US20050267059A1 - Syk-targeted nucleic acid interference - Google Patents
Syk-targeted nucleic acid interference Download PDFInfo
- Publication number
- US20050267059A1 US20050267059A1 US10/989,718 US98971804A US2005267059A1 US 20050267059 A1 US20050267059 A1 US 20050267059A1 US 98971804 A US98971804 A US 98971804A US 2005267059 A1 US2005267059 A1 US 2005267059A1
- Authority
- US
- United States
- Prior art keywords
- syk
- strand
- seq
- antisense polynucleotide
- antisense
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/10—Protein-tyrosine kinases (2.7.10)
- C12Y207/10001—Receptor protein-tyrosine kinase (2.7.10.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Definitions
- Syk is an intracellular protein-tyrosine kinase that is widely expressed in hematopoietic cells, cells of the immune system and cells of epithelial lineages. Syk is involved in transducing signals from activated immunoglobulin receptors, such as Fc ⁇ receptors and Fc ⁇ receptors. Syk is also implicated in the signaling triggered by receptors for G-CSF, IL-2, IL-3, IL-5, GM-CSF, IL-15, various chemokines, IL-1 and erythropoietin. Thus Syk is a promiscuous messenger in various signal transduction pathways. Syk mediates diverse cellular responses, including proliferation, differentiation, and phagocytosis.
- Syk is implicated in a variety of disorders relating to the immune system, including autoimmune diseases, allergic reactions and asthma.
- Syk is implicated in immune thrombocytopenia.
- the pathogenic mechanism of immune thrombocytopenia involves antibody-mediated destruction of platelets in the reticuloendothelial system through Fc ⁇ receptors (Fc ⁇ Rs) expressed on tissue macrophages, particularly in the spleen and liver.
- Fc ⁇ Rs Fc ⁇ receptors
- Fc ⁇ Rs signal via immunoreceptor tyrosine-based activation motifs (ITAMs) that are located either in the cytosolic domains of the receptors themselves (Fc ⁇ RIIA), or within associated ⁇ (Fc ⁇ RI and Fc ⁇ RIIIA) or ⁇ (Fc ⁇ RIIIA) subunits.
- ITAMs immunoreceptor tyrosine-based activation motifs
- tyrosine residues within the ITAMs become phosphorylated.
- the tyrosine-phosphorylated residues of the ITAMs serve as high affinity binding sites for Syk, a tyrosine kinase that contains tandem SH2 domains.
- Macrophages and neutrophils derived from the fetal livers of Syk-deficient mice fail to ingest IgG-coated particles. Also, decreased expression of Syk in monocytes using Syk antisense olignucleotides results in the decreased ability of these cells to ingest IgG-coated particles.
- An object of the present disclosure is to provide nucleic acid agents that inhibit Syk expression and to provide methods of using such agents for therapeutic purposes.
- RNAi constructs that target Syk and decrease Syk expression.
- Such constructs may be used in essentially any method where it is desirable to decrease the level of Syk protein.
- the disclosed nucleic acids will be useful in treating various disorders related to immune system function, such as immune thrombocytopenia and asthma.
- RNAi constructs for inhibiting the expression of Syk.
- Such nucleic acids may comprise (a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and (b) a sense polynucleotide that hybridizes to said antisense polynucleotide.
- the antisense and sense strands may be two separate nucleic acid strands, or the strands may be joined by a linker or by a stretch of further nucleic acid.
- the RNAi construct may be a single stranded nucleic acid containing two regions that are complementary, thereby forming a hairpin nucleic acid with a stretch of double-stranded helix.
- hairpin nucleic acids are often processed into an siRNA inside a cell.
- the portion of the nucleic acid that forms a double helix is about 19 to about 23 base pairs in length.
- the antisense polynucleotide strand may be complementary to a sequence of the human Syk mRNA of SEQ ID NO:1, or that of another animal of interest, such as mouse or rat.
- the antisense polynucleotide strand may be complementary to at least 5, 6, 7, 8, 10, 15, 20 or more nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
- the antisense polynucleotide may consist of a sequence that is complementary to a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
- the sense and antisense strands may be essentially any suitable nucleic acid, including RNA, DNA or other nucleic acid species that are not readily categorized as DNA or RNA.
- the sense and antisense strands need not be formed of the same nucleic acids.
- Either or both strands may include one or more modifications to the typical nucleic acid structure.
- the antisense strand may comprise one or more of the following modifications: (a) a modification to the sugar-phosphate backbone; (b) a modification to a base portion of a nucleotide; and (c) a conjugated hydrophobic moiety.
- the sense strand may be similarly modified.
- RNAi constructs may be formulated for administration to an organism.
- a pharmaceutical preparation for delivery of an RNAi construct to an organism may comprise a pharmaceutically acceptable carrier and an RNAi construct that inhibits expression of Syk.
- the preparation may be suitable for any desirable mode of administration. In certain instances, such as for the treatment of asthma or other disorders of the airway system, the preparation may be designed for administration by inhalation (e.g., aerosolized or intranasal).
- the disclosure provides methods for decreasing expression of Syk in a cell. Such methods may comprise contacting the cell with a composition comprising an RNAi construct that inhibits Syk expression.
- the disclosure provides methods for decreasing expression of Syk in one or more cells of an individual. Such methods may comprise administering to the individual a composition comprising a double-stranded nucleic acid that inhibits Syk expression.
- the individual may be diagnosed with a condition associated with excess Fc receptor activity or with any of a variety of disorders related to the immune system, such as asthma, immune thrombocytopenia or an autoimmune disease.
- the disclosure provides improved assays for measuring phagocytosis of target material in phagocytic cells.
- the methods employ phagocytic cells from a cell line, particularly a cell of a hematopoietic lineage, such a monoblastic cell line or other immune cell line. Desirable cells will generally express one or more Fc ⁇ receptors that mediate phagocytosis of opsonized material, such as Fc ⁇ RIIA.
- a method may comprise (a) exposing target material to antibody to generate prepared target material; (b) exposing the phagocytic cells to the prepared target material; and (c) selectively detecting the prepared target material that is internalized by the phagocytic cells.
- the target material will often be cells, particularly platelets.
- phagocytic cells are generally take up materials non-specifically, and therefore other materials, such as microbeads, may be used as a target material.
- Target material may be labeled in a variety of ways to facilitate detection, and target material may be pre-labeled or labeled upon exposure to antibody.
- the label may, for example, be a fluorescent label.
- the label is a fluorescent label, and selectively detecting the prepared target material comprises selectively quenching any extracellular label.
- detection of the fluorescent signal necessarily detects signal from unquenched fluorophore within the phagocytic cells.
- FIG. 1 Human monocytic cell line, THP-1 cells phagocytose anti-HPA-1a antisera coated human platelets.
- THP-1 cells incubated with normal sera coated human platelets at 4° C. (upper row), or with anti-HPA-1a antisera coated human platelets at 4° C. (second row), or with normal sera coated human platelets at 37° C. (third row), and with anti-HPA-1a antisera coated human platelets at 37° C. (bottom row).
- Human platelets were labeled with CFDA followed by incubating with normal sera or anti-HPA-1a antisera. Then the platelets were incubated with THP-1 cells. The fluorescence of phagocytosed THP-1 cells were analyzed by flow cytometry.
- FIG. 2 Syk siRNA leads to specific down-regulation of Syk protein and inhibits antibody mediated platelet phagocytosis.
- Western blot analysis of Syk in THP-1 cells after siRNA treatment Lane 1, Mock treated THP-1 cells; Lane 2, control siRNA treated THP-1 cells; Lane 3, Syk-187 treated THP-1 cells; Lane 4, Syk-334 treated THP1 cells.
- Intracellular proteins were immunoprecipitated by anti-CD32 (Fc ⁇ RIIA) mAb followed by SDS-PAGE. Protein bands were immunoblotted by either anti-Syk mAb or anti-CD32 mAb as control.
- FIG. 3 Syk siRNA inhibits antibody mediated platelets phagocytosis.
- CFDA-labeled and anti-HPA-1a coated platelets incubated with mock treated THP-1 cells (top row), or control-siRNA treated THP-1 cells (second row), or Syk-187 treated THP-1 cells (third row), and Syk-334 treated THP-1 cells (bottom row) followed by fluorescence analysis by flow cytometry.
- RNA interference constructs that are useful for inhibiting Syk expression.
- RNAi construct is a generic term used to include any of the various nucleic acid reagents that can be used to achieve a decrease in the levels of a targeted protein. Such decrease, however achieved, shall be referred to herein as a decrease in “expression” of the protein. While not wishing to be bound to any particular mechanism, it is expected that such constructs will act by an RNA interference (“RNAi”) mechanism.
- RNAi RNA interference
- Such constructs may be, for example, small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs.
- an RNAi construct may include a single nucleic acid molecule, as in the case of hairpin RNAs, or two nucleic acid molecules, as in the case of siRNAs, or more nucleic acid molecules. Nonetheless, an RNAi construct will generally include at least some portion in which, under physiological conditions, a double helix is formed, where such double helix may result from intramolecular hybridization or intermolecular hybridization.
- RNAi is a term that was initially applied only with respect to RNA molecules, it is now understood that the same effect may be accomplished with modified nucleic acids that are not necessarily RNA, and also with molecules containing one or more DNA moieties. Constructs including any of the various nucleic acids are intended to be included in the term “RNAi construct”.
- nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the term should also be understood to include, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
- the “canonical” nucleotides are adenosine (A), guanosine (G), cytosine (C), thymidine (T), and uracil (U), and include a ribose-phosphate backbone, but the term nucleic acid is intended to include polynucleotides comprising only canonical nucleotides as well as polynucleotides including one or more modifications to the sugar phosphate backbone or the nucleoside.
- DNA and RNA are chemically different because of the absence or presence of a hydroxyl group at the 2′ position on the ribose. Modified nucleic acids exist that cannot be readily termed DNA or RNA (e.g.
- nucleic acid in which an entirely different moiety is positioned at the 2′ position
- functional analogs such as peptide nucleic acids (PNAs) in which the backbone is a peptide backbone, in which the backbone contains neither sugar nor phosphate. All such molecules are included in the term “nucleic acid”.
- PNAs peptide nucleic acids
- An “unmodified” nucleic acid is a nucleic acid that contains only canonical nucleotides and a DNA or RNA backbone.
- RNA interference is a phenomenon describing double-stranded nucleic acid-dependent gene specific posttranscriptional silencing. Initial attempts to harness this phenomenon for experimental manipulation of mammalian cells were foiled by a robust and nonspecific antiviral defense mechanism activated in response to long dsRNA molecules. Gil et al. Apoptosis 2000, 5:107-114. The field was significantly advanced upon the demonstration that synthetic duplexes of 21 nucleotide RNAs could mediate gene specific RNAi in mammalian cells, without invoking generic antiviral defense mechanisms. Elbashir et al. Nature 2001, 411:494-498; Caplen et al. Proc Natl Acad Sci 2001, 98:9742-9747.
- siRNAs small-interfering RNAs
- Human Syk mRNA (Genbank NM_003177; gi:34147655; SEQ ID NO:1) 1 aggaagagcc gcgggcccgg cggctgaggc caccccggcg gcggctggag agcgaggagg 61 agcgggtggc cccgcgctgc gcccctcacctg gcgcaggtgg acacctgcgc 121 aggtgtgtgcccccggcccccctgaagcatg gccagcagcg gccaac 181 cacctgccct ttttcgg caacatcacc cgggaggagg cagaagatta cctgg
- Suitable nucleic acid constructs may be designed by selecting a target region of a Syk mRNA sequence, such as that of the human, listed above, or that of mouse (Genbank reference no. NP — 035648) or other animal, and preparing a construct having a polynucleotide strand that hybridizes to the selected region of the mRNA (the “antisense strand”) and a polynucleotide that hybridizes to the antisense strand (the “sense strand”). Constructs designed at random are unlikely to inhibit Syk expression. While it is possible to screen through large numbers of such constructs to identify those that are effective, it is generally desirable to follow a procedure for selecting target regions that have an improved likelihood of success.
- RNAse may employ the algorithm of Elbashir et al. (EMBO J. 20: 6877-6888, 2001) to select an appropriate target region and generate a construct with a higher chance of being effective. Briefly, this approach involves identifying nucleotide sequences in the target mRNA that begin with an AA dinucleotide and have a length of 21 nucleotides. siRNAs with other 3′ terminal dinucleotide overhangs have been shown to effectively induce RNAi, although overhang sequences containing a GG dinucleotide may be cleaved by RNAse.
- Double-stranded nucleic acid constructs may be evaluated for effectiveness by administering the construct to a cell and evaluating the effect on Syk protein levels, kinase activity or another feature that is correlated with Syk expression. Different nucleic acid constructs will tend to affect Syk expression to different degrees, and it will not always be apparent what percent inhibition of Syk expression will achieve the desired effects. Accordingly, double-stranded nucleic acid constructs may also be evaluated for effectiveness in one or more bioassays. For example, Syk-targeted constructs may be tested for effects on antibody mediated platelet phagocytosis to assess the effect on Fc ⁇ -mediated events. As another example, Syk-targeted constructs may be tested for effects on mast cell degranulation. Examples of such assays are provided below.
