RU2781979C2 - T-cell compositions with t-cell receptor deficiency - Google Patents

Abstract

FIELD: cell biology; medicine.

SUBSTANCE: present invention relates to cell biology and medicine, in particular to constructed T-cells, their production methods, a pharmaceutical composition, a vector for construction of T-cells, and the use of the latter for the treatment of cancer. To produce a constructed human T-cell, TCR-inhibiting molecule (TIM) is expressed in the specified T-cell, which is encoded by a nucleic acid sequence selected from SEQ ID No: 80, 82, 84, or 86.

EFFECT: present invention allows for an increase in the efficiency of remedies based on T-cells for the treatment of cancer.

14 cl, 3 dwg, 2 tbl, 5 ex

Description

The present invention was made with government support under contract number CA 130911 with the National Institutes of Health. The state has certain rights to this invention.

Cross-references to related applications

This application is a continuation in part of U.S. Patent Application No. 13/502,978, filed April 19, 2012, which is a national application filed pursuant to International Patent Application No. PCT/US2010/54846, filed October 29, 2010, which seeks priority of Provisional Patent Application No. 61/255,980, filed October 29, 2009, the disclosure of which is incorporated herein by reference.

State of the art

Field of invention

The present invention relates to TCR (T cell receptor) deficient T cells, methods for making and using TCR deficient T cells, and methods for using said TCR deficient T cells to combat diseases and disorders. In one embodiment, the present invention relates broadly to TCR-deficient T cells, their isolated population, and compositions containing them. According to another embodiment of the present invention, these TCR-deficient T cells are also altered to express a functional receptor other than the TRC. Also, the present invention relates to methods for obtaining these TCR-deficient T cells, as well as methods for reducing or alleviating, or preventing or treating diseases and disorders using these TCR-deficient T cells, their populations or compositions containing them.

Description of the prior art

The global burden of cancer has doubled from 1975 to 2000, and cancer is projected to be the leading cause of death worldwide by 2010. According to the American Cancer Society, it is expected to double by 2020 and triple by 2030 Thus, there is a need for more effective treatments for various forms of cancer. Ideally, any cancer remedy should be effective (in killing cancer cells), targeted (i.e., selective, would not kill healthy cells), permanent (would avoid relapses and metastases), and affordable. Today's standard of care for most forms of cancer falls short of expectations in some or all of these criteria.

Cell therapy has been shown to lead to specific tumor eradication and has the potential to provide specific and effective cancer treatments. (Ho, W.Y., et al. 2003. Cancer Cell 3:1318-1328; Morris E.C. et al. 2003. Clin. Exp. Immunol. 131:1-7; Rosenberg, S.A. 2001. Nature 411:380-384; Boon T and P van der Bruggen 1996 J Exp Med 183:725-729). T cells have often been the effector cells of choice for cancer immunotherapy due to their selective recognition and powerful effector mechanisms. T cells recognize specific peptides derived from internal cell proteins in the context of their own major histocompatibility complex (MHC) through their T cell receptors (TCRs).

It is recognized in the art that the TCR complex is associated with a subtle way of forming dimers and linking said dimers (TRC-alpha/beta, CD3-gamma/epsilon, CD3-delta/epsilon and CD3-zeta-dimer) into one TRC complex, which can exported to the cell surface. Failure of any of these complexes to form correctly will result in suppression of TCR assembly and expression (Call, M.E, et al. (2007) Nature Rev. Immunol., 7:841-850; Call, M.E, et al. (2005) Annu Rev Immunol., 23:101-125).

Certain amino acid residues in the respective TCR chains have been found to be important for proper dimer formation and TCR assembly. In particular, for TCR-alpha, such key amino acids in the transmembrane portion are arginine (for association with CD3-zeta) and lysine (for association with CD3-epsilon/delta-dimer). For TCR-beta, the key amino acid in the transmembrane portion is lysine for binding to CD3 epsilon/gamma dimer). For CD3-gamma, the key amino acid in the transmembrane portion is glutamic acid. For CD3 delta, the key amino acid in the transmembrane portion is aspartic acid. For CD3 epsilon, the key amino acid in the transmembrane portion is aspartic acid. For CD3-zeta, the key amino acid in the transmembrane portion is aspartic acid (Call, M.E, et al. (2007) Nature Rev. Immunol., 7:841-850; Call, M.E, et al. (2005) Annu Rev. Immunol. , 23:101-125).

Peptides derived from altered or mutated proteins in tumors can be recognized by specific TCRs. Several key studies have led to the identification of antigens associated with specific tumors that have been shown to be able to elicit effective cytotoxic T-cell (CTL) responses in patients. (Ribas, A. et al. 2003, J. Clin. Oncol. 21:2415-2432). The effector mechanisms of T cells include the ability to kill tumor cells directly and to produce cytokines that activate other host immune cells and alter the local tumor microenvironment. In theory, T cells can identify and destroy a tumor cell expressing a single mutated peptide. Adaptive immunotherapy with CTL clones specific for MART1 or gp100 at low doses of IL-2 (interlekin-2) has been effective in reducing and stabilizing tumor burden in some patients (Yee, C et. Al. 2002. Proc. Natl.Acad Sci USA 99:16168-16173). Other methods are based on the use of T cells with a specific antitumor receptor. Such methods include genetically engineered CTLs with novel antigen-specific T cell receptors that recognize tumor peptides and MCHs, chimeric antigen receptors (CARS) derived from single chain antibody (scFv) fragments coupled to an appropriate signaling element, or the use of chimeric cell receptors. NK (natural killer cells) (Ho W.Y. et al. 2003. Cancer Cell 3:431-437; Eshhar, Z. et al. 1993. Proc. Natl. Acad. Sci. USA 91:817-821; Zhang, T. et al 2005 Blood 106:1544-1551).

Cellular drugs are used in patients who have not responded to traditional chemotherapy or radiation therapy, or who have relapsed, in whom more than one type of therapy has often been tried. Immune cells harvested from patients with advanced cancer who have undergone several rounds of chemotherapy do not respond as strongly as cells from healthy people. In addition, cancer patients are often elderly and may suffer from other diseases that may limit the ability of their immune cells to become primed effector cells, even after in vivo activation and expansion. In addition, each cancer patient must provide enough of their own immune cells to be modified to express the new immune receptor. Since each remedy must be made individually for each patient, this process takes several weeks from the moment the decision is made to carry out such therapy; meanwhile, the cancer continues to grow. US Patent Application US2002/0039576 describes a method for immodulating T cell activity using T cells with the CD3 ⁺ -αβ-TcR ⁺ CD4 ^- CD8 ^- CD28 ^- NK1.1- phenotype ^. US Patent Application Publication No. US 2006/0166314 discloses the use of mutated T cells for the treatment of cancer, in which the T cells are T cells with an αβ T cell receptor specific for the MDM2 protein, mediating the T cell response.

Cancer is not the only disease for which T-cell manipulation can be effective. Active T cell receptors on T cells are known to be critical to the body's response to stimulation of the immune system. For example, a wide range of T cell receptors have been shown to play a role in graft-versus-host disease (GVHD), particularly in chronic GVHD (Anderson et al. (2004) Blood 104:1565-1573). In fact, administration of T-lymphocyte receptor antibodies has been shown to reduce the symptoms of acute GVHD (Maeda et al. (2005) Blood 106:749-755).

There continues to be a need for more effective T cell-based therapies for the treatment of certain diseases and disorders, and for treatments based on the development of new types of T cells.

The essence of the invention

In one embodiment, the present invention broadly relates to isolated, modified T cells that do not express functional T cell receptors (TCRs). In this embodiment, said T cells are TCR deficient in terms of expression of a functional TCR. According to another embodiment of the present invention, TCR-deficient T cells are modified to express a functional non-TCR receptor, such as a chimeric receptor, for example. These cells also function as a platform to express other specific receptors, such as receptors that may be useful in specific diseases, while retaining T cell effector functions, albeit without functioning TCRs.

The present invention provides populations of TCR-deficient T cells, and compositions containing them. The invention also provides methods for producing said TCR-deficient T cells, and methods for reducing and alleviating, or preventing or treating, diseases and disorders using said TCR-deficient T cells, their populations, or therapeutic compositions containing them. In one embodiment, the composition may be used to treat cancer, infection, one or more autoimmune disorders, radiation sickness, or to prevent or treat graft-versus-host disease (GCHD) or graft rejection in a subject undergoing tissue or organ transplant surgery. .

Brief description of the drawings

The Figure 1 illustrates the chimeric NK receptors described in this application. Extracellular (EC), transmembrane (TM), and cytoplasmic regions (Cyp) are shown. The wild-type (WT) and chimeric (CH) forms of the receptor are shown, where NH ₂ is the N-terminus and COOH is the C-terminus.

Figure 2 illustrates that TIMs reduce TCR recognition and human T-lymphocyte function during culture with PBMCs (peripheral blood mononuclear cells). Panel (A) shows that TIM-transfected T cells cultured with allogeneic PBMCs show reduced production of IFN-γ (interferon gamma). The total production of IFN-γ is shown. Panel (B) shows the amount of IFN-γ after subtracting the amount of autologous IFN-γ. This value reflects the specific IFN-γ produced upon recognition of allogeneic PBMCs.

Figure 3 illustrates the activation of TIM-expressing T cells by a recombinant anti-cancer receptor. TIM-expressing T cells that co-express the NKG2D (chNKG2D) chimeric receptor, which recognizes specific ligands on many tumor cell types that produce increased amounts of IFN-γ when co-cultured with RPMI8226 myeloma cells. A blocking monoclonal antibody (mAb) NKG2D was included in some wells to prevent chNKG2D from recognizing its ligands on tumor cells and this demonstrates a specific chNKG2D receptor response on these T cells.

Detailed Description of Preferred Embodiments

Definitions

It should be understood that the present invention is not limited to the specific methodology, protocols, cell lines, animal species or genera, and reagents described, which may vary. It should also be understood that the terminology used in this application is only intended to describe specific embodiments, and is not intended to limit the scope of the present invention, which is limited only by the appended claims.

In the present application, the singular includes plural entities, unless the context clearly dictates otherwise. Thus, for example, reference to "cell" includes a plurality of such cells, and reference to "protein" includes reference to one or more proteins and their equivalents known to those skilled in the art, and so on. All technical and scientific terms used in this application have the same meanings as commonly understood by experts in the field of technology to which this invention relates, unless expressly indicated otherwise.

In the context of the present invention, "TCR-deficient T cell" or a similar phrase should be understood to mean isolated T cell(s) that do not express a functional TCR that is intrinsically capable of inhibiting the production of its own TCRs, and also for which one can reasonably expect that the progeny of said T cell is intrinsically capable of inhibiting the production of its own TCRs. Intrinsic capacity is important in the context of therapy when the TCR turnover time scale (≈hours) is much faster than the demonstrated efficacy time scale (days-weeks), i.e., intrinsic capacity is required to maintain the desired phenotype during the treatment period. This can be achieved, for example, in various ways described below, for example, by obtaining an altered T cell such that it does not express any functional TCRs on its surface, or by obtaining an altered T cell such that it does not express one or more subunits , which contain a functional TCR and therefore did not produce a functional TCR, or by engineering a T cell to produce a negligible amount of a functional TCR on its surface, or which expresses a substantially damaged TCR, for example, by generating an altered T cell such that it expresses mutated or truncated forms of one or more of the subunits that the TCR contains, resulting in said T cell being unable to express a functional TCR, or producing a cell that expresses a substantially damaged TCR. The various subunits that make up a functional TCR are described below. Whether a cell expresses a functional TCR can be determined using assay methods such as those known in the art and described herein. By "substantially damaged TCR" we mean that the TCR will not substantially induce unwanted immune responses in the host, such as a GVHD response.

As described in more detail below, optionally, these TCR-deficient cells can be engineered to contain other mutations or transgenes, such as mutations or transgenes that affect the growth or proliferation of T cells, result in the expression or lack of expression of a desired gene, or a gene construct such as another receptor or cytokine or other immunomodulator or polypeptide or selectable marker such as a dominant selectable marker gene such as DHFR or neomycin transferase.

The term "allogeneic T cell" refers to a T cell obtained from a donor that has a tissue type of HLA (human lymphocyte antigen) that matches that of the recipient. As a rule, the assessment of conformity is carried out on the basis of variability at three or more loci of the HLA gene, and preferably a complete match. In some cases, allogeneic transplant donors may be relatives (usually siblings with similar HLA), isogenic subjects (the patient's monozygous "identical" twin), or non-relatives (a donor who is not a relative and exhibits a very high degree of HLA matching). HLA genes fall into two categories (type I and type II). Generally, type I gene mismatches (i.e., HLA-A, HLA-B, or HLA-C) increase the risk of transplant rejection. HLA type II mismatch (ie, HLA-DR or HLA-DQB1) increases the risk of graft versus host disease.

In the context of the present invention, the term "bank of tissue-compatible TCR-deficient T cells" refers to various compositions containing T cells of a particular HLA allotype rendered TCR deficient according to the present invention. Ideally, said bank would contain compositions containing broad spectrum T-cells of different types of TLA that are representative of the human population. Such a bank of engineered TCR-deficient T cells may be useful as it facilitates access to T lymphocytes suitable for use in a variety of recipients, such as cancer patients. The present invention provides methods for generating a bank of TCR-deficient T cells having different HLA haplotypes. These methods include obtaining a population of isolated T cells having a given HLA haplotype, which is determined by standard typing methods (for example, antibodies, PCR (polymerase chain reaction) or DNA sequencing), and expressing a TCR inhibitory molecule (TIM) in these T -cells, which destabilizes the TCR complex by reducing or blocking the expression of the components of the specified TCR complex. This is done for T cells derived from a wide range of different individuals with different HLA haplotypes. This pool of T cells from different donors that express TIM contains a bank of TCR-deficient T cells. Said bank of T-lymphocytes includes different populations of T-cells, each of which contains TCR-deficient T-lymphocytes with a specific type of HLA. Preferably, such a T cell bank includes a variety of HLA types, eg, at least 10 different HLA tissue types, at least 50 different HLA tissue types, at least 100 different HLA tissue types. In one embodiment, said T cell bank includes T cells from at least 10 different HLA tissue types. In another embodiment, said T cell bank includes T cells from at least 100 different HLA tissue types.

In the context of the present invention, the term "therapeutically effective amount" means an amount of TCR-deficient T cells that, when administered to a patient, alleviates the signs and symptoms of a disease (eg, cancer, infection, or GVHD). The actual amount to be administered can be determined based on in vitro or in vivo studies in which TCR-deficient T cells have shown pharmacological activity against the disease. For example, functional TCR-deficient T cells can inhibit growth in vitro or in vivo, and the amount of said functional TCR-deficient T cells that inhibits such growth is defined as a therapeutically effective amount.

The term "pharmaceutical composition" refers to a chemical or biological composition suitable for administration to a mammal. Such compositions can be formulated specifically for administration by one or more routes, including, without limitation, buccal, intra-arterial, intracardiac, intracerebroventricular, intradermal, intramuscular, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, rectal by enema or suppository, subcutaneous, subdermal , sublingual, transdermal and through mucous membranes. In addition, administration may be in the form of an injection, liquid, gel, drops, or other means of administration.

In this application, the terms "nucleic acid construct" or "nucleic acid sequence" should be understood as a DNA molecule that can be transformed or introduced into a T cell, and which will be transcribed and translated to form a product (for example, a chimeric receptor or suicide protein).

Nucleic acids are "operably linked" when they are in a functional relationship with another nucleic acid sequence. For example, DNA for a signal sequence is operably linked to DNA for a polypeptide if it is expressed as a precursor protein that is involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of said sequence. Generally, the term "operably linked" means that the DNA sequences that are linked are contiguous and, in the case of a secretion leader, contiguous and in-frame. However, enhancers do not have to be adjacent. Bindings are achieved by cross-linking at conventional restriction sites or, alternatively, using a PCR/recombination method known to those skilled in the art ( ^Gateway® Technology; Invitrogen, Carlsbad, CA). If such sites do exist, synthetic adapter oligonucleotides or linkers are used in accordance with conventional practice.

The present invention contemplates compositions and methods for reducing or alleviating, or preventing or treating, diseases or conditions such as cancer, infectious diseases, GVHD, transplant rejection, one or more autoimmune disorders, or radiation sickness. In a non-limiting embodiment, the compositions are based on the concept of providing an allogeneic source of isolated human T cells, namely TCR-deficient T cells, which can be produced before the patient needs them and inexpensively. The ability to create a single therapeutic drug in a single manufacturing site using well-controlled processes is attractive from both a cost and quality standpoint. Switching from an autologous source to an allogeneic source of T cells offers significant benefits. For example, it has been estimated that one healthy donor can provide enough T cells to treat twelve patients after transduction and expansion.

According to the present invention, modified allogeneic T cells are produced in such a way that they do not express functional T cell receptors (TCRs). It should be understood that some, or even all, of the TCR subunits/dimers may be expressed on the cell surface, but that these T cells do not express enough functional TCR to cause an undesirable response in the host. Without functional TCRs on their surface, allogeneic T cells cannot elicit an unwanted immune response against cells in the host. As a consequence, these TCR-deficient T cells do not cause, for example, CVHD because they cannot recognize the host's MHC molecules. In addition, these TCR-deficient T cells can be engineered to simultaneously express functional, non-TCR receptor, disease-specific receptors.

As is well known to those skilled in the art, there are various methods for isolating allogeneic T cells from a subject. For example, the use of cell surface expression of markers or the use of commercial kits (eg, ISOCELL™ from Pierce, Rockford, IL Rockford, Ill.).

For cancer therapy, the method comprises generating an isolated population of TCR-deficient T effector cells, e.g., an allotype of the desired tissue, that do not express a functional form of their endogenous TCR, or that express a substantially reduced level of endogenous TCR compared to wild-type T cells, such that they do not elicit an immune response when administered (such as CVHD), but instead express a functional receptor other than the TCR that recognizes tumor cells, or express another polypeptide that does not perceptibly or at all attack non-disease-associated cells eg, normal (non-oncogenic) cells that do not express an antigen or ligand recognized by a tumor-specific receptor, or that express said antigen or ligand at a reduced level compared to tumor cells. Those skilled in the art will appreciate that certain tumor-associated antigens are expressed in non-cancerous tissues, but they are possible targets for therapy in tumor hosts. With respect to the foregoing, it is generally accepted among those of skill in the art that certain non-TCR receptor, tumor-specific receptors are expressed in non-cancerous tissues, but are potential therapeutic targets in tumor hosts because they may be expressed at greatly reduced levels in normal cells. compared to tumor cells.

While not necessary for most uses of a subject's TCR-deficient T cells, in some cases it may be desirable to remove some or all of the donor's T cells from the host after they have mediated their antitumor effect. This can be facilitated by engineering T cells to express additional receptors or markers that facilitate their removal and/or identification in the host, such as GFP (Green Fluorescent Protein) and the like. While the present invention should substantially eliminate any possibility of GVHD or other adverse immune response in the recipient, they may be desirable in some individuals. This should not diminish efficacy since it has already been shown that donor T cells do not need to persist long in the host to initiate an antitumor effect (Zhang, T., et al. 2007. Cancer Res. 67:11029-11036; Barber, A. et al. 2008. J. Immunol. 180:72-78).

According to one embodiment of the present invention, the nucleic acid constructs introduced into engineered T cells further comprise a suicide gene, such as HSV type I thymidine kinase (TK) (Bonini, et al. (1997) Science 276:1719- 1724), a Fas-based "artificial suicide gene" (Thomis, et al. (2001) Blood 97:1249-1257), or an E. coli cytosine diaminase gene, which are activated by ganciclovir, AP1903, or 5-fluorocytosine, respectively. Said suicide gene is successfully included in the nucleic acid construct of the present invention to allow the removal of transformed T cells in case of toxicity and destruction of the chimeric construct when the tumor is reduced or removed. The use of suicide genes to remove transformed or transfected cells is well known in the art. For example, Bonini, et al. ((1997) Science 276:1719-1724) showed that donor lymphocytes transfected with the HSV-TK suicide gene provided antitumor activity in patients up to one year of age, and removal of the transfected cells was achieved with ganciclovir. Further, Gonzalez, et al. ((2004) J. Gene Med. 6:704-711) described targeting neuroblastoma with clones of cytotoxic T cells genetically modified to express the chimeric immunoreceptor scFvFc:zeta per epitope on L1-CAM, wherein said construct also expresses the suicide gene, hygromycin thymidine kinase (HyTK), to exclude transgenic clones.

It is contemplated that the suicide gene may be expressed from the same promoter as shRNA (short hairpin RNA), a minigene other than the TCR receptor, or from another promoter. Typically, however, the nucleic acid sequences encoding the suicide protein and the shRNA, minigene, or non-TCR receptor are in the same construct or vector. Expression of a suicide gene from the same promoter as shRNA, minigene or non-TCR receptor can be achieved using any of the well known internal ribosome entry sites (IRES). Suitable IRES sequences that can be used in the nucleic acid construct of the present invention include, without limitation, IRES from EMCV, c-myc, FGF-2, polio virus, and HTLV-1. By way of illustration only, a nucleic acid construct for expressing a chimeric receptor may have the following structure: promoter -> chimeric receptor -> IRES -> suicide gene. Alternatively, the suicide gene may be expressed from a promoter other than the chimeric receptor promoter (eg promoter 1->chimeric receptor->promoter 2->suicide gene).

In connection with the widespread use of T cells in cell therapy and the advanced nature of T cells according to the present invention, the present invention includes any method or composition in which T cells are therapeutically desirable. Such compositions and methods include compositions and methods for reducing or alleviating, or preventing or treating cancer, GVHD, transplant rejection, infection, one or more autoimmune diseases, radiation sickness, or other diseases or conditions that rely on the use of T cells, derived from an allogeneic source that do not express functional TCRs.

As indicated, further embodiments of the present invention include recombinant expression of receptors in said TCR-deficient T cells, such as chimeric NKG2D, chimeric Fv domains, NKG2D, or any other receptor to initiate signals for T cells, resulting in the creation of potent specific effector T cells. -cells. One skilled in the art can select the appropriate receptor to express on TCR-deficient T cells, depending on the disease to be treated. For example, receptors that can be expressed on TCR-deficient T cells for the treatment of cancer may include any receptor or ligand that has been identified on cancer cells. Such receptors include, without limitation, NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1, and NKp80.

According to another embodiment of the present invention, such receptors include, without limitation, NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1, and NKp80, or an antitumor antibody such as anti-Her2neu or anti-EGFR, and a signaling domain derived from CD3-zeta, Dap10, CB28, 41BB, and CD40L. An example of a chimeric receptor is chNKG2D, in which NKG2D is coupled to the cytoplasmic domain of CD3-zeta and is associated with Dap10 to provide both primary and secondary activation signals to T cells (Zhang, T. et al. 2006. Cancer Res. 66( 11): 5927-5933). According to one embodiment of the present invention, the chimeric receptor binds to MIC-A, MIC-B, Her2neu, EGFR, mesothelin, CD38, CD20, CD19, PSA, MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC12, MUC13, MUC15, MUC16, MUC17, MUC19, MUC20, is an estrogen receptor, progesterone receptor, RON, or one or more members of the ULBP/RAET1 family, including ULBP1, ULBP2, ULBP3, ULBP5, and ULBP6.

According to the methods of the present invention, a patient suffering from cancer, GVHD, transplant rejection, infection, one or more autoimmune disorders, or radiation sickness is administered a therapeutically effective amount of a composition comprising said TCR-deficient T cells. According to another embodiment of the present invention, a therapeutically effective amount of a composition comprising said TCR-deficient T cells is administered to prevent, treat, or reduce GVHD, transplant rejection, or cancer.

Methods for obtaining TCR-deficient T cells

T cells that do not stably express functional TCRs according to the present invention can be obtained using various methods. T cells internalize, sort, and destroy entire T cell receptors in a complex fashion with a half-life of approximately 10 hours for normal T cells, and 3 hours for stimulated T cells (von Essen, M. et al. 2004. J. Immunol 173:384-393). Proper functioning of the TCR complex requires the correct stoichiometric ratio of the proteins that make up the TCR complex. TCR function also requires two functioning TCR-zeta proteins with ITAM motifs. Activation of the TCR complex by its MHC peptide ligand requires the participation of several TCRs in a single T cell, all of which must correctly signal. Thus, if the TCR complex is destabilized by proteins that are not connected properly or cannot signal optimally, that T cell is not activated enough to trigger a cellular response.

The methods of the present invention include the expression of TCR inhibitory molecules (TIM) in T cells to destabilize the TCR complex by blocking the expression of essential components of the TCR complex and/or arresting TCR expression or function. There are different classes of TIMs including, but not limited to, short hairpin RNAs (shRNAs) and dominant negative inhibitory proteins, such as truncated proteins that do not contain important signaling motifs; KIR fusion proteins that contribute to the inhibitory signal; and proteins with mutations that interfere with proper binding to other components of the TCR complex and/or proper signaling. In general, TIM can be used to generate TCR-deficient T cells by preventing the expression of any or very poorly functional TCRs on the cell surface, and/or to stimulate the expression of substantially damaged TCRs on the cell surface.

As the results in the experimental examples below show, the present inventors have demonstrated that TCR expression or function can be halted or abolished by TIM, eg, shRNA and/or dominant negative inhibitors, while producing TCR-deficient T cells. Such TCR-deficient cell lines are well suited for use as T cell-based agents for the treatment of cancer and other diseases and disorders, as described below.

According to one embodiment of the present invention, TCR expression is abolished using short hairpin RNAs (shRNAs) that target nucleic acids encoding specific TCRs (e.g., TCR-α and TCR-β) and/or CD3 chains (e.g., CD3-zeta ) in primary T cells. By blocking the expression of one or more of these proteins, the T cell will no longer be able to produce one or more of the key components of the TCR complex, whereby the TCR complex is destabilized and expression of a functional TCR on the cell surface is prevented. Even though some TCR complexes may be recycled on the cell surface, shRNA interferes with the new production of TCR proteins, leading to the destruction and removal of the entire TCR complex, and T-lymphocytes are formed with a persistent lack of expression of functional TCRs.

Expression of shRNA in primary T cells can be achieved using a conventional expression system, such as the lentivirus expression system. Although lentiviruses are useful for targeting most primary T cells, not all T cells will express shRNA. Some of these T cells may not express enough shRNA to achieve sufficient downregulation of TCR expression to alter the functional activity of the T cells. Thus, T cells that retain moderate or high TCR expression after viral transduction can be removed, for example, by cell sorting or cell separation, such that the remaining T cells are deficient in TCR or CD3 on the cell surface, allowing expand the isolated population of T cells deficient in the expression of functional TCR or CD3.

According to a non-limiting embodiment of the present invention, exemplary shRNAs have been designed for key components of the TCR complex, as indicated below (Table 1).

Table 1 Target Bases in the target shRNA sequence %GC SEQID No.: TCR-β ^18a AGTGCGAGGAGATTCGGCAGCTTAT 52 one ^21a GCGAGGAGATTCGGCAGCTTATTTC 52 2 ^48a CCACCATCCTCTATGAGATCTTGCT 48 3 ^54a TCCTCTATGAGATCTTGCTAGGGAA 44 four TCR-α ^3b TCTATGGCTTCAACTGGCTAGGGTG 52 5 ^76b CAGGTAGAGGCCTTGTCCACCTAAT 52 6 ^01b GCAGCAGACACTGCTTTCTTACTTCT 48 7 ^07b GACACTGCTTTCTTACTTCTGTGTCTA 44 eight CD3-ε 89 ^c CCTCTGCCTCTTATCAGTTGGCGTT 52 9 27 ^c GAGCAAAGTGGTTATTATGTCTGCT 40 ten 62 ^c AAGCAAACCAGAAGATGCGAACTTT 40 eleven 45 GACCTGTATTCTGGCCTGAATCAGA 48 12 GGCCTCTGCCTCTTATCAGTT 52 13 GCCTCTGCCTCTTATCAGTTG 52 fourteen GCCTCTTTATCAGTTGGCGTTTT 48 fifteen AGGATCACCTGTCACTGAAGG 52 16 GGATCACCTGTCACTGAAGGA 52 17 GAATTGGAGCAAAGTGGTTAT 38 eighteen GGAGCAAAGTGGTTATTATGT 38 19 GCAAACCAGAAGATGCGAACT 48 twenty ACCTGTATTCTGGCCTGAATC 48 21 GCCTGAATCAGAGACGCATCT 52 22 CTGAAATACTATGGCAACACAATGATAAA 31 23 AAACATAGGCAGTGATGAGGATCACCTGT 45 24 ATTGTCATAGTGGACATCTGCATCACTGG 45 25 CTGTATTCTGGCCTGAATCAGAGACGCAT 48 26 CD3- ^δd GATACCTATAGAGGAACTTGA 38 27 GACAGAGTGTTTGTGAATTGC 43 28 GAACACTGCCTCTCAGACATTA 43 29 GGACCCACGAGGAATATATAG 48 thirty GGTGTAATGGGACAGATATAT 38 31 GCAAGTTCATTATCGAATGTG 38 32 GGCTGGCATCATTGTCACTGA 52 33 GCTGGCATCATTGTCACTGAT 48 34 GCATCATTGTCACTGATGTCA 43 35 GCTTTGGGAGTCTTCTGCTTT 48 36 TGGAACATAGCACGTTTCTCTCTGGCCTG 52 37 CTGCTCTCAGACATTACAAGACTGGACCT 48 38 ACCGTGGCTGGCATCATTGTCACTGATGT 52 39 TGATGCTCAGTACAGCCACCTTGGAGGAA 52 40 CD3- ^γe GGCTATCATTCTTCTTCAAGG 43 41 GCCCAGTCAATCAAAGGAAAC 48 42 GGTTAAGGTGTATGACTATCA 38 43 GGTTCGGTACTTCTGACTTGT 48 44 GAATGTGTCAGAACTGCATTG 43 45 GCAGCCACCATATCTGGCTTT 52 46 GGCTTTCTCTTTGCTGAAATC 43 47 GCTTTCTCTTTGCTGAAATCG 43 48 GCCACCTTCAAGGAAACCAGT 52 49 GAAACCAGTTGAGGAGGAATT 43 fifty GGCTTTCTCTTTGCTGAAAATCGTCAGCAT 45 51 AGGATGGAGTTCGCCAGTCGAGAGCTTCA 55 52 CCTCAAGGATCGAGAAGATGACCAGTACA 48 53 TACAGCCACCTTCAAGGAAACCAGTTGAG 48 54 CD3-ζ ^f. TGCTGTTGACAGTGAGCGACCTCTTGCCAGGATATTTTATTTAGTGAAGCCACAGATGTAAATAAATATCCTGGCAAGAGGGTGCCTACTGCCTCGGA 68 TGCTGTTGACAGTGAGCGACCCTCTTGCCAGGATATTTATTAGTGAAGCCACAGATGTAATAAATATCCTGGCAAGAGGGCTGCCTACTGCCTCGGA 69 TGCTGTTGACAGTGAGCGACCTCAGTATCCTGGATCTGAATAGTGAAGCCACAGATGTATTCAGATCCAGGATACTGAGGGTGCCTACTGCCTCGGA 70 TGCTGTTGACAGTGAGCGCGGATGGAATCCTCTTCATCTATAGTGAAGCCACAGATGTATAGATGAAGAGGATTCCATCCATGCCTACTGCCTCGGA 71

^a With reference to Accession No. EU030678.

^b With reference to Accession No. AY247834.

^c With reference to accession number NM_000733.

^d With reference to accession number NM_000732.

^e With reference to accession number NM_000073.

^f. With reference to accession number NM_000734.

TCR-alpha, TCR-beta, TCR-gamma, TCR-delta, CD3-gamma, CD3-delta, CD3-epsilon, or CD3-zeta mRNAs can be targeted alone or together using different target shRNAs. The TCR-β and TCR-α chains are composed of variable and constant portions. Several shRNA guides have been developed for the constant portions of these TCR/CD3 sequences. One combination of shRNAs can be used for each of the molecular targets to identify the most effective inhibitor of TCR expression. Using established protocols, each shRNA construct is cloned, for example, into the pLko.1 plasmid or the pSMc2 vector, and expression is controlled by a promoter commonly used in the art, for example, the U6p promoter. The resulting construct can be screened and the accuracy of the sequencing confirmed. The shRNA expression plasmid can then be transfected into any suitable host cell (eg, 293T), along with a packaging plasmid and a wrapper plasmid for packaging. Primary human blood mononuclear cells (PNMC) are isolated from healthy donors and activated with a low dose of soluble anti-CD3 and, for example, 25 U/ml to 50 U/ml, rhuIL-2 for 72 hours. Although retroviral transduction does not require activation of T lymphocytes, transduction is more efficient and allows the cells to continue to develop into IL-2. Activated cells are washed and transduced, for example by 1 hour spin-fection at 30° C. followed by a 7 hour rest period.

According to another embodiment of the present invention, overexpression of a dominant negative inhibitor protein is capable of resulting in a halt in TCR expression or function. In this embodiment, a minigene is prepared that includes part or all of a polynucleotide encoding one of the TCR components (e.g., TCR-alpha, TCR-beta, CD3-gamma, CD3-delta, CD3-epsilon, or CD3-zeta), but modify it so that: (1) it does not contain the main signaling motif (eg, ITAM) required for protein function; (2) modified so that it does not bind properly with its other natural TCR components; or (3) could bind correctly but did not bind ligands (eg, a truncated TCr-beta minigene). In addition, the minigene can be modified to include an inhibitory signaling motif, eg, the cytoplasmic domain from the KIR protein, which alters cell signaling and promotes inhibitory signals through the recruitment of phosphatases, eg, SHP1 and SHP2.

These minigenes may also encode a portion of a protein that serves as a means of identifying a minigene that is overexpressed. For example, polynucleotides encoding a truncated CD19 protein that contains a binding site for an anti-CD19 mAb can be operably linked to a minigene such that the resulting cell that expresses said minigene expresses the encoded protein and can be identified by anti-CD19 mAb. This identification makes it possible to determine the degree of expression of the minigene and to isolate cells expressing the indicated protein (and which do not contain a functional TCR).

In one embodiment of the present invention, overexpression of a minigene lacking signaling motif(s) results in the formation of a TCR complex that cannot signal correctly when the TCR contacts its MCH ligand peptide on an antagonistic cell. According to a non-limiting embodiment of the present invention, high expression of said minigene (and encoded polypeptide) results in displacement of the natural complete protein when TCR components bind, leading to the formation of a TCR complex that cannot signal. In another embodiment, said minigene comprises, or alternatively consists of, a polynucleotide encoding all or part of CD3 zeta, CD3 gamma, CD3 delta, or CD3 epsilon polypeptides that do not contain ITAM motifs that are needed for signal transduction. The CD3-zeta protein contains three ITAM motifs in the cytoplasmic portion, and according to one embodiment of the present invention, removal of all of these motifs through processing results in the suppression of proper signaling from the TCR in any complexes in which these modified proteins are included. See, for example, TIM5-8 in Table 2, which corresponds to SEQ ID nos: 72-79. Said construct may include ITIM or another signaling motif known to alter cellular signaling and promote inhibitory signals by recruiting phosphatases such as SHP1 and SHP2. See, for example, TIM9-13 in Table 2, which corresponds to SEQ ID NO: 80-89.

According to one embodiment of the present invention, said minigene comprises a polynucleotide encoding complete polypeptides or a portion of CD3-zeta, CD3-gamma, CD3-delta, or CD3-epsilon polypeptides with mutations, e.g. . See, for example, TIM14-19 in Table 2, which correspond to SEQ ID NO: 90-101.

In yet another embodiment of the present invention, the overexpression of the minigene is modified so that the encoded polypeptide can bind to some but not all of its natural partners, competing with the normal protein for said binding proteins. According to another non-limiting hypothesis in the present invention, the high level of expression of this minigene (and the encoded polypeptide) leads to the displacement of natural partner proteins and prevents the assembly of the functional TCR complex, which requires all components to be connected in the correct ratios and with the correct protein-protein interaction. According to another embodiment of the present invention, the minigenes comprise, or alternatively consist of, all or part of the polynucleotides encoding the full-length protein (e.g., TCR-alpha, TCR-beta, CD3-gamma, CD3-delta, CD3-epsilon, or CD3-zeta ), but containing selected substitutions in the sequence encoding the amino acids in the transmembrane portion of the protein, which is known to be required for assembly with other TCR/CD3 proteins.

According to one preferred embodiment of the present invention, selected substitutions in the amino acid coding sequence in the transmembrane portion of the protein known to be required for assembly with other TCR/CD3 proteins include, but are not limited to, an arginine residue at position 5 in the transmembrane region of TCR-alpha; a lysine residue at position 10 in the transmembrane region of TCR-alpha; a lysine residue at position 9 in the transmembrane region of TCR-beta; a glutamic acid residue in the transmembrane region of CD3-gamma; an aspartic acid residue in the transmembrane region of CD3 epsilon; and an aspartic acid residue in the transmembrane region of CD3-zeta.

