RU2788814C1 - Method for minimally invasive diagnosis of meningiomas and glial tumors with specification of the degree of malignancy - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to molecular oncology, and can be used for minimally invasive diagnosis of meningiomas and glial tumors with specification of the degree of malignancy. Microrna expression is analyzed in the plasma sample. High specific primers are used for hsa-miR-21-5p, hsa-miR-342-3p, hsa-miR-3180-3, hsa-let-7c-5p, hsa-miR-190b-5p and cel-miR-39 -5p. The values are calculated cel-miR-39-5p, ΔCt hsa-miR-3180-3p = Ct hsa-miR-3180-3p – Ct cel-miR-39-5p, ΔCt hsa-let-7c-5p = Ct hsa-let -7c-5p – Ct cel-miR-39-5p, ΔCt hsa-miR-190b-5p = Ct hsa-miR-190b-5p – Ct cel-miR-39-5p, where Ct is the threshold cycle number after which an increase in signal relative to background values is achieved. With a value of ΔCt hsa-miR-21-5p ≥ 1.7, meningioma is diagnosed. With the values ΔCt hsa-miR-21-5p < 1.7, ΔCt hsa-miR-342-3p ≥ 2.9 and ΔCt hsa-miR-3180-3p < 13, glioma is diagnosed. With a value of ΔCt hsa-miR-21-5p < -1.4, the GIV degree of malignancy is determined - glioblastoma. At the values of ΔCt hsa-let-7c-5p < 0.76 and ΔCt hsa-miR-190b-5p < 10, grade GIII of malignancy is established - anaplastic astrocytoma. At values of ΔCt hsa-let-7c-5p < 0.76 and ΔCt hsa-miR-190b-5p < 10, GII degree of malignancy is established - diffuse astrocytoma.

EFFECT: method provides for the creation and implementation of a new, universal, inexpensive and accurate test system for the diagnosis of the most common primary brain tumors, in particular meningiomas and glial tumors, through the use of highly specific primers for hsa-miR-21-5p, hsa-miR- 342-3p, hsa-miR-3180-3, hsa-let-7c-5p, hsa-miR-190b-5p and cel-miR-39-5p.

1 cl, 1 tbl, 4 ex

Description

SUBSTANCE: invention relates to medicine, namely to molecular oncology, and can be used for minimally invasive screening diagnostics of meningiomas and glial tumors with specification of their degree of malignancy.

The most common types of primary brain tumors are gliomas and meningiomas, which together account for 60% of all primary brain tumors (see Rostorguev, E.E. New approaches to the diagnosis and experimental therapy of high-grade glial tumors: Abstract of the thesis. .... Doctor of Medical Sciences: 01/14/12 - Rostov-on-Don, 2021.).

Gliomas develop from glial cells and are classified according to histopathological and molecular features into four classes, most commonly low-grade gliomas (LGG, GI - placental astrocytoma and GII - diffuse astrocytoma) and high-grade gliomas (HGG, GIII - anaplastic astrocytoma and GIV - glioblastoma), where the most common is glioblastoma. Since the prognosis and treatment strategy of patients with glioma depend on the degree of tumor malignancy, making an accurate diagnosis is of great clinical importance (see Altieri R. et al. Molecular biology of gliomas: present and future challenges //Translational medicine@ UniSa. - 2014. - T. 10. - S. 29).

Gliomas occur at a frequency of 4.7–5.7 cases per 100,000 people and are among the most aggressive brain tumors, with a median overall survival rate of only about 14.6 months even after combination therapy (see Table 1). Ostrom Q. T. et al. Response to “the epidemiology of glioma in adults: a 'state of the science'review" // Neuro-oncology. - 2015. - V. 17. - No. 4. - P. 624-626. ). In turn, meningiomas are in most cases slow-growing tumors and are the most common primary brain tumors in adults, characterized by almost twice the incidence in women than in men. Most meningiomas are benign tumors (see Shaikh N., Dixit K., Raizer J. Recent advances in managing/understanding meningioma // F1000Research. - 2018. - V. 7.).

Prognosis and therapy depend on early detection of the type of brain tumor, and accurate grading is critical to the patient's quality of life. Modern approaches to diagnostics are based on imaging methods - computed tomography (CT), magnetic resonance imaging (MRI) followed by histological and molecular genetic examination of tumor tissue. Histological and molecular genetic study of tumor material obtained as a result of cytoreduction or biopsy is currently the gold standard for the morphogenetic diagnosis of gliomas. Some glial tumors are not available for needle biopsy due to their localization, for example, when located in the brainstem (see Faulkner H. et al. The surgical resection of brainstem glioma: Outcomes and prognostic factors // World neurosurgery. - 2021. - T. 146. - S. e639-e650.). Moreover, the tissue obtained as a result of stereotaxic needle biopsy does not always cover the morphological and molecular genetic heterogeneity of the entire tumor mass (see Wang J., Bettegowda C. Applications of DNA-based liquid biopsy for central nervous system neoplasms //The Journal of Molecular Diagnostics. - 2017. - V. 19. - No. 1. - P. 24-34.).

Studies of circulating microRNAs in blood plasma provide reliable and reproducible results in the diagnosis of a number of oncological diseases, including primary brain tumors (see Butz H. Circulating Noncoding RNAs in Pituitary Neuroendocrine Tumors—Two Sides of the Same Coin //International Journal of Molecular Sciences. - 2022. - V. 23. - No. 9. - P. 5122.)

An analysis of patent sources showed the availability of a method for early diagnosis of glioma (see Patent RU 2 772 193 C1, published on May 18, 2022, Bull. No. 14). The patent describes a method involving selection of a sequence of DNA oligonucleotide probes complementary to glioma-associated cRNA regions and subsequent registration of cRNA circulating in the patient's blood using a nanowire chip biosensor. By the formation of complexes between the indicated sequences of DNA oligonucleotide probes and their complementary sections of circular RNA, glioma is diagnosed.

The described method has principles similar to our method, but circular RNAs are used as diagnostic molecules. In addition, the described method allows to identify glial tumors, but without specifying the degree of malignancy and does not allow to differentiate glioma from meningioma.

The technical result of the proposed method is the creation and implementation of a new, versatile, inexpensive and accurate test system with highly specific synthetic oligonucleotide sequences for the diagnosis of the most common primary brain tumors, in particular meningiomas and glial tumors.

The technical result is achieved by analyzing the expression of microRNA in a plasma sample, including the introduction of an exogenous control into the plasma sample and the isolation of total RNA, reverse transcription followed by real-time amplification, while using highly specific primers for hsa-miR-21-5p, hsa-miR-342-3p and hsa-miR-3180-3, hsa-miR-21-5p, hsa-let-7c-5p, hsa-miR-190b-5p and cel-miR-39-5p, analyze the obtained data and calculate values cel-miR-39-5p, ΔCt hsa-miR-3180-3p =Ct hsa-miR-3180-3p – Ct cel-miR-39-5p, ΔCt hsa-let-7c-5p =Ct hsa-let-7c -5p – Ct cel-miR-39-5p, ΔCt hsa-miR-190b-5p =Ct hsa-miR-190b-5p – Ct cel-miR-39-5p, where Ct is the threshold cycle number after which the increase is achieved signal relative to background values, with ΔCt hsa-miR-21-5p ≥ 1.7, meningioma is diagnosed, with ΔCt hsa-miR-21-5p < 1.7, ΔCt hsa-miR-342-3p ≥2.9 and ΔCt hsa-miR-3180-3p <13 establish the diagnosis of glioma; with a value of ΔCt hsa-miR-21-5p <-1.4, the GIV degree of malignancy is determined - glioblastoma, with the values of ΔCt hsa-let-7c-5p ≥ 0.76 and ΔCt hsa-miR-190b-5p ≥10, the GIII degree of malignancy is determined - anaplastic astrocytoma, with ΔCt hsa-let-7c-5p < 0.76 and ΔCt hsa-miR-190b-5p < 10, grade GII is established - diffuse astrocytoma.

A method for minimally invasive diagnosis of meningiomas and glial tumors is implemented by evaluating the expression of microRNA hsa-miR-21-5p, hsa-miR-342-3p and hsa-miR-3180-3p relative to the exogenous control of cel-miR-39-5p in blood plasma samples . When detecting a glial tumor of the brain, this method allows you to determine the degree of malignancy by evaluating the expression of hsa-miR-21-5p, hsa-let-7c-5p and hsa-miR-190b-5p relative to the exogenous control cel-miR-39-5p in samples blood plasma.

