US20010053539A1 - Fusion proteins with immunoglobulin portions, the preparation and use thereof - Google Patents
Fusion proteins with immunoglobulin portions, the preparation and use thereof Download PDFInfo
- Publication number
- US20010053539A1 US20010053539A1 US09/286,288 US28628899A US2001053539A1 US 20010053539 A1 US20010053539 A1 US 20010053539A1 US 28628899 A US28628899 A US 28628899A US 2001053539 A1 US2001053539 A1 US 2001053539A1
- Authority
- US
- United States
- Prior art keywords
- immunoglobulin
- protein
- parts
- fusion protein
- fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules.
- the functional properties of the two fusion partners are, surprisingly, retained in the fusion protein.
- EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding fusion proteins composed of various domains of the CD4 membrane protein of human T cells and of human IgG1 portions. Some of these fusion proteins bind with the same affinity to the glycoprotein gp120 of human immunodeficiency virus as the cell-bound CD4 molecule.
- the CD4 molecule belongs to the immunoglobulin family and, consequently, has a very similar tertiary structure to that of immunoglobulin molecules. This also applies to the a chain of the T-cell antigen receptor, for which such fusions have also been described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 2937-2940). Hence, on the basis of the very similar domain structure, in this case retention of the biological activity of the two fusion partners in the fusion protein was to be expected.
- the human proteins which are, according to the invention, preferably coupled to the amino terminus of the constant region of immunoglobulin do not belong to the immunoglobulin family and are to be assigned to the following classes: (i) membrane-bound proteins whose extracellular domain is wholly or partly incorporated in the fusion. These are, in particular, thromboplastin and cytokine receptors and growth factor receptors, such as the cellular receptors for interleukin-4, interleukin-7, tumor necrosis factor, GM-CSF, G-CSF, erythropoietin; (ii) non-membrane-bound soluble proteins which are wholly or partly incorporated in the fusion. These are, in particularly, proteins of therapeutic interest such as, for example, erythropoietin and other cytokines and growth factors.
- the fusion proteins can be prepared in known pro- and eukaryotic expression systems, but preferably in mammalian cells (for example CHO, COS and BHK cells).
- mammalian cells for example CHO, COS and BHK cells.
- the fusion proteins according to the invention are, by reason of their immunoglobulin portion, easy to purify by affinity chromatography and have improved pharmacokinetic-properties in vivo.
- the invention thus relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE).
- immunoglobulin is the constant part of the heavy chain of human IgG, particularly preferably of human IgG1, where fusion takes place at the hinge region.
- the invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for diagnosis and therapy.
- Blood coagulation is a process of central importance in the human body.
- the final products of the coagulation cascade are thrombin, which induces the aggregation of blood platelets, and fibrin which stabilizes the platelet thrombus.
- thrombin catalyzes the formation of fibrin from fibrinogen and itself is formed by limited proteolysis of prothrombin.
- Activated factor X (factor Xa) is responsible for this step and, in the presence of factor Va and calcium ions, binds to platelet membranes and cleaves prothrombin.
- factor X Two ways exist for factor X to be activated, the extrinsic and the intrinsic pathway.
- the intrinsic pathway a series of factors is activated by proteolysis in order for each of them to form active proteases.
- thromboplastin tissue factor
- factor VIIa factor VIIa
- calcium ions It was formerly assumed that the activity of thromboplastin is confined to this reaction.
- the thromboplastin/VIIa complex also intervenes to activate the intrinsic pathway at the level of factor IX.
- a thromboplastin/VIIa complex is one of the most important physiological activators of blood coagulation.
- thromboplastin apart from its use as diagnostic aid (see below), can also be employed as constituent of therapeutic agents for treating inborn or acquired blood coagulation deficiencies. Examples of this are chronic hemophilias caused by a deficiency of factors VIII, IX or XI or else acute disturbances of blood coagulation as a consequence of, for example, liver or kidney disease. Use of such a therapeutic agent after surgicial intervention would also be conceivable.
- Thromboplastin is an integral membrane protein which does not belong to the immunoglobulin family. Thromboplastin cDNA sequences have been published by a total of four groups (Fisher et al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell, vol. 50 (1987), 129-135; Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238; Spicer et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 5148-5152).
- Thromboplastin cDNA contains an open reading frame which codes for a polypeptide of 295 amino-acid residues, of which the 32 N-terminal amino acids act as signal peptide.
- Mature thromboplastin comprises 263 amino-acid residues and has a three-domain structure: i) amino-terminal extracellular domain (219 amino-acid residues); ii) transmembrane region (23 amino-acid residues); iii) cytoplasmic domain (carboxyl terminus; 21 amino-acid residues). In the extracellular domain there are three potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is normally glycosylated but glycosylation does not appear essential for the activity of the protein (Paborsky et al., Biochemistry, vol. 29 (1989), 8072-8077).
- Thromboplastin is required as additive to plasma samples in diagnostic tests of coagulation.
- the coagulation status of the tested person can be found by the one-stage prothrombin clotting time determination (for example Quick's test).
- the thromboplastin required for diagnostic tests is currently obtained from human tissue, and the preparation process is difficult to standardize, the yield is low and considerable amounts of human starting material (placentae) must be supplied.
- placentae human starting material
- it is to be expected that preparation of native, membrane-bound thromboplastin by genetic engineering will also be difficult owing to complex purification processes. These difficulties can be avoided by the fusion according to the invention to immunoglobulin portions.
- the thromboplastin fusion proteins according to the invention are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have surprisingly high activity in the one-stage prothrombin clotting time determination.
- mammalian cells for example CHO, BHK, COS cells
- FIG. 2 depicts the total sequence of the clone 2b-Apr5 with the thromboplastin amino-acid sequence deduced therefrom.
- the plasmid pCD4E gamma 1 (EP 0 325 262 A2; deposited at the ATCC under the number No. 67610) is used for expression of a fusion protein composed of human CD4 receptor and human IgG1.
- the DNA sequence coding for the extracellular domain of CD4 is deleted from this plasmid using the restriction enzymes HindIII and BamHI. Only partial cleavage must be carried out with the enzyme HindIII in this case, in order to cut at only one of the two HindIII sites contained in pCD4E gamma 1 (position 2198).
- the result is an opened vector in which a eukaryotic transcription regulation sequence (promoter) is followed by the open HindIII site.
- the open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgG1.
- the reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid.
- DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences are attached at one or both ends.
- oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′ GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3′) or coding region (B: 5′ GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3′) of thromboplastin cDNA were synthesized.
- A 5′ GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3′
- coding region B
- oligonucleotide A is partially homologous with the sequence of the coding strand
- oligonucleotide B is partially homologous with the non-coding strand; cf.
- amplification results in a DNA fragment (827 bp) which contains (based on the coding strand) at the 5′ end before the start of the coding sequence a HindIII site, and at the 3′ end after the codon for the first three amino-acid residues of the transmembrane region a BamHI site.
- the reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the thromboplastin cDNA to the stop codon of the heavy chain of IgG1.
- the desired fragment was obtained and, after treatment with HindIII and BamHI, ligated into the vector pCD4E gamma 1, as described above, which had been cut with HindIII (partially) and BamHI.
- the resulting plasmid was called pTF1Fc (FIG. 4).
- pTF1Fc The fusion protein encoded by the plasmid pTF1Fc is called pTF1Fc hereinafter.
- pTF1Fc was transiently expressed in COS cells.
- COS cells were transfected with pTF1Fc with the aid of DEAE-dextran (EP A 0 325 262).
- DEAE-dextran EP A 0 325 262
- Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
- the first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA).
- the pTF1Fc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 165 KDa).
- TF1Fc fusion protein is active in low concentrations (>50 ng/ml) in the one-stage prothrombin clotting time determination (Vinazzer, H. Gerinnungsphysiologie und Methoden im Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting times achieved are comparable with the clotting times obtained with thromboplastin isolated from human placenta.
- Interleukin-4 (IL-4) is synthesized by T cells and was originally called B-cell growth factor because it is able to stimulate B-cell proliferation. It exerts a large number of effects on these cells.
- One in particular is the stimulation of synthesis of molecules of immunoglobulin subclasses IgG1 and IgE in activated B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5).
- IL-4 also regulates the proliferation and differentiation of T cells and other hemopoietic cells. It thus contributes to the regulation of allergic and other immunological reactions.
- IL-4 binds with high affinity to a specific receptor.
- the cDNA which codes for the human IL-4 receptor has been isolated (Idzerda et al., J. Exp. Med., vol. 171 (1990) 861-873. It is evident from analysis of the amino-acid sequence deduced from the cDNA sequence that the IL-4 receptor is composed of a total of 825 amino acids, with the 25 N-terminal amino acids acting as signal peptide. Mature human IL-4 receptor is composed of 800 amino acids and, like thromboplastin, has a three-domain structure: i) amino-terminal extracellular domain (207 amino acids); ii) transmembrane region (24 amino acids) and iii) cytoplasmic domain (569 amino acids).
- IL- 4 receptor has homologies with human Il-6 [sic] receptor, with the ⁇ -subunit of human IL-2 receptor, with mouse erythropoietin receptor and with rat prolactin receptor (Idzerda et al., loc. cit.).
- thromboplastin it is not a member of the immunoglobulin family but is assigned together with the homologous proteins mentioned to the new family of hematopoietin receptors.
- Members of this family have four cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in the extracellular domain located near the transmembrane region in common.
- the IL-4 receptor fusion proteins are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have, surprisingly, identical functional properties to the extracellular domain of the intact membrane-bound IL-4 receptor molecule.
- oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′ GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3′) or coding region (B: 5′ CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3′) of the IL-4 receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda et al., loc. cit.) were synthesized.
- oligonucleotide A is partially homologous with the sequence of the coding strand
- oligonucleotide B is partially homologous with the non-coding strand; cf.
- thermostable DNA polymerase results in a DNA fragment (836 bp) which, based on the coding strand, contains at the 5′ end before the start of the coding sequence an XhoI site, and at the 3′ end before the last codon of the extracellular domain a BamHI site.
- the reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the IL-4 receptor cDNA to the stop codon of the heavy chain of IgG1.
- the desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI.
- the resulting plasmid was called pIL4RFc (FIG. 6).
- pIL4RFc The fusion protein encoded by the plasmid pIL4RFc is called pIL4RFc hereinafter.
- pIL4RFc was transiently expressed in COS cells.
- COS cells were transfected with pIL4RFc with the aid of DEAE-dextran (EP A 0 325 262).
- DEAE-dextran EP A 0 325 262
- Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
- the first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA).
- the IL4RFc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 150 KDa).
- CTLLHuIL-4RI clone D Idzerda et al., loc. cit.
- it is outstandingly suitable for developing IL-4 binding assays because it can be bound via its Fc part to microtiter plates previously coated with, for example, rabbit anti-human IgG, and in this form likewise binds its ligands with high affinity.
- Mature erythropoietin is a glycoprotein which is composed of 166 amino acids and is essential for the development of erythrocytes. It stimulates the maturation and the terminal differentiation of erythroid precursor cells.
- the cDNA for human EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino acids of mature EPO and a signal peptide of 22 amino acids which is essential for secretion.
- the cDNA can be used to prepare recombinant functional EPO in genetically manipulated mammalian cells and the EPO can be employed clinically for the therapy of anemic manifestations of various etiologies (for example associated with acute renal failure).
- oligonucleotide A is partially homologous with the sequence of the coding strand
- oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 7.
- thermostable DNA polymerase a DNA fragment (598 bp) which, based on the coding strand, contains at the 5′ end in front of the initiation codon an XhoI site and in which at the 3′ end the codon for the penultimate C-terminal amino acid residue of the EPO (Asp) is present in a BamHI recognition sequence.
- the reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of EPO cDNA to the stop codon of the heavy chain of IgG1.
- the desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI.
- the resulting plasmid was called pEPOFc (FIG. 8).
Abstract
The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are surprisingly retained in the fusion protein.
Description
- The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are, surprisingly, retained in the fusion protein.
- EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding fusion proteins composed of various domains of the CD4 membrane protein of human T cells and of human IgG1 portions. Some of these fusion proteins bind with the same affinity to the glycoprotein gp120 of human immunodeficiency virus as the cell-bound CD4 molecule. The CD4 molecule belongs to the immunoglobulin family and, consequently, has a very similar tertiary structure to that of immunoglobulin molecules. This also applies to the a chain of the T-cell antigen receptor, for which such fusions have also been described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 2937-2940). Hence, on the basis of the very similar domain structure, in this case retention of the biological activity of the two fusion partners in the fusion protein was to be expected.
- The human proteins which are, according to the invention, preferably coupled to the amino terminus of the constant region of immunoglobulin do not belong to the immunoglobulin family and are to be assigned to the following classes: (i) membrane-bound proteins whose extracellular domain is wholly or partly incorporated in the fusion. These are, in particular, thromboplastin and cytokine receptors and growth factor receptors, such as the cellular receptors for interleukin-4, interleukin-7, tumor necrosis factor, GM-CSF, G-CSF, erythropoietin; (ii) non-membrane-bound soluble proteins which are wholly or partly incorporated in the fusion. These are, in particularly, proteins of therapeutic interest such as, for example, erythropoietin and other cytokines and growth factors.
- The fusion proteins can be prepared in known pro- and eukaryotic expression systems, but preferably in mammalian cells (for example CHO, COS and BHK cells).
- The fusion proteins according to the invention are, by reason of their immunoglobulin portion, easy to purify by affinity chromatography and have improved pharmacokinetic-properties in vivo.
- The invention thus relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE). Preferred as immunoglobulin is the constant part of the heavy chain of human IgG, particularly preferably of human IgG1, where fusion takes place at the hinge region.
- Furthermore, the invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for diagnosis and therapy.
- Finally, the invention is explained in further examples.
- Blood coagulation is a process of central importance in the human body. There is appropriately delicate regulation of the coagulation cascade, in which a large number of cellular factors and plasma proteins cooperate. These proteins (and their cofactors) in their entirety are called coagulation factors. The final products of the coagulation cascade are thrombin, which induces the aggregation of blood platelets, and fibrin which stabilizes the platelet thrombus. Thrombin catalyzes the formation of fibrin from fibrinogen and itself is formed by limited proteolysis of prothrombin. Activated factor X (factor Xa) is responsible for this step and, in the presence of factor Va and calcium ions, binds to platelet membranes and cleaves prothrombin.
- Two ways exist for factor X to be activated, the extrinsic and the intrinsic pathway. In the intrinsic pathway a series of factors is activated by proteolysis in order for each of them to form active proteases. In the extrinsic pathway, there is increased synthesis of thromboplastin (tissue factor) by damaged cells, and it activates factor X, together with factor VIIa and calcium ions. It was formerly assumed that the activity of thromboplastin is confined to this reaction. However, the thromboplastin/VIIa complex also intervenes to activate the intrinsic pathway at the level of factor IX. Thus, a thromboplastin/VIIa complex is one of the most important physiological activators of blood coagulation.
- It is therefore conceivable that thromboplastin, apart from its use as diagnostic aid (see below), can also be employed as constituent of therapeutic agents for treating inborn or acquired blood coagulation deficiencies. Examples of this are chronic hemophilias caused by a deficiency of factors VIII, IX or XI or else acute disturbances of blood coagulation as a consequence of, for example, liver or kidney disease. Use of such a therapeutic agent after surgicial intervention would also be conceivable.
- Thromboplastin is an integral membrane protein which does not belong to the immunoglobulin family. Thromboplastin cDNA sequences have been published by a total of four groups (Fisher et al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell, vol. 50 (1987), 129-135; Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238; Spicer et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 5148-5152). Thromboplastin cDNA contains an open reading frame which codes for a polypeptide of 295 amino-acid residues, of which the 32 N-terminal amino acids act as signal peptide. Mature thromboplastin comprises 263 amino-acid residues and has a three-domain structure: i) amino-terminal extracellular domain (219 amino-acid residues); ii) transmembrane region (23 amino-acid residues); iii) cytoplasmic domain (carboxyl terminus; 21 amino-acid residues). In the extracellular domain there are three potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is normally glycosylated but glycosylation does not appear essential for the activity of the protein (Paborsky et al., Biochemistry, vol. 29 (1989), 8072-8077).
- Thromboplastin is required as additive to plasma samples in diagnostic tests of coagulation. The coagulation status of the tested person can be found by the one-stage prothrombin clotting time determination (for example Quick's test). The thromboplastin required for diagnostic tests is currently obtained from human tissue, and the preparation process is difficult to standardize, the yield is low and considerable amounts of human starting material (placentae) must be supplied. On the other hand, it is to be expected that preparation of native, membrane-bound thromboplastin by genetic engineering will also be difficult owing to complex purification processes. These difficulties can be avoided by the fusion according to the invention to immunoglobulin portions.
- The thromboplastin fusion proteins according to the invention are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have surprisingly high activity in the one-stage prothrombin clotting time determination.
- Cloning of Thromboplastin cDNA
- The sequence published by Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238, was used for cloning the thromboplastin cDNA. Two oligonucleotide probe molecules (see FIG. 1) were derived from this. These two probe molecules were used to screen a cDNA bank from human placenta (Grundmann et al., Proc. Natl. Acad. Sci. USA, vol. 83 (1986), 8024-8028).
- cDNA clones of various lengths were obtained. One clone, 2b-Apr5, which is used for the subsequent procedure, codes for the same amino-acid sequence as the cDNA described in Scarpati et al. FIG. 2 depicts the total sequence of the clone 2b-Apr5 with the thromboplastin amino-acid sequence deduced therefrom.
- Construction of a Hybrid Plasmid pTF1Fc Coding for Thromboplastin Fusion Protein
- The plasmid pCD4E gamma 1 (EP 0 325 262 A2; deposited at the ATCC under the number No. 67610) is used for expression of a fusion protein composed of human CD4 receptor and human IgG1. The DNA sequence coding for the extracellular domain of CD4 is deleted from this plasmid using the restriction enzymes HindIII and BamHI. Only partial cleavage must be carried out with the enzyme HindIII in this case, in order to cut at only one of the two HindIII sites contained in pCD4E gamma 1 (position 2198). The result is an opened vector in which a eukaryotic transcription regulation sequence (promoter) is followed by the open HindIII site. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgG1. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences are attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′ GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3′) or coding region (B: 5′ GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3′) of thromboplastin cDNA were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 3.
- Thus, amplification results in a DNA fragment (827 bp) which contains (based on the coding strand) at the 5′ end before the start of the coding sequence a HindIII site, and at the 3′ end after the codon for the first three amino-acid residues of the transmembrane region a BamHI site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in
pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the thromboplastin cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with HindIII and BamHI, ligated into thevector pCD4E gamma 1, as described above, which had been cut with HindIII (partially) and BamHI. The resulting plasmid was called pTF1Fc (FIG. 4). - Transfection of pTF1Fc into Mammalian Cells
- The fusion protein encoded by the plasmid pTF1Fc is called pTF1Fc hereinafter. pTF1Fc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pTF1Fc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
- Purification of pTF1Fc Fusion Protein from Cell Culture Supernatants
- 170 ml of supernatant from transiently transfected COS cells were collected overnight in a batch process in a column containing 0.8 ml of protein A-Sepharose at 4° C., washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM citric acid: 100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA). The pTF1Fc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 165 KDa).
- Biological Activity of Purified TF1Fc in the Prothrombin Clotting Time Determination
- TF1Fc fusion protein is active in low concentrations (>50 ng/ml) in the one-stage prothrombin clotting time determination (Vinazzer, H. Gerinnungsphysiologie und Methoden im Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting times achieved are comparable with the clotting times obtained with thromboplastin isolated from human placenta.
- Interleukin-4 (IL-4) is synthesized by T cells and was originally called B-cell growth factor because it is able to stimulate B-cell proliferation. It exerts a large number of effects on these cells. One in particular is the stimulation of synthesis of molecules of immunoglobulin subclasses IgG1 and IgE in activated B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5). In addition, IL-4 also regulates the proliferation and differentiation of T cells and other hemopoietic cells. It thus contributes to the regulation of allergic and other immunological reactions. IL-4 binds with high affinity to a specific receptor. The cDNA which codes for the human IL-4 receptor has been isolated (Idzerda et al., J. Exp. Med., vol. 171 (1990) 861-873. It is evident from analysis of the amino-acid sequence deduced from the cDNA sequence that the IL-4 receptor is composed of a total of 825 amino acids, with the 25 N-terminal amino acids acting as signal peptide. Mature human IL-4 receptor is composed of 800 amino acids and, like thromboplastin, has a three-domain structure: i) amino-terminal extracellular domain (207 amino acids); ii) transmembrane region (24 amino acids) and iii) cytoplasmic domain (569 amino acids). In the extracellular domain there are six potential sites for N-glycosylation (Asn-X-Thr/Ser). IL-4 receptor has homologies with human Il-6 [sic] receptor, with the β-subunit of human IL-2 receptor, with mouse erythropoietin receptor and with rat prolactin receptor (Idzerda et al., loc. cit.). Thus, like thromboplastin, it is not a member of the immunoglobulin family but is assigned together with the homologous proteins mentioned to the new family of hematopoietin receptors. Members of this family have four cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in the extracellular domain located near the transmembrane region in common.
- On the basis of the described function of the IL-4/IL-4 receptor system, there is a possible therapeutic use of a recombinant form of the IL-4 receptor for suppressing IL-4-mediated immune reactions (for example transplant rejection reaction, autoimmune diseases, allergic reactions).
- The amount of substance required for therapy make [sic] it necessary to prepare such molecules by genetic engineering. Because of the straightforward purification by affinity chromatography and improved pharmacokinetic properties, according to the invention the synthesis of soluble forms of the IL-4 receptor as immunoglobulin fusion protein is particularly advantageous.
- The IL-4 receptor fusion proteins are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have, surprisingly, identical functional properties to the extracellular domain of the intact membrane-bound IL-4 receptor molecule.
- Construction of a Hybrid Plasmid pIL-4RFc Coding for IL-4 Receptor Fusion Protein
- Cutting of the plasmid pCD4EGamma1 with XhoI and BamHI results in an opened vector in which the open XhoI site is located downstream from the promoter sequence. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgG1. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences can be attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′
GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3′) or coding region (B: 5′CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3′) of the IL-4 receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda et al., loc. cit.) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 5. Amplification using thermostable DNA polymerase results in a DNA fragment (836 bp) which, based on the coding strand, contains at the 5′ end before the start of the coding sequence an XhoI site, and at the 3′ end before the last codon of the extracellular domain a BamHI site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site inpCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the IL-4 receptor cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into thevector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pIL4RFc (FIG. 6). - Transfection of pIL4RFc into Mammalian Cells
- The fusion protein encoded by the plasmid pIL4RFc is called pIL4RFc hereinafter. pIL4RFc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pIL4RFc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
- Purification of IL4RFc Fusion Protein from Cell Culture Supernatants
- 500 ml of supernatant from transiently transfected COS cells were collected overnight in a batch process in a column containing 1.6 ml of protein A-Sepharose at 4° C., washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM citric acid: 100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA). The IL4RFc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 150 KDa).
- Biological Activity of Purified IL4RFc
- IL4RFc proteins binds125I-radiolabeled IL-4 with the same affinity (KD=0.5 nM) [sic] as membrane-bound intact IL-4 receptor. It inhibits the proliferation of IL-4-dependent cell line CTLLHuIL-4RI clone D (Idzerda et al., loc. cit.) in concentrations of 10-1000 ng/ml. In addition, it is outstandingly suitable for developing IL-4 binding assays because it can be bound via its Fc part to microtiter plates previously coated with, for example, rabbit anti-human IgG, and in this form likewise binds its ligands with high affinity.
- Mature erythropoietin (EPO) is a glycoprotein which is composed of 166 amino acids and is essential for the development of erythrocytes. It stimulates the maturation and the terminal differentiation of erythroid precursor cells. The cDNA for human EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino acids of mature EPO and a signal peptide of 22 amino acids which is essential for secretion. The cDNA can be used to prepare recombinant functional EPO in genetically manipulated mammalian cells and the EPO can be employed clinically for the therapy of anemic manifestations of various etiologies (for example associated with acute renal failure).
- Because of the straightforward purification and the improved pharmacokinetic properties, according to the invention synthesis of EPO as immunoglobulin fusion protein is particularly advantageous.
- Construction of a Hybrid Plasmid pEPOFc Coding for Erythropoietin Fusion Protein
- This construction was carried out in analogy to that described in Example 2 (section: “Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein”). Two oligonucleotides able to hybridize with sequences in the vicinity of the initiation codon (A: 5′
GATCGATCTCGAGATGGGGGTGCACGAATGTCCTGCCTGGCTGTGG 3′) and of the stop codon (B: 5′CTGGAATCGGATCCCCTGTCCTGCAGGCCTCCCCTGTGTACAGC 3′) of the EPO cDNA cloned in the vector pCES (EP A 0 267 678) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 7. After amplification there is present with thermostable DNA polymerase a DNA fragment (598 bp) which, based on the coding strand, contains at the 5′ end in front of the initiation codon an XhoI site and in which at the 3′ end the codon for the penultimate C-terminal amino acid residue of the EPO (Asp) is present in a BamHI recognition sequence. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site inpCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of EPO cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into thevector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pEPOFc (FIG. 8).
Claims (22)
1. A soluble fusion protein composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of immunoglobulin molecules of all subclasses.
2. A fusion protein as claimed in , wherein the immunoglobulin portion is the constant part of the heavy chain of human IgG.
claim 1
3. A fusion protein as claimed in , wherein the immunoglobulin portion is the constant part of the heavy chain of human IgG1 or a protein A-binding fragment thereof.
claim 2
4. A fusion protein as claimed in or , wherein the fusion takes place at the hinge region.
claim 2
claim 3
5. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extra-cellular portion of a membrane protein or parts thereof.
6. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of thromboplastin or parts thereof.
7. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of CD28 or parts thereof.
8. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of a cytokine receptor or growth factor receptor or parts thereof.
9. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of IL-4 receptor or parts thereof.
claim 8
10. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of IL-7 receptor or parts thereof.
claim 8
11. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of tumor necrosis factor receptor or parts thereof.
claim 8
12. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of G-CSF receptor or parts thereof.
claim 8
13. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of GM-CSF receptor or parts thereof.
claim 8
14. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is the extracellular portion of erythropoietin receptor or parts thereof.
claim 8
15. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is a non-membrane-bound soluble protein or parts thereof.
16. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is a cytokine- or growth factor or parts thereof.
claim 15
17. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is erythropoietin or parts thereof.
claim 16
18. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is GM-CSF or G-CSF or parts thereof.
claim 16
19. A fusion protein as claimed in , wherein the protein fused to immunoglobulin is interleukins IL-1 to IL-8 or parts thereof.
claim 16
20. A process for preparing fusion proteins as claimed in any of claims 1-19, which comprises introducing the DNA coding for these constructs into a mammalian cell expression system and, after expression, purifying the produced fusion protein by affinity chromatography via the immunoglobulin portion.
21. The use of the fusion proteins as claimed in any of claims 1-19 for diagnosis.
22. The use of the fusion proteins as claimed in any of claims 1-19 for therapy.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/286,288 US20010053539A1 (en) | 1990-06-28 | 1999-04-06 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
US10/135,747 US20030064480A1 (en) | 1990-06-28 | 2002-04-30 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE4020607 | 1990-06-28 | ||
DEP4020607.6 | 1990-06-28 | ||
US58170390A | 1990-09-13 | 1990-09-13 | |
US1322993A | 1993-02-01 | 1993-02-01 | |
US08/293,603 US7253264B1 (en) | 1990-06-28 | 1994-08-22 | Immunoglobulin fusion proteins, their production and use |
US09/286,288 US20010053539A1 (en) | 1990-06-28 | 1999-04-06 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/293,603 Division US7253264B1 (en) | 1990-06-28 | 1994-08-22 | Immunoglobulin fusion proteins, their production and use |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/135,747 Continuation US20030064480A1 (en) | 1990-06-28 | 2002-04-30 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
US20010053539A1 true US20010053539A1 (en) | 2001-12-20 |
Family
ID=27434968
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/293,603 Active US7253264B1 (en) | 1990-06-28 | 1994-08-22 | Immunoglobulin fusion proteins, their production and use |
US09/286,288 Abandoned US20010053539A1 (en) | 1990-06-28 | 1999-04-06 | Fusion proteins with immunoglobulin portions, the preparation and use thereof |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/293,603 Active US7253264B1 (en) | 1990-06-28 | 1994-08-22 | Immunoglobulin fusion proteins, their production and use |
Country Status (1)
Country | Link |
---|---|
US (2) | US7253264B1 (en) |
Cited By (35)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020147311A1 (en) * | 2000-02-11 | 2002-10-10 | Gillies Stephen D. | Enhancing the circulating half-life of antibody-based fusion proteins |
US20020193570A1 (en) * | 1997-12-08 | 2002-12-19 | Gillies Stephen D. | Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation |
US20030143226A1 (en) * | 2000-03-02 | 2003-07-31 | Yuko Kobayashi | Human monoclonal antibodies against oxidized ldl receptor and medicinal use thereof |
US20050042729A1 (en) * | 1999-05-19 | 2005-02-24 | Emd Lexigen Research Center Corp. | Expression and export of interferon-alpha proteins as Fc fusion proteins |
US20050069521A1 (en) * | 2003-08-28 | 2005-03-31 | Emd Lexigen Research Center Corp. | Enhancing the circulating half-life of interleukin-2 proteins |
US20050112685A1 (en) * | 2003-11-26 | 2005-05-26 | Amiss Terry J. | Compositions and methods for measuring analyte concentrations |
US20060073141A1 (en) * | 2001-06-28 | 2006-04-06 | Domantis Limited | Compositions and methods for treating inflammatory disorders |
US7067110B1 (en) | 1999-07-21 | 2006-06-27 | Emd Lexigen Research Center Corp. | Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens |
US20060141581A1 (en) * | 2004-12-09 | 2006-06-29 | Merck Patent Gmbh | IL-7 variants with reduced immunogenicity |
US20060228332A1 (en) * | 2004-06-28 | 2006-10-12 | Merck Patent Gmbh | Assembly and folding of Fc-interferon-beta fusion proteins |
US7141651B2 (en) | 1999-08-09 | 2006-11-28 | Emd Lexigen Research Center Corp. | Multiple cytokine protein complexes |
US20060269553A1 (en) * | 2003-11-13 | 2006-11-30 | Hanmi Pharm. Ind. Co., Ltd. | Protein complex using an immunoglobulin fragment and method for the preparation thereof |
US7148321B2 (en) | 2001-03-07 | 2006-12-12 | Emd Lexigen Research Center Corp. | Expression technology for proteins containing a hybrid isotype antibody moiety |
WO2007021129A1 (en) | 2005-08-16 | 2007-02-22 | Hanmi Pharmaceutical Co., Ltd. | A method for the mass production of immunoglobulin fc region deleted initial methionine residues |
US7229962B2 (en) | 2001-07-26 | 2007-06-12 | Medexgen Co., Ltd. | Tetravalent etanercept |
US20070134234A1 (en) * | 2005-09-29 | 2007-06-14 | Viral Logic Systems Technology Corp. | Immunomodulatory compositions and uses therefor |
US20070202103A1 (en) * | 2004-01-05 | 2007-08-30 | Emd Lexigen Research Center Corp. | Compounds For Targeting |
US7323549B2 (en) | 2003-12-30 | 2008-01-29 | Emd Lexigen Research Center Corp. | IL-7 fusion proteins |
US20080131431A1 (en) * | 2006-05-15 | 2008-06-05 | Viral Logic Systems Technology Corp. | CD47 related compositions and methods for treating immunological diseases and disorders |
US7465447B2 (en) | 2003-12-31 | 2008-12-16 | Merck Patent Gmbh | Fc-erythropoietin fusion protein with improved pharmacokinetics |
US20090249503A1 (en) * | 2004-12-06 | 2009-10-01 | Bolder Biotechnology, Inc. | Enzyme conjugates for use as detoxifying agents |
US7696320B2 (en) | 2004-08-24 | 2010-04-13 | Domantis Limited | Ligands that have binding specificity for VEGF and/or EGFR and methods of use therefor |
US7754855B1 (en) * | 1999-07-13 | 2010-07-13 | Bolder Biotechnology, Inc. | Immunoglobulin fusion proteins |
US7767405B2 (en) | 2002-12-17 | 2010-08-03 | Merck Patent Gmbh | Immunocytokine sequences and uses thereof |
US20100239579A1 (en) * | 2006-05-15 | 2010-09-23 | Viral Logic Systems Technology Corp. | CD47 Related Compositions and Methods for Treating Immunological Diseases and Disorders |
US7803618B2 (en) | 2001-05-03 | 2010-09-28 | Merck Patent Gmbh | Recombinant tumor specific antibody and use thereof |
EP2275816A2 (en) | 2006-03-22 | 2011-01-19 | Viral Logic Systems Technology Corp. | Methods for identifying polypeptide targets and uses thereof for treating immunological diseases |
US7888071B2 (en) | 2001-12-04 | 2011-02-15 | Merck Patent Gmbh | DNA encoding IL-2 fusion proteins with modulated selectivity |
US7955590B2 (en) | 1999-07-21 | 2011-06-07 | Merck Patent Gmbh | Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens |
US7973150B2 (en) | 2001-03-30 | 2011-07-05 | Merck Patent Gmbh | Reducing the immunogenicity of fusion proteins |
US8110665B2 (en) | 2003-11-13 | 2012-02-07 | Hanmi Holdings Co., Ltd. | Pharmaceutical composition comprising an immunoglobulin FC region as a carrier |
US8877186B2 (en) | 2007-06-06 | 2014-11-04 | Domantis Limited | Polypeptides, antibody variable domains and antagonists |
US8907066B2 (en) | 2009-04-22 | 2014-12-09 | Merck Patent Gmbh | Antibody fusion proteins with a modified FcRn binding site |
EP1648940B1 (en) | 2003-07-28 | 2016-04-27 | Genentech, Inc. | Reducing protein a leaching during protein a affinity chromatography |
US9493531B2 (en) * | 2011-06-01 | 2016-11-15 | Jyant Technologies, Inc. | Chemokine-immunoglobulin fusion polypeptides, compositions, method of making and use thereof |
Families Citing this family (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK0939121T4 (en) | 1989-09-12 | 2008-02-04 | Ahp Mfg B V | TNF-binding proteins |
AU1447600A (en) * | 1998-10-22 | 2000-05-08 | Thomas J. Gardella | Bioactive peptides and peptide derivatives of parathyroid hormone (pth) and parathyroid hormone-related peptide (pthrp) |
US20040220103A1 (en) * | 1999-04-19 | 2004-11-04 | Immunex Corporation | Soluble tumor necrosis factor receptor treatment of medical disorders |
WO2001023521A2 (en) * | 1999-09-29 | 2001-04-05 | The General Hospital Corporation | Polypeptide derivatives of parathyroid hormone (pth) |
AU2002339843B2 (en) * | 2001-07-23 | 2007-12-06 | The General Hospital Corporation | Conformationally constrained parathyroid hormone (PTH) analogs |
AU2003220380A1 (en) * | 2003-03-19 | 2004-11-19 | Bristol-Myers Squibb Company | CONFORMATIONALLY CONSTRAINED PARATHYROID HORMONES WITH Alpha-HELIX STABILIZERS |
EP1653985A4 (en) | 2003-07-17 | 2009-08-05 | Gen Hospital Corp | Conformationally constrained parathyroid hormone (pth) analogs |
DK1740698T3 (en) | 2004-04-22 | 2010-10-25 | Talecris Biotherapeutics Inc | Recombinant modified plasmin |
US7625564B2 (en) | 2006-01-27 | 2009-12-01 | Novagen Holding Corporation | Recombinant human EPO-Fc fusion proteins with prolonged half-life and enhanced erythropoietic activity in vivo |
EP2054077A4 (en) * | 2006-08-04 | 2010-10-13 | Gen Hospital Corp | Polypeptide derivatives of parathyroid hormone (pth) |
US8067548B2 (en) | 2007-07-26 | 2011-11-29 | Novagen Holding Corporation | Fusion proteins having mutated immunoglobulin hinge region |
CA3017668C (en) * | 2007-08-01 | 2021-11-09 | The General Hospital Corporation | Screening methods using g-protein coupled receptors and related compositions |
EP2220221B1 (en) | 2007-11-29 | 2014-12-31 | Grifols Therapeutics Inc. | Recombinantly modified plasmin |
JP2011522538A (en) * | 2008-06-04 | 2011-08-04 | タレクリス・バイオセラピユーテイクス・インコーポレーテツド | Compositions, methods and kits for plasmin production |
PT2403865E (en) | 2009-03-03 | 2015-11-18 | Grifols Therapeutics Inc | Methods for preparing plasminogen |
US9492508B2 (en) | 2010-05-13 | 2016-11-15 | The General Hospital Corporation | Parathyroid hormone analogs and uses thereof |
CN110551223A (en) | 2011-06-28 | 2019-12-10 | 英伊布里克斯有限合伙公司 | Serine protease inhibitor protein fusion polypeptides and methods of use thereof |
US10208125B2 (en) | 2013-07-15 | 2019-02-19 | University of Pittsburgh—of the Commonwealth System of Higher Education | Anti-mucin 1 binding agents and uses thereof |
WO2018195388A1 (en) | 2017-04-21 | 2018-10-25 | Kindred Biosciences, Inc. | Il4/il13 receptor molecule for veterinary use |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
EP0269455A3 (en) | 1986-11-28 | 1989-09-06 | Takeda Chemical Industries, Ltd. | Highly purified fused protein comprising human ige fc fragment and production thereof |
US5512544A (en) | 1987-09-13 | 1996-04-30 | Yeda Research And Development Co. Ltd. | Pharmaceutical compositions comprising an anticytokine |
PT89484B (en) | 1988-01-22 | 1994-03-31 | Gen Hospital Corp | GENE CLONED CODES OF FUSAO PROTEINS IG-CD4 AND ITS UTILIZATION |
WO1990005183A1 (en) | 1988-10-31 | 1990-05-17 | Immunex Corporation | Interleukin-4 receptors |
US5225538A (en) | 1989-02-23 | 1993-07-06 | Genentech, Inc. | Lymphocyte homing receptor/immunoglobulin fusion proteins |
CA2033082A1 (en) | 1989-06-15 | 1990-12-16 | Linda S. Park | Interleukin-7 receptors |
CA2065010A1 (en) | 1989-08-23 | 1991-02-24 | Brian Seed | Non-human primate cd4 polypeptides, fusions thereof, dna encoding, and uses thereof |
US5395760A (en) | 1989-09-05 | 1995-03-07 | Immunex Corporation | DNA encoding tumor necrosis factor-α and -β receptors |
US5605690A (en) | 1989-09-05 | 1997-02-25 | Immunex Corporation | Methods of lowering active TNF-α levels in mammals using tumor necrosis factor receptor |
NZ235148A (en) | 1989-09-05 | 1991-12-23 | Immunex Corp | Tumour necrosis factor receptor protein and dna sequences |
DK0939121T4 (en) | 1989-09-12 | 2008-02-04 | Ahp Mfg B V | TNF-binding proteins |
-
1994
- 1994-08-22 US US08/293,603 patent/US7253264B1/en active Active
-
1999
- 1999-04-06 US US09/286,288 patent/US20010053539A1/en not_active Abandoned
Cited By (74)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020193570A1 (en) * | 1997-12-08 | 2002-12-19 | Gillies Stephen D. | Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation |
US7879319B2 (en) | 1997-12-08 | 2011-02-01 | Merk Patent Gmbh | Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation |
US6838260B2 (en) | 1997-12-08 | 2005-01-04 | Emd Lexigen Research Center Corp. | Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation |
US20050042729A1 (en) * | 1999-05-19 | 2005-02-24 | Emd Lexigen Research Center Corp. | Expression and export of interferon-alpha proteins as Fc fusion proteins |
US20100285014A1 (en) * | 1999-07-13 | 2010-11-11 | Bolder Biotechnology, Inc. | Immunoglobulin fusion proteins |
US7754855B1 (en) * | 1999-07-13 | 2010-07-13 | Bolder Biotechnology, Inc. | Immunoglobulin fusion proteins |
US8043608B2 (en) | 1999-07-21 | 2011-10-25 | Merck Patent Gmbh | Methods of using Fc-cytokine fusion proteins |
US7067110B1 (en) | 1999-07-21 | 2006-06-27 | Emd Lexigen Research Center Corp. | Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens |
US7955590B2 (en) | 1999-07-21 | 2011-06-07 | Merck Patent Gmbh | Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens |
US7141651B2 (en) | 1999-08-09 | 2006-11-28 | Emd Lexigen Research Center Corp. | Multiple cytokine protein complexes |
US7582288B2 (en) | 1999-08-09 | 2009-09-01 | Merck Patent Gmbh | Methods of targeting multiple cytokines |
US20020147311A1 (en) * | 2000-02-11 | 2002-10-10 | Gillies Stephen D. | Enhancing the circulating half-life of antibody-based fusion proteins |
US7790415B2 (en) | 2000-02-11 | 2010-09-07 | Merck Patent Gmbh | Enhancing the circulating half-life of antibody-based fusion proteins |
US7993643B2 (en) | 2000-03-02 | 2011-08-09 | Amgen Fremont, Inc. | Uses of human monoclonal antibodies against oxidized LDL receptor |
US20030143226A1 (en) * | 2000-03-02 | 2003-07-31 | Yuko Kobayashi | Human monoclonal antibodies against oxidized ldl receptor and medicinal use thereof |
US20080241134A1 (en) * | 2000-03-02 | 2008-10-02 | Abgenix, Inc. | Uses of human monoclonal antibodies against oxidized ldl receptor |
US8066994B2 (en) | 2001-03-07 | 2011-11-29 | Merck Patent Gmbh | Proteins comprising an IgG2 domain |
US7148321B2 (en) | 2001-03-07 | 2006-12-12 | Emd Lexigen Research Center Corp. | Expression technology for proteins containing a hybrid isotype antibody moiety |
US8926973B2 (en) | 2001-03-30 | 2015-01-06 | Merck Patent Gmbh | Reducing the immunogenicity of fusion proteins |
US7973150B2 (en) | 2001-03-30 | 2011-07-05 | Merck Patent Gmbh | Reducing the immunogenicity of fusion proteins |
US7803618B2 (en) | 2001-05-03 | 2010-09-28 | Merck Patent Gmbh | Recombinant tumor specific antibody and use thereof |
US20060073141A1 (en) * | 2001-06-28 | 2006-04-06 | Domantis Limited | Compositions and methods for treating inflammatory disorders |
US20100278827A1 (en) * | 2001-07-26 | 2010-11-04 | Medexgen Co., Ltd. | Concatameric immunoadhesion molecule |
US7670602B2 (en) | 2001-07-26 | 2010-03-02 | Medexgen Co., Ltd | Concatameric immunoadhesion molecule |
US8372961B2 (en) | 2001-07-26 | 2013-02-12 | Medexgen Co., Ltd. | Polynucleotides encoding concatameric immunoadhesion molecules |
US7229962B2 (en) | 2001-07-26 | 2007-06-12 | Medexgen Co., Ltd. | Tetravalent etanercept |
US7888071B2 (en) | 2001-12-04 | 2011-02-15 | Merck Patent Gmbh | DNA encoding IL-2 fusion proteins with modulated selectivity |
US8470991B2 (en) | 2002-12-17 | 2013-06-25 | Merck Patent Gmbh | Immunocytokine sequences and uses thereof |
US7767405B2 (en) | 2002-12-17 | 2010-08-03 | Merck Patent Gmbh | Immunocytokine sequences and uses thereof |
EP1648940B1 (en) | 2003-07-28 | 2016-04-27 | Genentech, Inc. | Reducing protein a leaching during protein a affinity chromatography |
US20050069521A1 (en) * | 2003-08-28 | 2005-03-31 | Emd Lexigen Research Center Corp. | Enhancing the circulating half-life of interleukin-2 proteins |
US9750820B2 (en) | 2003-11-13 | 2017-09-05 | Hanmi Science Co., Ltd. | IgG Fc fragment for a drug carrier and method for the preparation thereof |
US20100255014A1 (en) * | 2003-11-13 | 2010-10-07 | Hanmi Pharm, Co., Ltd. | Protein Complex Using An Immunoglobulin Fragment and Method For The Preparation Thereof |
US11058776B2 (en) | 2003-11-13 | 2021-07-13 | Hanmi Science Co., Ltd. | IgG Fc fragment for a drug carrier and method for the preparation thereof |
US7737260B2 (en) | 2003-11-13 | 2010-06-15 | Hanmi Pharm. Co., Ltd | Protein complex using an immunoglobulin fragment and method for the preparation thereof |
US20060275254A1 (en) * | 2003-11-13 | 2006-12-07 | Hanmi Pharm. Ind. Co., Ltd. | Pharmaceutical composition comprising an immunoglobulin fc region as a carrier |
US20070041967A1 (en) * | 2003-11-13 | 2007-02-22 | Jung Sung Y | Igg fc fragment for a drug carrier and method for the preparation thereof |
US20060276633A1 (en) * | 2003-11-13 | 2006-12-07 | Jung Sung Y | Method for the mass production of immunoglobulin constant region |
US8822650B2 (en) | 2003-11-13 | 2014-09-02 | Hanmi Science Co., Ltd | Method for the mass production of immunoglobulin constant region |
US10071166B2 (en) | 2003-11-13 | 2018-09-11 | Hanmi Science Co., Ltd. | Protein complex using an immunoglobulin fragment and method for the preparation thereof |
US8110665B2 (en) | 2003-11-13 | 2012-02-07 | Hanmi Holdings Co., Ltd. | Pharmaceutical composition comprising an immunoglobulin FC region as a carrier |
US10272159B2 (en) | 2003-11-13 | 2019-04-30 | Hanmi Science Co., Ltd. | IgG Fc fragment for a drug carrier and method for the preparation thereof |
US20060269553A1 (en) * | 2003-11-13 | 2006-11-30 | Hanmi Pharm. Ind. Co., Ltd. | Protein complex using an immunoglobulin fragment and method for the preparation thereof |
US8846874B2 (en) | 2003-11-13 | 2014-09-30 | Hanmi Science Co., Ltd | IgG Fc fragment for a drug carrier and method for the preparation thereof |
US8029789B2 (en) | 2003-11-13 | 2011-10-04 | Hanmi Holdings Co., Ltd. | Method for the mass production of immunoglobulin constant region |
US7736653B2 (en) | 2003-11-13 | 2010-06-15 | Hanmi Pharm. Co., Ltd | Pharmaceutical composition comprising an immunoglobulin Fc region as a carrier |
US20050112685A1 (en) * | 2003-11-26 | 2005-05-26 | Amiss Terry J. | Compositions and methods for measuring analyte concentrations |
US20080032312A1 (en) * | 2003-11-26 | 2008-02-07 | Amiss Terry J | Compositions and methods for measuring analyte concentrations |
US8338575B2 (en) | 2003-12-30 | 2012-12-25 | Merck Patent Gmbh | IL-7 fusion proteins |
US7960514B2 (en) | 2003-12-30 | 2011-06-14 | Merck Patent Gmbh | IL-7 fusion proteins |
US7323549B2 (en) | 2003-12-30 | 2008-01-29 | Emd Lexigen Research Center Corp. | IL-7 fusion proteins |
US7465447B2 (en) | 2003-12-31 | 2008-12-16 | Merck Patent Gmbh | Fc-erythropoietin fusion protein with improved pharmacokinetics |
US8420087B2 (en) | 2004-01-05 | 2013-04-16 | Antisoma Research Limited | Interleukin-12 targeted to oncofoetal fibronectin |
US20070202103A1 (en) * | 2004-01-05 | 2007-08-30 | Emd Lexigen Research Center Corp. | Compounds For Targeting |
US7670595B2 (en) | 2004-06-28 | 2010-03-02 | Merck Patent Gmbh | Fc-interferon-beta fusion proteins |
US20060228332A1 (en) * | 2004-06-28 | 2006-10-12 | Merck Patent Gmbh | Assembly and folding of Fc-interferon-beta fusion proteins |
US8557232B2 (en) | 2004-06-28 | 2013-10-15 | Merck Patent Gmbh | Stabilization of Fc-interferon-beta fusion proteins |
US7696320B2 (en) | 2004-08-24 | 2010-04-13 | Domantis Limited | Ligands that have binding specificity for VEGF and/or EGFR and methods of use therefor |
US20090249503A1 (en) * | 2004-12-06 | 2009-10-01 | Bolder Biotechnology, Inc. | Enzyme conjugates for use as detoxifying agents |
US7589179B2 (en) | 2004-12-09 | 2009-09-15 | Merck Patent Gmbh | IL-7 variants with reduced immunogenicity |
US20060141581A1 (en) * | 2004-12-09 | 2006-06-29 | Merck Patent Gmbh | IL-7 variants with reduced immunogenicity |
US7968316B2 (en) | 2005-08-16 | 2011-06-28 | Hanmi Holdings Co., Ltd. | Method for the mass production of immunoglobulin Fc region deleted initial methionine residues |
WO2007021129A1 (en) | 2005-08-16 | 2007-02-22 | Hanmi Pharmaceutical Co., Ltd. | A method for the mass production of immunoglobulin fc region deleted initial methionine residues |
US20080293106A1 (en) * | 2005-08-16 | 2008-11-27 | Jung Sung Youb | Method For the Mass Production of Immunoglobulin Fc Region Deleted Initial Methionine Residues |
US20070134234A1 (en) * | 2005-09-29 | 2007-06-14 | Viral Logic Systems Technology Corp. | Immunomodulatory compositions and uses therefor |
EP2322931A2 (en) | 2006-03-22 | 2011-05-18 | Viral Logic Systems Technology Corp. | Methods for identifying polypeptide targets and uses thereof for treating immunological diseases |
EP2275816A2 (en) | 2006-03-22 | 2011-01-19 | Viral Logic Systems Technology Corp. | Methods for identifying polypeptide targets and uses thereof for treating immunological diseases |
US20100239579A1 (en) * | 2006-05-15 | 2010-09-23 | Viral Logic Systems Technology Corp. | CD47 Related Compositions and Methods for Treating Immunological Diseases and Disorders |
US20080131431A1 (en) * | 2006-05-15 | 2008-06-05 | Viral Logic Systems Technology Corp. | CD47 related compositions and methods for treating immunological diseases and disorders |
US8377448B2 (en) | 2006-05-15 | 2013-02-19 | The Board Of Trustees Of The Leland Standford Junior University | CD47 related compositions and methods for treating immunological diseases and disorders |
US8877186B2 (en) | 2007-06-06 | 2014-11-04 | Domantis Limited | Polypeptides, antibody variable domains and antagonists |
US8907066B2 (en) | 2009-04-22 | 2014-12-09 | Merck Patent Gmbh | Antibody fusion proteins with a modified FcRn binding site |
US9493531B2 (en) * | 2011-06-01 | 2016-11-15 | Jyant Technologies, Inc. | Chemokine-immunoglobulin fusion polypeptides, compositions, method of making and use thereof |
US9783588B2 (en) | 2011-06-01 | 2017-10-10 | Jyant Technologies, Inc. | Chemokine-immunoglobulin fusion polypeptides, compositions, method of making and use thereof |
Also Published As
Publication number | Publication date |
---|---|
US7253264B1 (en) | 2007-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7253264B1 (en) | Immunoglobulin fusion proteins, their production and use | |
CA2045869C (en) | Fusion proteins with immunoglobulin portions, the preparation and use thereof | |
US7361738B2 (en) | Megakaryocyte stimulating factors | |
JPS63503357A (en) | Novel coagulation active protein | |
EP0506757B2 (en) | A recombinant human factor viii derivative | |
US5422260A (en) | Human factor VIII:c muteins | |
KR0184235B1 (en) | A megakaryocytopoietic factor | |
EP0533862B1 (en) | Recombinant human factor viii derivatives | |
TW200415241A (en) | Fc fusion proteins of human erythropoietin with high biological activities | |
US20030064480A1 (en) | Fusion proteins with immunoglobulin portions, the preparation and use thereof | |
WO1990008822A1 (en) | Erythropoietin receptor | |
WO1990005530A1 (en) | Hybrid procoagulant proteins | |
JP3339855B2 (en) | Recombinant protein receptor | |
WO1993016709A1 (en) | Therapeutic domains of von willebrand factor | |
AU743833B2 (en) | Recombinant human erythropoietin with advantageous glycosylation profile | |
JP3490444B2 (en) | Thrombin inhibitors from insect saliva. | |
EP0261625B1 (en) | Human b-cell differentiation factor and process of producing said factor | |
IE84574B1 (en) | Fusion proteins with parts of immunoglobulins, their production and use | |
CN114364796A (en) | Chimeric proteins | |
JPH05103675A (en) | Production of human nerve growth factor 2 | |
JPH04210700A (en) | Recombinant human thrombomodulin derivative | |
CA2006475A1 (en) | Method for preparing water soluble polypeptides |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |