TW202003546A - Tumor marker, methylation detection reagent, kit and application thereof - Google Patents

Abstract

Disclosed in the present invention are a tumor marker, a methylation detection reagent, a kit and an application thereof. A colorectal cancer specimen may be distinguished from a normal human fecal specimen by means of detecting the methylation level of a TMEM240 gene promoter region. The present invention detects colorectal cancer using a methylation detection reagent containing the gene.

Description

Tumor markers, methylation detection reagents, kits and applications

The invention relates to the field of biotechnology, in particular to tumor markers, methylation detection reagents, kits and their applications.

Colorectal cancer, also known as colorectal cancer, is a common malignant tumor of the digestive tract. Its incidence is increasing year by year in my country. In some coastal areas of my country, such as Shanghai and Guangzhou, the incidence of colorectal cancer has ranked second, second only to lung cancer. It is currently believed that the formation of intestinal cancer is the result of the accumulation of genetic defects and epigenetic defects. The early onset of colorectal cancer is hidden, often without obvious symptoms, and late symptoms of blood in the stool, abdominal pain, and diarrhea may occur. And when the symptoms appear, they are often in the late stage, which brings great pain and expensive treatment to the patients. Therefore, early detection, early diagnosis, and early treatment are an important measure to reduce the incidence and mortality of colorectal cancer.

Screening can detect bowel cancer and precancerous lesions early, and remove the lesions, thus preventing the occurrence of bowel cancer. The current screening methods for colorectal cancer are mainly occult blood test and enteroscopy. The occult blood test has the problems of being easily affected by food or having a low detection rate of adenoma. Although colonoscopy is the gold standard for the diagnosis of bowel cancer, the population compliance is not high when used as a screening method. Therefore, a screening method for bowel cancer with high accuracy and high compliance is urgently needed.

Fecal genetic testing, as a new method of bowel cancer screening, is now gaining more and more attention. This method (Cologuard®) was incorporated into the US bowel cancer screening guidelines in 2016. This method has the characteristics of convenience, non-invasive, high detection rate of intestinal cancer and precancerous adenoma. To make a high-performance stool gene detection kit for bowel cancer detection, two main obstacles need to be overcome: the extraction of stool DNA and the selection of markers. On the one hand, the components in the feces are complex, there are many inhibitors for downstream reactions, and there are many bacterial DNAs. To extract human target genes from such a mixture, a set of highly sensitive gene extraction and purification methods are required; on the other hand, There are many markers related to intestinal cancer, especially DNA methylation markers, because studies have shown that DNA methylation is an early event of tumor formation. However, many methylation markers perform well at the cellular and tissue levels. When used as a screening medium for feces and blood, their sensitivity and specificity for bowel cancer are reduced. For example, the vimentin gene, which is found in tissues The sensitivity is 83%, and it drops to 46% in stool samples. Similar genes include SFRP1 and SFRP2. Such markers cannot meet the needs of clinical testing for bowel cancer. Therefore, the selection of markers with high detection sensitivity and specificity for bowel cancer in stool is the key to the detection of bowel cancer stool genes, and such markers are expected to be truly used for clinical detection of bowel cancer.

In view of this, the present invention provides a tumor marker, capture sequence, primer pair, probe, methylation detection reagent, kit and application thereof. The tumor marker is very sensitive to bowel cancer in feces.

Another object of the present invention is to provide a marker, capture sequence, primer pair, probe, methylation detection reagent, kit and method for noninvasive detection of tumor.

In order to achieve the above object of the invention, the present invention provides the following technical solutions:

The invention provides the application of TMEM240 gene in preparing tumor markers.

In some specific embodiments of the invention, the sequence of the TMEM240 gene has at least 97.8% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the invention, the sequence of the TMEM240 gene has at least 98.9% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has at least 99.9% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the invention, the tumor is a colorectal tumor.

In some specific embodiments of the invention, the tumor is colorectal cancer or adenoma. In some specific embodiments of the present invention, the sample to be tested is tissue, body fluid, or fecal matter.

In some specific embodiments of the invention, the tissue is intestinal tissue.

In some specific embodiments of the invention, the body fluid includes, but is not limited to, blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid, or aqueous humor.

In some specific embodiments of the invention, the excrement is sputum, urine, saliva, or feces.

The invention also provides the application of the TMEM240 gene methylation detection reagent in preparing tumor detection reagents or kits.

