US10081801B2 - Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans - Google Patents

Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans Download PDF

Info

Publication number
US10081801B2
US10081801B2 US14/783,967 US201414783967A US10081801B2 US 10081801 B2 US10081801 B2 US 10081801B2 US 201414783967 A US201414783967 A US 201414783967A US 10081801 B2 US10081801 B2 US 10081801B2
Authority
US
United States
Prior art keywords
sialidase
trans
seq
amino acid
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US14/783,967
Other versions
US20160076013A1 (en
Inventor
Jørn Dalgaard Mikkelsen
Carsten Jers
Malwina Michalak
Kasper Planeta Kepp
Dorte Møller Larsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dairy Crest Ltd
Original Assignee
Danmarks Tekniskie Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danmarks Tekniskie Universitet filed Critical Danmarks Tekniskie Universitet
Assigned to DANMARKS TEKNISKE UNIVERSITET reassignment DANMARKS TEKNISKE UNIVERSITET ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LARSEN, Dorte Møller, MICHALAK, Malwina, Mikkelsen, Jørn Dalgaard, KEPP, Kasper Planeta, JERS, Carsten
Publication of US20160076013A1 publication Critical patent/US20160076013A1/en
Application granted granted Critical
Publication of US10081801B2 publication Critical patent/US10081801B2/en
Assigned to KEPP, Kasper Planeta, Mikkelsen, Jørn Dalgaard, MICHALAK, Malwina, LARSEN, Dorte Møller, JERS, Carsten reassignment KEPP, Kasper Planeta ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DANMARKS TEKNISKE UNIVERSITET
Assigned to DANMARKS TEKNISKE UNIVERSITET reassignment DANMARKS TEKNISKE UNIVERSITET ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KEPP, Kasper Planeta, LARSEN, Dorte Møller, Mikkelsen, Jørn Dalgaard, JERS, Carsten, MICHALAK, Malwina
Assigned to DAIRY CREST LTD reassignment DAIRY CREST LTD ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DANMARKS TEKNISKE UNIVERSITET
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7016Disaccharides, e.g. lactose, lactulose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/702Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01018Exo-alpha-sialidase (3.2.1.18), i.e. trans-sialidase
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/414
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/582Recycling of unreacted starting or intermediate materials

Definitions

  • the invention relates to enzymes having trans-sialidase activity (EC 3.2.1.18), that are derived from Trypanosomal sialidases by mutation.
  • the enzymes obtained by mutation find particular use in the production of diverse sialylated galacto-oligosaccharides (GOS) and fructo-oligosaccharides (FOS), these being important additives in infant formula, a prebiotic nutritional supplement, and a food supplement.
  • GOS galacto-oligosaccharides
  • FOS fructo-oligosaccharides
  • Prebiotics are dietary substances that stimulate growth of selected groups of microorganisms in the colon and in addition may have other health benefits.
  • Galactooligosaccharides GOS
  • fructooligosaccharides FOS
  • lactulose lactulose
  • isomaltooligosaccharides IMO
  • oligosaccharides constitute the third largest component, present in amounts as much as 20-25 g/I around parturition, later declining to 5-15 g/L.
  • HMOs human milk oligosaccharides
  • glycan structures More than 100 different such glycan structures have been identified and approximately 10-20% of these are sialylated (Bode, 2012 , Glycobiology 22(9): 1147-1162). Sialylation and/or fucosylation of many of these HMOs appear to convey important functional properties.
  • HMOs can bind human pathogens, such as, Escherichia coli K1, Haemophilus influenzae, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejuni, Vibrio cholerae, Helicobacter pylori and Streptococcus agalactiae and thereby reduce the incidence of diarrhoea and other diseases in infants.
  • pathogens such as, Escherichia coli K1, Haemophilus influenzae, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejuni, Vibrio cholerae, Helicobacter pylori and Streptococcus agalactiae and thereby reduce the incidence of diarrhoea and other diseases in infants.
  • This ability of HMOs to function as soluble decoy receptors for human pathogens is most likely enhanced by their diversity, since mannose-containing glycoproteins,
  • sialylated HMOs may modulate the immune system; for example T cell cytokine production is stimulated by sialylated HMOs in vitro (Eiwegger et al., 2004 , Pediatric Rev. 56:536-540).
  • the active HMO molecules have not been identified, but in the case of necrotising enterocolitis, a frequent and often fatal disease in infants, the protective effect was recently shown to be due to a single molecule, disialyllacto-N-tetraose, using a rat model (Jantscher-Krenn et al., 2012 , Gut 61:1417-1425).
  • Bovine milk which forms the basis for most infant formula, has a very low oligosaccharide content when compared with human milk, with a different sialylation and fucosylation profile.
  • milk formula is currently supplemented with (non-HMO) GOS and FOS.
  • GOS and FOS are unlikely to provide the therapeutic benefits of HMOs, described above (Bode, 2012, supra).
  • TcTS trans-sialidase enzyme
  • Efforts to sialylate GOS and FOS rely on glycan sialylation, which can be achieved chemically as well as enzymatically using different types of enzymes [1].
  • a trans-sialidase enzyme (TcTS) from Trypansoma cruzi the causative agent of Chagas disease, has been used to transfer sialic acid from a donor to an acceptor glycan [2].
  • the T. cruzi trans-sialidase has a major drawback, namely that it constitutes an important virulence factor within T. cruzi [ 3].
  • TrSA native sialidase found in the non-pathogenic Trypansoma rangeli , has been used as a starting point for generating mutant enzymes that possess trans-sialidase activity [4]. Although this sialidase shares 70% sequence identity with that of TcTS, and has the same overall tertiary structure, it is a strict hydrolase having no detectable trans-sialidase activity [4].
  • the sialidase, TrSA, and the trans-sialidase, TcTS share a common double displacement mechanism with a tyrosine as catalytic nucleophile [5] [6].
  • the acceptor binding site consists of Tyr119 and Trp312 forming stacking interactions with the acceptor sugar [7].
  • Trp313 (corresponding to Trp312 in TcTS) is found in a different conformation due to a Gln at position 284, while it has a Ser residue at position 120 corresponding to Tyr119 in TcTS [8].
  • TrSA Long semiconductor-semiconductor-semiconductor
  • Met96Val Met96Val
  • Ala98Pro at the sialic acid binding pocket to confer trans-sialidase activity (1% of TcTS) to TrSA.
  • An additional single mutation Ile37Leu increased the levels of trans-sialidase activity to 10% of a T. cruzi trans-sialidase [4].
  • TrSA mutants display a >25-fold lower affinity for lactose and >100-fold higher turnover (kcat) for the undesired, competing hydrolysis compared to TcTS [4] indicating a considerable need for improvement before such an enzyme would have any practical value for. trans-sialylation.
  • TrSA native sialidase expressed by Trypansoma rangeli has any trans-sialidase activity.
  • Isolation and expression of a TrSA gene from Trypansoma rangeli is reported by Smith et al [31].
  • the isolated TrSA gene encodes an inactive protein, likely due to the substitution of a strictly conserved arginine, that functions by coordinating the carboxyl of sialic acid, by a cysteine residue [31].
  • Smith et al. also submitted a TrSA gene encoding sialidase (Q08672) to GenBank, which is predicted to be an anhydrosialidase [32].
  • this sialidase (Q08672) lacks the mutations S119Y and Q284P that are required to establish the acceptor binding site, and for this reason cannot function as a trans-sialidase.
  • TrSA Trypansoma rangeli gene that is predicted to encode a TrSA, UNIPROT: Q08672 having 70% sequence identity to TcTS, which is a common feature of other TrSAs having only hydrolytic activity.
  • One amino acid substitution in the primary sequence of a TrSA, found essential for obtaining a mutant TrSA having measurable trans-sialiase activity is Gly249-Tyr, which decreases hydrolytic activity [4].
  • a second mutation, Ile-37Leu which in combination with Tyr120, significantly enhances trans-sialidase activity in this mutant [4]. Neither of these mutations is found in TrSA, UNIPROT: Q08672.
  • lactose or HMOs of various lengths can be sialylated in ⁇ 2-3 or ⁇ 2-6 linkage which can be added to a terminal galactose or a subterminal N-acetyl-glucosamine, thereby contributing to the diversity of HMOs present.
  • Efforts to mimic such complex oligosaccharide compositions require a trans-sialidase that can transfer sialic acid to a variety of different acceptor groups.
  • TcTS can sialylate the terminal galactose of a glycan
  • trans-sialidase that can use other acceptor groups, which is essential if the diversity of HMOs is to be obtained synthetically.
  • the invention provides a mutant polypeptide having at least 80% amino acid sequence identity to amino acids residues 28-372 of SEQ ID NO: 2, and wherein residues 197 to 203 of SEQ ID NO. 2 comprise one or more of substituted amino acid residues resulting in a net positive charge of at least +3 for residues 197 to 203 of SEQ ID NO. 2, and wherein amino acid residues 37, 96, 98, 120, 249, 284 in the sequence of the mutant polypeptide have 100% sequence identity to the corresponding amino acid residues in SEQ ID NO. 2, wherein the polypeptide has trans-sialidase activity (EC 3.2.1.18).
  • a net positive charge of at least +2, preferably +3, for residues 197 to 203 of SEQ ID NO. 2 in the polypeptide of the invention confers a reduced hydrolase activity when compared to the polypeptide having the sequence of amino acids residues 28-372 of SEQ ID NO: 2.
  • the mutant polypeptide may be obtainable by mutation of SEQ ID NO: 2, and the amino acid sequence of the polypeptide may have sequence identity with SEQ ID NO: 2 with the exception that residues 197 to 203 of SEQ ID NO. 2 comprise one or more of substituted amino acid residues resulting in a net positive charge of at least +2, preferably +3, for residues 197 to 203.
  • the mutant polypeptide additionally comprises a C-terminal linker and carbohydrate-binding domain selected from among: a) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma rangeli trans-sialidase comprising amino acid residues 373 to 638 of SEQ ID NO: 2; b) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma cruzi trans-sialidase (SEQ ID NO. 8); c) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma congolense trans-sialidase (SEQ ID NO. 9); d) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma brucei trans-sialidase (SEQ ID NO. 10).
  • the mutant polypeptide may be expressed as a fusion protein comprising a homologous or heterologous amino-terminal signal peptide and/or a heterologous amino-terminal or carboxy-terminal peptide having selective substrate binding affinity for purification of the polypeptide.
  • the invention provides a DNA molecule comprising a positive DNA strand having a nucleic acid sequence encoding the mutant polypeptide according to the first or second embodiment.
  • the DNA molecule may have a nucleotide sequence encoding the mutant polypeptide having an amino acid sequence selected from among: a) amino acid residues 48-372 of SEQ ID NO. 4; b) amino acid residues 21-372 of SEQ ID NO. 4; c) amino acid residues 48-638 of SEQ ID NO. 4; and d) amino acid residues 21-638 of SEQ ID NO. 4.
  • the invention provides a recombinant host cell comprising the DNA molecule encoding the mutant polypeptide, wherein said cell is prokaryotic or eukaryotic and selected from among a bacterial cell, a yeast cell and a fungal cell.
  • the DNA molecule may either be integrated into the genome of the host cell or it may be integrated into a self-replicating plasmid in the host cell.
  • the invention provides a method for producing the mutant polypeptide of the invention comprising the steps of:
  • the invention provides an enzyme composition comprising the mutant polypeptide of the invention, wherein the composition is formulated as a dry powder, a tablet, or as a liquid.
  • the invention provides a method for producing sialylated mono- and/or oligo-saccharides, comprising the steps of:
  • the invention provides a composition comprising sialylated mono- and oligo-saccharides produced by the method of the invention, wherein the composition is selected from an infant formula, a prebiotic nutritional supplement, and a food supplement.
  • FIG. 1 A. Domain structure of a sialidase enzymes (EC 3.2.1.18), as exemplified by Trypanosoma cruzi trans-sialidase (TcTS). The catalytic domain is located on the left (light gray), the carbohydrate-binding domain to the right (dark grey), the two domains are linked together by a peptide linker (black). A ligand (sialyllactose) bound in the active site is shown in black sticks. B.
  • TcTS Trypanosoma cruzi trans-sialidase
  • FIG. 1 Cartoon of mutant trans-sialidase of the invention, showing domain structure (catalytic domain peptide; linker peptide; lectin peptide (carbohydrate-binding domain)) and one example of the mutated motif (amino acids 197-203), and amino acid residue positions with respect to SEQ ID NO: 2.
  • FIG. 2 Sequence alignment of sialidase catalytic domain from Tr6 (TrSA Smut [PDB: 1WCS] with a 6th point mutation, I37L; amino acid residues 26-372 of SEQ ID NO. 2) and related trans-sialidases. Tr6 and trans-sialidases from T. cruzi (SEQ ID NO. 5), Trypanosoma congolense (SEQ ID NO. 6) and Trypanosoma brucei (SEQ ID NO. 7) were aligned using ClustalW. Amino acids within 14 ⁇ of sialic acid binding site are shown in bold. The seven amino acid motif is indicated with filled circles, reverting mutations are indicated with a triangle while other mutated sites are indicated with asterisks.
  • FIG. 3 Homology model of Tr13 (mutant trans-sialidase of the invention). Close-up of the active site with a sialyllactose docked (dark gray). Acceptor binding site residues Tyr-120 and Trp-313 and catalytic nucleophile Tyr-343 side chains are shown in gray. The seven introduced amino acids are shown in light gray.
  • FIG. 4 Trans-sialidase activity of Tr6 and derived mutants using cGMP as sialic acid donor and methylumbelliferyl-pyrogalactoside as acceptor. Product formation is shown in arbitrary units.
  • FIG. 5 Enzyme activity of Tr6 and selected mutants Tr13 and Tr6 D363E.
  • FIG. 6 Time course of trans-sialylation catalysed by Tr13. Accumulation of 3′-sialyllactose over time at 25° C., pH 3, 351 mM lactose and 8 mM cGMP-bound sialic acid.
  • FIG. 7 Anion exchange separation profiles for sialylated glycans catalyzed by Tr13. Sialylated glycans separated from sialic acid and unused acceptor separated on Sepharose Q and detected at 210 nm.
  • a common structural feature of sialidase enzymes is their six bladed ⁇ -propeller catalytic domain with an active site comprising a catalytic arginine triad that coordinates sialic acid via the carboxylate group, an Asp residue as acid/base catalyst, and a Tyr/Glu nucleophile pair ( FIG. 1 ).
  • the catalytic domain can additionally be functionally linked to a non-essential carbohydrate-binding module (CBM) that may serve to recognize sialic acid and/or assist the enzyme target its substrate on cell surfaces.
  • CBM non-essential carbohydrate-binding module
  • Micromonospora viridifaciens secretes two forms of sialidase from the same gene, a short form, with just the catalytic domain, and a longer form with a galactose-binding module, dependent on the food source [29].
  • the present invention provides a mutant enzyme (EC 3.2.1.18) having an enhanced trans-sialidase: sialidase activity ratio relative to its immediate parent enzyme, the mutant being ultimately derived from a sialidase from Trypanosoma rangeli (GenBank Acc. No: U83180.1).
  • the mutant enzyme is a polypeptide comprising at least a catalytic domain having trans-sialidase activity.
  • the amino acid sequence of the catalytic domain has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to amino acids residues 28-372 of SEQ ID NO.
  • amino acid residues 197 to 203 amino acid motif of SEQ ID NO. 2
  • amino acid motif amino acid motif that has a net positive charge of at least +2, preferably +3.
  • Expression of the mutant enzyme yields a mature enzyme comprising a catalytic domain alone, having trans-sialidase activity ( FIG. 1 ).
  • the location of the catalytic domain in SEQ ID NO: 2 was confirmed using NCBI conserveed Domain Search.
  • a suitable positively charged amino acid is a K or R.
  • a suitable neutral amino acid to substitute for residue 199 (D) may be selected from among polar neutral amino acids including asparagine, glutamine, glycine, serine, threonine, cysteine, and tyrosine, or a nonpolar (hydrophobic) amino acids such as include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • polar neutral amino acids including asparagine, glutamine, glycine, serine, threonine, cysteine, and tyrosine
  • a nonpolar (hydrophobic) amino acids such as include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • the mutant motif may have any amino acid sequence selected from among: IAXMGGR; IXZMGGR; IAZXGGR; IAZMXGR; IAZMGXR, where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +2.
  • the mutant motif may have any amino acid sequence selected from among: IXDXGGR; IXDMXGR; IXDMGXR; IADXXGR; IADMXXR, where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +2.
  • mutant motif may have any amino acid sequence selected from among: IXZXGGR; IAZXXGR; IAZMXXR; IAXMGXR; IAXMXGR; IAXXGGR; and IAZXXXZ where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +3.
  • the mutant motif may have any amino acid sequence selected from among: VTNKKKQ (SEQ ID NO.: 58), ARNKANR (SEQ ID NO.: 59), IANKKKQ (SEQ ID NO.: 60), and IANRRRQ (SEQ ID NO.: 61).
  • the mutant enzyme is a polypeptide comprising a catalytic domain corresponding to amino acids residues 28-372 of SEQ ID NO: 4, wherein the motif consisting of amino acid residues 197 to 203 has a positive charge of +3.
  • the mutant enzyme of the present invention differs from the sialidase of Trypanosoma rangeli (GenBank Acc. No: U83180.1) by an additional 6 point mutations located within the catalytic domain. These 6 point mutations in T. rangeli sialidase were previously disclosed by Paris et al., 2005 [4].
  • TrSA Smut Protein Data Bank file: 1WCS
  • I37L I37L as the 6 th point mutation (corresponding to SEQ ID NO: 2).
  • the mutant enzyme is a polypeptide comprising a catalytic domain according to the first embodiment (corresponding to amino acids residues 28-372 of SEQ ID NO: 2, wherein one or more amino acid residues within a motif consisting of amino acid from residue 197 to 203 of SEQ ID NO. 2 is mutated, wherein the mutant motif has a net positive charge of at least +2, preferably +3, as well as a C-terminal carbohydrate-binding domain where the two domains are linked by a linker peptide.
  • the carbohydrate-binding domain and linker peptide (comprising a non-catalytic region) has an amino acid sequence having at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity to amino acid residues 373-638 of SEQ ID NO: 2.
  • the C-terminal carbohydrate-binding domain folds separately from the catalytic domain, in a ⁇ -sandwich fold, leaving the two domains to interact through a hydrophobic interface.
  • the mutant enzyme wherein the C-terminal domain is derived from a Trypanosomal trans-sialidase or sialidase enzyme.
  • the C-terminal domain may be selected from among: C-terminal amino acid residues 373 to 638 of SEQ ID NO: 2 derived from Tr6 mutant T. rangeli sialidase; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO. 8, derived from amino acid residues 373 to 642 of T. cruzi trans-sialidase [Uniprot ID Q26966]; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO.
  • the mutant enzyme according to the first or second embodiment is a polypeptide comprising an N-terminal peptide region fused to the catalytic domain corresponding to amino acids residues 1-372 of SEQ ID NO: 2.
  • the mutant enzyme is a polypeptide comprising amino acids residues 28-638 of SEQ ID NO: 4 or amino acids residues 1-638 of SEQ ID NO: 4.
  • the T. rangeli sialidase mutant enzymes previously described by Paris et al., 2005 [4], had the major deficiency that they retained the hydrolytic catalytic properties of the parent T. rangeli sialidase from which they were derived.
  • the mutant enzyme of the present invention according to the first or second embodiment, comprise a mutant motif (as defined in I.i and I.ii) having a net positive charge of at least +2. Mutations creating this mutant motif greatly reduce the hydrolase activity of the parent sialidase enzyme (see Example 3.3; FIG. 5A ).
  • the catalytic effect of the mutant motif was surprising since the motif is relatively far removed from the acceptor binding site ( ⁇ 14 ⁇ ), and is therefore unlikely to affect acceptor binding directly.
  • the net positively charged motif which is located at the border of the binding cleft, may change the electrostatic field in the cleft, creating an increased hydrogen bond donor capacity that could potentially disrupt or even reverse the water network in the active site.
  • Hydrolysis requires a water network aligned with oxygen lone pairs towards the sialic acid.
  • introduction of a strong positive charge (e.g. at least +2) and hydrogen-donor tendency at the edge of the binding cleft may turn the oxygen lone pairs towards the field of the lysines and correspondingly impair the nucleophilicity of the water network in the cleft.
  • a disruption of the water network could provide the theoretical explanation for the tiny quenching of hydrolysis, not achieved by other sialidase mutants.
  • the mutant trans-sialidase has a high trans-sialylation product yield when assayed under optimal conditions due to its very low hydrolase activity (see Example 4).
  • the mutant trans-sialidase of the invention has unexpectedly broad acceptor-substrate specificity, in contrast to native TcTS, which is only known to act on acceptor substrates comprising a terminal galactose [24].
  • the mutant trans-sialidase is both able to trans-sialylate terminal galactose as well as terminal glucose and even monomers of glucose and fucose.
  • the mutant enzyme was also able to trans-sialylate GOS and IMO and lactulose preparations in reasonable yields (Example 5; Table 2).
  • the sialylated GOS and IMO products obtained using the mutant trans-sialidase are complex, indicating that oligosaccharides of different chain length in the GOS and IMO mixtures are sialylated.
  • the mutant trans-sialidase is particularly suitable for enzymatic sialylation of a broad range of glycans in the manufacture of functional food ingredients and prebiotics.
  • GOS and IMO and lactulose are well-documented prebiotic compounds used as a nutritional supplement.
  • the mutant trans-sialidase is able to use casein glycomacropeptide (cGMP), which is a side-stream from dairy industry, as sialic acid donor (Example 5, FIG. 5 ).
  • cGMP casein glycomacropeptide
  • the mutant enzyme of the invention is characterized by both a high trans-sialidase:sialidase activity ratio and a remarkably broad acceptor-substrate specificity, while having the additional advantages of neither being derived from a non-pathogenic host, nor being a virulence factor.
  • the invention further provides DNA molecules comprising a positive DNA strand having a nucleic acid sequence encoding the mutant trans-sialidase according to the first and second embodiment.
  • the mutant trans-sialidase may be expressed as an N-terminal translational fusion protein, having an N-terminal homologous or heterologous amino-terminal peptide comprising a signal peptide sequence and optionally followed by a protease cleavage site.
  • a suitable N-terminal fusion protein may include ⁇ -factor signal sequence and Kex2 and/or Ste3 protease recognition sequences.
  • the mutant trans-sialidase may be expressed as a translational fusion protein comprising a heterologous peptide having selective substrate binding affinity suitable for purification of the polypeptide, as for example c-myc and 6xHis-tag, as present in SEQ ID NO: 12.
  • the heterologous peptide may be located either N-terminal or carboxy-terminal to the mutant trans-sialidase in the fusion protein, either in addition to/or independently of an N-terminal signal peptide.
  • the invention provides a DNA molecule encoding the mutant trans-sialidase selected from among: a nucleotide sequence encoding a catalytic domain comprising amino acids residues 28-372 of SEQ ID NO: 4; a nucleotide sequence encoding an N-terminal peptide region fused to the catalytic domain comprising amino acids residues 1-372 of SEQ ID NO: 4; a nucleotide sequence encoding the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 28-638 of SEQ ID NO: 4; and a nucleotide sequence encoding an N-terminal peptide region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1-638 of SEQ ID NO: 4.
  • the DNA molecule encoding the mutant trans-sialidase may be selected from among: nucleotide sequence 84-1116 of SEQ ID NO: 3 encoding the catalytic domain comprising amino acids residues 28-372 of SEQ ID NO: 4; nucleotide sequence 1-1116 of SEQ ID NO: 3 encoding an N-terminal peptide region fused to the catalytic domain comprising amino acids residues 1-372 of SEQ ID NO: 4; nucleotide sequence 84-1914 of SEQ ID NO: 3 encoding the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 28-638 of SEQ ID NO: 4; nucleotide sequence 1-1914 of SEQ ID NO: 3 encoding an N-terminal peptide region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1-638 of SEQ ID NO: 4.
  • the DNA molecules encoding the mutant trans-sialidase to be expressed are cloned into a suitable self-replicating or genome-integrating vector (plasmid) or are PCR amplified for the purpose of introducing the DNA molecules into a suitable expression host cell.
  • plasmid self-replicating or genome-integrating vector
  • the DNA molecule will be cloned behind a DNA promoter, whereby the nucleotide sequence of the promoter is operably linked to the nucleic acid sequence encoding the mutant trans-sialidase.
  • Suitable promoter elements for expression in yeast or other fungi include the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, alcohol oxidase promoter (AOX), PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, while promoters for prokaryotic expression vectors include the p-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731).
  • Suitable expression hosts include bacterial (e.g. Escherichia coli; Bacillus subtilis; Bacillus licheniformis ); yeast (e.g. Saccharomyces cerevisiae; Pichia pastoris, Hansenula polymorpha ) or fungal ( Aspergillus niger, A. oryzae, Trichoderma viridae ) hosts.
  • DNA molecules, encoding the mutant trans-sialidase to be expressed may be introduced into a host cell by transformation employing standard protocols known in the art, for example by electroporation.
  • the mutant trans-sialidase is fused with a signal peptide, facilitating secretion of the expressed protein and its subsequence purification from the host cultivation medium.
  • the invention provides a method for producing the mutant trans-sialidase comprising the steps of providing a recombinant host cell, wherein the cell comprises a DNA molecule encoding the mutant trans-sialidase according to the first or second embodiment, and incubating the host cell in a medium in which the cell is capable of expressing the mutant trans-sialidase, for example a growth medium, and then recovering the mutant trans-sialidase expressed by the host cell from the host cell cultivation and/or incubation medium.
  • the invention provides a method for assaying the mutant trans-sialidase of the invention, that may for example be obtained by recombinant expression.
  • Example 2.1 describes a fluorescence-based assay employing cGMP-bound sialic acid (for example 1 mM) as donor substrate and methylumbelliferyl- ⁇ -D-galactopyranoside (MU-Gal) as the acceptor (for example 0.5 mM), where the reaction is performed in a 50 mM phosphate-citrate (pH 6) at 30° C.
  • the trans-sialylation:sialidase activity ratio of an enzyme of the invention can be determined by measuring and determining the ratio of the initial reaction rate of the enzyme for the trans-sialidase reaction with respect to the sialidase reaction as described in Example 2.1 and 2.2.
  • the invention further provides a method for producing a product comprising sialylated mono- or oligo-saccharides (glycan), comprising the steps of: providing a sialic acid donor molecule and a molecule comprising an acceptor (e.g. glycan) capable of trans-sialylation; providing a mutant trans-sialidase according to the first or second embodiment; contacting the mutant trans-sialidase with both of the donor and acceptor molecules in an aqueous solution.
  • glycan sialylated mono- or oligo-saccharides
  • a suitable sialic acid donor molecule includes cGMP-bound sialic acid.
  • cGMP is a side-stream (e.g. cheese-processing waste stream) from the dairy industry.
  • Other sources include fetuin, colominic acid and free sialic acid.
  • Whey containing sialic acids is a byproduct obtained when cheese or rennet casein is produced from milks such as cow milk, goat milk, and sheep milk. For example acid whey, is generated by separating the solids when skim milk is coagulated to form cottage cheese.
  • a cheese processing waste stream is the portion of cheese manufacturing not retained for cheese after formation of curd. The cheese processing waste stream typically refers to the fluid drained from curd, which is frequently discarded.
  • a cheese processing waste stream can be whole whey, demineralized whey permeate, the regeneration stream from demineralized whey permeate, whey permeate, whey powder.
  • a suitable acceptor glycan capable of trans-sialylation includes galacto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomalto-oligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, lactose, lactosucrose, Lacto-N-tetraose (LNT), Lacto-N-neotetraose (LnNT), Lacto-N-fucopentaose I (LNFP I), and Lacto-N-fucopentaose V (LNFP V) and fucose.
  • GOS galacto-oligosaccharides
  • FOS fructo-oligosaccharides
  • MOS malto-oligosaccharides
  • IMO isomalto-oligosaccarides
  • lactulose melibio
  • Optimal substrate concentrations for use in producing sialylated products using the expressed trans-sialidase of the invention may be determined for each selected acceptor substrate.
  • the sialyloligosaccharides produced according to the methods of the invention may be recovered using methods known in the art, including, but not limited to, ultrafiltration, diafiltration, electrodialysis, ion-exchange chromatography and phase partition chemistry.
  • the invention further provides a two-step method for producing sialylated GOS comprising the steps of: providing a source of lactose, contacting the lactose with a ⁇ -galactosyltransferase capable of transferring a galactose residue from lactose to an acceptor molecule capable of extension by transgalactosylation (e.g. lactose or a GOS); followed by the step of combining the product of trans-galactosylation with a sialic acid donor molecule (as described herein) to provide a mixture; and then contacting the mixture with a mutant trans-sialidase according to the first or second embodiment to produce a sialylated GOS product.
  • a source of lactose contacting the lactose with a ⁇ -galactosyltransferase capable of transferring a galactose residue from lactose to an acceptor molecule capable of extension by transgalactosylation
  • GOSs transgalactosylation
  • the suitable 3-galactosyltransferase is a type of glycosyltransferase (EC.2.4.1) which catalyzes the transfer of galactose, such enzymes being well-known in the art [30].
  • the invention further provides a sialylated mono- and/or oligosaccharide product or a composition comprising the product, obtained by treating a mono- and/or oligosaccharide substrate with the trans-sialidase of the invention.
  • compositions comprising the sialylated mono- and/or oligosaccharide products may include infant formula, a prebiotic nutritional supplement or a food supplement.
  • infant formula means a foodstuff comprising the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, which is suitable for nutritional use by infants during the first 4-6 months or even 4 to 12 months of life and satisfying by itself the nutritional requirements of infants.
  • a prebiotic food supplement uses the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, to enhance the beneficial effects and efficiency of probiotics, such as Lactobacillus and Bifidobacterium species, for example by promoting the development of an early bifidogenic intestinal microbiota in infants, in reducing the risk of development of allergy and/or asthma in infants, in preventing and treating pathogenic infections in such as diarrhoea in infants.
  • probiotics such as Lactobacillus and Bifidobacterium species
  • the food supplement is a digestive health functional food used with the intention to enhance and preserve digestive health, and avoid digestive disorders, by utilizing the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, as physiologically functional ingredients or components in the form of a liquid, tablets, capsules, or powder.
  • a gene encoding a polypeptide comprising a T. rangeli sialidase (PDB 1WCS; SEQ ID NO. 1) with the following mutations, M96V, A98P, S120Y, G249Y, Q284P and I37L [12] was codon-optimized and synthesized by DNA 2.0 (Menlo Park, Calif., United States of America).
  • the synthetic gene was inserted into PICZ ⁇ C vector (Invitrogen) between the XbaI and XhoI restriction sites generating a gene (SEQ ID NO: 11) encoding a translational fusion comprising the mutant trans-sialidase (SEQ ID NO: 13) having a N-terminal ⁇ -factor signal sequence followed by Kex2 and Ste3 protease recognition sites (SEQ ID NO: 12), and a C-terminal c-myc and 6xHis tag (SEQ ID NO: 14).
  • the encoded mature polypeptide has 662 amino acids, following removal of the signal peptide and protease recognitions sites, and a theoretical molecular mass of 73 kDa.
  • the plasmid vector was propagated in Escherichia coli NM522 grown at 37° C. with shaking in low salt LB (10 g/L tryptone, 5 g/L yeast extract and g/L NaCl) supplemented with 25 ⁇ g/mL zeocin.
  • Tr6 The vector, pPICZa-Tr6, was used as template for introduction of additional mutations by PCR using overlapping primers (Table 1) employing standard PCR mutation protocols. PCR products were inserted in pPICZaC between the XhoI and XbaI sites. Constructs were sequenced to confirm the mutations and to assure that no unwanted mutations had been introduced by PCR.
  • the mutants of Tr6 are denoted by the amino acid change compared to the parent (e.g. Tr6 Q123R), except for a multi-mutant denoted Tr13 where amino acids 197-203 were changed from IADMGGR (SEQ ID NO.: 62) to VTNKKKQ (SEQ ID NO.: 58).
  • P. pastoris X-33 harboring pPICZ ⁇ with mutated genes were grown in 180 mL BMMY (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6), 13.4 g/L yeast nitrogen base, 0.4 mg/L biotin and 0.5° A) methanol) shaking at 30° C. for three days. Protein synthesis was induced every 24 hours by addition of methanol to a final concentration of 0.5%.
  • Cells were removed by centrifugation for 5 min at 3000 g and supernatant was subsequently sterile filtered using a 0.2 ⁇ m Minisart filter (Sartorius AG). The supernatant was concentrated about 100-fold using Vivaspin20 concentrators with a 30 kDa cutoff (Sartorius AG).
  • 6xHis-tagged protein was purified from concentrated samples using Ni-sepharose (GE Healthcare) columns in accordance with manufacturer's instructions, desalted with PD-10 columns (GE Healthcare) into a buffer containing 20 mM sodium phosphate (pH 7.4), 100 mM NaCl and 10° A) glycerol and finally concentrated to about 200 ⁇ L using Vivaspin0.5 concentrator with 50 kDa cutoff (Sartorius AG).
  • P. pastoris X-33 harboring pPICZ ⁇ with mutated genes were grown in a 5 L Sartorius Biostat Aplus fermentor as described previously [13].
  • the 6xHis-tagged protein was purified by Cu 2+ affinity column chromatography using a CIM® IDA-8f ml Tube Monolithic Column (BIA Separations GmbH, Villach, Austria) as described previously [14]. Protein concentrations were determined using the BCA protein assay (Thermo scientific) with bovine serum albumin as standard.
  • Trans-sialidase activity was assayed as described previously [17] but with the following modifications. Reactions were performed in 50 mM phosphate-citrate (pH 6) at 30° C. using 2.9 ⁇ g/mL enzyme. The assay employed 1 mM cGMP-bound sialic acid as donor substrate and MU-Gal as the acceptor. MU-Gal at 0.5 mM was the highest final concentration to be tested due to its low solubility in aqueous solution. A solution of 87 mM MU-Gal in DMSO was diluted to 2 mM in 50 mM phosphate-citrate buffer (pH 6) immediately before preparing the reactions. When assaying crude enzyme preparations from P.
  • Sialidase activity was measured in a reaction containing 50 mM phosphate-citrate buffer (pH 7), 0.75 mM pNP-NeuAc and 3 ⁇ g/mL sialidase enzyme. Reactions were initiated by addition of substrate and followed spectrophotometrically at 410 nm at 30° C. pH 7 was chosen to enable detection of released pNP in a continuous assay. Reaction rates were normalized as ° A) of the activity of the Tr6 parent enzyme.
  • the assay was performed with either 1 mM 3′-sialyllactose, 1 mM 6′-sialyllactose or 1 mM cGMP-bound sialic acid in 50 mM phosphate-citrate buffer (pH 5) using 1 ⁇ g/mL enzyme. Reactions were started by addition of enzyme and stopped by adding H 2 SO 4 to 45 mM final concentration. Quantification of free sialic acid was performed using a 2-thiobarbituric acid assay [15] with the modification that butanol extraction was substituted with mixing with dimethyl sulfoxide (DMSO) [16].
  • DMSO dimethyl sulfoxide
  • the catalytic domains of the sialidases were identified using NCBI conserveed Domain Search [10]. Pymol v1.3 (Schrödinger) was used to identify amino acids within 14 ⁇ of the sialic acid binding site.
  • the T. rangeli sialidase mutant Tr6 (see below) and trans-sialidases from T. cruzi (TcTS) (Uniprot ID Q26966), Trypanosoma congolense (Uniprot ID G0WJG3) and Trypanosoma brucei (Uniprot ID Q57XJ2) were aligned using ClustalW [11] ( FIG. 2 ). Ranking of chemical difference between substituted amino acids in Tr6 vs.
  • TcTS was done based on being first- or second sphere relative to the substrate and based on the polar/nonpolar and small/large distinction; such property-based selection turned out to correlate well with standard substitution matrices (BLOSUM62), i.e. the most unlikely substitutions were considered noteworthy.
  • BLOSUM62 standard substitution matrices
  • Tr13 was made using HHpred [12] with automatic template selection (1ms9_A) ( FIG. 3 ).
  • the Tyr120 side chain conformation was manually changed to resemble that of the solved structure (PDB 1WCS).
  • rangeli sialidase in particular those residues lying within 14 ⁇ of the sialic acid binding site, reveal a large number of candidate amino acid residues whose substitution might account for the former's trans-sialidase activity.
  • the candidate amino acids were evaluated in terms of their impact on degree of surface exposure, hydrogen bonding, extent of change in chemical structure/properties, and their distance from the acceptor binding site. On this basis, the single residues or a combination of residues depicted in the primary sequence of the catalytic domain shown in FIG. 2 were selected for mutagenesis.
  • mutant enzymes were produced by recombinant expression in P. pastoris , transformed with the respective mutant gene, by growth in shake flask cultures.
  • the trans-sialidase activity of the expressed mutant enzymes was measured with a fluorescence-based assay using cGMP as sialic acid donor and methylumbelliferyl- ⁇ -D-galactopyranoside (MU-Gal) as acceptor ( FIG. 4 ).
  • cGMP sialic acid donor
  • MU-Gal methylumbelliferyl- ⁇ -D-galactopyranoside
  • the assay provides an effective screen for mutants having a higher trans-sialidase to hydrolase activity ratio.
  • Tr6 sialidase mutants were shown to be active enzymes ( FIG. 4 ). Reversion of two of the mutations (P98A and Y249G) originally introduced in the Tr6 parent sialidase, led to a reduction in trans-sialidase activity over the Tr6 parent. This confirms that these two residues in Tr6 (P98 and Y249) contribute to trans-sialidase activity of this enzyme. Of all mutants tested, only two mutants, namely Tr13 (comprising a VTNKKKQ (SEQ ID NO.: 58) motif) and Tr6 D363E enhanced trans-sialidase activity relative to Tr6, while all other mutants displayed a decreased trans-sialidase activity.
  • Tr13 comprising a VTNKKKQ (SEQ ID NO.: 58) motif
  • Tr6 D363E enhanced trans-sialidase activity relative to Tr6, while all other mutants displayed a decreased trans-sialidase activity.
  • Tr6 parent sialidase was mutated by a single amino acid substitution to create a +1 net charge for residues 197-303 (IADMKGR (SEQ ID NO.: 63)) this led to a significant loss of activity, compared to the Tr6 parent.
  • the net +3 charge of the corresponding motif in the Tr13 mutant thus appears to provide a significant and unexpected improvement in trans-sialidase activity relative to Tr6.
  • the parent enzyme Tr6 and the two mutants Tr13 and Tr6 D363E were produced in a 5 L fermentor and purified in amounts sufficient to characterize their catalytic properties.
  • Hydrolase activity was measured using the artificial substrate para-nitrophenyl neuraminic acid (pNP-NeuSAc) as well as the natural substrates 3′-sialyllactose, 6′-sialyllactose and cGMP.
  • the a-2,6-linked sialic acid constitutes about 50% of total sialic acid content in cGMP [21]. Since none of the enzymes exhibited detectable activity on 6′-sialyllactose (data not shown), it was unlikely that a-2,6-linked sialic acid in cGMP can be used as a donor.
  • Tr13 showed greatly reduced hydrolase activity for all 3 substrates, while D363E only showed reduced hydrolase activity on pNP-Neu5Ac ( FIG. 5A ).
  • the initially measured product formation represents the trans-sialidase reaction rate, while maximum product formation is a measure of both trans-sialidase activity (product formation) and hydrolase activity (product degradation).
  • Tr6 and Tr13 appeared to have similar trans-sialidase activity, Tr13 gave twice the trans-sialylated product yield, under these reaction conditions ( FIG. 5B ), confirming the reduced hydrolytic activity of this Tr13 mutant trans-sialidase.
  • the Tr6 D363E had a similarly low product formation profile as Tr6, consistent with their similar hydrolytic activity using cGMP as donor ( FIG. 5A ).
  • the Tr13 mutant comprising a VTNKKKQ (SEQ ID NO.: 58) motif, introduces three lysine residues, where K200 and K201 are partly shielded from the active site ( FIG. 3 ) while K202 points towards the center of the active site.
  • Introduction of the single mutation G202K, which is part of the VTNKKKQ (SEQ ID NO.: 58) motif, does not confer the same properties since this mutant exhibited reduced trans-sialidase activity compared to the parent.
  • the improved maximal yield obtained with the Tr13 mutant suggests that the VTNKKKQ (SEQ ID NO.: 58) motif does not affect acceptor binding affinity but rather uniquely reduces the hydrolytic activity (water kcat and/or KM).
  • the effect may be acceptor-dependent, as the total extend of hydrolysis not only depends on the impaired water network but also the KM of the acceptor during trans-sialylation, which affects acceptor vs. water retention time and thus, the competition between hydrolysis and trans-sialylation.
  • Tr13 mutant trans-sialidase represents a major advance in engineering a hydrolysis-impaired sialidase enzyme.
  • the insertion of the VTNKKKQ (SEQ ID NO.: 58) motif is sufficient to confer low hydrolase activity, approaching the very low levels of hydrolase activity characteristic of TcTS to a sialidase enzyme.
  • TcTS is distinguished by both an exceptionally low hydrolase activity and the higher affinity for lactose in TcTS compared to Tr6.
  • viable mutants with improved properties that deviate so substantially from a wild type by 13 site changes including a 7 amino acid loop structure with a +3 charge difference) are unusual (if not unprecedented).
  • Optimal reaction conditions (pH, temperature, and concentration of donor and acceptor) were determined employing a quadratic central composite design.
  • MODDE Version 7.0.0.1 Umetrics AB, Ume ⁇ , Sweden
  • the pH regimes 3, 4 and 5, the incubation temperatures 20, 40 and 60° C. and the concentrations of the acceptor lactose of 117, 234 and 351 mM were tested.
  • Reactions used a fixed concentration of cGMP-bound sialic acid of 8 mM in 15 mM phosphate-citrate buffer with specified pH values using 15 ⁇ g/mL Tr13.
  • Lactose and cGMP were solubilized in buffer and pre-incubated at specific temperatures, before the reactions were initiated by addition of enzyme. The biocatalysis process was allowed to proceed for 20 min before the reaction was stopped by heating for 10 min at 90° C. Concentration of sialyllactose was determined by HPAEC, as described in 4.2.
  • Sialyllactose was quantified by High-performance anion exchange chromatography (HPAEC-PAD) using a Dionex BioLC system consisting of GS50 gradient pumps, ED50 electrochemical detector, AS50 chromatography compartment coupled to an AS50 autosampler (Dionex Corp., Sunnyvale, Calif.). Samples (10 ⁇ L) were injected on a CarboPacTM PA1 (4 mm ⁇ 250 mm) analytical column (Dionex Corp., Sunnyvale, Calif.) at a flow rate of 1 mL/min. The elution program was based on the method described in [18] except for the modifications in the eluent system given below.
  • HPAEC-PAD High-performance anion exchange chromatography
  • the eluent system comprised of deionised water (A), 0.5 M NaOH (B), 1 M NaOAc (C).
  • A deionised water
  • B 0.5 M NaOH
  • C 1 M NaOAc
  • the specific trans-sialidase activity measured as number of sialyl-moieties transferred of Tr13 was 4.4+/ ⁇ 0.7 nmol*min ⁇ 1 per ⁇ g of enzyme on cGMP. It was apparent that a higher product yield could be obtained by extending the reaction time from 20 up to 100 minutes with no detectable product degradation, since no free sialic acid was detected by LC/MS. A maximum yield (not determined) of at least about 2.5 mM 3′-sialyllactose is predicted by extrapolation.
  • sialic acid is bound as ⁇ -2,3-sialic acid and ⁇ -2,6-bound sialic acid in a ratio of about 1:1 [21] and hence only 4 of the 8 mM cGMP-bound sialic acid was theoretically accessible giving a yield of about 63%.
  • Tr13 trans-sialylate different glycan acceptor molecules (GOS, IMO, lactulose, melibiose, maltose, and fucose) was tested as follows. The reactions were carried out in stirred glass bottles in reaction volumes of 50 mL for melibiose and maltose, 88 mL for fucose, 100 mL for lactulose, and 250 mL for GOS and IMO.
  • the reaction was performed in 15 mM phosphate-citrate buffer (pH 3) with 351 mM sialic acid acceptor (GOS, IMO, lactulose, melibiose, maltose and fucose) and 8 mM cGMP-bound sialic acid at 25° C. using 15 ⁇ g/mL enzyme. Prior to the reaction, the substrates were pre-incubated in the buffer. The reaction was carried out for 20 minutes and then stopped by enzyme inactivation by heating at 90° C. for 10 minutes.
  • the reaction mixture was then applied to a HiScale 50/20 (GE Healthcare) anion exchange chromatography column packed with 402 mL of Sepharose Q FF.
  • the separation was done at ambient temperature with an ⁇ KTA purifier 100 work station equipped with a P-900 pump, UV-900 monitor, and Frac-950 fraction collector, all controlled by UNICORN software (GE Healthcare).
  • the elution was performed at a flow rate of 70 mL/min and monitored at 210 nm.
  • the column was equilibrated with 5 column volumes (CV) of water. After injection the column was washed with 3 CV of water which elutes neutral, unreacted acceptor molecules.
  • Negatively charged compounds i.e.
  • LC/MS analyses were performed on an Agilent 1100 LC/Agilent 6340 ion trap MS system was used. Oligosaccharides were separated using a Hypercarb porous graphitic carbon (PGC) column (0.32 ⁇ 150 mm, 5 ⁇ m, Thermo scientific) at 30° C. Samples (0.5 ⁇ L) were loaded onto the column in 10 mM ammonium bicarbonate. Gradient elution was achieved using a binary solvent system consisting of (A) 10 mM ammonium bicarbonate, adjusted to pH 8.5 with ammonium hydroxide, and (B) 100% acetonitrile at a flow rate of 5 ⁇ L/min.
  • PPC Hypercarb porous graphitic carbon
  • the gradient was initially at 98:2 (% A:B) for 5 min, followed by a linear increase to 42:58 (% A:B) at 33 min. This concentration of B was held for 3 min. Subsequently the eluent was returned to 98:2 (% A:B) at 40 min and the system was allowed to equilibrate for 10 min prior to the next injection. All solvents used were of the highest HPLC grade.
  • a PEEKTM Tubing (30 cm ⁇ 65 ⁇ m ID, IDEX Health & Science) was used as transfer line to the electrospray ion source of the MS system.
  • the mass spectrometry was performed in negative ion mode, and was scanned in the range m/z 150-2200 (2 microscans, maximum accumulation time of 150 ms, an ion current count of 200,000) followed by data-dependent MS2 scans of the four most abundant ions in each MS1 scan.
  • Yields are given as product concentration and as % (w/w) of product produced from acceptor used. ND; the molar concentration of sialylated GOS and IMO could not be calculated since the distribution of different chain lengths was not determined.
  • sialyllactulose was produced in the highest molar yield.
  • Galactose and the 1,4- ⁇ bond between galactose and fructose in lactulose may be a structure that is particularly accessible to the active site cleft of Tr13.
  • acceptors, melibiose (1,6- ⁇ -bound galactose) and maltose (1,4- ⁇ -bound glucose) are of similar size, their sialylation yield was more than 40% lower.
  • Bacterial growth assays on sialylated glycans were performed with the following strains: Bifidobacterium longum longum (Danisco Global Culture Collection DGCC 232), Bifidobacterium longum infantis (DGCC 233), Bifidobacterium longum infantis (DGCC 1497), Bifidobacterium longum infantis (DGCC 2238), Lactobacillus acidophilus (NCFM, ATCC 700396), Bifidobacterium longum (BI-05, DGCC 9917), Bifidobacterium lactis (HN019, DGCC2013), and Clostridium perfringens (ATCC 13124).
  • the tested sialylated substrates were dissolved in water at 10% (w/v) and sterilized by sterile filtration (0.2 ⁇ m Minisart, Sartorius AG, Göttingen, Germany). Galactan from potato (Megazyme International LTD, Bray, Co. Wicklow, Ireland), used as prebiotic standard control, was sterilised by UV-radiation for 30 seconds, due to its high viscosity.
  • the bacterial strains were precultured in MRS-medium (de Man, Rogosa and Sharpe medium without glucose) with no additional sugars added, for 24 h at 37° C. under anaerobic conditions, before being diluted with fresh MRS-medium to 1% (v/v).
  • test substrates were grown by adding 20 ⁇ L of 10% test substrates solutions and 180 ⁇ L 1% cell suspension in multi-well plates and growth was followed by measurement of optical density at 600 nm (OD600) using Biolink® software (Labsystems) in a Bioscreen® C system (Labsystems, Helsinki, Finland) as described previously [19]. The growth in MRS-medium without addition of carbohydrates was used as control. The experiments were performed in three replicates for each strain and carbohydrate substrate and growth was determined as the area under the growth curve. Data are given as mean values ⁇ standard error.
  • All the B. longum subsp. infantis strains tested contain a sialidase (a prerequisite for utilising the sialylated compounds) as well as C. perfringens that contains the necessary enzymes for metabolising sialic acid [27]. Although variations in growth were seen on the different substrates, even within species, it was evident that most bacteria to some extent were able to grow on the sialylated compounds.
  • sialylated melibiose and maltose did not appear to promote growth of the group of probiotic strains.
  • Growth of B. infantis 233, B. infantis 1497, and B. longum 232 was promoted to various degrees by different sialylated compounds, while sialylated fucose promoted growth of all three.
  • none of the sialylated compounds promoted growth of B. infantis 2238, B. lactis, L. acidophilus , and B. longum 9917, while L. acidophilus grew well on the prebiotic control substrate galactan.
  • C. perfringens grew significantly better than all the probiotic strains on the tested sialylated compounds. Mixed cultures are more likely to reveal a selective growth effect of sialylated on probiotic bacteria.

Abstract

The invention provides a mutant enzyme having trans-sialidase activity (EC 3.2.1.18), characterized by an enhanced trans-sialidase:sialidase ratio when compared to its parent sialidase enzyme. Further the enzyme may be used in a method for trans-sialylating mono- and oligo-saccharides, including galacto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomalto-oligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, lactosucrose and fucose. Trans-sialidated mono- and oligo-saccharides, produced with the mutant enzyme, are useful in preparing infant formula, a prebiotic nutritional supplement, and a food supplement.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS
This is a U.S. national stage entry of International Patent Application No. PCT/EP2014/057422, filed on Apr. 11, 2014, which claims priority to European Patent Application No. 13163551.8, filed on Apr. 12, 2013, the entire contents of all of which are fully incorporated herein by reference.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 74,659 Byte ASCII (Text) file named “P1419US00-030547-9041-US00-SEQ-LIST-01-16-18.txt” created on Jan. 15, 2018.
FIELD OF THE INVENTION
The invention relates to enzymes having trans-sialidase activity (EC 3.2.1.18), that are derived from Trypanosomal sialidases by mutation. The enzymes obtained by mutation find particular use in the production of diverse sialylated galacto-oligosaccharides (GOS) and fructo-oligosaccharides (FOS), these being important additives in infant formula, a prebiotic nutritional supplement, and a food supplement.
BACKGROUND OF THE INVENTION
Prebiotics are dietary substances that stimulate growth of selected groups of microorganisms in the colon and in addition may have other health benefits. Galactooligosaccharides (GOS), fructooligosaccharides (FOS), lactulose, and isomaltooligosaccharides (IMO) are among the few well-established prebiotics. In human milk, oligosaccharides constitute the third largest component, present in amounts as much as 20-25 g/I around parturition, later declining to 5-15 g/L. With few exceptions, all known human milk oligosaccharides (HMOs) have a lactose core and are elongated via linkage to one or more units of galactose and N-acetylglucosamine, and can be decorated with several sialic acid and fucose residues. More than 100 different such glycan structures have been identified and approximately 10-20% of these are sialylated (Bode, 2012, Glycobiology 22(9): 1147-1162). Sialylation and/or fucosylation of many of these HMOs appear to convey important functional properties. For example, HMOs can bind human pathogens, such as, Escherichia coli K1, Haemophilus influenzae, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejuni, Vibrio cholerae, Helicobacter pylori and Streptococcus agalactiae and thereby reduce the incidence of diarrhoea and other diseases in infants. This ability of HMOs to function as soluble decoy receptors for human pathogens is most likely enhanced by their diversity, since mannose-containing glycoproteins, sialylated and fucosylated glycans each target different subsets of pathogens (Kunz et al., 2000, Ann. Rev. Nutrition 20:699-722). In addition, sialylated HMOs may modulate the immune system; for example T cell cytokine production is stimulated by sialylated HMOs in vitro (Eiwegger et al., 2004, Pediatric Rev. 56:536-540). In most cases, the active HMO molecules have not been identified, but in the case of necrotising enterocolitis, a frequent and often fatal disease in infants, the protective effect was recently shown to be due to a single molecule, disialyllacto-N-tetraose, using a rat model (Jantscher-Krenn et al., 2012, Gut 61:1417-1425).
Bovine milk, which forms the basis for most infant formula, has a very low oligosaccharide content when compared with human milk, with a different sialylation and fucosylation profile. In an attempt to mimic the composition of human milk, milk formula is currently supplemented with (non-HMO) GOS and FOS. However, due to their lack of sialic acid residues, the added GOS and FOS are unlikely to provide the therapeutic benefits of HMOs, described above (Bode, 2012, supra).
Efforts to sialylate GOS and FOS rely on glycan sialylation, which can be achieved chemically as well as enzymatically using different types of enzymes [1]. For example, a trans-sialidase enzyme (TcTS) from Trypansoma cruzi, the causative agent of Chagas disease, has been used to transfer sialic acid from a donor to an acceptor glycan [2]. However, in the context of industrial production of food-grade HMOs, the T. cruzi trans-sialidase has a major drawback, namely that it constitutes an important virulence factor within T. cruzi [3].
A native sialidase (TrSA) found in the non-pathogenic Trypansoma rangeli, has been used as a starting point for generating mutant enzymes that possess trans-sialidase activity [4]. Although this sialidase shares 70% sequence identity with that of TcTS, and has the same overall tertiary structure, it is a strict hydrolase having no detectable trans-sialidase activity [4]. The sialidase, TrSA, and the trans-sialidase, TcTS, share a common double displacement mechanism with a tyrosine as catalytic nucleophile [5] [6]. In TcTS, the acceptor binding site consists of Tyr119 and Trp312 forming stacking interactions with the acceptor sugar [7]. In TrSA, Trp313 (corresponding to Trp312 in TcTS) is found in a different conformation due to a Gln at position 284, while it has a Ser residue at position 120 corresponding to Tyr119 in TcTS [8]. In addition to these differences in the acceptor binding site, a conserved Asp96 hydrogen bonds differently to sialic acid in the two enzymes, possibly due to two residue differences, Val96Met and Pro98Ala. Initial attempts based on TrSA single point mutants, failed to generate an enzyme with any trans-sialidase activity. Subsequent studies revealed the need for a combination of 5 point mutations TrSA, comprising Ser120Tyr, Gly249Tyr, and Gln284Pro at the acceptor-binding site as well as Met96Val, and Ala98Pro at the sialic acid binding pocket to confer trans-sialidase activity (1% of TcTS) to TrSA. An additional single mutation Ile37Leu increased the levels of trans-sialidase activity to 10% of a T. cruzi trans-sialidase [4]. Furthermore, kinetic data indicate that these TrSA mutants display a >25-fold lower affinity for lactose and >100-fold higher turnover (kcat) for the undesired, competing hydrolysis compared to TcTS [4] indicating a considerable need for improvement before such an enzyme would have any practical value for. trans-sialylation.
Despite the relatively close sequence homology between TrSA and TcTS, there is no evidence that the native sialidase expressed by Trypansoma rangeli has any trans-sialidase activity. Isolation and expression of a TrSA gene from Trypansoma rangeli is reported by Smith et al [31]. The isolated TrSA gene encodes an inactive protein, likely due to the substitution of a strictly conserved arginine, that functions by coordinating the carboxyl of sialic acid, by a cysteine residue [31]. Smith et al., also submitted a TrSA gene encoding sialidase (Q08672) to GenBank, which is predicted to be an anhydrosialidase [32]. In addition to lacking the Arg residue required for coordinating the carboxyl of sialic acid, this sialidase (Q08672) lacks the mutations S119Y and Q284P that are required to establish the acceptor binding site, and for this reason cannot function as a trans-sialidase.
Buschiazzo et al., [33] report the isolation of a Trypansoma rangeli gene that is predicted to encode a TrSA, UNIPROT: Q08672 having 70% sequence identity to TcTS, which is a common feature of other TrSAs having only hydrolytic activity. One amino acid substitution in the primary sequence of a TrSA, found essential for obtaining a mutant TrSA having measurable trans-sialiase activity is Gly249-Tyr, which decreases hydrolytic activity [4]. A second mutation, Ile-37Leu, which in combination with Tyr120, significantly enhances trans-sialidase activity in this mutant [4]. Neither of these mutations is found in TrSA, UNIPROT: Q08672.
In human milk, lactose or HMOs of various lengths can be sialylated in α2-3 or α2-6 linkage which can be added to a terminal galactose or a subterminal N-acetyl-glucosamine, thereby contributing to the diversity of HMOs present. Efforts to mimic such complex oligosaccharide compositions require a trans-sialidase that can transfer sialic acid to a variety of different acceptor groups. Although it is well established that TcTS can sialylate the terminal galactose of a glycan, there is no documented evidence of a trans-sialidase that can use other acceptor groups, which is essential if the diversity of HMOs is to be obtained synthetically.
Accordingly, there remains a need for an enzyme having trans-sialidase activity, that is neither a virulence factor nor derived from a pathogenic organism; and further has no significant sialidase hydrolytic activity, and that can transfer a sialic acid moiety to a range of different acceptor groups present in a glycan molecule.
SUMMARY OF THE INVENTION
According to a first embodiment, the invention provides a mutant polypeptide having at least 80% amino acid sequence identity to amino acids residues 28-372 of SEQ ID NO: 2, and wherein residues 197 to 203 of SEQ ID NO. 2 comprise one or more of substituted amino acid residues resulting in a net positive charge of at least +3 for residues 197 to 203 of SEQ ID NO. 2, and wherein amino acid residues 37, 96, 98, 120, 249, 284 in the sequence of the mutant polypeptide have 100% sequence identity to the corresponding amino acid residues in SEQ ID NO. 2, wherein the polypeptide has trans-sialidase activity (EC 3.2.1.18). A net positive charge of at least +2, preferably +3, for residues 197 to 203 of SEQ ID NO. 2 in the polypeptide of the invention confers a reduced hydrolase activity when compared to the polypeptide having the sequence of amino acids residues 28-372 of SEQ ID NO: 2. The mutant polypeptide may be obtainable by mutation of SEQ ID NO: 2, and the amino acid sequence of the polypeptide may have sequence identity with SEQ ID NO: 2 with the exception that residues 197 to 203 of SEQ ID NO. 2 comprise one or more of substituted amino acid residues resulting in a net positive charge of at least +2, preferably +3, for residues 197 to 203.
According to a second embodiment, the mutant polypeptide additionally comprises a C-terminal linker and carbohydrate-binding domain selected from among: a) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma rangeli trans-sialidase comprising amino acid residues 373 to 638 of SEQ ID NO: 2; b) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma cruzi trans-sialidase (SEQ ID NO. 8); c) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma congolense trans-sialidase (SEQ ID NO. 9); d) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma brucei trans-sialidase (SEQ ID NO. 10).
The mutant polypeptide may be expressed as a fusion protein comprising a homologous or heterologous amino-terminal signal peptide and/or a heterologous amino-terminal or carboxy-terminal peptide having selective substrate binding affinity for purification of the polypeptide.
According to a further embodiment, the invention provides a DNA molecule comprising a positive DNA strand having a nucleic acid sequence encoding the mutant polypeptide according to the first or second embodiment.
According to a further embodiment, the DNA molecule may have a nucleotide sequence encoding the mutant polypeptide having an amino acid sequence selected from among: a) amino acid residues 48-372 of SEQ ID NO. 4; b) amino acid residues 21-372 of SEQ ID NO. 4; c) amino acid residues 48-638 of SEQ ID NO. 4; and d) amino acid residues 21-638 of SEQ ID NO. 4.
According to a further embodiment, the invention provides a recombinant host cell comprising the DNA molecule encoding the mutant polypeptide, wherein said cell is prokaryotic or eukaryotic and selected from among a bacterial cell, a yeast cell and a fungal cell. The DNA molecule may either be integrated into the genome of the host cell or it may be integrated into a self-replicating plasmid in the host cell.
According to a further embodiment, the invention provides a method for producing the mutant polypeptide of the invention comprising the steps of:
a) providing a recombinant host cell, wherein the cell comprises a DNA molecule, the DNA molecule comprising a nucleic acid sequence encoding the mutant polypeptide of the invention, and b) incubating the host cell in a medium in which the host cell is capable of expressing the mutant polypeptide, and c) recovering the mutant polypeptide expressed by the host cell in step a) from the medium.
According to a further embodiment, the invention provides an enzyme composition comprising the mutant polypeptide of the invention, wherein the composition is formulated as a dry powder, a tablet, or as a liquid.
According to a further embodiment, the invention provides a method for producing sialylated mono- and/or oligo-saccharides, comprising the steps of:
a) providing a sialic acid donor molecule and a molecule comprising an acceptor mono- and/or oligo-saccharides capable of trans-sialylation; b) contacting the molecules of (a) with the mutant polypeptide of the invention in an aqueous solution.
According to a further embodiment, the invention provides a composition comprising sialylated mono- and oligo-saccharides produced by the method of the invention, wherein the composition is selected from an infant formula, a prebiotic nutritional supplement, and a food supplement.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. A. Domain structure of a sialidase enzymes (EC 3.2.1.18), as exemplified by Trypanosoma cruzi trans-sialidase (TcTS). The catalytic domain is located on the left (light gray), the carbohydrate-binding domain to the right (dark grey), the two domains are linked together by a peptide linker (black). A ligand (sialyllactose) bound in the active site is shown in black sticks. B. Cartoon of mutant trans-sialidase of the invention, showing domain structure (catalytic domain peptide; linker peptide; lectin peptide (carbohydrate-binding domain)) and one example of the mutated motif (amino acids 197-203), and amino acid residue positions with respect to SEQ ID NO: 2.
FIG. 2. Sequence alignment of sialidase catalytic domain from Tr6 (TrSASmut [PDB: 1WCS] with a 6th point mutation, I37L; amino acid residues 26-372 of SEQ ID NO. 2) and related trans-sialidases. Tr6 and trans-sialidases from T. cruzi (SEQ ID NO. 5), Trypanosoma congolense (SEQ ID NO. 6) and Trypanosoma brucei (SEQ ID NO. 7) were aligned using ClustalW. Amino acids within 14 Å of sialic acid binding site are shown in bold. The seven amino acid motif is indicated with filled circles, reverting mutations are indicated with a triangle while other mutated sites are indicated with asterisks.
FIG. 3. Homology model of Tr13 (mutant trans-sialidase of the invention). Close-up of the active site with a sialyllactose docked (dark gray). Acceptor binding site residues Tyr-120 and Trp-313 and catalytic nucleophile Tyr-343 side chains are shown in gray. The seven introduced amino acids are shown in light gray.
FIG. 4. Trans-sialidase activity of Tr6 and derived mutants using cGMP as sialic acid donor and methylumbelliferyl-pyrogalactoside as acceptor. Product formation is shown in arbitrary units.
FIG. 5. Enzyme activity of Tr6 and selected mutants Tr13 and Tr6 D363E. A) Hydrolase activity on the substrates pNP-Neu5Ac, 3′-sialyllactose, and cGMP. B) Trans-sialidase activity using cGMP as sialic acid donor and MU-gal as acceptor.
FIG. 6. Time course of trans-sialylation catalysed by Tr13. Accumulation of 3′-sialyllactose over time at 25° C., pH 3, 351 mM lactose and 8 mM cGMP-bound sialic acid.
FIG. 7. Anion exchange separation profiles for sialylated glycans catalyzed by Tr13. Sialylated glycans separated from sialic acid and unused acceptor separated on Sepharose Q and detected at 210 nm.
DETAILED DESCRIPTION OF THE INVENTION
A common structural feature of sialidase enzymes (EC 3.2.1.18) is their six bladed β-propeller catalytic domain with an active site comprising a catalytic arginine triad that coordinates sialic acid via the carboxylate group, an Asp residue as acid/base catalyst, and a Tyr/Glu nucleophile pair (FIG. 1). The catalytic domain can additionally be functionally linked to a non-essential carbohydrate-binding module (CBM) that may serve to recognize sialic acid and/or assist the enzyme target its substrate on cell surfaces. Micromonospora viridifaciens secretes two forms of sialidase from the same gene, a short form, with just the catalytic domain, and a longer form with a galactose-binding module, dependent on the food source [29].
I a Mutant Trans-Sialidase Derived from a Trypanosoma rangeli Sialidase
I.i Structure of Mutant Trans-Sialidase Comprising a Catalytic Domain
The present invention provides a mutant enzyme (EC 3.2.1.18) having an enhanced trans-sialidase: sialidase activity ratio relative to its immediate parent enzyme, the mutant being ultimately derived from a sialidase from Trypanosoma rangeli (GenBank Acc. No: U83180.1). In a first embodiment, the mutant enzyme is a polypeptide comprising at least a catalytic domain having trans-sialidase activity. The amino acid sequence of the catalytic domain has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to amino acids residues 28-372 of SEQ ID NO. 2, and one or more amino acid residues are substituted with respect to amino acid residues 197 to 203 (amino acid motif) of SEQ ID NO. 2, to give a mutant amino acid motif that has a net positive charge of at least +2, preferably +3. Expression of the mutant enzyme yields a mature enzyme comprising a catalytic domain alone, having trans-sialidase activity (FIG. 1). The location of the catalytic domain in SEQ ID NO: 2 was confirmed using NCBI Conserved Domain Search.
The amino acid motif consisting of amino acid residues 197 to 203 of SEQ ID NO: 2 has the sequence IADMGGR, which has one positively charged amino acid (R) and one negatively charged amino acid (D), giving a net charge=0. A mutant motif having a net positive charge of +2 or +3 that can be obtained by the substitution of one or more amino acid residues selected from among 198-203 of SEQ ID NO: 2, wherein the selected residue is substituted with a positively charged amino acid residue, and/or the substitution of residue 199 (D) with a neutral or positively charged amino acid. A suitable positively charged amino acid is a K or R. A suitable neutral amino acid to substitute for residue 199 (D) may be selected from among polar neutral amino acids including asparagine, glutamine, glycine, serine, threonine, cysteine, and tyrosine, or a nonpolar (hydrophobic) amino acids such as include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
For example, the mutant motif may have any amino acid sequence selected from among: IAXMGGR; IXZMGGR; IAZXGGR; IAZMXGR; IAZMGXR, where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +2.
Alternatively, the mutant motif may have any amino acid sequence selected from among: IXDXGGR; IXDMXGR; IXDMGXR; IADXXGR; IADMXXR, where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +2.
Furthermore, the mutant motif may have any amino acid sequence selected from among: IXZXGGR; IAZXXGR; IAZMXXR; IAXMGXR; IAXMXGR; IAXXGGR; and IAZXXXZ where X is K or R and wherein Z is a neutral amino acid, for example N, wherein the motif has a net positive charge of +3.
Furthermore, the mutant motif may have any amino acid sequence selected from among: VTNKKKQ (SEQ ID NO.: 58), ARNKANR (SEQ ID NO.: 59), IANKKKQ (SEQ ID NO.: 60), and IANRRRQ (SEQ ID NO.: 61). Thus according to one example, the mutant enzyme is a polypeptide comprising a catalytic domain corresponding to amino acids residues 28-372 of SEQ ID NO: 4, wherein the motif consisting of amino acid residues 197 to 203 has a positive charge of +3.
The mutant enzyme of the present invention differs from the sialidase of Trypanosoma rangeli (GenBank Acc. No: U83180.1) by an additional 6 point mutations located within the catalytic domain. These 6 point mutations in T. rangeli sialidase were previously disclosed by Paris et al., 2005 [4]. Thus the immediate parent enzyme, from which the present mutant enzyme was derived, has the protein sequence of TrSASmut (Protein Data Bank file: 1WCS) that further includes I37L as the 6th point mutation (corresponding to SEQ ID NO: 2).
I.ii Structure of Mutant Trans-Sialidase Comprising a Catalytic Domain and a Carbohydrate-Binding Peptide (Lectin-Domain) Connected by a Linker Peptide
In a second embodiment, the mutant enzyme is a polypeptide comprising a catalytic domain according to the first embodiment (corresponding to amino acids residues 28-372 of SEQ ID NO: 2, wherein one or more amino acid residues within a motif consisting of amino acid from residue 197 to 203 of SEQ ID NO. 2 is mutated, wherein the mutant motif has a net positive charge of at least +2, preferably +3, as well as a C-terminal carbohydrate-binding domain where the two domains are linked by a linker peptide. The carbohydrate-binding domain and linker peptide (comprising a non-catalytic region) has an amino acid sequence having at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity to amino acid residues 373-638 of SEQ ID NO: 2. The C-terminal carbohydrate-binding domain folds separately from the catalytic domain, in a β-sandwich fold, leaving the two domains to interact through a hydrophobic interface.
Examples of the second embodiment include the mutant enzyme wherein the C-terminal domain is derived from a Trypanosomal trans-sialidase or sialidase enzyme. For example, the C-terminal domain may be selected from among: C-terminal amino acid residues 373 to 638 of SEQ ID NO: 2 derived from Tr6 mutant T. rangeli sialidase; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO. 8, derived from amino acid residues 373 to 642 of T. cruzi trans-sialidase [Uniprot ID Q26966]; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO. 9, derived from amino acid residues 452 to 702 of T. congolense trans-sialidase [Uniprot IDG0WJG3]; C-terminal linker peptide and carbohydrate-binding peptide having SEQ ID NO. 10, derived from amino acid residues 373 to 642 of T. brucei trans-sialidase (Uniprot ID [Q57XJ2].
Optionally, the mutant enzyme according to the first or second embodiment is a polypeptide comprising an N-terminal peptide region fused to the catalytic domain corresponding to amino acids residues 1-372 of SEQ ID NO: 2. According to one example of the second embodiment, the mutant enzyme is a polypeptide comprising amino acids residues 28-638 of SEQ ID NO: 4 or amino acids residues 1-638 of SEQ ID NO: 4.
I.iii the Mutant Amino Acid Motif in the Mutant Trans-Sialidase Confers an Enhanced Trans-Sialidase:Sialidase Activity Ratio and Sialylated Product Yield
The T. rangeli sialidase mutant enzymes, previously described by Paris et al., 2005 [4], had the major deficiency that they retained the hydrolytic catalytic properties of the parent T. rangeli sialidase from which they were derived. The mutant enzyme of the present invention according to the first or second embodiment, comprise a mutant motif (as defined in I.i and I.ii) having a net positive charge of at least +2. Mutations creating this mutant motif greatly reduce the hydrolase activity of the parent sialidase enzyme (see Example 3.3; FIG. 5A).
The catalytic effect of the mutant motif was surprising since the motif is relatively far removed from the acceptor binding site (˜14 Å), and is therefore unlikely to affect acceptor binding directly. The net positively charged motif, which is located at the border of the binding cleft, may change the electrostatic field in the cleft, creating an increased hydrogen bond donor capacity that could potentially disrupt or even reverse the water network in the active site. Hydrolysis requires a water network aligned with oxygen lone pairs towards the sialic acid. Thus, introduction of a strong positive charge (e.g. at least +2) and hydrogen-donor tendency at the edge of the binding cleft may turn the oxygen lone pairs towards the field of the lysines and correspondingly impair the nucleophilicity of the water network in the cleft. Such a disruption of the water network could provide the theoretical explanation for the exquisite quenching of hydrolysis, not achieved by other sialidase mutants.
The mutant trans-sialidase has a high trans-sialylation product yield when assayed under optimal conditions due to its very low hydrolase activity (see Example 4).
I.iv the Mutant Trans-Sialidase has Broad Acceptor-Substrate Specificity
The mutant trans-sialidase of the invention has unexpectedly broad acceptor-substrate specificity, in contrast to native TcTS, which is only known to act on acceptor substrates comprising a terminal galactose [24]. The mutant trans-sialidase is both able to trans-sialylate terminal galactose as well as terminal glucose and even monomers of glucose and fucose. Importantly, the mutant enzyme was also able to trans-sialylate GOS and IMO and lactulose preparations in reasonable yields (Example 5; Table 2). The sialylated GOS and IMO products obtained using the mutant trans-sialidase are complex, indicating that oligosaccharides of different chain length in the GOS and IMO mixtures are sialylated. In view of its broad acceptor-substrate specificity, the mutant trans-sialidase is particularly suitable for enzymatic sialylation of a broad range of glycans in the manufacture of functional food ingredients and prebiotics. GOS and IMO and lactulose are well-documented prebiotic compounds used as a nutritional supplement.
Additionally, the mutant trans-sialidase is able to use casein glycomacropeptide (cGMP), which is a side-stream from dairy industry, as sialic acid donor (Example 5, FIG. 5). In summary, the mutant enzyme of the invention, is characterized by both a high trans-sialidase:sialidase activity ratio and a remarkably broad acceptor-substrate specificity, while having the additional advantages of neither being derived from a non-pathogenic host, nor being a virulence factor.
II a Method for Production of the Mutant Trans-Sialidase of the Invention, Including Expression Vectors and Host Cells
IIi Expression Constructs for Production of a Mutant Trans-Sialidase
The invention further provides DNA molecules comprising a positive DNA strand having a nucleic acid sequence encoding the mutant trans-sialidase according to the first and second embodiment. For the purposes of expression in a selected host cell, the mutant trans-sialidase may be expressed as an N-terminal translational fusion protein, having an N-terminal homologous or heterologous amino-terminal peptide comprising a signal peptide sequence and optionally followed by a protease cleavage site. A suitable N-terminal fusion protein may include α-factor signal sequence and Kex2 and/or Ste3 protease recognition sequences.
For the purposes of purification of the expressed protein, the mutant trans-sialidase may be expressed as a translational fusion protein comprising a heterologous peptide having selective substrate binding affinity suitable for purification of the polypeptide, as for example c-myc and 6xHis-tag, as present in SEQ ID NO: 12. The heterologous peptide may be located either N-terminal or carboxy-terminal to the mutant trans-sialidase in the fusion protein, either in addition to/or independently of an N-terminal signal peptide.
According to an embodiment, the invention provides a DNA molecule encoding the mutant trans-sialidase selected from among: a nucleotide sequence encoding a catalytic domain comprising amino acids residues 28-372 of SEQ ID NO: 4; a nucleotide sequence encoding an N-terminal peptide region fused to the catalytic domain comprising amino acids residues 1-372 of SEQ ID NO: 4; a nucleotide sequence encoding the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 28-638 of SEQ ID NO: 4; and a nucleotide sequence encoding an N-terminal peptide region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1-638 of SEQ ID NO: 4.
For example, the DNA molecule encoding the mutant trans-sialidase may be selected from among: nucleotide sequence 84-1116 of SEQ ID NO: 3 encoding the catalytic domain comprising amino acids residues 28-372 of SEQ ID NO: 4; nucleotide sequence 1-1116 of SEQ ID NO: 3 encoding an N-terminal peptide region fused to the catalytic domain comprising amino acids residues 1-372 of SEQ ID NO: 4; nucleotide sequence 84-1914 of SEQ ID NO: 3 encoding the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 28-638 of SEQ ID NO: 4; nucleotide sequence 1-1914 of SEQ ID NO: 3 encoding an N-terminal peptide region fused to the catalytic domain linked to a carbohydrate-binding domain comprising amino acid residues 1-638 of SEQ ID NO: 4.
The DNA molecules encoding the mutant trans-sialidase to be expressed are cloned into a suitable self-replicating or genome-integrating vector (plasmid) or are PCR amplified for the purpose of introducing the DNA molecules into a suitable expression host cell. Where the DNA molecule is cloned into vector, the DNA molecule will be cloned behind a DNA promoter, whereby the nucleotide sequence of the promoter is operably linked to the nucleic acid sequence encoding the mutant trans-sialidase. Suitable promoter elements for expression in yeast or other fungi include the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, alcohol oxidase promoter (AOX), PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, while promoters for prokaryotic expression vectors include the p-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731).
IIii Expression Hosts Comprising Mutant Trans-Sialidase Expression Constructs
Suitable expression hosts include bacterial (e.g. Escherichia coli; Bacillus subtilis; Bacillus licheniformis); yeast (e.g. Saccharomyces cerevisiae; Pichia pastoris, Hansenula polymorpha) or fungal (Aspergillus niger, A. oryzae, Trichoderma viridae) hosts. DNA molecules, encoding the mutant trans-sialidase to be expressed, may be introduced into a host cell by transformation employing standard protocols known in the art, for example by electroporation. Preferably the mutant trans-sialidase is fused with a signal peptide, facilitating secretion of the expressed protein and its subsequence purification from the host cultivation medium.
The invention provides a method for producing the mutant trans-sialidase comprising the steps of providing a recombinant host cell, wherein the cell comprises a DNA molecule encoding the mutant trans-sialidase according to the first or second embodiment, and incubating the host cell in a medium in which the cell is capable of expressing the mutant trans-sialidase, for example a growth medium, and then recovering the mutant trans-sialidase expressed by the host cell from the host cell cultivation and/or incubation medium.
IIiii Methods for Detecting and Measuring the Specific Activity of the Mutant Trans-Sialidase
The invention provides a method for assaying the mutant trans-sialidase of the invention, that may for example be obtained by recombinant expression. Example 2.1 describes a fluorescence-based assay employing cGMP-bound sialic acid (for example 1 mM) as donor substrate and methylumbelliferyl-β-D-galactopyranoside (MU-Gal) as the acceptor (for example 0.5 mM), where the reaction is performed in a 50 mM phosphate-citrate (pH 6) at 30° C.
The trans-sialylation:sialidase activity ratio of an enzyme of the invention can be determined by measuring and determining the ratio of the initial reaction rate of the enzyme for the trans-sialidase reaction with respect to the sialidase reaction as described in Example 2.1 and 2.2.
III Methods for Producing a Product Comprising Sialylated Mono- or Oligo-Saccharides
The invention further provides a method for producing a product comprising sialylated mono- or oligo-saccharides (glycan), comprising the steps of: providing a sialic acid donor molecule and a molecule comprising an acceptor (e.g. glycan) capable of trans-sialylation; providing a mutant trans-sialidase according to the first or second embodiment; contacting the mutant trans-sialidase with both of the donor and acceptor molecules in an aqueous solution.
A suitable sialic acid donor molecule includes cGMP-bound sialic acid. One source of cGMP is a side-stream (e.g. cheese-processing waste stream) from the dairy industry. Other sources include fetuin, colominic acid and free sialic acid. Whey containing sialic acids, is a byproduct obtained when cheese or rennet casein is produced from milks such as cow milk, goat milk, and sheep milk. For example acid whey, is generated by separating the solids when skim milk is coagulated to form cottage cheese. A cheese processing waste stream is the portion of cheese manufacturing not retained for cheese after formation of curd. The cheese processing waste stream typically refers to the fluid drained from curd, which is frequently discarded. A cheese processing waste stream can be whole whey, demineralized whey permeate, the regeneration stream from demineralized whey permeate, whey permeate, whey powder.
A suitable acceptor glycan capable of trans-sialylation includes galacto-oligosaccharides (GOS), fructo-oligosaccharides (FOS), malto-oligosaccharides (MOS), isomalto-oligosaccarides (IMO), lactulose, melibiose, maltose, glycosyl sucrose, lactose, lactosucrose, Lacto-N-tetraose (LNT), Lacto-N-neotetraose (LnNT), Lacto-N-fucopentaose I (LNFP I), and Lacto-N-fucopentaose V (LNFP V) and fucose.
Optimal substrate concentrations for use in producing sialylated products using the expressed trans-sialidase of the invention may be determined for each selected acceptor substrate. The sialyloligosaccharides produced according to the methods of the invention may be recovered using methods known in the art, including, but not limited to, ultrafiltration, diafiltration, electrodialysis, ion-exchange chromatography and phase partition chemistry.
IV Methods for Producing a Product Comprising Sialylated Galacto-Oligosaccharides
The invention further provides a two-step method for producing sialylated GOS comprising the steps of: providing a source of lactose, contacting the lactose with a β-galactosyltransferase capable of transferring a galactose residue from lactose to an acceptor molecule capable of extension by transgalactosylation (e.g. lactose or a GOS); followed by the step of combining the product of trans-galactosylation with a sialic acid donor molecule (as described herein) to provide a mixture; and then contacting the mixture with a mutant trans-sialidase according to the first or second embodiment to produce a sialylated GOS product. An additional step of enrichment and purification of the products of transgalactosylation (i.e. GOSs) may be included prior to performing the step of trans-sialylation with the mutant trans-sialidase. The suitable 3-galactosyltransferase is a type of glycosyltransferase (EC.2.4.1) which catalyzes the transfer of galactose, such enzymes being well-known in the art [30].
V Sialylated Mono- or Oligo-Saccharides and Compositions Thereof
The invention further provides a sialylated mono- and/or oligosaccharide product or a composition comprising the product, obtained by treating a mono- and/or oligosaccharide substrate with the trans-sialidase of the invention. Compositions comprising the sialylated mono- and/or oligosaccharide products may include infant formula, a prebiotic nutritional supplement or a food supplement.
In the present context, infant formula means a foodstuff comprising the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, which is suitable for nutritional use by infants during the first 4-6 months or even 4 to 12 months of life and satisfying by itself the nutritional requirements of infants. In the present context, a prebiotic food supplement uses the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, to enhance the beneficial effects and efficiency of probiotics, such as Lactobacillus and Bifidobacterium species, for example by promoting the development of an early bifidogenic intestinal microbiota in infants, in reducing the risk of development of allergy and/or asthma in infants, in preventing and treating pathogenic infections in such as diarrhoea in infants. In the present context, the food supplement is a digestive health functional food used with the intention to enhance and preserve digestive health, and avoid digestive disorders, by utilizing the sialylated mono- and/or oligosaccharide product, obtained or obtainable by the method of the present invention, as physiologically functional ingredients or components in the form of a liquid, tablets, capsules, or powder.
EXAMPLES Example 1 Cloning and Expression of T. rangeli Sialidase Gene Mutants in Yeast
1.1 Construction of Vector Comprising Parent Sialidase Gene (pPICZα-Tr6)
A gene encoding a polypeptide comprising a T. rangeli sialidase (PDB 1WCS; SEQ ID NO. 1) with the following mutations, M96V, A98P, S120Y, G249Y, Q284P and I37L [12] was codon-optimized and synthesized by DNA 2.0 (Menlo Park, Calif., United States of America). The synthetic gene was inserted into PICZαC vector (Invitrogen) between the XbaI and XhoI restriction sites generating a gene (SEQ ID NO: 11) encoding a translational fusion comprising the mutant trans-sialidase (SEQ ID NO: 13) having a N-terminal α-factor signal sequence followed by Kex2 and Ste3 protease recognition sites (SEQ ID NO: 12), and a C-terminal c-myc and 6xHis tag (SEQ ID NO: 14). The encoded mature polypeptide has 662 amino acids, following removal of the signal peptide and protease recognitions sites, and a theoretical molecular mass of 73 kDa. The plasmid vector was propagated in Escherichia coli NM522 grown at 37° C. with shaking in low salt LB (10 g/L tryptone, 5 g/L yeast extract and g/L NaCl) supplemented with 25 μg/mL zeocin.
1.2 Mutation of Parent Gene (Tr6)
The vector, pPICZa-Tr6, was used as template for introduction of additional mutations by PCR using overlapping primers (Table 1) employing standard PCR mutation protocols. PCR products were inserted in pPICZaC between the XhoI and XbaI sites. Constructs were sequenced to confirm the mutations and to assure that no unwanted mutations had been introduced by PCR. The mutants of Tr6 are denoted by the amino acid change compared to the parent (e.g. Tr6 Q123R), except for a multi-mutant denoted Tr13 where amino acids 197-203 were changed from IADMGGR (SEQ ID NO.: 62) to VTNKKKQ (SEQ ID NO.: 58).
TABLE 1
Name Sequence SEQ ID NO.
Tr_fwd GCTCTCGAGAAGAGAGAGGCTGAAG 15
Tr_rev CGCTCTAGAAATGCTGCTGTACCAGC 16
Q123S_F CTATTGGACCTCTCACAGAGATGGATCTGACTGG 17
Q123S_R CATCTCTGTGAGAGGTCCAATAGTTCCTTGTCTTG 18
R125G_F GACCCAGCACGGAGATGGATCTGACTGGGAACC 19
R125G_R CAGATCCATCTCCGTGCTGGGTCCAATAGTTCC 20
G127A_F GCACAGAGATGCTTCTGACTGGGAACCATTGTTG 21
G127A_R CCCAGTCAGAAGCATCTCTGTGCTGGGTCCAATAG 22
E175Q_F ACTTACTAAGCAGTTCGTAGGTGGAGTAGGCG 23
E175Q_R CTCCACCTACGAACTGCTTAGTAAGTATGCCGTCGAACTC 24
V177L_F TAAGGAATTCTTGGGTGGAGTAGGCGCCG 25
V177L_R CCTACTCCACCCAAGAATTCCTTAGTAAGTATGCCGTCG 26
V180A_F CGTAGGTGGAGCTGGCGCCGCCATCGTG 27
V180A_R TGGCGGCGCCAGCTCCACCTACGAATTCCTTAGTAAG 28
G202K_F TGCTGACATGAAGGGAAGAGTATTTACAAAAATTATGTATTCC 29
G202K_R ATACTCTTCCCTTCATGTCAGCAATTTGCACAG 30
N250R_F AGTCGATTACAGAAGACGTCTGGTGTACGAATCC 31
N250R_R CCAGACGTCTTCTGTAATCGACTCGGTTATTAATGATTAGC 32
D363E_F GAGATTAATACTAATGAGGTTTATTCTCTTGTTTTTGTCCG 33
D363E_R CAAGAGAATAAACCTCATTAGTATTAATCTCATGTAGGGAATA 34
TAATTTATC
13MUT_F CCCTGTGCAAGTAACTAATAAGAAGAAGCAAGTATTTACAAA 35
AATTATGTATTCCGAGG
13MUT_R TTGTAAATACTTGCTTCTTCTTATTAGTTACTTGCACAGGGTA 36
TACCAAATTAC
P98A_F GGTTGTCGATGCTACGGTCATAGTAAAGGGAAATAAGTTG 37
P98A_R CTATGACCGTAGCATCGACAACCCTTGAAACTG 38
Y249G_F CCGAGTCGATGGAAATAGACGTCTGGTGTACGAATC 39
Y249G_R GACGTCTATTTCCATCGACTCGGTTATTAATGATTAGC 40
Restriction sites are underlined and mutated nucleotides are given in bold.

1.3 Expression and Purification of Tr6 and Mutants Thereof Expressed in Yeast
Transformation and selection of zeocin resistant P. pastoris X-33 strains expressing the Tr6 and mutants thereof was carried out essential as described in [14]. For low-scale protein synthesis, P. pastoris X-33 harboring pPICZα with mutated genes were grown in 180 mL BMMY (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6), 13.4 g/L yeast nitrogen base, 0.4 mg/L biotin and 0.5° A) methanol) shaking at 30° C. for three days. Protein synthesis was induced every 24 hours by addition of methanol to a final concentration of 0.5%. Cells were removed by centrifugation for 5 min at 3000 g and supernatant was subsequently sterile filtered using a 0.2 μm Minisart filter (Sartorius AG). The supernatant was concentrated about 100-fold using Vivaspin20 concentrators with a 30 kDa cutoff (Sartorius AG). 6xHis-tagged protein was purified from concentrated samples using Ni-sepharose (GE Healthcare) columns in accordance with manufacturer's instructions, desalted with PD-10 columns (GE Healthcare) into a buffer containing 20 mM sodium phosphate (pH 7.4), 100 mM NaCl and 10° A) glycerol and finally concentrated to about 200 μL using Vivaspin0.5 concentrator with 50 kDa cutoff (Sartorius AG).
For large-scale production, P. pastoris X-33 harboring pPICZα with mutated genes were grown in a 5 L Sartorius Biostat Aplus fermentor as described previously [13]. The 6xHis-tagged protein was purified by Cu2+ affinity column chromatography using a CIM® IDA-8f ml Tube Monolithic Column (BIA Separations GmbH, Villach, Austria) as described previously [14]. Protein concentrations were determined using the BCA protein assay (Thermo scientific) with bovine serum albumin as standard.
Example 2 Methods for Measuring the Trans-Sialidase and Sialidase Enzymatic Activity
2.1 Trans-Sialidase Activity Assay
Trans-sialidase activity was assayed as described previously [17] but with the following modifications. Reactions were performed in 50 mM phosphate-citrate (pH 6) at 30° C. using 2.9 μg/mL enzyme. The assay employed 1 mM cGMP-bound sialic acid as donor substrate and MU-Gal as the acceptor. MU-Gal at 0.5 mM was the highest final concentration to be tested due to its low solubility in aqueous solution. A solution of 87 mM MU-Gal in DMSO was diluted to 2 mM in 50 mM phosphate-citrate buffer (pH 6) immediately before preparing the reactions. When assaying crude enzyme preparations from P. pastoris, a background signal was observed, and attributed to cleavage of MU-Gal by endogenous β-galactosidase. This background signal could be removed by washing the column eight times with 440 μL of 5 mM HCl after sample application without desorption of the sialylated product and this was therefore done routinely.
2.2 Sialidase Activity Assays
Sialidase activity was measured in a reaction containing 50 mM phosphate-citrate buffer (pH 7), 0.75 mM pNP-NeuAc and 3 μg/mL sialidase enzyme. Reactions were initiated by addition of substrate and followed spectrophotometrically at 410 nm at 30° C. pH 7 was chosen to enable detection of released pNP in a continuous assay. Reaction rates were normalized as ° A) of the activity of the Tr6 parent enzyme. For measurement of hydrolysis of natural substrates, the assay was performed with either 1 mM 3′-sialyllactose, 1 mM 6′-sialyllactose or 1 mM cGMP-bound sialic acid in 50 mM phosphate-citrate buffer (pH 5) using 1 μg/mL enzyme. Reactions were started by addition of enzyme and stopped by adding H2SO4 to 45 mM final concentration. Quantification of free sialic acid was performed using a 2-thiobarbituric acid assay [15] with the modification that butanol extraction was substituted with mixing with dimethyl sulfoxide (DMSO) [16].
Example 3 a Positively-Charged Motif on the Border of the Binding Cleft of Sialidase Quenches its Hydrolytic Activity
3.1 Selection of Candidate Residues in Tr6 Sialidase for Mutation Screening
The catalytic domains of the sialidases were identified using NCBI Conserved Domain Search [10]. Pymol v1.3 (Schrödinger) was used to identify amino acids within 14 Å of the sialic acid binding site. The T. rangeli sialidase mutant Tr6 (see below) and trans-sialidases from T. cruzi (TcTS) (Uniprot ID Q26966), Trypanosoma congolense (Uniprot ID G0WJG3) and Trypanosoma brucei (Uniprot ID Q57XJ2) were aligned using ClustalW [11] (FIG. 2). Ranking of chemical difference between substituted amino acids in Tr6 vs. TcTS was done based on being first- or second sphere relative to the substrate and based on the polar/nonpolar and small/large distinction; such property-based selection turned out to correlate well with standard substitution matrices (BLOSUM62), i.e. the most unlikely substitutions were considered noteworthy. A 3D-model of one mutant, Tr13, was made using HHpred [12] with automatic template selection (1ms9_A) (FIG. 3). The Tyr120 side chain conformation was manually changed to resemble that of the solved structure (PDB 1WCS). A comparison of the amino acid sequence of T. cruzi trans-sialidase (TcTS) and T. rangeli sialidase (TrSA), in particular those residues lying within 14 Å of the sialic acid binding site, reveal a large number of candidate amino acid residues whose substitution might account for the former's trans-sialidase activity. The candidate amino acids were evaluated in terms of their impact on degree of surface exposure, hydrogen bonding, extent of change in chemical structure/properties, and their distance from the acceptor binding site. On this basis, the single residues or a combination of residues depicted in the primary sequence of the catalytic domain shown in FIG. 2 were selected for mutagenesis.
3.2 Measurement of Net Trans-Sialylated Product Yield by Tr6 Sialidase Mutants
To assess the performance of the mutant enzymes, they were produced by recombinant expression in P. pastoris, transformed with the respective mutant gene, by growth in shake flask cultures. The trans-sialidase activity of the expressed mutant enzymes was measured with a fluorescence-based assay using cGMP as sialic acid donor and methylumbelliferyl-β-D-galactopyranoside (MU-Gal) as acceptor (FIG. 4). As the detected product is a measure of both the trans-sialidase activity (product formation) and hydrolase activity (product degradation) the assay provides an effective screen for mutants having a higher trans-sialidase to hydrolase activity ratio.
3.3 Selected Tr6 Sialidase Mutants Catalyze a Net Increase in Trans-Sialydated Product Yield
All the Tr6 sialidase mutants were shown to be active enzymes (FIG. 4). Reversion of two of the mutations (P98A and Y249G) originally introduced in the Tr6 parent sialidase, led to a reduction in trans-sialidase activity over the Tr6 parent. This confirms that these two residues in Tr6 (P98 and Y249) contribute to trans-sialidase activity of this enzyme. Of all mutants tested, only two mutants, namely Tr13 (comprising a VTNKKKQ (SEQ ID NO.: 58) motif) and Tr6 D363E enhanced trans-sialidase activity relative to Tr6, while all other mutants displayed a decreased trans-sialidase activity. When the Tr6 parent sialidase was mutated by a single amino acid substitution to create a +1 net charge for residues 197-303 (IADMKGR (SEQ ID NO.: 63)) this led to a significant loss of activity, compared to the Tr6 parent. The net +3 charge of the corresponding motif in the Tr13 mutant thus appears to provide a significant and unexpected improvement in trans-sialidase activity relative to Tr6. The parent enzyme Tr6 and the two mutants Tr13 and Tr6 D363E were produced in a 5 L fermentor and purified in amounts sufficient to characterize their catalytic properties. Hydrolase activity was measured using the artificial substrate para-nitrophenyl neuraminic acid (pNP-NeuSAc) as well as the natural substrates 3′-sialyllactose, 6′-sialyllactose and cGMP. The a-2,6-linked sialic acid constitutes about 50% of total sialic acid content in cGMP [21]. Since none of the enzymes exhibited detectable activity on 6′-sialyllactose (data not shown), it was unlikely that a-2,6-linked sialic acid in cGMP can be used as a donor.
Tr13 showed greatly reduced hydrolase activity for all 3 substrates, while D363E only showed reduced hydrolase activity on pNP-Neu5Ac (FIG. 5A).
In the trans-sialidase activity time course assay, the initially measured product formation represents the trans-sialidase reaction rate, while maximum product formation is a measure of both trans-sialidase activity (product formation) and hydrolase activity (product degradation). While, Tr6 and Tr13 appeared to have similar trans-sialidase activity, Tr13 gave twice the trans-sialylated product yield, under these reaction conditions (FIG. 5B), confirming the reduced hydrolytic activity of this Tr13 mutant trans-sialidase. By contrast, the Tr6 D363E had a similarly low product formation profile as Tr6, consistent with their similar hydrolytic activity using cGMP as donor (FIG. 5A).
The Tr13 mutant, comprising a VTNKKKQ (SEQ ID NO.: 58) motif, introduces three lysine residues, where K200 and K201 are partly shielded from the active site (FIG. 3) while K202 points towards the center of the active site. Introduction of the single mutation G202K, which is part of the VTNKKKQ (SEQ ID NO.: 58) motif, does not confer the same properties since this mutant exhibited reduced trans-sialidase activity compared to the parent. The improved maximal yield obtained with the Tr13 mutant suggests that the VTNKKKQ (SEQ ID NO.: 58) motif does not affect acceptor binding affinity but rather uniquely reduces the hydrolytic activity (water kcat and/or KM).
The mechanism by which the VTNKKKQ (SEQ ID NO.: 58) motif exerts its effect is hypothesized to involve impairing water nucleophilicity for attack on sialic acid (by partial disruption of the water network) and by reducing water's retention time in the active site in competition with the acceptor. The effect may be acceptor-dependent, as the total extend of hydrolysis not only depends on the impaired water network but also the KM of the acceptor during trans-sialylation, which affects acceptor vs. water retention time and thus, the competition between hydrolysis and trans-sialylation.
Thus the Tr13 mutant trans-sialidase represents a major advance in engineering a hydrolysis-impaired sialidase enzyme. The insertion of the VTNKKKQ (SEQ ID NO.: 58) motif is sufficient to confer low hydrolase activity, approaching the very low levels of hydrolase activity characteristic of TcTS to a sialidase enzyme. TcTS is distinguished by both an exceptionally low hydrolase activity and the higher affinity for lactose in TcTS compared to Tr6. Within protein engineering at large, viable mutants with improved properties that deviate so substantially from a wild type (by 13 site changes including a 7 amino acid loop structure with a +3 charge difference) are unusual (if not unprecedented).
Example 4 Optimal Reaction Conditions and Specific Activity of Tr13 Mutant Trans-Sialidase Catalyzed Trans-Sialylation
4.1 Optimized Reactions Conditions for Tr13 Mutant Trans-Sialidase
Optimal reaction conditions (pH, temperature, and concentration of donor and acceptor) were determined employing a quadratic central composite design. MODDE Version 7.0.0.1 (Umetrics AB, Umeå, Sweden) was used as a tool to design the experimental frame and to fit and analyze the data by multiple linear regression analysis. The pH regimes 3, 4 and 5, the incubation temperatures 20, 40 and 60° C. and the concentrations of the acceptor lactose of 117, 234 and 351 mM were tested. Reactions used a fixed concentration of cGMP-bound sialic acid of 8 mM in 15 mM phosphate-citrate buffer with specified pH values using 15 μg/mL Tr13. Lactose and cGMP were solubilized in buffer and pre-incubated at specific temperatures, before the reactions were initiated by addition of enzyme. The biocatalysis process was allowed to proceed for 20 min before the reaction was stopped by heating for 10 min at 90° C. Concentration of sialyllactose was determined by HPAEC, as described in 4.2.
The best reaction conditions were identified at 351 mM lactose (highest tested), pH 3 (lowest tested) and at 20° C. (lowest tested) using 8 mM cGMP (data not shown).
4.2 Quantification of Sialyllactose
Sialyllactose was quantified by High-performance anion exchange chromatography (HPAEC-PAD) using a Dionex BioLC system consisting of GS50 gradient pumps, ED50 electrochemical detector, AS50 chromatography compartment coupled to an AS50 autosampler (Dionex Corp., Sunnyvale, Calif.). Samples (10 μL) were injected on a CarboPac™ PA1 (4 mm×250 mm) analytical column (Dionex Corp., Sunnyvale, Calif.) at a flow rate of 1 mL/min. The elution program was based on the method described in [18] except for the modifications in the eluent system given below. The eluent system comprised of deionised water (A), 0.5 M NaOH (B), 1 M NaOAc (C). For the first 3 min an isocratic elution of 80:20 (% A:B) was applied, which was followed by a linear gradient from 80:20 (% A:B) to 60:20:20 (% A:B:C) from 3 to 27 min. Strongly retained anions were removed from the column by isocratic elution at 40:20:40 (% A:B:C) from 27 to 31 min. Subsequently the column was re-equilibrated for 7 min with 80:20 (% A:B).
4.3 Specific Activity of Tr13 Mutant Sialidase Catalyzed Trans-Sialylation
A time study was performed at these conditions and the specific trans-sialidase activity of the enzyme was determined (FIG. 6). The reaction was followed by sampling in a 100 min period and concentration of sialyllactose was determined by LC/MS as described in Example 5. The samples at t=0min were made using heat-inactivated enzyme. Three replicates were made and each data series fitted to a second order polynomial function. The slope to t=0min for each series was used to calculate the specific activity and the standard deviation.
The specific trans-sialidase activity measured as number of sialyl-moieties transferred of Tr13 was 4.4+/−0.7 nmol*min−1 per μg of enzyme on cGMP. It was apparent that a higher product yield could be obtained by extending the reaction time from 20 up to 100 minutes with no detectable product degradation, since no free sialic acid was detected by LC/MS. A maximum yield (not determined) of at least about 2.5 mM 3′-sialyllactose is predicted by extrapolation. In cGMP, sialic acid is bound as α-2,3-sialic acid and α-2,6-bound sialic acid in a ratio of about 1:1 [21] and hence only 4 of the 8 mM cGMP-bound sialic acid was theoretically accessible giving a yield of about 63%.
Example 5 Tr13 Catalyzed Production and Purification of Sialylated Glycans
The ability of Tr13 to trans-sialylate different glycan acceptor molecules (GOS, IMO, lactulose, melibiose, maltose, and fucose) was tested as follows. The reactions were carried out in stirred glass bottles in reaction volumes of 50 mL for melibiose and maltose, 88 mL for fucose, 100 mL for lactulose, and 250 mL for GOS and IMO. The reaction was performed in 15 mM phosphate-citrate buffer (pH 3) with 351 mM sialic acid acceptor (GOS, IMO, lactulose, melibiose, maltose and fucose) and 8 mM cGMP-bound sialic acid at 25° C. using 15 μg/mL enzyme. Prior to the reaction, the substrates were pre-incubated in the buffer. The reaction was carried out for 20 minutes and then stopped by enzyme inactivation by heating at 90° C. for 10 minutes.
5.1 Separation of Trans-Sialylation Products
The reaction mixture was then applied to a HiScale 50/20 (GE Healthcare) anion exchange chromatography column packed with 402 mL of Sepharose Q FF. The separation was done at ambient temperature with an ÄKTA purifier 100 work station equipped with a P-900 pump, UV-900 monitor, and Frac-950 fraction collector, all controlled by UNICORN software (GE Healthcare). The elution was performed at a flow rate of 70 mL/min and monitored at 210 nm. Before injection, the column was equilibrated with 5 column volumes (CV) of water. After injection the column was washed with 3 CV of water which elutes neutral, unreacted acceptor molecules. Negatively charged compounds, i.e. sialylated products and afterwards free sialic acid, and then eluted with 3.5 CV of 40 mM ammonium formate. The column is then flushed clean with 2 CV of 400 mM ammonium formate, and then regenerated with 3 CV of water. Fractions of interest were collected automatically. The products were lyophilized and ammonium formate was removed by repeated solubilization and lyophilization. Product structures were determined by LC/MS, as described below. According to LC/MS analysis, the anion exchange step completely separated the sialylated compounds from both sialic acid, and from the acceptor used in the reaction (see FIG. 7).
5.2 Identification of Trans-Sialylation Products by Capillary Liquid Chromatography/Mass Spectrometry (LC/MS)
LC/MS analyses were performed on an Agilent 1100 LC/Agilent 6340 ion trap MS system was used. Oligosaccharides were separated using a Hypercarb porous graphitic carbon (PGC) column (0.32×150 mm, 5 μm, Thermo scientific) at 30° C. Samples (0.5 μL) were loaded onto the column in 10 mM ammonium bicarbonate. Gradient elution was achieved using a binary solvent system consisting of (A) 10 mM ammonium bicarbonate, adjusted to pH 8.5 with ammonium hydroxide, and (B) 100% acetonitrile at a flow rate of 5 μL/min. The gradient was initially at 98:2 (% A:B) for 5 min, followed by a linear increase to 42:58 (% A:B) at 33 min. This concentration of B was held for 3 min. Subsequently the eluent was returned to 98:2 (% A:B) at 40 min and the system was allowed to equilibrate for 10 min prior to the next injection. All solvents used were of the highest HPLC grade. A PEEK™ Tubing (30 cm×65 μm ID, IDEX Health & Science) was used as transfer line to the electrospray ion source of the MS system. The mass spectrometry was performed in negative ion mode, and was scanned in the range m/z 150-2200 (2 microscans, maximum accumulation time of 150 ms, an ion current count of 200,000) followed by data-dependent MS2 scans of the four most abundant ions in each MS1 scan.
All glycan substrates were shown to the trans-sialylated by Tr13 (FIG. 7). The composition of GOS and IMO sialylation products generated by Tr13 was complex (Table 2). Four and five different sialylated compounds, respectively, were obtained. In the case of GOS, the product of the lowest molecular weight was sialyllactose (m/z of 632), whereas incubation of IMO with cGMP led also to production of sialylated glucose (m/z of 470), since the starting material was abundant in that monomer.
TABLE 2
Products of sialylation of various glycans analysed by LC/MS.
Product Product yield
m/z conc. [wprod/
Acceptor [M − H] Product [g/L] waccep] [mM]
GOS 632 SA-α-Gal-1,4-β-Glc 1.0 0.44% ND
794 SA-α-Gal-1,4-β-Gal-
1,4-β-Glc
956 SA-α-Gal-1,4-β-Gal-
1,4-β-Gal-1,4-β-Glc
1118 SA-α-Gal-1,4-β-Gal-
1,4-β-Gal-1,4-β-Gal-
1,4-β-Glc
Fucose 454 SA-α-Fuc 0.66 1.17% 1.46
Melibiose 632 SA-α-Gal-1,6-α-Glc 0.62 0.52% 0.98
Lactulose 632 SA-α-Gal-1,4-β-Fru 1.2 0.97% 1.84
Maltose 632 SA-α-Glc-1,4-α-Glc 0.66 0.55% 1.04
IMO 470 SA-α-Glc 0.72 0.60% ND
632 SA-α-Glc-α-Glc
794 SA-α-Glc-α-Glc-α-
Glc
956 SA-α-Glc-α-Glc-α-
Glc-α-Glc
1118 SA-α-Glc-α-Glc-α-
Glc-α-Glc-α-Glc
Yields are given as product concentration and as % (w/w) of product produced from acceptor used. ND; the molar concentration of sialylated GOS and IMO could not be calculated since the distribution of different chain lengths was not determined.
Of the compounds produced, sialyllactulose was produced in the highest molar yield. Galactose and the 1,4-β bond between galactose and fructose in lactulose may be a structure that is particularly accessible to the active site cleft of Tr13. Although the acceptors, melibiose (1,6-α-bound galactose) and maltose (1,4-α-bound glucose) are of similar size, their sialylation yield was more than 40% lower.
Example 6 Prebiotic Effect of Various Sialylated Glycans
6.1 Methods for Measuring Bacterial Growth on Sialylated Glycans
Bacterial growth assays on sialylated glycans were performed with the following strains: Bifidobacterium longum longum (Danisco Global Culture Collection DGCC 232), Bifidobacterium longum infantis (DGCC 233), Bifidobacterium longum infantis (DGCC 1497), Bifidobacterium longum infantis (DGCC 2238), Lactobacillus acidophilus (NCFM, ATCC 700396), Bifidobacterium longum (BI-05, DGCC 9917), Bifidobacterium lactis (HN019, DGCC2013), and Clostridium perfringens (ATCC 13124). The tested sialylated substrates were dissolved in water at 10% (w/v) and sterilized by sterile filtration (0.2 μm Minisart, Sartorius AG, Göttingen, Germany). Galactan from potato (Megazyme International LTD, Bray, Co. Wicklow, Ireland), used as prebiotic standard control, was sterilised by UV-radiation for 30 seconds, due to its high viscosity. The bacterial strains were precultured in MRS-medium (de Man, Rogosa and Sharpe medium without glucose) with no additional sugars added, for 24 h at 37° C. under anaerobic conditions, before being diluted with fresh MRS-medium to 1% (v/v). Growth on test substrates was performed by adding 20 μL of 10% test substrates solutions and 180 μL 1% cell suspension in multi-well plates and growth was followed by measurement of optical density at 600 nm (OD600) using Biolink® software (Labsystems) in a Bioscreen® C system (Labsystems, Helsinki, Finland) as described previously [19]. The growth in MRS-medium without addition of carbohydrates was used as control. The experiments were performed in three replicates for each strain and carbohydrate substrate and growth was determined as the area under the growth curve. Data are given as mean values±standard error.
To assess the impact of sialylation it would have been relevant to compare bacterial growth on sialylated and unsialylated acceptor molecules. Since the distribution of sialylated molecules of different chain length in case of GOS and IMO was not quantified, galactan from potato was used as a control, due to its confirmed prebiotic properties [26].
6.2 the Effect of Tr13 Trans-Sialyated Glycans on Bacterial Growth
All the B. longum subsp. infantis strains tested contain a sialidase (a prerequisite for utilising the sialylated compounds) as well as C. perfringens that contains the necessary enzymes for metabolising sialic acid [27]. Although variations in growth were seen on the different substrates, even within species, it was evident that most bacteria to some extent were able to grow on the sialylated compounds.
As shown in Table 3, sialylated melibiose and maltose did not appear to promote growth of the group of probiotic strains. Growth of B. infantis 233, B. infantis 1497, and B. longum 232, was promoted to various degrees by different sialylated compounds, while sialylated fucose promoted growth of all three. However, none of the sialylated compounds promoted growth of B. infantis 2238, B. lactis, L. acidophilus, and B. longum 9917, while L. acidophilus grew well on the prebiotic control substrate galactan. C. perfringens grew significantly better than all the probiotic strains on the tested sialylated compounds. Mixed cultures are more likely to reveal a selective growth effect of sialylated on probiotic bacteria.
TABLE 3
Bacterial growth on sialylated glycans.
Area under the growth curve [OD600 × min]*
Bacterial strain MRS- S-GOS S-fucose S-melibiose S-lactulose S-maltose S-IMO galactan
B. infantis 233  30 ± 14 132 ± 5  71 ± 6 14 ± 6 109 ± 20 30 ± 4  95 ± 23 55 ± 7
B. infantis 2238 294 ± 68 274 ± 18 285 ± 15 302 ± 2  269 ± 20 158 ± 24 269 ± 6  264 ± 7 
B. infantis 1497  31 ± 10  42 ± 13 149 ± 2  ND 34 ± 2 ND 45 ± 1 40 ± 9
B. longum 232  79 ± 20 162 ± 9  192 ± 20 104 ± 17 134 ± 19 122 ± 31 107 ± 19  42 ± 13
B. lactis 139 ± 70 176 ± 18 192 ± 27 ND 122 ± 18 102 ± 8  175 ± 13 143 ± 15
L. acidophilus 180 ± 28 159 ± 4  188 ± 18 192 ± 4  128 ± 2  193 ± 12 217 ± 19 371 ± 10
B. longum 9917 106 ± 30 71 ± 5 114 ± 15 70 ± 8  34 ± 14 101 ± 6  103 ± 9   93 ± 44
C. perfringens 455 ± 32 722 ± 52 811 ± 48 ND 541 ± 17 844 ± 99 1098 ± 61  447 ± 46
*Area under the growth curve of probiotic strains and pathogenic Clostridium perfringens grown on sialylated glycans; galactan was used as a control; growth responses for the substrates are shown for a substrate concentration of 10 g/L for all bacterial strains. Data are given as average values of 3 replicates and shown ± s.d. The growth of B. longum infantis 1497, B. lactis and C. perfringens was not tested on sialylmelibiose, nor was growth of B. longum infantis 1497 on sialylmaltose (ND).
Recently, three fucosylated HMOs were shown to stimulate bifidobacteria, while E. coli and C. perfringens were unable to utilise the HMOs [28], and the organic acid fermentation products inhibited their growth. Furthermore, a primary functionality of sialylated HMOs is rather attributed to their role as decoy molecules and in modulation of the immune system.
REFERENCES
  • 1. Chen X, Varki A (2010) Advances in the biology and chemistry of sialic acids. ACS Chem Biol 5: 163-176.
  • 2. Singh S, Scigelova M, Hallberg M L, Howarth O W, Schenkman S, et al. (2000) Synthesis of sialyloligosaccharides using the trans-sialidase from Trypanosoma cruzi: novel branched and di-sialylated products from digalactoside acceptors. Chem Commun 1013-1014.
  • 3. Pereira M E, Zhang K, Gong Y, Herrera E M, Ming M (1996) Invasive phenotype of Trypanosoma cruzi restricted to a population expressing trans-sialidase. Infect Immun 64: 3884-3892.
  • 4. Paris G, Ratier L, Amaya M F, Nguyen T, Alzari P M, et al. (2005) A Sialidase Mutant Displaying trans-Sialidase Activity. 3 Mol Biol 345: 923-934.
  • 5. Amaya M F, Watts A G, Damager I, Wehenkel A, Nguyen T, et al. (2004) Structural insights into the catalytic mechanism of Trypanosoma cruzi trans-sialidase. Structure 12: 775-784.
  • 6. Damager I, Buchini S, Amaya M F, Buschiazzo A, Alzari P, et al. (2008) Kinetic and mechanistic analysis of Trypanosoma cruzi trans-sialidase reveals a classical ping-pong mechanism with acid/base catalysis. Biochemistry 47: 3507-3512.
  • 7. Buschiazzo A, Amaya M F, Cremona M L, Frasch A C, Alzari P M (2002) The crystal structure and mode of action of trans-sialidase, a key enzyme in Trypanosoma cruzi pathogenesis. Mol Cell 10: 757-768.
  • 8. Buschiazzo A, Tavares G A, Campetella O, Spinelli S, Cremona M L, et al. (2000) Structural basis of sialyltransferase activity in trypanosomal sialidases. EMBO J 19: 16-24.
  • 9. Paris G, Cremona M L, Amaya M F, Buschiazzo A, Giambiagi S, et al. (2001) Probing molecular function of trypanosomal sialidases: single point mutations can change substrate specificity and increase hydrolytic activity. Glycobiology 11: 305-311.
  • 10. Marchler-Bauer A, Lu S, Anderson J B, Chitsaz F, Derbyshire M K, et al. (2011) CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 39: D225-D229.
  • 11. Larkin M A, Blackshields G, Brown N P, Chenna R, McGettigan P A, et al. (2007) ClustalW and ClustalX version 2. Bioinformatics 23: 2947-2948.
  • 12. Söding J, Biegert A, Lupas A N (2005) The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res 33: W244-W248.
  • 13. Michalak M, Thomassen L V, Roytio H, Ouwehand A C, Meyer A S, et al. (2012) Expression and characterization of an endo-1,4-β-galactanase from Emericella nidulans in Pichia pastoris for enzymatic design of potentially prebiotic oligosaccharides from potato galactans. Enzyme Microbl Technol 50: 121-129.
  • 14. Silva I R, Larsen D M, Meyer A S, Mikkelsen J D (2011) Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers. Enzyme Microb Technol 49: 160-166.
  • 15. Denny P C, Denny P A, Allerton S E (1983) Determination of sialic acid using 2-thiobarbituric acid in the absence of hazardous sodium arsenite. Clin Chim Acta 131: 333-336.
  • 16. Skoza L, Mohos S (1976) Stable thiobarbituric acid chromophore with dimethyl sulphoxide. Application to sialic acid assay in analytical de-O-acetylation. Biochem J 159: 457-462.
  • 17. Schrader S, Tiralongo E, Paris G, Yoshino T, Schauer R (2003) A nonradioactive 96-well plate assay for screening of trans-sialidase activity. Anal Biochem 322: 139-147.
  • 18. Kunz C, Rudloff S, Hintelmann A, Pohlentz G, Egge H (1996) High-pH anion-exchange chromatography with pulsed amperometric detection and molar response factors of human milk oligosaccharides. J Chromatogr B 685: 211-221.
  • 19. Mäkeläinen H, Saarinen M, Stowell J, Rautonen N, Ouwehand A C (2010) Xylo-oligosaccharides and lactitol promote the growth of Bifidobacterium lactis and Lactobacillus species in pure cultures. Benefic Microb 1: 139-48.
  • 20. Henikoff S, Henikoff J G (1992) Amino acid substitution matrices from protein blocks. Proc Natl Acad Sci USA 89:10915-10919.
  • 21. Saito T, Itoh T (1992) Variations and distributions of O-glycosidically linked sugar chains in bovine κ-casein. 3 Diary Sci 75: 1768-1774.
  • 22. Scudder P, Doom J P, Chuenkova M, Manger I D, Pereira M E A (1993) Enzymatic Characterization of β-D-Galactoside α2,3-trans-Sialidase from Trypanosoma cruzi. 3 Biol Chem 268: 9886-9891.
  • 23. Ribeirão M, Pereira-Chioccola V L, Eichinger D, Rodrigues M M, Schenkman S (1997) Temperature differences for trans-glycosylation and hydrolysis reaction reveal an acceptor binding site in the catalytic mechanism of Trypanosoma cruzi trans-sialidase. Glycobiology 7: 1237-1246.
  • 24. Schenkman S, Jiang M S, Hart G W, Nussenzweig V (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65: 1117-1125.
  • 25. Schmidt D, Sauerbrei B, Thiem J (2000) Chemoenzymatic Synthesis of Sialyl Oligosaccharides with Sialidases Employing Transglycosylation Methodology. 3 Org Chem 65: 8518-8526.
  • 26. Onumpai C, Kolida S, Bonnin E, Rastall R A (2011) Microbial utilization and selectivity of pectin fractions with various structures. Appl Environ Microbiol 77: 5747-5754.
  • 27. Walters D M, Stirewalt V L, Melville S B (1999) Cloning, Sequence, and Transcriptional Regulation of the Operon Encoding a Putative N-Acetylmannosamine-6-Phosphate Epimerase (nanE) and Sialic Acid Lyase (nanA) in Clostridium perfringens. J Bacteriol 181: 4526-4532.
  • 28. Yu Z T, Chen C, Kling D E, Liu B, McCoy J M, et al. (2013) The Principal Fucosylated Oligosaccharides of Human Milk Exhibit Prebiotic Properties on Cultured Infant Microbiota. Glycobiology 23: 169-177.
  • 29. Gaskell A, Crennell S, Taylor G. (1995) The three domains of a bacterial sialidase: a beta-propeller, an immunoglobulin module and a galactose-binding jelly-roll. Structure 3:1197-1205.
  • 30. Lamsal B P (2012) Production, health aspects and potential food uses of dairy prebiotic galactooligosaccharides. J Sci Food Agric 92: 2020-2028.
  • 31. Smith L E, Uemura, H, Eichinger D. (1996) Isolation and expression of an open reading frame encoding sialidase from Trypansoma rangeli Molecular and Biochemical Parasitology 79: 21-33.
  • 32. Smith L E, Q27064 UniprotKB submitted January 1996 to EMBL/GenBank/DDBJ database.
  • 33. Buschiazzo A, Cremona, M L, Campetella O, Frasch A C C and Sánchez D O. (1993) Sequence of a Trypansoma rangeli gene closely related to Trypansoma cruzi trans-sialidase.

Claims (15)

The invention claimed is:
1. A mutant polypeptide having at least 80% amino acid sequence identity to amino acid residues 28-372 of SEQ ID NO: 2, and wherein:
a) amino acid residues 197 to 203 of SEQ ID NO: 2 comprise substituted amino acid residues resulting in a net positive charge of at least +3 for residues 197 to 203 of SEQ ID NO: 2, and
b) amino acid residues 37, 96, 98, 120, 249, 284 have 100% sequence identity to the corresponding residues in SEQ ID NO: 2,
wherein the polypeptide has trans-sialidase activity.
2. The mutant polypeptide of claim 1, wherein the amino acid sequence of residues 197 to 203 in SEQ ID NO: 2 comprises VTNKKKQ.
3. The mutant polypeptide of claim 1, wherein the polypeptide further comprises a C-terminal linker and carbohydrate-binding domain selected from among:
a) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma rangeli trans-sialidase comprising amino acid residues 373 to 638 of SEQ ID NO: 2;
b) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma cruzi trans-sialidase comprising SEQ ID NO: 8;
c) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma congolense trans-sialidase comprising SEQ ID NO: 9; and
d) C-terminal linker peptide and carbohydrate-binding peptide of Trypanosoma brucei trans-sialidase comprising SEQ ID NO: 10.
4. The mutant polypeptide of claim 1, having an amino acid sequence selected from amino acids residues 28-372; 1-372, 28-638, and 1-638 of SEQ ID NO: 4.
5. The mutant polypeptide of claim 1, wherein the polypeptide is expressed as a fusion protein comprising a homologous or heterologous amino-terminal signal peptide and/or a heterologous peptide having selective substrate binding affinity for purification of the polypeptide.
6. A DNA molecule comprising a positive DNA strand having a nucleic acid sequence encoding the mutant polypeptide of claim 1.
7. A DNA molecule according to claim 6, wherein the nucleotide sequence is selected from among:
a) a nucleotide sequence encoding amino acid residues 28-372 of SEQ ID NO: 4;
b) a nucleotide sequence encoding amino acid residues 1-372 of SEQ ID NO: 4;
c) a nucleotide sequence encoding amino acid residues 28-638 of SEQ ID NO: 4; and
d) a nucleotide sequence encoding amino acid residues 1-638 of SEQ ID NO: 4.
8. A recombinant host cell comprising the DNA molecule of claim 6, wherein said cell is prokaryotic or eukaryotic, and is selected from a bacterial cell, a yeast cell and a fungal cell.
9. A method for producing the mutant polypeptide according to claim 1, comprising:
a) providing a recombinant host cell, wherein the cell comprises a DNA molecule, the DNA molecule comprising a nucleic acid sequence encoding the mutant polypeptide according to claim 1,
b) incubating the host cell in a medium suitable for expression of the mutant polypeptide, and
c) recovering the mutant polypeptide expressed by the host cell in step b) from the medium.
10. An enzyme composition comprising the mutant polypeptide according to claim 1, wherein the composition is formulated as a dry powder, a tablet, or as a liquid.
11. A method for producing sialylated mono- and/or oligo-saccharides, comprising the steps of:
a) providing a sialic acid donor molecule and a molecule comprising an acceptor mono- and/or oligo-saccharide capable of being trans-sialylated;
b) contacting the molecules of (a) with the mutant polypeptide according to claim 1 in an aqueous medium.
12. The method of claim 11, wherein the donor molecule is provided in the form of a dairy side stream, a whey or a casein glycomacropeptide.
13. The method of claim 11, wherein the acceptor glycan is selected from among one or more of galacto-oligosaccharides, fructo-oligosaccharides, malto-oligosaccharides, isomalto-oligosaccharides, lactose, lactosucrose, lactulose, lacto-N-tetraose, lacto-N-neotetraose, lacto-N-fucopentaose I, lacto-N-fucopentaose V, melibiose, maltose, glycosyl sucrose and fucose.
14. The method of claim 13, wherein the acceptor glycan is one or more galacto-oligosaccharide, the method further comprising a preceding step of contacting lactose with a β-trans-galactosidase to produce the one or more galacto-oligosaccharide.
15. A composition comprising sialylated mono- and oligo-saccharides produced by the method according to claim 11, wherein the sialylated oligosaccharides comprise sialylated galacto-oligosaccharides and fructo-oligosaccharides, and wherein said composition is selected from an infant formula, a prebiotic nutritional supplement, and a food supplement.
US14/783,967 2013-04-12 2014-04-11 Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans Active 2034-10-13 US10081801B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP13163551.8 2013-04-12
EP13163551 2013-04-12
EP13163551 2013-04-12
PCT/EP2014/057422 WO2014167112A1 (en) 2013-04-12 2014-04-11 A mutant sialidase having trans-sialidase activity for use in production of sialylated glycans

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/057422 A-371-Of-International WO2014167112A1 (en) 2013-04-12 2014-04-11 A mutant sialidase having trans-sialidase activity for use in production of sialylated glycans

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/139,213 Division US10533164B2 (en) 2013-04-12 2018-09-24 Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans

Publications (2)

Publication Number Publication Date
US20160076013A1 US20160076013A1 (en) 2016-03-17
US10081801B2 true US10081801B2 (en) 2018-09-25

Family

ID=48050610

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/783,967 Active 2034-10-13 US10081801B2 (en) 2013-04-12 2014-04-11 Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans
US16/139,213 Active US10533164B2 (en) 2013-04-12 2018-09-24 Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/139,213 Active US10533164B2 (en) 2013-04-12 2018-09-24 Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans

Country Status (5)

Country Link
US (2) US10081801B2 (en)
EP (1) EP2984104B1 (en)
CN (1) CN105246911B (en)
BR (1) BR112015025951A2 (en)
WO (1) WO2014167112A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180185462A1 (en) * 2015-06-23 2018-07-05 Saint Louis University Peptides for inducing chagas disease responses
US11965188B2 (en) 2018-01-03 2024-04-23 Palleon Pharmaceuticals Inc. Recombinant human sialidases, sialidase fusion proteins, and methods of using the same

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2798373T3 (en) * 2015-06-09 2020-12-11 Glycom As Mutated photobacterium transsialidases
CN107621399B (en) * 2016-07-14 2021-04-27 北京三元食品股份有限公司 Method for detecting oligosaccharide in breast milk
KR101822417B1 (en) * 2017-06-14 2018-01-29 주식회사 청도제약 Means for determination of oxdative stress in human fluid
JP2022538894A (en) * 2019-07-03 2022-09-06 パレオン ファーマシューティカルズ インコーポレイテッド Recombinant human sialidases, sialidase fusion proteins and methods of use thereof
GB201909888D0 (en) 2019-07-10 2019-08-21 Dairy Crest Ltd Methods for manufacturing comestible products
CN111411065B (en) * 2020-03-30 2022-07-05 江南大学 Recombinant bacterium for producing N-acetylneuraminic acid based on artificial double carbon sources
WO2022089707A1 (en) * 2020-10-30 2022-05-05 Mille International Aps A method of producing a human milk oligosaccharide (hmo)
KR20230138473A (en) * 2021-01-06 2023-10-05 팔레온 파마슈티칼스 인크. Sialidase-HER2-antibody fusion proteins and methods of use thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999008511A1 (en) * 1997-08-14 1999-02-25 Neose Technologies, Inc. Methods for producing sialyloligosaccharides in a dairy source

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10258400A1 (en) * 2002-12-13 2004-06-24 N.V. Nutricia New nucleic acid encoding a trans-sialidase, useful for treating or preventing e.g. infections by sialic acid-containing parasites, bacteria or viruses, or tumors
FR2952382B1 (en) * 2009-11-10 2011-11-25 Univ Victor Segalen Bordeaux 2 VACCINES AND DIAGNOSES AGAINST AFRICAN ANIMAL TRYPANOSOMOSES
FR2952649B1 (en) * 2009-11-13 2012-05-04 Univ Victor Segalen Bordeaux 2 THERAPEUTIC AND DIAGNOSTIC APPLICATIONS AGAINST AFRICAN ANIMAL TRYPANOSOMOSES
JP6106160B2 (en) * 2011-05-13 2017-03-29 グリコム アー/エスGlycom A/S Diversification of human milk oligosaccharide (HMO) or its precursor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999008511A1 (en) * 1997-08-14 1999-02-25 Neose Technologies, Inc. Methods for producing sialyloligosaccharides in a dairy source

Non-Patent Citations (41)

* Cited by examiner, † Cited by third party
Title
Amaya MF, Watts AG, Damager I, Wehenkel A, Nguyen T, et al. (2004) "Structural insights into the catalytic mechanism of Trypanosoma cruzi trans-sialidase." Structure 12: 775-784.
Bode, 2012, "Human milk oligosaccharides: Every baby needs a sugar mama," Glycobiology 22(9): 1147-1162.
Buschiazzo A, Amaya MF, Cremona ML, Frasch AC, Alzari PM (2002) "The crystal structure and mode of action of trans-sialidase, a key enzyme in Trypanosoma cruzi pathogenesis." Mol Cell 10: 757-768.
Buschiazzo A, Cremona, ML, Campetella O, Frasch ACC and Sánchez DO. (1993) "Sequence of a Ttypansoma rangeli gene closely related to Trypansoma cruzi trans-sialidase." Molecular and Biochemical Parasitology, 62 (1993) 115-116.
Buschiazzo A, Tavares GA, Campetella O, Spinelli S, Cremona ML, et al. (2000) "Structural basis of sialyltransferase activity in trypanosomal sialidases." EMBO J 19: 16-24.
Buschiazzo et al., 1998, GenBank Acc. No. U83180.1.
Chen X, Varki A (2010) "Advances in the biology and chemistry of sialic acids." ACS Chem Biol 5: 163-176.
Damager I, Buchini S, Amaya MF, Buschiazzo A, Alzari P, et al. (2008) "Kinetic and mechanistic analysis of Trypanosoma cruzi trans-sialidase reveals a classical ping-pong mechanism with acid/base catalysis." Biochemistry 47: 3507-3512.
Denny PC, Denny PA, Allerton SE (1983) "Determination of sialic acid using 2-thiobaibituric acid in the absence of hazardous sodium arsenite." Clin Chian Acta 131: 333-336.
Eiwegger et al., "Human Milk-Derived Oligosaccharides and Plant-Derived Oligosaccharides Stimulate Cytokine Production of Cord Blood T-Cells In Vitro," 2004, Pediatric Rev. 56:536-540.
Gaskell A, Crennell S, Taylor G. (1995) "The three domains of a bacterial sialidase: a beta-propeller, an immunoglobulin module and a galactose-binding jelly-roll." Structure 3:1197-1205.
Henikoff S, Henikoff JG (1992) "Amino acid substitution matrices from protein blocks." Proc Natl Acad Sci USA 89:10915-10919.
Jantscher-Krenn et al., "The human milk oligosaccharide disialyllacto-N-tetraose prevents necrotising enterocolitis in neonatal rats," 2012, Gut 61:1417-1425.
Kunz C, Rudloff S, Hintelmann A, Pohlentz G, Egge H (1996) "High-pH anion-exchange chromatography with pulsed amperometric detection and molar response factors of human milk oligosaccharides." J Chromatogr B 685: 211-221.
Kunz et al., "Oligosaccharides in HumanMilk: Structural, Functional, and Metabolic Aspects," 2000, Ann. Rev. Nutrition 20:699-722.
Lamsal BP (2012) "Production, health aspects and potential food uses of dairy prebiotic galactooligosaccharides." J Sci Food Agric 92: 2020-2028.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) "ClustalW and ClustalX version 2." Bioinformatics 23: 2947-2948.
Mäkeläinen H, Saarinen M, Stowell J, Rautonen N, Ouwehand AC (2010) "Xylo-oligosaccharides and lactitol promote the growth of Bifidobacterium lactis and Lactobacillus species in pure cultures." Benefic Microb 1: 139-48.
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, et al. (2011) "CDD: A Conserved Domain Database for the functional annotation of proteins." Nucleic Acids Res 39: D225-D229.
Michalak M, Thomassen LV, Roytio H, Ouwehand AC, Meyer AS, et al. (2012) "Expression and characterization of an endo-1,4-β-galactanase from Emericella nidulans in Pichia pastoris for enzymatic design of potentially prebiotic oligosaccharides from potato galactans." Enzyme Microbl Technol 50: 121-129.
Milk Facts-Retrived from < http://www.milkfacts.info/Milk%20Composition/Carbohydrate.htm > on Nov. 15, 2017. *
Milk Facts—Retrived from < http://www.milkfacts.info/Milk%20Composition/Carbohydrate.htm > on Nov. 15, 2017. *
Onumpai C, Kolida S, Bonnin E, Rastall RA (2011) "Microbial utilization and selectivity of pectin fractions with various structures." Appl Environ Microbiol 77: 5747-5754.
Paris G, Cremona ML, Amaya MF, Buschiazzo A, Giambiagi S, et al. (2001) "Probing molecular function of trypanosomal sialidases: single point mutations can change substrate specificity and increase hydrolytic activity." Glycobiology 11: 305-311.
Paris G, Railer L, Amaya MF, Nguyen T, Alzari PM, et al. (2005) "A Sialidase Mutant Displaying trans-Sialidase Activity." J Mol Biol 345: 923-934.
Pereira ME, Zhang K, Gong Y, Herrera EM, Ming M (1996) "Invasive phenotype of Trypanosoma cruzi restricted to a population expressing trans-sialidase." Infect Immun 64: 3884-3892.
Ribeirão M, Pereira-Chioccola VL, Eichinger D, Rodrigues MM, Schenkman S (1997) "Temperature differences for trans-glycosylation and hydrolysis reaction reveal an acceptor binding site in the catalytic mechanism of Trypanosoma cruzi trans-sialidase." Glycobiology 7: 1237-1246.
Saito T, Itoh T (1992) "Variations and distributions of O-glycosidically linked sugar chains in bovine κ-casein." J Diary Sci 75: 1768-1774.
Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65: 1117-1125.
Schmidt D, Sauerbrei B, Thiem J (2000) "Chemoenzymatic Synthesis of Slatyl Oligosaccharides with Sialidases Employing Transglycosylation Methodology." J Org Chem 65: 8518-8526.
Schrader S, Tiralongo E, Paris G, Yoshino T, Schauer R (2003) "A nonradioactive 96-well plate assay for screening of trans-sialidase activity." Anal Biochem 322: 139-147.
Scudder P, Doom JP, Chuenkova M, Manger ID, Pereira MEA (1993) "Enzymatic Characterization of β-D-Galactoside α2,3-trans-Sialidase from Trypanosoma cruzi." J Biol Chem 268: 9886-9891.
Silva IR, Larsen DM, Meyer AS, Mikkelsen JD (2011) "Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers." Enzyme Microb Technol 49: 160-166.
Singh S, Scigelova M, Hallberg ML, Howarth OW, Schenkman S, et al. (2000) "Synthesis of sialyloligosaccharides using the trans-sialidase from Trypanosoma cruzi: novel branched and di-sialylated products from digalactoside acceptors." Chem Commun 1013-1014.
Skoza L, Mohos S (1976) "Stable thiobarbituric acid chromophore with dimethyl sulphoxide. Application to sialic acid assay in analytical de-O-acetylation." Biochem J 159: 457-462.
Smith LE, Q27064 UniprotKB submitted Jan. 1996 to EMBL/GenBank/DDBJ database.
Smith LE, Uemura, H, Eichinger D. (1996) "Isolation and expression of an open reading frame encoding sialidase from Tiypansoma rangeli." Molecular and Biochemical Parasitology 25 79: 21-33.
Söding J, Biegert A, Lupas AN (2005) "The HHpred interactive server for protein homology detection and structure prediction" Nucleic Acids Res 33: W244-W248.
Villa-Kamaroff et al., "A bacterial clone synthesizing proinsulin," 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731.
Walters DM, Stirewalt VL, Melville SB (1999) "Cloning, Sequence, and Transcriptional Regulation of the Operon Encoding a Putative N-Acetylmarmosamine-6-Phosphate Epimerase (nanE) and Sialic Acid Lyase (nanA) in Clostridium perfringens." J Bacteriol 181: 4526-4532.
Yu ZT, Chen C, Kling DE, Liu B, McCoy JM, et al. (2013) "The Principal Fucosylated Oligosaccharides of Human Milk Exhibit Prebiotic Properties on Cultured Infant Microbiota." Glycobiology 23: 169-177.

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180185462A1 (en) * 2015-06-23 2018-07-05 Saint Louis University Peptides for inducing chagas disease responses
US10821164B2 (en) * 2015-06-23 2020-11-03 Saint Louis University Peptides for inducing Chagas disease responses
US11965188B2 (en) 2018-01-03 2024-04-23 Palleon Pharmaceuticals Inc. Recombinant human sialidases, sialidase fusion proteins, and methods of using the same

Also Published As

Publication number Publication date
NZ752561A (en) 2021-09-24
NZ713733A (en) 2021-09-24
CN105246911B (en) 2019-10-01
BR112015025951A2 (en) 2017-10-17
US20160076013A1 (en) 2016-03-17
US10533164B2 (en) 2020-01-14
EP2984104A1 (en) 2016-02-17
CN105246911A (en) 2016-01-13
WO2014167112A1 (en) 2014-10-16
EP2984104B1 (en) 2017-11-01
US20190119661A1 (en) 2019-04-25

Similar Documents

Publication Publication Date Title
US10533164B2 (en) Mutant sialidase having trans-sialidase activity for use in production of sialylated glycans
Zeuner et al. Substrate specificity and transfucosylation activity of GH29 α-L-fucosidases for enzymatic production of human milk oligosaccharides
Miwa et al. Cooperation of β-galactosidase and β-N-acetylhexosaminidase from bifidobacteria in assimilation of human milk oligosaccharides with type 2 structure
Rodriguez-Colinas et al. Galacto-oligosaccharide synthesis from lactose solution or skim milk using the β-galactosidase from Bacillus circulans
Urrutia et al. Detailed analysis of galactooligosaccharides synthesis with β-galactosidase from Aspergillus oryzae
Rodríguez-Díaz et al. Utilization of natural fucosylated oligosaccharides by three novel α-l-fucosidases from a probiotic Lactobacillus casei strain
Oliveira et al. Recombinant microbial systems for improved β-galactosidase production and biotechnological applications
Rodriguez-Colinas et al. Production of galacto-oligosaccharides by the β-galactosidase from Kluyveromyces lactis: comparative analysis of permeabilized cells versus soluble enzyme
Ashida et al. Two distinct α-L-fucosidases from Bifidobacterium bifidum are essential for the utilization of fucosylated milk oligosaccharides and glycoconjugates
Díez‐Municio et al. Synthesis of novel bioactive lactose‐derived oligosaccharides by microbial glycoside hydrolases
JP6641179B2 (en) Polypeptide having transgalactosylation activity
Saumonneau et al. Design of an α-L-transfucosidase for the synthesis of fucosylated HMOs
Iqbal et al. Characterization of a heterodimeric GH2 β-galactosidase from Lactobacillus sakei Lb790 and formation of prebiotic galacto-oligosaccharides
CN108699549B (en) Beta-galactosidase enzyme
Zeuner et al. Loop engineering of an α-1, 3/4-l-fucosidase for improved synthesis of human milk oligosaccharides
Jers et al. Rational design of a new Trypanosoma rangeli trans-sialidase for efficient sialylation of glycans
An et al. An alternative approach to synthesizing galactooligosaccharides by cell-surface display of β-galactosidase on Yarrowia lipolytica
Splechtna et al. Process development for the production of prebiotic galacto‐oligosaccharides from lactose using β‐galactosidase from Lactobacillus sp.
Michalak et al. Biocatalytic production of 3′-sialyllactose by use of a modified sialidase with superior trans-sialidase activity
Yañez-Ñeco et al. Synthesis of β (1→ 3) and β (1→ 6) galactooligosaccharides from lactose and whey using a recombinant β-galactosidase from Pantoea anthophila
US20220002685A1 (en) Compositions and methods comprising the use of a bacillus agaradhaerens inulosucrase (inuo)
Kittibunchakul et al. Structural comparison of different galacto-oligosaccharide mixtures formed by β-galactosidases from lactic acid bacteria and bifidobacteria
Delgado-Fernandez et al. Hydrolysis of lactose and transglycosylation of selected sugar alcohols by LacA β-galactosidase from Lactobacillus plantarum WCFS1
Liu et al. Biochemical characterization of a β-N-acetylhexosaminidase from Catenibacterium mitsuokai suitable for the synthesis of lacto-N-triose II
Thøgersen et al. Transglycosylating β‐d‐galactosidase and α‐l‐fucosidase from Paenibacillus sp. 3179 from a hot spring in East Greenland

Legal Events

Date Code Title Description
AS Assignment

Owner name: DANMARKS TEKNISKE UNIVERSITET, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MIKKELSEN, JOERN DALGAARD;JERS, CARSTEN;MICHALAK, MALWINA;AND OTHERS;SIGNING DATES FROM 20151030 TO 20151109;REEL/FRAME:037105/0719

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: MIKKELSEN, JOERN DALGAARD, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:048420/0548

Effective date: 20190125

Owner name: JERS, CARSTEN, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:048420/0548

Effective date: 20190125

Owner name: LARSEN, DORTE MOELLER, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:048420/0548

Effective date: 20190125

Owner name: KEPP, KASPER PLANETA, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:048420/0548

Effective date: 20190125

Owner name: MICHALAK, MALWINA, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:048420/0548

Effective date: 20190125

AS Assignment

Owner name: DANMARKS TEKNISKE UNIVERSITET, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MIKKELSEN, JOERN DALGAARD;MICHALAK, MALWINA;LARSEN, DORTE MOELLER;AND OTHERS;SIGNING DATES FROM 20191121 TO 20200307;REEL/FRAME:056385/0680

AS Assignment

Owner name: DAIRY CREST LTD, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DANMARKS TEKNISKE UNIVERSITET;REEL/FRAME:056454/0423

Effective date: 20210114

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FEPP Fee payment procedure

Free format text: SURCHARGE FOR LATE PAYMENT, SMALL ENTITY (ORIGINAL EVENT CODE: M2554); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4