Overexpression of the truncated TCR-alpha, TCR-beta, CD3-gamma, or CD3-delta protein results in the formation of a TCR complex that cannot bind to MCH ligand peptides and thus does not function to activate T cells. See Figure 2, panels (A) and (B). According to another embodiment of the present invention, the minigenes contain, or alternatively consist of, polynucleotides encoding the entire transmembrane or cytoplasmic portions of said proteins and portions of the extracellular region, but do not contain polynucleotides encoding all or part of the first extracellular domain (i.e., the outermost domain containing the ligand-binding site). In a preferred embodiment, the polynucleotides of said minigenes do not encode the V-alpha and V-beta polypeptides of the TCR-alpha and TCR-beta chains. In one embodiment, polynucleotides of said minigenes can be operably linked to polynucleotides encoding an epitope tag protein (eg, CD19) to allow identification of cells expressing said genes by mAb.

In another embodiment, these minigenes can be expressed using a strong viral promoter, such as the retrovirus 5'LTR, CMV, or the SV40 promoter. Typically, said promoter is immediately upstream of said minigene and drives high expression of the minigene mRNA. In another embodiment, said construct encodes a second polynucleotide sequence under the control of the same promoter (eg, using an IRES DNA sequence in between) or under the control of a different promoter. The sequence of said second polynucleotide may encode a functional non-TCR receptor conferring specificity for T cells. Examples of said polynucleotide include, without limitation, chimeric NKG2D, chimeric NKp30, chimeric NKp46, or chimeric anti-Her2neu. In a further embodiment, the promoter-minigene complex is constructed in a retrovirus plasmid or other suitable expression plasmid and transduced directly into T cells using standard methods (Zhang, T. et al., (2006) Cancer Res., 66(11) 5927- 5933 Barber, A. et al., (2007) Cancer Res., 67(10):5003-5008).

Following virus transduction and expansion using any of the methods discussed previously, any T cells that still express TCR/CD3 are removed with anti-CD3 mAb and magnetic beads using Miltenyi separation columns as described previously (Barber , A. et al., (2007) Cancer Res., 67(10):5003-5008). Subsequently, T cells are washed and cultured with IL-2 (25 U/ml) for 3-7 days to allow expansion of effector cells, similar to the use of cells in vivo.

Expression of TCR βα and CD3 can be assessed using flow cytometry and quantitative real-time PCR (qRT-PCR). mRNA expression of TCR-α, TCR-β, CD3ε, CD3-ζ and GAPDH (as control) can be analyzed by kRT-PCR using the ABI7300 real-time PCR instrument and TAQMAN® gene-specific primers using methods similar to in the manner described by Sentman, C.L. et al. ((2004) J. Immunol. 173:6760-6766). Changes in expression on the cell surface can be determined using antibodies specific for TCR-α, TCR-β, CD3ε, CD8, CD4, CD5 and CD45.

It is possible that a single type of shRNA may not be sufficient to suppress TCR expression on the cell surface. In this case, it is possible to simultaneously apply several TCR shRNAs directed to different components of the TCR complex. Assembly of the TCR complex on the cell surface requires each component of the TCR complex, so the loss of one of these proteins can lead to loss of TCR expression on the cell surface. While some or even all of TCR expression may be retained, whether a receptor will elicit an immune response is determined by the function of the receptor. The critical indicator is functional deficiency, and not a complete absence on the surface. In general, the lower the level of TCR expression, the less likely it is that sufficient cross-linking of the TCR will occur to activate T cells through the TCR complex. While particular embodiments cover targeting TCR alpha, TCR beta, and CD3 epsilon, other components of the TCR complex, such as CD3 gamma, CD3 delta, or CD3 zeta, can also be targeted.

The main goal of TCR removal from the cell surface is to prevent T cell activation by incompatible MHC alleles. To determine whether a decrease in TCR expression with each shRNA or minigene construct is sufficient to alter T cell function, T cells can be assayed for: (1) cell survival in vitro; (2) proliferation in the presence of mitomycin C-treated allogeneic PBMCs; and (3) cytokine production in response to allogeneic PBMC, anti-CD3 mAb, or anti-TCR mAb.

To evaluate cell survival, transduced T lymphocytes are distributed in RPMI complete medium (Roswell Park Cancer Institute) with rhuIL-2 (eg 25 U/ml - 50 U/ml). Cells are placed in petri dishes at the same density at the start of culture, and samples can be taken for cell count and viability once a day for 7 or more days. To determine if T cells express enough TCR to induce a response to allogeneic cells, transduced or control T cells are cultured with mitomycin C-treated allogeneic or synergistic PBMCs, for example, in a 4:1 ratio. These T cells are preloaded with CFSE, which is a permeable cell dye that is evenly distributed between daughter cells after division. The degree of cell division can be easily determined by flow cytometry. Another hallmark of T cell activation is the production of cytokines. To determine if each shRNA construct inhibits T cell function, transduced T cells are cultured with different doses of anti-CD3 mAb (from 1.6 to 5000 ng/ml). After 24 hours, the cell-free supernatant was removed and the amount of IL-2 and/or INF-γ produced was determined by ELISA (enzyme-linked immunosorbent assay). PMA/ionomycin was used as a positive control for T cell stimulation and T cells alone were used as a negative control.

Exemplary TIMs, e.g. shRNAs, truncated dominant negative proteins, KIR fusion dominant negative proteins, and dominant negative proteins with altered amino acid sequences due to single nucleotide substitutions, designed to target key components of the TCR complex, such as CD3 epsilon, were evaluated. or CD3-zeta, on effector T cells, and the results of this assessment are presented below in Table 2. These results demonstrate that TCR-deficient T cells can be obtained with TIM.

It is possible that removal of the TCR-alpha or TCR-beta components may allow preferential expansion of TCR-gamma/delta T lymphocytes. Such T cells are very rare in the blood, but the presence of these cells can be determined using antibodies to TCR-gamma/delta. If these cells naturally develop, targeting of CD3 epsilon, which is required for TCR-alpha/beta and TCR-gamma/delta to be expressed on the cell surface, can be applied. Both Il-2 and INF-γ are major effector cytokines that trigger T cell expansion and macrophage activation. Therefore, the lack of production of these cytokines is a sign of functional inactivation. Changes in the level of other cytokines such as TNF-α (tumor necrosis factor-α) can also be measured. Any reduction in T cell survival upon exclusion of TCR expression can be determined by culturing TCR-deficient T cells with PBMCs that better fit the in vivo environment and provide support for T cell survival.

Methods for obtaining TCR-deficient T cells expressing a functional receptor not characteristic of T cells

According to another embodiment of the present invention, T cells stably deficient in expression of a functional TCR express a functional non-TCR receptor. In this embodiment, elimination of TCR function (as previously described) is also combined with expression of one or more exogenous non-TCR targeted receptors (eg, such as chimeric NKG2D (chNKG2D) or Fv molecules). This embodiment provides "universal" cell products that can be stored for future therapy in any patient with any type of cancer, provided that an appropriate targeting receptor is used.

Additional embodiments of the present invention include recombinant expression of receptors in said TCR-deficient T cells, such as chNKG2D, Fv chimeric domains, NKG2D, or any other receptor to initiate signals in T lymphocytes, resulting in the creation of potent, specific effector T cells. . Those skilled in the art can select the appropriate receptor to be expressed in TCR-deficient T cells, depending on the disease to be treated. For example, receptors that can be expressed in TCR-deficient T cells for the treatment of cancer may include any ligand receptor that has been identified in cancer cells. Such receptors include, without limitation, NKG2D (GENBANK accession number BC039836), NKG2A (GENBANK accession number AF461812), NKG2C (GENBANK accession number AJ001684), NKG2F, LLT1, AICL, CD26, NKRP1, NKp30 (e.g. GENBANK access number AB055881), NKp44 (for example, GENBANK access number AJ225109), NKp46 (for example, GENBANK access number AJ001383), CD244 (2B4), DNAM-1, and NKp80.

According to another embodiment of the present invention, such receptors include, without limitation, chimeric receptors containing a ligand-binding domain derived from NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM -1 and NKp80, or an anti-tumor antibody such as anti-Her2neu and anti-EGFR, and a signal domain derived from CD3-zeta (CD3ζ) (e.g., GENBANK accession number NM_198053) (SEQ ID NO: 62), Dap10 (for example, GENBANK access number AF072845), CD28, 41BB and/or CD40L.

According to an additional embodiment of the present invention, said chimeric receptor binds to MIC-A, MIC-B, Her2neu, EGFR, mesothelin, CD38, CD20, CD19, PSA, MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7 , MUC8, MUC12, MUC13, MUC15, MUC16, MUC17, MUC19, MUC20, estrogen receptor, progesterone receptor, RON, or one or more members of the ULBP/RAET1 family, including ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.

For purposes of illustration only, shRNAs or minigenes that have been shown to abolish expression on the cell surface of the TCR complex are co-expressed with the chNKG2D receptor using one or more viral vectors. To achieve co-expression in the same vector, shRNA can be run from the U6 promoter and the chNKG2D receptor from the PGK promoter. In another embodiment, if an IRES sequence is used to separate genetic elements, then only one promoter is used.

The NK cell C-type lectin-like domain lectin-like domain receptor protein, particularly suitable for use in a chimeric receptor, includes a receptor expressed on the surface of natural killer cells, and when bound to its cognate ligand(s), it alters the activation of the NK cell. Said receptor may function alone or in conjunction with other molecules. Ligands for these receptors are typically expressed on the cell surface of one or more types of tumors, for example, tumors associated with colon, lung, breast, kidney, ovary, cervix and prostate cancer; melanoma; myeloma; leukemias and lymphomas Wu, et al. (2004) J. Clin. Invest. 114:60-568; Groh, et al. (1999) Proc. Natl. Acad. sci. USA 96:6879-6884; Pende, et al. (2001) EUR. J. Immunol. 31:1076-1086), but are not widely expressed on cell surfaces in normal tissues.

Examples of such ligands include, without limitation, MIC-A, MIC-B, heat shock proteins, ULBP binding proteins (e.g., ULBP 1-4), and non-classical HLA molecules such as HLA-E and HLA-G, while classical MHC molecules , such as HLA-A, HLA-B or HLA-C and their alleles are not considered strong ligands of the lectin-like domain lectin-like domain receptor protein of the C-type NK cells according to the present invention. The C-type lectin-like domain receptors of NK cells that bind to these ligands generally have a type II protein structure in which the N-terminus of the protein is extracellular. In addition to the NK cell receptors listed above, additional examples of NK cell receptors include, but are not limited to, dectin-1 (GENBANK accession number AJ312373 or AJ312372), mast cell function-associated antigen (GENBANK accession number AF097358), HNKR-P1A (GENBANK accession number AF097358), access number in the GENBANK system U11276), LLT1 (access number in the GENBANK system FA133299), CD69 (access number in the GENBANK system NM_001781), homolog CB69, CD72 (access number in the GENBANK system NM_001782), CD94 (access number in the GENBANK system NM_00262 or NM_007334 ), KLRF1 (GENBANK accession number NM__016523), oxidized LDL receptor (GENBANK accession number NM__002543), CLEC-1, CLEC-2 (GENBANK accession number NM__016509), NKG2D (GENBANK accession number BC039836), NKG2C (GENBANK accession AJ001684), NKG2A (GENBANK accession AF461812), NKG2E (GENBANK accession AF461157), WUGSC:H_DJ0701016.2 or myeloid DAP12-associated lectin (MD L-1; access number in the GENBANK system AJ271684). According to preferred embodiments of the present invention, the NK cell receptor is human NKG2D (SEQ ID no: 58) or human NKG2C (SEQ ID no: 59).

Similar type I receptors that may be useful in the chimeric receptor include NKp46 (GENBANK accession number AJ001383), NKp30 (GENBANK accession number AB055881), or NKp44 (GENBANK accession number AJ225109).

As an alternative to the NK cell lectin-like domain lectin-like domain receptor protein, a protein associated with the lectin-like domain lectin-like domain of the NK cell type lectin-like domain can be used in the chimeric receptor protein. Generally, proteins associated with the lectin-like domain C-type NK cell lectin-like domain receptor protein are understood to mean proteins that interact with the receptor and thereby induce a signal. Suitable human proteins that function in this manner further include, without limitation, DAP10 (e.g., GENBANK accession number AF072845) (SEQ ID NO:60), DAP12 (e.g., GENBANK accession number AF019562) (SEQ ID NO:61) and FcR gamma.

An immune signaling receptor with an immunoreceptor activation motif based on tyrosine (ITAM), (Asp/Glu)-Xaa-Xaa-Tyr*-Xaa-Xaa-(Ile/ Leu)-Xaa _6-8 -Tyr*-Xaa-Xaa-(Ile/Leu) (SEQ ID NO: 55-57), which is involved in the activation of cell responses through immune receptors. Similarly, when a protein associated with the lectin-like domain lectin-like domain of the C-type NK cells is used, the immune signaling receptor can be connected to the C-terminus of this protein (FIG. 1). Suitable immune signaling receptors for use in the chimeric receptor of the present invention include, without limitation, the T cell receptor zeta chain, eta, which differs from the zeta chain only in the most extreme exon at the C-terminus due to alternative mRNA splicing zeta, delta -, gamma and epsilon chains of the T-cell receptor (CD3 chains) and the gamma subunit of the FcR1 receptor. In specific embodiments, in addition to the immune signaling receptors described above, the immune signaling receptor is also CD3-zeta (CD3ζ) (e.g., GENBANK accession number for human genes NM_198053 and NM-000734) (SEQ ID NO: 62 and SEQ ID no: 64, respectively), or the gamma chain of the Fc-epsilon receptor (for example, GENBANK accession number M33195) (SEQ ID no: 63) or the cytoplasmic domain, or a splicing variant thereof. In particular, for example, CD3-zeta has 2 alternative transcript-splicing variants encoding different isoforms, ie, transcript variant 1 (SEQ ID no: 62) and transcript variant 2 (SEQ ID no: 64). The encoded isoform of variant 2 (SEQ ID NO: 65) omits an internal amino acid compared to variant 1.

In specific embodiments, the chimeric receptor of the present invention is a hybrid between NKG2D and CD3-zeta, or Dap10 and CD3-zeta.

In the nucleic acid construct of the present invention, the promoter is operably linked to the nucleic acid sequence encoding the chimeric receptor of the present invention, i.e., positioned to promote transcription of the messenger RNA from the DNA encoding said chimeric receptor. Said promoter may be of genomic origin or may be generated synthetically. A variety of T cell promoters are well known in the art (eg, the CD4 promoter disclosed in Marodon, et al. (2003) Blood 101(9):3416-23). Such a promoter may be constitutive or inducible, with induction associated with a specific cell type or a specific level of maturity. Alternatively, a number of well-known viral promoters are also suitable. Promoters of interest include the β-actin promoter, the SV40 early and late promoters, the immunoglobulin promoter, the human cytomegalovirus promoter, the retrovirus promoter, and the Freund's spleen necrosis virus promoter. Said promoters may or may not be associated with enhancers, and said enhancers may be naturally associated with a particular promoter or with different promoters.

The open reading frame sequence encoding the chimeric receptor can be obtained from a DNA genomic source, a cDNA source, or can be synthesized (eg, by PCR) or by combining these sources. Depending on the size of the genomic DNA and the number of introns, it may be desirable to use cDNA or a combination of the two, as introns have been shown to stabilize mRNA or provide T cell-specific expansion (Barthel and Goldfeld (2003) J. Immunol. 171(7): 3612-9). Also, the use of endogenous or exogenous non-coding regions for mRNA stabilization can be of additional benefit.

To express a chimeric receptor according to the present invention, a naturally occurring or endogenous transcription initiation region or nucleic acid sequence encoding the N-terminal component of said chimeric receptor can be used to generate the chimeric receptor in the target host. Alternatively, an exogenous transcription initiation region can be used which allows for constitutive or inducible expression, whereby expression can be controlled depending on the target host, the desired level of expression, the nature of the target host, and the like.

Similarly, the signal sequence that directs the chimeric receptor to the membrane surface may be the endogenous signal sequence of the N-terminal component of the chimeric receptor. Optionally, in some cases, it may be desirable to replace this sequence with a different signal sequence. However, the signal sequence chosen must be compatible with the T cell secretory pathway in order for the chimeric receptor to be present on the surface of the T cell.

Similarly, the termination region may be a naturally occurring or endogenous transcriptional termination region of the nucleic acid sequence encoding the C-terminal component of the chimeric receptor. Alternatively, the termination area can be obtained from another source. In most cases, it is considered that the source of the termination region is not critical for the expression of the recombinant protein, and a wide range of termination regions can be used without adversely affecting expression.

As will be appreciated by those skilled in the art, in some cases, several amino acids at the ends of the natural killer C-type lectin-like domain receptor (or protein associated with it) or the immune signaling receptor can be deleted, usually no more than 10, even more often no more than 5 residues. It may also be desirable to introduce a small number of amino acids at the boundaries, usually no more than 10, more often no more than 5 residues. Deletion or insertion of amino acids is usually a consequence of the need to obtain a design that provides for traditional restriction sites, ease of manipulation, increased expression, or the like. In addition, substitution of one or more amino acids for other amino acids can occur for similar reasons, but typically do not replace more than five amino acids in any one of the domains.

A chimeric construct that encodes a chimeric receptor can be prepared by conventional methods. Since naturally occurring sequences are used in most cases, naturally occurring genes are isolated and manipulated appropriately (eg, when a type II receptor is used, the immune signaling receptor may need to be inverted) so that the different components can be properly coupled. Thus, the nucleic acid sequence encoding proteins at the N-terminus and C-terminus of the chimeric receptor can be isolated by polymerase chain reaction (PCR) using appropriate primers, which leads to the deletion of unwanted parts of the gene. Alternatively, restriction enzyme digestion of cloned genes can be used to create a chimeric construct. In any case, the sequences can be chosen so that there are restriction sites that contain "blunt" ends, or contain complementary overlap.

Various manipulations in obtaining a chimeric construct can be carried out in vitro, and according to specific variants of implementation of the specified chimeric construct is introduced into vectors for cloning and expression in the appropriate host using standard methods of transformation or transfection. Thus, after each manipulation, the construct resulting from the joining of the DNA sequences is cloned, the vector is isolated, and the sequence is screened to ensure that said sequence encodes the desired chimeric receptor. The sequence can be screened by restriction analysis, sequencing, or the like.