The method is new, since the assessment of the expression of the microRNA data signature has not previously been used for the purpose of minimally invasive differential diagnosis of meningiomas and hyal tumors, and allows assessing the degree of malignancy of glioma.

In a preliminary study, the relative expression of hsa-miR-21-5p, hsa-miR-342-3p, hsa-miR-3180-3p, hsa-let-7c-5p, hsa-miR-190b-5p in plasma samples was evaluated blood of apparently healthy volunteers, patients with meningioma and patients with glial tumors of varying degrees of malignancy (GII-GIV).

For the method, specific oligonucleotide forward and reverse primers were developed for hsa-miR-21-5p, hsa-miR-342-3p, hsa-miR-3180-3p, hsa-let-7c-5p, hsa-miR-190b-5p , cel-miR-39-5p (see table 1).

Table 1.

Name
miRNA Sequence
miRNA Sequence hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA F: CGCAGTAGCTTATCAGACTG (SEQ ID #1)
R: GGTCCAGTTTTTTTTTTTTTTTCAACAT (SEQ ID #2) hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU F: CGCAGTCTCACACAGAAATC (SEQ ID No. 3)
R: CAGGTCCAGTTTTTTTTTTTTTTTACGGGT (SEQ ID No. 4) hsa-miR-3180-3p UGGGGCGGAGCUUCCGGAGGC F: CGCAGGGGGCGGAGCT (SEQ ID No. 5)
R: AGGTCCAGTTTTTTTTTTTTTTTGGCCT (SEQ ID No. 6) hsa-let-7c-5p UGAGGUAGGUAGGUUGUAUGGUU F: CGCAGTGAGGTAGTAGGTTGTA (SEQ ID No. 7)
R: CAGGTCCAGTTTTTTTTTTTTTTTAACCA (SEQ ID No. 8) hsa-miR-190b-5p UGAUAUGUUUGAUAUUGGGUUG F: CGCAGTGATATGTTTGATATTGG (SEQ ID No. 9)
R: CAGGTCCAGTTTTTTTTTTTTTTTCAC (SEQ ID NO. 10) cel-miR-39-5p GCAGAGCTGATTTCGTCTTG F: GCAGAGCTGATTTCGTCTTG (SEQ ID No. 9)
R: GGTCCAGTTTTTTTTTTTTTTTATTAC (SEQ ID No. 9) Universal RT primer CAGGTCCAGTTTTTTTTTTTTTVN (SEQ ID NO. 13) where V is A, C and G and N is A, C, G and T

The claimed method is carried out as follows:

In the first step, 6 ml blood samples are obtained by venipuncture into vacutainers containing K ₂ EDTA. After taking the tubes, mix by inverting for 10 seconds. and store before processing no more than 30 minutes at +4ºC. To obtain plasma, the blood is centrifuged at 1500g, +4ºC for 10 minutes. The cell-free fraction is transferred to a new tube and centrifuged at 12000g, +4ºC for 10 minutes, the supernatant is collected and stored at -80ºC.

At the second stage, the fraction of circulating microRNAs is isolated from plasma samples using the miRNeasy Serum/Plasma Kit (Qiagen, Germany), taking into account the manufacturer's recommendations. The miRNA fraction is eluted in 15 µl of ultrapure water. Prior to isolation, 5 µl of 5 mM exogenous control cel-miR-39-5p is added to the plasma sample.

At the third stage, cDNA synthesis is carried out using a mixture of reagents, including 1x reaction buffer, 0.1 mM ATP, 1 μM universal primer for reverse transcription, 0.1 mM mixture of dideoxynucleotides (dATP, dCTP, dGTP and dTTP), 10 u/μl of MMLV reverse transcriptase ( Evrogen, Russia), 0.1 U/µL poly(A) polymerase (New England Biolabs, USA), 1 U/µL RNase inhibitor Ribolock (Thermo Fisher Scientific, USA), 1 mM DTT, and 14 µL eluate containing the miRNA fraction, the total volume of the mixture is 26 μl. The reaction mixture is incubated at 42°C for an hour, followed by enzyme inactivation at 95°C for 5 minutes using a C1000 touch cycler (Bio-Rad Laboratories, USA).

At the fourth stage, the resulting complementary DNA (cDNA) is used to carry out the polymerase chain reaction in a total volume of 20 µl in the presence of 5 µl of 10x diluted cDNA, 1x EvaGreen (Evrogen, Russia), 1x reaction buffer, 0.2 mM mixture of dideoxynucleotides (dATP, dCTP, dGTP and dTTP), 2 mM MgCl2, 0.25 μM forward and reverse primers, 0.05 U/μL Taq polymerase (Evrogen, Russia). For each sample and pair of primers, no template control (NTC) and no reverse transcriptase control (NRT) controls are tested. Amplification temperature regime includes: 95C for 5-10 min, then 40 cycles at 95C for 10 s and 60C for 30 s, with signal detection by the FAM channel. Amplification of each microRNA is carried out in triplicate.

The relative miRNA expression is calculated as follows:

- calculate the geometric mean C _t for three repetitions for the target and reference miRNA, where Ct is the number of the threshold cycle, after which an increase in the signal relative to background values is achieved;

- calculate the value of ΔC _t hsa-miR-21-5p =C _t hsa-miR-21-5p – C _t cel-miR-39-5p;

- calculate the value of ΔC _t hsa-miR-342-3p =C _t hsa-miR-342-3p – C _t cel-miR-39-5p;

- calculate the value of ΔC _t hsa-miR-3180-3p =C _t hsa-miR-3180-3p – C _t cel-miR-39-5p;

- calculate the value of ΔC _t hsa-let-7c-5p =C _t hsa-let-7c-5p – C _t cel-miR-39-5p;

- calculate the value of ΔC _t hsa-miR-190b-5p =C _t hsa-miR-190b-5p – C _t cel-miR-39-5p.

If the value of ΔC _t hsa-miR-21-5p ≥1.7, the diagnosis of minengioma is established, with the values of ΔCt hsa-miR-21-5p <1.7, ΔC _t hsa-miR-342-3p ≥2.9 and ΔC _t hsa-miR-3180- 3p <13 establishes the diagnosis of glioma. When detecting a glial tumor of the brain, the method allows to clarify the degree of malignancy - with a value of ΔC _t hsa-miR-21-5p <-1.4, the GIV degree of malignancy is determined - glioblastoma, with values of ΔC _t hsa-let-7c-5p ≥0.76 and ΔC _t hsa-miR-190b-5p ≥10 set GIII degree of malignancy - anaplastic astrocytoma, with values of ΔC _t hsa-let-7c-5p <0.76 and ΔC _t hsa-miR-190b-5p <10 set GII degree of malignancy - diffuse astrocytoma .

To prove the prognostic value of the proposed test system, extracts from 4 case histories are given.

Example 1

Patient X., aged 62. Complaints of headache, bouts of dizziness, bouts of loss of consciousness. MRI of the brain with contrast from 08/25/2020: Picture outside the brain formation (parasagittal meningioma), dimensions 21.3 × 25 × 19 mm.

The results of the molecular analysis of the blood plasma sample before treatment ΔC _t hsa-miR-21-5p =1.9 corresponds to the presence of meningioma in the patient.

Surgery date: 09/04/2020 – resection craniectomy in the left frontal area, removal of the meningioma using neurophysiological monitoring (1 degree of radicalness according to Simpson), dural defect repair using a Hemopatch plate. Diagnosis - (D32.0) Transient meningioma ( histological examination 75597-07 \ 2020 WHO G1 in the left frontal region of the brain with intraosseous growth and growth into the wall of the superior sagittal sinus. Condition after craniectomy, removal of meningioma - 1 degree of radicalness according to Simpson (04.09 .2020, National Medical Research Center of Oncology).

Example 2

Patient L., 49 years old. Complaints of headaches, generalized convulsive seizures. MRI of the brain with contrast enhancement from 10/13/2020: Median structures are displaced to the right by 7 mm. The substance of the brain is extensively infiltrated by the tumor. In the left frontal, insular, and left temporal lobes, a massive cystic-solid tumor with intraventricular growth was revealed, with spread to the subcortical nuclei with perifocal vasogenic edema, with a total size of 47x55x42 mm. The structure of the tumor was changed due to areas of diffusion restriction in solid tissue, areas with central necrosis. Volumetric effect in the form of narrowing of the adjacent subarachnoid spaces, compression and infiltration of the body of the left lateral ventricle. The tumor involves branches of the left MCA. After intravenous amplification, the tumor diffusely inhomogeneously accumulates contrast with a solid component along the periphery of the necrosis cavities. The tumor has an abnormal vascular network, more in the right frontal lobe. The cerebellar tonsils are located at the level of the foramen magnum. In DTI, the corticospinal and corticothalamic tracts on the left at the level of the tumor and the peritumoral zone are partially destroyed, impoverishment and displacement of the pathways are noted, they are not clearly visible in the tumor.

The results of the molecular analysis of the blood plasma sample before treatment ΔCt hsa-miR-21-5p =0.5, ΔCt hsa-miR-342-3p =3.1 and ΔCt hsa-miR-3180-3p =12.3 correspond to the presence of a glial tumor. ΔCt values hsa-let-7c-5p = 0.81 and hsa-miR-190b-5p=10.3 suggest the presence of anaplastic astrocytoma - GIII.

Name and date of surgery: 06.11.2020 – osteoplastic craniotomy in the left temporal region, removal of the tumor with intraoperative awakening of the patient and the use of neurophysiological monitoring.

Diagnosis. (C71.8) Grade III anaplastic astrocytoma (histological verification number 97904–08/2020. left frontal and temporal lobes with extension to the insular lobe of the brain. Condition after osteoplastic craniotomy in the left temporal region, tumor removal with intraoperative awakening of the patient and the use of neurophysiological monitoring (06.11.2020, National Medical Research Center of Oncology). No stage. Clinical group 2. Main complication: Symptomatic epilepsy.

Example 3

Patient K., aged 64 (C71.8). Complaints of decreased vision, weakness in the left limbs. MRI of the brain with contrast enhancement from 10/16/2020: The median structures are shifted to the left at the level of the MSF up to 5–6 mm. In the subcortical nuclei, the thalamus, the parietal lobe of the right hemisphere, a zone was revealed, represented by a tumor with vasogenic edema along the periphery, with a total size of about 40x34x41 mm. The structure is cystic-solid, in the solid component there are areas of hemorrhagic impregnation. Compression of the third and right lateral ventricle of the brain. Narrowing of s / a spaces, lateral fissure of the right hemisphere. After intravenous amplification, there is a diffuse uniform peripheral accumulation of contrast by the tumor tissue in the subcortical nuclei and the thalamus, in the form of merging nodes with sizes of 23x29 and 17x14 mm. In DTI, destruction/infiltration of the conducting tracts at the level of the tumor, involvement of the right corticospinal tract in the process, infiltration of the posterior thigh of the internal capsule. The lateral ventricles of the brain are asymmetric, D < S, not dilated.

The results of the molecular analysis of the blood plasma sample before treatment ΔCt hsa-miR-21-5p = -1.5 suggest the presence of a glial tumor - GIV glioblastoma.

Name and date of surgery: 10/29/2020 – stereotaxic tumor biopsy using the Medtronic “StealthStation S7” navigation system, neurophysiological monitoring and intraoperative fluorescence microscopy.

Diagnosis - glioblastoma Grade IV (histological examination No. 94239\2020) of subcortical nuclei, thalamus, parietal lobe of the right hemisphere of the brain. Status of stereotaxic tumor biopsy (October 29, 2020, National Medical Research Center of Oncology). No stage. Clinical group 2. Primary complication: Dislocation syndrome. Left-sided hemiparesis.

Example 4

Patient Sh., aged 32. Complaints: headache, generalized convulsive seizures. MRI of the brain with contrast enhancement from 10/09/2020: Median structures are not displaced. The substance of the brain is locally deformed. In the left temporal region along the course of the inferior and middle temporal gyri with perifocal vasogenic edema and gliosis, an area of dysplastic changes with a total size of 24x18x18 mm was revealed, with a local disturbance of the typical pattern of sulci and gyri. Volumetric effect is not expressed. After intravenous amplification, the zone of dysplastic changes does not accumulate contrast. The cerebellar tonsils are located at the level of the foramen magnum. In DTI, the corticospinal and corticothalamic tracts are preserved on the right and left, locally destroyed in the temporal lobe. The thickness of the cortex outside the process is diffusely reduced to 2-3 mm. Liquorodynamics is not broken. The lateral ventricles of the brain are 8 mm symmetrical, not changed. The third ventricle is not dilated. The fourth ventricle is not dilated. Additional formations in the region of cerebellopontine angles were not revealed. The basal cisterns are not expanded, not deformed, the subarachnoid convexital spaces and sulci of the cerebral hemispheres are not expanded. Skull bones without destruction. Craniovertebral transition - without features. Deviation of the nasal septum. Pneumatization of the sinuses is not disturbed, edema and hypertrophy of the mucosa of the left maxillary sinus. Orbits and chiasmal region without features, pituitary gland 5 mm thick, pituitary tissue has a normal signal. The internal auditory canals are not dilated. Without infiltration along the optic nerves.

The results of the molecular analysis of the blood plasma sample before treatment ΔCt hsa-miR-21-5p =0.7, ΔCt hsa-miR-342-3p =3.3 and ΔCt hsa-miR-3180-3p =11.4 correspond to the presence of a glial tumor. ΔCt values hsa-let-7c-5p = 0.55 and hsa-miR-190b-5p=9.7 suggest the presence of diffuse GII astrocytoma.

Name and date of operation: 22.10.2020 – osteoplastic craniotomy in the left temporal region, removal of the tumor with intraoperative awakening of the patient and the use of neurophysiological monitoring. Diagnosis (C71.2) - diffuse astrocytoma G II (histological verification 91944-47\20) of the left temporal lobe of the brain. Condition after osteoplastic craniotomy in the left temporal region, tumor removal with intraoperative awakening of the patient (October 22, 2020, National Medical Research Center of Oncology). Complication: Symptomatic epilepsy.

Clinical data obtained from outpatient examination of these patients subsequently confirmed the diagnosis in accordance with the diagnostic value of microRNA in plasma samples of patients obtained before treatment.

The analysis of the presented clinical cases demonstrates the possibilities of minimally invasive diagnosis of meningiomas and glial tumors with specification of their degree of malignancy using the assessment of the expression of hsa-miR-21-5p, hsa-miR-342-3p and hsa-miR-3180-3, hsa-miR- 21-5p, hsa-let-7c-5p and hsa-miR-190b-5p in plasma samples relative to exogenous control cel-miR-39-5p by real-time polymerase chain reaction.

Claims (1)

A method for minimally invasive diagnosis of meningiomas and glial tumors with specification of the degree of malignancy, which consists in the analysis of microRNA expression in a plasma sample, including the introduction of an exogenous control into the plasma sample and the isolation of total RNA, reverse transcription followed by real-time amplification, while use highly specific primers for hsa-miR-21-5p, hsa-miR-342-3p, hsa-miR-3180-3, hsa-let-7c-5p, hsa-miR-190b-5p and cel-miR-39- 5p, analyze the obtained data and calculate the values ΔCt hsa-miR-21-5p = Ct hsa-miR-21-5p – Ct cel-miR-39-5p, ΔCt hsa-miR-342-3p = Ct hsa-miR-342 -3p – Ct cel-miR-39-5p, ΔCt hsa-miR-3180-3p = Ct hsa-miR-3180-3p – Ct cel-miR-39-5p, ΔCt hsa-let-7c-5p = Ct hsa -let-7c-5p – Ct cel-miR-39-5p, ΔCt hsa-miR-190b-5p = Ct hsa-miR-190b-5p – Ct cel-miR-39-5p, where Ct is the threshold cycle number, after which an increase in the signal relative to background values is achieved, with a value of ΔCt hsa-miR-21-5p ≥ 1.7, set the diagnosis of meningioma is made, with the values of ΔCt hsa-miR-21-5p < 1.7, ΔCt hsa-miR-342-3p ≥ 2.9 and ΔCt hsa-miR-3180-3p < 13, the diagnosis of glioma is established; with a value of ΔCt hsa-miR-21-5p < -1.4, the GIV degree of malignancy is determined - glioblastoma, with the values of ΔCt hsa-let-7c-5p ≥ 0.76 and ΔCt hsa-miR-190b-5p ≥ 10, the GIII degree of malignancy is determined - anaplastic astrocytoma, with ΔCt hsa-let-7c-5p < 0.76 and ΔCt hsa-miR-190b-5p < 10, grade GII is established - diffuse astrocytoma.