The methylation detection reagent of the TMEM240 gene may be a methylation detection reagent in the prior art. In the prior art, there have been various methods to detect the methylation of the target gene, such as methylation specific PCR (MSP) , Methylation-specific quantitative PCR (qMSP), PCR of methylated DNA-specific binding proteins, quantitative PCR and DNA chips, methylation-sensitive restriction enzymes, bisulfite sequencing or pyrophosphate sequencing and many more. Each detection method has its corresponding reagent, and these reagents can be used to detect the methylation of the TMEM240 gene using the present invention.

The present invention also provides a capture sequence having any one of the following nucleotide sequences:

I. having the nucleotide sequence shown in SEQ ID NO: 1;

II. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in SEQ ID NO: 1 or having a nucleotide sequence shown in SEQ ID NO: 1 CpG islands obtain similar nucleotide sequences;

III. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1 or having the core shown in SEQ ID NO: 1 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

IV. The complementary sequence of the sequence shown as I, II or III.

The present invention also provides a primer pair, the upstream primer has any one of the following nucleotide sequences:

V. Has the nucleotide sequence shown in SEQ ID NO: 2;

VI. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 2;

VII. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 2 or having the core shown in SEQ ID NO: 2 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

VIII. The complementary sequence of the sequence shown as V, VI or VII;

The downstream primer has any of the nucleotide sequences shown below:

IX. having the nucleotide sequence shown in SEQ ID NO: 3;

X. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 3;

XI, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or having a nucleus shown in SEQ ID NO: 3 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

Ⅻ Complementary sequences as shown in IX, X or XI.

The present invention also provides a probe having any one of the following nucleotide sequences:

XIII, having the nucleotide sequence shown in SEQ ID NO: 4;

XIV, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 4;

XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or having the core shown in SEQ ID NO: 4 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

XVI, the complement of the sequence shown as XIII, XIV or XV.

The invention also provides a methylation detection reagent for the TMEM240 gene, including a capture sequence, primers and/or probes for the TMEM240 gene.

In some specific embodiments of the present invention, the capture sequences, primers and/or probes obtained for the CpG island of the TMEM240 gene are included.

In some specific embodiments of the present invention, the primers and/or probes detect methylation of the TMEM240 gene by quantitative methylation-specific PCR (Qmsp).

In some specific embodiments of the present invention, the methylation detection reagent provided by the present invention detects the methylation level of the gene body, the intergenic region or the promoter region and the region near the promoter region of the TMEM240 gene.

The methylation present in tumor tissues is considered to be a potential clinically valuable DNA modification. Methylation exists in the gene body, intergenic regions, promoters or nearby regions, and methylation in these regions may be associated with tumors. At present, it has been confirmed in a variety of tumors that abnormal methylation of CpG islands in the tumor suppressor gene promoter or its vicinity causes transcription inactivation.

In some specific embodiments of the present invention, the methylation detection reagent provided by the present invention includes a capture sequence, primers, and/or probes obtained for CpG islands in the promoter region of the TMEM240 gene or in a region near the promoter region.

In some specific embodiments of the present invention, the capture sequence in the methylation detection reagent provided by the present invention has any one of the following nucleotide sequences:

I. having the nucleotide sequence shown in SEQ ID NO: 1;

II. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in SEQ ID NO: 1 or having a nucleotide sequence shown in SEQ ID NO: 1 CpG islands obtain similar nucleotide sequences;

III. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1 or having the core shown in SEQ ID NO: 1 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

IV. The complementary sequence of the sequence shown as I, II or III.

In some specific embodiments of the present invention, in the methylation detection reagent provided by the present invention, the upstream primer in the primer has any one of the following nucleotide sequences:

V. Has the nucleotide sequence shown in SEQ ID NO: 2;

VI. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 2;

VII. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 2 or having the core shown in SEQ ID NO: 2 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

VIII. The complementary sequence of the sequence shown as V, VI or VII.

In some specific embodiments of the present invention, in the methylation detection reagent provided by the present invention, the downstream primer in the primer has any one of the following nucleotide sequences:

IX. having the nucleotide sequence shown in SEQ ID NO: 3;

X. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 3;

XI, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or having a nucleus shown in SEQ ID NO: 3 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

Ⅻ Complementary sequences as shown in IX, X or XI.

In some specific embodiments of the present invention, the probe in the methylation detection reagent provided by the present invention has any one of the following nucleotide sequences:

XIII, having the nucleotide sequence shown in SEQ ID NO: 4;

XIV, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 4;

XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or having the core shown in SEQ ID NO: 4 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function;

XVI, the complement of the sequence shown as XIII, XIV or XV.

