molecules to which they are targeted do not internalize, and internalization is required for entry of the toxin molecules into the cells (Waldmann, T.A. , 1991, Science 252: 1657-1662) . Targeted viruses circumvent this requirement for receptor internalization since the virus itself contains the necessary cell fusion machinery (Gilbert, J.M. , et al., 1990, J Virol 64: 5106-5113; Roizman, B. et al., 1990, in BN Fields, et al., eds. Virology. Raven Press, Ltd. New York) .
General Requirements for Targeted Viruses In general targeted viruses are constructed by replacing the receptor recognition domain of the viral envelope protein with a ligand directed against a specific cell surface receptor. The ligand can be, without limitation, an immunoglobulin (e.g., FAb, dAb, Fd, or Fc) , a hormone, or any other synthetic or natural protein that can direct the binding of the targeted viruses to a cell surface molecule. The ligand is biologically incorporated into the viral envelope by genetic fusion with that portion of the normal viral envelope protein involved in viral assembly and budding. The envelope portion of the hybrid protein consists of an envelope fragment (or analog thereof) that is sufficient to direct efficient incorporation of the envelope hybrid protein into the viral envelope. Preferably, the envelope hybrid protein no longer directs an interaction between the virus and its normal host cell.
It has been demonstrated that changing the receptor specificity of the envelope protein of a virus changes the virus's tropism. For example, vesicular stomatitis virus (VSV) pseudotypes that have their virus envelope replaced with that of a retrovirus acquire the ability to infect retrovirus infectable cells (Schnitzer, T.J., et al., 1977, J Gen Virol .23:449-454; Zavada. J., et al., 1972, J Gen Virol 15:183-191), indicating that species specific protein-protein interactions between a virus core protein and an envelope protein are not critical for virus fusion and penetration at least in these cases. Moreover, previous experiments have also indicated that virus envelopes can tolerate changes in length or conformation introduced into the envelope protein, e.g., by a conjugated ligand. For example. Gitman et al . have shown that Sendai virus envelopes reconstituted with viral envelope glycoproteins, chemically cross-linked to anti-erythrocyte antibodies acquire the ability to bind to erythrocytes that had been stripped of the normal virus receptor. Similarly, Sendai virus envelopes reconstituted with envelope proteins, chemically cross-linked to insulin molecules, were able to bind to receptor-stripped erythrocytes expressing the insulin receptor. In both cases, envelope binding but not fusion occurred with the receptor-stripped erythrocytes. Fusion between the conjugated envelopes and erythrocytes occurred, however, when the conjugated- envelopes were coreconstituted with the normal viral hemagglutinin/neuraminidase and fusion proteins (Gitman, A.G. , et al., 1985, Biochem 24:2762-2768).
Preferably, the targeted virus contains 1) a viral envelope derived from a host cellular membrane; 2) a transmembrane hybrid envelope protein that directs the binding and penetration of the virus to specific target cells; 3) a transmembrane envelope protein that directs the fusion of the targeted virus with the cellular membrane of the targeted cell for viral penetration (e.g., the targeting protein itself or another envelope protein) ; 4) viral core proteins; 5) a foreign gene(s) of interest; and 6) all necessary viral and genetic components for penetration and expression of genes contained in the viral genome. The transmembrane hybrid' envelope protein consists of 1) determinants that enable the hybrid protein to become processed and incorporated into viral envelopes; 2) determinants that enable fusion of the viral envelope with the targeted cellular membrane; these are essential for penetration of the targeted virus; 3) a ligand determinant that enables the targeted virus to recognize and bind to specific receptors on target cells. The viral genome may also include bacterial selectable markers (e.g., ampicillin resistance) and/or a mammalian cell selectable marker (e.g., neomycin resistance).
The transmembrane hybrid protein is constructed genetically by splicing the cell surface receptor binding domain of a ligand gene to a portion of the viral envelope protein gene. The transmembrane hybrid protein must retain those portions of the envelope protein that direct the efficient post-translational processing, sorting and incorporation of the protein into the viral envelope.
The following domains must be considered in constructing the hybrid ligand-envelope protein:
1. The receptor binding domain The receptor binding domain is that portion of the envelope protein that recognizes and binds to cell surface receptors. In hybrid envelope proteins, this portion of the envelope protein is replaced with ligand sequences. The receptor binding domain of retrovirus envelope proteins has been localized to the SU subunit (Coffin, J.M. , 1990, in BN Fields, et al., eds. Virology r Raven Press, Ltd., New York). Since the SU protein of retroviruses is coded for 5' to the transmembrane protein, replacement of the amino-terminal sequences of the envelope protein with ligand sequences poses no problem for the creation of a functional hybrid ligand- envelope protein.
2. Proteolvtic cleavage site
The envelope protein of retroviruses is synthesized as a polyprotein which is later proteolytically cleaved to form SU and TM heterodimers. In construction of the hybrid ligand-envelope protein, the proteolytic cleavage site should be eliminated. The proteolytic cleavage site should be eliminated either by deletion or by site directed mutagenesis. Perez and Hunter have demonstrated that elimination of the . proteolytic cleavage site does not block transport or surface expression of Rous sarcoma virus envelope proteins (Perez, L.G., et al. , 1987, J Virol 61:1609- 1614) .
3. Oligomerization domain
The envelope proteins of many animal viruses associate to form trimers (Fields, B.N., et al., 1991, Virology, 2nd ed., Raven Press, Ltd., New York). Trimerization of the envelope protein is thought to be essential for the proper transport and insertion of envelope proteins into the viral envelope (Singh, J. et al., 1990, Embo J 9.:631-639; Kreis, T.E., et al., 1986, Cell 46.:929-937) . Therefore it is important that this domain be retained in the hybrid ligand-envelope protein. The trimerization domain likely resides in the transmembrane TM protein of retroviruses (Einfeld, D. , et al., 1988, Proc Natl Acad Sci USA 85.:8688-8692) ; hence, creation of a functional hybrid ligand-envelope retroviral protein lacking the SU subunit is possible. Some viral envelope proteins may oligomerize to form stoichiometric combinations other than trimers.
4. Fusion domain
The fusion domain is a hydrophobic stretch of amino acids that is involved in fusion of the virus envelope with the cell membrane (Wiley, D.C., et al., 1990, in Fields, B.N. et al., eds. Virology r 2nd ed. , Raven Press, Ltd., New York). Viral fusion allows entry of the viral core proteins and genome into the cell. In influenza virus, the fusion domain, located in the amino terminus of the envelope HA2 protein, is sequestered in the hemagglutinin trimer until a low pH-induced conformational change allows presentation of the fusion domain to the cell membrane. Trimerization of the envelope proteins can prevent constitutive expression of fusion activity by sequestering it within an internal hydrophobic pocket. A potential fusion domain has been located within the extracellular portion of the gp37 TM protein of Rous sarcoma virus (Hunter E. et al., 1983, J Virol __ y.920-936) . Similar hydrophobic fusion sequences have been noted in the pl5E protein of Moloney murine leukemia virus (Mo-MuLV) (Chambers, P., et al.,1990, J Gen Virol 71:3075-3080).
In constructing a hybrid ligand-envelope protein, it may be necessary to eliminate the fusion domain to prevent the possibility of constitutive fusion activity, a state that may impair the infectivity of targeted viruses. Therefore two proteins may be incorporated into the viral envelope of targeting viruses. The first protein is the hybrid ligand-envelope protein which directs targeting of the virus but lacks fusion activity. The second protein is an envelope protein possessing fusion activity but lacking a receptor binding domain. This type of situation is observed for paramyxoviruses where one envelope protein is dedicated to targeting while another carries out fusion (Kingsbury, D.W. , 1990, B.N. Fields, et al., eds. Virology, 2nd ed. , Raven Press, Ltd., New York.). Where it is not necessary to prevent constitutive fusion activity, both activities may be included in one protein. 5. Transmembrane domain
The transmembrane domain is a stretch of approximately twenty or more amino acids that anchor the envelope protein to the viral envelope. It is located within the pl5E protein of Moloney murine leukemia virus (Chambers, et al., supra) . Retention of the transmembrane domain is thought to be essential since deletion of the transmembrane domain results in secretion of the synthesized envelope protein (Perez, L.G., et al., 1987, J Virol 11:2981-2988). 6. Virus budding domain
Amino acid sequences within the envelope protein may be involved with the exclusive incorporation of viral envelope proteins into viral envelopes and with virus budding. The virus budding domain directs the hybrid ligand-envelope protein into the viral envelope. These sequences are thought to reside within the portion of the envelope protein facing the inside of the virus and may involve specific protein-protein interactions between envelope proteins and viral core or matrix proteins.
Although Perez et al . demonstrated that deletion of the carboxy-terminal sequences of the Rous sarcoma virus env protein resulted in normal budding of the mutant virus (Perez, L.G., et al., 1987, J Virol jSl:2981-2988) , evidence exists that, for other viruses, interactions between envelope proteins and viral core proteins may direct virus assembly and envelopment (BN Fields, et al., eds., 1990, Virology. Raven Press, Ltd., New York).
7. Sorting signals and other signals Sorting signals are determinants that direct the envelope protein to the correct intracellular location during post-translational processing. These sequences insure that the envelope protein passes through the endoplasmic reticulum, Golgi apparatus, and other σrganelles until it eventually reaches the viral envelope. Other signals that may have to be retained in the hybrid ligand-envelope protein are glycosylation sequences and sequences involved in effective conformation of the envelope protein (e.g., disulfide bonds) .
8. Signal sequence
The signal sequence is an amino-terminal hydrophobic stretch of amino acids that directs the envelope protein into the endoplasmic reticulum. The signal sequence, which is later proteolytically cleaved. is essential for the hybrid ligand-envelope protein to become located in a membrane.
The diversity of signals and domains that must be considered in constructing targeted viruses requires that precise and correct splicing of ligand and envelope genes occur. The present invention describes a selection scheme for constructing targeted viruses whereby the ligand gene is spliced to an envelope gene fragment; this hybrid gene codes for those portions of the envelope protein which are required to direct efficient incorporation of the resultant hybrid envelope-ligand protein into the mature viral particle. According to the selection scheme, cell surface receptor binding domains of ligand genes are randomly ligated to progressive deletions of viral envelope genes. The correct combination of ligand and envelope sequences is determined by a selection scheme for the production of biologically active targeted virus. The selection scheme not only produces targeted virus but simplifies the construction of future targeted viruses.
A Specific Example of a Targeted Retrovirus There now follows an example of a recombinant retrovirus which targets and infects particular host cells for the purpose of delivering to those cells a desired therapeutic gene. This example is provided for the purpose of illustrating, not limiting, the invention. Moloney murine leukemia virus (Mo-MuLV) is a mouse ecotropic retrovirus. A recombinant Mo-MuLV based retroviral vector that is targeted to colon cancer cells is constructed. The targeted retroviral vector delivers the neomycin resistance gene to colon cancer cells. Targeting to human colon cancer cells is accomplished by incorporating into the viral envelope hybrid immunoglobulin-env proteins directed against carcinoembryonic antigen. Carcinoembryonic antigen (CEA) is a tumor associated antigen expressed on the surface of human colon cancer cells but not on the surface of normal adult cells. The CEA glycoprotein, possessing multiple membrane spanning alpha helices, does not internalize in response to ligand (Benchimol, S. et al., 1989, Cell 57:327-334). A protein that is homologous to carcinoembryonic antigen has recently been shown to be the receptor for mouse hepatitis virus (Dveksler, G.S., et al, 1991, J Virol 65.:6881-6891) . For the purpose of this illustration, a single variable region of the heavy chain of anti-CEA is fused to a portion of the env gene. Single variable heavy chain fragments (dAb) have been shown to be as effective in antigen binding as fragmented antibodies (FAb) , containing both heavy and light chain fragments, and intact monoclonal antibodies (Ward, E.S., et al.. Nature 341:544-546) . The function of immunoglobulin-env proteins is not limited, however, to the use of dAb's and can be applied with FAb's, Fv's and mAb's. Modification of the retroviral vector LNCX
LNCX is a Moloney murine leukemia virus based retroviral vector contained in the plasmid pLNCX (Miller, A.D., et al., 1989, Biotechniques 2:980-990). pLNCX contains a unique Hindlll and Clal cloning site for expression of inserted genes, a cytomegalovirus (CMV) promoter, a polyadenylation site (pA) , retroviral long terminal repeats (LTR) for retroviral RNA transcription and reverse transcription, a bacterial neomycin resistance gene (Neo) which conveys resistance to both neomycin and G418, a bacterial origin of replication
(Or) , a bacterial ampicillin resistance gene (Amp) , and a retroviral RNA packaging sequence (ψ+) . LNCX is modified to contain a unique Sail site as shown in Figure 1. pLNCX is linearized with Xbal and subcloned into the Xbal site of the phagemid Bluescriptll SK+ (Stratagene, La Jolla, CA) . Single stranded DNA is purified and the unique BstEII site of LNCX is converted into a Sail site by site directed mutagenesis with the oligonucleotide 5'-GCAGAAGGTCGACCCAACG-3' (SEQ ID NO: 1). The BstEII site is located within the extended packaging signal (¥+) of Mo-MuLV RNA (Bender, M.A. , et al., 1987, J Virol 61:1639-1646; Adam, M.A., et al., 1988, J Virol 62:3802- 3806; Armentano, D. et al., 1987, J Virol 61:1647-1650) . Conversion of the BstEII site to Sail does not affect packaging since this region has been determined to be dispensable for efficient packaging (Schwartzberg. P., et al., 1983, J Virol 46:538-546; Mann R. et al., 1985, J Virol 54.:401-407; and Mann, R., et al., 1983, Cell 3_3:153-159) . The BstEII site is converted into a Sail site because BstEII sites, but not Sail sites, frequently occur in heavy chain genes (Chaudhary, V.K. , et al, 1990, Proc Natl Acad Sci USA 82:1066-1070). The Sail containing plasmid is recircularized with Xbal and DNA ligase to form the plasmid pLNCX*. Cloning of the Mo-MuLV env protein in pLNCX*
The Mo-MuLV env gene is cloned into pLNCX*. as shown in Figure 2. The Mo-MuLV env gene is excised from plasmid p8.2 (Shoemaker, C. , et al., 1980, Proc Natl Acad Sci USA 22:3932-3936) as a 1.9kb Scal-Nhel fragment. The 1.9kb Scal-Nhel fragment contains the entire coding region for the pl5E transmembrane protein and the majority of the coding region for the gp70 SU protein. The 5'-protruding ends are digested with Sl-nuclease, and Hindlll linkers (5-CCAAGCTTGG-3'; SEQ ID NO: 2) are added. The env gene is cloned as a Hindlll fragment in the Hindlll site of pLNCX* to form plasmid LNCenvpA. The orientation of the Hindlll env fragment is such that it can be transcribed and expressed from the cytomegalovirus (CMV) promoter. Modification of LNCenvpA to LNCenv
LNCenvpA is cloned as an Xbal fragment in phagemid pBluescript II SK+ for additional site directed mutagenesis (Figure 3) . The env encoding Hindlll fragment contains a polyadenylation signal that may interfere with the polyadenylation signal provided by the viral vector. The AAUAAA polyadenylation signal is therefore changed to AAGAAA by site directed mutagenesis with the oligonucleotide 5'-GTTTTCTTTTATC-3' (SEQ ID NO: 3) . The Hindlll site located at the 3' end of the env gene is eliminated by site directed mutagenesis with the oligonucleotide 5-CAAGCATGGCTTGCC-3' (SEQ ID NO: 4). The env containing retroviral vector is reσircularized by Xbal restriction and ligation to form plasmid LNCenv. Molecular cloning of anti-CEA immunoglobulin genes cDNA encoding the mature variable region domain of anti-CEA heavy chain genes is cloned as an Xhol-Spel fragment using the polymerase chain reaction (PCR) and RNA template. RNA is derived from the spleen of mice immunized against purified carcinoembryonic antigen. Alternatively, RNA can be derived from hybridoma cell lines that secrete monoclonal antibodies against CEA, e.g., 1116NS-3d (American Type Culture Collection CRL8019) or CEA 66-E3 (Wagener, C, et al., 1983, J Immunol 130:2308-2315) .
The following PCR primers hybridize to cDNA encoding the aminoterminal end of mature heavy chain genes (Stratacyte, Inc.). The degenerate primers introduce an Xhol site which is underlined. 5' AGGTGCAGCTGCTCGAGTCGGG 3' (SEQ ID NO: 5)
5' AGGTGCAACTGCTCGAGTCGGG 3' (SEQ ID NO: 6)
5' AGGTGCAGCTGCTCGAGTCTGG 3' (SEQ ID NO: 7)
5' AGGTGCAACTGCTCGAGTCTGG 3' (SEQ ID NO: 8) 5' AGGTCCAGCTGCTCGAGTCTGG 3' (SEQ ID NO: 9)
Xhol
The following PCR primer hybridizes to immunoglobulin heavy chain mRNA within the region coding for the J-region and introduces Spel and BstEII sites. 5' CTATTAACTAGTGACGGTTACCGTGGTCCCTTGGCCCCA 3' (SEQ
ID NO: 10)
Spel BstEII The amplified anti-CEA variable heavy chain DNA is cloned as an Xhol-Spel fragment in an ImmunoZAP H vector (Stratacyte, Inc.) (Mullinax, R.I. et al., 1990, Proc Natl Acad Sci USA 82:8095-8099). ImmunoZAP H is a modified lambdaZAP vector that has been modified to express in E.coli immunoglobulin variable heavy chain fragments behind a pelB signal sequence. The procedure could similarly be performed by expressing immunoglobulin variable light chain fragments in a packaging cell line. Identification of high affinity anti-CEA clones Clones expressing high affinity anti-CEA antibodies are identified by a filter binding assay. The anti-CEA phage library is screened by nitrocellulose plaque lifts with [125I]bovine serum albumin conjugated to CEA, as previously described (Huse, W.D., et al., 1989, Science 146:1275-1281). High and intermediate affinity anti-CEA clones are chosen for further manipulation. Construction of plasmid LNC-itnmunoσloj ulin
Two strategies are presented for creating plasmid LNC-itnrøunogrloJbuIin (in this example, LNC-antiCEA, which codes for an anti-CEA immunoglobulin gene) . LNC- immunoglobulin vectors encode an immunoglobulin peptide fused to an amino-terminal signal sequence. Some-amino acids at the amino-terminal end of the mature immunoglobulin peptide have been modified by the PCR primers used to generate the immunoZAP library. Moreover, the design of the LNC-antiCEA plasmid results in the insertion of an extra amino acid at the amino terminal end. These amino acid changes do not affect antigen binding because 1) the amino acid changes are conservative; 2) the affected amino acids are normally variable at those sites; and 3) the affected amino acids occur within the framework region of immunoglobulins which has been shown not to participate in antigen binding or conformation of the antibody (Relchman et al. 1988 Nature 332:323-327) . It is for these same reasons that cleavage of the signal sequence from mature peptide will not be affected.
Both strategies for creating TJSC- immunoglobulin rely on the use of plasmid pUC Star-Sig, the construction of which is presented below. An immunoglobulin signal sequence is cloned into a modified pUC119 vector to create pUC Star-Sig as follows (Figure 4) . pUC119 is a phagemid containing a polylinker cloning site. The multiple cloning sites of pUC119 are replaced with new restriction sites by insertion of the following polylinker into the Hindlll and Xbal sites of pUC119.