It is contemplated that the chimeric construct may be introduced into T cells as naked DNA or as part of a suitable vector. Methods for stable transfection of T cells by electroporation using naked DNA are known in the art. See, for example, US Patent No. 6,410,319. The term "naked DNA" generally refers to DNA encoding a chimeric receptor of the present invention contained in a plasmid-based expression vector in the correct orientation for expression. Preferably, the use of naked DNA reduces the time required to obtain T-lymphocytes expressing the chimeric receptor of the present invention.

Alternatively, a viral vector (eg, retrovirus vector, adenovirus vector, adeno-associated virus vector, or lentiviral vector) can be used to introduce the chimeric construct into T cells. Suitable vectors for use in implementing the method of the present invention do not replicate in the subject's T cells. A wide range of vectors are known that are based on viruses, when the number of copies of the virus in the cell is kept low enough to keep the cell viable. Illustrative vectors include pFB-neo vectors (STRATAGENE™) as well as HIV, SV40, EBV, HSV or BPV vectors. Once it has been established that a transfected or transduced T cell is capable of expressing the chimeric receptor as a surface membrane protein with the desired regulation and at the desired level, it can be determined whether said chimeric receptor is functional in the host cell to provide the desired signal induction ( eg production of Rantes, Mip1-alpha, GM-CSF when stimulated with the appropriate ligand).

As described above, primary human PBMCs are isolated from healthy donors and activated with low doses of sparingly soluble anti-CD3 (eg 40 ng/mL) and rhuIL-2 (eg 50 U/mL), anti-CD3/anti-CD28 beads and rhuIL-2, or irradiated antigen presenting cells and rhuIL-2. The activated T cells are then washed and transduced using a retrovirus, eg sonication for 1 hour at 32° C. followed by a rest period of 7 hours. Although lentiviral transduction does not require T cell activation, transduction is more efficient and allows the cells to continue to develop into IL-2. Activated cells are washed and transduced as described above followed by a dormant period and then transferred to a selection step, eg with G418 for 3 days. After selection, the cells are washed and cultured in IL-2 for 2-7 days to allow expansion of the effector cells in a manner similar to that which occurs when the cells are used in vivo. The change in the expression of receptors on the cell surface is analyzed using antibodies specific for CD3, CD4, NKG2D or CD5. Expression of an exogenous, non-TCR receptor is expected to be upregulated in cells that have been transduced to express that particular receptor, e.g., T cells transduced with a chNKG2D-expressing retrovirus are expected to be upregulated in cell surface expression of chNKG2D .

Expression of TCRαβ, CD3 and NKG2D can be assessed by flow cytometry and qRTPCR as discussed in this application. You can also determine the number of CD4+ and CD8+ T-lymphocytes. The total number of cells and the percentage of T-lymphocytes deficient in the TCR complex, TCR-competent and expressing chNKG2D can be determined using flow cytometry. This number can be compared to PBMCs transduced with shRNA alone or with chNKG2D genes (as a control). Cells transduced with the vector alone can also be included as controls.

After virus transduction and expansion, TCR+ and TCR- cells can be separated using magnetic bead mAbs on Miltenyi separation columns, and TCR-deficient T cells expressing the chNKG2D receptor are detected and isolated. For example, chNKG2D expression can be verified by real-time quantitative PCR using specific primers for the chNKG2D receptor (Zhang, T. et al. (2007) Cancer Res. 67:11029-11036; Barber, A. et al. (2008 ) J. Immunol. 180:72-78). The function of said TCR-deficient chNKG2D+ cells can be determined by culturing said cells with PNMC or tumor cells that express chNKG2D ligands. T cell proliferation and cytokine production (eg, IFN-γ and/or IL-2) can be determined by flow cytometry and ELISA, respectively. In order to identify T cells that lost TCR function and retained chNKG2D function, transduced or control T cells were cultured with anti-CD3 antibody (1.6-5000 ng/mL), allogeneic peripheral blood mononuclear cells (PBMCs) treated with mitomycin C, or syngeneic PBMCs. The culture supernatants are taken and the level of cytokine production (IFN-gamma and/or IL-2) is determined by ELISA. Said T cells can be preloaded with CFSE, which is a permeant cell dye that distributes uniformly between daughter cells after division. The degree of cell division can be easily determined by flow cytometry.

Another hallmark of T cell activation is the production of cytokines. To determine whether TCR-deficient chNKG2D+ cells cause T cell activation, these T cells are co-cultured with mitomycin C-treated allogeneic PBMC or tumor cells: P815-MICA (mouse tumor expressing MICA - ligand for NKG2D), P815 , A2008 (human ovarian tumor - ligand+ NKG2D) and U266 (human myeloma cell line, ligand+ NKG2D). After 24 hours, the cell-free supernatant was removed and the amount of IL-2 and INF-γ produced was determined by ELISA. T cells alone and in culture with PMBC were used as a negative control. In T-cells expressing TIM7 and TIM8, which also coexpressed chNKG2D, more than 40% reduction in IFN-γ production was observed (results not shown in Figure 3).

Subsequently, the transduced T cells are reintroduced into the subject to activate antitumor responses in said subject. To facilitate administration, the transduced T cells of the present invention can be formulated into a pharmaceutical composition or made into an implant suitable for in vivo administration with appropriate bases and solvents, which may also be pharmaceutically acceptable. Methods for preparing such a composition or implant have been described in the art (see, for example, Remington's Pharmaceutical Sciences, 16th Ed., Mack, ed. (1980)). If applicable, the transduced T cells can be formulated into a semi-solid or liquid form, such as a capsule, solution, injection, inhalation or aerosol, by the usual methods for their respective route of administration. Methods known in the art can be used to prevent or minimize absorption of the composition before it reaches the target tissue or organ, or to ensure timely release of the composition. However, it is desirable to use a pharmaceutically acceptable form that will not be ineffective against cells expressing the chimeric receptor. Thus, it is desirable that the transduced T cells can be made into a pharmaceutical composition containing a balanced salt solution, preferably Hank's balanced salt solution or normal saline.

Methods for alleviating or reducing symptoms, treating or preventing diseases or disorders using TCR-deficient cells

Also, the present invention is directed to methods of reducing or alleviating, or preventing or treating diseases and disorders using TCR-deficient T cells described in this application, their selected populations or therapeutic compositions containing them. In one embodiment, the TCR-deficient T cells described herein, isolated populations thereof, or therapeutic compositions containing them are used to reduce or alleviate, or prevent or treat, cancer, infection, one or more autoimmune disorders, radiation sickness, or for the prevention or treatment of graft-versus-host disease (GVHD) or graft rejection in a subject undergoing organ or tissue transplant surgery.

The TCR-deficient T cells described herein, their isolated populations, or therapeutic compositions containing them are useful for altering autoimmune responses or transplant rejection because these effector cells can be grown into TGF-β during development and will differentiate, becoming induced by T-regulatory lymphocytes. In one embodiment, functional non-TCR receptors are used to confer on said induced T-regulatory lymphocytes the functional specificity they require to exercise their inhibitory function in a diseased tissue site. Thus, it is possible to grow a large number of antigen-specific regulatory T cells for use in patients. The expression of FoxP3, which is important for the differentiation of T-regulatory lymphocytes, can be analyzed by flow cytometry, and the functional suppression of T-cell proliferation by these T-regulatory lymphocytes can be analyzed by studying the decrease in T-cell proliferation after anti-CD3 stimulation in co-culture.

Another embodiment of the present invention is directed to the use of the TCR-deficient T cells described herein, their isolated populations, or therapeutic compositions containing them, for the prevention or treatment of radiation sickness. One of the problems after exposure to radiation (eg, dirty nuclear bomb explosion, radiation leakage) or other pathological condition that affects the bone marrow (certain drug treatments) is the restoration of the hematopoietic system. In patients undergoing bone marrow transplantation, the absolute lymphocyte count at day 15 after transplantation correlates with successful outcome. Such patients with high lymphocyte counts recover well because it is important that there is a good recovery of lymphocytes. The reason for this action is not clear, but it may be due to the protection of lymphocytes from infection and / or the production of growth factors that favor the restoration of hematopoiesis.

In this embodiment, the TCR-deficient T cells described herein, their isolated populations, or therapeutic compositions containing them result in the production of a large number of T cells that are unable to respond to allogeneic MHC antigens. Therefore, these T cells can be used to restore people, and they can provide protection against infection, leading to faster recovery of people suffering from complete or partial damage to the bone marrow due to exposure to radiation. In cases of catastrophic or unanticipated exposure to high doses of radiation, the TCR-deficient T cells described herein possessing a different functional receptor, isolated populations thereof, or therapeutic compositions containing them, can be rapidly administered by infusion to patients to provide some degree of recovery of their immune response. response and production of growth factors during the first days to weeks, until one's own hematopoietic cells recover themselves, or until the person receives an additional source of hematopoietic stem cells as a treatment (for example, bone marrow transplantation).

Those skilled in the art will understand how to treat cancer, infection, transplant rejection, one or more autoimmune disorders, radiation sickness, or GVHD based on their experience with other types of T cells.

In addition to the exemplary TCR-deficient chNKG2D+ T cells described herein, it is contemplated that TCR-deficient T cells can be modified or engineered to express other functional receptors useful in the treatment of diseases such as cancer or infection, as described earlier. Briefly, the methods of treatment according to the present invention involve the use of TCR-deficient T cells expressing functional non-TCR receptors such as chNKG2D, Fv chimeric domains, NKG2D, or any other receptor to initiate a signal to T cells, thereby creating powerful, specific effector T cells. Those skilled in the art should be able to select the appropriate receptor for expression by TCR-deficient T cells, depending on the disease to be treated. For example, receptors that may be expressed by TCR-deficient T cells for cancer treatment may include any receptor that binds to a ligand that has been identified on cancer cells. Such receptors include, without limitation, NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1, and NKp80.

According to another embodiment of the present invention, such receptors include, without limitation, chimeric receptors containing a ligand-binding domain from NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1 and NKp80, or from an anti-tumor antibody such as anti-Her2neu and anti-EGFR, and a signal domain derived from CD3-zeta, Dap10, CD28, 41NN and CD40L.

In a further embodiment, said chimeric receptor binds to MIC-A, MIC-B, Her2neu, EGFR, mesothelin, CD38, CD20, CD19, PSA, MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8 , MUC12, MUC13, MUC15, MUC16, MUC17, MUC19, MUC20, estrogen receptor, progesterone receptor, RON, or one or more members of the ULBP/RAET1 family, including ULBP1, ULBP2, ULBP3, ULBP5, and ULBP6.

The present invention also encompasses TCR-deficient T cells that express a pathogen-associated receptor other than TCR, and the use of said TCR-deficient T cells expressing a pathogen-associated receptor for the treatment or prevention of infectious diseases. In this embodiment, said non-TCR receptor binds to a viral antigen or virus-induced antigen found on the surface of an infected cell. The infection to be treated or prevented may be caused by, for example, a virus, bacterium, protozoa, or parasites. Viruses that can be controlled include, without limitation, HCMV, EBV (Epstein-Barr virus), hepatitis C (HCV), Ebola virus, VSV (vesicular stomatitis virus), influenza, varicella, adenovirus, herpes simplex virus 1 (HSV- 1), herpes simplex virus 2 (HSV-2), rinderpest virus, rhinovirus, echovirus, rotavirus, respiratory syncytial virus, papillomavirus, cytomegalovirus (CMV), echinovirus, arbovirus, hantavirus, coxsackievirus, mumps virus, measles virus , rubella virus, polio virus and / or human immunodeficiency virus type 1 or 2 (HIV-1, HIV-2). Non-viral infections that can be treated with TCR-deficient T cells include, without limitation, those caused by Staphylococcus spp., Enterococcus spp., Bacillus anthracis, Lactobacillus spp., Listeria spp., Corynebacterium diphtheriae, Nocardia spp., Streptococcus spp., Pseudomonas spp., Gardnerella spp. , Streptomyces spp., Thermoactinomyces vulgaris, Treponema spp., Camplyobacter spp., Raeruginosa spp., Legionella spp., N. gonorrhoeae, N. meningitides, F. meningosepticum, F. odoraturn, Brucella spp., B. pertussis, B. bronchiseptica, E. coli, Klebsiella, Enterobacter, S. marcescens, S. liquefaciens, Edwardsiella, P. mirabilis, P. vulgaris, Streptobacillus, R. fickettsfi, C. psittaci, C. trachornatis, M. tuberculosis, M. intracellulare, M. folluiturn, M. laprae, M. avium, M. bovis, M. africanum, M. kansasii, M. lepraernurium, trypanosoma, chlamydia, or rickettsia.

The efficacy of the compositions of the present invention can be demonstrated in the most appropriate in vivo model system, depending on the type of drug product to be developed. The medical literature has detailed the benefits and uses of a wide range of such models. For example, there are many different types of cancer models that are routinely used to study the pharmaceutical activity of cancer drugs, such as the mouse xenograft model (e.g., He, S. et al. 2008. J. Immunol. 181:7581-7592) and chronic GVHD model (e.g., Xiao, Z.Y. et al. 2007. Life Sci. 81:1403-1410).

When it has been possible to show that the compositions of the present invention are effective in animals in vivo, a clinical research program can be developed based on doses that have been shown to be safe and effective in animals. Those skilled in the art can design such clinical trials based on standard protocols as described in textbooks such as Spilker (2000. Guide to Clinical Trials. Lippincott Williams & Wilkins: Philadelphia).

Introduction

According to one implementation variant of the present invention, TCR-deficient T cells are administered to the recipient in an amount of from about 10 ⁶ to about 10 ¹¹ cells. According to a preferred embodiment of the present invention, TCR-deficient T cells are administered to the recipient in an amount of 10 ⁸ to 10 ⁹ cells. According to a preferred embodiment of the present invention, TCR-deficient T cells are administered to the recipient at a frequency of every twenty-six weeks or less, every sixteen weeks or less, every eight weeks or less, or every four weeks or less.

These values are general guidelines for the range of transduced T cells that should be used by the practitioner when optimizing the method according to the present invention for the implementation of the invention. The presentation in this application of such ranges in no way precludes the use of more or less of the component, which may be justified within a particular application. For example, the actual dose and mode of administration may vary depending on whether the compositions are administered in combination with other pharmaceutical compositions, or depending on inter-individual differences in pharmacokinetics, drug distribution and metabolism. Those skilled in the art can easily make any necessary adjustments depending on the needs of the particular situation.

The person skilled in the art should be able to determine the effective dose and frequency of administration based on the knowledge available in the art, or by standard experimentation, for example, guided by the disclosure in this application and the information given in Goodman, L. S., Gilman, A., Brunton, L. L., Lazo, J. S., & Parker, K. L. (2006). Goodman & Gilman's the pharmacological basis of therapeutics. New York: McGraw-Hill; Howland, R. D., Mycek, M. J., Harvey, R. A., Champe, P. C., & Mycek, M. J. (2006). Pharmacology. Lippincott's illustrated reviews. Philadelphia: Lippincott Williams &Wilkins; and Golan, D. E. (2008). Principles of pharmacology: the pathophysiologic basis of drug therapy. Philadelphia, Pa., [etc.]: Lippincott Williams & Wilkins. The mode of administration may be selected based on conventional cell therapy methods (see, for example, Topalian and Rosenberg (1987) Acta Haematol. 78 Suppl 1:75-6; US Pat. No. 4,690,915), or an alternative continuous infusion strategy may be used.

According to another embodiment of the present invention, TCR-deficient T cells are administered to a subject in the form of a pharmaceutical form.

According to one embodiment of the present invention, TCR-deficient T cells may optionally be administered in combination with one or more active agents. Such active agents include analgesic, antipyretic, anti-inflammatory, antimicrobial, antiviral and anticytokine agents. Active agents include agonists, antagonists and modulators of TNF-α, IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-α, IFN-γ, BAFF, CXCL13, IP-10, VEGF, EPO, EGF, HRG, hepatocyte growth factor (HGF), hepcidin, including antibodies directed against any of the substances listed above and antibodies directed against any of their receptors. Active agents also include 2-arylpropionic acids, aceclofenac, acemetacin, acetylsalicylic acid (aspirin), alkofenac, alminoprofen, amoxypyrine, ampiron, arylalkonic acids, azapropazone, benorylate/benoylate, benoxaprofien, bromfenac, caprophene, choline magnesium salicylate, clofezone inhibitors -2, Dexibuprofen, Dexketoprofen, Diclofenac, Diflunisal, Droxicam, Etenzamide, Etodolac, Etoricoxib, Faislamin, Fenamic Acid, Fenbufen, Fenoprofen, Flufenamic Acid, Flunoxaprofen, Flubiprofen, Fluprofen, Ibuproxam, Indomethacin, Indoprofen, Kebusone, Ketoprofen, Noxycamlor , loxoprofen, lumiracoxib, magnesium salicylate, meclofenamic acid, mefenamic acid, meloxicam, metamizole, methyl salicylate, mofebutazone, nabumetone, naproxen, N-arylanthranilic acids, nerve growth factor (NGF), oxamethacin, oxaprozin, oxycams, oxyphenbutazone, parecoxib, phenazone, phenylbutazone, phenylbutazone, piroxicam, pyrofen, profens, proglumethacin, pyrazole derivatives idina, rofecoxib, salicyl salicylate, salicyclamide, salicylates, sulfinpyrazone, sulindac, suprofen, tenoxicam, thiaprofenic acid, tolfenamic acid, tolmetim, and valdecoxib.

Antibiotics include amikacin, aminoglycosides, amoxicillin, ampicillin, ansamycins, arsphenamines, azithromycin, azlocillin, aztreonam, bacitracin, carbacefem, carbapenems, carbecillin, cefaclor, cefadroxil, cephalexin, cephalothin, cephalothin, cefamandol, ceferenimine, cefedimine, cefdirimine цефоперазон, цефатоксим, цефокситин, цефодоксим, цефпрозил, цефтазидим, цефбутен, цефтизозим, цефтобипрол, цефтриаксон, цефуроксим, цефалоспорины, хлорамфеникол, циластатин, ципрофлоксацин, кларитромицин, клиндамицин, клоксациллин, колистин, котримоксазол, дальфопристин, демкелоциклин, диклоксациллин, диритромицин, дорипенем, doxycycline, enoxacin, ertapenem, erythromycin, etrambutol, flucloxacillin, fosfomycin, furozolidone, fusidic acid, gatifloxacin, geldamycin, gentamicin, cyclopeptides, herbimycin, imipenem, isoniazid, kanamycin, levofloxacin, lincomycin, linezolid, lomefloxacin, loracarbefen, merophenem, macrolides , methicillin, metronidazole, mezlocillin, minocycline, mo nobactams, moxifloxacin, mupirocin, nafcillin, netilmicin, ngitrofurantoin, norfloxacin, ofloxacin, oxacillin, oxytetracycline, paromycin, penicillin, penicillins, piperacycline, plateshenmycin, polymyxin B, poipeptides, prontosil, pyrazinamide, quinolones, quinpyristine, spectinomycin, spectithromycin, roxythromycin , sulfacetamide, sulfamethizole, sulfanilimide, sulfazalazine, sulfisoxazole, sulfonamides, teicoplanin, telithromycin, tetracycline, tetracyclines, ticarcillin, tinidazole, tobramycin, trimethoprim, trimethoprim-sulfamethoxazole, troleandomycin, trovafloxacin, and vancomycin.

Active agents also include aldosterone, beclomethasone, metamethasone, corticosteroids, cortisol, cortisone acetate, deoxycaorticosterone acetate, dexamethasone, fludrocortisone acetate, glucocorticoids, hydrocortisone, methylprednisolone, prednisolone, prednisone, steroids, and triamcinolone. Any suitable combination of said active agents is also contemplated.

A "pharmaceutical excipient" or "pharmaceutically acceptable excipient" is a vehicle, usually a liquid, in which an active therapeutic agent is present. In one embodiment of the present invention, said active therapeutic agent is a population of TCR-deficient T cells. In one embodiment of the present invention, said active therapeutic agent is a population of TCR-deficient T cells expressing a functional non-TCR receptor. Typically, the excipient does not impart any pharmacological activity to the dosage form, although it may provide chemical and/or biological stability. Examples of dosage forms can be found, for example, in Remington's Pharmaceutical Sciences, 19 ^th Ed., Grennaro, A., Ed., 1995, which is incorporated into the present application by reference.

As used herein, the terms "pharmaceutically acceptable carrier" or "adjuvant" include any solvents, dispersants, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retardants that are physiologically compatible. In one embodiment, said base may be suitable for parenteral administration. Alternatively, said vehicle may be suitable for intravenous, intraperitoneal, intramuscular or sublingual administration. Pharmaceutically acceptable bases include sterile aqueous solutions or dispersions for preparing sterile injectable solutions or dispersions shortly before use. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional medium or agent is incompatible with the active compound, their use in the pharmaceutical compositions of the present invention is contemplated. Additional active compounds may also be included in the compositions.

According to a specific preferred embodiment of the present invention, suitable bases include, without limitation, Hank's balanced salt solution (HNSS), phosphate buffered saline (PBS), or any frozen medium containing, for example, 10% DMSO (dimethyl sulfoxide) and 90% human serum.

In general, pharmaceutical compositions must be sterile and stable under the conditions of manufacture and storage. The invention implies that the pharmaceutical composition is present in a lyophilized form. The composition may be in the form of a solution. The base may be a dispersant containing, for example, water.

For each of the listed embodiments, the compounds can be administered in different dosage forms. Any biologically acceptable dosage form known to those skilled in the art, and combinations thereof, is contemplated. Examples of such dosage forms include, without limitation, liquids, solutions, suspensions, emulsions, injections (including subcutaneous, intramuscular, intravenous, and intradermal), infusions, and combinations thereof.

The description given above of the various illustrated embodiments of the present invention should not be construed as exhaustive or limiting the invention to the exact form that is disclosed. While the present application describes specific embodiments and examples of the present invention for purposes of illustration, various equivalent modifications are possible within the scope of the present invention, which should be understood by those skilled in the art. The information presented in this application can be used for purposes other than the examples described above.

These and other changes may be made to the invention in light of the above detailed description. Generally, in the following claims, the terms used are not intended to limit the invention to the specific embodiments disclosed in the specification and claims. Therefore, the present invention is not limited to the disclosure, but rather the scope of the invention is to be determined entirely by the following claims.

The present invention may be practiced in ways other than those specifically described in the above description and examples. A number of modifications and variations are possible in light of the foregoing and therefore fall within the scope of the appended claims.

Certain knowledge related to compositions with T cells deficient in the T cell receptor, and methods of using them, were disclosed in US Patent Preliminary Description No. 61/255,980, filed October 29, 2009, a disclosure which is incorporated in this application by reference to its full version.

Certain knowledge related to the production of T cells expressing chimeric receptors and methods of using them has been disclosed in U.S. Patent Application Publication No. 2010/0029749, published Feb. full version.

Certain polynucleotide sequences useful in the production of T cell receptor deficient T cells according to the present invention are disclosed in the sequence listing appended to this patent application, and the disclosure of said sequence listing is incorporated herein by reference to its full version.

The full disclosure of each document cited (including patents, patent applications, journal articles, abstracts, manuals, monographs, or other disclosures) in the "Prior Art", "Detailed Description" and "Examples" section is incorporated into this application by reference to its entirety. version.

The following examples are provided to provide those skilled in the art with a full disclosure and description of how the present invention is made and used, and are not intended to limit the scope of the invention. Every effort has been made to ensure accuracy with regard to the numerical values used (eg amounts, temperatures, concentrations, etc.), but some experimental errors and deviations may be allowed. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is expressed in degrees Celsius, and pressure is close to atmospheric.

Examples

Example 1 Production of T Cell Receptor (TCR) Deficient T Cells

The minigenes are encoded by a retrovirus-based expression plasmid (eg, pFB-neo or pSFG) containing LTR sequences at the 3' and 5' ends. These plasmids are packaged into a retrovirus packaging cell line, eg PT67 and PG13, and viral particles are harvested when the packaging cells expand to confluence. T cells are then activated with PHA (fetohemagglutinin), anti-CD3 or anti-CD3/28 monoclonal antibodies for 1-3 days in complete medium (or serum-free medium) supplemented with rIL-2 (25 U/ml), and transduction of T cells by spinoculation at 32°C in the presence of retronectin or polybrene. After a dormant period of 5 to 7 hours, the cells are washed and placed in fresh medium supplemented with IL-2 for 2-7 days. Cell counts are performed periodically to avoid excess cell concentrations (ie, >2×10 ⁶ cells/ml) and replated at a density of 7×10 ⁵ cells/ml. Optionally, selection medium is used to remove non-transduced T cells 2 days later for a period of 3-5 days. Live cells are harvested with a Lymphoprep™ gradient (Sentinel, Milan, Italy) and seeded again for 1-3 days.

After incubation, the cells are analyzed to evaluate the expression and function of the TCR. Expression of a functional non-TCR receptor can also be analyzed simultaneously if needed. To assess the expression of TCR/CD3 used flow cytometry using antibodies labeled with fluorochrome. Live cells are stained with antibodies for CD5, CD8 and CD4 in combination with an antibody for CD3ε, TCRα, TCRβ, TCRγ or TCRδ. If CD3 or TCR gene expression is used, expression of both TCR proteins and CD3 proteins should be significantly reduced compared to control vector-treated T cells. Isotype control antibodies are used to control background fluorescence. To identify T-lymphocytes, cells are triggered on CD5, and then the expression of CD4, CD8, CD3 and TCR is determined. For each treatment option, several samples are used, and appropriate compensation of the fluorochrome emission spectrum is applied. Expression of another receptor (eg, chNKG2D) is determined using specific antibodies and flow cytometry as previously described in the art (Zhang, T. et al., (2006) Cancer Res., 66(11) 5927-5933; Barber, A et al., (2007) Cancer Res., 67(10):5003-5008).

To evaluate functional TCR deficiency, anti-CD3 stimulation of effector cells is applied at the end of the culture process to measure the production of interferon (IFN)-gamma after 24 hours. T cells (2×10 ⁵ ) are cultured with soluble anti-CD3 (OKT3) mAb in complete medium. After 24 hours, cell-free conditioned medium is withdrawn and analyzed by ELISA for IFN-gamma. Changes in TCR expression or function should be reflected in IFN-gamma production.

To assess the function of functional non-TCR receptors, the determination of the production of specific cytokines by T cells incubated with tumor cells that express or do not express their specific ligands is used. For example, to evaluate chNKG2D function, 10 ⁵ T cells are incubated with 10 ⁵ P815-MICA (ligand+) tumor cells, 10 ⁵ P815 (ligand-), 10 ⁵ RPMI8226 (ligand+) cells, or T cells alone. After 24 hours, cell-free conditioned medium is withdrawn and IFN-g determined by ELISA. Chimeric NKG2D T cells produce INF-γ when cultured with ligand-expressing tumor cells (Zhang, T. et al., (2006) Cancer Res., 66(11) 5927-5933; Barber, A. et al., ( 2007) Cancer Res., 67(10):5003-5008). Cellular cytotoxicity against ligand+ tumor cells can also be assessed as previously described in the art (Zhang, T. et al., (2006) Cancer Res., 66(11) 5927-5933). Specificity is shown using ligand-tumor cells or specific mAbs that block receptors.

Example 2 Generation of T Cell Receptor (TCR) Deficient T Cells Expressing chNKG2D

In this example, the simultaneous expression of the chNKG2D receptor and the suppression of the expression of endogenous TCR is carried out. In this example, the mouse chNKG2D receptor is used, consisting of NKG2D in combination with an N-terminally attached CD3 zeta. The chNKG2D receptor is generated and expressed in mouse T cells. NKG2D is a type II protein in which the N-terminus is located in the extracellular space of Raulet (2003) Nat. Rev. Immunol. 3:781-790), while the CD3-zeta chain is a type I protein with a C-terminus located in the cytoplasm (Weissman, et al. (1988) Proc. Natl. Acad. Sci. USA 85:9709-9713). To generate the NKG2D-CD3 zeta chimeric protein, the initiation codon ATG is placed before the coding sequence of the cytoplasmic region of the CD3 zeta chain (without the TAA stop codon) followed by the wild-type NKG2D gene. When expressed, the orientation of the zeta portion is flipped inside the cell. The extracellular and transmembrane domains are derived from NKG2D. Also construct a second chimeric gene encoding Dap10, followed by a fragment encoding the cytoplasmic domain of CD3-zeta. Figure 1 shows the structures of the chimeric receptor and the wild-type receptor.

shRNA is operably linked in the lentiviral vector to the chNKG2D receptor. To achieve the expression of both genes, shRNA is launched from the U6 promoter, and the chNKG2D receptor from the PGK promoter. Primary human PBMCs are isolated from healthy donors and activated with low doses of sparingly soluble anti-CD3 and 25 U/ml rhuIL-2 for 48 hours. Although lentiviral transduction does not require the activation of T lymphocytes, transduction is more efficient and allows the cells to continue to develop into IL-2. Activated cells are washed and transduced by spin-fection for 1 hour at 30°C followed by a dormant period of 7 hours. Cells are washed and cultured with 25 U/ml IL-2 for 3-7 days to enable expansion of effector cells similar to what we do when using cells in vivo. The expression of TCRαβ, CD3 and NKG2D is assessed by flow cytometry and quantitative real-time PCR (qRT-PCR). The number of CD4+ and CD8+ T cells is determined by flow cytometry. The values obtained are compared to PBMCs transduced with shRNA alone or with the chNKG2D gene (as a control). Also included as controls are cells that have been transduced with the vector alone.

It is expected that these cells that do not express TCR, or express it in small amounts on their surface, will express more NKG2D on the surface due to co-expression of the chNKG2D receptor.

Alternatively, transduction can be carried out with two viruses simultaneously, one containing the shRNA construct and the other containing the chNKG2D construct. To ensure high levels of chNKG2D expression in non-TCR expressing T cells, more chNKG2D virus is used. TCR+ T cells that may remain are removed to obtain TCR-, chNKG2D+ T cells.

After viral transduction and expansion of TCR+ and TCR- cells are separated using mAbs using magnetic beads on Miltenyi columns. Verification of chNKG2D expression is performed by real-time quantitative PCR using specific primers for the chNKG2D receptor.

To determine whether T cells have lost TCR function and retained chNKG2D function, transduced or control T cells are cultured with mitomycin C treated allogeneic PBMCs or synergistic PBMCs. These T cells are preloaded with CFSE, which is a permeant cell dye that is evenly distributed between daughter cells after division. The degree of cell division can be easily determined by flow cytometry.

To determine whether the shRNA construct suppressed TCR function and allowed chNKG2D receptor function, transduced or control T cells were cultured with mitomycin C-treated allogeneic PBMCs, synergistic PBMCs, or tumor cells: P815-MICA (mouse tumor expressing Human MICA ligand for NKG2D), P815, A2008 (human ovarian tumor cells, NKG2D ligand+) and U266 (human myeloma cell line, NKG2D ligand+). After 48 hours, the cell-free supernatant was removed and the amount of IL-2 and IFN-γ produced was assessed by ELISA. T cells alone are used as a negative control.

Example 3 Administration of T Cell Receptor (TCR) Deficient T Cells Expressing chNKG2D

In this example, TCR-deficient T cells expressing the mouse chNKG2D receptor obtained in Example 2 are administered to mice to evaluate the therapeutic potential of these T cells in vivo for certain types of cancer. T-cells - carriers of chimeric chNKG2D (10 ⁶ ) are administered subcutaneously to C57BL/6 mice, together with tumor cells RMA/Rae-1β (10 ⁵ ). Therapeutic antitumor activity in these mice is indicated by the absence of tumor or inhibition of RMA/Rae-1β tumor growth in mice injected with TCR-deficient T cells carrying chimeric chNKG2D after 30 days.

In a second and more rigorous model, transduced T cells (10 ⁷ ) are adaptively administered iv to B6 mice one day prior to sc inoculation of RMA/Rae-1β tumor in the right flank. Suppression of tumor growth of RMA/Rae-1β (sc) compared to control vector-modified T cells indicates therapeutic antitumor activity in these mice. Regarding the toxicity of treatment with T cells modified with chimeric chNKG2D, it is expected that animals will not show any overt signs of inflammatory damage (i.e., ruffled coat, hump or diarrhea, etc.) when they are treated with T- cells - carriers of chimeric chNKG2D, which may indicate the absence of overt toxicity.

In a more stringent model of established ovarian tumors (ID8), transduced chNKG2D T cells (5×10 ⁶ T cells ip) are administered to tumor bearing mice for 5 weeks. Subsequently, mice are injected with T cells 7 and 9 weeks after tumor challenge. Under these conditions, mice injected with chNKG2D-containing T-lymphocytes should remain tumor-free for more than 250 days, while mice that were similarly injected with control T-lymphocytes should die from tumor growth within 100 days. Regarding the toxicity of treatment with T cells modified with chimeric chNKG2D, it is expected that animals will not show any obvious signs of inflammatory damage (i.e. ruffled coat, hump or diarrhea, etc.) when treated with T cells. - carriers of chimeric chNKG2D, which may indicate the absence of overt toxicity.

In a multiple myeloma model, mice carrying 5T33MM tumor cells are treated with chNKG2D-containing T cells (5×10 ⁶ , iv) on day 12 after tumor cell infusion. Said exposure should result in increased lifespan in all mice, and approximately half of said mice should be tumor-free centenarians. Mice injected with control T cells die of tumors in the first 30 days. When treated with chNKG2D-containing T cells, no obvious signs of toxicity are observed.

Because the immune system can select for tumor variants, the most effective cancer immunotherapies are likely to be those that induce immunity against multiple tumor antigens. A third experiment tests whether treatment with T cells containing the chimeric NKG2D can induce immunity against wild-type tumor cells in the host. Mice that were injected with chimeric NKG2D T cells and 5T33MM tumor cells and were tumor free for 80 days thereafter were challenged with 5T33MM tumor cells. Tumor-free surviving mice are resistant to subsequent challenge with 5T33MM cells (3×10 ⁵ ), compared to untreated control mice, which die from tumor on average in the first 27 days. However, tumor-free surviving mice are not resistant to subsequent challenge with RMA-Rael tumor cells (3×10 ⁵ ), and die from the tumor with approximately the same lifespan as untreated mice (20 days). This indicates that the adaptive transfer of T cells carrying chimeric NKG2D may allow the host to generate tumor-specific T cell memory.

The present invention provides four classes of TCR inhibitory molecules (TIMs) that affect T cell function. Table 2 summarizes the effects of 19 different TIMs on effector T cell function, either in response to stimulation with soluble anti-CD3 antibody (OKT3 200 ng/mL) (CD3) or allogeneic PBMC culture (Allo). The notation on the left shows the TIM class. Numerical values indicate the percentage reduction in TCR inhibition compared to control T cells transduced with the pFB control vector. NI: no inhibition. ND: not done.

Table 2: Summary of the effect of TCR inhibitory molecules (TIM) on T cell function.

TIM class CD3 Hello shRNA TIM1 ^* 22.6 ND TIM2 ^* ND ND TIM3 ^* 14.9 ND TIM4 ^** N.I. ND truncated proteins TIM5 ^*** N.I. N.I. TIM6 ^** N.I. 56 TIM7 ^** 44 90 TIM8 ^** 58 100 KIR fusion proteins TIM9 ^** 32.7 ND TIM10 ^** 28 ND TIM11 ^** 32 ND TIM12 ^** -12 40 TIM13 ^** ND -26 Mutations TIM14 ^** N.I. ND TIM15 ^** -6 35 TIM16 ^** 23.2 27 TIM17 ^** 8.2 -9 TIM18 ^** -28 21 TIM19 ^** 33.9 eight

Example 4 Generation of T Cell Receptor (TCR) Deficient T Cells Using shRNAs Targeting Nucleic Acids Encoding CD3 Epsilon and CD3 Zeta

In this example, endogenous TCR expression was inhibited by shRNA sequences that target nucleic acids encoding CD3 epsilon or CD3 zeta.

ShRNA sequences cloned into the pSM2c retroviral vector (Open Biosystems) were used, in which expression was controlled by the U6 promoter. These shRNA constructs were used to block the expression of CD3 epsilon and/or CD3 zeta so that the T cell no longer produced one of the key components of the TCR complex. Subsequently, the TCR complex was destabilized and expression of functional TCR on the cell surface was disrupted, leading to a decrease in T-cell function associated with the TCR complex. The sequence of shRNAs directed against CD3 epsilon or CD3 zeta is described in Table 1 and corresponds to SEQ ID nos: 9-26 and 68-71, respectively.

To determine if these shRNAs alter TCR function, IFN-gamma production was measured in response to (i) stimulation with soluble anti-CD3 (CD3) or (ii) in response to culture with allogeneic PBMCs (Allo). In particular, T-lymphocytes treated with TIM1 and TIM3 showed a decrease of 22.6% or 14.9% in TCR inhibition, respectively, after stimulation with 200 ng/ml of anti-CD3 monoclonal antibody. See Table 2 above.

Example 4 Generation of T Cell Receptor (TCR) Deficient T Cells Using a Dominant Negative CD3 Zeta Inhibitor

In this example, overexpression of a dominant-negative inhibitor protein, i.e. TIM, led to the suspension of TCR expression and function. Endogenous TCR expression was inhibited by a dominant negative inhibitor protein containing CD3-zeta modified to include an inhibitory signal from KIR2DL1 and the resulting T cells were not activated in response to TCR stimulation.

Minigene constructs that included all or part of the modified CD3-zeta-encoding polynucleotide were generated by PCR using CD3-zeta and KIR2DL1 cDNA templates corresponding to SEQ ID NO: 64 and SEQ ID NO: 66, respectively, purchased from Open Biosystems (Huntsville, Alabama). All PCRs were performed using high fidelity DNA polymerase fusion (New England Biolabs, Ipswich, Massachusetts) and primers were synthesized by Integrated DNA Technologies (Coralville, Iowa). Using established protocols, each construct was cloned into the pFB-neo retroviral vector (Stratagene) and expression was controlled by the 5' LTR promoter. Ltd.") The DNA sequences and their predicted protein sequences correspond to SEQ ID NO: 68-101.

TIM was expressed in primary T cells using a retrovirus-based expression system. Two different packaging cell lines were used to generate low or high titer viruses. Low titer virus was generated using GP2-293T cells transiently transfected with a packaging plasmid and a coat plasmid. After 72 hours, the viral supernatant was collected and titers were measured by infecting NIH-3T3 cells, followed by selection with G418. The titers of viruses produced by this system ranged from 5×10 ⁵ to 1×10 ⁷ CFU/ml. To obtain high titer viruses, the virus was generated in a GP2-293T system to transduce PT67 packaging cells. PT67 cells infected with viral particles were selected by treatment with G418 for 5 days. TIM-expressing PT67 cells were seeded and used to obtain the virus. 72 hours after the cells had reached monolayer confluence, the viral supernatant was collected and titers were measured in NIH-3T3. The titers of viruses obtained in this system ranged from 7×10 ⁷ to 2×10 ⁸ cfu/ml.

For transduction of human T cells, primary human PBMCs were isolated from healthy donors and activated with 40 ng/ml soluble anti-CD3 and 50 U/ml rhuIL-2 for 72 hours. Activated T cells were washed and transduced with a retrovirus obtained either as low titer or high titer virus by 1 hour spin infection at 32° C. followed by a 6 hour rest period. Cells were washed and cultured in 50 U/ml IL-2 for 48 hours and then submitted for selection for 3 days. After selection, live cells were isolated using Lymphoprep (Mediatech) and effector cells were distributed in 50 U/ml IL-2 for 48 hours, after which the cells were used for functional analysis. Endogenous expression of CD3 epsilon and CD3 zeta in shRNA-transduced cells and reduced expression of these genes due to shRNA were analyzed by real-time quantitative PCR (qRT-PCR). Briefly, RNA was extracted from the transduced T cells and 0.5-1 μg of total RNA was reverse transcribed using the QuantiTect Rev Transcription Kit (Qiagen). The resulting cDNA was used with SYBR green (Applied Biosystems) for real-time quantitative PCR and the data normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels. Changes in cell surface expression were analyzed using antibodies specific for CD3, CD8, CD4 and CD5, and no differences were found in the expression of molecules on the surface of these cells in TIM-expressing T cells compared to the control vector.

To determine whether the reduction in TCR expression with each shRNA or minigene construct (which abolishes or destroys TCRs on the cell surface) was sufficient to prevent TCR activation upon TCR stimulation, T cells were assessed for: (1) cell survival in vitro; and (2) cytokine production in response to allogeneic PBMCs and/or anti-CD3 mAbs.

To assess cell survival, transduced T cells were expanded in RPMI medium with rhuIL-2 (50 U/ml). Cells were placed in Petri dishes at the same density at the beginning of cultivation, and samples were taken for cell counting and viability assessment once a day for 7 or more days. There were no differences in the growth of TIM-expressing cells and corresponding T-cells expressing the control vector. To determine if T cells express enough TCR to induce a response to allogeneic cells, transduced or control T cells were cultured with allogeneic autologous PBMCs at a ratio of 4:1. After 24 hours, the cell-free supernatant was collected and the amount of IFN-γ produced was determined by ELISA. T cells alone, including PBMC, and transduced cells were used as negative controls. Among the TCR inhibitory molecules analyzed, two minigenes (TIM7 and TIM8) were identified that could significantly reduce TCR function in T cells. See Figure 2. Allogeneic analysis was performed with 19 different donors expressing TIM7 and TIM8, where each donor's cells were cultured with 3 different allogeneic PBMCs. The mean decrease in IFN-γ production in TIM7 expressing T cells was 49% and the mean decrease in TIM8 expressing T cells was 60%.

To determine if each TIM suppresses T cell function upon direct antibody stimulation of the TCR complex, TIM transduced T cells were treated with different doses of anti-CD3 mAb (from 1.6 to 5000 ng/ml). After 24 hours, the cell-free supernatant was collected and the amount of IL-2 and/or INF-γ produced was determined by ELISA. T cells alone were used as a negative control. When cells were stimulated with 200 ng/ml anti-CD3 mAb for 24 h, the maximum reduction in IFN-γ production of 44% and 58% was observed in T cells expressing TIM7 and TIM8, respectively. Taken together, these data suggest that a decrease in TCR expression, such as when TIM is used to remove or destroy TCR, is sufficient to alter T cell function.

Example 5 Generation of T Cell Receptor (TCR) Deficient T Cells Expressing chNKG2D

In this example, simultaneous overexpression of a dominant negative TCR inhibitor protein, ie, TIM, and expression of a chimeric anti-tumor receptor was achieved. In particular, the expression of endogenous TCR was suppressed by TIM, and the chimeric chNKG2D receptor was expressed, i.e. NKG2D associated with the cytoplasmic domain of CD3-zeta. NKG2D is associated with Dap10 to provide both primary and secondary activation of signals to T cells. See, Zhang, T. et al. 2006 Cancer Res. 66(11): 5927-5933. Ligands for NKG2D are expressed by most human tumor cells, but not by most normal cells.

To evaluate the expression of both TIM and the chimeric anti-tumor receptor, primary human PBMCs were isolated from healthy donors and activated with 40 ng/ml soluble anti-CD3 and 50 U/ml rhuIL-2 for 72 hours. Activated T lymphocytes were washed and transduced with high titer retroviruses by 1 hour spinoculation at 32° C. followed by a 7 hour rest period. An equivalent amount of TIM and chNKG2D virus was used for transduction. Cells were washed and cultured in 50 U/ml IL-2 for 48 hours and then submitted for selection with G418 for 3 days. After selection, live cells were isolated using Lymphoprep (Mediatech) and effector cells were distributed in 50 U/ml IL-2 for 48 hours, after which the cells were used for functional analysis. The change in expression on the cell surface was analyzed using antibodies specific for CD3, CD8, CD4, NKG2D and CD5. There were no differences in the expression of molecules on the surface of these cells in TIM-expressing T cells compared to the control vector, except for higher expression of the NKG2D receptor in cells transduced with chNKG2D virus, which was expected.

To determine whether TIM+ chNKG2D+ cells can show a reduced response to allogeneic cells but an increased response to tumor cells, T cells were co-cultured with allogeneic PBMCs, synergistic PBMCs, or tumor cells: RPMI8226 (human myeloma cell line, NKG2D ligand+), PANC -1 ((cell line from human pancreas, NKG2D+) or NIH-3T3 (normal mouse fibroblast line, NKG2D ligand-) as a negative control. After 24 hours, the cell-free supernatant was collected and the amount of INF-produced was determined. γ by ELISA T cells alone and culture with synergistic PBMCs were used as a negative control.

In allogeneic analysis, a 45% decrease in INF-γ production was observed in TIM7-expressing T cells and a 44% decrease in INF-γ production in TIM8-expressing T cells that coexpressed chNKG2D compared to cells expressing the control vector. When cultured with tumor cells, there was a significant increase in INF-γ production in response to tumor cells in TIM+ chNKG2D+ cells compared to TIM-only cells when tumor cells expressed chNKG2D ligands (RPMI8226 and PANC-1), but not when cultured with ligand-deficient tumor cells (NIH-3T3). See Figure 3 showing a representative experiment using RPMI8226. The same experiment also demonstrated that higher INF-γ production was dependent on NKG2D, since incubation with a blocking mAb on NKG2D did not lead to an increase in INF-γ production.

--->

Sequence listing

<110> THE TRUSTEES OF DARTMOUTH COLLEGE

<120> T Cell Receptor-Deficient T Cell Compositions

<130> 76840.000106

<140>tba

<141> 2013-04-30

<150> 13/459.664

<151> 2012-04-30

<150> 13/502.978

<151> 2012-04-19

<150> PCT/US10/54846

<151> 2010-10-29

<150> 61/255.980

<151> 2009-10-29

<160> 101

<170>PatentIn version 3.5

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-beta shRNA sequence

<400> 1

agtgcgagga gattcggcag cttat 25

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-beta shRNA sequence

<400> 2

gcgaggagat tcggcagctt atttc 25

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-beta shRNA sequence

<400> 3

ccaccatcct ctatgagatc ttgct 25

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-beta shRNA sequence

<400> 4

tcctctatga gatcttgcta gggaa 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-alpha shRNA sequence

<400> 5

tctatggctt caactggcta gggtg 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-alpha shRNA sequence

<400> 6

caggtagagg ccttgtccac ctaat 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-alpha shRNA sequence

<400> 7

gcagcagaca ctgcttctta cttct 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> TCR-alpha shRNA sequence

<400> 8

gacactgctt cttacttctg tgcta 25

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 9

cctctgcctc ttatcagttg gcgtt 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 10

gagcaaagtg gttattatgt ctgct 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 11

aagcaaacca gaagatgcga acttt 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 12

gacctgtatt ctggcctgaa tcaga 25

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 13

ggcctctgcc tcttatcagt t 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 14

gcctctgcct cttatcagtt g 21

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 15

gcctcttatc agttggcgtt t 21

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 16

aggatcacct gtcactgaag g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 17

ggatcacctg tcactgaagg a 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 18

gaattggagc aaagtggtta t 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 19

ggagcaaagt ggttattatg t 21

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 20

gcaaaccaga agatgcgaac t 21

<210> 21

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 21

acctgtattc tggcctgaat c 21

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 22

gcctgaatca gagacgcatc t 21

<210> 23

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 23

ctgaaatact atggcaacac aatgataaa 29

<210> 24

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 24

aaacataggc agtgatgagg atcacctgt 29

<210> 25

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 25

attgtcatag tggacatctg catcactgg 29

<210> 26

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-epsilon shRNA sequence

<400> 26

ctgtattctg gcctgaatca gagacgcat 29

<210> 27

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 27

gatacctata gaggaacttg a 21

<210> 28

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 28

gacagagtgt ttgtgaattg c 21

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 29

gaacactgct ctcagacatt a 21

<210> 30

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 30

ggacccacga ggaatatata g 21

<210> 31

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 31

ggtgtaatgg gacagatata t 21

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 32

gcaagttcat tatcgaatgt g 21

<210> 33

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 33

ggctggcatc attgtcactg a 21

<210> 34

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 34

gctggcatca ttgtcactga t 21

<210> 35

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 35

gcatcattgt cactgatgtc a 21

<210> 36

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 36

gctttgggag tcttctgctt t 21

<210> 37

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 37

tggaacatag cacgtttctc tctggcctg 29

<210> 38

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 38

ctgctctcag acattacaag actggacct 29

<210> 39

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 39

accgtggctg gcatcattgt cactgatgt 29

<210> 40

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-delta shRNA sequence

<400> 40

tgatgctcag tacagccacc ttggaggaa 29

<210> 41

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 41

ggctatcatt cttcttcaag g 21

<210> 42

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 42

gcccagtcaa tcaaaggaaa c 21

<210> 43

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 43

ggttaaggtg tatgactatc a 21

<210> 44

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 44

ggttcggtac ttctgacttg t 21

<210> 45

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 45

gaatgtgtca gaactgcatt g 21

<210> 46

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 46

gcagccacca tatctggctt t 21

<210> 47

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 47

ggctttctct ttgctgaaat c 21

<210> 48

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 48

gctttctctt tgctgaaatc g 21

<210> 49

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 49

gccaccttca aggaaaccag t 21

<210> 50

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 50

gaaaccagtt gaggaggaat t 21

<210> 51

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 51

ggctttctct ttgctgaaat cgtcagcat 29

<210> 52

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 52

aggatggagt tcgccagtcg aggcttca 29

<210> 53

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 53

cctcaaggat cgagaagatg accagtaca 29

<210> 54

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-gamma shRNA sequence

<400> 54

tacagccacc ttcaaggaaa ccagttgag 29

<210> 55

<211> 17

<212> PRT

<213> Artificial Sequence

<220>

<223> Immunoreceptor tyrosine-based activation motif (ITAM)

<220>

<221> VARIANT

<222> (1)..(1)

<223> Xaa may be Asp or Glu

<220>

<221> VARIANT

<222> (2)..(3)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (5)..(6)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222>(7)..(7)

<223> Xaa may be Ile or Leu

<220>

<221> VARIANT

<222> (8)..(13)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (15)..(16)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (17)..(17)

<223> Xaa may be Ile or Leu

<400> 55

Xaa Xaa Xaa Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr Xaa Xaa

1 5 10 15

xaa

<210> 56

<211> 18

<212> PRT

<213> Artificial Sequence

<220>

<223> Immunoreceptor tyrosine-based activation motif (ITAM)

<220>

<221> VARIANT

<222> (1)..(1)

<223> Xaa may be Asp or Glu

<220>

<221> VARIANT

<222> (2)..(3)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (5)..(6)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222>(7)..(7)

<223> Xaa may be Ile or Leu

<220>

<221> VARIANT

<222> (8)..(14)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (16)..(17)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (18)..(18)

<223> Xaa may be Ile or Leu

<400> 56

Xaa Xaa Xaa Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr Xaa

1 5 10 15

Xaa Xaa

<210> 57

<211> 19

<212> PRT

<213> Artificial Sequence

<220>

<223> Immunoreceptor tyrosine-based activation motify (ITAM)

<220>

<221> VARIANT

<222> (1)..(1)

<223> Xaa may be Asp or Glu

<220>

<221> VARIANT

<222> (2)..(3)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (5)..(6)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222>(7)..(7)

<223> Xaa may be Ile or Leu

<220>

<221> VARIANT

<222> (8)..(16)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (17)..(18)

<223> Xaa may be any amino acids

<220>

<221> VARIANT

<222> (19)..(19)

<223> Xaa may be Ile or Leu

<400> 57

Xaa Xaa Xaa Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr

1 5 10 15

Xaa Xaa Xaa

<210> 58

<211> 1575

<212> DNA

<213> Homo sapien

<400> 58

tgaggacata tctaaatttt ctagttttat agaaggcttt tatccacaag aatcaagatc 60

ttccctctct gagcaggaat cctttgtgca ttgaagactt tagattcctc tctgcggtag 120

acgtgcactt ataagtattt gatggggtgg attcgtggtc ggaggtctcg acacagctgg 180

gagatgagtg aatttcataa ttataacttg gatctgaaga agagtgattt ttcaacacga 240

tggcaaaagc aaagatgtcc agtagtcaaa agcaaatgta gagaaaatgc atctccattt 300

tttttctgct gcttcatcgc tgtagccatg ggaatccgtt tcattattat ggtagcaata 360

tggagtgctg tattcctaaa ctcattattc aaccaagaag ttcaaattcc cttgaccgaa 420

agttactgtg gcccatgtcc taaaaactgg atatgttaca aaaataactg ctaccaattt 480

tttgatgaga gtaaaaactg gtatgagagc caggcttctt gtatgtctca aaatgccagc 540

cttctgaaag tatacagcaa agaggaccag gatttactta aactggtgaa gtcatatcat 600

tggatgggac tagtacacat tccaacaaat ggatcttggc agtgggaaga tggctccatt 660

ctctcaccca acctactaac aataattgaa atgcagaagg gagactgtgc actctatgcc 720

tcgagcttta aaggctatat agaaaactgt tcaactccaa atacatacat ctgcatgcaa 780

aggactgtgt aaagatgatc aaccatctca ataaaagcca ggaacagaga aggattaca 840

ccagcggtaa cactgccaac cgagactaaa ggaaacaaac aaaaacagga caaaatgacc 900

aaagactgtc agatttctta gactccacag gaccaaacca tagaacaatt tcactgcaaa 960

catgcatgat tctccaagac aaaagaagag agatcctaaa ggcaattcag atatccccaa 1020

ggctgcctct cccaccacaa gccgagtg gatgggctgg gggaggggtg ctgttttaat 1080

ttctaaaggt aggaccaaca cccaggggat cagtgaagga agagaaggcc agcagatcag 1140

tgagagtgca accccaccct ccacaggaaa ttgcctcatg ggcaggggcca cagcagagag 1200

acacagcatg ggcagtgcct tccctgcctg tgggggtcat gctgccactt ttaatgggtc 1260

ctccacccaa cggggtcagg gaggtggtgc tgccctagtg ggccatgatt atcttaaagg 1320

1380

agtcccatga ctgtttctct tcctctcttt cttccttttg gaatagtaat atccatccta 1440

1500

1560

aaaaaaaaaaaaaaa 1575

<210> 59

<211> 6098

<212> DNA

<213> Homo sapien

<400> 59

gcagttatca tagagcacag tccctcacat cacacagctg cagagatgag taaacaaaga 60

ggaaccttct cagaagtgag tctggcccag gacccaaagc ggcagcaaag gaaacctaaa 120

ggcaataaaa gctccatttc aggaaccgaa caggaaatat tccaagtaga attaaatctt 180

caaaatcctt ccctgaatca tcaagggatt gataaaatat atgactgcca aggtaaaaca 240

ttaaatatat cttcaatatt attgttctag gatgtgcagt tgaatgcaga agggtgagga 300

aagattaggg aatattttgc acttgtgaga atcggagttc ataattggga tctaaaattc 360

taatatgaaa tcagaagact aattttattc gggcattgtt caactgtaat ctgcggtcca 420

ctcatggaac attatattta ctgaaaatga aatggtatat tctgagagaa agattactag 480

540

ctagtatgta attctctagt atgtaatcct aatcaactct ctatctcccc tctctcagtg 600

cctctatttc tctccctgca ggtttactgc cacctccaga gaagctcact gccgaggtcc 660

taggaatcat ttgcattgtc ctgatggcca ctgtgttaaa aacaatagtt cttattcctt 720

gtaagcatat tcttgaaaga ttagaaggga acgttttact ttaatgcttg gaagtgcctc 780

aaaatatttc atactgttga agaatagaac tcttatttta ctgtttcttt caaagatcta 840

ttacttcatt tatttttata gaaaaagtta attttattaa agattgtccc cattttaaat 900

aacacacaaa gtttcaaagt aagaaactaa actcattatg gtttatctaa atattacttt 960

ttataaaaat cattttaatt tttctgttac agtcctggaa cagaacaatt cttccccaaa 1020

tacaagaacc cagaaaagta catttttatt ttcaaagttc tgatattagt acaatttgga 1080

accaaaagta atatggttat tctgaatttt tcacaacata aataacaaaa tcattgtaga 1140

1200

1260

attaattttt gaaagtggtt acatcaaata ctacaagaga tggtgaagtt tgtgctaaag 1320

1380

ttttattaaa gattctcccc attttaaata acacacaaag tttcaaagta agaaactaaa 1440

ctcgttatgg ttcatctaga tatcagtttt tataaaaatc attttaattt ttctattaca 1500

1560

1620

tagtggcatt tttgcagaaa ataagccata aattcagcca taaatatttg taaagaaaga 1680

ttatgaggca gcatttcctt ttctccagtg agtagaaata ctcacttaaa atcattctac 1740

cctctttctc ccaattaaca gaggtttcct actgctgtga gatgatacca aataaataat 1800

1860

tttgtttgt tcatttgctt tatatgggaa cacaattagg gaggagaggc taacccttgt 1920

ctgtgcatgt gtgtatgact gactcagtta ttaaaaatat acatttataa gcctgtaagg 1980

atgcgtaaat atgttaagca catatatgtt tatactgttg aaatatgtga actaattttc 2040

atttttaaaa attcatattg gtctaaatag taattcatat ctttattagc acgtcattgt 2100

ggccattgtc ctgaggagtg gattacatat tccaacagtt gttattacat tggtaaggaa 2160

agaagaactt gggaagagag tttgctggcc tgtacttcga agaactccag tctgctttct 2220

aagataatg aagaagaaat ggtaagatgt aaatgtttca aacattattat gaaaagcttc 2280

cttcagtgaa taatacattt gtagaaaaca tccatatgtg tgtacatata tttatctcat 2340

atattttcaa gtgtatgtaa tattcaattg attgacttaa taatgttttt aaagttatat 2400

actgctaatg tacatttatt ttcagttttt gtttttcaag gaaaaccatg cttctataag 2460

tgctttgaat ccacaataaa ttttgctatc taattttatc gggcatgata tcatctggtc 2520

2580

gtttccagct ctagcagttc cacccctgtg tatgccctca tcacttatcc tgactcctct 2640

ccaaaacgca gtcttgactt ttaatattat aaataatgat tgcctgttct tgaatttatt 2700

tatataaagg gaatcaaaca gtgtgaattt catgtctttt tcaatcctat ctgatattttg 2760

tgcaattcct ccatattatt gcagttatca gtagtatgtt actgttcact gctgtactat 2820

gtacaaagaa cagtaagaat ccattgagtc cttgtctctg gatggggaag tgggtctcat 2880

gccctcaggg acaaagagga ccctaggtgg tttacggtgc actgttagtc atggggtccc 2940

tttgctgatc ctcctcatcc acagccatcc tggtgtctct tggtatgaga aggaagcact 3000

ttctctagct ccatattggt agcaggtctc ctggtagatc atccttgcca gtggcaccag 3060

ccttgcctgg tattgtggag gggactctcc ttcgataccc tcctcctatt gccaggttgg 3120

gtgtagggaa acagcaggcc taggtcacct tcttctgtcg tgtggaggac ttaacatgct 3180

cacttggaca cttggttgat ccctgatgct agggtcccag acaatttcat ctttctcttt 3240

ccacctttca gagttctcca ttgcttttgt ctttcattaa tccgagtt tatagttgtt 3300

tttagtaggg agtagcagag agagacgagt ctacaccacc tggccaggac ccctgtttatt 3360

ccgcaaaaac cgaatcggat aaaaattgag ggcttatcta gttaaagaat ggtgtggtac 3420

ccagaaaacc caatctgtag cttccatgtc atctatttct gaatgacaac ccctcaattc 3480

3540

tctggagaaa tgaatgcaca gtatcaggaa acttattaaa acccttcctg tgtttattct 3600

gttaattgga gtaactatta cattgcaaga attaaaatgt ctttattaac atgagaataa 3660

gaatgaaagt actaagtata aacgttgaag agttcattta aataaaaaat tcaaacattt 3720

3780

ttttcataat tattatttaa gtgaaaatta ttttcttttct tttgaaatt tctggccagc 3840

attttacctt cctcatggat tggtgtgttt cgtaacagca gtcatcatcc atgggtgaca 3900

ataaatggtt tggctttcaa acataagtaa gttcttttgt atggcgctat ataaaaaata 3960

tatataaagg ataaattcag aagaataata tgaataaatt tatgtggaat cattgacatg 4020

4080

gtccatatat ttcaaccgct cattggtctg ctagtaacct tcttggttat cagatggacc 4140

aggggtgtcc catctttggc ttctgtgggc cacgttagaa gacgaatagt cttggcccac 4200

acatagaata cactaacact aacgatagct gacgagctaa aaaaaaaaaa aaatcacaga 4260

4320

tgcggcccat gggcagcgag ttggacaacc tcgagctgga ctatcaggga actgcagtgc 4380

ttgtttttat taaaaagcca cgcttacttt tttacttaag aatatcctca aagcacaata 4440

atagtgctgt tggcatattg ctataatttt tttattacta gttattgttg tcaatctctt 4500

attgtgccta atttataaat taaactttat cacagttatg aatgtgtaga gaaaacataa 4560

tctctctata ggttctgcac tatctgccat ttcaggcatc cactggggtc ttgaaacata 4620

tccctcgtgg atgaagaggg actactctgt tgagtgttca gaataatgac tcttactaat 4680

attatgaaaa atttaattac ccttttccat gaaattcttt tcttacagta catggaaaat 4740

gctttcgtct catgaatcat ttgcttaaaa tgtaacagaa tatggatttt tctccattac 4800

aggataaaag actcagataa tgctgaactt aactgtgcag tgctacaagt aaatcgactt 4860

aaatcagccc agtgtggatc ttcaatgata tatcattgta agcataagct ttagaagtaa 4920

agcatttgcg tttacagtgc atcagataca ttttatattt cttaaaatag aaatattatg 4980

attgcataaa tctgaaaatg aattatgtta tttgctctaa tacaaaaatt ctaaatcaat 5040

tattgaaata ggatgcacac aattactaaa gtacagacat cctagcattt gtgtcgggct 5100

cattttgctc aacatggtat ttgtggtttt cagcctttct aaaagttgca tgttatgtga 5160

gtcagcttat aggaagtacc aagaacagtc aaacccatgg agacagaaag tagaatagtg 5220

gttgccaatg tctcagggag gttgaaatag gagatgacca ctaattgata gaacgtttct 5280

ttgtgtcgtg atgaaaactt tctaaatttc agtaatggtg atggttgtaa ctttgcgaat 5340

atactaaaca tcattgattt ttaatcattt taagtgcatg aaatgtatgc tttgtacatg 5400

acacttcaat aaagctatcc agaaaaaaaa aagcctctga tgggattgtt tatgactgca 5460

tttatctcta aagtaatttt aaagattagc ttctttataa tattgacttt tctaatcagt 5520

ataaagtgtt tccttcaatg tactgtgtta tctttaattt ctctctcttg tattttgtat 5580

tttgggggat tgaagtcata cagaaatgta ggtattttac atttatgctt ttgtaaatgg 5640

catcctgatt ctaaaattcc ctttagtaat ttttgttgtt ataaatagaa atacaactga 5700

tgtctgcatt ttgattttat atctacttat tccactgatt ttatatattt aaatctatta 5760

5820

tcacactttt atttttttta atccatgtgc tataacttag tttttattttc attttattttc 5880

actggctaag gttttatacc catagttgaa tagaaggcac aatcaaagtt ctttgtggat 5940

catatgcatc attttctggt tttggcaaaa aatacttcaa catgttatac atatttaaaa 6000

agcttggtgt ttttgcatc ctatctttct catatcgaag cagttttata atcctatttt 6060

6098

<210> 60

<211> 3000

<212> DNA

<213> Homo sapien

<300>

<308> AF072845

<309> 1998-06-22

<313> (1)..(3000)

<400> 60

aattcccagc cctggagctg gcattccagt gggaggccac tctcagtttc acttggtgac 60

ctttcacagc actgaccatg ttggccctat ttctcccctg cttgcttgct tttctatttt 120

attttattat tacattttta ttgttagaga gagggtctca ttctgtcgcc caggctggag 180

tgcagtggca aagtggtgag atctcggctc actgcaacct ccacttgcct cagtctccca 240

agtagctggg attacaggag cctgacacca tgcccgggta atttttgtat ttttgtagag 300

acggggtttc accatattgg cttgaactcc tgatctcagg tgatcccccc accttggcct 360

cccaaagtgc tgggattaca ggcatgagcc actgcggtgg cctctcccct gctttcaaga 420

tgccatgctc tcaggggtcc cctccctctt tctccatttc cctggcaaag ttcctcctct 480

tcccccattc agtgtgtgtt gtgataggggg cagaatcctg tctgcactca cttccttggt 540

gatctcaccc agtcttgtgg ctttaagtac catccataag ccatcaaccc ccaaatttac 600

atctccagac cagccttatc ccctgaactc ctaaatgcag tgaggttatt cagcatctcc 660

acagggagat tgtcaggcat ttccaaccct gtatgcccaa acctcgtcac tttccccgca 720

aacccacttc cctacctttc atctctgcca gcagacactc ccatcttctc agcgtttcat 780

gccagaaggc ttggctgtct aggatccctc tcaaacacac ccacattcat ttaatcagca 840

aattttcttg gccctacctc caaaatattt ccagatctcc ctagcctgca cacccttgcc 900

acctgtcatt cccacttgga ccaggccagc agcctccctg gtctctctga ccctccccct 960

gagttcgttc accaaaggca gtaacggaga caccccctca acacacacag gaagcagatg 1020

gccttgacac cagcagggtg acatccgcta ttgctacttc tctgctcccc cacagttcct 1080

ctggacttct ctggaccaca gtcctctgcc agacccctgc cagaccccag tccaccatga 1140

tccatctggg tcacatcctc ttcctgcttt tgctcccagg tgaagccagt ggttacaggg 1200

1260

gaaagtgggg ttcttctccc tgcacccctt cccttctggg agatccattc tgcttcaggg 1320

cctgggtcct tgggggcgga agggggtgag acagggagtt ctggaggggc tgcctgttag 1380

cgtccccttc tcatggctgg gtctctgctg ccacttccaa tttcttgtca ctctccatgt 1440

ctctgggagt ccccttccca tgtggtcctg ttccatctct ccagcctgga gattacttct 1500

1560

tcttgctctg ttgtccaggc tggagtgcag tggcacaatc acggctcacg gcagccttga 1620

cttcctgggc tcaggtgatc ctcccagctc agcctcccga gtaactggga ttacaggtgt 1680

gaaccaacac ttccagctaa tttttgtatt tcttgtagag acgaggtctc actatgttgc 1740

ccaggctggt ctcgaactcc tgggctcaag cgatcttcct gcctcggcct cccaaagtgc 1800

tgggatgaca ggcgtgagcc acggtgccag gctgagcatt ctgttttgtg gaccttctct 1860

ccaccctcat ccaccttctt tctctttcca cagtggctgc agctcagacg actccaggag 1920

agagatcatc actccctgcc ttttaccctg gcacttcagg tatcacttcc accccagaag 1980

cttggccaga ggctcccaga acaccccagt ggttctccag gtcaccatcc cacctcccgt 2040

ccccaaatca gaggatccgt gtccttctcc gagtcccaga atcagcgacc cccagcctgt 2100

gttcaggagc accccgtgtg cccgccgcac agccccgagg gtcctgggac accccagcct 2160

ctctgcatct gtctcccgtt tcattcccca agcgcaactc caaggaacct gggacccgcc 2220

ccctcgcagg ggacttcctc tctgcctgtg gccaaagcac agccccagga cgcagagctt 2280

gagttgtctc cctgttccgg cccccactct ccaggctctt gttccggatg tgggtccctc 2340

tctctgccgc tcctggcagg cctcgtggct gctgatgcgg tggcatcgct gctcatcgtg 2400

ggggcggtgt tcctgtgcgc acgccccgc cgcagccccg cccaaggtga gggcggagat 2460

gggcggggcc tggaaggtgt atagtgtccc tagggagggg gtcccaggga gggggccctt 2520

ggggaagccc tggaggaggt gctggggaaa ccctggggga ggtgcctggg ggaacccctg 2580

aggaaaccccc tgaagcaggg ggtccccagg gaagtggaga tatgggtggt caagcttcat 2640

gctttctctc ccctatcccc agaagatggc aaagtctaca tcaacatgcc aggcaggggc 2700

tgaccctcct gcagcttgga cctttgactt ctgaccctct catcctggat ggtgtgtggt 2760

ggcacaggaa cccccgcccc aacttttgga ttgtaataaa acaattgaaa cacctgtagt 2820

2880

gatccaaggc cccctcagaa cccccacatg tccccatccc atcagcccaa ggatctggca 2940

taatgttttt gtgcttcatg tttattttag gagagtattg gggagcggtc tggtctctca 3000

<210> 61

<211> 604

<212> DNA

<213> Homo sapien

<300>

<308> AF019562

<309> 1997-08-14

<313> (1)..(604)

<400> 61

ccacgcgtcc gcgctgcgcc acatcccacc ggcccttaca ctgtggtgtc cagcagcatc 60

cggcttcatg gggggacttg aaccctgcag caggctcctg ctcctgcctc tcctgctggc 120

tgtaagtggt ctccgtcctg tccaggccca ggcccagagc gattgcagtt gctctacggt 180

gagcccgggc gtgctggcag ggatcgtgat gggagacctg gtgctgacag tgctcattgc 240

cctggccgtg tacttcctgg gccggctggt ccctcggggg cgaggggctg cggaggcagc 300

gacccggaaa cagcgtatca ctgagaccga gtcgccttat caggagctcc agggtcagag 360

gtcggatgtc tacagcgacc tcaacacaca gaggccgtat tacaaatgag cccgaatcat 420

gacagtcagc aacatgatac ctggatccag ccattcctga agcccaccct gcacctcatt 480

ccaactccta ccgcgataca gacccacaga gtgccatccc tgagagacca gaccgctccc 540

caatactctc ctaaaataaa catgaagcac aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 600

aaaa 604

<210> 62

<211> 1677

<212> DNA

<213> Homo sapien

<300>

<308> NM_198053

<309> 2010-08-01

<313> (1)..(1677)

<400> 62

gtcctccact tcctggggag gtagctgcag aataaaacca gcagagactc cttttctcct 60

aaccgtcccg gccaccgctg cctcagcctc tgcctcccag cctctttctg agggaaagga 120

caagatgaag tggaaggcgc ttttcaccgc ggccatcctg caggcacagt tgccgattac 180

agaggcacag agctttggcc tgctggatcc caaactctgc tacctgctgg atggaatcct 240

cttcatctat ggtgtcattc tcactgcctt gttcctgaga gtgaagttca gcaggagcgc 300

agacgccccc gcgtaccagc agggccagaa ccagctctat aacgagctca atctaggacg 360

aagagaggag tacgatgttt tggacaagag acgtggccgg gaccctgaga tggggggaaa 420

gccgcagaga aggaagaacc ctcaggaagg cctgtacaat gaactgcaga aagataagat 480

ggcgggaggcc tacagtgaga ttgggatgaa aggcgagcgc cggaggggca aggggcacga 540

tggcctttac cagggtctca gtacagccac caaggacacc tacgacgccc ttcacatgca 600

ggccctgccc ccctcgctaac agccagggga tttcaccact caaaggccag acctgcagac 660

gcccagatta tgagacacag gatgaagcat ttacaacccg gttcactctt ctcagccact 720

gaagtattcc cctttatgta caggatgctt tggttatatt tagctccaaa ccttcacaca 780

cagactgttg tccctgcact ctttaaggga gtgtactccc agggcttacg gccctggcct 840

tgggccctct ggtttgccgg tggtgcaggt agacctgtct cctggcggtt cctcgttctc 900

cctgggaggc gggcgcactg cctctcacag ctgagttgtt gagtctgttt tgtaaagtcc 960

ccagagaaag cgcagatgct agcacatgcc ctaatgtctg tatcactctg tgtctgagtg 1020

gcttcactcc tgctgtaaat ttggcttctg ttgtcacctt cacctccttt caaggtaact 1080

gtactgggcc atgttgtgcc tccctggtga gagggccggg cagaggggca gatggaaagg 1140

agcctaggcc aggtgcaacc agggagctgc aggggcatgg gaaggtggggc gggcaggggga 1200

gggtcagcca gggcctgcga gggcagcggg agcctccctg cctcaggcct ctgtgccgca 1260

ccattgaact gtaccatgtg ctacaggggc cagaagatga acagactgac cttgatgagc 1320

tgtgcacaaa gtggcataaa aaacatgtgg ttacacagtg tgaataaagt gctgcggagc 1380

aagaggaggc cgttgattca cttcacgctt tcagcgaatg acaaaatcat ctttgtgaag 1440

gcctcgcagg aagacccaac acatgggacc tataactgcc cagcggacag tggcaggaca 1500

ggaaaaaccc gtcaatgtac taggatactg ctgcgtcatt acagggcaca ggccatggat 1560

ggaaaacgct ctctgctctg ctttttttct actgttttaa tttatactgg catgctaaag 1620

ccttcctatt ttgcataata aatgcttcag tgaaaaaaaa aaaaaaaaaa aaaaaaa 1677

<210> 63

<211> 591

<212> DNA

<213> Homo sapien

<300>

<308> M33195

<309> 1993-04-27

<313> (1)..(591)