The invention also provides a kit for detecting tumors, which includes the capture sequence, primer pair, probe or methylation detection reagent.

In some specific embodiments of the present invention, the kit provided by the present invention includes: one or more containers divided into receiving reagents therein.

In some specific embodiments of the present invention, the kit provided by the present invention includes: a first container containing a capture sequence; a second container containing a pair of primers for amplification; and a third container containing a probe.

In some specific embodiments of the present invention, the kit provided by the present invention further includes common reagents in the kit, such as a common conversion agent in qMSP, which is used to convert unmethylated cytosine bases to uracil, and The methylated cytosine base remains unchanged. The conversion agent includes but is not limited to bisulfite, bisulfite or hydrazine salt and the like. Another example is DNA polymerases, dNTPs, Mg²⁺ ions and buffers commonly used in the amplification of TMEM240 genes.

The invention also provides the application of the above-mentioned capture sequence, primer pair, probe, methylation detection reagent and kit in detecting tumor.

The invention also provides a tumor detection method, which distinguishes normal samples and tumor samples by detecting the methylation level of the TMEM240 gene.

In some specific embodiments of the present invention, it includes the following steps:

(1) Test the methylation level of TMEM240 gene in the subjects;

(2) Compare the methylation level of the subject's TMEM240 gene with that of the normal control sample;

(3) According to the increase in the methylation level of the TMEM240 gene of the subject compared with that of the normal control sample, it indicates that the subject has or is at risk of developing a tumor to distinguish the normal sample And tumor samples.

In some specific embodiments of the present invention, the present invention detects the methylation level of the gene body, intergenic region or promoter region of the TMEM240 gene and the region near the promoter region.

In some specific embodiments of the present invention, the present invention distinguishes between normal samples and tumor samples by detecting the methylation level of the TMEM240 gene promoter region and the region near the promoter region.

In some specific embodiments of the present invention, the methylation level is by methylation-specific PCR, or methylation-specific quantitative PCR (qMSP), or PCR, quantitative PCR of methylated DNA-specific binding proteins , And DNA chips, or methylation-sensitive restriction enzymes, or bisulfite sequencing, or pyrosequencing.

In some specific embodiments of the invention, the methylation level is detected by methylation specific quantitative PCR (qMSP).

In some specific embodiments of the invention, the methylation level is detected using the capture sequence, primer pair, probe, methylation detection reagent or the kit.

In some specific embodiments of the present invention, in step (1), detecting the methylation level of the TMEM240 gene in the subject comprises the following steps:

Using magnetic bead capture method to extract the DNA of the sample to be tested;

The DNA of the sample to be tested is transformed with bisulfite, bisulfite or hydrazine;

Methylation specific quantitative PCR (qMSP) detection.

In some specific embodiments of the present invention, in step a), extracting the DNA of the sample to be tested using the magnetic bead capture method includes the following steps;

Take the sample to be tested and mix it in the protective solution, grind, centrifuge, and take the supernatant;

Centrifuge the supernatant, take the supernatant, add lysate and magnetic beads with specific complementary oligonucleotide capture sequences to the supernatant and incubate;

Discard part of the supernatant, wash the magnetic beads and transfer to a clean centrifuge tube, add the washing solution, incubate at room temperature 100~2000 rpm for 0.5~5 min, place it on a magnetic stand to suck up the supernatant, repeat 3 times;

The target gene DNA is eluted with buffer.

In some specific embodiments of the present invention, the detection standard is: judging the tumor specimen and the normal specimen according to the cut-off value, the cut-off value of the Ct value in the stool sample is 32-42, preferably, the cut-off value of the Ct value in the stool sample Is 35, and the Ct value of the stool sample is less than the cutoff value of the Ct value is determined as a tumor specimen, and the Ct value of the stool sample is greater than or equal to the cutoff value of the Ct value is determined as a normal specimen. The threshold can be adjusted according to the actual situation.

The invention also provides a tumor detection system. The system includes the following components: a methylation detection component of the TMEM240 gene; a data processing component; and a result output component.

In some specific embodiments of the present invention, the methylation detection component contains one or more of a fluorescent quantitative PCR instrument, a PCR instrument, and a sequencer; in some specific embodiments of the present invention, the methyl group The chemical detection component also contains the capture sequence, primer pair, probe, methylation detection reagent or kit.

In some specific embodiments of the present invention, the data processing component is configured to a. receive test data of the test sample and the normal control sample; b. store test data of the test sample and the normal control sample; c. ratio Test data of the same type of test samples and normal control samples; d. According to the comparison results, respond to the probability or possibility of the test subject suffering from a tumor.

In some specific embodiments of the present invention, the result output means is used to output the probability or possibility of the test subject suffering from a tumor.

In some specific embodiments of the present invention, the judgment criterion of the data processing component is:

Judging the tumor specimen and the normal specimen according to the cutoff value, the cutoff value of the Ct value in the stool specimen is 32-42, preferably, the cutoff value of the Ct value in the stool specimen is 35, and the Ct value of the stool specimen is less than the Ct The cut-off value of the value is determined to be a tumor specimen, and the cut-off value of the stool sample is greater than or equal to the cut-off value of the Ct value to be determined as a normal specimen. The threshold can be adjusted according to the actual situation.

In some specific embodiments of the invention, the tumor of the invention is a colorectal tumor.

In some specific embodiments of the invention, the tumor of the invention is colorectal cancer or adenoma.

In some specific embodiments of the present invention, the sample to be tested or the sample type provided by the present invention is tissue, body fluid, or fecal matter.

In some specific embodiments of the invention, the tissue is intestinal tissue.

In some specific embodiments of the invention, the body fluid includes blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid, or aqueous humor.

In some specific embodiments of the invention, the excrement is sputum, urine, saliva, or feces.

The present invention has found through research that by detecting the methylation level of the promoter region of the TMEM240 gene, a colorectal cancer specimen can be well distinguished from the stool specimen of a normal person. The invention uses the methylation detection reagent containing the gene to detect colorectal cancer, and has a very high sensitivity and specificity for detecting intestinal cancer. The present invention verifies for the first time that the methylation level of this gene is associated with the onset of colorectal cancer.

Compared with the existing markers for detecting bowel cancer, the markers and technical solutions provided by the present invention can detect colorectal cancer with high sensitivity and specificity, specifically the following points:

1. In one of the above technical solutions, the methylation detection reagent containing the TMEM240 gene provided by the present invention can detect 83% of colorectal cancer when the specificity is 94% in the stool sample, and the stool can be easily done To test samples, make a reliable diagnosis of colorectal cancer. Stool samples are very easy to obtain, sampling is non-invasive and simple, and does not cause any pain or inconvenience to patients.

2. In one of the above technical solutions, the methylation detection reagent and extraction detection method containing the TMEM240 gene can be very convenient and accurate to determine colorectal cancer and normal people. The methylation detection reagent of this gene is expected to be used in stool Genetic testing kit, and serve for clinical testing of intestinal cancer.

3. The reagents/kits in one of the above technical solutions are used to detect and diagnose cancer through methylation level. More and more studies have confirmed that methylation change is an early event in tumorigenesis, detecting abnormal methylation It is easier to find early lesions.

The invention discloses a tumor marker, a methylation detection reagent, a kit and applications thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve. In particular, it should be noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and it is obvious that relevant persons can modify or appropriately modify and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention. Apply the technology of the present invention.

The tumor markers, methylation reagents, kits and raw materials, auxiliary materials and reagents used in the application provided by the present invention can be purchased or synthesized from the market.

As long as there are CpG sites that can detect differential methylation, any nucleic acid fragment of the TMEM240 gene can be used in the present invention. CpG islands are CpG-rich regions in nucleic acid sequences. The CpG island starts upstream of the promoter and extends downstream to the transcription region. Methylation of CpG islands on the promoter usually suppresses gene expression. The CpG island in the promoter is part of methylation, and there is a conservative DNA methylation target for CpG open sea in the genome. Recent research has revealed the synergistic effect of methylation in non-promoter regions (such as genomic bodies and UTR) on gene expression, and genomic methylation may be a potential therapeutic target in cancer.

Generally speaking, CpG islands refer to some regions rich in CpG dinucleotides, usually located in the promoter and its nearby regions. The CpG islands in the present invention not only refer to the promoter and its nearby regions rich in CpG dinuclear Glycosides also include hybrid methylated CpG sites, or isolated CpG sites.

Generally, the CpG-containing nucleic acid is DNA. However, the present invention is applicable, for example, to a sample containing DNA, or DNA and RNA containing mRNA, wherein the DNA or RNA may be single-stranded or double-stranded, or a DNA-RNA hybrid strand may also be included in the sample.

The "primer" or "probe" in the present invention refers to an oligonucleotide that includes a region complementary to a sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (eg, target gene). In some embodiments, the primer or probe comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 with the target molecule A contiguous or non-contiguous block nucleotide sequence complementary region. When the primer or probe contains a region that is complementary to at least x consecutive nucleotides of the target molecule, the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

The "detection" and the diagnosis in the present invention include, in addition to the early diagnosis of colorectal tumors, the diagnosis of mid- and late-stage colorectal tumors, and also include colorectal tumor screening, risk assessment, prognosis, disease identification, diagnosis of disease stage and The choice of therapeutic target.

The application of colorectal tumor marker TMEM240 makes early diagnosis of colorectal tumor possible. When it is determined that the genes methylated in cancer cells are methylated in clinically or morphologically normal cells, this indicates that the normal cells are developing to cancer. In this way, colorectal cancer can be diagnosed early by methylation of the colorectal tumor-specific gene TMEM240 in cells of normal appearance.

Among them, early diagnosis refers to the possibility of finding cancer before metastasis, preferably before morphological changes of tissues or cells can be observed.

In addition to the early diagnosis of colorectal tumors, the reagents/kits of the present invention are promising for colorectal tumor screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stage, and selection of therapeutic targets.

As an alternative embodiment of the disease stage, the progression of the colorectal tumor at different stages or stages can be diagnosed by measuring the degree of methylation of TMEM240 obtained from the sample. By comparing the degree of TMEM240 gene methylation of nucleic acids isolated from samples at each stage of colorectal cancer with the TMEM240 gene A of one or more nucleic acids isolated from samples in intestinal tissue without cell proliferation abnormalities The degree of basalization can detect the specific stage of colorectal tumor in the sample.

The present invention will be further described in combination with the following embodiments:

Examples 1

36 fecal specimens (18 cases of colorectal cancer, 18 cases of normal, all confirmed by enteroscopy or pathology) were selected, ground and centrifuged, 100 μl capture magnetic beads (containing the capture sequence of TMEM240 gene) were added, and the technique was described above After the protocol operation, 15 µl of DNA converted by Bisulfite was finally obtained. Then perform qMSP to detect the methylation level of TMEM240.

qMSP reaction system: 25 µl (nuclease-free water 8.2 µl, 5×Colorless GoTaq Flexi Buffer 5 µl, MgCl₂ (25 mM) 5 µl, dNTPs (10 mM) 1 µl, GoTaq Hot Start polymerase 0.5 µl, Forward primer (100 µM) 0.125 µl, Reverse primer (100 µM) 0.125 µl, Probe (100 µM) 0.05 µl, DNA 5 µl). Reaction procedure: 95 ℃ 4 min, (95 ℃ 20 s, 56 ℃ 30 s, 72 ℃ 30 s) × 45 Cycles, 37 ℃ 30 s.

Finally, the copy number of the gene in the specimen is calculated according to the standard curve.

The methylation site of TMEM240 gene is relatively constant, mainly located on the promoter region or nearby CpG island. A set of capture sequences, primers and probes were designed for these regions and used in TMEM240 gene methylation detection reagents.

The capture sequences and primer probes contained in the reagent are as follows:

The capture sequence of TMEM240 (SEQ ID NO: 1): 5’- GGTTGTGGACTCACCGGCCACAGTTGCAGTGGCAGACGC -3’

QMSP primer probe of TMEM240: Forward Primer (SEQ ID NO: 2): 5’- CGCGTGTTTGATGGATATGAAC -3’ Reverse Primer (SEQ ID NO: 3): 5’- CGACCACAATTACAATAACAAACG -3’ Probe (SEQ ID NO: 4): 5’- CGTATTTGCGGGGCGAGGATC -3’

In the stool experiment, the ROC curve of TMEM240 gene for colorectal cancer is shown in Figure 1:

For colorectal cancer, the detection sensitivity of the TMEM240 gene is 83% (15/18), the specificity is 94% (17/18), and the area under the ROC curve is 0.949 (95% CI: 0.883–1, p <0.0001)

In the fecal experiment, the amplification curve of TMEM240 gene standard curve is shown in Figure 2:

The amplification efficiency of the standard music is 101%, and the linearity R² = 0.999.

表1 註：「無擴增」表示無擴增曲線，無Ct數據，屬於大於界值的範圍。 [ Table 1] Raw data of fecal experiment

Table 1 Note: "No amplification" means that there is no amplification curve and no Ct data, which belongs to a range greater than the limit.

Comparative example 1

At present, there are studies using the QIAamp DNA Stool Mini Kit (QIAGEN) to extract DNA from stool samples, and then use methylation-specific PCR (MSP) or quantitative methylation-specific PCR (qMSP) to qualitatively or quantitatively detect the signs in the specimens Level of things. Among them, the detection of colorectal cancer by MSP requires electrophoresis, which is more inconvenient and has a risk of product contamination; the DNA in feces is extracted by QIAamp DNA Stool Mini Kit as the total DNA of humans and bacteria. Real human tumor DNA is very rare , Not conducive to subsequent PCR detection.

Comparative example 2

Studies have shown that SFRP1 gene methylation is related to intestinal cancer, and detecting the degree of methylation of this gene in feces can detect colorectal cancer. In 53 stool samples (29 cases of bowel cancer, 7 cases of adenoma, and 17 cases of normal), 89% of colorectal tumors were detected when the specificity was 86%. (Zhang W, Bauer M, Croner RS, Pelz JO, Lodygin D, Hermeking H, Sturzl M, Hohenberger W, Matzel KE. DNA stool test for colorectal cancer: Hypermethylation of the secreted frizzled-related protein-1 gene. DISEASES OF THE COLON & RECTUM 2007; 50(10): 1618-26; discussion 1626-7.)

The methylation level of the SFRP1 gene was also detected in 19 pairs of tissues and 36 stool samples. The target gene extraction method in stool samples was the same as in Example 1. In the 19 pairs of tissue experiments, according to the protocol, QIAamp DNA Kit (QIAGEN) was used Extract tissue DNA, and then transform DNA with EZ DNA Methylation Kit (Zymo Research).

Then perform qMSP to detect the methylation level of SFRP1.

The qMSP reaction system and reaction steps are the same as the stool experiment of Example 1. Finally, calculate the methylation value of the gene in the specimen according to the standard curve: (Target/ACTB)*100. The qMSP primer probe used was the same as in Example 1.

The ROC curve of SFRP1 gene detection for colorectal cancer is shown in Figure 4:

For colorectal cancer tissues, the detection sensitivity of the SFRP1 gene was 89%, the specificity was 95%, and the area under the ROC curve was 0.972 (95% CI: 0.929–1, p <0.001).

In 36 fecal experiments, the ROC curve of SFRP1 gene detection of colorectal cancer is shown in Figure 5:

For colorectal cancer, the detection sensitivity of the SFRP1 gene was 67%, the specificity was 94%, and the area under the ROC curve was 0.892 (95% CI: 0.790–0.994, p <0.0001).

This shows that the SFRP1 gene has a high detection sensitivity and specificity for colorectal cancer tissues, and its sensitivity in fecal specimens is greatly reduced.

The above is only the preferred embodiment of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principles of the present invention, several improvements and retouches can be made. These improvements and retouches also It should be regarded as the protection scope of the present invention.

no.

In order to more clearly explain the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required in the embodiments or the description of the prior art.

Figure 1 shows the ROC curve of colorectal cancer detected by TMEM240 gene in the fecal experiment of Example 1;

Figure 2 shows the amplification curve of TMEM240 gene standard curve in the stool experiment of Example 1;

Figure 3 shows the ROC curve of SFRP1 gene detection of colorectal cancer in 19 pairs of tissue experiments of Comparative Example 2;

Figure 4 shows the ROC curve of colorectal cancer detected by SFRP1 gene in 36 fecal experiments of Comparative Example 2.

Claims (14)

An application of TMEM240 gene in preparing tumor markers; Preferably, the sequence of the TMEM240 gene has at least 97.8%, at least 98.9%, at least 99.9% or 100% identity with the sequence shown in Genebank Accession No. NC_000001.11; Preferably, the tumor is a colorectal tumor; Preferably, the tumor is colorectal cancer or adenoma; Preferably, the test sample targeted by the marker is tissue, body fluid or excrement; Preferably, the tissue is intestinal tissue; Preferably, the body fluid is blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; Preferably, the excrement is sputum, saliva, urine or feces. Application of a TMEM240 gene methylation detection reagent in preparing tumor detection reagents or kits; Preferably, the sequence of the TMEM240 gene has at least 97.8%, at least 98.9%, at least 99.9% or 100% identity with the sequence shown in Genebank Accession No. NC_000001.11; Preferably, the tumor is a colorectal tumor; Preferably, the tumor is colorectal cancer or adenoma; Preferably, the test sample targeted by the detection reagent is tissue, body fluid or excrement; Preferably, the tissue is intestinal tissue; Preferably, the body fluid is blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; Preferably, the excrement is sputum, urine, saliva or feces. A capture sequence with any of the nucleotide sequences shown below: I. having the nucleotide sequence shown in SEQ ID NO: 1; II. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in SEQ ID NO: 1 or having a nucleotide sequence shown in SEQ ID NO: 1 CpG islands obtain similar nucleotide sequences; III. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1 or having the core shown in SEQ ID NO: 1 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; IV. The complementary sequence of the sequence shown as I, II or III. A pair of primers, where, The upstream primer has any of the following nucleotide sequences: V. Has the nucleotide sequence shown in SEQ ID NO: 2; VI. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 2; VII. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 2 or having the core shown in SEQ ID NO: 2 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; VIII. The complementary sequence of the sequence shown as V, VI or VII; The downstream primer has any of the nucleotide sequences shown below: IX. having the nucleotide sequence shown in SEQ ID NO: 3; X. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 3; XI, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or having a nucleus shown in SEQ ID NO: 3 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; Ⅻ Complementary sequences as shown in IX, X or XI. A probe with any of the following nucleotide sequences: XIII, having the nucleotide sequence shown in SEQ ID NO: 4; XIV, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 4; XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or having the core shown in SEQ ID NO: 4 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; XVI, the complement of the sequence shown as XIII, XIV or XV. A TMEM240 gene methylation detection reagent, including a capture sequence, primers and/or probes for TMEM240 gene methylation detection; Preferably, the capture sequence, primers and/or probes obtained for the CpG island of the TMEM240 gene are included; Preferably, it includes capture sequences, primers and/or probes obtained for CpG islands of the gene body, intergenic region, promoter region or the region near the promoter region of the TMEM240 gene; Preferably, the capture sequence has any one of the following nucleotide sequences: I. having the nucleotide sequence shown in SEQ ID NO: 1; II. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in SEQ ID NO: 1 or having a nucleotide sequence shown in SEQ ID NO: 1 CpG islands obtain similar nucleotide sequences; III. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 1 or having the core shown in SEQ ID NO: 1 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; IV. The complementary sequence of the sequence shown as I, II or III; Preferably, the upstream primer in the primer has any one of the following nucleotide sequences: V. Has the nucleotide sequence shown in SEQ ID NO: 2; VI. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 2; VII. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 2 or having the core shown in SEQ ID NO: 2 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; VIII. The complementary sequence of the sequence shown as V, VI or VII; The downstream primer in this primer has any one of the following nucleotide sequences: IX. having the nucleotide sequence shown in SEQ ID NO: 3; X. A nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 3; XI, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or having a nucleus shown in SEQ ID NO: 3 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; Ⅻ, the complementary sequence of the sequence shown as IX, X or XI; Preferably, the probe has any one of the following nucleotide sequences: XIII, having the nucleotide sequence shown in SEQ ID NO: 4; XIV, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases with the nucleotide sequence shown in SEQ ID NO: 4; XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or having the core shown in SEQ ID NO: 4 The nucleotide sequence obtained by CpG island of nucleotide sequence has similar function; XVI, the complement of the sequence shown as XIII, XIV or XV. A kit comprising the capture sequence described in claim 3, the primer pair described in claim 4, the probe described in claim 5, or the methylation detection reagent described in claim 6; Preferably, the kit includes: a first container, which contains a capture sequence; a second container, which contains a primer pair for amplification; and a third container, which contains a probe. A capture sequence according to claim 3, a primer pair according to claim 4, a probe according to claim 5 or a methylation detection reagent according to claim 6, in the preparation of a kit for detecting tumors application; Preferably, the tumor is intestinal cancer; Preferably, the tumor is colorectal cancer or adenoma; Preferably, the sample to be tested for detection is body fluid or excrement; Preferably, the tissue is intestinal tissue; Preferably, the body fluid is blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; Preferably, the excrement is sputum, saliva, urine or feces. A capture sequence according to claim 3, a primer pair according to claim 4, a probe according to claim 5, a methylation detection reagent according to claim 6, or a kit according to claim 7 Application in tumor detection; Preferably, the tumor is a colorectal tumor; Preferably, the tumor is colorectal cancer or adenoma; Preferably, the sample targeted for detection is tissue, body fluid or excrement; Preferably, the tissue is intestinal tissue; Preferably, the body fluid is blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; Preferably, the excrement is sputum, urine, saliva or feces. A tumor detection method, including, (1) Test the methylation level of TMEM240 gene in the subjects; (2) Compare the methylation level of the subject's TMEM240 gene with that of the normal control sample; (3) According to the increase in the methylation level of the TMEM240 gene of the subject compared with the normal control sample, it indicates that the subject has or is at risk of developing a tumor to distinguish the normal sample from the tumor sample; Preferably, by detecting the methylation level of the gene body, intergenic region or promoter region of the TMEM240 gene and the region near the promoter region; Preferably, by detecting the methylation level of the promoter region of the TMEM240 gene and the region near the promoter region, a normal sample and a tumor sample are distinguished; Preferably, the methylation level is determined by methylation-specific PCR, or methylation-specific quantitative PCR, or PCR, quantitative PCR, and DNA chip of methylated DNA specific binding protein, or methylation-sensitive Restriction enzyme, or bisulfite sequencing method, or pyrosequencing detection; Preferably, the methylation level is detected by quantitative methylation-specific quantitative PCR; Preferably, the methylation level adopts the capture sequence described in claim 3, or the primer pair described in claim 4, or the probe described in claim 5, or the methylation described in claim 6. Test reagents, or the kit test according to claim 7; Preferably, in step (1), detecting the methylation level of the subject's TMEM240 gene includes the following steps: a) Extract the DNA of the sample to be tested by magnetic bead capture method; b) The DNA of the sample to be tested is transformed with bisulfite, bisulfite or hydrazine; c) Methylation specific quantitative PCR detection; Preferably, in step a), extracting the DNA of the sample to be tested using the magnetic bead capture method includes the following steps; Take the sample to be tested and mix it in the protective solution, grind, centrifuge, and take the supernatant; Centrifuge the supernatant, take the supernatant, add lysate and magnetic beads with specific complementary oligonucleotide capture sequences to the supernatant and incubate; After discarding part of the supernatant, wash the magnetic beads and transfer to a clean centrifuge tube, add the washing solution, incubate at room temperature at 100-2000rpm for 0.5-5min, place on a magnetic stand to suck up the supernatant, and repeat 3 times; The target gene DNA is eluted with buffer. The method according to claim 10, wherein the detection standard is: judging the tumor specimen and the normal specimen according to the cut-off value, the cut-off value of the Ct value in the stool specimen is 32-42, and the Ct value of the stool specimen is less than the Ct value The cutoff value is judged to be a tumor specimen, and the stool sample whose Ct value is greater than or equal to the Ct value is judged to be a normal specimen. A tumor detection system, including; (1) TMEM240 gene methylation detection component; (2) Data processing components; (3) Results output component; Preferably, the methylation detection component contains one or more of a fluorescent quantitative PCR instrument, a PCR instrument, and a sequencer; Preferably, the methylation detection component further contains the capture sequence described in claim 3, or the primer pair described in claim 4, or the probe described in claim 5, or the alpha The detection reagent based on, or the kit as described in claim 7; Preferably, the data processing component is configured to a. receive the test data of the test sample and the normal control sample; b. store the test data of the test sample and the normal control sample; c. compare the same type of test sample and normal The test data of the control sample; d. According to the comparison result, in response to the probability or possibility of the test subject suffering from a tumor; Preferably, the result output means is used to output the probability or possibility that the tester has a tumor; Preferably, the judgment criterion of the data processing component is: judging the tumor specimen and the normal specimen according to the boundary value; The cutoff value of the Ct value in the stool sample is 32~42, the cutoff value of the stool sample is less than the cutoff value of the Ct value is determined as a tumor specimen, and the cutoff value of the stool sample is greater than or equal to the cutoff value of the Ct value is determined as Normal specimen. The method according to claim 10 or 11, or the system according to claim 12, wherein the tumor is a colorectal tumor; preferably, the tumor is colorectal cancer or adenoma. The method according to claim 10 or claim 11, or the system according to claim 12, wherein the detection sample type of the system or the method is tissue, body fluid, or fecal matter; Preferably, the tissue is intestinal tissue; Preferably, the body fluid is blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; Preferably, the excrement is sputum, urine, saliva or feces.

Images