Hindlll PstI Xhol Bell Spel NotI Clal Xbal
5 ' -AGCTTCTGCAGGCTCGAGTGATCAACTAGTGCGGCCGCATCGATT-3 ' ( SEQ ID NO: 11) 3 ' -AGACGTCCGAGCTCACTAGTTGATCACGCCGGCGTAGCTAAGATC-5 ' ( SEQ ID NO: 12)
The modified pUC119 is called pUC Star-1 (Figure 4) . The restriction sites may be further separated by small linkers, if adjacent restriction sites interfere with one another during digestion.
The signal sequence from an anti-NP immunoglobulin heavy chain gene is isolated from plasmid pcDFL.l (Ucker, D.S., et al., 1985, J Immnol JL35:4204-4214) as a ~330bp PstI fragment. The 330bp PstI fragment is subcloned into pUC Star-1 to yield plasmid pUC Star-Sig (Figure 4). The PstI fragment is oriented so that the signal sequence can be expressed. A. Construction of LNC-iiMnunoσlojbulin through plasmid LNC-Sicrf an immunoglobulin expression vector.
LNCX* is converted into a eukaryotic immunoglobulin expression vector (Figures 4 and 5) . An immunoglobulin heavy chain signal sequence and Xhol-Spel cloning sites are inserted behind the CMV promoter of plasmid LNCX* to allow expression of the PCR amplified immunoglobulin genes. Conversion of LNCX* is as follows. The immunoglobulin heavy chain signal sequence is recovered from pUC Star-Sig as a Hindlll-Clal restriction fragment and cloned into the Hindlll-Clal sites of LNCX*. The resulting plasmid, LNC-Sigr contains a retroviral vector with the immunoglobulin heavy chain signal sequence under control of the CMV promoter (Figure 5) . An anti-CEA gene from the immunoZAP library is then subcloned into LNC-Sig to form plasmid LNCanti-CEA. This generates an anti-CEA variable heavy chain gene containing a signal sequence (Figure 6). The anti-CEA gene is first excised from immunoZAP phage DNA as a Bluescript SK- phagemid (see lambdaZAP protocols, Stratagene, Inc. La Jolla, CA) . The anti-CEA gene is purified as an Xhol-Spel fragment and ligated to Xhol- Spel restricted LNC-Sig. LNC-Sig contains three Spel sites. Therefore, to generate plasmid LNCanti-CEA, the ligation mix is transformed into neomycin-sensitive, ampicillin-sensitive E__ coli and neomycin-resistant, ampicillin-resistant transformants are selected for. Plasmid LNCanti-CEA is screened from neomycin-resistant, ampicillin-resistant transformants by using the Spel-Xhol anti-CEA restriction fragment from Bluescript SK-anti-CEA as a probe. The Spel site is used because of dependence upon the available sites in the ImmunoZap expression vector. To simplify construction of LNCanti-CEA, a unique NotI site can be introduced into the ImmunoZap H expression vector so that NotI sites can be used instead of Spel sites.
B. Construction of LNC-immunoσloJulin through plasmid pUC Star-Siσ
An anti-CEA gene from the immunoZAP library is subcloned into plasmid pUC Star-Sig to form plasmid pUC Star-anti-CEA. This generates an anti-CEA variable heavy chain gene containing a signal sequence (Figure 12) . . The anti-CEA gene is excised from immunoZAP phage DNA as a Bluescript SK-phagemid (see lambdaZAP protocols, Stratagene, Inc., La Jolla, CA) . Bluescript SK-anti-CEA double stranded DNA is prepared and restricted with Xhol and Spel. The anti-CEA containing Xhol-Spel fragment is purified by electroelution and ligated to Xho-Spel restricted pUC Star-Sig to create plasmid pUC Star- antiCEA (Figure 12) . The antiCEA gene is transferred from pUC Star-anti CEA to LNCX* as a Hindlll-Clal fragment to create plasmid LNC-antiCEA (figure 13) . The antiCEA-containing Hindlll- Clal fragment is purified from pUC Star-antiCEA by electroelution. Phosphatase treated, Hindlll-Clal restricted LNCX* is ligated with the purified Hindlll- Clal antiCEA fragment to generate LNC-antiCEA (figure 13) .
Strategy for generating targeted viruses The starting materials for generation of targeted viruses are the LNCenv and LNC-immunoglobulin (in this example, LNC-antiCEA) plasmids shown in Figure 7. • Figures 8-11 diagram the general principle for the primary generation of targeted viruses. Hybrid immunoglobulin-env proteins are generated that target viruses to cells expressing carcinoembryonic antigen. Since the location of important determinants for envelope protein sorting (S) , trimerization (T) , and fusion (F) is not known with certainty, the immunoglobulin gene is ligated to progressive deletions of the env gene and functional immunoglobulin-env hybrids are selected for. Useful Envelope Fragments or Analogs
The envelope portion of the fusion protein may consist of any portion of the envelope protein (or any analog thereof) which is sufficient to direct efficient incorporation of the envelope fusion protein into the viral coat (upon budding of the recombinant virus from a producer cell line) . Such fragments or analogs may be determined using the following general selection scheme which generally involves ligation of cell surface receptor binding domains of ligand genes to progessive deletions of viral envelope genes. The correct combination of ligand and envelope sequences is determined by a selection scheme for the production of biologically active targeted virus. The selection scheme not only produces targeted virus but simplifies the construction of future targeted viruses. Construction of hybrid immunoglobulin-env genes in vitro Plasmid LNCenv contains the coding region for the Mo-MuLV env polyprotein (Figure 8) . LNCenv is first linearized by Hindlll restriction. A range of deletions extending into the env gene is created by collecting aliquots of Exonuclease III treated DNA over time and removing 5'-processive ends with Sl-nuclease (Guo, I.H., et al., 1983, Methods Enzymol 100:60; and Sambrook, J. , et al., 1989, Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor) . NotI linkers (5' AGCGGCCGCT 3' SEQ ID NO: 13) are ligated onto the blunt end termini and restricted with NotI. This results in a NotI restriction overhang at the 5'-border of every deletion within the env gene. The NotI overhangs at the other end of the molecules are removed by Sail restriction of the reaction mixture. The reaction mixture is then treated with phosphatase to prevent circularization of the reaction products. The reaction mixture is ligated to a Sall-NotI restriction fragment from LNC-antiCEA that contains the anti-CEA variable heavy chain gene. This creates a pool of functional retroviral vectors encoding an anti-CEA peptide fused to a series of env deletions. Generation of pooled virus constructions
The total reaction mixture from above is transformed into ampicillin-sensitive E. coli and ampicillin resistance is selected for (Figure 9) . Reσombinants containing functional retroviral vectors are selected for since only they contain the ampicillin resistance gene. Plasmid DNA is prepared from transformants grown in liquid culture to create a pool of retroviral vectors containing different immunoglobulin- env fusion genes. The DNA is transfected into the crip2 retroviral packaging cell line (Danos, 0., et al., 1988, Proc Natl Acad Sci USA 85: 6460-6464) . Alternatively, DNA is transfected into a packaging cell line that does not encode wild-type env protein. The transfected packaging cell line synthesizes each of the different hybrid immunoglobulin-env proteins as well as the wild type env protein (encoded by an env gene contained in the cell line) . The transfected packaging cell line secretes a pool of enveloped retroviruses containing the different retroviral genomes encoding hybrid immunoglobulin-env genes. If the hybrid immunoglobulin-env protein retained all of the necessary determinants for efficient incorporation into viral envelopes then the hybrid-env protein can be incorporated into viral envelopes. Wild type env proteins encoded for by the packaging cell line are also incorporated into the viral envelopes. This creates a virus containing both wild type and hybrid env proteins in the viral envelope. This system therefore selects for immunoglobulin-env hybrids that can incorporate their gene products into the viral envelope. Virus pools are harvested from media filtered at 0.45μ to remove contaminating G418-resistant packaging cells. Selection and characterization of targeted virus G418-sensitive target cells are exposed to virus pools by standard procedures, and G418-resistant cells are selected for. The target cells can be any non-mouse cell line (uninfeσtable by wild type Mo-MuLV) that expresses carcinoembryonic antigen. Examples include ATCC COLO 205, a human cell line isolated from the ascites of a patient with carcinoma of the colon (A.T.C.C.#CCL 222); LR-73 CEA, a Chinese hamster ovary cell line transfected with a mouse carcinoembryonic antigen gene (Benchimol, S. et al., supra) ; and HCT48, a human colon adenocarcinoma cell line (Shi, Z.R., et al., 1883, Cancer Res 11:4045-4049).
G418-resistant cells can only have arisen from transduction of the neomycin resistance gene by targeted virus. This system therefore selects for recombinant viruses that have hybrid immunoglobulin-env proteins that have retained all the necessary determinants for viral targeting and fusion. Rescue of integrated immunoglobulin-env gene
Infection by targeted virus results in integration of the hybrid envelope gene that created the targeting protein. The integrated hybrid immunoglobulin-env-gene is rescued from the host DNA by polymerase chain reaction (PCR) with the following primers:
PCR 5' Rescue primer: 5 '-CCAGCCTCCGCGGCCCCAAGCTTCTGCA-3' (SEQ ID NO: 14)
Hindlll PCR 3' Rescue primer:
5'-GGTTCTCTAGAAACTGCTGAGGGC-3' (SEQ ID NO: 15) Xbal
PCR amplification with these primers generates the immnoglobulin-env gene bordered by Hindlll and Xbal sites. The amplified DNA is restricted with Hindlll and Xbal to create sticky ends and the DNA is ligated into Hindlll-Xbal cut LNCX*. When transfected into crip2 packaging cells, this generates a retroviral vector targeted to cells expressing cell surface carcinoembryonic antigen (e.g., colon cancer cells).
The retroviral vector produced in the above selection scheme is targeted to both CEA-expressing human cells (directed by the hybrid envelope protein) and normal mouse cells (directed by the wild type envelope protein) when produced in crip2 packaging cells. To create viruses that infect target cells only, the retroviral vector will irst be tested to determine if incorporation of the hybrid envelope protein alone is sufficient to direct virus fusion. This is accomplished by transfecting DNA into a modified packaging cell line that does not encode wild type env.
If fusion functions are found to have been supplied from the wild type envelope protein, targeted viruses will be created as follows. A packaging cell line will be created that encodes an env gene containing mutations in the receptor binding domain. When transfected with the targeted viral vector DNA, targeted viruses expressing both hybrid ligand-env proteins and env proteins with mutated binding sites will be produced. The viruses will exclusively infect target cells. The targeted viral vector is a universal vector
The viral vector that is constructed by the above procedure is a universal targeted vector (Figure 11) . Targeting to other cells is accomplished by replacing the Xhol-Spel anti-CEA fragment with any Xhol-Spel fragment encoding an in-frame immunoglobulin or ligand directed against specific cell surface proteins. For example, an Xhol-Spel immunoglobulin-containing fragment from an immunoZAP library can be fused in frame behind a signal sequence and subcloned into LNCX* through the pUC Star- Sig plasmid, as outlined above. Substituting a Sall-NotI fragment from another LNC-immunoglobulin plasmid into the universal vector would create another targeted virus vector. Other Viral Vectors Any enveloped virus may be used as a vector for the targeted delivery of a therapeutic gene. Particular examples include both DNA and RNA viruses, such as Herpesviridae, e.g., herpes simplex type 1 or 2, Paramyxoviridae, Retroviridae, Hepadnaviridae, Poxviridae, Iridoviridae, Togaviridae, Flaviviridae, Coronaviridae, Rhabodoviridae, Filoviridae, Orthomyxoviridae, Bunyaviridae, or Arenaviridae, or any other, yet unclassified, enveloped virus.
An extensive selection of these viruses is available, e.g. , from the American Type Culture Collection. Targeting Ligands
Any molecule that is capable of directing specific interaction with a target host cell (e.g., by specific recognition of and binding to a host cell surface protein) may be used as the targeting ligand portion of the envelope fusion protein. Preferably, such a protein is derived from one member of a ligand:receptor pair. The targeting ligands are not limited to proteins. Carbohydrate and lipid moieties can be attached to the envelope protein via protein fragments containing consensus sequences for glycosylation and lipidation.
Immunoglobulin genes can be used as ligands, as shown in the example above. Genes for high affinity immunoglobulins are screened from a lambda or bacterial expression library by a filter binding assay with [125I] bovive serum albumin conjugated to antigen, as previously described (Huse, et al. Supra) .
Cell surface molecules such as integrins, adhesion molecules or homing receptors can be used as cell- specific ligands since they are involved in cell-cell interactions via receptors on other cells. Genes encoding these molecules can be identified by the panning method of Seed and Aruffo (Seed. B., et al., 1987, Proc Natl Acad Sci USA 84:3365-3369) .
Hormones that bind to specific receptors can be used as targeting ligands as well as viral proteins, such as HIV envelope protein gpl20, and modifications of naturally occuring ligands. Therapeutic Genes
Therapeutic genes useful in the invention include the following. 1) Genes that are therapeutic to cancer cells may include a) antisense oncogenes; b) tumor suppressor genes, such as p53 or the retinoblastoma gene product Rb, c) destructive toxin genes such as a diphtheria toxin gene; d) cytokines such as tumor necrosis factor or interferons; or e) any other therapeutic gene. 2) Therapeutic genes targeted to cells that are infected with HIV. Specific examples include antisense DNA complementary to essential genes for HIV, e.g., polymerase; destructive toxin genes-, e.g., diphtheria toxin; and genes that will invoke intracellular immunity, e.g., HIV enhancer sequences that titrate and remove HIV regulatory proteins (Baltimore, D., 1988, Nature 335:395-396) . 3) Genes to correct inherited deficiencies. Examples include, but are not limited to, insulin genes delivered specifically to pancreatic beta cells, or the cystic fibrosis transmembrane regulator (CFTR) gene delivered to the appropriate lung cells of cystic fibrosis patients. The expression of targeted genes can be further accomplished through the use of tissue specific enhancers that regulate the transgene. Therapy For any gene therapy described herein, the appropriate recombinant virus, as described above, is administered to a patient in a pharmaceutically- acceptable buffer (e.g., physiological saline). The therapeutic preparation is administered in accordance with the condition to be treated. For example, to treat an HIV-infected individual, the virus is administered by direct injection, e.g., by intravenous, intramuscular, or intraperitoneal injection, at a dosage that provides suitable targeting and lysis of HIV-infected host cells. Alternatively, it may be necessary to administer the targeted virus surgically to the appropriate target tissue, or via a catheter, or a videoscope. It may be convenient to administer the therapeutic orally, nasally, or topically, e.g., as a liquid or spray. Again, an appropriate dosage is an amount of therapeutic virus which effects a reduction in the disease.
Targeted virus can also be administered by implanting viral packaging cells into a patient. The cells can be enclosed in a semi-permeable container, e.g., permeable to a virus but not permeable to a packaging cell. The implanted container may be removable. Alternatively, the container may be hooked up to a patient intravenously, so that virus enters the patient through a needle or through a catheter. In this way the patient receives a continuous dose of viral gene therapy.
Other Embodiments Other embodiments are within the following claims. For example, replication competent viruses may be used in certain cases. In other cases, where replication-deficient viruses are necessary, it may be efficacious to administer modified packaging cells, rather than the targeted virus, to patients. By this method a non-proliferating dose of recombinant virus is delivered to a local area, and then the virus locates the specific target cell. For example, tumor infiltrating lymphocytes (TIL) , which surround cancer cells, can be modified to secrete locally high concentrations of cancer cell-targeted virus. Treatment may be repeated as necessary. Immune response against targeted viruses can be overcome with immunosuppressive drugs.
In addition to colon cancer cells, the virus of the invention may be used to target other cancer cells, e.g., ovarian, breast, or lung cancer cells, or cells affected with hereditary diseases such as muscular dystrophy, Huntington's disease, or cells with a defect in adenosine deaminase. Herpesviridae viruses may include Herpes simplex type 1 or type 2, Epstein-Barr virus, or Cytomegalovirus. Sendai virus and Vaccinia virus may also be adapted to this method. SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Alexander T. Young
(ii) TITLE OF INVENTION: GENE THERAPY USING
TARGETED VIRAL VECTORS
(iii) NUMBER OF SEQUENCES: 15
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fish & Richardson
(B) STREET: 225 Franklin Street
(C) CITY: Boston
(D) STATE: Massachusetts
(E) COUNTRY: U.S.A.
(F) ZIP: 02110-2804
(V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5" Diskette, 1.44 Mb (B) COMPUTER: IBM PS/2 Model 50Z or 55SX
(C) OPERATING SYSTEM: IBM P.C. DOS (Version 5.00)
(D) SOFTWARE: WordPerfect (Version 5.1)
(Vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(Vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 07/862,795
(B) FILING DATE: April 3, 1992
(Viϋ) ATTORNEY/AGENT INFORMATION:
(A) NAME: Paul T. Clark
(B) REGISTRATION NUMBER: 30,162
(C) REFERENCE/DOCKET NUMBER:05140/002002
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 542-5070
(B) TELEFAX: (617) 542-8906
(C) TELEX: 200154 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER? 1: (1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GCAGAAGGTC GACCCAACG 19
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 2: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
CCAAGCTTGG 10
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 3: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTHS 13
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GTTTTCTTTT ATC 13
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 4: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CAAGCATGGC TTGCC 15
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 5: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
AGGTGCAGCT GCTCGAGTCG GG 22
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 6: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
AGGTGCAACT GCTCGAGTCT GG 22
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 7: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
AGGTGCAGCT GCTCGAGTCT GG 22 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER? 8: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
AGGTGCAACT GCTCGAGTCT GG 22
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 9: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
AGGTCCAGCT GCTCGAGTCT GG 22
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
CTATTAACTA GTGACGGTTA CCGTGGTCCC TTGGCCCCA 39
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER:
11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
AGCTTCTGCA GGCTCGAGTG ATCAACTAGT GCGGCCGCAT CGATT 45
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 12: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45
(B) TYPE: " nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
AGACGTCCGA GCTCACTAGT TGATCACGCC GGCGTAGCTA AGATC 45
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 13: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
AGCGGCCGCT 10
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 14: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
CCAGCCTCCG CGGCCCCAAG CTTCTGCA 28 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 15: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
GGTTCTCTA GAAACTGCTG AGGGC 24

Claims

What is claimed is:Claims
1. A method for expressing a nucleic acid of interest in a heterologous host cell, said method comprising
(a) providing a virus whose genome comprises (i) said nucleic acid of interest and (ii) a hybrid envelope gene, said hybrid gene encoding an envelope fragment joined to a targeting ligand, whereby said envelope fragment does not facilitate recognition or binding of its normal host cell but which does facilitate efficient incorporation of said virus into a mature viral particle and whereby said targeting ligand facilitates targeting and binding of said mature viral particle to the surface of said heterologous host cell, and
(b) administering said virus so as to permit viral infection of said heterologous host cell.
2. The method of claim 1, wherein said virus is an envelope virus.
3. The method of claim 2, wherein said envelope virus is a Herpesviridae.
4. The method of claim 2, wherein said envelope virus is a Retroviridae.
5. The method of claim 4, wherein said Retroviridae is a Moloney murine leukemia virus.
6. The method of claim 1, wherein said nucleic acid of interest is DNA.
7. The method of claim l, wherein said nucleic acid of interest is RNA.
8. The method of claim 1, wherein said heterologous host cell is infectious.
9. The method of claim 1, wherein a portion of said hybrid envelope fragment consists of a receptor binding domain, an oligomerization domain, a transmembrane domain, a virus budding domain, sorting signals, and a signal sequence.
10. The method of claim 9, wherein said envelope fragment further consists of a fusion domain.
11. The method of claim 1, wherein the fusion activity of said envelope fragment is performed by a second protein.
12. The method of claim 1, wherein said administration is by implanting a container enclosing said virus into a patient.
13. The method of claim 12, wherein said virus is inside a packaging cell.
14. A virus, the genome of which encodes a hybrid envelope protein, said hybrid protein comprising an envelope fragment joined in frame to a targeting ligand, whereby said envelope fragment does not facilitate recognition or binding of its normal host cell but which does facilitate efficient incorporation of said hybrid envelope protein into a mature viral particle and whereby said non-viral protein facilitates targeting and binding of said mature viral particle to the surface of a cell not normally infected by said virus.
15. The virus of claim 14, wherein said virus is an envelope virus.
16. The virus of claim 15, wherein said envelope virus is a Herpesviridae.
17. The virus of claim 15, wherein said envelope virus is a Retroviridae.
18. The virus of claim 17, wherein said Retroviridae is a Moloney murine leukemia virus.
19. The virus of claim 14, wherein said nucleic acid of interest is DNA.
20. The virus of claim 14, wherein said nucleic acid of interest is RNA.
21. The virus of claim 14, wherein said heterologous host cell is infectious.
22. The virus of claim 14, wherein a portion of said hybrid envelope protein consists of a receptor binding domain, an oligomerization domain, a transmembrane domain, a virus budding domain, sorting signals, and a signal sequence.
23. The virus of claim 22, wherein said envelope fragment further consists of a fusion domain.
24. The virus of claim 14, wherein the fusion activity of said envelope fragment is performed by a second protein.
25. The virus of claim 14, wherein said administration is by implanting a container enclosing said virus into a patient.
26. The virus of claim 25, wherein said virus is inside a packaging cell.
27. A method for delivering a nucleic acid of interest to a heterologous host cell, said method comprising a) providing a virus whose genome comprises (i) said nucleic acid of interest and (ii) a hybrid envelope gene, said hybrid gene encoding an envelope fragment joined to a targeting ligand, whereby said envelope fragment does not facilitate recognition or binding to its normal host cell but does facilitate ef icient incorporation of said virus into a mature viral particle and whereby said targeting ligand facilitates targeting and binding of said mature viral particle to the surface of said heterologous host cell, and b) administering said virus so as to permit viral infection of said cell.
28. The method of claim 27, wherein said virus is an envelope virus.
29. The method of claim 28, wherein said envelope virus is a Herpesviridae.
30. The method of claim 28, wherein said envelope virus is a Retroviridae.
31. The method of claim 30, wherein said Retroviridae is a Moloney murine leukemia virus.
32. The method of claim 27, wherein said nucleic acid of interest is DNA.
33. The method of claim 27, wherein said nucleic acid of interest is an RNA.
34. The method of claim 27, wherein said heterologous host cell is infectious.
35. The method of claim 27, wherein a portion of said hybrid envelope fragment consists of a receptor binding domain, an oligomerization domain, a transmembrane domain, a virus budding domain, sorting signals, and a signal sequence.
36. The method of claim 35, wherein said envelope fragment further consists of a fusion domain.
37. The method of claim 27, wherein said the fusion activity of said envelope fragment is performed by a second protein.
38. The method of claim 27, wherein said administration is by implanting a container enclosing said virus into a patient.
39. The method of claim 38, wherein said virus is inside a packaging cell.
PCT/US1993/002957 1992-04-03 1993-03-31 Gene therapy using targeted viral vectors WO1993020221A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP93908659A EP0633943A4 (en) 1992-04-03 1993-03-31 Gene therapy using targeted viral vectors.
JP5517626A JPH07505773A (en) 1992-04-03 1993-03-31 Gene therapy using targeted viral vectors
AU39402/93A AU3940293A (en) 1992-04-03 1993-03-31 Gene therapy using targeted viral vectors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US86279592A 1992-04-03 1992-04-03
US862,795 1992-04-03
US4074893A 1993-03-29 1993-03-29
US08/040,748 1993-03-29

Publications (1)

Publication Number Publication Date
WO1993020221A1 true WO1993020221A1 (en) 1993-10-14

Family

ID=26717389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/002957 WO1993020221A1 (en) 1992-04-03 1993-03-31 Gene therapy using targeted viral vectors

Country Status (5)

Country Link
EP (1) EP0633943A4 (en)
JP (1) JPH07505773A (en)
AU (1) AU3940293A (en)
CA (1) CA2133411A1 (en)
WO (1) WO1993020221A1 (en)

Cited By (151)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006920A1 (en) * 1992-09-22 1994-03-31 Medical Research Council Recombinant viruses displaying a nonviral polypeptide on their external surface
WO1995031566A1 (en) * 1994-05-13 1995-11-23 Chiron Viagene, Inc. Compositions and methods for targeting gene delivery vehicles
WO1996020014A1 (en) * 1994-12-23 1996-07-04 New York University Viral vector complexes having adapters of predefined valence
EP0746625A1 (en) * 1992-11-09 1996-12-11 UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Targetable vector particles
US5643756A (en) * 1992-08-28 1997-07-01 The Public Health Research Institute Of The City Of New York, Inc. Fusion glycoproteins
WO1997024453A1 (en) * 1995-12-28 1997-07-10 Chiron Corporation Receptor specific chimeric viral surface polypeptides for viral and particle incorporation and internalization in target cells
WO1999051748A2 (en) 1998-04-07 1999-10-14 Corixa Corporation Fusion proteins of mycobacterium tuberculosis antigens and their uses
US6004798A (en) * 1997-05-14 1999-12-21 University Of Southern California Retroviral envelopes having modified hypervariable polyproline regions
US6074850A (en) * 1996-11-15 2000-06-13 Canji, Inc. Retinoblastoma fusion polypeptides
WO2000046376A2 (en) * 1999-02-05 2000-08-10 Eberhard Hildt Particles for gene therapy
EP1156118A1 (en) * 1999-02-24 2001-11-21 Juridical Foundation Japanese Foundation For Cancer Research Virus vector
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
US6379927B1 (en) 1996-11-15 2002-04-30 Canji, Inc. Retinoblastoma fusion proteins
US6392069B2 (en) 1996-01-08 2002-05-21 Canji, Inc. Compositions for enhancing delivery of nucleic acids to cells
US6432699B1 (en) 1997-03-28 2002-08-13 New York University Viral vectors having chimeric envelope proteins containing the IgG-binding domain of protein A
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
WO2003086458A1 (en) 2002-04-12 2003-10-23 Medimmune, Inc. Recombinant anti-interleukin-9 antibodies
US6699656B2 (en) 1996-06-24 2004-03-02 University Of Maryland Biotechnology Institute Treatment and prevention of HIV infection by administration of derivatives of human chorionic gonadotropin
US6759393B1 (en) 1999-04-12 2004-07-06 Pfizer Inc. Growth hormone and growth hormone releasing hormone compositions
WO2005001038A2 (en) 2003-05-28 2005-01-06 Seattle Genetics, Inc. Recombinant anti-cd30 antibodies and uses thereof
US6849399B1 (en) 1996-05-23 2005-02-01 Bio-Rad Laboratories, Inc. Methods and compositions for diagnosis and treatment of iron misregulation diseases
US6864082B2 (en) 1997-04-10 2005-03-08 University Of Southern California Modified viral surface proteins for binding to extracellular matrix components
WO2005032572A2 (en) 2003-10-03 2005-04-14 Vib Vzw Means and methods for the recruitment and identification of stem cells
WO2005042708A2 (en) 2003-10-27 2005-05-12 Rosetta Inpharmatics Llc METHOD OF DESIGNING siRNAS FOR GENE SILENCING
US6974572B2 (en) 2001-05-22 2005-12-13 Pfizer, Inc. Non-anaphylactogenic IgE fusion proteins
WO2006001888A2 (en) 2004-04-16 2006-01-05 Acuity Pharmaceuticals Inc Compositions and methods for inhibiting angiogenesis
WO2006007539A1 (en) * 2004-07-01 2006-01-19 Virxsys Corporation Vector packaging cell line
US7002027B1 (en) 1996-01-08 2006-02-21 Canji, Inc. Compositions and methods for therapeutic use
US7026116B1 (en) 1996-04-04 2006-04-11 Bio-Rad Laboratories, Inc. Polymorphisms in the region of the human hemochromatosis gene
US7067255B2 (en) 1996-04-04 2006-06-27 Bio-Rad Laboratories, Inc. Hereditary hemochromatosis gene
WO2006069253A2 (en) 2004-12-22 2006-06-29 Auckland Uniservices Limited Trefoil factors and methods of treating proliferation disorders using same
WO2006091871A1 (en) 2005-02-23 2006-08-31 Halozyme Therapeutics, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
WO2006102095A2 (en) 2005-03-18 2006-09-28 Medimmune, Inc. Framework-shuffling of antibodies
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
US7393534B2 (en) 2003-07-15 2008-07-01 Barros Research Institute Compositions and methods for immunotherapy of cancer and infectious diseases
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
EP1967206A2 (en) 2000-08-30 2008-09-10 Pfizer Products Inc. Anti-IgE vaccines
EP1978098A2 (en) 1999-12-10 2008-10-08 Invitrogen Corporation Use of multiple recombination sites with unique specificity in recombinational cloning
US7449562B2 (en) 2001-06-29 2008-11-11 Novartis Ag PERV screening method and use thereof
WO2008157379A2 (en) 2007-06-21 2008-12-24 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2009002193A1 (en) 2007-06-27 2008-12-31 Auckland Uniservices Limited Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof
EP2014674A1 (en) 2001-11-26 2009-01-14 Cellvir Protein-protein interactions in human immunodeficiency virus
EP2027874A2 (en) 2000-11-28 2009-02-25 Medimmune, Inc. Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment
US7498314B2 (en) 2001-05-03 2009-03-03 Fit Biotech Oyj Plc Expression vectors and uses thereof
US7566452B1 (en) 1999-05-04 2009-07-28 New York University Cancer treatment with endothelin receptor antagonists
WO2009123894A2 (en) 2008-04-02 2009-10-08 Macrogenics, Inc. Her2/neu-specific antibodies and methods of using same
EP2128270A1 (en) 2003-08-08 2009-12-02 Genenews Inc. Osteoarthritis biomarkers and uses thereof
WO2009151717A2 (en) 2008-04-02 2009-12-17 Macrogenics, Inc. Bcr-complex-specific antibodies and methods of using same
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
EP2163643A1 (en) 2003-03-05 2010-03-17 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
WO2010033279A2 (en) 2008-06-04 2010-03-25 Macrogenics, Inc. Antibodies with altered binding to fcrn and methods of using same
US7700341B2 (en) 2000-02-03 2010-04-20 Dendreon Corporation Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
WO2010072684A1 (en) 2008-12-22 2010-07-01 Universität Regensburg Norrin in the treatment of diseases associated with an increased tgf-beta activity
WO2010080538A1 (en) 2008-12-19 2010-07-15 Macrogenics, Inc. Covalent diabodies and uses thereof
EP2218779A1 (en) 2002-12-16 2010-08-18 Halozyme, Inc. Human chondroitinase glycoprotein (chasegp), process for preparing the same, and pharmaceutical compositions comprising thereof
EP2228389A2 (en) 2001-04-13 2010-09-15 Human Genome Sciences, Inc. Antibodies against vascular endothelial growth factor 2
WO2010124365A1 (en) 2009-04-27 2010-11-04 Ottawa Hospital Research Institute Compositions and methods for modulating stem cells and uses thereof
WO2010141329A1 (en) 2009-06-01 2010-12-09 Medimmune, Llc Molecules with extended half-lives and uses thereof
EP2272566A2 (en) 2003-08-18 2011-01-12 MedImmune, LLC Humanisation of antibodies
WO2011020079A1 (en) 2009-08-13 2011-02-17 Calmune Corporation Antibodies against human respiratory syncytial virus (rsv) and methods of use
EP2292663A2 (en) 2006-08-28 2011-03-09 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2298869A1 (en) 2003-06-13 2011-03-23 University Of Medicine And Dentistry Of New Jersey Recombinant protein production in the presence of mRNA interferase
WO2011035205A2 (en) 2009-09-18 2011-03-24 Calmune Corporation Antibodies against candida, collections thereof and methods of use
EP2308996A1 (en) 1998-03-30 2011-04-13 NorthWest Biotherapeutics, Inc. Therapeutic and diagnostic applications based on the role of the CXCR-4 and SDF-1 genes in tumourigenesis
US7928189B2 (en) 2008-05-05 2011-04-19 Ottawa Health Research Institute PCSK9 polypeptide fragment
WO2011046457A1 (en) 2009-10-16 2011-04-21 Auckland Uniservices Limited Anti-neoplastic uses of artemin antagonists
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
EP2319941A2 (en) 2005-10-21 2011-05-11 GeneNews Inc. Method and apparatus for correlating levels of biomarker products with disease
WO2011057188A1 (en) 2009-11-06 2011-05-12 Idexx Laboratories, Inc. Canine anti-cd20 antibodies
US7964708B2 (en) 2006-11-15 2011-06-21 Limin Li Anti-TSG101 antibodies and their uses for treatment of viral infections
US7973139B2 (en) 2004-03-26 2011-07-05 Human Genome Sciences, Inc. Antibodies against nogo receptor
EP2341060A1 (en) 2000-12-12 2011-07-06 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
EP2351584A1 (en) 2003-12-23 2011-08-03 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
WO2011101031A1 (en) 2010-02-19 2011-08-25 Université de Liège A polynucleotide for use in treatment of influenza a virus induced diseases, encoding modified mx protein, said modified mx protein, and a transgenic animal expressing gene encoding modified mx protein
US8022189B2 (en) 1998-08-21 2011-09-20 Albany Medical College Isolated antibodies against biologically active leptin-related peptides
US8021833B2 (en) 2003-02-12 2011-09-20 Functional Genetics, Inc. Method for reducing HIV viral budding by administering a VPS28-specfic antibody that disrupts Gag-TSG101-VPS28 binding interactions
EP2368578A1 (en) 2003-01-09 2011-09-28 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2371389A2 (en) 2002-08-14 2011-10-05 MacroGenics, Inc. FcgammaRIIB-specific antibodies and methods of use thereof
EP2383350A1 (en) 2004-05-07 2011-11-02 Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Methods of diagnosing or treating prostate cancer using the erg gene, alone or in combination with other over or under expressed genes in prostate cancer
EP2385124A2 (en) 1999-05-14 2011-11-09 Arbor Vita Corporation Peptides or peptide analogues for modulating the binding of a PDZ protein and a PL protein
EP2387995A1 (en) 2006-03-30 2011-11-23 PTC Therapeutics, Inc. Methods for the production of functional protein from DNA having a nonsense mutation and the treatment of disorders associated therewith
WO2012006596A2 (en) 2010-07-09 2012-01-12 Calmune Corporation Anti-human respiratory syncytial virus (rsv) antibodies and methods of use
EP2407548A1 (en) 2006-10-16 2012-01-18 MedImmune, LLC Molecules with reduced half-lives, compositions and uses thereof
WO2012013249A1 (en) 2010-07-30 2012-02-02 Université de Liège Dentin matrix protein 1 (dmp1) for use in pharmaceutical compositions
WO2012018687A1 (en) 2010-08-02 2012-02-09 Macrogenics, Inc. Covalent diabodies and uses thereof
EP2422811A2 (en) 2004-10-27 2012-02-29 MedImmune, LLC Modulation of antibody specificity by tailoring the affinity to cognate antigens
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
EP2453024A2 (en) 2004-06-21 2012-05-16 The Board of Trustees of The Leland Stanford Junior University Genes and pathways differentially expressed in bipolar disorder and/or major depressive disorder
US8231878B2 (en) 2001-03-20 2012-07-31 Cosmo Research & Development S.P.A. Receptor trem (triggering receptor expressed on myeloid cells) and uses thereof
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2505209A1 (en) 2006-06-26 2012-10-03 MacroGenics, Inc. Fcgamma-RIIB-specific antibodies and methods of the use thereof
EP2518163A2 (en) 2006-10-10 2012-10-31 The Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Prostate cancer specific alterations in erg gene expression and detection and treatment methods based on those alterations
EP2520669A2 (en) 2005-02-07 2012-11-07 GeneNews Inc. Mild osteoathritis biomarkers and uses thereof
WO2012162068A2 (en) 2011-05-21 2012-11-29 Macrogenics, Inc. Deimmunized serum-binding domains and their use for extending serum half-life
EP2564864A2 (en) 2005-11-12 2013-03-06 The Board of Trustees of the Leland FGF2-related methods for diagnosing and treating depression
WO2013040341A2 (en) 2011-09-16 2013-03-21 Ottawa Hospital Research Institute Wnt7a compositions and methods of using the same
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
WO2014006063A2 (en) 2012-07-02 2014-01-09 Medizinische Universität Wien Complement split product c4d for the treatment of inflammatory conditions
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8916517B2 (en) 2009-11-02 2014-12-23 The Administrators Of The Tulane Educational Fund Analogs of pituitary adenylate cyclase-activating polypeptide (PACAP) and methods for their use
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US8981061B2 (en) 2001-03-20 2015-03-17 Novo Nordisk A/S Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof
US9000127B2 (en) 2012-02-15 2015-04-07 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9006181B2 (en) 2004-07-21 2015-04-14 The Administrators Of The Tulane Educational Fund Treatment of renal dysfunction and multiple myeloma using PACAP compounds
US9211315B2 (en) 2004-03-05 2015-12-15 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
US9273111B2 (en) 2004-11-29 2016-03-01 Universite De Lorraine Therapeutic TREM-1 peptides
US9447454B2 (en) 2003-10-23 2016-09-20 The Rockefeller University Method of purifying RNA binding protein-RNA complexes
US9458464B2 (en) 2014-06-23 2016-10-04 The Johns Hopkins University Treatment of neuropathic pain
US9550830B2 (en) 2012-02-15 2017-01-24 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
US9663568B2 (en) 2012-02-15 2017-05-30 Novo Nordisk A/S Antibodies that bind peptidoglycan recognition protein 1
WO2017182981A1 (en) 2016-04-20 2017-10-26 Washington University Ppar agonist or lxr agonist for use in the treatment of systemic lupus erythematosus by modulation of lap activity
US9873722B2 (en) 2011-09-16 2018-01-23 Fate Therapeutics, Inc. Wnt compositions and therapeutic uses of such compositions
US9920100B2 (en) 2015-06-05 2018-03-20 The Chinese University Of Hong Kong Mimotopes of tropomyosin for use in immunotherapy for shellfish and/or arthropod allergy
EP3320906A1 (en) 2012-10-26 2018-05-16 The Chinese University of Hong Kong Treatment of melanoma and lung carcinoma using a smad3 inhibitor
US10130687B2 (en) 2011-01-05 2018-11-20 Rhode Island Hospital Compositions and methods for the treatment of orthopedic disease or injury
US10179814B2 (en) 2014-07-17 2019-01-15 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
EP3450571A1 (en) 2014-02-24 2019-03-06 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
EP3479844A1 (en) 2005-04-15 2019-05-08 MacroGenics, Inc. Covalent diabodies and uses thereof
WO2019099744A1 (en) 2017-11-15 2019-05-23 Adicet Bio, Inc. METHODS FOR SELECTIVE EXPANSION OF δ3 γδ T-CELL POPULATIONS AND COMPOSITIONS THEREOF
WO2019104269A1 (en) 2017-11-27 2019-05-31 Immatics US, Inc. Methods for activating, modifying and expanding gamma delta t cells for the treatment of cancer and related malignancies
US10570200B2 (en) 2013-02-01 2020-02-25 California Institute Of Technology Antibody-mediated immunocontraception
WO2020097261A1 (en) 2018-11-06 2020-05-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services New compositions and methods for treating beta-globinopathies
WO2020117862A1 (en) 2018-12-03 2020-06-11 Adicet Bio, Inc. Methods for selective in vivo expansion of gamma delta t-cell populations and compositions thereof
US10729790B2 (en) 2015-05-26 2020-08-04 Salk Institute For Biological Studies Motor neuron-specific expression vectors
WO2020243134A1 (en) 2019-05-27 2020-12-03 Immatics US, Inc. Viral vectors and their use in adoptive cellular therapy
WO2021138581A1 (en) 2020-01-03 2021-07-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Tnap locally administered for promoting periodontal health
WO2021173560A1 (en) 2020-02-24 2021-09-02 Immatics US, Inc. Methods for expanding t cells for the treatment of cancer and related malignancies
DE102020111571A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
DE102020106710A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
US11135245B2 (en) 2014-11-17 2021-10-05 Adicet Bio, Inc. Engineered γδ T-cells
EP3888690A2 (en) 2014-05-16 2021-10-06 MedImmune, LLC Molecules with altered neonate fc receptor binding having enhanced therapeutic and diagnostic properties
US11155618B2 (en) 2018-04-02 2021-10-26 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
US11299708B2 (en) 2016-05-12 2022-04-12 Adicet Bio, Inc. Methods for selective expansion of γδ T-cell populations and compositions thereof
DE102021100038A1 (en) 2020-12-31 2022-06-30 Immatics US, Inc. MODIFIED CD8 POLYPEPTIDES, COMPOSITIONS AND METHODS OF USE THEREOF
WO2022147029A2 (en) 2020-12-31 2022-07-07 Immatics US, Inc. Cd8 polypeptides, compositions, and methods of using thereof
WO2022157548A1 (en) 2021-01-24 2022-07-28 Forrest Michael David Inhibitors of atp synthase - cosmetic and therapeutic uses
WO2022240824A1 (en) 2021-05-13 2022-11-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for treating sickle cell diseases
WO2023004332A2 (en) 2021-07-19 2023-01-26 New York University Adeno-associated viral vector compositions and methods of promoting muscle regeneration
WO2023064255A2 (en) 2021-10-15 2023-04-20 The Regents Of The University Of California Diagnosis and treatment of anti-pf4 induced thrombocytopenia
WO2023081167A2 (en) 2021-11-02 2023-05-11 The Regents Of The University Of California P-selectin mutants and modulation of integrin-mediated signaling
WO2023131901A1 (en) 2022-01-07 2023-07-13 Johnson & Johnson Enterprise Innovation Inc. Materials and methods of il-1beta binding proteins
WO2023146807A1 (en) 2022-01-25 2023-08-03 The Regents Of The University Of California Vegf mutants and modulation of integrin-mediated signaling
WO2023200897A1 (en) 2022-04-13 2023-10-19 The Regents Of The University Of California Use of viral il-6 in cancer therapy
WO2023212697A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. Membrane-bound il-15, cd8 polypeptides, cells, compositions, and methods of using thereof
WO2023212655A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. Il-12 polypeptides, il-15 polypeptides, il-18 polypeptides, cd8 polypeptides, compositions, and methods of using thereof
WO2023212691A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. DOMINANT NEGATIVE TGFβ RECEPTOR POLYPEPTIDES, CD8 POLYPEPTIDES, CELLS, COMPOSITIONS, AND METHODS OF USING THEREOF
WO2023215825A1 (en) 2022-05-05 2023-11-09 Immatics US, Inc. Methods for improving t cell efficacy
WO2024013727A1 (en) 2022-07-15 2024-01-18 Janssen Biotech, Inc. Material and methods for improved bioengineered pairing of antigen-binding variable regions

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL217626B1 (en) * 2002-07-18 2014-08-29 Helix Biopharma Corp Use of urease for inhibiting cancer cell growth

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0466815A4 (en) * 1989-04-05 1992-09-02 Novacell Corpporation Infectious targetted replication-defective virion
EP0487587A1 (en) * 1989-08-18 1992-06-03 Chiron Corporation Recombinant retroviruses delivering vector constructs to target cells
CA2092195C (en) * 1990-09-21 2000-04-18 Douglas J. Jolly Retroviral packaging cell line
ATE188740T1 (en) * 1991-02-19 2000-01-15 Univ California VIRUS PARTICLES WITH ALTERED HOST SPECTRUM
WO1993000103A1 (en) * 1991-06-21 1993-01-07 The Wistar Institute Of Anatomy And Biology Chimeric envelope proteins for viral targeting
WO1993005147A1 (en) * 1991-08-30 1993-03-18 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Defective interfering hiv particles with chimeric cd4-env
WO1993014188A1 (en) * 1992-01-17 1993-07-22 The Regents Of The University Of Michigan Targeted virus

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Immunology Today, Vol. 11, No. 6, issued 1990, S.J. RUSSELL, "Lymphokine Gene Therapy for Cancer", pages 196-200, see page 198, second column, first paragraph. *
Nature, Vol. 340, issued 27 July 1989, J.W. WILLS, "Retro-secretion of Recombinant Proteins", pages 323-324, see page 324, last paragraph. *
Science, Vol. 244, issued 16 June 1989, T. FRIEDMANN, "Progress Toward Human Gene Therapy", pages 1275-1281, see pages 1277-1278. *
Science, Vol. 250, issued 07 December 1990, J.A.T. YOUNG et al., "Efficient Incorporation of Human CD4 Protein into Avian Leukosis Virus Particles", pages 1421-1423, see entire article. *
See also references of EP0633943A4 *

Cited By (259)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643756A (en) * 1992-08-28 1997-07-01 The Public Health Research Institute Of The City Of New York, Inc. Fusion glycoproteins
US5952474A (en) * 1992-08-28 1999-09-14 The Public Health Research Institute Of The City Of New York, Inc. Fusion glycoproteins
US6297004B1 (en) 1992-09-22 2001-10-02 Cambridge Drug Discovery Holding, Ltd Recombinant viruses displaying a nonviral polypeptide on their external surface
WO1994006920A1 (en) * 1992-09-22 1994-03-31 Medical Research Council Recombinant viruses displaying a nonviral polypeptide on their external surface
US5723287A (en) * 1992-09-22 1998-03-03 Medical Research Council Recombinant viruses displaying a nonviral polypeptide on their external surface
US5985655A (en) * 1992-11-09 1999-11-16 The United States Of America As Represented By The Department Of Health And Human Sevices Targetable vector particles
EP0746625A1 (en) * 1992-11-09 1996-12-11 UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Targetable vector particles
EP0746625A4 (en) * 1992-11-09 1997-05-02 Us Health Targetable vector particles
US6503501B1 (en) 1992-11-09 2003-01-07 W. French Anderson Targetable vector particles
WO1995031566A1 (en) * 1994-05-13 1995-11-23 Chiron Viagene, Inc. Compositions and methods for targeting gene delivery vehicles
US5753499A (en) * 1994-12-23 1998-05-19 New York University Viral vector complexes having adapters of predefined valence
WO1996020014A1 (en) * 1994-12-23 1996-07-04 New York University Viral vector complexes having adapters of predefined valence
WO1997024453A1 (en) * 1995-12-28 1997-07-10 Chiron Corporation Receptor specific chimeric viral surface polypeptides for viral and particle incorporation and internalization in target cells
US7002027B1 (en) 1996-01-08 2006-02-21 Canji, Inc. Compositions and methods for therapeutic use
US6392069B2 (en) 1996-01-08 2002-05-21 Canji, Inc. Compositions for enhancing delivery of nucleic acids to cells
US7534769B2 (en) 1996-01-08 2009-05-19 Canji, Inc. Compositions and methods for enhancing delivery of therapeutic agents to cells
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US8257927B2 (en) 1996-04-04 2012-09-04 Bio-Rad Laboratories, Inc. Hereditary hemochromatosis gene
US7998680B2 (en) 1996-04-04 2011-08-16 Bio-Rad Laboratories, Inc. Determining genotype of a polymorphic site in the hereditary hemochromatosis gene
US7595385B2 (en) 1996-04-04 2009-09-29 Bio-Rad Laboratories, Inc. Polymorphisms in the region of the human hemochromatosis gene
US7052845B2 (en) 1996-04-04 2006-05-30 Bio-Rad Laboratories, Inc. Polymorphisms in the region of the human hemochromatosis gene
US7067255B2 (en) 1996-04-04 2006-06-27 Bio-Rad Laboratories, Inc. Hereditary hemochromatosis gene
US7579169B2 (en) 1996-04-04 2009-08-25 Bio-Rad Laboratories, Inc. Hereditary hemochromatosis gene
US7026116B1 (en) 1996-04-04 2006-04-11 Bio-Rad Laboratories, Inc. Polymorphisms in the region of the human hemochromatosis gene
US6849399B1 (en) 1996-05-23 2005-02-01 Bio-Rad Laboratories, Inc. Methods and compositions for diagnosis and treatment of iron misregulation diseases
US6699656B2 (en) 1996-06-24 2004-03-02 University Of Maryland Biotechnology Institute Treatment and prevention of HIV infection by administration of derivatives of human chorionic gonadotropin
US6379927B1 (en) 1996-11-15 2002-04-30 Canji, Inc. Retinoblastoma fusion proteins
US6074850A (en) * 1996-11-15 2000-06-13 Canji, Inc. Retinoblastoma fusion polypeptides
US6902731B1 (en) 1996-11-15 2005-06-07 Canji, Inc. Methods of treating hyperproliferative disorders using retinoblastoma fusion proteins
US6432699B1 (en) 1997-03-28 2002-08-13 New York University Viral vectors having chimeric envelope proteins containing the IgG-binding domain of protein A
US7347998B2 (en) 1997-04-10 2008-03-25 University Of Southern California Method of delivering therapeutic agents to site of tissue injury
US8530441B2 (en) 1997-04-10 2013-09-10 University Of Southern California Transgene delivering retrovirus targeting collagen exposed at site of tissue injury
US6864082B2 (en) 1997-04-10 2005-03-08 University Of Southern California Modified viral surface proteins for binding to extracellular matrix components
US7820157B2 (en) 1997-04-10 2010-10-26 University Of Southern California Transgene delivering retrovirus targeting collagen exposed at site of tissue injury
US8871734B2 (en) 1997-04-10 2014-10-28 The University Of Southern California Transgene delivering retrovirus targeting collagen exposed at site of tissue injury
US8148509B2 (en) 1997-04-10 2012-04-03 University Of Southern California Transgene delivering retrovirus targeting collagen exposed at site of tissue injury
US6004798A (en) * 1997-05-14 1999-12-21 University Of Southern California Retroviral envelopes having modified hypervariable polyproline regions
EP2106807A1 (en) 1997-07-08 2009-10-07 CANJI, Inc. Compositions and kits for enhancing delivery of therapeutic agents to cells
EP2308996A1 (en) 1998-03-30 2011-04-13 NorthWest Biotherapeutics, Inc. Therapeutic and diagnostic applications based on the role of the CXCR-4 and SDF-1 genes in tumourigenesis
WO1999051748A2 (en) 1998-04-07 1999-10-14 Corixa Corporation Fusion proteins of mycobacterium tuberculosis antigens and their uses
US8022189B2 (en) 1998-08-21 2011-09-20 Albany Medical College Isolated antibodies against biologically active leptin-related peptides
US8067545B2 (en) 1998-08-21 2011-11-29 Albany Medical College Isolated antibodies against biologically active leptin-related peptides
WO2000046376A3 (en) * 1999-02-05 2000-11-16 Eberhard Hildt Particles for gene therapy
WO2000046376A2 (en) * 1999-02-05 2000-08-10 Eberhard Hildt Particles for gene therapy
US7018826B1 (en) 1999-02-05 2006-03-28 Island Pharmaceuticals Ltd. Particles for gene therapy
EP1156118A4 (en) * 1999-02-24 2002-09-11 Japan Found Cancer Virus vector
EP1156118A1 (en) * 1999-02-24 2001-11-21 Juridical Foundation Japanese Foundation For Cancer Research Virus vector
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
US6759393B1 (en) 1999-04-12 2004-07-06 Pfizer Inc. Growth hormone and growth hormone releasing hormone compositions
US8597645B2 (en) 1999-05-04 2013-12-03 New York University Cancer treatment with endothelin receptor antagonists
US7566452B1 (en) 1999-05-04 2009-07-28 New York University Cancer treatment with endothelin receptor antagonists
US8067000B2 (en) 1999-05-04 2011-11-29 New York University Cancer treatment with endothelin receptor antagonists
US9125897B2 (en) 1999-05-04 2015-09-08 New York University Cancer treatment with endothelin receptor antagonists
EP2385124A2 (en) 1999-05-14 2011-11-09 Arbor Vita Corporation Peptides or peptide analogues for modulating the binding of a PDZ protein and a PL protein
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
EP2210948A2 (en) 1999-12-10 2010-07-28 Life Technologies Corporation Use of multiple recombination sites with unique specificity in recombinational cloning
EP1978098A2 (en) 1999-12-10 2008-10-08 Invitrogen Corporation Use of multiple recombination sites with unique specificity in recombinational cloning
US7700341B2 (en) 2000-02-03 2010-04-20 Dendreon Corporation Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP2275449A1 (en) 2000-06-16 2011-01-19 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP2281843A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP2281842A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to BLyS
US7897151B2 (en) 2000-08-30 2011-03-01 Pharmacia & Upjohn Company, Llc Anti-IgE vaccines
EP1967206A2 (en) 2000-08-30 2008-09-10 Pfizer Products Inc. Anti-IgE vaccines
EP1967205A2 (en) 2000-08-30 2008-09-10 Pfizer Products Inc. Anti-IgE vaccines
US8273356B2 (en) 2000-08-30 2012-09-25 Pfizer Inc. Anti-IgE vaccines
EP2361635A2 (en) 2000-08-30 2011-08-31 Pfizer Products Inc. Anti IgE vaccines
EP2065052A2 (en) 2000-08-30 2009-06-03 Pfizer Products Inc. Anti-IgE vaccines
EP2412384A1 (en) 2000-11-28 2012-02-01 MedImmune, LLC Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment
EP2338512A1 (en) 2000-11-28 2011-06-29 MedImmune, LLC Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment
EP2027874A2 (en) 2000-11-28 2009-02-25 Medimmune, Inc. Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment
EP2341060A1 (en) 2000-12-12 2011-07-06 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
EP2354149A1 (en) 2000-12-12 2011-08-10 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
EP2357187A1 (en) 2000-12-12 2011-08-17 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
EP3569610A2 (en) 2000-12-12 2019-11-20 Medlmmune, LLC Molecules with extended half lives, compositions and uses thereof
US8981061B2 (en) 2001-03-20 2015-03-17 Novo Nordisk A/S Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof
US8231878B2 (en) 2001-03-20 2012-07-31 Cosmo Research & Development S.P.A. Receptor trem (triggering receptor expressed on myeloid cells) and uses thereof
EP2228389A2 (en) 2001-04-13 2010-09-15 Human Genome Sciences, Inc. Antibodies against vascular endothelial growth factor 2
US7498314B2 (en) 2001-05-03 2009-03-03 Fit Biotech Oyj Plc Expression vectors and uses thereof
US9725486B2 (en) 2001-05-03 2017-08-08 Fit Biotech Oy Methods of treating HIV diseases using novel expression vectors
US7510718B2 (en) 2001-05-03 2009-03-31 Fit Biotech Oyj Plc Expression vectors and uses thereof
US6974572B2 (en) 2001-05-22 2005-12-13 Pfizer, Inc. Non-anaphylactogenic IgE fusion proteins
US7420047B2 (en) 2001-05-22 2008-09-02 Pfizer Inc. Non-anaphylactogenic IgE fusion proteins
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
US7449562B2 (en) 2001-06-29 2008-11-11 Novartis Ag PERV screening method and use thereof
EP2014674A1 (en) 2001-11-26 2009-01-14 Cellvir Protein-protein interactions in human immunodeficiency virus
EP2270049A2 (en) 2002-04-12 2011-01-05 Medimmune, Inc. Recombinant anti-interleukin-9-antibody
WO2003086458A1 (en) 2002-04-12 2003-10-23 Medimmune, Inc. Recombinant anti-interleukin-9 antibodies
EP2371389A2 (en) 2002-08-14 2011-10-05 MacroGenics, Inc. FcgammaRIIB-specific antibodies and methods of use thereof
EP2218779A1 (en) 2002-12-16 2010-08-18 Halozyme, Inc. Human chondroitinase glycoprotein (chasegp), process for preparing the same, and pharmaceutical compositions comprising thereof
US8815558B2 (en) 2002-12-16 2014-08-26 Halozyme, Inc. Human chondroitinase glycoprotein (CHASEGP), process for preparing the same, and pharmaceutical compositions comprising thereof
EP2298874A1 (en) 2002-12-16 2011-03-23 Halozyme, Inc. Human chondroitinase glycoprotein (CHASEGP), process for preparing the same, and pharmaceutical compositions comprising thereof
EP2368578A1 (en) 2003-01-09 2011-09-28 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US8021833B2 (en) 2003-02-12 2011-09-20 Functional Genetics, Inc. Method for reducing HIV viral budding by administering a VPS28-specfic antibody that disrupts Gag-TSG101-VPS28 binding interactions
US9677062B2 (en) 2003-03-05 2017-06-13 Halozyme, Inc. Hyaluronidase and factor VIII compositions
EP2311973A1 (en) 2003-03-05 2011-04-20 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP3009517A1 (en) 2003-03-05 2016-04-20 Halozyme, Inc. Soluble hyaluronidase glycoprotein (shasegp), process for preparing the same, uses and pharmaceutical compositions comprising thereof
US9562223B2 (en) 2003-03-05 2017-02-07 Halozyme, Inc. Methods for reducing intraocular pressure by administering a soluble hyaluronidase glycoprotein (sHASEGP)
US10898551B2 (en) 2003-03-05 2021-01-26 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP2177620A1 (en) 2003-03-05 2010-04-21 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
US10286044B2 (en) 2003-03-05 2019-05-14 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
US11723959B2 (en) 2003-03-05 2023-08-15 Halozyme, Inc. Preparation of mammalian oocyte for fertilization via a soluble human PH20 hyaluronidase polypeptide
US9677061B2 (en) 2003-03-05 2017-06-13 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP2405015A2 (en) 2003-03-05 2012-01-11 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP2330213A1 (en) 2003-03-05 2011-06-08 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP2163643A1 (en) 2003-03-05 2010-03-17 Halozyme, Inc. Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
WO2005001038A2 (en) 2003-05-28 2005-01-06 Seattle Genetics, Inc. Recombinant anti-cd30 antibodies and uses thereof
EP2298869A1 (en) 2003-06-13 2011-03-23 University Of Medicine And Dentistry Of New Jersey Recombinant protein production in the presence of mRNA interferase
EP2302040A1 (en) 2003-06-13 2011-03-30 University Of Medicine And Dentistry Of New Jersey Medical use of mRNA interferase
US8257714B2 (en) 2003-07-15 2012-09-04 Michigan State University Compositions and methods for immunotherapy of cancer and infectious diseases
US7393534B2 (en) 2003-07-15 2008-07-01 Barros Research Institute Compositions and methods for immunotherapy of cancer and infectious diseases
EP2128270A1 (en) 2003-08-08 2009-12-02 Genenews Inc. Osteoarthritis biomarkers and uses thereof
EP2272566A2 (en) 2003-08-18 2011-01-12 MedImmune, LLC Humanisation of antibodies
WO2005032572A2 (en) 2003-10-03 2005-04-14 Vib Vzw Means and methods for the recruitment and identification of stem cells
US8003096B2 (en) 2003-10-03 2011-08-23 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Means and methods for the recruitment and identification of stem cells
US9447454B2 (en) 2003-10-23 2016-09-20 The Rockefeller University Method of purifying RNA binding protein-RNA complexes
WO2005042708A2 (en) 2003-10-27 2005-05-12 Rosetta Inpharmatics Llc METHOD OF DESIGNING siRNAS FOR GENE SILENCING
EP2351584A1 (en) 2003-12-23 2011-08-03 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
EP3718564A1 (en) 2003-12-23 2020-10-07 Genentech, Inc. Novel anti-il 13 antibodies and uses thereof
EP2805728A1 (en) 2003-12-23 2014-11-26 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
US9211315B2 (en) 2004-03-05 2015-12-15 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
US10016491B2 (en) 2004-03-05 2018-07-10 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
US7973139B2 (en) 2004-03-26 2011-07-05 Human Genome Sciences, Inc. Antibodies against nogo receptor
WO2006001888A2 (en) 2004-04-16 2006-01-05 Acuity Pharmaceuticals Inc Compositions and methods for inhibiting angiogenesis
EP2383350A1 (en) 2004-05-07 2011-11-02 Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Methods of diagnosing or treating prostate cancer using the erg gene, alone or in combination with other over or under expressed genes in prostate cancer
EP2453024A2 (en) 2004-06-21 2012-05-16 The Board of Trustees of The Leland Stanford Junior University Genes and pathways differentially expressed in bipolar disorder and/or major depressive disorder
WO2006007539A1 (en) * 2004-07-01 2006-01-19 Virxsys Corporation Vector packaging cell line
US9006181B2 (en) 2004-07-21 2015-04-14 The Administrators Of The Tulane Educational Fund Treatment of renal dysfunction and multiple myeloma using PACAP compounds
EP2422811A2 (en) 2004-10-27 2012-02-29 MedImmune, LLC Modulation of antibody specificity by tailoring the affinity to cognate antigens
US10603357B2 (en) 2004-11-29 2020-03-31 Bristol-Myers Squibb Company Therapeutic TREM-1 peptides
US9273111B2 (en) 2004-11-29 2016-03-01 Universite De Lorraine Therapeutic TREM-1 peptides
WO2006069253A2 (en) 2004-12-22 2006-06-29 Auckland Uniservices Limited Trefoil factors and methods of treating proliferation disorders using same
EP2520669A2 (en) 2005-02-07 2012-11-07 GeneNews Inc. Mild osteoathritis biomarkers and uses thereof
US10588983B2 (en) 2005-02-23 2020-03-17 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
EP3045472A1 (en) 2005-02-23 2016-07-20 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
WO2006091871A1 (en) 2005-02-23 2006-08-31 Halozyme Therapeutics, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
EP3943501A1 (en) 2005-02-23 2022-01-26 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
WO2006102095A2 (en) 2005-03-18 2006-09-28 Medimmune, Inc. Framework-shuffling of antibodies
EP3479844A1 (en) 2005-04-15 2019-05-08 MacroGenics, Inc. Covalent diabodies and uses thereof
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2319941A2 (en) 2005-10-21 2011-05-11 GeneNews Inc. Method and apparatus for correlating levels of biomarker products with disease
EP3299027A1 (en) 2005-11-04 2018-03-28 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2998318A1 (en) 2005-11-04 2016-03-23 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2564864A2 (en) 2005-11-12 2013-03-06 The Board of Trustees of the Leland FGF2-related methods for diagnosing and treating depression
EP2387995A1 (en) 2006-03-30 2011-11-23 PTC Therapeutics, Inc. Methods for the production of functional protein from DNA having a nonsense mutation and the treatment of disorders associated therewith
EP2505209A1 (en) 2006-06-26 2012-10-03 MacroGenics, Inc. Fcgamma-RIIB-specific antibodies and methods of the use thereof
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
EP2292663A2 (en) 2006-08-28 2011-03-09 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2484696A1 (en) 2006-08-28 2012-08-08 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2518163A2 (en) 2006-10-10 2012-10-31 The Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Prostate cancer specific alterations in erg gene expression and detection and treatment methods based on those alterations
EP2837697A2 (en) 2006-10-10 2015-02-18 The Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Prostate cancer-specific alterations in ERG gene expression and detection and treatment methods based on those alternations
EP2407548A1 (en) 2006-10-16 2012-01-18 MedImmune, LLC Molecules with reduced half-lives, compositions and uses thereof
EP2514439A1 (en) 2006-11-15 2012-10-24 Functional Genetics, Inc. Anti-TSG101antibodies and their uses for treatment of viral infections
US8796423B2 (en) 2006-11-15 2014-08-05 Eli Lilly And Company Anti-TSG101 antibodies and their uses for treatment of viral infections
US7964708B2 (en) 2006-11-15 2011-06-21 Limin Li Anti-TSG101 antibodies and their uses for treatment of viral infections
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
EP3424951A1 (en) 2007-06-21 2019-01-09 MacroGenics, Inc. Covalent diabodies and uses thereof
WO2008157379A2 (en) 2007-06-21 2008-12-24 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2009002193A1 (en) 2007-06-27 2008-12-31 Auckland Uniservices Limited Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof
US9243067B2 (en) 2007-08-29 2016-01-26 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8980262B2 (en) 2007-08-29 2015-03-17 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9175087B2 (en) 2007-08-29 2015-11-03 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9228019B2 (en) 2007-08-29 2016-01-05 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9815902B2 (en) 2007-08-29 2017-11-14 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their uses
WO2009151717A2 (en) 2008-04-02 2009-12-17 Macrogenics, Inc. Bcr-complex-specific antibodies and methods of using same
EP3067063A1 (en) 2008-04-02 2016-09-14 MacroGenics, Inc. Her2/neu-specific antibodies and methods of using same
EP3045475A1 (en) 2008-04-02 2016-07-20 MacroGenics, Inc. Bcr-complex-specific antibodies and methods of using same
WO2009123894A2 (en) 2008-04-02 2009-10-08 Macrogenics, Inc. Her2/neu-specific antibodies and methods of using same
US7928189B2 (en) 2008-05-05 2011-04-19 Ottawa Health Research Institute PCSK9 polypeptide fragment
WO2010033279A2 (en) 2008-06-04 2010-03-25 Macrogenics, Inc. Antibodies with altered binding to fcrn and methods of using same
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
EP2786762A2 (en) 2008-12-19 2014-10-08 MacroGenics, Inc. Covalent diabodies and uses thereof
EP3482769A1 (en) 2008-12-19 2019-05-15 MacroGenics, Inc. Covalent diabodies and uses thereof
WO2010080538A1 (en) 2008-12-19 2010-07-15 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2010072684A1 (en) 2008-12-22 2010-07-01 Universität Regensburg Norrin in the treatment of diseases associated with an increased tgf-beta activity
US10071138B2 (en) 2009-04-27 2018-09-11 Ottawa Hospital Research Institute Compositions and methods for modulating stem cells and uses thereof
US10828346B2 (en) 2009-04-27 2020-11-10 Ottawa Hospital Research Institute Compositions and methods for modulating stem cells and uses thereof
WO2010124365A1 (en) 2009-04-27 2010-11-04 Ottawa Hospital Research Institute Compositions and methods for modulating stem cells and uses thereof
WO2010141329A1 (en) 2009-06-01 2010-12-09 Medimmune, Llc Molecules with extended half-lives and uses thereof
US9403900B2 (en) 2009-08-13 2016-08-02 Crucell Holland B.V. Anti-human respiratory syncytial virus (RSV) antibodies and methods of use
WO2011020079A1 (en) 2009-08-13 2011-02-17 Calmune Corporation Antibodies against human respiratory syncytial virus (rsv) and methods of use
US9365638B2 (en) 2009-08-13 2016-06-14 Crucell Holland B. V. Antibodies against human respiratory syncytial virus (RSV) and methods of use
US8568719B2 (en) 2009-08-13 2013-10-29 Crucell Holland B.V. Antibodies against human respiratory syncytial virus (RSV) and methods of use
US9988437B2 (en) 2009-08-13 2018-06-05 Janssen Vaccines & Prevention B.V. Anti-human Respiratory Syncytial Virus (RSV) antibodies and methods of use
WO2011035205A2 (en) 2009-09-18 2011-03-24 Calmune Corporation Antibodies against candida, collections thereof and methods of use
WO2011046457A1 (en) 2009-10-16 2011-04-21 Auckland Uniservices Limited Anti-neoplastic uses of artemin antagonists
US8916517B2 (en) 2009-11-02 2014-12-23 The Administrators Of The Tulane Educational Fund Analogs of pituitary adenylate cyclase-activating polypeptide (PACAP) and methods for their use
WO2011057188A1 (en) 2009-11-06 2011-05-12 Idexx Laboratories, Inc. Canine anti-cd20 antibodies
WO2011101031A1 (en) 2010-02-19 2011-08-25 Université de Liège A polynucleotide for use in treatment of influenza a virus induced diseases, encoding modified mx protein, said modified mx protein, and a transgenic animal expressing gene encoding modified mx protein
US9149025B2 (en) 2010-02-19 2015-10-06 Universite De Liege Polynucleotide for use in treatment of influenza A virus induced diseases, encoding modified Mx protein, said modified Mx protein, and a transgenic animal expressing gene encoding modified Mx protein
WO2012006596A2 (en) 2010-07-09 2012-01-12 Calmune Corporation Anti-human respiratory syncytial virus (rsv) antibodies and methods of use
US9139642B2 (en) 2010-07-09 2015-09-22 Crucell Holland B.V. Anti-human respiratory syncytial virus (RSV) antibodies and methods of use
WO2012013249A1 (en) 2010-07-30 2012-02-02 Université de Liège Dentin matrix protein 1 (dmp1) for use in pharmaceutical compositions
WO2012018687A1 (en) 2010-08-02 2012-02-09 Macrogenics, Inc. Covalent diabodies and uses thereof
US10130687B2 (en) 2011-01-05 2018-11-20 Rhode Island Hospital Compositions and methods for the treatment of orthopedic disease or injury
WO2012162068A2 (en) 2011-05-21 2012-11-29 Macrogenics, Inc. Deimmunized serum-binding domains and their use for extending serum half-life
US9732130B2 (en) 2011-09-16 2017-08-15 Ottawa Hospital Research Institute WNT7A compositions and method of using the same
WO2013040341A2 (en) 2011-09-16 2013-03-21 Ottawa Hospital Research Institute Wnt7a compositions and methods of using the same
US9873722B2 (en) 2011-09-16 2018-01-23 Fate Therapeutics, Inc. Wnt compositions and therapeutic uses of such compositions
US10906975B2 (en) 2012-02-15 2021-02-02 Novo Nordisk A/S Methods of treating autoimmune disease or chronic inflammation with antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US10906965B2 (en) 2012-02-15 2021-02-02 Novo Nordisk A/S Methods of treating autoimmune disease or chronic inflammation wtih antibodies that bind peptidoglycan recognition protein 1
US9550830B2 (en) 2012-02-15 2017-01-24 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US10189904B2 (en) 2012-02-15 2019-01-29 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9663568B2 (en) 2012-02-15 2017-05-30 Novo Nordisk A/S Antibodies that bind peptidoglycan recognition protein 1
US10150809B2 (en) 2012-02-15 2018-12-11 Bristol-Myers Squibb Company Antibodies that bind peptidoglycan recognition protein 1
US9000127B2 (en) 2012-02-15 2015-04-07 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
US10525130B2 (en) 2012-03-26 2020-01-07 Sanofi Stable IGG4 based binding agent formulations
WO2014006063A2 (en) 2012-07-02 2014-01-09 Medizinische Universität Wien Complement split product c4d for the treatment of inflammatory conditions
EP3320906A1 (en) 2012-10-26 2018-05-16 The Chinese University of Hong Kong Treatment of melanoma and lung carcinoma using a smad3 inhibitor
EP3527213A1 (en) 2012-10-26 2019-08-21 The Chinese University Of Hong Kong Treatment of cancer using a smad3 inhibitor
US10570200B2 (en) 2013-02-01 2020-02-25 California Institute Of Technology Antibody-mediated immunocontraception
EP3450571A1 (en) 2014-02-24 2019-03-06 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
EP3888690A2 (en) 2014-05-16 2021-10-06 MedImmune, LLC Molecules with altered neonate fc receptor binding having enhanced therapeutic and diagnostic properties
US9458464B2 (en) 2014-06-23 2016-10-04 The Johns Hopkins University Treatment of neuropathic pain
US11072654B2 (en) 2014-07-17 2021-07-27 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US10179814B2 (en) 2014-07-17 2019-01-15 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US11135245B2 (en) 2014-11-17 2021-10-05 Adicet Bio, Inc. Engineered γδ T-cells
US10729790B2 (en) 2015-05-26 2020-08-04 Salk Institute For Biological Studies Motor neuron-specific expression vectors
US11642423B2 (en) 2015-05-26 2023-05-09 Salk Institute For Biological Studies Motor neuron-specific expression vectors
US9920100B2 (en) 2015-06-05 2018-03-20 The Chinese University Of Hong Kong Mimotopes of tropomyosin for use in immunotherapy for shellfish and/or arthropod allergy
WO2017182981A1 (en) 2016-04-20 2017-10-26 Washington University Ppar agonist or lxr agonist for use in the treatment of systemic lupus erythematosus by modulation of lap activity
US11299708B2 (en) 2016-05-12 2022-04-12 Adicet Bio, Inc. Methods for selective expansion of γδ T-cell populations and compositions thereof
WO2019099744A1 (en) 2017-11-15 2019-05-23 Adicet Bio, Inc. METHODS FOR SELECTIVE EXPANSION OF δ3 γδ T-CELL POPULATIONS AND COMPOSITIONS THEREOF
US11690872B2 (en) 2017-11-27 2023-07-04 Immatics US, Inc. Methods for expanding and activating γδ T cells for the treatment of cancer and related malignancies
WO2019104269A1 (en) 2017-11-27 2019-05-31 Immatics US, Inc. Methods for activating, modifying and expanding gamma delta t cells for the treatment of cancer and related malignancies
US11952420B2 (en) 2018-04-02 2024-04-09 Bristol-Myers Squibb Company Nucleic acids encoding anti-TREM-1 antibodies
US11919954B2 (en) 2018-04-02 2024-03-05 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
US11155618B2 (en) 2018-04-02 2021-10-26 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
WO2020097261A1 (en) 2018-11-06 2020-05-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services New compositions and methods for treating beta-globinopathies
US11325978B2 (en) 2018-11-06 2022-05-10 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Compositions and methods for treating beta-globinopathies
WO2020117862A1 (en) 2018-12-03 2020-06-11 Adicet Bio, Inc. Methods for selective in vivo expansion of gamma delta t-cell populations and compositions thereof
WO2020243134A1 (en) 2019-05-27 2020-12-03 Immatics US, Inc. Viral vectors and their use in adoptive cellular therapy
WO2021138581A1 (en) 2020-01-03 2021-07-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Tnap locally administered for promoting periodontal health
WO2021173560A1 (en) 2020-02-24 2021-09-02 Immatics US, Inc. Methods for expanding t cells for the treatment of cancer and related malignancies
WO2021183643A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. Wpre mutant constructs, compositions and methods thereof
DE102020106710A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
DE102020111571A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
WO2022147029A2 (en) 2020-12-31 2022-07-07 Immatics US, Inc. Cd8 polypeptides, compositions, and methods of using thereof
DE102021100038A1 (en) 2020-12-31 2022-06-30 Immatics US, Inc. MODIFIED CD8 POLYPEPTIDES, COMPOSITIONS AND METHODS OF USE THEREOF
WO2022157548A1 (en) 2021-01-24 2022-07-28 Forrest Michael David Inhibitors of atp synthase - cosmetic and therapeutic uses
WO2022240824A1 (en) 2021-05-13 2022-11-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for treating sickle cell diseases
WO2023004332A2 (en) 2021-07-19 2023-01-26 New York University Adeno-associated viral vector compositions and methods of promoting muscle regeneration
WO2023064255A2 (en) 2021-10-15 2023-04-20 The Regents Of The University Of California Diagnosis and treatment of anti-pf4 induced thrombocytopenia
WO2023081167A2 (en) 2021-11-02 2023-05-11 The Regents Of The University Of California P-selectin mutants and modulation of integrin-mediated signaling
WO2023131901A1 (en) 2022-01-07 2023-07-13 Johnson & Johnson Enterprise Innovation Inc. Materials and methods of il-1beta binding proteins
WO2023146807A1 (en) 2022-01-25 2023-08-03 The Regents Of The University Of California Vegf mutants and modulation of integrin-mediated signaling
WO2023200897A1 (en) 2022-04-13 2023-10-19 The Regents Of The University Of California Use of viral il-6 in cancer therapy
WO2023212655A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. Il-12 polypeptides, il-15 polypeptides, il-18 polypeptides, cd8 polypeptides, compositions, and methods of using thereof
WO2023212691A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. DOMINANT NEGATIVE TGFβ RECEPTOR POLYPEPTIDES, CD8 POLYPEPTIDES, CELLS, COMPOSITIONS, AND METHODS OF USING THEREOF
WO2023212697A1 (en) 2022-04-28 2023-11-02 Immatics US, Inc. Membrane-bound il-15, cd8 polypeptides, cells, compositions, and methods of using thereof
WO2023215825A1 (en) 2022-05-05 2023-11-09 Immatics US, Inc. Methods for improving t cell efficacy
WO2024013727A1 (en) 2022-07-15 2024-01-18 Janssen Biotech, Inc. Material and methods for improved bioengineered pairing of antigen-binding variable regions

Also Published As

Publication number Publication date
JPH07505773A (en) 1995-06-29
EP0633943A1 (en) 1995-01-18
CA2133411A1 (en) 1993-10-14
AU3940293A (en) 1993-11-08
EP0633943A4 (en) 1997-05-02

Similar Documents

Publication Publication Date Title
EP0633943A1 (en) Gene therapy using targeted viral vectors
Salmons et al. Targeting of retroviral vectors for gene therapy
ES2297831T3 (en) RETROVIRIC VECTORS THAT PRESENT A REDUCED RECOMBINATION RATE.
Tolstoshey Gene therapy, concepts, current trials and future directions
EP2344648B1 (en) Recombinant vectors
DE69534792T2 (en) ADMINISTRATION OF COMPLETE FACTOR VIII WITH THE HELP OF A RETROVIRAL SYSTEM
Frecha et al. Strategies for targeting lentiviral vectors
WO1993014188A1 (en) Targeted virus
WO1995030763A9 (en) Retroviral vectors having a reduced recombination rate
JPH10500852A (en) Safe vectors for gene therapy
JPH09509329A (en) Compositions and methods targeting gene delivery vehicles
JP4011604B2 (en) New grafts and new vectors for the treatment of acquired diseases
US20220169701A1 (en) Enveloped Virus Resistant to Complement Inactivation for the Treatment of Cancer
JP2002522090A (en) Cell type-specific gene transfer using a retroviral vector containing an antibody envelope fusion protein and a wild type envelope protein
JP2001501441A (en) Methods and compositions for inhibiting the production of replication competent viruses
US6448390B1 (en) Stable envelope proteins for retroviral, viral and liposome vectors and use in gene drug therapy
JP3908274B2 (en) Vector having a therapeutic gene encoding an antimicrobial peptide for gene therapy
US5736360A (en) Endothelial cell tropic compositions and methods of making and using the same
WO1999026480A1 (en) Anti-angiogenic gene therapy vectors and their use in treating angiogenesis-related diseases
AU2001234025B2 (en) Mutated cyclin g1 protein
US20020035079A1 (en) Mutated cyclin G1 protein
Dickler et al. Gene therapy in the treatment of disease
JPH10512276A (en) Delivery of therapeutics by gene therapy
AU780164B2 (en) Novel implant and novel vector for the treatment of acquired diseases
DE69829174T2 (en) EXPRESSION OF A MODIFIED "FOAMY VIRUS ENVELOPE PROTEIN" (SLEEP PROTEIN)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

EX32 Extension under rule 32 effected after completion of technical preparation for international publication

Free format text: KZ

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2133411

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1993908659

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1993908659

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1993908659

Country of ref document: EP