- Mouse Syk-1 AATGCATCAACTACTACAAGT (SEQ ID NO: 16)
- Mouse Syk-2 AACCTGTGCTGGACTTACGAT (SEQ ID NO: 17)
- Mouse Syk-3 AATTACTACTACGACGTGGTT (SEQ ID NO: 18)
- Mouse Syk-4 AACTGAGGCTTCGCAATTACT (SEQ ID NO: 19)
- RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15 are effective in reducing Syk protein levels. See Example 1, Table 4.
- RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 5, 7, 8, 10, 11, 12, 13, and 14 are effective in reducing Syk protein levels by greater than 30%, while those containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10, and 11 are effective in reducing Syk protein levels by greater than 60%.
- RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 8, 10, 11, 12, 14 and 15 are effective in reducing phagocytosis of opsonized platelets, while those containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10, 14 and 15 are effective in reducing phagocytosis of opsonized platelets by greater than 30%.
- an RNAi construct that produces an effect in a phagocytosis bioassay, such as an RNAi construct having an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 8, 10, 11, 12, 14 and 15.
- an RNAi construct that causes a measurable decrease in Syk protein levels, such as an RNAi construct containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos.
- RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10 and 14 are particularly notable for having a strong effect on Syk protein levels and on platelet phagocytosis.
- RNAi constructs may be designed to contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (i.e., the “target” gene) and is sufficient for decreasing the expression of the protein encoded by the target gene.
- the nucleotide sequence of the RNAi construct may hybridize to coding or non-coding portions of a transcript, including, for example, the 3′ and 5′ untranslated regions (“UTRs”).
- UTRs 3′ and 5′ untranslated regions
- the RNAi construct need only be sufficiently similar to natural RNA that it has the ability to be effective. Thus, sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence may be tolerated.
- the number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3′ end of the siRNA antisense strand do not significantly contribute to specificity of the target recognition.
- Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the interfering RNA and the portion of the target gene is preferred.
- the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing).
- a portion of the target gene transcript e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing).
- RNAi constructs can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro.
- RNAi constructs may include modifications to the phosphate-sugar backbone and/or the nucleoside.
- the sense strand does not directly participate in the formation of a silencing complex (RISC) and is therefore subject to few constraints in the number and type of modifications that may be introduced.
- RISC silencing complex
- the sense strand need only retain the ability to hybridize with the antisense strand, and, in the case of longer nucleic acids, should not interfere with the activity of RNAses, such as Dicer, that participate in cleaving longer double-stranded constructs to yield smaller, active siRNAs.
- the antisense strand should retain the ability to hybridize with both the sense strand and the target transcript, and the ability to form an RNAi induced silencing complex (RISC).
- the sense strand comprises at least 20%, 30%, 50%, 70%, 90% and 100% modified nucleic acids.
- the antisense strand comprises no more than 0%, 10%, 20%, 30%, 40% or 50% modified nucleic acids. Modifications may be useful for, e.g., reduced susceptibility to nucleases, improved bioavailability, improved formulation characteristics, and changed pharmacokinetic properties. Many nucleases are progressive enzymes that initiate degradation at one end of a nucleic acid.
- resistance to nucleases may be conferred by modification of, for example, one, two, three or more nucleotides at either the 5′end, the 3′end or both ends of a sense or antisense strand.
- one, two or three phosphorothioate linkages may be positioned at either the 5′end, the 3′end or both ends of a sense or antisense strand.
- one, two or three 2′ O-methyl modified nucleotides may be positioned at either the 5′end, the 3′end or both ends of a sense or antisense strand.
- RNAi constructs see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J Mol Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61).
- RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2′-substituted ribonucleosides, a-configuration).
- Additional modified nucleotides are as follows (this list contains forms that are modified on either the backbone or the nucleoside or both, and is not intended to be all-inclusive): 2′-O-Methyl-2-aminoadenosine; 2′-O-Methyl-5-methyluridine; 2′-O-Methyladenosine; 2′-O-Methylcytidine; 2′-O-Methylguanosine; 2′-O-Methyluridine; 2-Amino-2′-deoxyadenosine; 2-Aminoadenosine; 2-Aminopurine-2′-deoxyriboside; 4-Thiothymidine; 4-Thiouridine; 5-Methyl-2′-deoxycytidine; 5-Methylcytidine; 5-Methyluridine; 5-Propynyl-2′-deoxycytidine; 5-Propynyl-2′-deoxyuridine; N1
- the double-stranded structure may be formed by a single self-complementary nucleic acid strand or by two complementary nucleic acid strands.
- a double-stranded nucleic acid disclosed herein may include portions of single-stranded nucleic acid.
- Duplex formation may be initiated either inside or outside the cell.
- the RNAi construct may be introduced in an amount that allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
- the subject nucleic acid constructs are “small interfering RNAs” or “siRNAs.” These nucleic acids include an antisense RNA strand that is from about 19 to about 30 nucleotides in length, and possibly from about 21 to 23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease “dicing” of long double-stranded RNAs.
- siRNAs may include a sense strand that is RNA, DNA or other modified nucleic acids. The siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex.
- SiRNA molecules can be obtained using a number of techniques known to those of skill in the art.
- the siRNA can be chemically synthesized or recombinantly produced using methods known in the art.
- short sense and antisense oligomers can be synthesized and annealed to form double-stranded structures with 2-nucleotide overhangs at each end (Caplen, et al. (2001) Proc Natl Acad Sci USA, 98:9742-9747; Elbashir, et al. (2001) EMBO J, 20:6877-88).
- These double-stranded siRNA structures can then be introduced into cells, either by passive uptake or a delivery system of choice, such as described below.
- the siRNA constructs can be generated by the processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer.
- the Drosophila in vitro system is used.
- dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination.
- the combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides.
- modifications should be selected so as to not interfere with the activity of the RNAse.
- the siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.
- gel electrophoresis can be used to purify siRNAs.
- non-denaturing methods such as non-denaturing column chromatography
- chromatography e.g., size exclusion chromatography
- glycerol gradient centrifugation glycerol gradient centrifugation
- affinity purification with antibody can be used to purify siRNAs.
- At least one strand of an siRNA has a 3′ overhang consisting of from about 1 to about 6 nucleotides.
- the overhang may consist of from about 2 to about 4 nucleotides.
- the 3′ overhangs consist of about 1 to about 3 nucleotides.
- one strand has a 3′ overhang and the other strand is either blunt-ended or also has a 3′ overhang.
- the length of the overhangs may be the same or different for each strand. In order to further enhance the stability of the siRNA, the 3′ overhangs can be stabilized against degradation.
- the RNA antisense strand is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
- purine nucleotides such as adenosine or guanosine nucleotides.
- substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotide 3′ overhangs by 2′-deoxythyinidine is tolerated and does not affect the efficiency of RNAi.
- the absence of a 2′ hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium and may be beneficial in vivo.
- a sense or antisense strand may be conjugated to one or more additional moieties to improve properties such as stability, cellular uptake or pharmacokinetics.
- Hydrophobic moieties such as lipids and sterols, such as cholesterol, may be conjugated to a sense or antisense strand. See for example, Lorenz et al. Bioorg. Med. Chem. Lett. 14, 4975-4977 (2004) and Soutscheck et al. Nature 2004, 432:173-178.
- a sense or antisense strand may include one, two, three or more such hydrophobic moieties.
- an RNAi construct is in the form of a hairpin structure.
- the hairpin can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature 2002, 418:38-9; McManus et al., RNA 2002, 8:842-50; Yu et al., Proc Natl Acad Sci USA, 2002, 99:6047-52).
- hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene.
- siRNAs can be produced by the processing of a hairpin RNA in the cell.
- the single strand portion connecting the sense and antisense portions should be designed so as to be cleavable by nucleases in vivo, and any duplex portion should be susceptible to processing by nucleases such as Dicer.
- RNAi acid constructs disclosed herein may be used in essentially any in vivo or in vitro setting where inhibition of Syk expression is desirable.
- Syk-targeted nucleic acid constructs may be used to treat a variety of diseases related to the immune system.
- Syk inhibition may be useful in the treatment of autoimmune diseases, particularly those characterized by interactions of immune complexes (eg, IgG-containing immune complexes) with Fc receptors (for example, those present on the surface of macrophages).
- Diseases such as immune cytopenias (e.g.
- RNAi constructs disclosed herein may be treated with RNAi constructs disclosed herein. See, e.g., Samuelsson et al. 2001 Science 291:484.
- Syk inhibition may also be useful in the treatment of allergic disorders and asthma.
- Mast cells play a critical role in asthma and allergic disorders by releasing pro-inflammatory mediators and cytokines.
- Antigen-mediated aggregation of Fc ⁇ RI results in activation of mast cells. This triggers a series of signaling events resulting in the release of mediators, including histamine, proteases, leukotrienes and cytokines. These mediators cause increased vascular permeability, mucus production, bronchoconstriction, tissue degradation and inflammation, thus playing key roles in the etiology and symptoms of asthma and allergic disorders.
- Syk activation is a key event in the signaling pathway following the activation of mast cells.
- Syk kinase acts as a central initiator of subsequent signaling leading to mediator release.
- Syk inhibitors block the release of mediators in stimulated mast cells, and Syk activators stimulate events leading to mediator release normally induced by clustering of Fc ⁇ RI.
- Double-stranded nucleic acids that inhibit Syk expression may be used in treating inflammatory and allergic disorders including asthma, chronic obstructive pulmonary disease (COPD), adult respiratory distress syndrome (ARDS), ulcerative colitis, Crohn's disease, bronchitis, conjunctivitis, psoriasis, scleroderma, urticaria, dermatitis and allergic rhinitis.
- COPD chronic obstructive pulmonary disease
- ARDS adult respiratory distress syndrome
- bronchitis conjunctivitis
- psoriasis scleroderma
- urticaria dermatitis and allergic rhinitis.
- Syk is expressed in other cells of the hematopoietic lineages including B cells, where it is thought to play an essential role in transducing signals required for the transition of immature B cells into mature B cells (M. Turner et al., Immunology Today, 2000, 21, 148). B cells are reported to play an important role in some inflammatory conditions such as lupus (O. T. Chan et al., Immunological Rev., 1999, 169, 107) and rheumatoid arthritis (A. Gause and C. Borek, Biodrugs, 2001, 15, 73). Therefore, double-stranded nucleic acids that inhibit Syk expression may be used in treating such disorders. Other cell types in which Syk is active include dendritic cells and lymphocytes, and therefore, disorders associated with abnormal activity of such cells may be treated by administration of a double-stranded nucleic acid disclosed herein.
- Syk is expressed in platelets and mediates signaling from Fc ⁇ R that leads to activation in platelets. Chacko et al. J. Biol. Chem. 271(18):10775-81, 1996. Thus inhibition of Syk may be useful in patients at risk for thrombosis, and particularly thrombosis mediated by Fc ⁇ R signaling.
- Syk inhibitors may be administered to heparinized patients to reduce the risk of heparin induced thrombocytopenia. Syk inhibitors may also be used in diabetic patients to reduce the risk of arterial thrombosis in these patients. Calverley et al. Br. J. Haemat. 121(1):139-42, 2003.
- Syk was also reported to be an element of the signaling cascade in beta-amyloid and prion fibrils leading to production of neurotoxic products (C. K. Combs et al., J. Neurosci., 1999, 19, 928). Double-stranded nucleic acids that inhibit Syk expression may be used in treating Alzheimer's disease and related neuroinflammatory diseases.
- RNAi constructs disclosed herein may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, polymers, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption of the constructs.
- the subject RNAi constructs can be provided in formulations also including penetration enhancers, carrier compounds and/or transfection agents.
- nucleic acids can be performed with a variety of compositions and methods of administration.
- methods of administration to cells and organisms will be available to persons skilled in the art. Dosing regimens, for example, are known to depend on the severity and degree of responsiveness of the disease or disorder to be treated, with a course of treatment spanning from days to months, or until the desired effect on the disorder or disease state is achieved. Chronic administration of the agent may be required in certain cases for lasting desired effects with some diseases or disorders.
- Suitable dosing regimens can be determined by, for example, administering varying amounts of one or more RNAi constructs in a pharmaceutically acceptable carrier or diluent, by a pharmaceutically acceptable delivery route, and amount of agent accumulated in the body of the recipient organism can be determined at various times following administration.
- the desired effect for example, degree of suppression of transcription or expression or activity of a gene product or gene activity
- this data can be correlated with other pharmacokinetic data, such as body or organ accumulation.
- Those of ordinary skill can determine optimum dosages, dosing regimens, and the like.
- Those of ordinary skill may employ EC 50 data from in vivo and in vitro animal models as guides for human studies.
- RNAi constructs disclosed herein also encompass any pharmaceutically acceptable salts, esters or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to RNAi constructs and pharmaceutically acceptable salts of such RNAi constructs, and other bioequivalents.
- a pharmaceutical preparation will generally be free of substantial amounts of pyrogenic impurities.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N,NI-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., “Pharmaceutical Salts,” J. of Pharma Sci., 1977, 66,1-19).
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
- a “pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines.
- Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
- Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids.
- examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic
- polynucleotides can be prepared for topical, oral, local or parenteral administration.
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- Oligonucleotides with at least one 2′-O-methoxyethyl (or similar) modification are believed to be particularly useful for oral administration.
- Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- RNAi constructs are described in the following references: Sorensen et al. J. Mol. Biol. 327:761-766, 2003 (intravenous injection of cationic liposomes); Sioud et al. BBRC 312, 1220-1225, 2003 (intraperitoneal injection of cationic liposomes); Tompkins et al. Proc. Natl. Acad. Sci. 101:8682-8686, 2004.
- the respiratory tract includes the upper airways, including the oropharynx and larynx, followed by the lower airways, which include the trachea followed by bifurcations into the bronchi and bronchioli.
- the upper and lower airways are called the conductive airways.
- the terminal bronchioli then divide into respiratory bronchioli which then lead to the ultimate respiratory zone, the alveoli, or deep lung.
- Administration may be accomplished by oral or nasal inhalation.
- pharmaceutical devices for aerosol delivery include metered dose inhalers (MDIs), dry powder inhalers (DPIs), and air-jet nebulizers.
- MDIs metered dose inhalers
- DPIs dry powder inhalers
- air-jet nebulizers Exemplary nucleic acid delivery systems by inhalation which can be readily adapted for delivery of the subject nucleic acid constructs are described in, for example, U.S. Pat. Nos. 5,756,353; 5,858,784; and PCT applications WO98/31346; WO98/10796; WO00/27359; WO01/54664; WO02/060412.
- Other aerosol formulations that may be used for delivering the double-stranded RNAs are described in U.S. Pat. Nos.
- nucleic acid constructs can be adapted from those used in delivering other oligonucleotides (e.g., an antisense oligonucleotide) by inhalation, such as described in Templin et al., Antisense Nucleic Acid Drug Dev, 2000, 10:359-68; Sandrasagra et al., Expert Opin Biol Ther, 2001, 1:979-83; Sandrasagra et al., Antisense Nucleic Acid Drug Dev, 2002, 12:177-81.
- oligonucleotides e.g., an antisense oligonucleotide
- Formulations of cationic liposomes may be used for administration by inhalation, particular after aerosolization. Nanospheres of biodegradable polymers may also be used.
- the deep lung, or alveoli are the primary target of inhaled therapeutic aerosols for systemic delivery of nucleic acid constructs.
- the aerosoled RNAi constructs are formulated as microparticles. Microparticles having a diameter of between 0.5 and ten microns can penetrate the lungs, passing through most of the natural barriers. A diameter of less than ten microns is required to bypass the throat; a diameter of 0.5 microns or greater is required to avoid being exhaled.
- THP-1 The human monoblastic cell line, THP-1 was purchased from ATCC (Manassas, Va.).
- Anti-HPA-1a allo-antiserum was obtained from the mother of an infant with neonatal alloimmune thrombocytopenia due to HPA-1a incompatibility.
- Human platelets were derived from a blood group “O” Rh + donor with the approval of the Institutional Review Board of Yale University School of Medicine.
- Anti-CD32 and anti-human Syk monoclonal antibodies (mAb) were purchased from BD Biosciences-PharMingen (San Diego, Calif.).
- 5-(and-6)-carboxyfluorescein diacetate mixed isomers were purchased from Molecular Probes, Inc (Eugene, Oreg.).
- RNAs that were within 500 bp of N-terminal of Syk coding region sequence were chosen for the present study (Table 1).
- Sense and anti-sense RNAs were synthesized.
- Double strand RNAs (dsRNAs) were made followed by transfection with TransMessenger reagent according to annealing instructions from Qiagen-Xeragon, Germantown, Md.
- TransMessenger reagent for the transfection of dsRNA, 6 ⁇ 10 5 THP-1 cells were plated into 6-well plates 24 hours prior to the transfection.
- THP-1 cellular proteins were isolated 48 hours after siRNA transfection. Immunoblotting was performed as described 15 .
- the platelets were washed and resuspended in M199 at 3 ⁇ 10 8 /ml before exposure to THP-1 cells in a ratio of 300:1 platelets:THP-1 for 2 hours.
- Phagocytosis of antibody-coated platelets by human granulocytes in vitro was first reported by Handin et al 18 .
- serum-treated platelets were labeled with 51 Cr, and the radioactivity was measured in the washed leukocyte pellet after incubation.
- a phagocytosis assay of antibody sensitized platelets by primary monocytes was recently developed by using fluorescein diacetate-labeled platelets 19; 20.
- false positive results were frequent due to non-specific binding.
- THP-1 cells have the ability to undergo phagocytosis and constitutively express Fc ⁇ RI and II 21; 22 .
- THP-1 cells were co-incubated with anti-HPA-1 a antibody coated, CFDA-labeled platelets at 37° C., the positive population was 46%. After quenching the surface fluorescence with Trypan Blue immediately prior to analysis, the positive population was still 33%. In the control group, the co-incubation of THP-1 with CFDA-labeled, normal serum coated platelets at 37° C.
- Syk is a key intracellular. tyrosine kinase in Fc ⁇ Rs-mediated phagocytosis 3; 4 .
- the dsRNA specific for the 187-207 coding sequence of Syk in 100 nm concentration significantly reduced the expression of Fc ⁇ RII-associated Syk protein, while Fc ⁇ RII molecule remained in same level ( FIG. 2 ).
- FIG. 3 shows that Syk 187 dsRNA treated THP-1 cells decreased the ability to ingest antibody-coated platelets about 50% comparing control THP-1 cells (from 33% to 19%). Syk-187 dsRNA thus specifically inhibited platelet phagocytosis by THP-1 cells.
- Syk siRNA specifically inhibits antibody-mediated platelet phagocytosis in human system in vitro.
- Syk-187 denotes the siRNA homologous to 187-207 coding sequence of human Syk molecule.
- Syk-334 denotes the siRNA homologous to 334-354-coding sequence of human Syk molecule.
- Control-siRNA has no homologous to human genes except 16 base overlap with Thermotoga maritimia section 21 of 136 of the complete genome in the blast search. Similar siRNA constructs were prepared with respect to each of the sequences listed below, and the relative effectiveness in decreasing protein expression and platelet phagocytosis is reported.
- Target Sequence SEQ ID NO: Syk Protein Phagocytosis Syk-187 AACCACCTGCCCTTCTTTTTC (SEQ ID NO: 2) + + + + + + + + + Syk-334 AAGGCACACCACTACACCATC (SEQ ID NO: 3) + + Syk-1 AATGCCTTGGTTCCATGGAAA (SEQ ID NO: 4) 0 0 Syk-2 AAGTTCCTGATCCGAGCCAGA (SEQ ID NO: 5) + + 0 Syk-3 AAGAAGTTCGACACGCTCTGG (SEQ ID NO: 6) 0 0 Syk-4 AATCCGTATGAGCCAGAACTT (SEQ ID NO: 7) + + 0 Syk-5 AAGTACTTGGAGGAGAGCAAT (SEQ ID NO: 8) + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
- Example 1 we establish the downregulation of Syk by an RNAi approach and its effect on Fc ⁇ RII-mediated phagocytosis. Next, we will establish the effectiveness of Syk-targeted nucleic acids for treating asthma.
- MC/9 murine mast cells which express Fc ⁇ and Syk were used for the analysis of Syk siRNA.
- Cells purchased from ATCC were transfected with dsRNAs by using Fugene 5 transfection reagents (Roche), followed by analysis of Syk reduction by flow cytometry analysis.
- Fugene 5 transfection reagents Roche
- the effectiveness of siRNA constructs in mast cells closely mirrored the effectiveness as described in THP-1 cells, above. Potent siRNAs will be tested for inhibition of mast cell activation in vitro.
- MC/9 cells will be stimulated by DNP-anti-DNP-IgE complex and followed by a degranulation assay. The degree of degranulation will be determined by measuring the release of beta-hexamimidase. See Saitoh et al. 2000 Immunity 12:525-535.
- IL-9 can drive mast cell proliferation in vitro and promote mast cell hyperplasia.
- Syk may play an important role in regulating IL-9 activity. Therefore, we will assess whether targeting Syk can inhibit the mast cell proliferative effect of IL-9 in vitro.
- MC/9 cells, and IL-9 responsive cell line will be transfected with Syk dsRNA, incubated with IL-9 followed by a proliferation assay, as described in Kimura et al. 1995 Int. Immunol. 7:115-120.
- Syk siRNA constructs will be tested in animal models. Delivery of siRNA by the inhaled route (intranasal or aerosolized) will be assessed in normal C57BL/6 mice.
- SiRNA may be formulated in cationic liposomes or in nanospheres of biodegradable polymers. As an initial dose, 50 ⁇ l of siRNA (labeled with PE) in liposomal suspension will be administered intranasally to a lightly anesthetized mouse. Lung tissues will be harvested and dsRNA distribution in the lung will be localized by fluorescence microscopy and compared to liposome alone control animals. Effects on Syk expression will be evaluated by Western blot analysis of the lung tissue.
- OVA sensitized and challenged BALB/c mice and CC10 IL-9 and IL-13 overexpressing transgenic mice will be used to evaluate the effects of Syk RNAi on airway hyperreactivity.
- the OVA-induced asthmatic model is described in Cohn et al. 1997 J. Exp. Med. 188:1307-1320.
- SiRNA is administered either before challenge or after inflammation has begun.
- BAL fluid and lung tissues will be tested for cytokine profiles and lung function will be tested for airway hyperreactivity.
Abstract
The present invention provides methods and compositions for attenuating expression of Spleen Tyrosine Kinase, Syk. In general, the described methodology involves the use of RNAi constructs that are targeted to a Syk mRNA sequence.
Description
- This application claims the benefit of the filing date of U.S. Provisional Application No. 60/519,899, filed Nov. 14, 2003, entitled “Inhibition of phagocytosis with RNAi specific for cell surface receptors”, and of U.S. Provisional Application No. 60/564,459, filed Apr. 22, 2004, entitled “Short interfacing (si) RNA sequence(s) specific for the SH2 tyrosine kinase, Syk, inhibits phagocytosis by human macrophages”. The teachings of both of the above-mentioned applications are incorporated by reference herein in their entirety.
- Syk is an intracellular protein-tyrosine kinase that is widely expressed in hematopoietic cells, cells of the immune system and cells of epithelial lineages. Syk is involved in transducing signals from activated immunoglobulin receptors, such as Fcγ receptors and Fcε receptors. Syk is also implicated in the signaling triggered by receptors for G-CSF, IL-2, IL-3, IL-5, GM-CSF, IL-15, various chemokines, IL-1 and erythropoietin. Thus Syk is a promiscuous messenger in various signal transduction pathways. Syk mediates diverse cellular responses, including proliferation, differentiation, and phagocytosis.
- Syk is implicated in a variety of disorders relating to the immune system, including autoimmune diseases, allergic reactions and asthma. As an example, Syk is implicated in immune thrombocytopenia. The pathogenic mechanism of immune thrombocytopenia involves antibody-mediated destruction of platelets in the reticuloendothelial system through Fcγ receptors (FcγRs) expressed on tissue macrophages, particularly in the spleen and liver. FcγRs signal via immunoreceptor tyrosine-based activation motifs (ITAMs) that are located either in the cytosolic domains of the receptors themselves (FcγRIIA), or within associated γ (FcγRI and FcγRIIIA) or ζ (FcγRIIIA) subunits. Following clustering of the FcγRs and their associated γ subunits by bound IgG ligands, tyrosine residues within the ITAMs become phosphorylated. The tyrosine-phosphorylated residues of the ITAMs serve as high affinity binding sites for Syk, a tyrosine kinase that contains tandem SH2 domains. Macrophages and neutrophils derived from the fetal livers of Syk-deficient mice fail to ingest IgG-coated particles. Also, decreased expression of Syk in monocytes using Syk antisense olignucleotides results in the decreased ability of these cells to ingest IgG-coated particles.
- An object of the present disclosure is to provide nucleic acid agents that inhibit Syk expression and to provide methods of using such agents for therapeutic purposes.
- The disclosure provides, in part, RNAi constructs that target Syk and decrease Syk expression. Such constructs may be used in essentially any method where it is desirable to decrease the level of Syk protein. In particular, the disclosed nucleic acids will be useful in treating various disorders related to immune system function, such as immune thrombocytopenia and asthma.
- In certain aspects, the disclosure provides RNAi constructs for inhibiting the expression of Syk. Such nucleic acids may comprise (a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and (b) a sense polynucleotide that hybridizes to said antisense polynucleotide. The antisense and sense strands may be two separate nucleic acid strands, or the strands may be joined by a linker or by a stretch of further nucleic acid. For example, the RNAi construct may be a single stranded nucleic acid containing two regions that are complementary, thereby forming a hairpin nucleic acid with a stretch of double-stranded helix. Such hairpin nucleic acids are often processed into an siRNA inside a cell. Optionally, the portion of the nucleic acid that forms a double helix is about 19 to about 23 base pairs in length. The antisense polynucleotide strand may be complementary to a sequence of the human Syk mRNA of SEQ ID NO:1, or that of another animal of interest, such as mouse or rat. The antisense polynucleotide strand may be complementary to at least 5, 6, 7, 8, 10, 15, 20 or more nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15. The antisense polynucleotide may consist of a sequence that is complementary to a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15. The sense and antisense strands may be essentially any suitable nucleic acid, including RNA, DNA or other nucleic acid species that are not readily categorized as DNA or RNA. The sense and antisense strands need not be formed of the same nucleic acids. Either or both strands may include one or more modifications to the typical nucleic acid structure. For example, the antisense strand may comprise one or more of the following modifications: (a) a modification to the sugar-phosphate backbone; (b) a modification to a base portion of a nucleotide; and (c) a conjugated hydrophobic moiety. The sense strand may be similarly modified.
- RNAi constructs may be formulated for administration to an organism. A pharmaceutical preparation for delivery of an RNAi construct to an organism may comprise a pharmaceutically acceptable carrier and an RNAi construct that inhibits expression of Syk. The preparation may be suitable for any desirable mode of administration. In certain instances, such as for the treatment of asthma or other disorders of the airway system, the preparation may be designed for administration by inhalation (e.g., aerosolized or intranasal).
- In certain aspects, the disclosure provides methods for decreasing expression of Syk in a cell. Such methods may comprise contacting the cell with a composition comprising an RNAi construct that inhibits Syk expression.
- In certain aspects, the disclosure provides methods for decreasing expression of Syk in one or more cells of an individual. Such methods may comprise administering to the individual a composition comprising a double-stranded nucleic acid that inhibits Syk expression. The individual may be diagnosed with a condition associated with excess Fc receptor activity or with any of a variety of disorders related to the immune system, such as asthma, immune thrombocytopenia or an autoimmune disease.
- In an additional aspect, the disclosure provides improved assays for measuring phagocytosis of target material in phagocytic cells. The methods employ phagocytic cells from a cell line, particularly a cell of a hematopoietic lineage, such a monoblastic cell line or other immune cell line. Desirable cells will generally express one or more Fcγ receptors that mediate phagocytosis of opsonized material, such as FcγRIIA. A method may comprise (a) exposing target material to antibody to generate prepared target material; (b) exposing the phagocytic cells to the prepared target material; and (c) selectively detecting the prepared target material that is internalized by the phagocytic cells. The target material will often be cells, particularly platelets. However, phagocytic cells are generally take up materials non-specifically, and therefore other materials, such as microbeads, may be used as a target material. Target material may be labeled in a variety of ways to facilitate detection, and target material may be pre-labeled or labeled upon exposure to antibody. The label may, for example, be a fluorescent label. In a preferred embodiment, the label is a fluorescent label, and selectively detecting the prepared target material comprises selectively quenching any extracellular label. Thus, detection of the fluorescent signal necessarily detects signal from unquenched fluorophore within the phagocytic cells.
-
FIG. 1 : Human monocytic cell line, THP-1 cells phagocytose anti-HPA-1a antisera coated human platelets. THP-1 cells incubated with normal sera coated human platelets at 4° C. (upper row), or with anti-HPA-1a antisera coated human platelets at 4° C. (second row), or with normal sera coated human platelets at 37° C. (third row), and with anti-HPA-1a antisera coated human platelets at 37° C. (bottom row). Human platelets were labeled with CFDA followed by incubating with normal sera or anti-HPA-1a antisera. Then the platelets were incubated with THP-1 cells. The fluorescence of phagocytosed THP-1 cells were analyzed by flow cytometry. -
FIG. 2 : Syk siRNA leads to specific down-regulation of Syk protein and inhibits antibody mediated platelet phagocytosis. Western blot analysis of Syk in THP-1 cells after siRNA treatment.Lane 1, Mock treated THP-1 cells;Lane 2, control siRNA treated THP-1 cells;Lane 3, Syk-187 treated THP-1 cells;Lane 4, Syk-334 treated THP1 cells. Intracellular proteins were immunoprecipitated by anti-CD32 (FcγRIIA) mAb followed by SDS-PAGE. Protein bands were immunoblotted by either anti-Syk mAb or anti-CD32 mAb as control. -
FIG. 3 . Syk siRNA inhibits antibody mediated platelets phagocytosis. CFDA-labeled and anti-HPA-1a coated platelets incubated with mock treated THP-1 cells (top row), or control-siRNA treated THP-1 cells (second row), or Syk-187 treated THP-1 cells (third row), and Syk-334 treated THP-1 cells (bottom row) followed by fluorescence analysis by flow cytometry. - I. RNAi Constructs
- In part, the disclosure provides RNA interference (“RNAi”) constructs that are useful for inhibiting Syk expression. As used herein, the term “RNAi construct” is a generic term used to include any of the various nucleic acid reagents that can be used to achieve a decrease in the levels of a targeted protein. Such decrease, however achieved, shall be referred to herein as a decrease in “expression” of the protein. While not wishing to be bound to any particular mechanism, it is expected that such constructs will act by an RNA interference (“RNAi”) mechanism. Such constructs may be, for example, small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs. As will be apparent from the preceding examples, an RNAi construct may include a single nucleic acid molecule, as in the case of hairpin RNAs, or two nucleic acid molecules, as in the case of siRNAs, or more nucleic acid molecules. Nonetheless, an RNAi construct will generally include at least some portion in which, under physiological conditions, a double helix is formed, where such double helix may result from intramolecular hybridization or intermolecular hybridization. Although RNAi is a term that was initially applied only with respect to RNA molecules, it is now understood that the same effect may be accomplished with modified nucleic acids that are not necessarily RNA, and also with molecules containing one or more DNA moieties. Constructs including any of the various nucleic acids are intended to be included in the term “RNAi construct”.
- As used herein, the term “nucleic acid” refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term should also be understood to include, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. The “canonical” nucleotides are adenosine (A), guanosine (G), cytosine (C), thymidine (T), and uracil (U), and include a ribose-phosphate backbone, but the term nucleic acid is intended to include polynucleotides comprising only canonical nucleotides as well as polynucleotides including one or more modifications to the sugar phosphate backbone or the nucleoside. DNA and RNA are chemically different because of the absence or presence of a hydroxyl group at the 2′ position on the ribose. Modified nucleic acids exist that cannot be readily termed DNA or RNA (e.g. in which an entirely different moiety is positioned at the 2′ position), as do functional analogs, such as peptide nucleic acids (PNAs) in which the backbone is a peptide backbone, in which the backbone contains neither sugar nor phosphate. All such molecules are included in the term “nucleic acid”. An “unmodified” nucleic acid is a nucleic acid that contains only canonical nucleotides and a DNA or RNA backbone.
- RNA interference is a phenomenon describing double-stranded nucleic acid-dependent gene specific posttranscriptional silencing. Initial attempts to harness this phenomenon for experimental manipulation of mammalian cells were foiled by a robust and nonspecific antiviral defense mechanism activated in response to long dsRNA molecules. Gil et al. Apoptosis 2000, 5:107-114. The field was significantly advanced upon the demonstration that synthetic duplexes of 21 nucleotide RNAs could mediate gene specific RNAi in mammalian cells, without invoking generic antiviral defense mechanisms. Elbashir et al. Nature 2001, 411:494-498; Caplen et al. Proc Natl Acad Sci 2001, 98:9742-9747. As a result, small-interfering RNAs (siRNAs) have become powerful tools to dissect gene function, and data from Soutscheck et al. Nature 2004, 432:173-178 has established that double-stranded RNA constructs can be delivered in vivo to modulate expression of the target gene.
- The mRNA sequence for human Syk is represented below:
Human Syk mRNA (Genbank NM_003177; gi:34147655; SEQ ID NO:1) 1 aggaagagcc gcgggcccgg cggctgaggc caccccggcg gcggctggag agcgaggagg 61 agcgggtggc cccgcgctgc gcccgccctc gcctcacctg gcgcaggtgg acacctgcgc 121 aggtgtgtgc cctccggccc ctgaagcatg gccagcagcg gcatggctga cagcgccaac 181 cacctgccct tctttttcgg caacatcacc cgggaggagg cagaagatta cctggtccag 241 gggggcatga gtgatgggct ttatttgctg cgccagagcc gcaactacct gggtggcttc 301 gccctgtccg tggcccacgg gaggaaggca caccactaca ccatcgagcg ggagctgaat 361 ggcacctacg ccatcgccgg tggcaggacc catgccagcc ccgccgacct ctgccactac 421 cactcccagg agtctgatgg cctggtctgc ctcctcaaga agcccttcaa ccggccccaa 481 ggggtgcagc ccaagactgg gccctttgag gatttgaagg aaaacctcat cagggaatat 541 gtgaagcaga catggaacct gcagggtcag gctctggagc aggccatcat cagtcagaag 601 cctcagctgg agaagctgat cgctaccaca gcccatgaaa aaatgccttg gttccatgga 661 aaaatctctc gggaagaatc tgagcaaatt gtcctgatag gatcaaagac aaatggaaag 721 ttcctgatcc gagccagaga caacaacggc tcctacgccc tgtgcctgct gcacgaaggg 781 aaggtgctgc actatcgcat cgacaaagac aagacaggga agctctccat ccccgaggga 841 aagaagttcg acacgctctg gcagctagtc gagcattatt cttataaagc agatggtttg 901 ttaagagttc ttactgtccc atgtcaaaaa atcggcacac agggaaatgt taattttgga 961 ggccgtccac aacttccagg ttcccatcct gcgacttggt cagcgggtgg aataatctca 1021 agaatcaaat catactcctt cccaaagcct ggccacagaa agtcctcccc tgcccaaggg 1081 aaccggcaag agagtactgt gtcattcaat ccgtatgagc cagaacttgc accctgggct 1141 gcagacaaag gcccccagag agaagcccta cccatggaca cagaggtgta cgagagcccc 1201 tacgcggacc ctgaggagat caggcccaag gaggtttacc tggaccgaaa gctgctgacg 1261 ctggaagaca aagaactggg ctctggtaat tttggaactg tgaaaaaggg ctactaccaa 1321 atgaaaaaag ttgtgaaaac cgtggctgtg aaaatactga aaaacgaggc caatgacccc 1381 gctcttaaag atgagttatt agcagaagca aatgtcatgc agcagctgga caacccgtac 1441 atcgtgcgca tgatcgggat atgcgaggcc gagtcctgga tgctagttat ggagatggca 1501 gaacttggtc ccctcaataa gtatttgcag cagaacagac atgtcaagga taagaacatc 1561 atagaactgg ttcatcaggt ttccatgggc atgaagtact tggaggagag caattttgtg 1621 cacagagatc tggctgcaag aaatgtgttg ctagttaccc aacattatgc caagatcagt 1681 gatttcggac tctccaaagc actgcgtgct gatgaaaact actacaaggc ccagacccat 1741 ggaaagtggc ctgtcaagtg gtacgctccg gaatgcatca actactacaa gttctccagc 1801 aaaagcgatg tctggagctt tggagtgttg atgtgggaag cattctccta tgggcagaag 1861 ccatatcgag ggatgaaagg aagtgaagtc accgctatgt tagagaaagg agagcggatg 1921 gggtgccctg cagggtgtcc aagagagatg tacgatctca tgaatctgtg ctggacatac 1981 gatgtggaaa acaggcccgg attcgcagca gtggaactgc ggctgcgcaa ttactactat 2041 gacgtggtga actaaccgct cccgcacctg tcggtggctg cctttgatca caggagcaat 2101 cacaggaaaa tgtatccaga ggaattgatt gtcagccacc tccctctgcc agtcgggaga 2161 gccaggcttg gatggaacat gcccacaact tgtcacccaa agcctgtccc aggactcacc 2221 ctccacaaag caaaggcagt cccgggagaa aagacggatg gcaggatcca aggggctagc 2281 tggatttgtt tgttttcttg tctgtgtgat tttcatacag gttattttta cgatctgttt 2341 ccaaatccct ttcatgtctt tccacttctc tgggtcccgg ggtgcatttg ttactcatcg 2401 ggcccaggga cattgcagag tggcctagag cactctcacc ccaagcggcc ttttccaaat 2461 gcccaaggat gccttagcat gtgactcctg aagggaaggc aaaggcagag gaatttggct 2521 gcttctacgg ccatgagact gatccctggc cactgaaaag ctttcctgac aataaaaatg 2581 ttttgaggct ttaaaaagaa aatcaagttt gaccagtgca gtttctaagc atgtagccag 2641 ttaaggaaag aaagaaaaaa aaaaaaaaaa aa - Suitable nucleic acid constructs may be designed by selecting a target region of a Syk mRNA sequence, such as that of the human, listed above, or that of mouse (Genbank reference no. NP—035648) or other animal, and preparing a construct having a polynucleotide strand that hybridizes to the selected region of the mRNA (the “antisense strand”) and a polynucleotide that hybridizes to the antisense strand (the “sense strand”). Constructs designed at random are unlikely to inhibit Syk expression. While it is possible to screen through large numbers of such constructs to identify those that are effective, it is generally desirable to follow a procedure for selecting target regions that have an improved likelihood of success.
- For example, one may employ the algorithm of Elbashir et al. (EMBO J. 20: 6877-6888, 2001) to select an appropriate target region and generate a construct with a higher chance of being effective. Briefly, this approach involves identifying nucleotide sequences in the target mRNA that begin with an AA dinucleotide and have a length of 21 nucleotides. siRNAs with other 3′ terminal dinucleotide overhangs have been shown to effectively induce RNAi, although overhang sequences containing a GG dinucleotide may be cleaved by RNAse.
- Double-stranded nucleic acid constructs may be evaluated for effectiveness by administering the construct to a cell and evaluating the effect on Syk protein levels, kinase activity or another feature that is correlated with Syk expression. Different nucleic acid constructs will tend to affect Syk expression to different degrees, and it will not always be apparent what percent inhibition of Syk expression will achieve the desired effects. Accordingly, double-stranded nucleic acid constructs may also be evaluated for effectiveness in one or more bioassays. For example, Syk-targeted constructs may be tested for effects on antibody mediated platelet phagocytosis to assess the effect on Fcγ-mediated events. As another example, Syk-targeted constructs may be tested for effects on mast cell degranulation. Examples of such assays are provided below.
- The table below lists the target sequences (sense DNA) for a series of RNA interference constructs designed to inhibit Syk expression.
TABLE 1 Human Syk siRNA Target Sequences Syk-187 AACCACCTGCCCTTCTTTTTC (SEQ ID NO: 2) Syk-334 AAGGCACACCACTACACCATC (SEQ ID NO: 3) Syk-1 AATGCCTTGGTTCCATGGAAA (SEQ ID NO: 4) Syk-2 AAGTTCCTGATCCGAGCCAGA (SEQ ID NO: 5) Syk-3 AAGAAGTTCGACACGCTCTGG (SEQ ID NO: 6) Syk-4 AATCCGTATGAGCCAGAACTT (SEQ ID NO: 7) Syk-5 AAGTACTTGGAGGAGAGCAAT (SEQ ID NO: 8) Syk-6 AAGTGGCCTGTCAAGTGGTAC (SEQ ID NO: 9) Syk-7 AAGTCACCGCTATGTTAGAGA (SEQ ID NO: 10) Syk-8 AATCTGTGCTGGACATACGAT (SEQ ID NO: 11) Syk-9 AACTGCGGCTGCGCAATTACT (SEQ ID NO: 12) Syk-10 AATTGATTGTCAGCCACCTCC (SEQ ID NO: 13) Syk-11 AAGACGGATGGCAGGATCCAA (SEQ ID NO: 14) Syk-12 AAGCATGTAGCCAGTTAAGGA (SEQ ID NO: 15) -
TABLE 2 Mouse Syk siRNA Target Sequences Mouse Syk-1: AATGCATCAACTACTACAAGT (SEQ ID NO: 16) Mouse Syk-2: AACCTGTGCTGGACTTACGAT (SEQ ID NO: 17) Mouse Syk-3: AATTACTACTACGACGTGGTT (SEQ ID NO: 18) Mouse Syk-4: AACTGAGGCTTCGCAATTACT (SEQ ID NO: 19) - As demonstrated herein, RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15 are effective in reducing Syk protein levels. See Example 1, Table 4. RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 5, 7, 8, 10, 11, 12, 13, and 14 are effective in reducing Syk protein levels by greater than 30%, while those containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10, and 11 are effective in reducing Syk protein levels by greater than 60%. RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 8, 10, 11, 12, 14 and 15 are effective in reducing phagocytosis of opsonized platelets, while those containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10, 14 and 15 are effective in reducing phagocytosis of opsonized platelets by greater than 30%. Where an RNAi construct is to be used for a purpose related to reducing phagocytosis by immune cells, it may be preferable to use an RNAi construct that produces an effect in a phagocytosis bioassay, such as an RNAi construct having an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 8, 10, 11, 12, 14 and 15. Where an RNAi construct is to be used for a purpose not related to reducing phagocytosis in immune cells, it may be preferable to use an RNAi construct that causes a measurable decrease in Syk protein levels, such as an RNAi construct containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15. RNAi constructs containing an antisense strand that hybridizes to a sequence of any of SEQ ID Nos. 2, 8, 10 and 14 are particularly notable for having a strong effect on Syk protein levels and on platelet phagocytosis.
- RNAi constructs may be designed to contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (i.e., the “target” gene) and is sufficient for decreasing the expression of the protein encoded by the target gene. The nucleotide sequence of the RNAi construct may hybridize to coding or non-coding portions of a transcript, including, for example, the 3′ and 5′ untranslated regions (“UTRs”). The RNAi construct need only be sufficiently similar to natural RNA that it has the ability to be effective. Thus, sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence may be tolerated. In certain cases, the number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3′ end of the siRNA antisense strand do not significantly contribute to specificity of the target recognition.
- Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the interfering RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing).
- Production of RNAi constructs can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro.
- One or both strands of an RNAi construct may include modifications to the phosphate-sugar backbone and/or the nucleoside. In general, the sense strand does not directly participate in the formation of a silencing complex (RISC) and is therefore subject to few constraints in the number and type of modifications that may be introduced. The sense strand need only retain the ability to hybridize with the antisense strand, and, in the case of longer nucleic acids, should not interfere with the activity of RNAses, such as Dicer, that participate in cleaving longer double-stranded constructs to yield smaller, active siRNAs. The antisense strand should retain the ability to hybridize with both the sense strand and the target transcript, and the ability to form an RNAi induced silencing complex (RISC). Optionally, the sense strand comprises at least 20%, 30%, 50%, 70%, 90% and 100% modified nucleic acids. Optionally, the antisense strand comprises no more than 0%, 10%, 20%, 30%, 40% or 50% modified nucleic acids. Modifications may be useful for, e.g., reduced susceptibility to nucleases, improved bioavailability, improved formulation characteristics, and changed pharmacokinetic properties. Many nucleases are progressive enzymes that initiate degradation at one end of a nucleic acid. Therefore, resistance to nucleases may be conferred by modification of, for example, one, two, three or more nucleotides at either the 5′end, the 3′end or both ends of a sense or antisense strand. For example, one, two or three phosphorothioate linkages may be positioned at either the 5′end, the 3′end or both ends of a sense or antisense strand. As another example, one, two or three 2′ O-methyl modified nucleotides may be positioned at either the 5′end, the 3′end or both ends of a sense or antisense strand. For a demonstration of the effectiveness of such modifications in improving the in vivo performance of RNAi constructs see, for example, Soutscheck et al. Nature 2004, 432:173-178. Nucleotides in the sense strand may also be DNA.
- Methods of chemically modifying RNA molecules can be adapted for modifying RNAi constructs (see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J Mol Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61). Merely to illustrate, the backbone of an RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2′-substituted ribonucleosides, a-configuration). Additional modified nucleotides are as follows (this list contains forms that are modified on either the backbone or the nucleoside or both, and is not intended to be all-inclusive): 2′-O-Methyl-2-aminoadenosine; 2′-O-Methyl-5-methyluridine; 2′-O-Methyladenosine; 2′-O-Methylcytidine; 2′-O-Methylguanosine; 2′-O-Methyluridine; 2-Amino-2′-deoxyadenosine; 2-Aminoadenosine; 2-Aminopurine-2′-deoxyriboside; 4-Thiothymidine; 4-Thiouridine; 5-Methyl-2′-deoxycytidine; 5-Methylcytidine; 5-Methyluridine; 5-Propynyl-2′-deoxycytidine; 5-Propynyl-2′-deoxyuridine; N1-Methyladenosine; N1-Methylguanosine; N2-Methyl-2′-deoxyguanosine; N6-Methyl-2′-deoxyadenosine; N6-Methyladenosine; 06-Methyl-2′-deoxyguanosine; and 06-Methylguanosine.
- The double-stranded structure may be formed by a single self-complementary nucleic acid strand or by two complementary nucleic acid strands. A double-stranded nucleic acid disclosed herein may include portions of single-stranded nucleic acid. Duplex formation may be initiated either inside or outside the cell. The RNAi construct may be introduced in an amount that allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
- In certain embodiments, the subject nucleic acid constructs are “small interfering RNAs” or “siRNAs.” These nucleic acids include an antisense RNA strand that is from about 19 to about 30 nucleotides in length, and possibly from about 21 to 23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease “dicing” of long double-stranded RNAs. siRNAs may include a sense strand that is RNA, DNA or other modified nucleic acids. The siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex.
- SiRNA molecules can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA can be chemically synthesized or recombinantly produced using methods known in the art. For example, short sense and antisense oligomers can be synthesized and annealed to form double-stranded structures with 2-nucleotide overhangs at each end (Caplen, et al. (2001) Proc Natl Acad Sci USA, 98:9742-9747; Elbashir, et al. (2001) EMBO J, 20:6877-88). These double-stranded siRNA structures can then be introduced into cells, either by passive uptake or a delivery system of choice, such as described below.
- In certain embodiments, the siRNA constructs can be generated by the processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer. In one embodiment, the Drosophila in vitro system is used. In this embodiment, dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides. In this embodiment, modifications should be selected so as to not interfere with the activity of the RNAse.
- The siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.
- In certain embodiments, at least one strand of an siRNA has a 3′ overhang consisting of from about 1 to about 6 nucleotides. The overhang may consist of from about 2 to about 4 nucleotides. Typically, the 3′ overhangs consist of about 1 to about 3 nucleotides. In certain embodiments, one strand has a 3′ overhang and the other strand is either blunt-ended or also has a 3′ overhang. The length of the overhangs may be the same or different for each strand. In order to further enhance the stability of the siRNA, the 3′ overhangs can be stabilized against degradation. In one embodiment, the RNA antisense strand is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of
uridine nucleotide 3′ overhangs by 2′-deoxythyinidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2′ hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium and may be beneficial in vivo. - A sense or antisense strand may be conjugated to one or more additional moieties to improve properties such as stability, cellular uptake or pharmacokinetics. Hydrophobic moieties, such as lipids and sterols, such as cholesterol, may be conjugated to a sense or antisense strand. See for example, Lorenz et al. Bioorg. Med. Chem. Lett. 14, 4975-4977 (2004) and Soutscheck et al. Nature 2004, 432:173-178. A sense or antisense strand may include one, two, three or more such hydrophobic moieties.
- In certain embodiments, an RNAi construct is in the form of a hairpin structure. The hairpin can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature 2002, 418:38-9; McManus et al., RNA 2002, 8:842-50; Yu et al., Proc Natl Acad Sci USA, 2002, 99:6047-52). Preferably, such hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that siRNAs can be produced by the processing of a hairpin RNA in the cell. In such an embodiment, the single strand portion connecting the sense and antisense portions should be designed so as to be cleavable by nucleases in vivo, and any duplex portion should be susceptible to processing by nucleases such as Dicer.
- II. Methods for Using Syk-Targeted Nucleic Acid Interference
- RNAi acid constructs disclosed herein may be used in essentially any in vivo or in vitro setting where inhibition of Syk expression is desirable.
- In human patients and other mammals, Syk-targeted nucleic acid constructs may be used to treat a variety of diseases related to the immune system. For example, Syk inhibition may be useful in the treatment of autoimmune diseases, particularly those characterized by interactions of immune complexes (eg, IgG-containing immune complexes) with Fc receptors (for example, those present on the surface of macrophages). Diseases such as immune cytopenias (e.g. immune thrombocytopenia, immune hemolytic anemia, or immune neutropenia), Guillain-Barre syndrome, myasthenia gravis, anti-Factor VIII immune disease, dermatomyositis, vasculitis, uveitis, rheumatoid arthritis and systemic lupus erythematosus may be treated with RNAi constructs disclosed herein. See, e.g., Samuelsson et al. 2001 Science 291:484.
- Syk inhibition may also be useful in the treatment of allergic disorders and asthma. Mast cells play a critical role in asthma and allergic disorders by releasing pro-inflammatory mediators and cytokines. Antigen-mediated aggregation of FcεRI, the high-affinity receptor for IgE results in activation of mast cells. This triggers a series of signaling events resulting in the release of mediators, including histamine, proteases, leukotrienes and cytokines. These mediators cause increased vascular permeability, mucus production, bronchoconstriction, tissue degradation and inflammation, thus playing key roles in the etiology and symptoms of asthma and allergic disorders. Syk activation is a key event in the signaling pathway following the activation of mast cells. Syk kinase acts as a central initiator of subsequent signaling leading to mediator release. Syk inhibitors block the release of mediators in stimulated mast cells, and Syk activators stimulate events leading to mediator release normally induced by clustering of FcεRI.
- Agents that block the activity of Syk kinase act to block the release of allergic and pro-inflammatory mediators and cytokines. Thus double-stranded nucleic acids that inhibit Syk expression may be used in treating inflammatory and allergic disorders including asthma, chronic obstructive pulmonary disease (COPD), adult respiratory distress syndrome (ARDS), ulcerative colitis, Crohn's disease, bronchitis, conjunctivitis, psoriasis, scleroderma, urticaria, dermatitis and allergic rhinitis.
- Syk is expressed in other cells of the hematopoietic lineages including B cells, where it is thought to play an essential role in transducing signals required for the transition of immature B cells into mature B cells (M. Turner et al., Immunology Today, 2000, 21, 148). B cells are reported to play an important role in some inflammatory conditions such as lupus (O. T. Chan et al., Immunological Rev., 1999, 169, 107) and rheumatoid arthritis (A. Gause and C. Borek, Biodrugs, 2001, 15, 73). Therefore, double-stranded nucleic acids that inhibit Syk expression may be used in treating such disorders. Other cell types in which Syk is active include dendritic cells and lymphocytes, and therefore, disorders associated with abnormal activity of such cells may be treated by administration of a double-stranded nucleic acid disclosed herein.
- Syk is expressed in platelets and mediates signaling from FcγR that leads to activation in platelets. Chacko et al. J. Biol. Chem. 271(18):10775-81, 1996. Thus inhibition of Syk may be useful in patients at risk for thrombosis, and particularly thrombosis mediated by FcγR signaling. For example, Syk inhibitors may be administered to heparinized patients to reduce the risk of heparin induced thrombocytopenia. Syk inhibitors may also be used in diabetic patients to reduce the risk of arterial thrombosis in these patients. Calverley et al. Br. J. Haemat. 121(1):139-42, 2003.
- Syk was also reported to be an element of the signaling cascade in beta-amyloid and prion fibrils leading to production of neurotoxic products (C. K. Combs et al., J. Neurosci., 1999, 19, 928). Double-stranded nucleic acids that inhibit Syk expression may be used in treating Alzheimer's disease and related neuroinflammatory diseases.
- III. Formulations
- The RNAi constructs disclosed herein may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, polymers, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption of the constructs. The subject RNAi constructs can be provided in formulations also including penetration enhancers, carrier compounds and/or transfection agents.
- Therapeutic applications of the disclosed nucleic acids can be performed with a variety of compositions and methods of administration. In view of the teachings herein, methods of administration to cells and organisms will be available to persons skilled in the art. Dosing regimens, for example, are known to depend on the severity and degree of responsiveness of the disease or disorder to be treated, with a course of treatment spanning from days to months, or until the desired effect on the disorder or disease state is achieved. Chronic administration of the agent may be required in certain cases for lasting desired effects with some diseases or disorders. Suitable dosing regimens can be determined by, for example, administering varying amounts of one or more RNAi constructs in a pharmaceutically acceptable carrier or diluent, by a pharmaceutically acceptable delivery route, and amount of agent accumulated in the body of the recipient organism can be determined at various times following administration. Similarly, the desired effect (for example, degree of suppression of transcription or expression or activity of a gene product or gene activity) can be measured at various times following administration of the RNAi construct, and this data can be correlated with other pharmacokinetic data, such as body or organ accumulation. Those of ordinary skill can determine optimum dosages, dosing regimens, and the like. Those of ordinary skill may employ EC50 data from in vivo and in vitro animal models as guides for human studies.
- The RNAi constructs disclosed herein also encompass any pharmaceutically acceptable salts, esters or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to RNAi constructs and pharmaceutically acceptable salts of such RNAi constructs, and other bioequivalents. A pharmaceutical preparation will generally be free of substantial amounts of pyrogenic impurities.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N,NI-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., “Pharmaceutical Salts,” J. of Pharma Sci., 1977, 66,1-19). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a “pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids.
- For polynucleotides, examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.
- Further, the polynucleotides can be prepared for topical, oral, local or parenteral administration. Parenteral administration, includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl (or similar) modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Electroporation may be used as a further means to introduce polynucleotides into cells. Specific approaches to delivering RNAi constructs are described in the following references: Sorensen et al. J. Mol. Biol. 327:761-766, 2003 (intravenous injection of cationic liposomes); Sioud et al. BBRC 312, 1220-1225, 2003 (intraperitoneal injection of cationic liposomes); Tompkins et al. Proc. Natl. Acad. Sci. 101:8682-8686, 2004.
- Another aspect of the disclosure provides aerosols for the delivery of RNAi constructs to the respiratory tract. The respiratory tract includes the upper airways, including the oropharynx and larynx, followed by the lower airways, which include the trachea followed by bifurcations into the bronchi and bronchioli. The upper and lower airways are called the conductive airways. The terminal bronchioli then divide into respiratory bronchioli which then lead to the ultimate respiratory zone, the alveoli, or deep lung.
- Administration may be accomplished by oral or nasal inhalation. Examples of pharmaceutical devices for aerosol delivery include metered dose inhalers (MDIs), dry powder inhalers (DPIs), and air-jet nebulizers. Exemplary nucleic acid delivery systems by inhalation which can be readily adapted for delivery of the subject nucleic acid constructs are described in, for example, U.S. Pat. Nos. 5,756,353; 5,858,784; and PCT applications WO98/31346; WO98/10796; WO00/27359; WO01/54664; WO02/060412. Other aerosol formulations that may be used for delivering the double-stranded RNAs are described in U.S. Pat. Nos. 6,294,153; 6,344,194; 6,071,497, and PCT applications WO02/066078; WO02/053190; WO01/60420; WO00/66206. Further, methods for delivering nucleic acid constructs can be adapted from those used in delivering other oligonucleotides (e.g., an antisense oligonucleotide) by inhalation, such as described in Templin et al., Antisense Nucleic Acid Drug Dev, 2000, 10:359-68; Sandrasagra et al., Expert Opin Biol Ther, 2001, 1:979-83; Sandrasagra et al., Antisense Nucleic Acid Drug Dev, 2002, 12:177-81. Formulations of cationic liposomes may be used for administration by inhalation, particular after aerosolization. Nanospheres of biodegradable polymers may also be used. The deep lung, or alveoli, are the primary target of inhaled therapeutic aerosols for systemic delivery of nucleic acid constructs.
- In certain embodiments, particularly where systemic dosing with the nucleic acid construct is desired, the aerosoled RNAi constructs are formulated as microparticles. Microparticles having a diameter of between 0.5 and ten microns can penetrate the lungs, passing through most of the natural barriers. A diameter of less than ten microns is required to bypass the throat; a diameter of 0.5 microns or greater is required to avoid being exhaled.
- The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.
- Study Design:
- Cell Lines, Platelets, and Other Reagents
- The human monoblastic cell line, THP-1 was purchased from ATCC (Manassas, Va.). Anti-HPA-1a allo-antiserum was obtained from the mother of an infant with neonatal alloimmune thrombocytopenia due to HPA-1a incompatibility. Human platelets were derived from a blood group “O” Rh+ donor with the approval of the Institutional Review Board of Yale University School of Medicine. Anti-CD32 and anti-human Syk monoclonal antibodies (mAb) were purchased from BD Biosciences-PharMingen (San Diego, Calif.). 5-(and-6)-carboxyfluorescein diacetate mixed isomers (CFDA) were purchased from Molecular Probes, Inc (Eugene, Oreg.).
- SIRNA and Transfection
- According to the Elbashir's criteria 11, two siRNAs that were within 500 bp of N-terminal of Syk coding region sequence were chosen for the present study (Table 1). Sense and anti-sense RNAs were synthesized. Double strand RNAs (dsRNAs) were made followed by transfection with TransMessenger reagent according to annealing instructions from Qiagen-Xeragon, Germantown, Md. For the transfection of dsRNA, 6×105 THP-1 cells were plated into 6-well plates 24 hours prior to the transfection.
- Analysis of Protein Expression
- The THP-1 cellular proteins were isolated 48 hours after siRNA transfection. Immunoblotting was performed as described15.
- Phagocytosis In Vitro Assay
- Platelets at 108 cells/ml in EDTA buffer (2 mM EDTA, 0.1% BSA in PBS) were incubated in 10 um CFDA at 20° C. for 30 minutes, washed and incubated in 1:5 (V:V) test serum for 30 minutes. The platelets were washed and resuspended in M199 at 3×108/ml before exposure to THP-1 cells in a ratio of 300:1 platelets:THP-1 for 2 hours. After washing 3 times with EDTA buffer, the cells were re-suspended in 1% paraformadehyde in EDTA buffer and analyzed by flow cytometry (FACScan, BD Biosciences, San Jose, (CA). Immediately before the FACS analysis, the surface bound fluorescence on the cells were quenched by adding 0.2% Trypan Blue16; 17
- Results and Discussion
- Cell-Based Platelet Phagocytosis
- Phagocytosis of antibody-coated platelets by human granulocytes in vitro was first reported by Handin et al18. To quantify the uptake of platelets by neutrophils, serum-treated platelets were labeled with 51Cr, and the radioactivity was measured in the washed leukocyte pellet after incubation. A phagocytosis assay of antibody sensitized platelets by primary monocytes was recently developed by using fluorescein diacetate-labeled
platelets 19; 20. However, false positive results were frequent due to non-specific binding. In this study, we employed the THP-1 cells to establish a cell-based platelet phagocytosis assay, because THP-1 cells have the ability to undergo phagocytosis and constitutively express FcγRI and II21; 22. When THP-1 cells were co-incubated with anti-HPA-1 a antibody coated, CFDA-labeled platelets at 37° C., the positive population was 46%. After quenching the surface fluorescence with Trypan Blue immediately prior to analysis, the positive population was still 33%. In the control group, the co-incubation of THP-1 with CFDA-labeled, normal serum coated platelets at 37° C. in our experiments showed only 6.6% non-specific bright population, though aged platelets can be cleared by macrophage cells via a scavenger receptor 23(FIG. 1 ). This indicated that non-specific platelet phagocytosis by THP-1 cells was minimal in this assay system. Fluorescent microscopy confirmed that CFDA-labeled platelets were located in the intracellular space of cells in the sorted positive THP-1 cells. The result was reproducible in five separate experiments. Thus, this assay is reliable for quantitation of antibody-mediated platelet phagocytosis. This assay provides a useful model to study the intracellular pathway of Fc-receptor mediated platelet phagocytosis. It can also be used for clinically evaluating patients with pathologic anti-platelet antibodies as well as those with other immune diseases involving phagocytosis in the pathogenic mechanism. - RNAi Down-Regulation of Syk Protein Expression
- Syk is a key intracellular. tyrosine kinase in FcγRs-mediated phagocytosis 3; 4. We confirmed the association of Syk with FcγRII in THP-1 cells by immunoprecipation and immunoblotting (
FIG. 2 ). We then transfected designed Syk-specific siRNAs into THP-1 cells to test if Syk specific siRNA can down-regulate the Syk protein expression. The dsRNA specific for the 187-207 coding sequence of Syk in 100 nm concentration significantly reduced the expression of FcγRII-associated Syk protein, while FcγRII molecule remained in same level (FIG. 2 ). Another dsRNA, specific for the 334-354 coding sequence of Syk had less effect on the expression of FcγRII associated Syk protein in the same concentration. We then tested the kinetics of this Syk protein reduction and found that the FcγRII-associated Syk protein was decreased at 48 hours after dsRNA transfection, and reached maximal reduction at 72 hours after dsRNA transfection. At 96 hours after dsRNA transfection, Syk protein levels began to recover. These results indicate the Syk siRNA can specifically knockdown Syk protein expression in vitro. - Inhibition of Anti-Platelet Antibody-Mediated Platelet Phagocytosis by THP-1 Cells by Syk dsRNAs
- Based on above results, we then tested whether or not Syk dsRNAs could interfere with the phagocytotic function of THP-1 cells.
FIG. 3 shows thatSyk 187 dsRNA treated THP-1 cells decreased the ability to ingest antibody-coated platelets about 50% comparing control THP-1 cells (from 33% to 19%). Syk-187 dsRNA thus specifically inhibited platelet phagocytosis by THP-1 cells. These results indicate that the tyrosine kinase, Syk, is important for antibody-mediated platelet phagocytosis. Targeting a specific intracellular protein, such as Syk, with siRNA is expected to be a potential pharmacologic intervention for immune thrombocytopenia. Targeting Syk with siRNA may also be applied to other disease condition of antibody-mediated phagocytosis. Moreover, knockdown of a given gene with siRNAs combining a cell-based assay system offers an important strategy for human functional genomics, like the studies of gene function in gene knockout animals. In conclusion, we report that Syk siRNA specifically inhibits antibody-mediated platelet phagocytosis in human system in vitro.TABLE 3 Examples of siRNA sequences used Syk-187 Sense r(CCA CCU GCC CUU CUU UUU C)d(TT) Antisense r(GAA AAA GAA GGG CAG GUG G)d(TT) Syk-334 Sense r(GGC ACA CCA CUA CAC CAU C)d(TT) Antisense r(GAU GGU GUA GUG GUG UGC C)d(TT) Control-siRNA Sense r(UUC UCC GAA CGU GUC ACG U)d(T′T′) Antisense r(ACG UGA CAC GUU CGG AGA A)d(TT) - Syk-187 denotes the siRNA homologous to 187-207 coding sequence of human Syk molecule. Syk-334 denotes the siRNA homologous to 334-354-coding sequence of human Syk molecule. Control-siRNA has no homologous to human genes except 16 base overlap with Thermotoga maritimia section 21 of 136 of the complete genome in the blast search. Similar siRNA constructs were prepared with respect to each of the sequences listed below, and the relative effectiveness in decreasing protein expression and platelet phagocytosis is reported.
TABLE 4 Syk siRNA Targets and Effectiveness Effect on Effect on Probe: Target Sequence: SEQ ID NO: Syk Protein Phagocytosis Syk-187 AACCACCTGCCCTTCTTTTTC (SEQ ID NO: 2) + + + + + Syk-334 AAGGCACACCACTACACCATC (SEQ ID NO: 3) + + Syk-1 AATGCCTTGGTTCCATGGAAA (SEQ ID NO: 4) 0 0 Syk-2 AAGTTCCTGATCCGAGCCAGA (SEQ ID NO: 5) + + 0 Syk-3 AAGAAGTTCGACACGCTCTGG (SEQ ID NO: 6) 0 0 Syk-4 AATCCGTATGAGCCAGAACTT (SEQ ID NO: 7) + + 0 Syk-5 AAGTACTTGGAGGAGAGCAAT (SEQ ID NO: 8) + + + + + Syk-6 AAGTGGCCTGTCAAGTGGTAC (SEQ ID NO: 9) + 0 Syk-7 AAGTCACCGCTATGTTAGAGA (SEQ ID NO: 10) + + + + + Syk-8 AATCTGTGCTGGACATACGAT (SEQ ID NO: 11) + + + + Syk-9 AACTGCGGCTGCGCAATTACT (SEQ ID NO: 12) + + + Syk-10 AATTGATTGTCAGCCACCTCC (SEQ ID NO: 13) + + 0 Syk-11 AAGACGGATGGCAGGATCCAA (SEQ ID NO: 14) + + + + Syk-12 AAGCATGTAGCCAGTTAAGGA (SEQ ID NO: 15) + + +
Key:
“0”= <10% inhibition
“+” = 10-30% inhibition
“+ +” = 31-60% inhibition
“+ + +” = >60% inhibition
-
- 1. Beardsley D S. Pathophysiology of immune thrombocytopenic purpura. Blood Reviews. 2002; 16:13-14.
- 2. Cines D B, Blanchette V S. Immune thrombocytopenic purpura. New England Journal of Medicine. 2002; 346:995-1008.
- 3. Greenberg S, Grinstein S. Phagocytosis and innate immunity. Current Opinion in Immunology. 2002; 14:136-145.
- 4. Cox D, Greenberg S. Phagocytic signaling strategies: Fc(gamma)receptormediated phagocytosis as a model system. Seminars in Immunology. 2001; 13:339-345.
- 5. Indik Z K, Park J G, Hunter S, Schreiber A D. The molecular dissection of Fe gamma receptor mediated phagocytosis. Blood. 1995; 86:4389-4399.
- 6. Crowley M T, Costello P S, Fitzer-Attas C J, et al. A critical role for Syk in signal transduction and phagocytosis mediated by Fcgamma receptors on macrophages. Journal of Experimental Medicine. 1997; 186:1027-1039.
- 7. Kiefer F, Brumell J, Al Alawi N, et al. The Syk protein tyrosine kinase is essential for Fcgamma receptor signaling in macrophages and neutrophils. Molecular & Cellular Biology. 1998; 18:4209-4220.
- 8. Matsuda M, Park J G, Wang D C, Hunter S, Chien P, Schreiber A D. Abrogation of the Fc gamma receptor IIA-mediated phagocytic signal by stem-loop Syk antisense oligonucleotides. Molecular Biology of the Cell. 1996; 7:1095-1106.
- 9. Hannon G J. RNA interference. Nature. 2002; 418:244-251.
- 10. Plasterk R H. RNA silencing: the genome's immune system. Science. 2002; 296:1263-1265.
- 11. Elbashir S M, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. [comment].—Nature. -2001; 411:494-498.
- 12. Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert D N, Fesik S W. Specificity of short interfering RNA determined through gene expression signatures. [comment]. Proceedings of the National Academy of Sciences of the United States of America. 2003; 100:6347-6352.
- 13. Hutvagner G, McLachlan J, Pasquinelli A E, Balint E, Tuschl T, Zamore P D. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA.[comment]. Science. 2001; 293:834-838.
- 14. Caplen N J, Parrish S, Imani F, Fire A, Morgan R A. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proceedings of the National Academy of Sciences of the United States of America. 2001; 98:9742-9747.
- 15. Ghazizadeh S, Bolen J B, Fleit H B. Tyrosine phosphorylation and association of Syk with Fc gamma RII in monocytic THP-1 cells. Biochemical Journal. 1995; 305:669-674.
- 16. Lehmann A K, Sornes S, Halstensen A. Phagocytosis: measurement by flow cytometry. Journal of Immunological Methods 2000; 243:229-242.
- 17. Ramet M, Manfruelli P, Pearson A, Mathey-Prevot B, Ezekowitz R A. Functional genomic analysis of phagocytosis and identification of a Drosophila receptor for E. coli. Nature. 2002; 416:644-648.
- 18. Handin R1, Stossel T P. Phagocytosis of antibody-coated platelets by human granulocytes. New England Journal of Medicine. 1974; 290:989-993.
- 19. Lim J, Kim Y, Han K, et al. Flow cytometric monocyte phagocytic assay for predicting platelet transfusion outcome. Transfusion. 2002; 42:309-316.
- 20. Wiener E, Abeyakoon O, Benchetrit G, Lyall M, Keler T, Rodeck C H. AntiHPA-1a-mediated platelet phagocytosis by monocytes in vitro and its inhibition by Fc gamma receptor (FcgammaR) reactive reagents. European Journal of Haematology. 2003; 70:67-74.
- 21. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K. Establishment and characterization of a human acute monocytic leukemia cell line (THP 1). International Journal of Cancer. 1980; 26:171-176.
- 22. Garcia-Garcia E, Rosales R, Rosales C. Phosphatidylinositol 3-kinase and extracellular signal-regulated kinase are recruited for Fc receptor-mediated phagocytosis during monocyte-to-macrophage differentiation. Journal of Leukocyte Biology. 2002; 72:107-114.
- 23. Brown S B, Clarke M C, Magowan L, Sanderson H, Savill J. Constitutive death of platelets leading to scavenger receptor-mediated phagocytosis. A caspaseindependent cell clearance program. Journal of Biological Chemistry. 2000; 275:5987-5996.
- In Example 1, we establish the downregulation of Syk by an RNAi approach and its effect on FcγRII-mediated phagocytosis. Next, we will establish the effectiveness of Syk-targeted nucleic acids for treating asthma.
- MC/9 murine mast cells, which express Fcε and Syk were used for the analysis of Syk siRNA. Cells purchased from ATCC were transfected with dsRNAs by using
Fugene 5 transfection reagents (Roche), followed by analysis of Syk reduction by flow cytometry analysis. The effectiveness of siRNA constructs in mast cells closely mirrored the effectiveness as described in THP-1 cells, above. Potent siRNAs will be tested for inhibition of mast cell activation in vitro. MC/9 cells will be stimulated by DNP-anti-DNP-IgE complex and followed by a degranulation assay. The degree of degranulation will be determined by measuring the release of beta-hexamimidase. See Saitoh et al. 2000 Immunity 12:525-535. - IL-9 can drive mast cell proliferation in vitro and promote mast cell hyperplasia. Syk may play an important role in regulating IL-9 activity. Therefore, we will assess whether targeting Syk can inhibit the mast cell proliferative effect of IL-9 in vitro. MC/9 cells, and IL-9 responsive cell line, will be transfected with Syk dsRNA, incubated with IL-9 followed by a proliferation assay, as described in Kimura et al. 1995 Int. Immunol. 7:115-120.
- Syk siRNA constructs will be tested in animal models. Delivery of siRNA by the inhaled route (intranasal or aerosolized) will be assessed in normal C57BL/6 mice. SiRNA may be formulated in cationic liposomes or in nanospheres of biodegradable polymers. As an initial dose, 50 μl of siRNA (labeled with PE) in liposomal suspension will be administered intranasally to a lightly anesthetized mouse. Lung tissues will be harvested and dsRNA distribution in the lung will be localized by fluorescence microscopy and compared to liposome alone control animals. Effects on Syk expression will be evaluated by Western blot analysis of the lung tissue.
- OVA sensitized and challenged BALB/c mice and CC10 IL-9 and IL-13 overexpressing transgenic mice will be used to evaluate the effects of Syk RNAi on airway hyperreactivity. The OVA-induced asthmatic model is described in Cohn et al. 1997 J. Exp. Med. 188:1307-1320. SiRNA is administered either before challenge or after inflammation has begun. BAL fluid and lung tissues will be tested for cytokine profiles and lung function will be tested for airway hyperreactivity.
Claims (34)
1. An RNAi construct for inhibiting the expression of Syk, comprising
(a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and
(b) a sense polynucleotide that hybridizes to said antisense polynucleotide.
2. The RNAi construct of claim 1 , wherein the double-stranded nucleic acid is a hairpin nucleic acid.
3. The RNAi construct of claim 1 , wherein the antisense strand and the sense strand form a double helix of about 19 to about 30 base pairs in length.
4. The RNAi construct of claim 1 , wherein the antisense polynucleotide strand is complementary to a sequence of the human Syk mRNA of SEQ ID NO:1.
5. The RNAi construct of claim 4 , wherein the RNA antisense polynucleotide strand is complementary to at least 7 nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
6. The RNAi construct of claim 4 , wherein the RNA antisense polynucleotide strand consists of a sequence that is complementary to a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
7. The RNAi construct of claim 4 , wherein greater than 50% of the nucleotides of the antisense strand are RNA.
8. The RNAi construct of claim 4 , wherein the antisense strand comprises one or more modifications selected from the group consisting of:
(a) a modification to the sugar-phosphate backbone;
(b) a modification to a base portion of a nucleotide; and
(c) a conjugated hydrophobic moiety.
9. The double-stranded nucleic acid of claim 4 , wherein the sense strand comprises one or more modifications selected from the group consisting of:
(a) a modification to the sugar-phosphate backbone;
(b) a modification to a base portion of a nucleotide; and
(c) a conjugated hydrophobic moiety.
10. A pharmaceutical preparation for delivery of an RNAi construct to an organism, the composition comprising a pharmaceutically acceptable carrier and an RNAi construct that inhibits expression of Syk.
11. The pharmaceutical preparation of claim 10 , wherein the RNAi construct comprises:
(a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and
(b) a sense polynucleotide that hybridizes to said antisense polynucleotide.
12. The pharmaceutical preparation of claim 11 , wherein the antisense polynucleotide strand is complementary to at least 7 nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
13. The pharmaceutical preparation of claim 11 , wherein the antisense polynucleotide strand consists of a sequence that is complementary to a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
14. The pharmaceutical preparation of claim 11 , wherein greater than 50% of the nucleotides of the antisense strand are RNA.
15. The pharmaceutical preparation of claim 1 , wherein the antisense strand comprises one or more modifications selected from the group consisting of:
(a) a modification to the sugar-phosphate backbone;
(b) a modification to a base portion of a nucleotide; and
(c) a conjugated hydrophobic moiety.
16. The pharmaceutical preparation of claim 11 , wherein the sense strand comprises one or more modifications selected from the group consisting of:
(a) a modification to the sugar-phosphate backbone;
(b) a modification to a base portion of a nucleotide; and
(c) a conjugated hydrophobic moiety.
17. The pharmaceutical preparation of claim 10 , wherein the preparation is suitable for administration by inhalation.
18. A method for decreasing expression of Syk in a cell, the method comprising contacting the cell with an RNAi construct which comprises:
(a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and
(b) a sense polynucleotide that hybridizes to said antisense polynucleotide.
19. The method of claim 18 , wherein the antisense polynucleotide strand is complementary to a sequence of the human Syk mRNA of SEQ ID NO:1.
20. The method of claim 18 , wherein the antisense polynucleotide strand is complementary to at least 7 nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
21. The method of claim 18 , wherein the antisense polynucleotide strand consists of a sequence that is complementary to a sequence selected from the group consisting of:
SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
22. A method for decreasing expression of Syk in one or more cells of an individual, the method comprising administering to the individual a composition comprising an RNAi construct which comprises:
(a) an antisense polynucleotide strand that hybridizes to at least a portion of a Syk transcript and inhibits Syk expression; and
(b) a sense polynucleotide that hybridizes to said antisense polynucleotide.
23. The method of claim 22 , wherein the antisense polynucleotide strand is complementary to a sequence of the human Syk mRNA of SEQ ID NO:1.
24. The method of claim 22 , wherein the antisense polynucleotide strand is complementary to at least 7 nucleotides of a sequence selected from the group consisting of: SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
25. The method of claim 22 , wherein the antisense polynucleotide strand consists of a sequence that is complementary to a sequence selected from the group consisting of:
SEQ ID Nos. 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14 and 15.
26. The method of claim 22 , wherein the individual has a condition associated with excess Fc receptor activity.
27. The method of claim 22 , wherein the individual has asthma or experiences symptoms associated with asthma.
28. The method of claim 27 , wherein the composition comprising the RNAi construct is administered by inhalation.
29. The method of claim 22 , wherein the individual has an immune cytopenia.
30. A method for measuring phagocytosis of target material in phagocytic cells from a cell line of hematopoietic lineage, the method comprising:
a) exposing target material to antibody to generate prepared target material;
b) exposing the phagocytic cells to the prepared target material; and
c) selectively detecting the prepared target material that is internalized by the phagocytic cells.
31. The method of claim 30 , wherein the target material comprises platelets.
32. The method of claim 30 , wherein the prepared target material is labeled with a fluorophore.
33. The method of claim 32 , wherein selectively detecting the prepared target material comprises selectively quenching extracellular target material and detecting the unquenched fluorophore.
34. The method of claim 30 , wherein the phagocytic cells from a cell line of hematopoietic lineage express one or more Fcγ receptors that mediate phagocytosis of opsonized material.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/989,718 US20050267059A1 (en) | 2003-11-14 | 2004-11-15 | Syk-targeted nucleic acid interference |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US51989903P | 2003-11-14 | 2003-11-14 | |
US56445904P | 2004-04-22 | 2004-04-22 | |
US10/989,718 US20050267059A1 (en) | 2003-11-14 | 2004-11-15 | Syk-targeted nucleic acid interference |
Publications (1)
Publication Number | Publication Date |
---|---|
US20050267059A1 true US20050267059A1 (en) | 2005-12-01 |
Family
ID=34623110
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/989,597 Expired - Fee Related US7368559B2 (en) | 2003-11-14 | 2004-11-15 | FcγRIIA-specific nucleic acid interference |
US10/989,718 Abandoned US20050267059A1 (en) | 2003-11-14 | 2004-11-15 | Syk-targeted nucleic acid interference |
US12/079,193 Abandoned US20080293659A1 (en) | 2003-11-14 | 2008-03-25 | FC gamma RIIA-specific nucleic acid interference |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/989,597 Expired - Fee Related US7368559B2 (en) | 2003-11-14 | 2004-11-15 | FcγRIIA-specific nucleic acid interference |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/079,193 Abandoned US20080293659A1 (en) | 2003-11-14 | 2008-03-25 | FC gamma RIIA-specific nucleic acid interference |
Country Status (3)
Country | Link |
---|---|
US (3) | US7368559B2 (en) |
CA (2) | CA2546074A1 (en) |
WO (2) | WO2005049838A2 (en) |
Cited By (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20050075306A1 (en) * | 2003-07-03 | 2005-04-07 | The Trustees Of The University Of Pennsylvania | Inhibition of Syk kinase expression |
US20080139531A1 (en) * | 2006-12-04 | 2008-06-12 | Alcon Manufacturing Ltd. | Use of connective tissue mast cell stabilizers to facilitate ocular surface re-epithelization and wound repair |
US20080254029A1 (en) * | 2007-04-11 | 2008-10-16 | Alcon Research, Ltd. | Use of an Inhibitor of TNFa Plus an Antihistamine to Treat Allergic Rhinitis and Allergic Conjunctivitis |
US20110082145A1 (en) * | 2009-10-01 | 2011-04-07 | Alcon Research, Ltd. | Olopatadine compositions and uses thereof |
WO2014071109A1 (en) | 2012-11-01 | 2014-05-08 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
WO2014151386A1 (en) | 2013-03-15 | 2014-09-25 | Infinity Pharmaceuticals, Inc. | Salts and solid forms of isoquinolinones and composition comprising and methods of using the same |
WO2014194254A1 (en) | 2013-05-30 | 2014-12-04 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
WO2015051241A1 (en) | 2013-10-04 | 2015-04-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015051244A1 (en) | 2013-10-04 | 2015-04-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015061204A1 (en) | 2013-10-21 | 2015-04-30 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015143012A1 (en) | 2014-03-19 | 2015-09-24 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders |
WO2015160986A2 (en) | 2014-04-16 | 2015-10-22 | Infinity Pharmaceuticals, Inc. | Combination therapies |
WO2016054491A1 (en) | 2014-10-03 | 2016-04-07 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
US20160257963A1 (en) * | 2006-04-13 | 2016-09-08 | Arrowhead Pharmaceuticals, Inc. | RNAi-MEDIATED INHIBITION OF SPLEEN TYROSINE KINASE-RELATED INFLAMMATORY CONDITIONS |
WO2017214269A1 (en) | 2016-06-08 | 2017-12-14 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2017223422A1 (en) | 2016-06-24 | 2017-12-28 | Infinity Pharmaceuticals, Inc. | Combination therapies |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005049838A2 (en) * | 2003-11-14 | 2005-06-02 | Yale University | Syk-targeted nucleic acid interference |
US20050265927A1 (en) * | 2004-05-17 | 2005-12-01 | Yale University | Intranasal delivery of nucleic acid molecules |
WO2007073149A1 (en) * | 2005-12-22 | 2007-06-28 | Keygene N.V. | Alternative nucleotides for improved targeted nucleotide exchange |
JP2010527914A (en) * | 2007-04-26 | 2010-08-19 | クォーク ファーマシューティカルズ インコーポレーティッド | Therapeutic delivery of inhibitory nucleic acid molecules to the respiratory system |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996040199A1 (en) | 1995-06-07 | 1996-12-19 | University Of Pennsylvania | Methods of inhibiting phagocytosis |
US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
US6440738B1 (en) * | 2001-02-08 | 2002-08-27 | Isis Pharmaceuticals, Inc. | Antisense modulation of casein kinase 2-beta expression |
WO2003070912A2 (en) * | 2001-06-06 | 2003-08-28 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF EPIDERMAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
US20060127385A1 (en) * | 2002-12-06 | 2006-06-15 | The Trustees Of Boston University | Method for sustaining enos activity |
EP2371835A1 (en) * | 2003-07-03 | 2011-10-05 | The Trustees Of The University Of Pennsylvania | Inhibition of syk kinase expression |
WO2005049838A2 (en) * | 2003-11-14 | 2005-06-02 | Yale University | Syk-targeted nucleic acid interference |
-
2004
- 2004-11-15 WO PCT/US2004/038202 patent/WO2005049838A2/en active Application Filing
- 2004-11-15 CA CA002546074A patent/CA2546074A1/en not_active Abandoned
- 2004-11-15 US US10/989,597 patent/US7368559B2/en not_active Expired - Fee Related
- 2004-11-15 WO PCT/US2004/038192 patent/WO2005049832A2/en active Application Filing
- 2004-11-15 US US10/989,718 patent/US20050267059A1/en not_active Abandoned
- 2004-11-15 CA CA002546067A patent/CA2546067A1/en not_active Abandoned
-
2008
- 2008-03-25 US US12/079,193 patent/US20080293659A1/en not_active Abandoned
Cited By (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7173015B2 (en) | 2003-07-03 | 2007-02-06 | The Trustees Of The University Of Pennsylvania | Inhibition of Syk kinase expression |
US20070219152A1 (en) * | 2003-07-03 | 2007-09-20 | The Trustees Of The University Of Pennsylvania | Inhibition of Syk kinase expression |
US20050075306A1 (en) * | 2003-07-03 | 2005-04-07 | The Trustees Of The University Of Pennsylvania | Inhibition of Syk kinase expression |
US20160257963A1 (en) * | 2006-04-13 | 2016-09-08 | Arrowhead Pharmaceuticals, Inc. | RNAi-MEDIATED INHIBITION OF SPLEEN TYROSINE KINASE-RELATED INFLAMMATORY CONDITIONS |
US20080139531A1 (en) * | 2006-12-04 | 2008-06-12 | Alcon Manufacturing Ltd. | Use of connective tissue mast cell stabilizers to facilitate ocular surface re-epithelization and wound repair |
US20080254029A1 (en) * | 2007-04-11 | 2008-10-16 | Alcon Research, Ltd. | Use of an Inhibitor of TNFa Plus an Antihistamine to Treat Allergic Rhinitis and Allergic Conjunctivitis |
US20110082145A1 (en) * | 2009-10-01 | 2011-04-07 | Alcon Research, Ltd. | Olopatadine compositions and uses thereof |
WO2014071109A1 (en) | 2012-11-01 | 2014-05-08 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
WO2014151386A1 (en) | 2013-03-15 | 2014-09-25 | Infinity Pharmaceuticals, Inc. | Salts and solid forms of isoquinolinones and composition comprising and methods of using the same |
EP3811974A1 (en) | 2013-05-30 | 2021-04-28 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
WO2014194254A1 (en) | 2013-05-30 | 2014-12-04 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
WO2015051241A1 (en) | 2013-10-04 | 2015-04-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015051244A1 (en) | 2013-10-04 | 2015-04-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
EP3964507A1 (en) | 2013-10-04 | 2022-03-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015061204A1 (en) | 2013-10-21 | 2015-04-30 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2015143012A1 (en) | 2014-03-19 | 2015-09-24 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders |
EP4066834A1 (en) | 2014-03-19 | 2022-10-05 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders |
WO2015160986A2 (en) | 2014-04-16 | 2015-10-22 | Infinity Pharmaceuticals, Inc. | Combination therapies |
WO2016054491A1 (en) | 2014-10-03 | 2016-04-07 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2017214269A1 (en) | 2016-06-08 | 2017-12-14 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
WO2017223422A1 (en) | 2016-06-24 | 2017-12-28 | Infinity Pharmaceuticals, Inc. | Combination therapies |
Also Published As
Publication number | Publication date |
---|---|
US7368559B2 (en) | 2008-05-06 |
US20050250722A1 (en) | 2005-11-10 |
CA2546067A1 (en) | 2005-06-02 |
WO2005049832A3 (en) | 2006-04-20 |
WO2005049838A2 (en) | 2005-06-02 |
CA2546074A1 (en) | 2005-06-02 |
WO2005049832A2 (en) | 2005-06-02 |
WO2005049838A3 (en) | 2005-10-06 |
US20080293659A1 (en) | 2008-11-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20080293659A1 (en) | FC gamma RIIA-specific nucleic acid interference | |
US7173015B2 (en) | Inhibition of Syk kinase expression | |
EP1781787B1 (en) | Treatment of eye disorders characterized by an elevated intraocular pressure by sirnas | |
US20050202077A1 (en) | Targeted delivery of RNA interference molecules | |
EP2051585A2 (en) | Materials and methods for reducing inflammation by inhibition of the atrial natriuretic peptide receptor | |
EP3156486A2 (en) | Rnai-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions | |
US20170051291A1 (en) | RNAi-Mediated Inhibition of Phosphodiesterase Type 4 for Treatment of CAMP-Related Ocular Disorders | |
US9745585B2 (en) | RNAi-mediated inhibition of histamine receptor H1-related conditions | |
WO2006024880A9 (en) | Methods and compositions to inhibit p2x7 receptor expression | |
AU2012201409A1 (en) | RNAi-Mediated inhibition of tumor necrosis factor alpha-related conditions |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: YALE UNIVERSITY, CONNECTICUT Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BEARDSLEY, DIANA;CHEN, BING-GUAN;CANDELARIO, ALEJANDRO;REEL/FRAME:016752/0419;SIGNING DATES FROM 20050708 TO 20050711 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |