US20040058884A1 - Tenasin-C nucleic acid ligands - Google Patents

Tenasin-C nucleic acid ligands Download PDF

Info

Publication number
US20040058884A1
US20040058884A1 US10/429,176 US42917603A US2004058884A1 US 20040058884 A1 US20040058884 A1 US 20040058884A1 US 42917603 A US42917603 A US 42917603A US 2004058884 A1 US2004058884 A1 US 2004058884A1
Authority
US
United States
Prior art keywords
tenascin
nucleic acid
artificial sequence
selex
ligands
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/429,176
Inventor
Brian Hicke
Stephen Warren
David Parma
Larry Gold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gilead Sciences Inc
Original Assignee
Gilead Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US07/714,131 external-priority patent/US5475096A/en
Priority claimed from US08/434,425 external-priority patent/US5789157A/en
Priority claimed from US08/993,765 external-priority patent/US6610841B1/en
Application filed by Gilead Sciences Inc filed Critical Gilead Sciences Inc
Priority to US10/429,176 priority Critical patent/US20040058884A1/en
Assigned to GILEAD SCIENCES, INC. reassignment GILEAD SCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NEXSTAR PHARMACEUTICALS, INC.
Publication of US20040058884A1 publication Critical patent/US20040058884A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/547Chelates, e.g. Gd-DOTA or Zinc-amino acid chelates; Chelate-forming compounds, e.g. DOTA or ethylenediamine being covalently linked or complexed to the pharmacologically- or therapeutically-active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06Pyrimidine radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06Pyrimidine radicals
    • C07H19/10Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1048SELEX
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1276RNA-directed DNA polymerase (2.7.7.49), i.e. reverse transcriptase or telomerase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531Production of immunochemical test materials
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531Production of immunochemical test materials
    • G01N33/532Production of labelled immunochemicals
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531Production of immunochemical test materials
    • G01N33/532Production of labelled immunochemicals
    • G01N33/535Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • G01N33/56988HIV or HTLV
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/76Human chorionic gonadotropin including luteinising hormone, follicle stimulating hormone, thyroid stimulating hormone or their receptors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2123/00Preparations for testing in vivo
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/13Decoys
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/317Chemical structure of the backbone with an inverted bond, e.g. a cap structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3183Diol linkers, e.g. glycols or propanediols
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3517Marker; Tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2541/00Reactions characterised by directed evolution
    • C12Q2541/10Reactions characterised by directed evolution the purpose being the selection or design of target specific nucleic acid binding sequences
    • C12Q2541/101Selex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • FMECHANICAL ENGINEERING; LIGHTING; HEATING; WEAPONS; BLASTING
    • F02COMBUSTION ENGINES; HOT-GAS OR COMBUSTION-PRODUCT ENGINE PLANTS
    • F02BINTERNAL-COMBUSTION PISTON ENGINES; COMBUSTION ENGINES IN GENERAL
    • F02B75/00Other engines
    • F02B75/02Engines characterised by their cycles, e.g. six-stroke
    • F02B2075/022Engines characterised by their cycles, e.g. six-stroke having less than six strokes per cycle
    • F02B2075/027Engines characterised by their cycles, e.g. six-stroke having less than six strokes per cycle four
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08RNA viruses
    • G01N2333/15Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus, feline leukaemia virus, human T-cell leukaemia-lymphoma virus
    • G01N2333/155Lentiviridae, e.g. visna-maedi virus, equine infectious virus, FIV, SIV
    • G01N2333/16HIV-1, HIV-2
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08RNA viruses
    • G01N2333/15Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus, feline leukaemia virus, human T-cell leukaemia-lymphoma virus
    • G01N2333/155Lentiviridae, e.g. visna-maedi virus, equine infectious virus, FIV, SIV
    • G01N2333/16HIV-1, HIV-2
    • G01N2333/163Regulatory proteins, e.g. tat, nef, rev, vif, vpu, vpr, vpt, vpx
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475Assays involving growth factors
    • G01N2333/50Fibroblast growth factors [FGF]
    • G01N2333/503Fibroblast growth factors [FGF] basic FGF [bFGF]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575Hormones
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575Hormones
    • G01N2333/62Insulins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/81Protease inhibitors
    • G01N2333/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • G01N2333/811Serine protease (E.C. 3.4.21) inhibitors
    • G01N2333/8121Serpins
    • G01N2333/8125Alpha-1-antitrypsin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433Serine endopeptidases (3.4.21)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433Serine endopeptidases (3.4.21)
    • G01N2333/96441Serine endopeptidases (3.4.21) with definite EC number
    • G01N2333/96455Kallikrein (3.4.21.34; 3.4.21.35)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/966Elastase
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/972Plasminogen activators
    • G01N2333/9726Tissue plasminogen activator
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/974Thrombin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/976Trypsin; Chymotrypsin

Definitions

  • Described herein are high affinity nucleic acid ligands to tenascin-C. Also described herein are methods for identifying and preparing high affinity nucleic acid ligands to tenascin-C. The method used herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by Exponential enrichment. Further disclosed are high affinity nucleic acid ligands to tenascin-C. Further disclosed are RNA ligands to tenascin-C. Also included are oligonucleotides containing nucleotide derivatives chemically modified at the 2′-positions of the purines and pyrimidines. Additionally disclosed are RNA ligands to tenascin-C containing 2′-F and 2′OMe modifications. The oligonucleotides of the present invention are useful as diagnostic and/or therapeutic agents.
  • Tenascin-C is a 1.1-1.5 million Da, hexameric glycoprotein that is located primarily in the extracellular matrix. Tenascin-C is expressed during embryogenesis, wound healing, and neoplasia, suggesting a role for this protein in tissue remodeling (Erickson & Bourdon, (1989) Ann Rev Cell Biol 5:71-92).
  • Neoplastic processes also involve tissue remodeling, and tenascin-C is over-expressed in many tumor types including carcinomas of the lung, breast, prostate, and colon, astrocytomas, glioblastomas, melanomas, and sarcomas (Soini et al., (1993) Am J Clin Pathol 100(2):145-50; Koukoulis et al., (1991) Hum Pathol 22(7):636-43; Borsi et al., (1992) Int J Cancer 52(5):688-92; Koukoulis et al., (1993) J Submicrosc Cytol Pathol 25(2):285-95; Wheat et al., (1993) Hum Pathol 24(9):982-9; Riedl et al., (1998) Dis Colon Rectum 41(1):86-92; Tuominen & Kallioinen (1994) J Cutan Pathol 21(5):424-9; Natali et al., (1990) Int J Cancer
  • tenascin-C is overexpressed in hyperproliferative skin diseases, e.g. psoriasis (Schalkwijk et al., (1991) Br J Dermatol 124(1):13-20), and in atherosclerotic lesions (Fukumoto et al., (1998) J Atheroscler Thromb 5(1):29-35; Wallner et al., (1999) Circulation 99(10):1284-9).
  • Radiolabeled antibodies that bind tenascin-C are used for imaging and therapy of tumors in clinical settings (Paganelli et al., (1999) Eur J Nucl Med 26(4):348-57; Paganelli et al., (1994) Eur J Nucl Med 21(4):314-21; Bigner et al., (1998) J Clin Oncol 16(6):2202-12; Merlo et al., (1997) Int J Cancer 71(5):810-6).
  • Aptamers against tenascin-C have potential utility for cancer diagnosis and therapy, as well as for diagnosis and therapy of atheroslerosis and therapy of psoriasis.
  • Relative to antibodies, aptamers are small (7-20 kDa), clear very rapidly from blood, and are chemically synthesized. Rapid blood clearance is important for in vivo diagnostic imaging, where blood levels are a primary determinant of background that obscures an image. Rapid blood clearance may also be important in therapy, where blood levels may contribute to toxicity.
  • SELEX technology allows rapid aptamer isolation, and chemical synthesis enables facile and site-specific conjugation of aptamers to a variety of inert and bioactive molecules.
  • An aptamer to tenascin-C would therefore be useful for tumor therapy or in vivo or ex vivo diagnostic imaging and/or for delivering a variety of therapeutic agents complexed with the tenascin-C nucleic acid ligand for treatment of disease conditions in which tenascin-C is expressed.
  • SELEX process Systematic Evolution of Ligands by EXponential enrichment
  • nucleic acids have three dimensional structural diversity not unlike proteins.
  • the SELEX process is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by EXponential Enrichment,” now abandoned, U.S. Pat. No. 5,475,096 entitled “Methods for Identifying Nucleic Acid Ligands”, U.S. Pat. No.
  • the SELEX process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets in the SELEX method.
  • the SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
  • the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule.
  • nucleic acids as chemical compounds can form a wide array of shapes, sizes and configurations, and are capable of a far broader repertoire of binding and other functions than those displayed by nucleic acids in biological systems.
  • the SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions.
  • SELEX process-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines.
  • Pat. No. 5,580,737, supra describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH 2 ), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe).
  • the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Blended SELEX,” respectively.
  • These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.
  • the SELEX method further encompasses combining selected nucleic acid ligands with lipophilic compounds or non-immunogenic, high molecular weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”.
  • U.S. patent application Ser. No. 08/434,465 filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”.
  • the present invention describes a method for isolating nucleic acid ligands that bind to tenascin-C with high specificity. Further described herein are nucleic acid ligands to tenascin-C. Also described herein are high affinity RNA ligands to tenascin-C. Further described are 2′fluoro-modified pyrimidine and 2′OMe-modified purine RNA ligands to tenascin-C. The method utilized herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by Exponential enrichment. Included herein are the ligands that are shown in Tables 3 and 4 and FIG. 2.
  • a method for detecting the presence of a disease that is expressing tenascin-C in a biological tissue that may contain the disease is a method for detecting the presence of a tumor that is expressing tenascin-C in a biological tissue that may contain the tumor.
  • a complex for use in in vivo or ex vivo diagnostics is a method for delivering therapeutic agents for the treatment or prophylaxis of diseased tissues that express tenascin-C.
  • FIG. 1 shows binding of Cell SELEX RNA pools to U251 cells.
  • FIG. 2 shows proposed secondary structure of aptamers TTA1 and TTA1.NB. Included in the figure is the conjugation of the aptamers with Tc-99m. All A's are 2′OMe modified. All G's, except as indicated, are 2′OMe modified. All C's and U's are 2′F modified.
  • FIG. 3 shows images of U251 tumor xenografts in mice, obtained using Tc-99m-labeled TTA1 and TTA1.NB, three hours post-injection.
  • FIG. 4 shows fluorescence microscopy of a U251 glioblastoma tumor section, taken three hours after i.v. injection of Rhodamine-Red-X-labeled TTA1.
  • FIG. 5 shows the way in which the Tc-99m and linker is bound through the 5′G of TTA1.
  • the central method utilized herein for identifying nucleic acid ligands to tenascin-C is called the SELEX process, an acronym for Systematic Evolution of Ligands by Exponential enrichment and involves (a) contacting the candidate mixture of nucleic acids with tenascin-C (b) partitioning between members of said candidate mixture on the basis of affinity to tenascin-C, and c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to tenascin-C.
  • the invention includes RNA ligands to tenascin-C.
  • This invention further includes the specific RNA ligands to tenascin-C shown in Tables 3 and 4 and FIG. 2. More specifically, this invention includes nucleic acid sequences that are substantially homologous to and that have substantially the same ability to bind tenascin-C as the specific nucleic acid ligands shown in Tables 3 and 4 and FIG. 2.
  • substantially homologous it is meant a degree of primary sequence homology in excess of 70% , most preferably in excess of 80%, and even more preferably in excess of 90%, 95%, or 99%.
  • the percentage of homology as described herein is calculated as the percentage of nucleotides found in the smaller of the two sequences which align with identical nucleotide residues in the sequence being compared when 1 gap in a length of 10 nucleotides may be introduced to assist in that alignment.
  • Substantially the same ability to bind tenascin-C means that the affinity is within one or two orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has the same ability to bind tenascin-C.
  • nucleic acid ligands of tenascin-C shown in Tables 3 and 4 and FIG. 2 shows that sequences with little or no primary homology may have substantially the same ability to bind tenascin-C.
  • this invention also includes Nucleic Acid Ligands that have substantially the same postulated structure or structural motifs and ability to bind tenascin-C as the nucleic acid ligands shown in Tables 3 and 4 and FIG. 2. Substantially the same structure or structural motifs can be postulated by sequence alignment using the Zukerfold program (see Zuker (1989) Science 244:48-52).
  • a method for detecting the presence of a disease that is expressing tenascin-C in a biological tissue which may contain the disease by the method of (a) identifying a nucleic acid ligand from a candidate mixture of nucleic acids, the nucleic acid ligand being a ligand of tenascin-C, by the method comprising (i) contacting a candidate mixture of nucleic acids with tenascin-C, wherein nucleic acids having an increased affinity to tenascin-C relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (ii) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (iii) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids with relatively higher affinity and specificity for binding to tenascin-C, whereby a nucleic acid ligand of tenascin-C is identified; (b) attach
  • nucleic acid ligand is a non-naturally occurring nucleic acid having a desirable action on a target. Nucleic acid ligands are often referred to as “aptamers.”
  • the target of the present invention is tenascin-C, hence the term tenascin-C nucleic acid ligand.
  • a desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule.
  • the action is specific binding affinity for a target molecule, such target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the nucleic acid ligand is not a nucleic acid having the known physiological function of being bound by the target molecule.
  • Nucleic acid ligands are identified from a candidate mixture of nucleic acids, said nucleic acid ligand being a ligand of a tenascin-C, by the method comprising: a) contacting the candidate mixture with tenascin-C, wherein nucleic acids having an increased affinity to tenascin-C relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; b) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and c) amplifying the increased affinity nucleic acids to yield a ligand-enriched mixture of nucleic acids (see U.S. patent application Ser. No. 08/434,425, filed May 3, 1995, now U.S. Pat. No. 5,789,157, which is hereby incorporated herein by reference).
  • candidate mixture is a mixture of nucleic acids of differing sequence from which to select a desired ligand.
  • the source of a candidate mixture can be from naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques.
  • each nucleic acid has fixed sequences surrounding a randomized region to facilitate the amplification process.
  • nucleic acid means either DNA, RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.
  • modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.
  • SELEX methodology involves the combination of selection of nucleic acid ligands which interact with a target in a desirable manner, for example binding to a protein, with amplification of those selected nucleic acids. Optional iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids which interact most strongly with the target from a pool which contains a very large number of nucleic acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. In the present invention, the SELEX methodology is employed to obtain nucleic acid ligands to tenascin-C.
  • SELEX target or “target” means any compound or molecule of interest for which a ligand is desired.
  • a target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation.
  • the SELEX target is tenascin-C.
  • “Complex” as used herein means the molecular entity formed by the covalent linking of one or more tenascin-C nucleic acid ligands with one or more markers.
  • the complex is depicted as A-B-Y, wherein A is a marker; B is optional, and comprises a linker; and Y is a tenascin-C nucleic acid ligand.
  • Marker as used herein is a molecular entity or entities that when complexed with the tenascin-C nucleic acid ligand, either directly or through a linker(s) or spacer(s), allows the detection of the complex in an in vivo or ex vivo setting through visual or chemical means.
  • markers include, but are not limited to radionuclides, including Tc-99m, Re-188, Cu-64, Cu-67, F-18, 125 I, 131 I, 32 P, 186 Re; all fluorophores, including fluorescein, rhodamine, Texas Red; derivatives of the above fluorophores, including Rhodamine-Red-X; magnetic compounds; and biotin.
  • linker is a molecular entity that connects two or more molecular entities through covalent bond or non-covalent interactions, and can allow spatial separation of the molecular entities in a manner that preserves the functional properties of one or more of the molecular entities.
  • a linker can also be known as a spacer. Examples of a linker include, but are not limited to, the (CH 2 CH 2 O) 6 and hexylamine structures shown in FIG. 2.
  • “Therapeutic” as used herein, includes treatment and/or prophylaxis. When used, therapeutic refers to humans and other animals.
  • Covalent Bond is the chemical bond formed by the sharing of electrons.
  • Non-covalent interactions are means by which molecular entities are held together by interactions other than Covalent Bonds including ionic interactions and hydrogen bonds.
  • the nucleic acid ligands of the present invention are derived from the SELEX methodology.
  • the SELEX process is described in U.S. patent application Ser. No. 07/536,428, entitled Systematic Evolution of Ligands by Exponential Enrichment, now abandoned, U.S. Pat. No. 5,475,096 entitled Nucleic Acid Ligands and U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled Methods for Identifying Nucleic Acid Ligands.
  • These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications.
  • the SELEX process provides a class of products which are nucleic acid molecules, each having a unique sequence, and each of which has the property of binding specifically to a desired target compound or molecule.
  • Target molecules are preferably proteins, but can also include among others carbohydrates, peptidoglycans and a variety of small molecules.
  • SELEX methodology can also be used to target biological structures, such as cell surfaces or viruses, through specific interaction with a molecule that is an integral part of that biological structure.
  • the SELEX process may be defined by the following series of steps:
  • a candidate mixture of nucleic acids of differing sequence is prepared.
  • the candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences.
  • the fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture.
  • the randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).
  • the candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid-target pairs between the target and those nucleic acids having the strongest affinity for the target.
  • nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately 5-50%) are retained during partitioning.
  • nucleic acids selected during partitioning as having the relatively higher affinity for the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target.
  • the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase.
  • the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule.
  • the SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions.
  • SELEX-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines.
  • the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” respectively.
  • These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.
  • nucleic acid ligand can be made to increase the in vivo stability of the nucleic acid ligand or to enhance or to mediate the delivery of the nucleic acid ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, now abandoned, and U.S. Pat. No.
  • nucleic acid ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.
  • Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.
  • the nucleic acid ligands are RNA molecules that are 2′-fluoro (2′-F) modified on the sugar moiety of pyrimidine residues.
  • the modifications can be pre- or post-SELEX process modifications.
  • Pre-SELEX process modifications yield nucleic acid ligands with both specificity for their SELEX target and improved in vivo stability.
  • Post-SELEX process modifications made to 2′-OH nucleic acid ligands can result in improved in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.
  • nucleic acid ligands of the invention are prepared through the SELEX methodology that is outlined above and thoroughly enabled in the SELEX applications incorporated herein by reference in their entirety.
  • the tenascin-C aptamers of the invention bind to the heparin binding site of the tenascin-C COOH terminus.
  • the Nucleic Acid ligands to tenascin-C described herein are useful for diagnostic purposes and can be used to image pathological conditions (such as human tumor imaging).
  • the tenascin-C nucleic acid ligands are useful in the prognosis and monitoring of disease conditions in which tenascin-C is expressed.
  • Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes.
  • Those skilled in the art would be able to adapt any tenascin-C nucleic acid ligand by procedures known in the art to incorporate a marker in order to track the presence of the nucleic acid ligand. Such a marker could be used in a number of diagnostic procedures, such as detection of primary and metastatic tumors and athersclerotic lesions.
  • the labeling marker exemplified herein is technetium-99m; however, other markers such as additional radionuclides, magnetic compounds, fluorophores, biotin, and the like can be conjugated to the tenascin-C nucleic acid ligand for imaging in an in vivo or ex vivo setting disease conditions in which tenascin-C is expressed (e.g., cancer, atherosclerosis, and psoriasis).
  • the marker may be covalently bound to a variety of positions on the tenascin-C nucleic acid ligand, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the tenascin-C nucleic acid ligand.
  • the marker is technetium-99m, preferably it is bonded to the 5′ or 3′ hydroxyl of the phosphate group thereof or to the 5 position of a modified pyrimidine.
  • the marker is bonded to the 5′ hydroxyl of the phosphate group of the nucleic acid ligand with or without a linker.
  • the marker is conjugated to the nucleic acid ligand by incorporating a pyrimidine containing a primary amine at the 5 position, and use of the amine for conjugation to the marker. Attachment of the marker can be done directly or with the utilization of a linker.
  • the preferred linker is a hexylamine linker as shown in FIG. 2.
  • the tenascin-C nucleic acid ligands are useful for the delivery of therapeutic compounds (including, but not limited to, cytotoxic compounds, immune enhancing substances and therapeutic radionuclides) to tissues or organs expressing tenascin-C.
  • therapeutic compounds including, but not limited to, cytotoxic compounds, immune enhancing substances and therapeutic radionuclides
  • Disease conditions in which tenascin-C may be expressed include, but are not limited to, cancer, atherosclerosis, and psoriasis.
  • Those skilled in the art would be able to adapt any tenascin-C nucleic acid ligand by procedures known in the art to incorporate a therapeutic compound in a complex.
  • the therapeutic compound may be covalently bound to a variety of positions on the tenascin-C nucleic acid ligand, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the tenascin-C nucleic acid ligand.
  • the therapeutic agent is bonded to the 5′ amine of the nucleic acid ligand. Attachment of the therapeutic agent can be done directly or with the utilization of a linker.
  • 5-fluorodeoxyuracil or other nucleotide analogs known to be active against tumors can be incorporated internally into existing U's within the tenascin-C nucleic acid ligand or can be added internally or conjugated to either terminus either directly or through a linker.
  • both pyrimidine analogues 2′2′-diFluorocytidine and purine analogues (deoxycoformycin) can be incorporated.
  • U.S. application Ser. No. 08/993,765 filed Dec.
  • nucleotide-based prodrugs comprising nucleic acid ligands directed to a tumor, for example tenascin-C, for precisely localizing chemoradiosensitizers, and radiosensitizers and radionuclides and other radiotherapeutic agents to the tumor.
  • both the marker and therapeutic agent may be associated with the tenascin-C nucleic acid ligand such that detection of the disease condition and delivery of the therapeutic agent is accomplished together in one aptamer or as a mixture of two or more different modified versions of the same aptamer. It is also contemplated that either or both the marker and/or the therapeutic agent may be associated with a non-immunogenic, high molecular weight compound or lipophilic compound, such as a liposome. Methods for conjugating nucleic acid ligands with lipophilic compounds or non-immunogenic compounds in a diagnostic or therapeutic complex are described in U.S.
  • compositions described herein may be administered parenterally by injection (e.g., intravenous, subcutaneous, intradermal, intralesional), although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned. They may also be applied locally by direct injection, can be released from devices, such as implanted stents or catheters, or delivered directly to the site by an infusion pump.
  • One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used.
  • the carrier and the tenascin-C nucleic acid ligand complexed with a therapeutic compound constitute a physiologically-compatible, slow release formulation.
  • the primary solvent in such a carrier may be either aqueous or non-aqueous in nature.
  • the carrier may contain other pharmacologically acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the tenascin-C nucleic acid ligand.
  • excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form.
  • the therapeutic or diagnostic composition may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in ready to use form or requiring reconstitution immediately prior to administration.
  • the manner of administering formulations containing tenascin-C nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intraarterial, intranasal or vaginal or rectal suppository.
  • Example 1 describes the materials and experimental procedures used in Example 2 for the generation of RNA ligands to tenascin-C.
  • Example 2 describes the RNA ligands to tenascin-C and the predicted secondary structure of a selected nucleic acid ligand.
  • Example 3 describes the determination of minimal size necessary for high affinity binding of a selected nucleic acid ligand, and substitution of 2′-OH purines with 2′-OMe purines.
  • Example 4 describes the biodistribution of Tc-99m labeled tenascin-C nucleic acid ligands in tumor-bearing mice.
  • Example 5 describes the use of a fluorescently labeled tenascin-C nucleic acid ligand to localize tenascin-c within tumor tissue.
  • Tenascin-C was purchased from Chemicon (Temecula, Calif.). Single-stranded DNA-primers and templates were synthesized by Operon Technologies Inc. (Alameda, Calif.).
  • RNA which contains the T7 polymerase promoter (underlined).
  • RNA was prepared with T7 RNA polymerase as described previously in Fitzwater, T., and Polisky, B. 1996. A SELEX primer. Methods Enzymol. 267, 275-301, incorporated herein by reference in its entirety. All transcription reactions were performed in the presence of pyrimidine nucleotides that were 2′-fluoro (2′-F) modified on the sugar moiety. This substitution confers enhanced resistance to ribonucleases that utilize the 2′-hydroxyl moiety for cleavage of the phosphodiester bond.
  • 2′-F 2′-fluoro
  • each transcription mixture contained 3.3 mM 2′-F UTP and 3.3 mM 2′-F CTP along with 1 mM GTP and ATP.
  • the initial randomized RNA library thus produced comprised 3 ⁇ 10 14 molecules.
  • the affinities of individual ligands for tenascin-C were determined by standard methods using nitrocellulose filter partitioning (Tuerk C, Gold L. Science 1990 Aug. 3 ;249(4968):505-10).
  • Lumino plates (Labsystems, Needham Heights, Mass.) were coated for 2 hours at room temperature with 200 ⁇ l Dulbecco's PBS containing tenascin-C concentrations as shown in Table 1. After coating, wells were blocked using HBSMC+ buffer [20 mM Hepes, pH 7.4, 137 mM NaCl, 1 mM CaCl 2 , 1 mM MgCl 2 and 1 g/liter human serum albumin (Sigma, fraction V) for rounds 1 to 6 while for rounds 7 and 8 wells were blocked HBSMC+ buffer containing 1 g/liter casein (I-block; Tropix).
  • HBSMC+ buffer 20 mM Hepes, pH 7.4, 137 mM NaCl, 1 mM CaCl 2 , 1 mM MgCl 2 and 1 g/liter human serum albumin (Sigma, fraction V) for rounds 1 to 6 while for rounds 7 and 8 wells were blocked HBSMC+ buffer containing 1 g/liter casein
  • Binding and wash buffer consisted of HBSMC+ buffer containing 0.05% Tween 20.
  • RNA was diluted into 100 ⁇ l of binding buffer and allowed to incubate for 2 hours at 37° C. in the protein coated wells that were pre-washed with binding buffer. After binding, six washes of 200 ⁇ l each were performed. Following the wash step, the dry well was placed on top of a 95° C. heat block for 5 minutes. Standard AMV reverse transcriptase reactions (50 ⁇ l) were performed at 48° C. directly in the well and the reaction products utilized for standard PCR and transcription reactions. Two synthetic primers 5N7 (see above) and 3N7a:
  • Binding assays for the U251 cells Internally labeled RNA was incubated at increasing concentrations with confluent U251 cells in six-well tissue culture plates (Becton Dickinson Labware, Lincoln Park, N.J.) at 37 degrees for 60 min. Unbound RNA was washed away using three 10 minute washes with DPBS+ CaCl 2 at 37 degrees, and bound RNA was collected by disrupting the cells using Trizol (Gibco BRL, Gaithersburg, Md.). Bound RNA was quantitated by liquid scintillation counting.
  • Nucleic Acid Ligands to U251 cells were obtained by the SELEX process and are described in U.S. patent application Ser. No. 08/434,425, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Tissue SELEX,” filed May 3, 1995, now U.S. Pat. No. 5,789,157. Subsequently it was determined that the ligands that were obtained were tenascin-C nucleic acid ligands.
  • RNA and protein input into each round is shown in Table 1. After 8 rounds of SELEX, the affinity of the oligonucleotide pool for tenascin-C was 10 nM, and this affinity did not increase with additional SELEX rounds.
  • FIG. 1 shows that as the number of SELEX rounds increases, the amount of bound RNA also increases at a particular concentration. Because of the complexity of the target tissue, it was not possible to estimate the affinity of the oligonucleotide pools for the unknown target molecules(s) on these cells.
  • E9 pool (nine rounds of binding and EDTA elution from U251 cells) was then used as a starting point for a SELEX against purified tenascin-C. Two rounds of SELEX using purified tenascin-C were performed as described above. Input protein and RNA concentrations for two rounds of SELEX (E9P1 and E9P2) are described in Table 2.
  • Oligonucleotide synthesis procedures were standard for those skilled in the art (Green L S, Jellinek D, Bell C, Beebe L A, Feistner B D, Gill S C, Jucker F M, Janjic N. Chem Biol 1995 October; 2(10):683-95).
  • 2′-fluoro pyrimidine phosphoramidite monomers were obtained from JBL Scientific (San Luis Obispo, Calif.);
  • 2′-OMe purine, 2′-OH purine, hexyl amine, and (CH 2 CH 2 O) 6 monomers, along with the dT polystyrene solid support, were obtained from Glen Research (Sterling, Va.).
  • Aptamer affinities were determined using nitrocellulose filter partitioning (Green et al., supra).
  • TN9 was chosen for further analysis based on its high affinity for tenascin-C. We first searched for a minimal sequence necessary for high affinity binding. Using standard techniques (Green et al, supra), it was discovered that nucleotides 3′ of nucleotide 55 were required for binding to tenascin-C, while no nucleotides could be removed from the 5′ end without loss of affinity. To further decrease the TN9's length from 55 nucleotides and retain high affinity binding, we then attempted to define internal deletions of TN9.
  • RNA foldings predicted by the algorithm, a structure common to each oligonucleotide was found.
  • This structure represented by oligonucleotide TTA1 in FIG. 2, contains three stems that meet at a single junction, a so-called 3-stem junction. This folding places the most highly conserved nucleotides of family II oligonucleotides at the junction area.
  • the second stem was of variable length and sequence, suggesting that extension of the second stem is not required for binding to tenascin-C.
  • nucleotides 10-26 could be replaced with an ethylene glycol linker, (CH 2 CH 2 O) 6 .
  • the linker serves as a substitute loop and decreases the size of the aptamer.
  • four-nucleotide loops (CACU or GAGA) that replace nucleotides 10-26 produce sequences with high affinity for tenascin-C. It would be well within one skilled in the art to determine other nucleotide loops or other spacers that could replace nucleotides 10-26 to produce sequences with high affinity for tenascin-C.
  • TTA1 (Table 4) was then synthesized with the (CH 2 CH 2 O) 6 (Spacer 18) linker, a 3′-3′ dT cap for exonuclease protection, a 5′ hexyl amine (Table 4), and all purines as 2′-OMe except the 5 Gs indicated in Table 4.
  • a non-binding control aptamer, TTA1.NB was generated by deleting 5 nucleotides at the 3′ end to produce TTA1.NB.
  • TTA1 binds to tenascin-C with an equilibrium dissociation constant (K d ) of 5 nM, while TTA1.NB has a K d of >5 ⁇ M for tenascin-C.
  • Nucleotides 10-26 can be replaced by a non-nucleotide ethylene glycol linker. It is therefore likely that TTA1 can be synthesized in two separate pieces, where a break is introduced at the position of the ethylene glycol linker and new 5′ and 3′ ends are introduced. Subsequent to synthesis, the two molecules will incubated together to allow hybrid formation. This method allows introduction of additional amine groups as well as nucleotides at the new 5′ and 3 ends. The new functionalities could be used for bioconjugation. In addition, two-piece synthesis results in increased chemical synthetic yield due to shortening the length of the molecules.
  • Tc-99m chelator Hi 15 ; Hilger, C. S., Willis, M. C., Wolters, M. Pieken, W. A. 1998. Tet, Lett 39, 9403-9406
  • TTA1 and TTA1.NB were conjugated to Hi 15 at 50 mg/ml aptamer in 30% dimethylformamide with 5 molar equivalents of Hi 15 -N-hydoxysuccinimide, buffered in 100 mM Na Borate pH 9.3, for 30 minutes at room temperature.
  • Reversed phase HPLC purification yielded Hi 15 -TTA1 and Hi 15 -TTA1.NB.
  • the oligonucleotides were then labeled with Tc-99m in the following manner: to 1 nmole Hi15-aptamer was added 200 ⁇ L of 100 mM NaPO4 buffer, pH 8.5, 23 mg/mL NaTartrate, and 50 ⁇ L Tc-99m pertechnetate (5.0 mCi) eluted from a Mo-99 column (Syncor, Denver) within 12 hours of use.
  • the labeling reaction was initiated by the addition of 10 ⁇ L 5 mg/mL SnCl 2 .
  • the reaction mixture was incubated for 15 minutes at 90° C.
  • the reaction was separated from unreacted Tc-99m by spin dialysis through a 30,000 MW cut-off membrane (Centrex, Schleicher & Scheull) with two 300 ⁇ L washes. This labeling protocol results in 30-50% of the added 99mTc being incorporated with a specific activity of 2-3 mCi/nmole RNA.
  • the Tc-99m is bound through the 5′G as shown in FIG. 5.
  • U251 xenograft tumors were prepared as follows: U251 cells were cultured in Dulbeccos' Modified Eagle's Medium supplemented with 10% v/v fetal calf serum (Gibco BRL, Gaithersburg, Md.). Athymic mice (Harlan Sprague Dawley, Indianapolis, Ind.) were injected subcutaneously with 1 ⁇ 10 6 U251 cells. When the tumors reached a size of 200-300 mg (1-2 weeks), Tc-99m labeled aptamer was injected intravenously at 3.25 mg/kg.
  • mice were anesthetized using isoflurane (Fort Dodge Animal Health, Fort Dodge, Iowa), blood was collected by cardiac puncture, and the animal was sacrificed and tissues were harvested. Tc-99m levels were counted using a gamma counter (Wallac Oy, Turku, Finland). Aptamer uptake into tissues was measured as the % of injected dose per gram of tissue (% ID/g).
  • mice were obtained using a gamma camera. Mice were placed onto the camera (Siemens, LEM+) under anesthesia (isoflurane). Data were collected (30 sec to 10 minutes) and analyzed using Nuclear MAC software version 3.22.2 (Scientific Imaging, CA) on a Power MAC G3 (Apple Computer, CA).
  • Tc-99m radioactivity also appears in other tissues, notably the small and large intestines.
  • the hepatobiliary clearance pattern seen here can be readily altered by those skilled in the art, for example by altering the hydrophilicity of the Tc-99m chelator, changing the chelator, or changing the radiometal/chelator pair altogether.
  • TTA1 and TTA1.NB were synthesized as described above.
  • Succinimdyl Rhodamine-Red-X (Molecular Probes, Eugene, Oreg.) was conjugated to the 5′ amine of the aptamers as described above for H 15 -NHS conjugation.
  • the Rhodamine-Red-X-conjugated aptamers, TTA1-Red and TTA1.NB-Red were purified by reversed phase HPLC. U251 cell culture and tumor growth in nude mice were as described above.
  • TTA1-Red or TTA1.NB-Red Five nmol of TTA1-Red or TTA1.NB-Red were injected intravenously into nude mice and at the desired time the animal was placed under anesthesia, perfused with 0.9% NaCl, and sacrificed. The tumor was excised and placed in formalin. After 24 hr in formalin, 10 ⁇ M sections were cut and Rhodamine-Red-X was detected using a fluorescence microscope (Eclipse E800, Nikon, Japan).
  • TTA1-Red has identical affinity for tenascin-C as the unconjugated parent aptamer, TTA1, at 5 nM.
  • TTA1-Red has identical affinity for tenascin-C as the unconjugated parent aptamer, TTA1, at 5 nM.
  • TTA1-Red has identical affinity for tenascin-C as the unconjugated parent aptamer, TTA1, at 5 nM.
  • TTA1-Red The binding aptamer, TTA1-Red, strongly stains the tumor but not adjacent tissue (FIG. 4). In contrast, only tissue auto-fluorescence is detected with TTA1.NB-Red.
  • Tenascin-C SELEX RNA and protein input Tenascin-C SELEX RNA and protein input.
  • Tenascin-C RNA Round (pMol/well) (pMol/well) 1 12 200 2 12 200 3 12 200 4 12 200 5 2 33 6 2 33 7 2 33 8 0.2 3.3
  • TN9.4M1235 55 16667667C67U6C6677C77U6C7CUCGCUCGCCGU77U667U6UUU6CUCCCU65 16.5 nM TN9.4M135G6 56 166676 6 ACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUU6CUCCCU65 2.2 nM TN9.4M135A7 57 166676G 7 CGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUU6CUCCCU65 1.7 nM TN9.4M135G9 58 166676GAC 6 AUGCG677C77U6C7CUCGUCGCCGU77U667U6UUU6CUCCCU65 7.7 nM TN9.4M135A10 59 166676GACG 7 UGCG677C77U6C7CUCGUCGCCGU77U667U6UUU6CUCCCU

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Nanotechnology (AREA)
  • Endocrinology (AREA)

Abstract

Methods are described for the identification and preparation of nucleic acid ligands to tenascin-C. Included in the invention are specific RNA ligands to tenascin-C identified by the SELEX method. Further included in the invention are methods for detecting the presence of a disease condition in a biological tissue in which tenascin-C is expressed.

Description

    RELATED APPLICATIONS
  • This application is a Divisional of U.S. patent application Ser. No. 09/854,662, filed May 14, 2001, which is a Divisional of U.S. patent application Ser. No. 09/364,902, filed Jul. 29, 1999, now U.S. Pat. No. 6,232,071, which is a Continuation-in-Part of U.S. patent application Ser. No. 08/434,425, filed May 3, 1995, entitled Systematic Evolution of Ligands by Exponential Enrichment: Tissue SELEX,” now U.S. Pat. No. 5,789,157, which is a Continuation-in Part of U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096, which is a Continuation-in-Part of U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned, and U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev”, now U.S. Pat. No. 5,496,938. This application is also a Continuation-in-Part of U.S. patent application Ser. No. 08/993,765, filed Dec. 18, 1997, entitled “Nucleotide Based Prodrugs.” Each of the above described patents and applications is specifically incorporated by reference herein in their entirety.[0001]
  • FIELD OF THE INVENTION
  • Described herein are high affinity nucleic acid ligands to tenascin-C. Also described herein are methods for identifying and preparing high affinity nucleic acid ligands to tenascin-C. The method used herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by Exponential enrichment. Further disclosed are high affinity nucleic acid ligands to tenascin-C. Further disclosed are RNA ligands to tenascin-C. Also included are oligonucleotides containing nucleotide derivatives chemically modified at the 2′-positions of the purines and pyrimidines. Additionally disclosed are RNA ligands to tenascin-C containing 2′-F and 2′OMe modifications. The oligonucleotides of the present invention are useful as diagnostic and/or therapeutic agents. [0002]
  • BACKGROUND OF THE INVENTION
  • Tenascin-C is a 1.1-1.5 million Da, hexameric glycoprotein that is located primarily in the extracellular matrix. Tenascin-C is expressed during embryogenesis, wound healing, and neoplasia, suggesting a role for this protein in tissue remodeling (Erickson & Bourdon, (1989) [0003] Ann Rev Cell Biol 5:71-92). Neoplastic processes also involve tissue remodeling, and tenascin-C is over-expressed in many tumor types including carcinomas of the lung, breast, prostate, and colon, astrocytomas, glioblastomas, melanomas, and sarcomas (Soini et al., (1993) Am J Clin Pathol 100(2):145-50; Koukoulis et al., (1991) Hum Pathol 22(7):636-43; Borsi et al., (1992) Int J Cancer 52(5):688-92; Koukoulis et al., (1993) J Submicrosc Cytol Pathol 25(2):285-95; Ibrahim et al., (1993) Hum Pathol 24(9):982-9; Riedl et al., (1998) Dis Colon Rectum 41(1):86-92; Tuominen & Kallioinen (1994) J Cutan Pathol 21(5):424-9; Natali et al., (1990) Int J Cancer 46(4):586-90; Zagzag et al., (1995) Cancer Res 55(4):907-14; Hasegawa et al., (1997) Acta Neuropathol (Berl) 93(5):431-7; Saxon et al., (1997) Pediatr Pathol Lab Med 17(2):259-66; Hasegawa et al., (1995) Hum Pathol 26(8):838-45). In addition, tenascin-C is overexpressed in hyperproliferative skin diseases, e.g. psoriasis (Schalkwijk et al., (1991) Br J Dermatol 124(1):13-20), and in atherosclerotic lesions (Fukumoto et al., (1998) J Atheroscler Thromb 5(1):29-35; Wallner et al., (1999) Circulation 99(10):1284-9). Radiolabeled antibodies that bind tenascin-C are used for imaging and therapy of tumors in clinical settings (Paganelli et al., (1999) Eur J Nucl Med 26(4):348-57; Paganelli et al., (1994) Eur J Nucl Med 21(4):314-21; Bigner et al., (1998) J Clin Oncol 16(6):2202-12; Merlo et al., (1997) Int J Cancer 71(5):810-6).
  • Aptamers against tenascin-C have potential utility for cancer diagnosis and therapy, as well as for diagnosis and therapy of atheroslerosis and therapy of psoriasis. Relative to antibodies, aptamers are small (7-20 kDa), clear very rapidly from blood, and are chemically synthesized. Rapid blood clearance is important for in vivo diagnostic imaging, where blood levels are a primary determinant of background that obscures an image. Rapid blood clearance may also be important in therapy, where blood levels may contribute to toxicity. SELEX technology allows rapid aptamer isolation, and chemical synthesis enables facile and site-specific conjugation of aptamers to a variety of inert and bioactive molecules. An aptamer to tenascin-C would therefore be useful for tumor therapy or in vivo or ex vivo diagnostic imaging and/or for delivering a variety of therapeutic agents complexed with the tenascin-C nucleic acid ligand for treatment of disease conditions in which tenascin-C is expressed. [0004]
  • The dogma for many years was that nucleic acids had primarily an informational role. Through a method known as Systematic Evolution of Ligands by EXponential enrichment, termed the SELEX process, it has become clear that nucleic acids have three dimensional structural diversity not unlike proteins. The SELEX process is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by EXponential Enrichment,” now abandoned, U.S. Pat. No. 5,475,096 entitled “Methods for Identifying Nucleic Acid Ligands”, U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled “Nucleic Acid Ligands” each of which is specifically incorporated by reference herein in its entirety. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a nucleic acid ligand to any desired target molecule. The SELEX process provides a class of products which are referred to as nucleic acid ligands or aptamers, each having a unique sequence, and which have the property of binding specifically to a desired target compound or molecule. Each SELEX-identified nucleic acid ligand is a specific ligand of a given target compound or molecule. The SELEX process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets in the SELEX method. The SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule. [0005]
  • It has been recognized by the present inventors that the SELEX method demonstrates that nucleic acids as chemical compounds can form a wide array of shapes, sizes and configurations, and are capable of a far broader repertoire of binding and other functions than those displayed by nucleic acids in biological systems. [0006]
  • The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat. No. 5,707,796, both entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describe the use of the SELEX process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned, U.S. Pat. No. 5,763,177 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” and U.S. patent application Ser. No. 09/093,293, filed Jun. 8 1998, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” describe a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. Pat. No. 5,580,737 entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, which can be non-peptidic, termed Counter-SELEX. U.S. Pat. No. 5,567,588 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. [0007]
  • The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX process-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. Pat. No. 5,580,737, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH[0008] 2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, oligonucleotides containing various 2′-modified pyrimidines.
  • The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by EXponential Enrichment: Blended SELEX,” respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. [0009]
  • The SELEX method further encompasses combining selected nucleic acid ligands with lipophilic compounds or non-immunogenic, high molecular weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”. Each of the above described patents and applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety. [0010]
  • SUMMARY OF THE INVENTION
  • The present invention describes a method for isolating nucleic acid ligands that bind to tenascin-C with high specificity. Further described herein are nucleic acid ligands to tenascin-C. Also described herein are high affinity RNA ligands to tenascin-C. Further described are 2′fluoro-modified pyrimidine and 2′OMe-modified purine RNA ligands to tenascin-C. The method utilized herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by Exponential enrichment. Included herein are the ligands that are shown in Tables 3 and 4 and FIG. 2. [0011]
  • Further included in this invention is a method for detecting the presence of a disease that is expressing tenascin-C in a biological tissue that may contain the disease. Still further included in this invention is a method for detecting the presence of a tumor that is expressing tenascin-C in a biological tissue that may contain the tumor. Further included in this invention is a complex for use in in vivo or ex vivo diagnostics. Still further included in this invention is a method for delivering therapeutic agents for the treatment or prophylaxis of diseased tissues that express tenascin-C. Still further included in this invention is a complex for use in delivering therapeutic agents for treatment or prophylaxis of diseased tissues that express tenascin-C.[0012]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 shows binding of Cell SELEX RNA pools to U251 cells. [0013]
  • FIG. 2 shows proposed secondary structure of aptamers TTA1 and TTA1.NB. Included in the figure is the conjugation of the aptamers with Tc-99m. All A's are 2′OMe modified. All G's, except as indicated, are 2′OMe modified. All C's and U's are 2′F modified. [0014]
  • FIG. 3 shows images of U251 tumor xenografts in mice, obtained using Tc-99m-labeled TTA1 and TTA1.NB, three hours post-injection. [0015]
  • FIG. 4 shows fluorescence microscopy of a U251 glioblastoma tumor section, taken three hours after i.v. injection of Rhodamine-Red-X-labeled TTA1. [0016]
  • FIG. 5 shows the way in which the Tc-99m and linker is bound through the 5′G of TTA1.[0017]
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The central method utilized herein for identifying nucleic acid ligands to tenascin-C is called the SELEX process, an acronym for Systematic Evolution of Ligands by Exponential enrichment and involves (a) contacting the candidate mixture of nucleic acids with tenascin-C (b) partitioning between members of said candidate mixture on the basis of affinity to tenascin-C, and c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to tenascin-C. The invention includes RNA ligands to tenascin-C. This invention further includes the specific RNA ligands to tenascin-C shown in Tables 3 and 4 and FIG. 2. More specifically, this invention includes nucleic acid sequences that are substantially homologous to and that have substantially the same ability to bind tenascin-C as the specific nucleic acid ligands shown in Tables 3 and 4 and FIG. 2. By substantially homologous it is meant a degree of primary sequence homology in excess of 70% , most preferably in excess of 80%, and even more preferably in excess of 90%, 95%, or 99%. The percentage of homology as described herein is calculated as the percentage of nucleotides found in the smaller of the two sequences which align with identical nucleotide residues in the sequence being compared when 1 gap in a length of 10 nucleotides may be introduced to assist in that alignment. Substantially the same ability to bind tenascin-C means that the affinity is within one or two orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has the same ability to bind tenascin-C. [0018]
  • A review of the sequence homologies of the nucleic acid ligands of tenascin-C shown in Tables 3 and 4 and FIG. 2 shows that sequences with little or no primary homology may have substantially the same ability to bind tenascin-C. For these reasons, this invention also includes Nucleic Acid Ligands that have substantially the same postulated structure or structural motifs and ability to bind tenascin-C as the nucleic acid ligands shown in Tables 3 and 4 and FIG. 2. Substantially the same structure or structural motifs can be postulated by sequence alignment using the Zukerfold program (see Zuker (1989) Science 244:48-52). As would be known in the art, other computer programs can be used for predicting secondary structure and structural motifs. Substantially the same structure or structural motif of Nucleic Acid Ligands in solution or as a bound structure can also be postulated using NMR or other techniques as would be known in the art. [0019]
  • Further included in this invention is a method for detecting the presence of a disease that is expressing tenascin-C in a biological tissue which may contain the disease by the method of (a) identifying a nucleic acid ligand from a candidate mixture of nucleic acids, the nucleic acid ligand being a ligand of tenascin-C, by the method comprising (i) contacting a candidate mixture of nucleic acids with tenascin-C, wherein nucleic acids having an increased affinity to tenascin-C relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (ii) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (iii) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids with relatively higher affinity and specificity for binding to tenascin-C, whereby a nucleic acid ligand of tenascin-C is identified; (b) attaching a marker that can be used in in vivo or ex vivo diagnostics to the nucleic acid ligand identified in step (iii) to form a marker-nucleic acid ligand complex; (c) exposing a tissue which may contain the disease to the marker-nucleic acid ligand complex; and (d) detecting the presence of the marker-nucleic acid ligand in the tissue, whereby a disease expressing tenascin-C is identified. [0020]
  • It is a further object of the present invention to provide a complex for use in in vivo or ex vivo diagnostics comprising one or more tenascin-C nucleic acid ligands and one or more markers. Still further included in this invention is a method for delivering therapeutic agents for the treatment or prophylaxis of disease conditions in which tenascin-C is expressed. Still further included in this invention is a complex for use in delivering therapeutic agents for treatment or prophylaxis of disease conditions in which tenascin-C is expressed. [0021]
  • Definitions
  • Various terms are used herein to refer to aspects of the present invention. To aid in the clarification of the description of the components of this invention, the following definitions are provided: [0022]
  • As used herein, “nucleic acid ligand” is a non-naturally occurring nucleic acid having a desirable action on a target. Nucleic acid ligands are often referred to as “aptamers.” The target of the present invention is tenascin-C, hence the term tenascin-C nucleic acid ligand. A desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule. In the preferred embodiment, the action is specific binding affinity for a target molecule, such target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the nucleic acid ligand is not a nucleic acid having the known physiological function of being bound by the target molecule. Nucleic acid ligands are identified from a candidate mixture of nucleic acids, said nucleic acid ligand being a ligand of a tenascin-C, by the method comprising: a) contacting the candidate mixture with tenascin-C, wherein nucleic acids having an increased affinity to tenascin-C relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; b) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and c) amplifying the increased affinity nucleic acids to yield a ligand-enriched mixture of nucleic acids (see U.S. patent application Ser. No. 08/434,425, filed May 3, 1995, now U.S. Pat. No. 5,789,157, which is hereby incorporated herein by reference). [0023]
  • As used herein, “candidate mixture” is a mixture of nucleic acids of differing sequence from which to select a desired ligand. The source of a candidate mixture can be from naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques. In a preferred embodiment, each nucleic acid has fixed sequences surrounding a randomized region to facilitate the amplification process. [0024]
  • As used herein, “nucleic acid” means either DNA, RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. [0025]
  • “SELEX” methodology involves the combination of selection of nucleic acid ligands which interact with a target in a desirable manner, for example binding to a protein, with amplification of those selected nucleic acids. Optional iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids which interact most strongly with the target from a pool which contains a very large number of nucleic acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. In the present invention, the SELEX methodology is employed to obtain nucleic acid ligands to tenascin-C. [0026]
  • The SELEX methodology is described in the SELEX Patent Applications. [0027]
  • “SELEX target” or “target” means any compound or molecule of interest for which a ligand is desired. A target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation. In this application, the SELEX target is tenascin-C. [0028]
  • “Complex” as used herein means the molecular entity formed by the covalent linking of one or more tenascin-C nucleic acid ligands with one or more markers. In certain embodiments of the present invention, the complex is depicted as A-B-Y, wherein A is a marker; B is optional, and comprises a linker; and Y is a tenascin-C nucleic acid ligand. [0029]
  • “Marker” as used herein is a molecular entity or entities that when complexed with the tenascin-C nucleic acid ligand, either directly or through a linker(s) or spacer(s), allows the detection of the complex in an in vivo or ex vivo setting through visual or chemical means. Examples of markers include, but are not limited to radionuclides, including Tc-99m, Re-188, Cu-64, Cu-67, F-18, [0030] 125I, 131I, 32P, 186Re; all fluorophores, including fluorescein, rhodamine, Texas Red; derivatives of the above fluorophores, including Rhodamine-Red-X; magnetic compounds; and biotin.
  • As used herein, “linker” is a molecular entity that connects two or more molecular entities through covalent bond or non-covalent interactions, and can allow spatial separation of the molecular entities in a manner that preserves the functional properties of one or more of the molecular entities. A linker can also be known as a spacer. Examples of a linker include, but are not limited to, the (CH[0031] 2CH2O)6 and hexylamine structures shown in FIG. 2.
  • “Therapeutic” as used herein, includes treatment and/or prophylaxis. When used, therapeutic refers to humans and other animals. [0032]
  • “Covalent Bond” is the chemical bond formed by the sharing of electrons. [0033]
  • “Non-covalent interactions” are means by which molecular entities are held together by interactions other than Covalent Bonds including ionic interactions and hydrogen bonds. [0034]
  • In the preferred embodiment, the nucleic acid ligands of the present invention are derived from the SELEX methodology. The SELEX process is described in U.S. patent application Ser. No. 07/536,428, entitled Systematic Evolution of Ligands by Exponential Enrichment, now abandoned, U.S. Pat. No. 5,475,096 entitled Nucleic Acid Ligands and U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled Methods for Identifying Nucleic Acid Ligands. These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications. [0035]
  • The SELEX process provides a class of products which are nucleic acid molecules, each having a unique sequence, and each of which has the property of binding specifically to a desired target compound or molecule. Target molecules are preferably proteins, but can also include among others carbohydrates, peptidoglycans and a variety of small molecules. SELEX methodology can also be used to target biological structures, such as cell surfaces or viruses, through specific interaction with a molecule that is an integral part of that biological structure. [0036]
  • In its most basic form, the SELEX process may be defined by the following series of steps: [0037]
  • 1) A candidate mixture of nucleic acids of differing sequence is prepared. The candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent). [0038]
  • 2) The candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid-target pairs between the target and those nucleic acids having the strongest affinity for the target. [0039]
  • 3) The nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately 5-50%) are retained during partitioning. [0040]
  • 4) Those nucleic acids selected during partitioning as having the relatively higher affinity for the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target. [0041]
  • 5) By repeating the partitioning and amplifying steps above, the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule. [0042]
  • The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat. No. 5,707,796 both entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describe the use of the SELEX process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned, U.S. Pat. No. 5,763,177 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” and U.S. patent application Ser. No. 09/093,293, filed Jun. 8 1998, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Photoselection of Nucleic Acid Ligands and Solution SELEX” all describe a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. Pat. No. 5,580,737 entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. Pat. No. 5,567,588 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. Pat. No. 5,496,938 entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” describes methods for obtaining improved nucleic acid ligands after SELEX has been performed. U.S. Pat. No. 5,705,337 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chemi-SELEX,” describes methods for covalently linking a ligand to its target. [0043]
  • The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified nucleic acid ligands containing modified nucleotides are described in U.S. Pat. No. 5,660,985 entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. Pat. No. 5,637,459, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH[0044] 2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” describes oligonucleotides containing various 2′-modified pyrimidines.
  • The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” and U.S. Pat. No. 5,683,867 entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. [0045]
  • In U.S. Pat. No. 5,496,938 methods are described for obtaining improved Nucleic Acid Ligands after the SELEX process has been performed. This patent, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” is specifically incorporated herein by reference. [0046]
  • U.S. patent application Ser. No. 08/434,425, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Tissue SELEX,” filed May 3, 1995, now U.S. Pat. No. 5,789,157, describes methods for identifying a nucleic acid ligands to a macromolecular component of a tissue, including cancer cells, and the nucleic acid ligands so identified. This patent is specifically incorporated herein by reference. [0047]
  • One potential problem encountered in the diagnostic or therapeutic use of nucleic acids is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Certain chemical modifications of the nucleic acid ligand can be made to increase the in vivo stability of the nucleic acid ligand or to enhance or to mediate the delivery of the nucleic acid ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, now abandoned, and U.S. Pat. No. 5,660,985, both entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides”, which is specifically incorporated herein by reference. Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. In preferred embodiments of the instant invention, the nucleic acid ligands are RNA molecules that are 2′-fluoro (2′-F) modified on the sugar moiety of pyrimidine residues. [0048]
  • The modifications can be pre- or post-SELEX process modifications. Pre-SELEX process modifications yield nucleic acid ligands with both specificity for their SELEX target and improved in vivo stability. Post-SELEX process modifications made to 2′-OH nucleic acid ligands can result in improved in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand. [0049]
  • Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX process (modification of previously identified unmodified ligands) or by incorporation into the SELEX process. [0050]
  • The nucleic acid ligands of the invention are prepared through the SELEX methodology that is outlined above and thoroughly enabled in the SELEX applications incorporated herein by reference in their entirety. [0051]
  • The tenascin-C aptamers of the invention bind to the heparin binding site of the tenascin-C COOH terminus. [0052]
  • In certain embodiments of the present invention, the Nucleic Acid ligands to tenascin-C described herein are useful for diagnostic purposes and can be used to image pathological conditions (such as human tumor imaging). In addition to diagnosis, the tenascin-C nucleic acid ligands are useful in the prognosis and monitoring of disease conditions in which tenascin-C is expressed. [0053]
  • Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would be able to adapt any tenascin-C nucleic acid ligand by procedures known in the art to incorporate a marker in order to track the presence of the nucleic acid ligand. Such a marker could be used in a number of diagnostic procedures, such as detection of primary and metastatic tumors and athersclerotic lesions. The labeling marker exemplified herein is technetium-99m; however, other markers such as additional radionuclides, magnetic compounds, fluorophores, biotin, and the like can be conjugated to the tenascin-C nucleic acid ligand for imaging in an in vivo or ex vivo setting disease conditions in which tenascin-C is expressed (e.g., cancer, atherosclerosis, and psoriasis). The marker may be covalently bound to a variety of positions on the tenascin-C nucleic acid ligand, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the tenascin-C nucleic acid ligand. In embodiments where the marker is technetium-99m, preferably it is bonded to the 5′ or 3′ hydroxyl of the phosphate group thereof or to the 5 position of a modified pyrimidine. In the most preferred embodiment, the marker is bonded to the 5′ hydroxyl of the phosphate group of the nucleic acid ligand with or without a linker. In another embodiment, the marker is conjugated to the nucleic acid ligand by incorporating a pyrimidine containing a primary amine at the 5 position, and use of the amine for conjugation to the marker. Attachment of the marker can be done directly or with the utilization of a linker. In the embodiment where technetium-99m is used as the marker, the preferred linker is a hexylamine linker as shown in FIG. 2. [0054]
  • In other embodiments, the tenascin-C nucleic acid ligands are useful for the delivery of therapeutic compounds (including, but not limited to, cytotoxic compounds, immune enhancing substances and therapeutic radionuclides) to tissues or organs expressing tenascin-C. Disease conditions in which tenascin-C may be expressed include, but are not limited to, cancer, atherosclerosis, and psoriasis. Those skilled in the art would be able to adapt any tenascin-C nucleic acid ligand by procedures known in the art to incorporate a therapeutic compound in a complex. The therapeutic compound may be covalently bound to a variety of positions on the tenascin-C nucleic acid ligand, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the tenascin-C nucleic acid ligand. In the preferred embodiment, the therapeutic agent is bonded to the 5′ amine of the nucleic acid ligand. Attachment of the therapeutic agent can be done directly or with the utilization of a linker. In embodiments in which cancer is the targeted disease, 5-fluorodeoxyuracil or other nucleotide analogs known to be active against tumors can be incorporated internally into existing U's within the tenascin-C nucleic acid ligand or can be added internally or conjugated to either terminus either directly or through a linker. In addition, both [0055] pyrimidine analogues 2′2′-diFluorocytidine and purine analogues (deoxycoformycin) can be incorporated. In addition, U.S. application Ser. No. 08/993,765, filed Dec. 18, 1997, incorporated herein by reference in its entirety, describes, inter alia, nucleotide-based prodrugs comprising nucleic acid ligands directed to a tumor, for example tenascin-C, for precisely localizing chemoradiosensitizers, and radiosensitizers and radionuclides and other radiotherapeutic agents to the tumor.
  • It is also contemplated that both the marker and therapeutic agent may be associated with the tenascin-C nucleic acid ligand such that detection of the disease condition and delivery of the therapeutic agent is accomplished together in one aptamer or as a mixture of two or more different modified versions of the same aptamer. It is also contemplated that either or both the marker and/or the therapeutic agent may be associated with a non-immunogenic, high molecular weight compound or lipophilic compound, such as a liposome. Methods for conjugating nucleic acid ligands with lipophilic compounds or non-immunogenic compounds in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Ligand Nucleic Acid Complexes,” which is incorporated herein in its entirety. [0056]
  • The therapeutic or diagnostic compositions described herein may be administered parenterally by injection (e.g., intravenous, subcutaneous, intradermal, intralesional), although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned. They may also be applied locally by direct injection, can be released from devices, such as implanted stents or catheters, or delivered directly to the site by an infusion pump. One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used. In one embodiment, it is envisioned that the carrier and the tenascin-C nucleic acid ligand complexed with a therapeutic compound constitute a physiologically-compatible, slow release formulation. The primary solvent in such a carrier may be either aqueous or non-aqueous in nature. In addition, the carrier may contain other pharmacologically acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the tenascin-C nucleic acid ligand. Such excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form. [0057]
  • Once the therapeutic or diagnostic composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in ready to use form or requiring reconstitution immediately prior to administration. The manner of administering formulations containing tenascin-C nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intraarterial, intranasal or vaginal or rectal suppository. [0058]
  • The following examples are provided to explain and illustrate the present invention and are not to be taken as limiting of the invention. Example 1 describes the materials and experimental procedures used in Example 2 for the generation of RNA ligands to tenascin-C. Example 2 describes the RNA ligands to tenascin-C and the predicted secondary structure of a selected nucleic acid ligand. Example 3 describes the determination of minimal size necessary for high affinity binding of a selected nucleic acid ligand, and substitution of 2′-OH purines with 2′-OMe purines. Example 4 describes the biodistribution of Tc-99m labeled tenascin-C nucleic acid ligands in tumor-bearing mice. Example 5 describes the use of a fluorescently labeled tenascin-C nucleic acid ligand to localize tenascin-c within tumor tissue. [0059]
  • EXAMPLES Example 1 Use of SELEX to Obtain Nucleic Acid Ligands to Tenascin-C and to U251 Glioblastoma Cells
  • Materials and Methods [0060]
  • Tenascin-C was purchased from Chemicon (Temecula, Calif.). Single-stranded DNA-primers and templates were synthesized by Operon Technologies Inc. (Alameda, Calif.). [0061]
  • The SELEX-process has been described in detail in the SELEX Patent Applications. In brief, double-stranded transcription templates were prepared by Klenow fragment extension of 40N7a ssDNA: [0062]
  • 5′-TCG[0063] CGCGAGTCGTCTG[40N]CCGCATCGTCCTCCC3′ (SEQ ID NO:1)
  • using the 5N7 primer: [0064]
  • 5′-[0065] TAATACGACTCACTATAGGGAGGACGATGCGG-3′ (SEQ ID NO:2)
  • which contains the T7 polymerase promoter (underlined). RNA was prepared with T7 RNA polymerase as described previously in Fitzwater, T., and Polisky, B. 1996. A SELEX primer. [0066] Methods Enzymol. 267, 275-301, incorporated herein by reference in its entirety. All transcription reactions were performed in the presence of pyrimidine nucleotides that were 2′-fluoro (2′-F) modified on the sugar moiety. This substitution confers enhanced resistance to ribonucleases that utilize the 2′-hydroxyl moiety for cleavage of the phosphodiester bond. Specifically, each transcription mixture contained 3.3 mM 2′-F UTP and 3.3 mM 2′-F CTP along with 1 mM GTP and ATP. The initial randomized RNA library thus produced comprised 3×1014 molecules. The affinities of individual ligands for tenascin-C were determined by standard methods using nitrocellulose filter partitioning (Tuerk C, Gold L. Science 1990 Aug. 3 ;249(4968):505-10).
  • For each round of SELEX, Lumino plates (Labsystems, Needham Heights, Mass.) were coated for 2 hours at room temperature with 200 μl Dulbecco's PBS containing tenascin-C concentrations as shown in Table 1. After coating, wells were blocked using HBSMC+ buffer [20 mM Hepes, pH 7.4, 137 mM NaCl, 1 mM CaCl[0067] 2, 1 mM MgCl2 and 1 g/liter human serum albumin (Sigma, fraction V) for rounds 1 to 6 while for rounds 7 and 8 wells were blocked HBSMC+ buffer containing 1 g/liter casein (I-block; Tropix). Binding and wash buffer consisted of HBSMC+ buffer containing 0.05% Tween 20. For each SELEX round, RNA was diluted into 100 μl of binding buffer and allowed to incubate for 2 hours at 37° C. in the protein coated wells that were pre-washed with binding buffer. After binding, six washes of 200 μl each were performed. Following the wash step, the dry well was placed on top of a 95° C. heat block for 5 minutes. Standard AMV reverse transcriptase reactions (50 μl) were performed at 48° C. directly in the well and the reaction products utilized for standard PCR and transcription reactions. Two synthetic primers 5N7 (see above) and 3N7a:
  • 5′-TCGCGCGAGTCGTCTG-3′ (SEQ ID NO:3) [0068]
  • were used for these template amplification and reverse transcription steps. [0069]
  • For cell SELEX, U251 human glioblastoma cells (Hum. Hered., 1971, 21: 238) were grown to confluence in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal calf serum (GIBCO BRL, Gaithersburg, Md.) on six-well tissue culture plates (Becton Dickinson Labware, Lincoln Park, N.J.) and washed three times using Dulbecco's PBS supplemented with CaCl[0070] 2 (DPBS, GIBCO BRL) buffer. RNA labeled internally by transcription (Fitzwater, 1996, supra) was incubated with the cells at 37 degrees for one hour. The labeled RNA was then removed, and the cells were washed six times for ten minutes each at 37 degrees with DPBS. DPBS containing 5 mM EDTA was then added and incubated with the cells for 30 minutes to elute bound RNAs that remained after the washing steps. This RNA was quantitated by a standard liquid scintillation counting protocol and amplified using RT-PCR.
  • Binding assays for the U251 cells. Internally labeled RNA was incubated at increasing concentrations with confluent U251 cells in six-well tissue culture plates (Becton Dickinson Labware, Lincoln Park, N.J.) at 37 degrees for 60 min. Unbound RNA was washed away using three 10 minute washes with DPBS+ CaCl[0071] 2 at 37 degrees, and bound RNA was collected by disrupting the cells using Trizol (Gibco BRL, Gaithersburg, Md.). Bound RNA was quantitated by liquid scintillation counting.
  • Cloning and Sequencing. Amplified affinity enriched oligonucleotide pools were purified on an 8% polyacrylamide gel, reverse transcribed into ssDNA and the DNA amplified by the polymerase chain reaction (PCR) using primers containing BamH1 and HindIII restriction endonuclease sites. PCR fragments were cloned, plasmids prepared and sequence analyses performed according to standard techniques (Sambrook et al. (1989) [0072] Molecular Cloning: A Laboratory Manual, 2nd Ed. 3 vols., Cold Spring Harbor Laboratory Press, Cold Spring Harbor).
  • Example 2 RNA Ligands to Tenascin-C
  • Nucleic Acid Ligands to U251 cells were obtained by the SELEX process and are described in U.S. patent application Ser. No. 08/434,425, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Tissue SELEX,” filed May 3, 1995, now U.S. Pat. No. 5,789,157. Subsequently it was determined that the ligands that were obtained were tenascin-C nucleic acid ligands. [0073]
  • To obtain oligonucleotide ligands against human tenascin-C, eight rounds of SELEX were performed using the randomized nucleotide library as described above in Materials and Methods. RNA and protein input into each round is shown in Table 1. After 8 rounds of SELEX, the affinity of the oligonucleotide pool for tenascin-C was 10 nM, and this affinity did not increase with additional SELEX rounds. [0074]
  • To obtain ligands to U251 glioblastoma cells, nine rounds of SELEX were performed using the randomized nucleotide library. After nine rounds of binding to U251 cells and EDTA elution, rounds 3, 5 and 9 were tested for their ability to bind to U251 cells. FIG. 1 shows that as the number of SELEX rounds increases, the amount of bound RNA also increases at a particular concentration. Because of the complexity of the target tissue, it was not possible to estimate the affinity of the oligonucleotide pools for the unknown target molecules(s) on these cells. [0075]
  • The E9 pool (nine rounds of binding and EDTA elution from U251 cells) was then used as a starting point for a SELEX against purified tenascin-C. Two rounds of SELEX using purified tenascin-C were performed as described above. Input protein and RNA concentrations for two rounds of SELEX (E9P1 and E9P2) are described in Table 2. [0076]
  • In summary, three different SELEX experiments were performed: an experiment using purified tenascin-C as the target, an experiment using U251 glioblastoma cells as the target, and an experiment in which the SELEX pool from the U251 glioblastoma cells was used to initiate a SELEX experiment using purified tenascin-C as the target. [0077]
  • All three SELEX experiments were analyzed by cloning and sequencing ligands from [0078] round 8 of the purified tenascin-C SELEX (“TN” sequences), from round 9 of the U251 cell SELEX (“E9” sequences), and from round 2 of the U251/tenascin-C hybrid SELEX (“E9P2” sequences). The sequences of 34 unique clones are shown in Table 3, and are divided into two major groups: tenascin-C ligands (“TN” and “E9P2” sequences) and U251 cell ligands (“E9” ligands). Among the tenascin-C ligands, the majority of the clones (65 total) represent one of two distinct sequence classes designated Family I and Family II (FIG. 1). Examination of the variable region of the 12 clones in Family I revealed 7 unique sequences that are related through the consensus sequence GACNYUUCCNGCYAC (SEQ ID NO: 12). Examination of the variable region of the 18 clones in Family II revealed sequences that share a consensus sequence CGUCGCC (Table 3;). The E9 sequences could be grouped into a related set by virtue of conserved GAY and CAU sequences within the variable regions. The remaining sequences did not appear related to other sequences and were classified as orphans. Three sequences predominate, with E9P2-1, E9P2-2, and TN9 represented 14, 16, and 10 times respectively. In the “Orphan” category, one sequence, TN18, was represented twice. Overall, these data represent a highly enriched sequence pool.
  • Most individuals displayed low nanomolar dissociation constants, with the three most prevalent sequences, TN9 and E9P2-1 and -2, having the highest affinities at 5 nM, 2 nM, and 8 nM. (Table 3). These results indicate that the U251 cell SELEX is a repository for aptamers against tenascin-C, and that only two rounds of SELEX were required to isolate the tenascin-specific ligands from the cell SELEX pool. Oligonucleotide ligands against other proteins can be similarly isolated from the E9 pool using purified protein targets. [0079]
  • Example 3 Determination of Minimal Size of TN9, and Substitution of 2′-OH Purines with 2′-OMe Purines: Synthesis of Aptamer TTA1
  • Oligonucleotide synthesis procedures were standard for those skilled in the art (Green L S, Jellinek D, Bell C, Beebe L A, Feistner B D, Gill S C, Jucker F M, Janjic N. Chem Biol 1995 October; 2(10):683-95). 2′-fluoro pyrimidine phosphoramidite monomers were obtained from JBL Scientific (San Luis Obispo, Calif.); 2′-OMe purine, 2′-OH purine, hexyl amine, and (CH[0080] 2CH2O)6 monomers, along with the dT polystyrene solid support, were obtained from Glen Research (Sterling, Va.). Aptamer affinities were determined using nitrocellulose filter partitioning (Green et al., supra).
  • TN9 was chosen for further analysis based on its high affinity for tenascin-C. We first searched for a minimal sequence necessary for high affinity binding. Using standard techniques (Green et al, supra), it was discovered that [0081] nucleotides 3′ of nucleotide 55 were required for binding to tenascin-C, while no nucleotides could be removed from the 5′ end without loss of affinity. To further decrease the TN9's length from 55 nucleotides and retain high affinity binding, we then attempted to define internal deletions of TN9. The first 55 nucleotides of TN9, along with the first 55 nucleotides of related family II ligands TN7, TN21, and TN41, were input into a computer algorithm to determine possible RNA secondary structure foldings (mfold 3.0, accessed at http://www.ibc.wustl.edu/˜zuker/. M. Zuker, D. H. Mathews & D. H. Turner. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. In: RNA Biochemistry and Biotechnology, J. Barciszewski & B. F. C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers, (1999)). Among many potential RNA foldings predicted by the algorithm, a structure common to each oligonucleotide was found. This structure, represented by oligonucleotide TTA1 in FIG. 2, contains three stems that meet at a single junction, a so-called 3-stem junction. This folding places the most highly conserved nucleotides of family II oligonucleotides at the junction area. In comparing TN9, TN7, TN21, and TN41, the second stem was of variable length and sequence, suggesting that extension of the second stem is not required for binding to tenascin-C. Testing this hypothesis on TN9, we found that nucleotides 10-26 could be replaced with an ethylene glycol linker, (CH2CH2O)6. The linker serves as a substitute loop and decreases the size of the aptamer. Additionally, four-nucleotide loops (CACU or GAGA) that replace nucleotides 10-26 produce sequences with high affinity for tenascin-C. It would be well within one skilled in the art to determine other nucleotide loops or other spacers that could replace nucleotides 10-26 to produce sequences with high affinity for tenascin-C.
  • To increase protection against nuclease activity, purine positions that could be substituted with the corresponding 2′-OMe purines were located. The oligonucleotide was arbitrarily divided into five sectors and all purines within each sector were substituted by the corresponding 2′-OMe purine nucleotide, a total of five oligonucleotides (Table 4, Phase I syntheses). The affinity of each oligonucleotide for tenascin-C was determined, and it was found that all purines within [0082] sectors 1, 3 and 5 could be substituted without appreciable loss in affinity. Within sectors 2 and 4, individual purines were then substituted with 2′-OMe purines and the effect of affinity was measured (Table 4, Phase III syntheses). From these experiments, it was deduced that substitution of nucleotides G9, G28, G31, and G34, with 2′-OMe G causes loss in affinity for tenascin-C. Therefore these nucleotides remain as 2′-OH purines in the aptamer TTA1.
  • The aptamer TTA1 (Table 4) was then synthesized with the (CH[0083] 2CH2O)6 (Spacer 18) linker, a 3′-3′ dT cap for exonuclease protection, a 5′ hexyl amine (Table 4), and all purines as 2′-OMe except the 5 Gs indicated in Table 4. A non-binding control aptamer, TTA1.NB, was generated by deleting 5 nucleotides at the 3′ end to produce TTA1.NB. TTA1 binds to tenascin-C with an equilibrium dissociation constant (Kd) of 5 nM, while TTA1.NB has a Kd of >5 μM for tenascin-C.
  • Nucleotides 10-26 can be replaced by a non-nucleotide ethylene glycol linker. It is therefore likely that TTA1 can be synthesized in two separate pieces, where a break is introduced at the position of the ethylene glycol linker and new 5′ and 3′ ends are introduced. Subsequent to synthesis, the two molecules will incubated together to allow hybrid formation. This method allows introduction of additional amine groups as well as nucleotides at the new 5′ and 3 ends. The new functionalities could be used for bioconjugation. In addition, two-piece synthesis results in increased chemical synthetic yield due to shortening the length of the molecules. [0084]
  • Example 4 Biodistribution of Tc-99m Labeled Aptamers in Tumor-Bearing Mice
  • Aptamer biodistribution was tested by conjugating a Tc-99m chelator (Hi[0085] 15; Hilger, C. S., Willis, M. C., Wolters, M. Pieken, W. A. 1998. Tet, Lett 39, 9403-9406) to the 5′ end of the oligonucleotide as shown in FIG. 2, and radiolabeling the aptamer with Tc-99m. TTA1 and TTA1.NB were conjugated to Hi15 at 50 mg/ml aptamer in 30% dimethylformamide with 5 molar equivalents of Hi15-N-hydoxysuccinimide, buffered in 100 mM Na Borate pH 9.3, for 30 minutes at room temperature. Reversed phase HPLC purification yielded Hi15-TTA1 and Hi15-TTA1.NB. The oligonucleotides were then labeled with Tc-99m in the following manner: to 1 nmole Hi15-aptamer was added 200 μL of 100 mM NaPO4 buffer, pH 8.5, 23 mg/mL NaTartrate, and 50 μL Tc-99m pertechnetate (5.0 mCi) eluted from a Mo-99 column (Syncor, Denver) within 12 hours of use. The labeling reaction was initiated by the addition of 10 μL 5 mg/mL SnCl2. The reaction mixture was incubated for 15 minutes at 90° C. The reaction was separated from unreacted Tc-99m by spin dialysis through a 30,000 MW cut-off membrane (Centrex, Schleicher & Scheull) with two 300 μL washes. This labeling protocol results in 30-50% of the added 99mTc being incorporated with a specific activity of 2-3 mCi/nmole RNA. The Tc-99m is bound through the 5′G as shown in FIG. 5.
  • For biodistribution experiments, U251 xenograft tumors were prepared as follows: U251 cells were cultured in Dulbeccos' Modified Eagle's Medium supplemented with 10% v/v fetal calf serum (Gibco BRL, Gaithersburg, Md.). Athymic mice (Harlan Sprague Dawley, Indianapolis, Ind.) were injected subcutaneously with 1×10[0086] 6 U251 cells. When the tumors reached a size of 200-300 mg (1-2 weeks), Tc-99m labeled aptamer was injected intravenously at 3.25 mg/kg. At indicated times, animals were anesthetized using isoflurane (Fort Dodge Animal Health, Fort Dodge, Iowa), blood was collected by cardiac puncture, and the animal was sacrificed and tissues were harvested. Tc-99m levels were counted using a gamma counter (Wallac Oy, Turku, Finland). Aptamer uptake into tissues was measured as the % of injected dose per gram of tissue (% ID/g).
  • Images of mice were obtained using a gamma camera. Mice were placed onto the camera (Siemens, LEM+) under anesthesia (isoflurane). Data were collected (30 sec to 10 minutes) and analyzed using Nuclear MAC software version 3.22.2 (Scientific Imaging, CA) on a Power MAC G3 (Apple Computer, CA). [0087]
  • Biodistribution experiments, Table 5, indicated rapid and specific uptake of the aptamer into tumor tissue; the non-binding aptamer does not remain in the tumor. Blood levels of Tc-99m also cleared rapidly. After three hours, Tc-99m levels brought into the tumor using Hi[0088] 15-TTA1 had a very long half life (>18 hrs). This indicates that once the aptamer penetrates the tumor, the radiolabel carried with it remains in the tumor for long periods of time. Such data indicate that cytotoxic agents, including radionuclides and non-radioactive agents, conjugated to the aptamer will also remain in the tumor with long half lives.
  • Tc-99m radioactivity also appears in other tissues, notably the small and large intestines. The hepatobiliary clearance pattern seen here can be readily altered by those skilled in the art, for example by altering the hydrophilicity of the Tc-99m chelator, changing the chelator, or changing the radiometal/chelator pair altogether. [0089]
  • Whole animal images were obtained using Tc-99m labeled Hi[0090] 15-TTA1 and at 3 hours post-injection. Images obtained from mice injected with Hi15-TTA1, but not from mice injected with Hi15-TTA1.NB, clearly show the tumor (FIG. 3). Additional radioactivity is evident in gastrointestinal tract, as predicted by the biodistribution experiments.
  • Example 5 Use of Fluorescently Labeled TTA1 to Localize Tenascin-C Within Tumor Tissue
  • Materials and Methods. [0091]
  • TTA1 and TTA1.NB were synthesized as described above. Succinimdyl Rhodamine-Red-X (Molecular Probes, Eugene, Oreg.) was conjugated to the 5′ amine of the aptamers as described above for H[0092] 15-NHS conjugation. The Rhodamine-Red-X-conjugated aptamers, TTA1-Red and TTA1.NB-Red, were purified by reversed phase HPLC. U251 cell culture and tumor growth in nude mice were as described above. Five nmol of TTA1-Red or TTA1.NB-Red were injected intravenously into nude mice and at the desired time the animal was placed under anesthesia, perfused with 0.9% NaCl, and sacrificed. The tumor was excised and placed in formalin. After 24 hr in formalin, 10 μM sections were cut and Rhodamine-Red-X was detected using a fluorescence microscope (Eclipse E800, Nikon, Japan).
  • Results: TTA1-Red has identical affinity for tenascin-C as the unconjugated parent aptamer, TTA1, at 5 nM. We compared tumor fluorescence levels of TTA1-Red and TTA1.NB-Red 10 min post-injection. The binding aptamer, TTA1-Red, strongly stains the tumor but not adjacent tissue (FIG. 4). In contrast, only tissue auto-fluorescence is detected with TTA1.NB-Red. These results demonstrate the utility of the aptamer in fluorescent detection of tenascin-C in vivo, and the aptamer may be similarly used for staining tissues sections ex vivo. [0093]
    TABLE 1
    Tenascin-C SELEX RNA and protein input.
    Tenascin-C RNA
    Round (pMol/well) (pMol/well)
    1 12 200
    2 12 200
    3 12 200
    4 12 200
    5 2 33
    6 2 33
    7 2 33
    8 0.2 3.3
  • [0094]
    TABLE 2
    Cell SELEX/tenascin-C SELEX RNA and protein input
    Tenascin-C RNA
    Round (pMol/well) (pMol/well)
    E9P1 2 33
    E9P2 2 33
  • [0095]
    TABLE 3
    Tenascin-C Sequences: purified protein SELEX (tenascin sequences) and U251 cell SELEX +
    purified protein SELEX (E9P2 sequences)
    SEQ
    ID
    NO:
    Family I
    TN11 4 ggGAggAcGauGcgg CAAUcAAAACUcACGUUA UUCCC UCAUUCUAUUAGCUUCCC cagacgacucgcccga 10 nM
    TN45 5 qggaggacgaugcgg CAAUCUcCGAAAAAGACUCUUCCU GCAUCCUCUcACCCCC cagacgacucgcccga 30 nM
    TN4 6 gggaggacgaugcgg CAACCUc   GAAAGACUUUUCCC GCAUCACUGUGUACUCCCC cagacgacucgcccga 40 nM
    TN22 7 gggaggacgaugcgg CAACCUc   GAUAGACUUUUCCC GCAUCACUGUGUACUCCCC cagacgacucgcccga 40 nM
    TN32(2) 8 gggAggAcgauCcgg cAaCCUcAA UCUuGaCAUUUCCC GcACCUAAAUUUG  CCCC cagacgacucgcccga 15 nM
    TN14 9 gggaggacgaugcgg CAAACGAUC ACU UACCUUUCCU GCAUCUGCUAGC CUCCCC cagacgacucgcccga 20 nM
    TN44(3) 10 gggaggacgaugcgg   ACGCCAGCCAUUGACCCUCGCUUCCACUAUUCCAUCCCCC cagacgacucgcccga 10 nM
    TN29(2) 11 gggaggacgaugcgg CCAACCUCAUUUUGACACUUCGCCGCACCUAAUUGCCCC cagacgacucgcccga 25 nM
    consensus: 12                               GACNYUUCCN GCAYC
    Family II
    E922-4(5) 13 gggaggacgaugcgg AACCCAUA ACGCGA ACCGACCAACAUGCCUCCCGUGCCCC cagacgacucgcccga
    E9P2-1(14) 14 gggAggacgaugcgg UGCCCAUAG AAGCGU GCCGCUAAUGCUAACGCCCUCCCC cagacgacucgcccga 2 nM
    E9P2-2(16) 15 gggaggacgaugcgg UGCCCACU AUGCGU GCCGAAAAACAUUUCCCCCUCUACCC cagacgacucgcccga 8 nM
    TN7 (3) 16 gggaggacgaugcgg AACACUUUCCCAUGCGUCGCC AUACC GGAUAUAUUGCUCC cagacgacucgcccga 20 nM
    TN21(4) 17 gggaggacgaugcgg   ACUGGACCAAACCGUCGCCGAUACCCGGAUACUUUGCUCC cagacgacucgcccga 10 nM
    TN9(10) 18 gggaggacgaugcgg    AACAAUGCACUCGUCGCCGUAAU GGAUGUUUUGCUCCCUG cagacgacucgcccga 5 nM
    TN41 19 gggaggacgaugcgg UUAAGUCUCGGUUGAAU GCCCAUCCC AGAUCCCCCUGACC cagacgacucgcccga 20 nM
    consensus:                               GCGUCGCCG
    Orphans
    E992-17 20 gggaggacgaugcgg AUGGCAAGUCGAACCAUCCCCCACGCUUCUCCUGUUCCCC cagacgacucgcccga
    E992-48 21 gggaggacgaugcgg GAAGUUUUcUCUGCCUUGGUUUCGAUUGGCGCCUccCCCC cagacgacucgcccga1
    E9P2-14 22 gggaggacgaugcgg UCGAGCGgUCGACCGUCAACAAGAAUAAAGCGUGUCCCUG cagacgacucgcccga
    E9P2-17 23 gggaggacgaugcgg AUGGCAAGUCGAACCAUCCCCCACGCUUCUCCUGUUCCCC cagacgacucgcccga
    E9P2-22 24 gggaggacgaugcgg ACUAGACcgCGAGUCCAUUCAACUUGCCCAAAAaAAAACcUCCCC cagacgacucgcccga
    E9P2-40 25 gggaggacgaugcgg GAGAUCAACAUUCCUCUAGUUUGGUUCCAACCUACACCCC cagacgacucgcccga
    E9P2-41 26 gggaggacgaugcgg ACGAGCGUCUCAUGAUCACACUAUUUCGUCUCAGUGUGCA cagacgacucgcccga
    TNT8 27 gggaggacgaugcgg UCGACCUCGAAUGACUCUCCACCUAUCUAACAUCCCCCCC cagacgacucgcccga 145 nM
    TN20 28 gggaggacgaugcgg UCGACCUCGAAUGACUCUCCACCUAUCUAACAGCCUUCCC cagacgacucgcccga
    TN5T 29 gggaggacgaugcgg AGAACUCAUCCUAACCGCUCUAACAAAUCUUGUCCGACCG cagacgacucgcccga
    TN8 30 gggaggacgaugcgg AUAAUUcGACACCAACCAGGUCCCGGAAAUCAUCCCUCUG cagacgacucgcccga >10 uM
    TN27 31 gggaggacgaugcgg AAACCAACCGUUGACCAC CUUUUCGUUUCCGGAAAGUCCC cagacgacucgcccga 110 nM
    TN39 32 gggaggacgaugcgg AAGCCAACCCUCUAGUCAGCCUUUCGUUUCCCACGCCACC cagacgacucgcccga
    TN24 33 gggaggacgaugcGg gACCAACUAAACUGUUCGAAAGCUGGaACAUGUCCUGACGC cagacgacucgcccga 10 nM
    TN5 34 gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUGGAACACGUCCUGACGC cagacgacucgcccga
    TN3G 35 gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUAGAACACGUCCAGACGC cagacgacucgcccga
    TN36 36 gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUGGAACACGUUCUGACGC cagacgacucgcccga
    TN10 37 gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUGGAAUACGUCCUGACGC cagacgacucgcccga
    TN1 38 gggaggacgaugcgg AAGUUUA GuGCUCCAGUUCCGACACUCCUcUACUCAGCCC cagacgacucgcccga >10 uM
    TN109 39 qggaggacgaugcgG AgCCAGAGCCUcUcUcAGUUcUaCAGAACUuACCcACUGG cagacgacucgcccga
    TN110 40 gggaggacgaugcgg ACCUAACUCAAUCAGGAACCAAACCUAGCACUCUCAUGGC cagacgacucgcccga
    U251 SELEX Aptamers, EDTA Elution (E9)
    E9-8(3) 41 gggaggacgaugcgg    GAGAUCAACAUUCCUCUAGUUUGGUUCCCAACCUACACCCC cagacgacucgcccga
    E9-15 42 gggaggacgaugcgg AUCUCGAUCCUUCAGCACUUCAUUUCAUUCCUUUcUGCCC cagacgacucgcccga
    E9-6 43 gggaggacgaugcgg    ACGAUCCUUUCCUUA CAUUUCAUCAUUUCUCUUGUGCCC cagacgacucgcccga
    E9-5(2) 44 gggaggacgaugcgg UGACGACAACUCGACUG CAUAUCUCACAACUCCUGUGCCC cagacgacucgcccga
    E9-3(6) 45 gggaggacgaugcgg ACUAGACCGCGAGUC   CAUUCAACUUGCCCAAAAACCUCCCC cagacgacucgcccga
    E9-9 46 gggaggacgaugcgg       GCGCAUCGACCAACAUCCGAUUCGGAUUCCUCCACUCCCC cagacgacugcccga
  • [0096]
    TABLE 4
    2′-OMe Substitutions, Internal Deletions, TTA1, and TTA1.NB
    Sequence SEQ ID NO: Kd
    Phase I. 2′-OMe.Affinity.
    TN9.3 47 gggaggacgaugcggAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCU5 >10 uM
    TN9.4 48 GGGAGGACGAUGCGGAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCUCCCUG5 2 nM
    TN9.4M1 49 66676GACGAUGCGGAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCUCCCU65 6 nM
    TN9.4M2 50 GGGAG67C67U6C6GAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCUCCUG5 20 nM
    TN9.4M3 51 GGGAGGACGAUGCG677C77U6C7CUCGUCGCCGUAAUGGAUGUUUUGCUCCCUG5 7 nM
    TN9.4M4 52 GGGAGGACGAUGCGGAACAAUGCACUC6UC6CC6UAAUGGAUGUUUUGCUCCCUG5 nb
    TN9.4M5 53 GGGAGGACGAUGCGGAACAAUGCACUCGUCGCCGU77U667U6UUUU6CUCCCUG5 4 nM
    TN9.4Me 54 16667667C67U6C6677C77U6C7CUC6UC6CC6U77U667U6UUUU6CUCCCU65 10 nM
    Phase III. 2′-OMe.Affinity.
    TN9.4M1235 55 16667667C67U6C6677C77U6C7CUCGCUCGCCGU77U667U6UUUU6CUCCCU65 16.5 nM
    TN9.4M135G6 56 1666766ACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 2.2 nM
    TN9.4M135A7 57 166676G7CGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 1.7 nM
    TN9.4M135G9 58 166676GAC6AUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 7.7 nM
    TN9.4M135A10 59 166676GACG7UGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 1.3 nM
    TN9.4M135G12c14 60 166676GACGAU6C6677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 2.5 nM
    TN9.4M135G28 61 166676GACGAUGCG677C77U6C7CUC6UCGCCGU77U667U6UUUU6CUCCCU65 37 nM
    TN9.4M135G31 62 166676GACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 55 nM
    TN9.4M135G34 63 166676GACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 7 nM
    TTA1: 64 5′-1G667667CG-(CH2CH2O)6-CGUCGCCGU77U667U6UUUU6CUCCCU65 5 nM
    TTA1.NB: 65 5′-1G667667CG-(CH2CH2O)6-CGUCGCCGU77U667U6UUUU6CU5 >5 uM
  • [0097]
    TABLE 5
    Biodistribution of Tc-99m-TTA1 and -TTA1.NB
    min TTA1 TTA1.NB
    tumor 2 4.470 ± 0.410 4.510 ± 0.300
    10 5.940 ± 0.590 3.020 ± 0.210
    60 2.689 ± 0.310 0.147 ± 0.018
    180 1.883 ± 0.100 0.043 ± 0.004
    570 1.199 ± 0.066 0.018 ± 0.001
    1020 1.150 ± 0.060 N/A
    blood 2 18.247 ± 1.138  15.013 ± 0.506 
    10 2.265 ± 0.245 2.047 ± 0.195
    60 0.112 ± 0.003 0.102 ± 0.019
    180 0.032 ± 0.001 0.034 ± 0.003
    570 0.013 ± 0.001 0.011 ± 0.001
    1020 0.006 ± 0.001 N/A
    lung 2 8.970 ± 1.210 8.130 ± 0.960
    10 2.130 ± 0.080 1.940 ± 0.230
    60 0.157 ± 0.011 0.120 ± 0.005
    180 0.048 ± 0.006 0.041 ± 0.003
    570 0.028 ± 0.006 0.017 ± 0.002
    1020 0.007 ± 0.001 N/A
    liver 2 9.120 ± 0.530 7.900 ± 0.350
    10 12.460 ± 1.250  9.100 ± 0.830
    60 1.234 ± 0.091 0.423 ± 0.095
    180 0.401 ± 0.084 0.211 ± 0.059
    570 0.104 ± 0.017 0.058 ± 0.003
    1020 0.075 ± 0.003 N/A
    spleen 2 5.100 ± 0.410 4.860 ± 0.130
    10 2.460 ± 0.210 1.220 ± 0.120
    60 0.643 ± 0.076 0.110 ± 0.015
    180 0.198 ± 0.026 0.038 ± 0.005
    570 0.062 ± 0.004 0.020 ± 0.001
    1020 0.030 ± 0.003 N/A
    kidney 2 44.430 ± 4.280  54.470 ± 1.210 
    10 18.810 ± 0.940  14.320 ± 2.080 
    60 1.514 ± 0.040 0.637 ± 0.111
    180 0.286 ± 0.028 0.221 ± 0.021
    570 0.140 ± 0.006 0.100 ± 0.013
    1020 0.081 ± 0.005 N/A
    sm. int. 2 3.690 ± 0.250 3.120 ± 0.100
    10 7.010 ± 0.070 6.440 ± 0.250
    60 15.716 ± 2.036  14.649 ± 0.532 
    180 1.479 ± 0.710 1.243 ± 0.405
    570 0.219 ± 0.147 0.159 ± 0.067
    1020 0.280 ± 0.243 N/A
    lg. int. 2 2.340 ± 0.240 2.280 ± 0.180
    10 0.890 ± 0.040 0.770 ± 0.070
    60 10.799 ± 5.381  21.655 ± 11.676
    180 26.182 ± 7.839  18.023 ± 3.485 
    570 1.263 ± 0.706 0.716 ± 0.179
    1020 0.298 ± 0.167 N/A
    muscle
    2 1.270 ± 0.130 1.490 ± 0.050
    10 0.870 ± 0.090 1.840 ± 1.000
    60 0.064 ± 0.003 0.050 ± 0.004
    180 0.016 ± 0.002 0.011 ± 0.001
    570 0.011 ± 0.002 0.007 ± 0.001
    1020  0.003 ± 0.0003
  • [0098]
  • 1 65 1 71 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 1 tcgcgcgagt cgtctgnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnccgc 60 atcgtcctcc c 71 2 32 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 2 taatacgact cactataggg aggacgatgc gg 32 3 16 DNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 3 tcgcgcgagt cgtctg 16 4 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 4 gggaggacga ugcggcaauc aaaacucacg uuauucccuc aucuauuagc uuccccagac 60 gacucgcccg a 71 5 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 5 gggaggacga ugcggcaauc uccgaaaaag acucuuccug cauccucuca ccccccagac 60 gacucgcccg a 71 6 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 6 gggaggacga ugcggcaacc ucgaaagacu uuucccgcau cacuguguac ucccccagac 60 gacucgcccg a 71 7 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 7 gggaggacga ugcggcaacc ucgauagacu uuucccgcau cacuguguac ucccccagac 60 gacucgcccg a 71 8 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 8 gggaggacga ugcggcaacc ucaaucuuga cauuucccgc accuaaauuu gcccccagac 60 gacucgcccg a 71 9 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 9 gggaggacga ugcggcaaac gaucacuuac cuuuccugca ucugcuagcc ucccccagac 60 gacucgcccg a 71 10 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 10 gggaggacga ugcggacgcc agccauugac ccucgcuucc acuauuccau ccccccagac 60 gacucgcccg a 71 11 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 11 gggaggacga ugcggccaac cucauuuuga cacuucgccg caccuaauug cccccagacg 60 acucgcccga 70 12 15 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 12 gacnyuuccn gcayc 15 13 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 13 gggaggacga ugcggaaccc auaacgcgaa ccgaccaaca ugccucccgu gcccccagac 60 gacucgcccg a 71 14 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 14 gggaggacga ugcggugccc auagaagcgu gccgcuaaug cuaacgcccu cccccagacg 60 acucgcccga 70 15 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 15 gggaggacga ugcggugccc acuaugcgug ccgaaaaaca uuucccccuc uaccccagac 60 gacucgcccg a 71 16 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 16 gggaggacga ugcggaacac uuucccaugc gucgccauac cggauauauu gcucccagac 60 gacucgcccg a 71 17 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 17 gggaggacga ugcggacugg accaaaccgu cgccgauacc cggauacuuu gcucccagac 60 gacucgcccg a 71 18 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 18 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccugcagac 60 gacucgcccg a 71 19 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 19 gggaggacga ugcgguuaag ucucgguuga augcccaucc cagauccccc ugacccagac 60 gacucgcccg a 71 20 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 20 gggaggacga ugcggauggc aagucgaacc aucccccacg cuucuccugu ucccccagac 60 gacucgcccg a 71 21 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 21 gggaggacga ugcgggaagu uuucucugcc uugguuucga uuggcgccuc ccccccagac 60 gacucgcccg a 71 22 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 22 gggaggacga ugcggucgag cggucgaccg ucaacaagaa uaaagcgugu cccugcagac 60 gacucgcccg a 71 23 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 23 gggaggacga ugcggauggc aagucgaacc aucccccacg cuucuccugu ucccccagac 60 gacucgcccg a 71 24 76 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 24 gggaggacga ugcggacuag accgcgaguc cauucaacuu gcccaaaaaa aaaccucccc 60 cagacgacuc gcccga 76 25 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 25 gggaggacga ugcgggagau caacauuccu cuaguuuggu uccaaccuac acccccagac 60 gacucgcccg a 71 26 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 26 gggaggacga ugcggacgag cgucucauga ucacacuauu ucgucucagu gugcacagac 60 gacucgcccg a 71 27 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 27 gggaggacga ugcggucgac cucgaaugac ucuccaccua ucuaacaucc ccccccagac 60 gacucgcccg a 71 28 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 28 gggaggacga ugcggucgac cucgaaugac ucuccaccua ucuaacagcc uuccccagac 60 gacucgcccg a 71 29 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 29 gggaggacga ugcggagaac ucauccuaac cgcucuaaca aaucuugucc gaccgcagac 60 gacucgcccg a 71 30 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 30 gggaggacga ugcggauaau ucgacaccaa ccaggucccg gaaaucaucc cucugcagac 60 gacucgcccg a 71 31 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 31 gggaggacga ugcggaaacc aaccguugac caccuuuucg uuuccggaaa guccccagac 60 gacucgcccg a 71 32 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 32 gggaggacga ugcggaagcc aacccucuag ucagccuuuc guuucccacg ccacccagac 60 gacucgcccg a 71 33 72 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 33 gggaggacga ugcgggacca acuaaacugu ucgaaagcug gaacaugucc ugacgccaga 60 cgacucgccc ga 72 34 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 34 gggaggacga ugcggaccaa cuaaacuguu cgaaagcugg aacacguccu gacgccagac 60 gacucgcccg a 71 35 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 35 gggaggacga ugcggaccaa cuaaacuguu cgaaagcuag aacacgucca gacgccagac 60 gacucgcccg a 71 36 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 36 gggaggacga ugcggaccaa cuaaacuguu cgaaagcugg aacacguucu gacgccagac 60 gacucgcccg a 71 37 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 37 gggaggacga ugcggaccaa cuaaacuguu cgaaagcugg aauacguccu gacgccagac 60 gacucgcccg a 71 38 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 38 gggaggacga ugcggaaguu uagugcucca guuccgacac uccucuacuc agccccagac 60 gacucgcccg a 71 39 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 39 gggaggacga ugcggagcca gagccucucu caguucuaca gaacuuaccc acuggcagac 60 gacucgcccg a 71 40 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 40 gggaggacga ugcggaccua acucaaucag gaaccaaacc uagcacucuc auggccagac 60 gacucgcccg a 71 41 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 41 gggaggacga ugcgggagau caacauuccu cuaguuuggu uccaaccuac acccccagac 60 gacucgcccg a 71 42 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 42 gggaggacga ugcggaucuc gauccuucag cacuucauuu cauuccuuuc ugccccagac 60 gacucgcccg a 71 43 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 43 gggaggacga ugcggacgau ccuuuccuua acauuucauc auuucucuug ugccccagac 60 gacucgcccg a 71 44 71 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 44 gggaggacga ugcggugacg acaacucgac ugcauaucuc acaacuccug ugccccagac 60 gacucgcccg a 71 45 72 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 45 gggaggacga ugcggacuag accgcgaguc cauucaacuu gcccaaaaac cucccccaga 60 cgacucgccc ga 72 46 70 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 46 gggaggacga ugcgggcgca ucgagcaaca uccgauucgg auuccuccac ucccccagac 60 gacugcccga 70 47 50 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 47 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu 50 48 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 48 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 49 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 49 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 50 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 50 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 51 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 51 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 52 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 52 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 53 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 53 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 54 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 54 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 55 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 55 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 56 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 56 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 57 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 57 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 58 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 58 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 59 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 59 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 60 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 60 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 61 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 61 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 62 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 62 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 63 55 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 63 gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 64 39 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 64 gggaggacgn cgucgccgua auggauguuu ugcucccug 39 65 34 RNA Artificial Sequence Description of Artificial Sequence Synthetic Sequence 65 gggaggacgn cgucgccgua auggauguuu ugcu 34

Claims (10)

What is claimed is:
1. A method for delivering a therapeutic agent to a patient having a disease in which tecnascin-C is expressed, comprising:
covalently attaching a tenascin-C nucleic acid ligand to a therapeutic agent to form a complex, and administering said complex to said patient.
2. The method of claim 1, wherein the disease in which tenascin-C is expressed is selected from the group consisting of cancer, hyperproliferative skin diseases, and arthrosclerosis.
3. The method of claim 2, wherein the cancer is selected from the group consisting of lung cancer, breast cancer, prostate cancer, colon cancer, astrocytomas, glioblastomas, melanomas, and sarcomas.
4. The method of claim 1, wherein the disease in which tenascin-C is expressed is a disease in which tenascin-C is overexpressed.
5. The method of claim 1, wherein the attachment of the tenascin-C nucleic acid ligand to a therapeutic agent is accomplished through the use of a linker.
6. The method of claim 5, wherein said linker has the structure:
Figure US20040058884A1-20040325-C00001
7. The method of claim 6, wherein the tenascin-C nucleic acid ligand is single stranded.
8. The method of claim 7, wherein the tenascin-C nucleic acid ligand is RNA.
9. The method of claim 8, wherein the tenascin-C nucleic acid ligand is comprised of 2′-fluoro (2′-F) modified nucleotides.
10. The method of claim 1, wherein the tenascin-C nucleic acid ligand is selected from the group consisting of SEQ ID NO:4-65.
US10/429,176 1990-06-11 2003-05-01 Tenasin-C nucleic acid ligands Abandoned US20040058884A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/429,176 US20040058884A1 (en) 1990-06-11 2003-05-01 Tenasin-C nucleic acid ligands

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US53642890A 1990-06-11 1990-06-11
US07/714,131 US5475096A (en) 1990-06-11 1991-06-10 Nucleic acid ligands
US08/434,425 US5789157A (en) 1990-06-11 1995-05-03 Systematic evolution of ligands by exponential enrichment: tissue selex
US08/993,765 US6610841B1 (en) 1997-12-18 1997-12-18 Nucleotide-based prodrugs
US09/364,902 US6232071B1 (en) 1990-06-11 1999-07-29 Tenascin-C nucleic acid ligands
US09/854,662 US6596491B2 (en) 1990-06-11 2001-05-14 Tenascin-C nucleic acid ligands
US10/429,176 US20040058884A1 (en) 1990-06-11 2003-05-01 Tenasin-C nucleic acid ligands

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US08/993,765 Continuation-In-Part US6610841B1 (en) 1990-06-11 1997-12-18 Nucleotide-based prodrugs
US09/854,662 Division US6596491B2 (en) 1990-06-11 2001-05-14 Tenascin-C nucleic acid ligands

Publications (1)

Publication Number Publication Date
US20040058884A1 true US20040058884A1 (en) 2004-03-25

Family

ID=23436596

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/364,902 Expired - Fee Related US6232071B1 (en) 1990-06-11 1999-07-29 Tenascin-C nucleic acid ligands
US09/854,662 Expired - Fee Related US6596491B2 (en) 1990-06-11 2001-05-14 Tenascin-C nucleic acid ligands
US10/429,176 Abandoned US20040058884A1 (en) 1990-06-11 2003-05-01 Tenasin-C nucleic acid ligands
US11/300,662 Abandoned US20060105378A1 (en) 1999-07-29 2005-12-13 Tenascin-C nucleic acid ligands

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/364,902 Expired - Fee Related US6232071B1 (en) 1990-06-11 1999-07-29 Tenascin-C nucleic acid ligands
US09/854,662 Expired - Fee Related US6596491B2 (en) 1990-06-11 2001-05-14 Tenascin-C nucleic acid ligands

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/300,662 Abandoned US20060105378A1 (en) 1999-07-29 2005-12-13 Tenascin-C nucleic acid ligands

Country Status (29)

Country Link
US (4) US6232071B1 (en)
EP (1) EP1198589B9 (en)
JP (1) JP2003505111A (en)
KR (1) KR100605072B1 (en)
CN (2) CN100558411C (en)
AT (1) ATE405675T1 (en)
AU (1) AU767501C (en)
BG (1) BG106361A (en)
BR (1) BR0013170A (en)
CA (1) CA2380473A1 (en)
CZ (1) CZ2002365A3 (en)
DE (1) DE60039986D1 (en)
DK (1) DK1198589T3 (en)
EA (1) EA004795B1 (en)
EE (1) EE200200051A (en)
ES (1) ES2310989T3 (en)
HK (1) HK1048499B (en)
HR (1) HRP20020186A2 (en)
HU (1) HUP0202221A3 (en)
IL (2) IL147872A0 (en)
MX (1) MXPA02000819A (en)
NO (1) NO20020424L (en)
NZ (2) NZ516907A (en)
PL (1) PL201637B1 (en)
RS (1) RS50426B (en)
SK (1) SK1222002A3 (en)
UA (1) UA75578C2 (en)
WO (1) WO2001009390A1 (en)
ZA (1) ZA200200747B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080268478A1 (en) * 2005-03-01 2008-10-30 Cedars-Sinai Medical Center Use of Eotaxin as a Diagnostic Indicator For Atherosclerosis and Vascular Inflammation
US20110104667A1 (en) * 2009-11-03 2011-05-05 Infoscitex Corporation Methods for identifying nucleic acid ligands
US20110104668A1 (en) * 2009-11-03 2011-05-05 Infoscitex Corporation Nucleic acid ligands against infectious prions

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6232071B1 (en) * 1990-06-11 2001-05-15 Gilead Sciences, Inc. Tenascin-C nucleic acid ligands
US7005260B1 (en) * 2000-01-28 2006-02-28 Gilead Sciences, Inc. Tenascin-C nucleic acid ligands
CA2328356A1 (en) * 1999-12-22 2001-06-22 Itty Atcravi Recreational vehicles
US7645743B2 (en) * 1999-12-22 2010-01-12 Altermune, Llc Chemically programmable immunity
IL159053A0 (en) 2001-05-25 2004-05-12 Univ Duke Modulators of pharmacological agents
US20040249130A1 (en) * 2002-06-18 2004-12-09 Martin Stanton Aptamer-toxin molecules and methods for using same
JP2005533794A (en) * 2002-06-18 2005-11-10 アーケミックス コーポレイション Aptamer-toxin molecules and methods of using the same
US10100316B2 (en) 2002-11-21 2018-10-16 Archemix Llc Aptamers comprising CPG motifs
US8039443B2 (en) * 2002-11-21 2011-10-18 Archemix Corporation Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US7727969B2 (en) * 2003-06-06 2010-06-01 Massachusetts Institute Of Technology Controlled release nanoparticle having bound oligonucleotide for targeted delivery
UY29460A1 (en) * 2005-04-08 2006-11-30 Noxxon Pharma Ag NUCLEIC ACIDS FROM UNION TO GHRELIN
EP1897562A1 (en) * 2006-09-08 2008-03-12 Bayer Schering Pharma Aktiengesellschaft Aptamers labelled with Gallium-68
EP3056509A1 (en) 2006-09-08 2016-08-17 Piramal Imaging SA Bombesin analogues for use in diagnosis
US20110136099A1 (en) 2007-01-16 2011-06-09 Somalogic, Inc. Multiplexed Analyses of Test Samples
US8975026B2 (en) 2007-01-16 2015-03-10 Somalogic, Inc. Method for generating aptamers with improved off-rates
ES2647587T3 (en) * 2007-07-17 2017-12-22 Somalogic, Inc. Aptamers with uridines and / or substituted thymidines in position 5 with a benzyl group
EP2036981A1 (en) * 2007-09-12 2009-03-18 Bayer Schering Pharma Aktiengesellschaft Aptamers labeled with 18F
CA2760774A1 (en) 2009-05-05 2010-11-11 Altermune Technologies, Llc Chemically programmable immunity
GB201114662D0 (en) 2011-08-24 2011-10-12 Altermune Technologies Llc Chemically programmable immunity
CN102533772B (en) * 2011-12-12 2013-10-09 中国科学院武汉病毒研究所 Anti-HBV (Hepatitis B Virus) decoy aptamer and screening method thereof
WO2013088140A2 (en) * 2011-12-12 2013-06-20 Isis Innovation Limited Biomarker and use thereof
WO2014012081A2 (en) 2012-07-13 2014-01-16 Ontorii, Inc. Chiral control
CN107058596A (en) * 2017-06-19 2017-08-18 上海市第十人民医院 A kind of mark related to glioblastoma diagnosis and its application

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5436132A (en) * 1993-02-13 1995-07-25 Amano Pharmaceutical Co., Ltd. Quantitative determination of tenascin as glioma marker
US5475096A (en) * 1990-06-11 1995-12-12 University Research Corporation Nucleic acid ligands
US5496938A (en) * 1990-06-11 1996-03-05 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands to HIV-RT and HIV-1 rev
US5582981A (en) * 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target
US5723323A (en) * 1985-03-30 1998-03-03 Kauffman; Stuart Alan Method of identifying a stochastically-generated peptide, polypeptide, or protein having ligand binding property and compositions thereof
US5789157A (en) * 1990-06-11 1998-08-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: tissue selex
US5859228A (en) * 1995-05-04 1999-01-12 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6127119A (en) * 1990-06-11 2000-10-03 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands of tissue target
US6232071B1 (en) * 1990-06-11 2001-05-15 Gilead Sciences, Inc. Tenascin-C nucleic acid ligands
US6242246B1 (en) * 1997-12-15 2001-06-05 Somalogic, Inc. Nucleic acid ligand diagnostic Biochip
US6610841B1 (en) * 1997-12-18 2003-08-26 Gilead Sciences, Inc. Nucleotide-based prodrugs

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989006694A1 (en) 1988-01-15 1989-07-27 Trustees Of The University Of Pennsylvania Process for selection of proteinaceous substances which mimic growth-inducing molecules
CA2104698A1 (en) 1991-02-21 1992-08-22 John J. Toole Aptamers specific for biomolecules and methods of making
US5683874A (en) * 1991-03-27 1997-11-04 Research Corporation Technologies, Inc. Single-stranded circular oligonucleotides capable of forming a triplex with a target sequence
US6229002B1 (en) * 1995-06-07 2001-05-08 Nexstar Pharmaceuticlas, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
ATE318143T1 (en) * 1996-10-25 2006-03-15 Gilead Sciences Inc VASCULAR CELL GROWTH FACTOR (VEGF) NUCLEIC ACID LIGAND COMPLEXES

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5723323A (en) * 1985-03-30 1998-03-03 Kauffman; Stuart Alan Method of identifying a stochastically-generated peptide, polypeptide, or protein having ligand binding property and compositions thereof
US5475096A (en) * 1990-06-11 1995-12-12 University Research Corporation Nucleic acid ligands
US5496938A (en) * 1990-06-11 1996-03-05 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands to HIV-RT and HIV-1 rev
US5789157A (en) * 1990-06-11 1998-08-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: tissue selex
US6127119A (en) * 1990-06-11 2000-10-03 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands of tissue target
US6232071B1 (en) * 1990-06-11 2001-05-15 Gilead Sciences, Inc. Tenascin-C nucleic acid ligands
US6596491B2 (en) * 1990-06-11 2003-07-22 Gilead Sciences, Inc. Tenascin-C nucleic acid ligands
US5582981A (en) * 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target
US5436132A (en) * 1993-02-13 1995-07-25 Amano Pharmaceutical Co., Ltd. Quantitative determination of tenascin as glioma marker
US5859228A (en) * 1995-05-04 1999-01-12 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6242246B1 (en) * 1997-12-15 2001-06-05 Somalogic, Inc. Nucleic acid ligand diagnostic Biochip
US6610841B1 (en) * 1997-12-18 2003-08-26 Gilead Sciences, Inc. Nucleotide-based prodrugs

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080268478A1 (en) * 2005-03-01 2008-10-30 Cedars-Sinai Medical Center Use of Eotaxin as a Diagnostic Indicator For Atherosclerosis and Vascular Inflammation
US20110104667A1 (en) * 2009-11-03 2011-05-05 Infoscitex Corporation Methods for identifying nucleic acid ligands
US20110104668A1 (en) * 2009-11-03 2011-05-05 Infoscitex Corporation Nucleic acid ligands against infectious prions
US8236570B2 (en) 2009-11-03 2012-08-07 Infoscitex Methods for identifying nucleic acid ligands
US8841429B2 (en) 2009-11-03 2014-09-23 Vivonics, Inc. Nucleic acid ligands against infectious prions
US9085773B2 (en) 2009-11-03 2015-07-21 Vivonics, Inc. Methods for identifying nucleic acid ligands

Also Published As

Publication number Publication date
NZ516907A (en) 2003-10-31
EP1198589A1 (en) 2002-04-24
KR100605072B1 (en) 2006-07-26
EP1198589B1 (en) 2008-08-20
HRP20020186A2 (en) 2004-02-29
US20030104377A1 (en) 2003-06-05
CN1164760C (en) 2004-09-01
JP2003505111A (en) 2003-02-12
BR0013170A (en) 2002-04-02
IL147872A (en) 2008-06-05
PL353357A1 (en) 2003-11-17
PL201637B1 (en) 2009-04-30
HUP0202221A3 (en) 2010-01-28
HK1048499A1 (en) 2003-04-04
ZA200200747B (en) 2004-01-28
NZ528077A (en) 2005-04-29
UA75578C2 (en) 2006-05-15
ATE405675T1 (en) 2008-09-15
NO20020424L (en) 2002-03-27
HK1048499B (en) 2005-05-13
BG106361A (en) 2002-10-31
MXPA02000819A (en) 2003-07-14
AU3351900A (en) 2001-02-19
AU767501C (en) 2004-06-17
EA200200094A1 (en) 2002-08-29
KR20020092897A (en) 2002-12-12
EP1198589A4 (en) 2003-02-19
CN1365395A (en) 2002-08-21
YU6402A (en) 2005-03-15
EA004795B1 (en) 2004-08-26
DK1198589T3 (en) 2008-11-17
CN100558411C (en) 2009-11-11
CA2380473A1 (en) 2001-02-08
NO20020424D0 (en) 2002-01-28
AU767501B2 (en) 2003-11-13
CN1589908A (en) 2005-03-09
ES2310989T3 (en) 2009-02-01
US20060105378A1 (en) 2006-05-18
WO2001009390A1 (en) 2001-02-08
US6596491B2 (en) 2003-07-22
IL147872A0 (en) 2002-08-14
HUP0202221A1 (en) 2002-10-28
EP1198589B9 (en) 2009-08-12
SK1222002A3 (en) 2002-09-10
RS50426B (en) 2009-12-31
EE200200051A (en) 2003-04-15
DE60039986D1 (en) 2008-10-02
US6232071B1 (en) 2001-05-15
CZ2002365A3 (en) 2002-06-12

Similar Documents

Publication Publication Date Title
US6596491B2 (en) Tenascin-C nucleic acid ligands
US6127119A (en) Nucleic acid ligands of tissue target
US6124449A (en) High affinity TGFβ nucleic acid ligands and inhibitors
US6699843B2 (en) Method for treatment of tumors using nucleic acid ligands to PDGF
US6933114B2 (en) Nucleic acid ligands to the prostate specific membrane antigen
US6346611B1 (en) High affinity TGfβ nucleic acid ligands and inhibitors
AU2002224401A1 (en) Nucleic acid ligands to the prostate specific membrane antigen
US7005260B1 (en) Tenascin-C nucleic acid ligands
US20060084797A1 (en) High affinity TGFbeta nucleic acid ligands and inhibitors
AU2004242532A1 (en) High affinity TGF beta nucleic acid ligands and inhibitors

Legal Events

Date Code Title Description
AS Assignment

Owner name: GILEAD SCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NEXSTAR PHARMACEUTICALS, INC.;REEL/FRAME:013737/0533

Effective date: 20010123

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE