US20080107596A1

US20080107596A1 - Novel Method of Diagnosing, Monitoring, Staging, Imaging and Treating Breast Cancer

Info

Publication number: US20080107596A1
Application number: US11/752,338
Authority: US
Inventors: Susana Salceda; Robert Cafferkey; Herve Recipon; Yongming Sun
Original assignee: Diadexus Inc
Current assignee: Diadexus Inc
Priority date: 1999-11-23
Filing date: 2007-05-23
Publication date: 2008-05-08
Also published as: US7238471B1

Abstract

The present invention provides new markers and methods for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating breast cancer.

Description

INTRODUCTION

This patent application is a continuation of U.S. patent application Ser. No. 09/721,183, filed Nov. 22, 2000, which claims the benefit of priority from U.S. Provisional Application Ser. No. 60/166,973, filed Nov. 23, 1999, teachings of each of which are hereby incorporated by reference in their entirety.

FIELD OF THE INVENTION

This invention relates, in part, to newly identified breast cancer specific genes and assays for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating cancers, particularly breast cancer.

BACKGROUND OF THE INVENTION

It is estimated that one out of every nine women in America will develop breast cancer sometime during her life based on a lifespan of 85 years. Annually, over 180,000 women in the United States are diagnosed with breast cancer and approximately 46,000 die from this disease. Every woman is at risk for breast cancer. However, a woman's chances of developing breast cancer increase as she grows older; 80 percent of all cancers are found in women over the age of 50. There are also several risk factors that can increase a woman's chances of developing breast cancer. These include a family history of breast cancer, having no children or the first child after the age of 30, and an early start of menstruation. However, more than 70 percent of women who develop breast cancer have no known risk factors. Less than 10 percent of breast cancer cases are thought to be related to the BRCA1 gene discovered in 1994. Researchers are now investigating the role of other factors such as nutrition, alcohol, exercise, smoking, and oral contraceptives in development of this gynecologic cancer. Mammograms, or special x-rays of the breast, can detect more than 90 percent of all cancers.
Procedures used for detecting, diagnosing, monitoring, staging, and prognosticating breast cancer are of critical importance to the outcome of the patient. Patients diagnosed early generally have a much greater five-year survival rate as compared to the survival rate for patients diagnosed with distant metastasized breast cancer. New diagnostic methods which are more sensitive and specific for detecting early breast cancer are clearly needed.
Breast cancer patients are closely monitored following initial therapy and during adjuvant therapy to determine response to therapy and to detect persistent or recurrent disease or metastasis. Thus, there is also clearly a need for cancer markers which are more sensitive and specific in detecting breast cancer recurrence.
Another important step in managing breast cancer is to determine the stage of the patient's disease. Stage determination has potential prognostic value and provides criteria for designing optimal therapy. Generally, pathological staging of cancer is preferable over clinical staging because the former gives a more accurate prognosis. However, clinical staging would be preferred were it at least as accurate as pathological staging because it does not depend on an invasive procedure to obtain tissue for pathological evaluation. Staging of cancer would be improved by detecting new markers in cells, tissues or bodily fluids which could differentiate between different stages of invasion.
New breast cancer specific genes, referred to herein as BCSGs, have now been identified for use in diagnosing, monitoring, staging, imaging and treating cancers, and in particular breast cancer. Accordingly, the present invention relates to new methods for detecting, diagnosing, monitoring, staging, prognosticating, in vivo imaging and treating cancer via a BCSG. BCSG refers, among other things, to native proteins expressed by the genes comprising the polynucleotide sequences of BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5). Exemplary proteins expressed by genes BCSG-2 and BCSG-3 are depicted herein as SEQ ID NO:19 and SEQ ID NO:21. By “BCSG” it is also meant herein variant polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20 but which still encode the same proteins. In the alternative, what is meant by BCSG as used herein, means the native mRNAs encoded by the genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or it can refer to the actual genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5), or levels of polynucleotides which are capable of hybridizing under stringent conditions to the antisense sequences of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.
Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

SUMMARY OF THE INVENTION

Toward these ends, and others, it is an object of the present invention to provide BCSGs comprising a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof, a protein expressed by a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or variant thereof which expresses the protein; or a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.
Further provided is a method for diagnosing the presence of breast cancer by analyzing for changes in levels of BCSG in cells, tissues or bodily fluids compared with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein a change in levels of BCSG in the patient versus the normal human control is associated with breast cancer.
Further provided is a method of diagnosing metastatic breast cancer in a patient having breast cancer which is not known to have metastasized by identifying a human patient suspected of having breast cancer that has metastasized; analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissues, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.
Also provided by the invention is a method of staging breast cancer in a human by identifying a human patient having breast cancer; analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG; comparing BCSG levels in such cells, tissues, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of BCSG is associated with a cancer which is regressing or in remission.
Further provided is a method of monitoring breast cancer in a human patient for the onset of metastasis. The method comprises identifying a human patient having breast cancer that is not known to have metastasized; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.
Further provided is a method of monitoring the change in stage of cancer in a human patient having breast cancer by looking at levels of BCSG in the human patient. The method comprises identifying a human patient having breast cancer; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the levels of BCSG is associated with breast cancer which is regressing or in remission.
Further provided are methods of designing new therapeutic agents targeted to BCSGs for use in imaging and treating cancer. For example, in one embodiment, therapeutic agents such as antibodies targeted against a BCSG or fragments of such antibodies can be used to treat, detect or image localization of a BCSG in a patient for the purpose of detecting or diagnosing a disease or condition. In this embodiment, an increase in the amount of labeled antibody detected as compared to normal tissue would be indicative of tumor metastases or growth. Such antibodies can be polyclonal, monoclonal, or omniclonal or prepared by molecular biology techniques. The term “antibody”, as used herein and throughout the instant specification is also meant to include aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art. Antibodies can be labeled with a variety of detectable labels including, but not limited to, radioisotopes and paramagnetic metals. Therapeutics agents such as small molecule and antibodies or fragments thereof which decrease the concentration and/or activity of a BCSG can also be used in the treatment of diseases characterized by overexpression of BCSG. In these applications, the antibody can be used without or with derivatization to a cytotoxic agent such as a radioisotope, enzyme, toxin, drug or a prodrug.
Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

DESCRIPTION OF THE INVENTION

The present invention relates to diagnostic assays and methods, both quantitative and qualitative for detecting, diagnosing, monitoring, staging, prognosticating, in vivo imaging and treating breast cancer by comparing levels of breast cancer specific genes (BCSGs) with levels of BCSGs in a normal human control. BCSG refers, among other things, to native proteins expressed by the genes comprising the polynucleotide sequences of BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5). Exemplary proteins expressed by genes BCSG-2 and BCSG-3 are depicted herein as SEQ ID NO:19 and SEQ ID NO:21. The genes encoding these proteins (SEQ ID NO:18 and 20) as well as the proteins (SEQ ID NO:19 and 21) have been disclosed in GenBank as Accession No. AF016492.1 (SEQ ID NO:18), AAC27891.1 (SEQ ID NO:19), AF183819 (SEQ ID NO:20) and AAF23614.1 (SEQ ID NO:21). By “BCSG” it is also meant herein variant polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20 but which still encode the same proteins. The native protein being detected may be whole, a breakdown product, a complex of molecules or chemically modified. In the alternative, what is meant by BCSG as used herein, means the native mRNAs encoded by the genes comprising BCSG-1 or Gene ID 3323C9 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or it can refer to the actual genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or levels of polynucleotides which are capable of hybridizing under stringent conditions to the antisense sequences of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20. Such levels are preferably measured in at least one of, cells, tissues and/or bodily fluids, including determination of normal and abnormal levels. Thus, for instance, a diagnostic assay in accordance with the invention for diagnosing over-expression of a BCSG protein compared to normal control bodily fluids, cells, or tissue samples can be used to diagnose the presence of cancers, and in particular breast cancer. BCSGs may be measured alone in the methods of the invention, or, more preferably, in combination with other diagnostic markers for breast cancer including other BCSGs as described herein. Other breast cancer markers, in addition to BCSGs, useful in the present invention are known to those of skill in the art.

Diagnostic Assays

The present invention provides methods for diagnosing the presence of cancer, and in particular breast cancer, by analyzing for changes in levels of BCSG in cells, tissues or bodily fluids from a human patient compared with levels of BCSG in cells, tissues or bodily fluids of preferably the same type from a normal human control, wherein an increase in levels of BCSG in the patient versus the normal human control is associated with the presence of cancer.
Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the patient being tested has breast cancer is one in which cells, tissues, or bodily fluid levels of a cancer marker, such as BCSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues, or bodily fluid of a normal human control.
The present invention also provides a method of diagnosing metastatic cancer, and in particular metastatic breast cancer, in a patient having breast cancer which has not yet metastasized. In the method of the present invention, a human cancer patient suspected of having breast cancer which may have metastasized (but which was not previously known to have metastasized) is identified. This is accomplished by a variety of means known to those of skill in the art.
In the present invention, determining the presence of BCSG in cells, tissues, or bodily fluid, is particularly useful for discriminating between cancers which have not metastasized and cancers which have metastasized. Existing techniques have difficulty discriminating between breast cancer which has metastasized and breast cancer which has not metastasized. However, proper treatment selection is often dependent upon such knowledge.
In the present invention, one of the cancer marker levels measured in cells, tissues, or bodily fluid of a human patient is BCSG. Levels in the human patient are compared with levels of BCSG in preferably the same cells, tissue, or bodily fluid type of a normal human control. That is, if the cancer marker being observed is BCSG in serum, this level is preferably compared with the level of BCSG in serum of a normal human control. An increase in BCSG in the human patient versus the normal human control is associated with a cancer which has metastasized.
Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the cancer in the patient being tested or monitored has metastasized is one in which cells, tissues, or bodily fluid levels of a cancer marker, such as BCSG, are at least two times higher, and more preferably are at least five times higher, than in preferably the same cells, tissues, or bodily fluid of a normal human control.
Normal human control as used herein includes a human patient without cancer and/or non cancerous samples from the patient; in the methods for diagnosing metastasis or monitoring for metastasis, normal human control preferably includes samples from a human patient that is determined by reliable methods to have breast cancer which has not metastasized, such as samples from the same patient prior to metastasis.

Staging

The invention also provides a method of staging cancers in a human patient.
The method comprises identifying a human patient having breast cancer and analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG. The measured BCSG levels are then compared to levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the human patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the levels of BCSG is associated with breast cancer which is regressing or in remission.

Monitoring

Further provided is a method of monitoring breast cancer in a human patient for the onset of metastasis. The method comprises identifying a human patient having breast cancer that is not known to have metastasized; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; and comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.
Further provided by this invention is a method of monitoring the change in stage of breast cancer. The method comprises identifying a human patient having breast cancer; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; and comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing in stage and a decrease in the levels of BCSG is associated with breast cancer which is regressing in stage or in remission.
Monitoring such patients for onset of metastasis is periodic and preferably done on a quarterly basis. However, this may be performed more or less frequently depending on the cancer, the particular patient, and the stage of the cancer.

Prognostic Testing and Clinical Trial Monitoring

The methods described herein can further be utilized as prognostic assays to identify subjects having or at risk of developing a disease or disorder associated with increased levels of BCSG. The present invention provides a method in which a test sample is obtained from a human patient and BCSG is detected. The presence of higher BCSG levels as compared to normal human controls is diagnostic for the human patient being at risk for developing cancer, particularly breast cancer.
The effectiveness of therapeutic agents to decrease expression or activity of the BCSGs of the invention can also be monitored by analyzing levels of expression of the BCSGs in a human patient in clinical trials or in in vitro screening assays such as in human cells. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the human patient, or cells as the case may be, to the agent being tested.

Detection of Genetic Lesions or Mutations

The methods of the present invention can also be used to detect genetic lesions or mutations in BCSG, thereby determining if a human with the genetic lesion is at risk for breast cancer or has breast cancer. Genetic lesions can be detected, for example, by ascertaining the existence of a deletion and/or addition and/or substitution of one or more nucleotides from the BCSGs of this invention, a chromosomal rearrangement of BCSG, aberrant modification of BCSG (such as of the methylation pattern of the genomic DNA), the presence of a non-wild type splicing pattern of a mRNA transcript of BCSG, allelic loss of BCSG, and/or inappropriate post-translational modification of BCSG protein. Methods to detect such lesions in the BCSG of this invention are known to those of skill in the art.

Assay Techniques

Assay techniques that can be used to determine levels of gene expression, such as BCSG of the present invention, in a sample derived from a human are well-known to those of skill in the art. Such assay methods include radioimmunoassays, reverse transcriptase PCR (RT-PCR) assays, immunohistochemistry assays, in situ hybridization assays, competitive-binding assays, Western Blot analyses, ELISA assays and proteomic approaches, two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based approaches such as mass spectrometry or protein interaction profiling. Among these, ELISAs are frequently preferred to diagnose a gene's expressed protein in biological fluids.
An ELISA assay initially comprises preparing an antibody, if not readily available from a commercial source, specific to BCSG, preferably a monoclonal antibody. In addition a reporter antibody generally is prepared which binds specifically to BCSG. The reporter antibody is attached to a detectable reagent such as a radioactive, fluorescent or enzymatic reagent, for example horseradish peroxidase enzyme or alkaline phosphatase.
To carry out the ELISA, antibody specific to BCSG is incubated on a solid support, e.g., a polystyrene dish, that binds the antibody. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the sample to be analyzed is incubated in the dish, during which time BCSG binds to the specific antibody attached to the polystyrene dish. Unbound sample is washed out with buffer. A reporter antibody specifically directed to BCSG and linked to a detectable reagent such as horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to BCSG. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a calorimetric substrate are then added to the dish. Immobilized peroxidase, linked to BCSG antibodies, produces a colored reaction product. The amount of color developed in a given time period is proportional to the amount of BCSG protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.
A competition assay can also be employed wherein antibodies specific to BCSG are attached to a solid support and labeled BCSG and a sample derived from the patient or human control are passed over the solid support. The amount of label detected which is attached to the solid support can be correlated to a quantity of BCSG in the sample.
Using all or a portion of a nucleic acid sequence of a BCSG of the present invention as a hybridization probe, nucleic acid methods can also be used to detect BCSG mRNA as a marker for cancer, and in particular breast cancer. Polymerase chain reaction (PCR) and other nucleic acid methods, such as ligase chain reaction (LCR) and nucleic acid sequence based amplification (NASABA), can be used to detect malignant cells for diagnosis and monitoring of various malignancies. For example, reverse-transcriptase PCR (RT-PCR) is a powerful technique which can be used to detect the presence of a specific mRNA population in a complex mixture of thousands of other mRNA species. In RT-PCR, an mRNA species is first reverse transcribed to complementary DNA (cDNA) with use of the enzyme reverse transcriptase; the cDNA is then amplified as in a standard PCR reaction. RT-PCR can thus reveal by amplification the presence of a single species of mRNA. Accordingly, if the mRNA is highly specific for the cell that produces it, RT-PCR can be used to identify the presence of a specific type of cell.
Hybridization to clones or oligonucleotides arrayed on a solid support (i.e., gridding) can be used to both detect the expression of and quantitate the level of expression of that gene. In this approach, a cDNA encoding a BCSG gene is fixed to a substrate. The substrate may be of any suitable type including but not limited to glass, nitrocellulose, nylon or plastic. At least a portion of the DNA encoding the BCSG gene is attached to the substrate and then incubated with the analyte, which may be RNA or a complementary DNA (cDNA) copy of the RNA, isolated from the tissue of interest. Hybridization between the substrate bound DNA and the analyte can be detected and quantitated by several means including but not limited to radioactive labeling or fluorescence labeling of the analyte or a secondary molecule designed to detect the hybrid. Quantitation of the level of gene expression can be done by comparison of the intensity of the signal from the analyte compared with that determined from known standards. The standards can be obtained by in vitro transcription of the target gene, quantitating the yield, and then using that material to generate a standard curve.
Of the proteomic approaches, 2D electrophoresis is a technique well known to those in the art. Isolation of individual proteins from a sample such as serum is accomplished using sequential separation of proteins by different characteristics usually on polyacrylamide gels. First, proteins are separated by size using an electric current. The current acts uniformly on all proteins, so smaller proteins move farther on the gel than larger proteins. The second dimension applies a current perpendicular to the first and separates proteins not on the basis of size but on the specific electric charge carried by each protein. Since no two proteins with different sequences are identical on the basis of both size and charge, the result of a 2D separation is a square gel in which each protein occupies a unique spot. Analysis of the spots with chemical or antibody probes, or subsequent protein microsequencing can reveal the relative abundance of a given protein and the identity of the proteins in the sample.
The above tests can be carried out on samples derived from a variety cells, bodily fluids and/or tissue extracts (homogenates or solubilized tissue) obtained from the patient including tissue biopsy and autopsy material. Bodily fluids useful in the present invention include blood, urine, saliva, or any other bodily secretion or derivative thereof. Blood can include whole blood, plasma, serum, or any derivative of blood.

In Vivo Targeting of BCSGs/Breast Cancer Therapy

Identification of BCSGs is also useful in the rational design of new therapeutics for imaging and treating cancers, and in particular breast cancer. For example, in one embodiment, antibodies which specifically bind to BCSGs can be raised and used in vivo in patients suspected of suffering from cancer. Antibodies which specifically bind a BCSG can be injected into a patient suspected of having cancer for diagnostic and/or therapeutic purposes. The preparation and use of antibodies for in vivo diagnosis is well known in the art. For example, antibody-chelators labeled with Indium-111 have been described for use in the radioimmunoscintographic imaging of carcinoembryonic antigen expressing tumors (Sumerdon et al. Nucl. Med. Biol. 1990 17:247-254). In particular, these antibody-chelators have been used in detecting tumors in patients suspected of having recurrent colorectal cancer (Griffin et al. J. Clin. One. 1991 9:631-640). Antibodies with paramagnetic ions as labels for use in magnetic resonance imaging have also been described (Lauffer, R. B. Magnetic Resonance in Medicine 1991 22:339-342). Antibodies directed against BCSGs can be used in a similar manner. Labeled antibodies which specifically bind a BCSG can be injected into patients suspected of having breast cancer for the purpose of diagnosing or staging of the disease status of the patient. The label used will be selected in accordance with the imaging modality to be used. For example, radioactive labels such as Indium-111, Technetium-99m or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT). Positron emitting labels such as Fluorine-19 can be used in positron emission tomography. Paramagnetic ions such as Gadlinium (III) or Manganese (II) can be used in magnetic resonance imaging (MRI). Localization of the label permits determination of the spread of the cancer. The amount of label within an organ or tissue also allows determination of the presence or absence of cancer in that organ or tissue.
For patients diagnosed with cancer, and in particular breast cancer, injection of an antibody which specifically binds a BCSG can also have a therapeutic benefit. The antibody may exert its therapeutic effect alone. Alternatively, the antibody can be conjugated to a cytotoxic agent such as a drug, toxin or radionuclide to enhance its therapeutic effect. Drug monoclonal antibodies have been described in the art for example by Garnett and Baldwin, Cancer Research 1986 46:2407-2412. The use of toxins conjugated to monoclonal antibodies for the therapy of various cancers has also been described by Pastan et al. Cell 1986 47:641-648. Yttrium-90 labeled monoclonal antibodies have been described for maximization of dose delivered to the tumor while limiting toxicity to normal tissues (Goodwin and Meares Cancer Supplement 1997 80:2675-2680). Other cytotoxic radionuclides including, but not limited to Copper-67, Iodine-131 and Rhenium-186 can also be used for labeling of antibodies against BCSG.
Antibodies which can be used in these in vivo methods include polyclonal, monoclonal and omniclonal antibodies and antibodies prepared via molecular biology techniques. Antibody fragments and aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art can also be used.

Screening Assays

The present invention also provides methods for identifying modulators which bind to BCSG protein or have a modulatory effect on the expression or activity of BCSG protein. Modulators which decrease the expression or activity of BCSG protein are believed to be useful in treating breast cancer. Such screening assays are known to those of skill in the art and include, without limitation, cell-based assays and cell free assays.
Small molecules predicted via computer imaging to specifically bind to regions of BCSG can also be designed, synthesized and tested for use in the imaging and treatment of breast cancer. Further, libraries of molecules can be screened for potential anticancer agents by assessing the ability of the molecule to bind to the BCSGs identified herein. Molecules identified in the library as being capable of binding to BCSG are key candidates for further evaluation for use in the treatment of breast cancer. In a preferred embodiment, these molecules will downregulate expression and/or activity of BCSG in cells.

Adoptive Immunotherapy and Vaccines

Adoptive immunotherapy of cancer refers to a therapeutic approach in which immune cells with an antitumor reactivity are administered to a tumor-bearing host, with the aim that the cells mediate either directly or indirectly, the regression of an established tumor. Transfusion of lymphocytes, particularly T lymphocytes, falls into this category and investigators at the National Cancer Institute (NCI) have used autologous reinfusion of peripheral blood lymphocytes or tumor-infiltrating lymphocytes (TIL), T cell cultures from biopsies of subcutaneous lymph nodules, to treat several human cancers (Rosenberg, S. A., U.S. Pat. No. 4,690,914, issued Sep. 1, 1987; Rosenberg, S. A., et al., 1988, N. England J. Med. 319:1676-1680).
The present invention relates to compositions and methods of adoptive immunotherapy for the prevention and/or treatment of primary and metastatic breast cancer in humans using macrophages sensitized to the antigenic BCSG molecules, with or without non-covalent complexes of heat shock protein (hsp). Antigenicity or immunogenicity of the BCSG is readily confirmed by the ability of the BCSG protein or a fragment thereof to raise antibodies or educate naive effector cells, which in turn lyse target cells expressing the antigen (or epitope).
Cancer cells are, by definition, abnormal and contain proteins which should be recognized by the immune system as foreign since they are not present in normal tissues. However, the immune system often seems to ignore this abnormality and fails to attack tumors. The foreign BCSG proteins that are produced by the cancer cells can be used to reveal their presence. The BCSG is broken into short fragments, called tumor antigens, which are displayed on the surface of the cell. These tumor antigens are held or presented on the cell surface by molecules called MHC, of which there are two types: class I and II. Tumor antigens in association with MHC class I molecules are recognized by cytotoxic T cells while antigen-MHC class II complexes are recognized by a second subset of T cells called helper cells. These cells secrete cytokines which slow or stop tumor growth and help another type of white blood cell, B cells, to make antibodies against the tumor cells.
In adoptive immunotherapy, T cells or other antigen presenting cells (APCs) are stimulated outside the body (ex vivo), using the tumor specific BCSG antigen. The stimulated cells are then reinfused into the patient where they attack the cancerous cells. Research has shown that using both cytotoxic and helper T cells is far more effective than using either subset alone. Additionally, the BCSG antigen may be complexed with heat shock proteins to stimulate the APCs as described in U.S. Pat. No. 5,985,270.
The APCs can be selected from among those antigen presenting cells known in the art including, but not limited to, macrophages, dendritic cells, B lymphocytes, and a combination thereof, and are preferably macrophages. In a preferred use, wherein cells are autologous to the individual, autologous immune cells such as lymphocytes, macrophages or other APCs are used to circumvent the issue of whom to select as the donor of the immune cells for adoptive transfer. Another problem circumvented by use of autologous immune cells is graft versus host disease which can be fatal if unsuccessfully treated.
In adoptive immunotherapy with gene therapy, DNA of the BCSG can be introduced into effector cells similarly as in conventional gene therapy. This can enhance the cytotoxicity of the effector cells to tumor cells as they have been manipulated to produce the antigenic protein resulting in improvement of the adoptive immunotherapy.
BCSG antigens of this invention are also useful as components of breast cancer vaccines. The vaccine comprises an immunogenically stimulatory amount of an BCSG antigen. Immunogenically stimulatory amount refers to that amount of antigen that is able to invoke the desired immune response in the recipient for the amelioration, or treatment of breast cancer. Effective amounts may be determined empirically by standard procedures well known to those skilled in the art.
The BCSG antigen may be provided in any one of a number of vaccine formulations which are designed to induce the desired type of immune response, e.g., antibody and/or cell mediated. Such formulations are known in the art and include, but are not limited to, formulations such as those described in U.S. Pat. No. 5,585,103. Vaccine formulations of the present invention used to stimulate immune responses can also include pharmaceutically acceptable adjuvants.

EXAMPLES

The present invention is further described by the following examples. These examples are provided solely to illustrate the invention by reference to specific embodiments. These exemplifications, while illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed invention.

Example 1

Identification of BCSGs via CLASP

Identification of BCSGs (Breast Cancer Specific Genes) was carried out by a systematic analysis of data in the LIFESEQ Gold (LSGold) database available from Incyte Pharmaceuticals, Palo Alto, Calif. using the data mining Cancer Leads Automatic Search Package (CLASP) developed by diaDexus LLC, Santa Clara Calif.
The CLASP performs the following steps:
(1) Selection of highly expressed organ specific genes based on the abundance level of the corresponding EST in the targeted organ versus all the other organs.
(2) Analysis of the expression level of each highly expressed organ specific gene in normal, tumor tissue, disease tissue and tissue libraries associated with tumor or disease.
(3) Selection of the candidates wherein component ESTs are exclusively or more frequently found in tumor libraries.
The CLASP allows the identification of highly expressed organ and cancer specific genes. A final manual in depth evaluation is then performed to finalize the Organ Cancer Specific Genes (OCSGs) selection. Table 1 provides the BCSGs of the present invention identified using CLASP.

TABLE 1

BCSGs

BCSG	SEQ ID NO:	LSGold Clone ID	LSGold Gene ID

BCSG-1	1	none	332369
BCSG-2	2 or 18	none	480489
BCSG-3	3 or 20	none	274731
BCSG-4	4	none	173388
BCSG-5	5	3040232	411152

Example 2

Determination of mRNA Expression of BCSG-5

The mRNA expression level of BCSG, BCSG-5 (SEQ ID NO:5, Clone ID 3040232, Gene ID 411152), also referred to as MAM009, in different tissues was analyzed using Real-Time quantitative PCR. The results presented here for BCSG-5 support the usage of CLASP as a tool for identifying cancer diagnostic markers.
These experiments were carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. Routine molecular biology techniques were carried out as described in standard laboratory manuals, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
Real-Time quantitative PCR with fluorescent Taqman probes is a quantitation detection system utilizing the 5′-3′ nuclease activity of Taq DNA polymerase. The method uses an internal fluorescent oligonucleotide probe (Taqman) labeled with a 5′ reporter dye and a downstream, 3′ quencher dye. During PCR, the 5′-3′ nuclease activity of Taq DNA polymerase releases the reporter, whose fluorescence can then be detected by the laser detector of the Model 7700 Sequence Detection System (PE Applied Biosystems, Foster City, Calif., USA).
Amplification of an endogenous control is used to standardize the amount of sample RNA added to the reaction and normalize for Reverse Transcriptase (RT) efficiency. Either cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or 18S ribosomal RNA (rRNA) was used as this endogenous control. To calculate relative quantitation between all the samples studied, the target RNA levels for one sample were used as the basis for comparative results (calibrator). Quantitation relative to the “calibrator” can be obtained using the standard curve method or the comparative method (User Bulletin #2: ABI PRISM 7700 Sequence Detection System).
The tissue distribution, and the level of the target gene were determined for every sample in normal and cancer tissue. Total RNA was extracted from normal tissues, cancer tissues, and from cancers and the corresponding matched adjacent tissues. Subsequently, first strand cDNA was prepared with reverse transcriptase and the polymerase chain reaction was done using primers and Taqman probe specific to each target gene. The results were analyzed using the ABI PRISM 7700 Sequence Detector. The absolute numbers are relative levels of expression of the target gene in a particular tissue compared to the calibrator tissue.
Primers used for expression analysis include:

	BCSG-5 forward:
	ACCCCATTTAGCCTGCCAT	(SEQ ID NO: 6)

	BCSG-5 reverse:
	ATGGGAGTATCTCATCTGCTCTCA	(SEQ ID NO: 7)

	Q-PCR probe:
	TGTTTGTTCATTCTTCAATTCCAAGGCTTT	(SEQ ID NO: 8)

The absolute numbers depicted in Table 2 are relative levels of expression of BCSG-5 in 12 normal different tissues. All the values are compared to normal testis (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.

TABLE 2

Relative Levels of BCSG-5 Expression in Pooled
Samples

	Tissue	NORMAL

	Brain	0.00
	Heart	0.00
	Kidney	0.00
	Liver	0.00
	Lung	0.00
	Mammary gland	106.15
	Muscle	0.00
	Prostate	0.00
	Small Intestine	0.00
	Testis	1.00
	Thymus	0.00
	Uterus	0.00

The relative levels of expression in Table 2 show that BCSG-5 mRNA expression is detected in the pool of normal mammary gland and in testis but not in the other 10 normal tissue pools analyzed. The level of expression in mammary gland is more than 100 fold higher than in testis. These results demonstrate that BCSG-5 mRNA expression is highly specific for mammary gland tissue and is also found in testis. Expression in a male specific tissue is not relevant in detecting cancer in female specific tissues.

The absolute numbers in Table 2 were obtained analyzing pools of samples of a particular tissue from different individuals. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 3.
The absolute numbers depicted in Table 3 are relative levels of expression of BCSG-5 in 78 pairs of matching samples. All the values are compared to normal testis (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 2 unmatched cancer samples (from ovary) and 2 unmatched normal samples (from ovary) were also tested.

TABLE 3

Relative Levels of BCSG-5 Expression in Individual
Samples

			Matching
Sample			Normal
ID	Tissue	Cancer	Adjacent	Normal

MamS621	Mammary Gland 1	60.37	0.00
MamS516	Mammary Gland 2	1.97	1.09
MamS079	Mammary Gland 3	2.31	2.74
Mam517	Mammary Gland 4	3.42	2.71
Mam59X	Mammary Gland 5	0.47	9.56
MamS127	Mammary Gland 6	0.00	2.22
MamB011X	Mammary Gland 7	2.52	25.28
Mam522	Mammary Gland 8	109.66	2.67
Mam51DN	Mammary Gland 9	11.71	169.77
Mam19DN	Mammary Gland 10	369.64	28.24
MamS123	Mammary Gland 11	0.10	1.21
MamS997	Mammary Gland 12	8.80	2.29
Mam162X	Mammary Gland 13	7.67	1.08
Mam220	Mammary Gland 14	11.50	53.60
Mam699F	Mammary Gland 15	0.52	3.48
Mam42DN	Mammary Gland 16	1.39	3.54
Mam76DN	Mammary Gland 17	300.03	84.71
MamS854	Mammary Gland 18	2.77	2.64
MamS967	Mammary Gland 19	892.68	4.46
Mam986	Mammary Gland 20	14.40	19.27
MamS699	Mammary Gland 21	2.24	1.43
Mam355	Mammary Gland 22	223.37	0.00
MamA06X	Mammary Gland 23	1220.50	2.26
MamS570	Mammary Gland 24	0.00	120.39
MamS918	Mammary Gland 25	181.43	60.30
End12XA	Endometrium 1	0.00	0.00
End28XA	Endometrium 2	0.00	0.00
End3AX	Endometrium 3	0.00	0.00
End4XA	Endometrium 4	0.00	0.00
End5XA	Endometrium 5	0.00	0.00
End10479	Endometrium 6	0.00	0.00
End65RA	Endometrium 7	0.00	0.00
End68X	Endometrium 8	0.00	0.00
CvxNKS18	Cervix 1	0.00	0.00
CvxNKS54	Cervix 2	0.00	0.00
CvxNK23	Cervix 3	0.00	0.00
CvxNK24	Cervix 4	0.00	0.00
CvxKS52	Cervix 5	0.00	0.00
CvxKS83	Cervix 6	0.00	0.00
Utr141XO	Uterus 1	0.00	0.00
Utr135XO	Uterus 2	0.00	0.00
Utr23XU	Uterus 3	0.00	0.00
Utr85XU	Uterus 4	0.00	0.00
LngC20X	Lung 1	0.00	0.00
LngSQ56	Lung 2	0.00	0.00
Lng90X	Lung 3	0.00	0.00
LngAC11	Lung 4	0.00	0.00
Pro101XB	Prostate 1	0.00	0.00
Pro23B	Prostate 2	0.00	0.00
Skn448S	Skin 1	0.00	0.00
Skn784S	Skin 2	0.00	0.00
ClnSG45	Colon 1	0.00	0.00
ClnTX01	Colon 2	0.00	0.00
ClnAS46	Colon 3	0.00	0.00
ClnAS67	Colon 4	0.00	0.00
BldTR17	Bladder 1	0.00	0.00
Bld66X	Bladder 2	0.00	0.00
Kid11XD	Kidney 1	0.00	0.00
Kid5XD	Kidney 2	0.00	0.00
Kid109XD	Kidney 3	0.00	0.00
Liv532L	Liver 1	0.00	0.00
Liv175L	Liver 2	0.00	0.00
Liv187L	Liver 3	0.00	0.00
OvrG010	Ovary 1	0.00	0.00
Ovr1005O	Ovary 2	0.00
Ovr1028	Ovary 3	0.00
Ovr103X	Ovary 4	0.00	0.00
Ovr18GA	Ovary 5			0.00
Ovr206I	Ovary 6			0.00
Pan92X	Pancreas 1	0.00	0.00
PanC044	Pancreas 2	0.00	0.00
SmIH89	Small Intestine 1	0.00	0.00
SmI21XA	Small Intestine 2	0.00	0.00
Sto15S	Stomach 1	0.00	0.00
StoAC44	Stomach 2	0.00	0.00
Sto288S	Stomach 3	0.00	0.00
Sto531S	Stomach 4	0.00	0.00
Thr644T	Thyroid 1	0.00	0.00
Thr145T	Thyroid 2	0.00	0.00
Thr939T	Thyroid 3	0.00	0.00
Tst39X	Testis 1	0.00	0.00
Tst663T	Testis 2	0.00	0.00

0.00 = Negative

Among 160 samples in Table 3 representing 17 different tissues significant expression is seen only in mammary gland tissues. These results confirm the tissue specificity results obtained with normal samples shown in Table 2. Table 2 and Table 3 represent a combined total of 172 samples in 21 human tissue types. One hundred and twenty samples representing 20 different tissue types excluding mammary gland had no detectable level of BCSG-5 mRNA. Other than mammary gland, BCSG-5 is detected only in one tissue type (testis) and then only in the pooled tissue sample (Table 2) but not in the matched testis cancer samples (Table 3; testis 1 and 2).
Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 3. BCSG-5 is expressed at higher levels in 12 of 25 (48%) cancer samples (mammary gland 1, 2, 8, 10, 12, 13, 17, 19, 21, 22, 23 and 25) compared to normal adjacent tissue.
Altogether, the high level of tissue specificity, plus the mRNA overexpression in 48% of the mammary gland matching samples tested are indicative of BCSG-5, and more generally BCSGs selected by CLASP, being good diagnostic markers for breast cancer.

Example 3

Determination of mRNA Expression of BCSG-1

The mRNA expression level of BCSG, BCSG-1 (SEQ ID NO:1, Gene ID 332369), also referred to as MAM014 were also determined in accordance with methods as set forth in Example 2.
Real-Time quantitative PCR was done using the following primers:

BCSG-1 forward:
5′GCCCATTAGCACCCAGATAAT3′	(SEQ ID NO: 9)

BCSG-2 reverse:
5′GCCAACCCTTCACCTAAGAAA3′	(SEQ ID NO: 10)

Q-PCR probe
5′CTTCCCACTGTACAAAGATTTTCCAGGATG3′	(SEQ ID NO: 11)

The absolute numbers depicted in Table 4 are relative levels of expression of BCSG-1 in 37 normal samples from 25 different tissues. All the values are compared to normal kidney (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals; except for the blood samples that they are normal samples from a single individual.

TABLE 4

Relative Levels of BCSG-1 Expression in Pooled
Samples

	Tissue	NORMAL

	Adrenal Gland	1.09
	Bladder	0.05
	Brain	24.00
	Cervix	3.84
	Colon	0.00
	Endometrium	10.41
	Esophagus	0.18
	Heart	0.01
	Kidney	1.00
	Liver	0.02
	Lung	4.35
	Mammary	1.19
	Muscle	0.09
	Ovary	23.51
	Pancreas	0.86
	Prostate	7.75
	Rectum	0.33
	Small Intestine	0.85
	Spleen	17.51
	Stomach	2.42
	Testis	111.04
	Thymus	9.95
	Trachea	6.43
	Uterus	0.68
	Blood 1	34.42
	Blood 2	0.00
	Blood 3	21.19
	Blood 4	25.19
	Blood 5	51.09
	Blood 6	1144.10
	Blood 7	59.10
	Blood 8	60.13
	Blood 9	37.53
	Blood 10	0.00
	Blood 11	15.30
	Blood 12	0.00
	Blood 13	0.00

The relative levels of expression in Table 4 show that BCSG-1 mRNA expression is detected in the pool of normal mammary gland as well as in the other normal tissue analyzed.
The absolute numbers in Table 5 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 5.
The absolute numbers depicted in Table 5 are relative levels of expression of BCSG-1 in 77 pairs of matching samples. All the values are compared to normal kidney (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 3 unmatched cancer samples (from ovary) and 3 unmatched normal samples (from ovary) were also tested.

TABLE 5

Relative Levels of BCSG-1 Expression in Individual
Samples

			Matching
Sample			Normal
ID	Tissue	Cancer	Adjacent	Normal

MamS621	Mammary Gland 1	7.48	0.00
MamS516	Mammary Gland 2	0.90	0.00
Mam173M	Mammary Gland 3	3.96	0.00
Mam497M	Mammary Gland 4	9.71	0.00
MamS079	Mammary Gland 5	1.72	0.00
Mam517	Mammary Gland 6	8.88	3.35
Mam726M	Mammary Gland 7	3.04	0.00
Mam59X	Mammary Gland 8	7.01	15.73
MamS127	Mammary Gland 9	24.59	0.00
MamB011X	Mammary Gland 10	8.43	1.14
MamS22	Mammary Gland 11	14.55	0.00
Mam15DN	Mammary Gland 12	4.16	0.00
Mam51DN	Mammary Gland 13	32.90	3.11
Mam976M	Mammary Gland 14	6.17	0.00
Mam543M	Mammary Gland 15	34.42	0.32
Mam245M	Mammary Gland 16	10.82	0.00
MamS123	Mammary Gland 17	0.37	0.00
MamS997	Mammary Gland 18	0.56	0.00
Mam162X	Mammary Gland 19	6.09	0.52
Mam220	Mammary Gland 20	2.08	0.58
Mam699F	Mammary Gland 21	6.75	6.36
Mam42DN	Mammary Gland 22	10.16	0.00
Mam76DN	Mammary Gland 23	31.23	4.68
MamS854	Mammary Gland 24	6.11	0.00
MamS967	Mammary Gland 25	86.22	0.00
Mam986	Mammary Gland 26	13.36	9.00
MamS699	Mammary Gland 27	4.52	0.00
Mam355	Mammary Gland 28	107.38	0.00
MamA06X	Mammary Gland 29	43.26	0.00
MamS570	Mammary Gland 30	68.36	64.22
MamS918	Mammary Gland 31	2.49	0.86
Bld66X	Bladder	0.00	3.24
ClnTX01	Colon 1	0.55	0.00
ClnAS43	Colon 2	1.11	0.00
ClnAS49	Colon 3	0.69	0.60
ClnRS45	Colon 4	0.00	0.00
CvxNK24	Cervix 1	2.53	0.69
CvxNKS54	Cervix 2	1.71	0.54
CvxNK23	Cervix 3	0.34	0.00
CvxNKS81	Cervix 4	0.00	0.00
End5XA	Endometrium 1	1.16	2.85
End8911	Endometrium 2	2.62	1.65
End8963	Endometrium 3	6.50	0.00
End28XA	Endometrium 4	1.75	1.33
End65RA	Endometrium 5	0.45	0.00
End12XA	Endometrium 6	34.80	3.55
End3AX	Endometrium 7	0.00	0.00
Kid11XD	Kidney 1	0.94	1.42
Kid124D	Kidney 2	1.35	0.00
Liv532L	Liver 1	0.33	0.00
Liv390L	Liver 2	0.66	0.00
LngSQ56	Lung 1	0.00	0.00
Lng223L	Lung 2	0.20	0.00
LngLC71	Lung 3	7.67	8.20
LngAC90	Lung 4	11.70	0.98
Lng75XC	Lung 5	0.00	0.00
OvrA082	Ovary 1	21.33	42.96
OvrA082	Ovary 2	52.68	186.62
Ovr103X	Ovary 3	44.88	17.67
Ovr1005O	Ovary 4	6.89
Ovr1028	Ovary 5	0.44
Ovr1040O	Ovary 6	0.80
Ovr18GA	Ovary 7			6.63
Ovr206I	Ovary 8			1.46
Ovr20GA	Ovary 9			5.96
Pan92X	Pancreas 1	0.00	0.00
Pan77X	Pancreas 2	0.24	0.00
Pro23B	Prostate 1	0.80	0.00
Pro13XB	Prostate 2	0.05	17.75
Skn448S	Skin 1	0.00	0.00
Skn784S	Skin 2	0.13	0.11
SmIntH89	Small Intestine 1	0.00	0.00
Sto264S	Stomach 1	0.80	1.15
Sto15S	Stomach 2	0.23	2.29
Sto27S	Stomach 3	1.07	1.35
Thr644T	Thyroid 1	0.00	0.00
Thr143T	Thyroid 2	0.58	0.00
Tst663T	Testis 1	5.46	1.80
Tst647T	Testis 2	1.27	5.68
Utr23XU	Uterus 1	9.38	1.17
Utr85XU	Uterus 2	4.36	2.17
Utr141XO	Uterus 3	0.00	0.00
Utr135XO	Uterus 4	7.53	10.10

0.00 = Negative

Table 5 represents 160 samples in 17 different tissues. Table 4 and Table 5 represent a combined total of 197 samples in 27 human tissue types. Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 5. BCSG-1 is expressed at higher levels in 27 of 30 (90%) cancer samples (mammary gland 1-7, 9-20, 22-25, 27-29, and 31) compared to normal adjacent tissue.

Example 4

Determination of mRNA Expression of BCSG-2

The mRNA expression level of BCSG, BCSG-2 (SEQ ID NO:2 or 18, Gene ID 480489), also referred to as MAM013 were also determined in accordance with methods as set forth in Example 2.
Real-Time quantitative PCR was done using the following primers:

BCSG-2 forward:
5′CCTGGAGTTTTCAATTTCCTCA3′	(SEQ ID NO: 12)

BCSG-2 reverse:
5′CCCCAGAGAAAACACCACAA3′	(SEQ ID NO: 13)

Q-PCR probe
5′ACTCCTCCATTTCCTTAGGTAGGGGTTTG3′	(SEQ ID NO: 14)

The absolute numbers depicted in Table 6 are relative levels of expression of BCSG-2 in 37 normal samples from 25 different tissues. All the values are compared to normal liver (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals, except for the blood samples that they are normal samples from a single individual.

TABLE 6

Relative Levels of BCSG-2 Expression in Pooled
Samples

	Tissue	NORMAL

	Adrenal Gland	0.00
	Bladder	0.00
	Brain	0.00
	Cervix	0.00
	Colon	0.00
	Endometrium	0.33
	Esophagus	0.00
	Heart	0.02
	Kidney	0.28
	Liver	1.00
	Lung	0.07
	Mammary	20.39
	Muscle	0.00
	Ovary	0.00
	Pancreas	0.05
	Prostate	0.26
	Rectum	0.00
	Small Intestine	0.00
	Spleen	0.00
	Stomach	0.12
	Testis	1.55
	Thymus	0.55
	Trachea	1.23
	Uterus	0.00
	Blood 1	0.00
	Blood 2	0.00
	Blood 3	0.00
	Blood 4	0.00
	Blood 5	6.17
	Blood 6	0.00
	Blood 7	0.00
	Blood 8	0.00
	Blood 9	16.97
	Blood 10	0.00
	Blood 11	77.98
	Blood 12	0.00
	Blood 13	0.00

The relative levels of expression in Table 6 show that BCSG-2 mRNA expression is detected in the pool of normal mammary gland. The level of expression is higher than in the other tissues with the exception of two blood samples.
The absolute numbers in Table 6 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 7.
The absolute numbers depicted in Table 7 are relative levels of expression of BCSG-2 in 76 pairs of matching samples. All the values are compared to normal liver (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 3 unmatched cancer samples (from ovary) and 3 unmatched normal samples (from ovary) were also tested.

TABLE 7

Relative Levels of BCSG-2 Expression in
Individual Samples

			Matching
Sample			Normal
ID	Tissue	Cancer	Adjacent	Normal

MamS621	Mammary Gland 1	0.00	0.00
Mam173M	Mammary Gland 2	7.21	0.00
Mam497M	Mammary Gland 3	1634.92	31.12
MamS079	Mammary Gland 4	42.56	1.39
Mam517	Mammary Gland 5	2.42	4.21
Mam726M	Mammary Gland 6	0.00	6.75
Mam59X	Mammary Gland 7	0.00	16.11
MamS127	Mammary Gland 8	5.31	0.00
MamB011X	Mammary Gland 9	0.87	182.28
Mam522	Mammary Gland 10	480.47	0.18
Mam19DN	Mammary Gland 11	4.79	0.22
Mam51DN	Mammary Gland 12	19.49	72.76
Mam976M	Mammary Gland 13	62.25	0.00
Mam543M	Mammary Gland 14	103.97	0.00
Mam245M	Mammary Gland 15	49.01	615.24
MamS123	Mammary Gland 16	0.42	1.27
MamS997	Mammary Gland 17	0.24	0.66
Mam162X	Mammary Gland 18	0.45	1.39
Mam220	Mammary Gland 19	0.00	0.00
Mam699F	Mammary Gland 20	0.00	12.38
Mam42DN	Mammary Gland 21	44.48	11.47
Mam76DN	Mammary Gland 22	9.32	26.26
MamS854	Mammary Gland 23	6.50	103.61
MamS967	Mammary Gland 24	3.36	5.13
Mam986	Mammary Gland 25	7.67	65.12
MamS699	Mammary Gland 26	1.68	11.63
Mam355	Mammary Gland 27	1.32	0.00
MamA06X	Mammary Gland 28	1.73	0.26
MamS570	Mammary Gland 29	0.00	194.69
MamS918	Mammary Gland 30	0.07	0.13
Bld66X	Bladder	0.00	0.00
ClnTX01	Colon 1	0.00	0.00
ClnAS43	Colon 2	0.00	0.00
ClnAS49	Colon 3	0.00	0.00
ClnRS45	Colon 4	0.00	0.01
CvxNK24	Cervix 1	0.00	0.00
CvxNKS54	Cervix 2	0.00	0.00
CvxNK23	Cervix 3	0.02	0.00
CvxNKS81	Cervix 4	0.00	0.00
End5XA	Endometrium 1	0.00	0.00
End8911	Endometrium 2	0.00	0.00
End8963	Endometrium 3	0.00	0.00
End28XA	Endometrium 4	0.05	0.00
End65RA	Endometrium 5	0.00	0.00
End12XA	Endometrium 6	0.23	0.00
End3AX	Endometrium 7	0.00	0.05
Kid11XD	Kidney 1	0.04	0.00
Kid124D	Kidney 2	0.37	0.00
Liv532L	Liver 1	0.00	2.02
Liv390L	Liver 2	0.08	0.56
Lng223L	Lung 1	0.00	0.00
LngLC71	Lung 2	0.00	0.00
LngSQ56	Lung 3	0.00	0.00
LngAC90	Lung 4	0.00	0.00
Lng75XC	Lung 5	0.00	0.00
OvrA082	Ovary 1	0.00	0.00
OvrA082	Ovary 2	0.00	0.00
Ovr103X	Ovary 3	0.07	0.00
Ovr1005O	Ovary 4	1.09
Ovr1028	Ovary 5	0.00
Ovr1040O	Ovary 6	0.00
Ovr18GA	Ovary 7			0.00
Ovr206I	Ovary 8			0.00
Ovr20GA	Ovary 9			0.00
Pan92X	Pancreas 1	0.00	0.00
Pan77X	Pancreas 2	1.91	1.11
Pro23B	Prostate 1	0.01	0.00
Pro13XB	Prostate 2	0.00	0.00
Skn448S	Skin 1	0.00	0.00
Skn784S	Skin 2	0.00	0.00
SmIntH89	Small Intestine 1	0.00	0.02
Sto264S	Stomach 1	0.00	0.00
Sto15S	Stomach 2	0.04	0.00
Sto27S	Stomach 3	0.00	0.00
Thr644T	Thyroid 1	0.00	0.12
Thr143T	Thyroid 2	0.03	3.73
Tst663T	Testis 1	0.09	0.00
Tst647T	Testis 2	0.55	0.00
Utr23XU	Uterus 1	0.00	0.00
Utr85XU	Uterus 2	0.00	2.85
Utr141XO	Uterus 3	0.04	0.00
Utr135XO	Uterus 4	0.17	0.12

0.00 = Negative

Table 7 represents 158 samples in 17 different tissues. Table 6 and Table 7 represent a combined total of 195 samples in 25 human tissue types. Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 7. BCSG-2 is expressed at higher levels in 11 of 30 (37%) cancer samples (mammary gland 2-4, 8, 10, 11, 13, 14, 21, 27, 28) compared to normal adjacent tissue.

Example 5

Determination of mRNA Expression of BCSG-3

The mRNA expression level of BCSG, BCSG-3 (SEQ ID NO:3 or 20, Gene ID 274731), also referred to as MAM017 were also determined in accordance with methods as set forth in Example 2.
Real-Time quantitative PCR was done using the following primers:

	BCSG-3 forward:
	5′GAGCACTTCCTTTTGGTTTTTC3′	(SEQ ID NO: 15)

	BCSG-3 reverse:
	5′GCCCTAGCATATTCCAGAAGTTC3′	(SEQ ID NO: 16)

	Q-PCR probe
	5′TAGACAGTGGGCTCACATGTTCCTG	(SEQ ID NO: 17)
	ATAGTG3′

The absolute numbers depicted in Table 8 are relative levels of expression of BCSG-3 in 36 normal samples from 25 different tissues. All the values are compared to normal prostate (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals, except for the blood samples that they are normal samples from a single individual.

TABLE 8

Relative Levels of BCSG-3 Expression in Pooled
Samples

	Tissue	NORMAL

	Adrenal Gland	0.16
	Bladder	0.02
	Brain	0.12
	Cervix	1.41
	Colon	0.01
	Endometrium	3.77
	Esophagus	0.03
	Heart	0.02
	Kidney	0.07
	Liver	0.00
	Lung	0.59
	Mammary	7.67
	Muscle	0.08
	Ovary	0.94
	Pancreas	0.14
	Prostate	1.00
	Rectum	0.13
	Small Intestine	0.05
	Spleen	0.89
	Stomach	0.17
	Testis	0.20
	Thymus	0.56
	Trachea	0.39
	Uterus	1.22
	Blood 1	1.91
	Blood 2	1.76
	Blood 3	0.76
	Blood 4	0.18
	Blood 5	1.41
	Blood 6	1.54
	Blood 7	0.48
	Blood 8	1.92
	Blood 9	1.63
	Blood 10	1.65
	Blood 11	1.83
	Blood 12	0.37

The relative levels of expression in Table 8 show that BCSG-3 mRNA expression is detected in the pool of normal mammary gland with the highest expression value.
The absolute numbers in Table 8 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 9.
The absolute numbers depicted in Table 9 are relative levels of expression of BCSG-3 in 68 pairs of matching samples. All the values are compared to normal prostate (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 1 unmatched cancer sample (from ovary) and 1 unmatched normal sample (from ovary) were also tested.

TABLE 9

Relative Levels of BCSG-3 Expression in
Individual Samples

			Matching
Sample			Normal
ID	Tissue	Cancer	Adjacent	Normal

Mam497M	Mammary Gland 1	3.22	1.11
Mam173M	Mammary Gland 2	1.39	17.75
Mam726M	Mammary Gland 3	7.62	1.31
MamS516	Mammary Gland 4	11.08	0.10
MamS621	Mammary Gland 5	18.25	0.05
MamS079	Mammary Gland 6	0.78	0.24
Mam19DN	Mammary Gland 7	71.01	1.39
Mam522	Mammary Gland 8	3.35	0.16
MamS127	Mammary Gland 9	48.00	0.48
Mam162X	Mammary Gland 10	0.18	0.65
MamS123	Mammary Gland 11	49.69	0.00
MamS997	Mammary Gland 12	141.53	0.48
Mam543M	Mammary Gland 13	34.66	0.10
Mam976M	Mammary Gland 14	0.37	0.10
Mam74DN	Mammary Gland 15	35.14	4.36
MamS918	Mammary Gland 16	16.74	5.58
MamS854	Mammary Gland 17	1.11	1.58
Mam986	Mammary Gland 18	0.58	1.14
MamS967	Mammary Gland 19	121.94	2.97
Mam355	Mammary Gland 20	11.35	0.06
MamA06X	Mammary Gland 21	7.65	0.13
Bld32XK	Bladder 1	0.17	0.02
Bld66X	Bladder 2	0.17	0.13
BldTR17	Bladder 3	6.21	0.00
Bld46XK	Bladder 4	0.06	0.00
BldTR14	Bladder 5	0.79	0.19
ClnB56	Colon 1	0.12	0.10
ClnDC63	Colon 2	0.21	1.09
CvxKS52	Cervix 1	10.74	2.21
CvxNK24	Cervix 2	6.96	4.63
CvxKS83	Cervix 3	2.29	2.23
CvxNK23	Cervix 4	0.22	1.54
End10479	Endometrium 1	4.68	5.13
End12XA	Endometrium 2	1.68	2.00
End5XA	Endometrium 3	0.38	0.40
End65RA	Endometrium 4	0.49	0.38
End28XA	Endometrium 5	4.32	2.94
End3AX	Endometrium 6	0.21	0.21
Kid6XD	Kidney 1	0.06	0.16
Kid710K	Kidney 2	0.03	0.10
Liv175L	Liver 1	1.24	0.09
Liv187L	Liver 2	0.07	0.06
Liv15XA	Liver 3	0.02	0.01
Lng47XQ	Lung 1	0.15	0.06
LngAC88	Lung 2	1.78	0.95
LngAC90	Lung 3	0.46	0.00
LngSQ80	Lung 4	1.91	0.35
Ovr103X	Ovary 1	25.63	2.52
OvrA084	Ovary 2	7.70	3.19
OvrG010	Ovary 3	0.62	3.40
OvrG021	Ovary 4	0.09	0.45
Ovr1118	Ovary 5	0.13
Ovr32RA	Ovary 6			2.81
Pan77X	Pancreas 1	0.56	0.19
Pan82XP	Pancreas 2	0.62	0.73
Pro109XB	Prostate 1	0.00	0.10
Pro125XB	Prostate 2	0.05	0.01
Skn248S	Skin 1	0.94	0.02
Skn287S	Skin 2	0.36	0.05
SmIntH89	Small Intestine 1	0.12	0.04
SmInt21XA	Small Intestine 2	0.29	0.01
Sto115S	Stomach 1	1.17	0.44
Sto15S	Stomach 2	0.15	0.18
StoMT54	Stomach 3	0.12	0.18
Thr590D	Thyroid	3.46	3.33
Tst647T	Testis	1.06	0.24
Utr141XO	Uterus 1	2.86	0.51
Utr23XU	Uterus 2	0.60	0.13
Utr85XU	Uterus 3	12.21	1.43
Utr135XO	Uterus 4	2.98	3.93

0.00 = Negative

Table 9 represents 138 samples in 17 different tissues. Table 8 and Table 9 represent a combined total of 174 samples in 26 human tissue types.
Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 8. BSCG-3 is expressed at higher levels in 17 of 21 (81%) cancer samples (mammary gland 1, 3-6, 7-9, 11-16, 19-21) compared to normal adjacent tissue.

Claims

1. A BCSG comprising:

(a) a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof;

(b) a protein expressed by a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof; or

(c) a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.

2. The BCSG of claim 1 comprising a protein of SEQ ID NO:19 or 21.

3. A method for diagnosing the presence of breast cancer in a patient comprising:

(a) determining levels of a BCSG of claim 1 in cells, tissues or bodily fluids in a patient; and

(b) comparing the determined BCSG levels with levels of BCSG in cells, tissues or bodily fluids from a normal human control, wherein a change in determined levels of BCSG in said patient versus normal human control is associated with the presence of breast cancer.

4. A method of diagnosing metastases of breast cancer in a patient comprising:

(a) identifying a patient having breast cancer that is not known to have metastasized;

(b) determining levels of a BCSG of claim 1 in cells, tissues, or bodily fluid from said patient; and

(c) comparing the determined BCSG levels with levels of BCSG in cells, tissue, or bodily fluid of a normal human control, wherein an increase in determined BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

5. A method of staging breast cancer in a patient having breast cancer comprising:

(a) identifying a patient having breast cancer;

(b) determining levels of a BCSG of claim 1 in a sample of cells, tissue, or bodily fluid from said patient; and

(c) comparing determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in determined BCSG levels in said patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the determined BCSG levels is associated with breast cancer which is regressing or in remission.

6. A method of monitoring breast cancer in a patient for the onset of metastasis comprising:

(b) periodically determining levels of a BCSG of claim 1 in samples of cells, tissues, or bodily fluid from said patient; and

(c) comparing the periodically determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

7. A method of monitoring a change in stage of breast cancer in a patient comprising:

(a) identifying a patient having breast cancer;

(b) periodically determining levels of a BCSG of claim 1 in cells, tissues, or bodily fluid from said patient; and

(c) comparing the periodically determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing in stage and a decrease is associated with breast cancer which is regressing in stage or in remission.

8. A method of identifying potential therapeutic agents for use in imaging and treating breast cancer comprising screening molecules for an ability to bind to a BCSG of claim 1 wherein the ability of a molecule to bind to BCSG is indicative of the molecule being useful in imaging and treating breast cancer.

9. An antibody which specifically binds a BCSG of claim 1.

10. A method of imaging breast cancer in a patient comprising administering to the patient the antibody of claim 9.

11. The method of claim 10 wherein said antibody is labeled with paramagnetic ions or a radioisotope.

12. A method of treating breast cancer in a patient comprising administering to the patient the antibody of claim 9.

13. The method of claim 12 wherein the antibody is conjugated to a cytotoxic agent.

14. A method of treating breast cancer in a patient comprising administering to the patient a molecule which downregulates expression or activity of a BCSG of claim 1.

15. A method of inducing an immune response against a target cell expressing a BCSG of claim 1 comprising delivering to a human patient an immunogenically stimulatory amount of a BCSG protein of claim 1 so that an immune response is mounted against the target cell.

16. A vaccine for treating breast cancer comprising a BCSG of claim 1.