<400> 63

cagaacggcc gatctccagc ccaagatgat tccagcagtg gtcttgctct tactcctttt 60

ggttgaacaa gcagcggccc tgggagagcc tcagctctgc tatatcctgg atgccatcct 120

gtttctgtat ggaattgtcc tcaccctcct ctactgtcga ctgaagatcc aagtgcgaaa 180

ggcagctata accagctatg agaaatcaga tggtgtttac acgggcctga gcaccaggaa 240

ccaggagact tacgagactc tgaagcatga gaaaccacca cagtagcttt agaatagatg 300

cggtcatatt cttctttggc ttctggttct tccagccctc atggttggca tcacatatgc 360

ctgcatgcca ttaacaccag ctggccctac ccctataatg atcctgtgtc ctaaattaat 420

atacaccagt ggttcctcct ccctgttaaa gactaatgct cagatgctgt ttacggatat 480

ttatattcta gtctcactct cttgtcccac ccttcttctc ttccccattc ccaactccag 540

ctaaaatatg ggaagggaga acccccaata aaactgccat ggactggact c 591

<210> 64

<211> 1687

<212> DNA

<213> Homo sapiens

<400> 64

tgctttctca aaggccccac agtcctccac ttcctgggga ggtagctgca gaataaaacc 60

agcagagact ccttttctcc taaccgtccc ggccaccgct gcctcagcct ctgcctccca 120

gcctctttct gagggaaagg acaagatgaa gtggaaggcg cttttcaccg cggccatcct 180

gcaggcacag ttgccgatta cagaggcaca gagctttggc ctgctggatc ccaaactctg 240

ctacctgctg gatggaatcc tcttcatcta tggtgtcatt ctcactgcct tgttcctgag 300

agtgaagttc agcaggagcg cagacgcccc cgcgtaccag cagggccaga accagctcta 360

taacgagctc aatctaggac gaagagagga gtacgatgtt ttggacaaga gacgtggccg 420

ggaccctgag atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga 480

actgcagaaa gtaagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg 540

gaggggcaag gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta 600

cgacgccctt cacatgcagg ccctgccccc tcgctaacag ccaggggatt tcaccactca 660

aaggccagac ctgcagacgc ccagattatg agacacagga tgaagcattt acaacccggt 720

tcactcttct cagccactga agtattcccc tttatgtaca ggatgctttg gttatattta 780

gctccaaacc ttcacacaca gactgttgtc cctgcactct ttaagggagt gtactcccag 840

ggcttacggc cctggccttg ggccctctgg tttgccggtg gtgcaggtag acctgtctcc 900

tggcggttcc tcgttctccc tgggaggcgg gcgcactgcc tctcacagct gagttgttga 960

gtctgttttg taaagtcccc agagaaagcg cagatgctag cacatgccct aatgtctgta 1020

tcactctgtg tctgagtggc ttcactcctg ctgtaaattt ggcttctgtt gtcaccttca 1080

cctcctttca aggtaactgt actgggccat gttgtgcctc cctggtgaga gggccggggca 1140

gaggggcaga tggaaaggag cctaggccag gtgcaaccag ggagctgcag gggcatggga 1200

1260

tcaggcctct gtgccgcacc attgaactgt accatgtgct acaggggcca gaagatgaac 1320

1380

aataaagtgc tgcggagcaa gaggaggccg ttgattcact tcacgctttc agcgaatgac 1440

aaaatcatct ttgtgaaggc ctcgcaggaa gacccaacac atgggaccta taactgccca 1500

gcggacagtg gcaggacagg aaaaacccgt caatgtacta ggatactgct gcgtcattac 1560

agggcacagg ccatggatgg aaaacgctct ctgctctgct ttttttctac tgttttaatt 1620

tatactggca tgctaaagcc ttcctatttt gcataataaa tgcttcagtg aaaatgcaaa 1680

aaaaaaa 1687

<210> 65

<211> 163

<212> PRT

<213> Homo sapiens

<400> 65

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Phe Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

145 150 155 160

Pro Pro Arg

<210> 66

<211> 255

<212> DNA

<213> Homo sapiens

<400> 66

catcgctggt gctccaacaa aaaaaatgct gcggtaatgg accaagagtc tgcaggaaac 60

agaacagcga atagcaagga ctctgatgaa caagaccctc aggaggtgac atacacacag 120

ttgaatcact gcgttttcac acagagaaaa atcactcacc cttctcagag gcccaagaca 180

cccccaacag atatcatcat gtacacggaa cttccaaatg ctgagtccag atccaaagtt 240

gtctcctgcc catga 255

<210> 67

<211> 84

<212> PRT

<213> Homo sapiens

<400> 67

His Arg Trp Cys Ser Asn Lys Lys Asn Ala Ala Val Met Asp Gln Glu

1 5 10 15

Ser Ala Gly Asn Arg Thr Ala Asn Ser Glu Asp Ser Asp Glu Gln Asp

20 25 30

Pro Gln Glu Val Thr Tyr Thr Gln Leu Asn His Cys Val Phe Thr Gln

35 40 45

Arg Lys Ile Thr Arg Pro Ser Gln Arg Pro Lys Thr Pro Pro Thr Asp

50 55 60

Ile Ile Val Tyr Thr Glu Leu Pro Asn Ala Glu Ser Arg Ser Lys Val

65 70 75 80

Val Ser Cys Pro

<210> 68

<211> 97

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-zeta shRNA sequence

<400> 68

tgctgttgac agtgagcgac ctcttgccag gatatttatt tagtgaagcc acagatgtaa 60

ataaatatcc tggcaagagg gtacctactg cctcgga 97

<210> 69

<211> 97

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-zeta shRNA sequence

<400> 69

tgctgttgac agtgagcgac cctcttgcca ggatatttat tagtgaagcc acagatgtaa 60

taaatatcct ggcaagggg ctgcctactg ccctcgga 97

<210> 70

<211> 97

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-zeta shRNA sequence

<400> 70

tgctgttgac agtgagcgac ctcagtatcc tggatctgaa tagtgaagcc acagatgtat 60

tcagatccag gatactgagg gtgcctactg cctcgga 97

<210> 71

<211> 97

<212> DNA

<213> Artificial Sequence

<220>

<223> CD3-zeta shRNA sequence

<400> 71

tgctgttgac agtgagcgcg gatggaatcc tcttcatcta tagtgaagcc acagatgtat 60

agatgaagag gattccatcc atgcctactg cctcgga 97

<210> 72

<211> 528

<212> DNA

<213> Homo sapiens

<400> 72

atgaaaaacg tgttcccacc cgaggtcgct gtgtttgagc catcagaagc agagatctcc 60

cacacccaaa aggccacact ggtgtgcctg gccacaggct tctaccccga ccacgtggag 120

ctgagctggt gggtgaatgg gaaggaggtg cacagtgggg tcagcacaga cccgcagccc 180

ctcaaggagc agcccgccct caatgactcc agatactgcc tgagcagccg cctgagggtc 240

tcggccacct tctggcagaa cccccgcaac cacttccgct gtcaagtcca gttctacggg 300

ctctcggaga atgacgagtg gacccaggat agggccaaac ctgtcaccca gatcgtcagc 360

gccgaggcct ggggtagagc agactgtggc ttcacctccg agtcttacca gcaaggggtc 420

ctgtctgcca ccatcctcta tgagatcttg ctagggaagg ccaccttgta tgccgtgctg 480

gtcagtgccc tcgtgctgat ggccatggtc aagagaaagg atttctaa 528

<210> 73

<211> 175

<212> PRT

<213> Homo sapiens

<400> 73

Met Lys Asn Val Phe Pro Glu Val Ala Val Phe Glu Pro Ser Glu

1 5 10 15

Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu Ala Thr

20 25 30

Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn Gly Leu

35 40 45

Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys Glu Gln

50 55 60

Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val

65 70 75 80

Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val

85 90 95

Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala

100 105 110

Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp

115 120 125

Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr

130 135 140

Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu

145 150 155 160

Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Phe

165 170 175

<210> 74

<211> 168

<212> DNA

<213> Homo sapiens

<400> 74

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtc tcattctcac tgccttgttc ctgagagtga agttcagc 168

<210> 75

<211> 56

<212> PRT

<213> Homo sapiens

<400> 75

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser

50 55

<210> 76

<211> 189

<212> DNA

<213> Homo sapiens

<400> 76

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gccccgcg 189

<210> 77

<211> 63

<212> PRT

<213> Homo sapiens

<400> 77

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala

50 55 60

<210> 78

<211> 214

<212> DNA

<213> Homo sapiens

<400> 78

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt accagcaggg ccagaaccca gctc 214

<210> 79

<211> 71

<212> PRT

<213> Homo sapiens

<400> 79

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Pro Ala

65 70

<210> 80

<211> 423

<212> DNA

<213> Homo sapiens

<400> 80

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcca tcgctggtgc 180

tccaacaaaa aaaatgctgc ggtaatggac caagagtctg caggaaacag aacagcgaat 240

agcgaggact ctgatgaaca agaccctcag gaggtgacat acacacagtt gaatcactgc 300

gttttcacac agagaaaaat cactcgaaat tctcagaggc ccaagacacc cccaacagat 360

atcatcatgt acacggaact tccaaatgct gagtccagat ccaaagttgt ctcctgccca 420

tga 423

<210> 81

<211> 140

<212> PRT

<213> Homo sapiens

<400> 81

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser His Arg Trp Cys Ser Asn Lys Lys

50 55 60

Asn Ala Ala Val Met Asp Gln Glu Ser Ala Gly Asn Arg Thr Ala Asn

65 70 75 80

Ser Glu Asp Ser Asp Glu Gln Asp Pro Gln Glu Val Thr Tyr Thr Gln

85 90 95

Leu Asn His Cys Val Phe Thr Gln Arg Lys Ile Thr Arg Pro Ser Gln

100 105 110

Arg Pro Lys Thr Pro Pro Thr Asp Ile Ile Val Tyr Thr Glu Leu Pro

115 120 125

Asn Ala Glu Ser Arg Ser Lys Val Val Ser Cys Pro

130 135 140

<210> 82

<211> 444

<212> DNA

<213> Homo sapiens

<400> 82

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgc atcgctggtg ctccaacaaa aaaaatgctg cggtaatgga ccaagagtct 240

gcaggaaaca gaacagcgaa tagcgaggac tctgatgaac aagaccctca ggaggtgaca 300

tacacacagt tgaatcactg cgttttcaca cagagaaaaa tcactcgccc ttctcagagg 360

tacacggaac ttccaaatgc tgagtccaga 420

tccaaagttg tctcctgccc atga 444

<210> 83

<211> 147

<212> PRT

<213> Homo sapiens

<400> 83

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala His

50 55 60

Arg Trp Cys Ser Asn Lys Lys Asn Ala Ala Val Met Asp Gln Glu Ser

65 70 75 80

Ala Gly Asn Arg Thr Ala Asn Ser Glu Asp Ser Asp Glu Gln Asp Pro

85 90 95

Gln Glu Val Thr Tyr Thr Gln Leu Asn His Cys Val Phe Thr Gln Arg

100 105 110

Lys Ile Thr Arg Pro Ser Gln Arg Pro Lys Thr Pro Pro Thr Asp Ile

115 120 125

Ile Val Tyr Thr Glu Leu Pro Asn Ala Glu Ser Arg Ser Lys Val Val

130 135 140

Ser Cys Pro

145

<210> 84

<211> 471

<212> DNA

<213> Homo sapiens

<400> 84

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt accagcaggg ccagaaccag ctccatcgct ggtgctccaa caaaaaaaat 240

gctgcggtaa tggaccaaga gtctgcagga aacagaacag cgaatagcga ggactctgat 300

cagttgaatc actgcgtttt cacacagaga 360

aaaatcactc gcccttctca gaggcccaag acacccccaa cagatatcat cgtgtacacg 420

gaacttccaa atgctgagtc cagatccaaa gttgtctcct gcccatgagc a 471

<210> 85

<211> 155

<212> PRT

<213> Homo sapiens

<400> 85

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Pro Ala His Arg Trp Cys Ser Asn Lys Lys Asn

65 70 75 80

Ala Ala Val Met Asp Gln Glu Ser Ala Gly Asn Arg Thr Ala Asn Ser

85 90 95

Glu Asp Ser Asp Glu Gln Asp Pro Gln Glu Val Thr Tyr Thr Gln Leu

100 105 110

Asn His Cys Val Phe Thr Gln Arg Lys Ile Thr Arg Pro Ser Gln Arg

115 120 125

Pro Lys Thr Pro Pro Thr Asp Ile Ile Val Tyr Thr Glu Leu Pro Asn

130 135 140

Ala Glu Ser Arg Ser Lys Val Val Ser Cys Pro

145 150 155

<210> 86

<211> 618

<212> DNA

<213> Homo sapiens

<400> 86

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atgtatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt tccagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agccggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gcccatcgct ggtgctccaa caaaaaaaat gctgcggtaa tggaccaaga gtctgcagga 420

aacagaacag cgaatagcga ggactctgat gaacaagacc ctcaggaggt gacatacaca 480

cagttgaatc actgcgtttt cacacagaga aaaatcactc gcccttctca gaggcccaag 540

acacccccaa cagatatcat cgtgtacacg gaacttccaa atgctgagtc cagatccaaa 600

gttgtctcct gcccatga 618

<210> 87

<211> 205

<212> PRT

<213> Homo sapiens

<400> 87

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Phe

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Gly Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala His Arg Trp Cys Ser Asn Lys

115 120 125

Lys Asn Ala Ala Val Met Asp Gln Glu Ser Ala Gly Asn Arg Thr Ala

130 135 140

Asn Ser Glu Asp Ser Asp Glu Gln Asp Pro Gln Glu Val Thr Tyr Thr

145 150 155 160

Gln Leu Asn His Cys Val Phe Thr Gln Arg Lys Ile Thr Arg Pro Ser

165 170 175

Gln Arg Pro Lys Thr Pro Pro Thr Asp Ile Ile Val Tyr Thr Glu Leu

180 185 190

Pro Asn Ala Glu Ser Arg Ser Lys Val Val Ser Cys Pro

195 200 205

<210> 88

<211> 708

<212> DNA

<213> Homo sapiens

<400> 88

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gaaaaagcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gccttcagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac acccatcgct ggtgctccaa caaaaaaaat 480

gctgcggtaa tggaccaaga gtctgcagga aacagaacag cgaatagcga ggactctgat 540

gaacaagacc ctcaggaggt gacatacaca cagttgaatc actgcgtttt cacacagaga 600

aaaatcactc gcccttctca gaggcccaag acacccccaa cagatatcat cgtgtacacg 660

gaacttccaa atgctgagtc cagatccaaa gttgtctcct gcccatga 708

<210> 89

<211> 235

<212> PRT

<213> Homo sapiens

<400> 89

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr His Arg Trp Cys Ser Asn Lys Lys Asn

145 150 155 160

Ala Ala Val Met Asp Gln Glu Ser Ala Gly Asn Arg Thr Ala Asn Ser

165 170 175

Glu Asp Ser Asp Glu Gln Asp Pro Gln Glu Val Thr Tyr Thr Gln Leu

180 185 190

Asn His Cys Val Phe Thr Gln Arg Lys Ile Thr Arg Pro Ser Glu Arg

195 200 205

Pro Lys Thr Pro Pro Thr Asp Ile Ile Val Tyr Thr Glu Leu Pro Asn

210 215 220

Ala Glu Ser Arg Ser Lys Val Val Ser Cys Pro

225 230 235

<210> 90

<211> 492

<212> DNA

<213> Homo sapiens

<400> 90

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggctgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 480

ccccctcgct aa 492

<210> 91

<211> 163

<212> PRT

<213> Homo sapiens

<400> 91

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Ala Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

145 150 155 160

Pro Pro Arg

<210> 92

<211> 492

<212> DNA

<213> Homo sapiens

<400> 92

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagtggcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt tccagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 480

ccccctcgct aa 492

<210> 93

<211> 163

<212> PRT

<213> Homo sapiens

<400> 93

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Phe Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

145 150 155 160

Pro Pro Arg

<210> 94

<211> 492

<212> DNA

<213> Homo sapiens

<400> 94

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt tccagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gccttcagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 480

ccccctcgct aa 492

<210> 95

<211> 163

<212> PRT

<213> Homo sapiens

<400> 95

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Phe Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

145 150 155 160

Pro Pro Arg

<210> 96

<211> 465

<212> DNA

<213> Homo sapiens

<400> 96

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt tccagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gccttcagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac accttcgacg ccctt 465

<210> 97

<211> 155

<212> PRT

<213> Homo sapiens

<400> 97

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Phe Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr Phe Asp Ala Leu

145 150 155

<210> 98

<211> 363

<212> DNA

<213> Homo sapiens

<400> 98

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt tccagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gcc 363

<210> 99

<211> 121

<212> PRT

<213> Homo sapiens

<400> 99

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Phe

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala

115 120

<210> 100

<211> 453

<212> DNA

<213> Homo sapiens

<400> 100

atgaagtgga aggcgctttt caccgcggcc atcctgcagg cacagttgcc gattacagag 60

gcacagagct ttggcctgct ggatcccaaa ctctgctacc tgctggatgg aatcctcttc 120

atctatggtg tcattctcac tgccttgttc ctgagagtga agttcagcag gagcgcagac 180

gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 240

gaggagtacc atgttttgga caagagacgt ggccgggacc ctgagatgggg gggaaagccg 300

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 360

gccttcagtg agattgggat gaaaggagcg cgccggaggg gcaaggggca cgatggcctt 420

taccagggtc tcagtacagc caccaaggac acc 453

<210> 101

<211> 151

<212> PRT

<213> Homo sapiens

<400> 101

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

100 105 110

Leu Gln Lys Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly Met Lys

115 120 125

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

130 135 140

Ser Thr Ala Thr Lys Asp Thr

145 150

<---

Claims (14)

1. A method for producing an engineered human T cell, comprising expressing a TCR inhibitory molecule (TIM) in said T cell, characterized in that the TIM is encoded by a nucleic acid sequence selected from SEQ ID No: 80, 82, 84, or 86 . 2. The method according to claim 1, characterized in that the nucleic acid encodes a polypeptide with SEQ ID NO: 81, 83 or 85. 3. The method according to p. 1, characterized in that the nucleic acid sequence is selected from SEQ ID NO: 80, 82 or 84. 4. The method according to any one of paragraphs. 1-3, characterized in that the T cell is also engineered to express the chimeric anti-tumor receptor. 5. The method according to any one of paragraphs. 1-4, characterized in that TIM destabilizes the TCR complex by reducing or blocking the expression of the components of the TCR complex. 6. The method according to any one of paragraphs. 1-5, characterized in that the engineered human T cell does not elicit graft-versus-host disease (GVHD) or elicits a reduced GVHD response in a histone-incompatible human recipient compared to a GVHD response elicited by a human T cell that does not express an inhibitory molecule TCR (TIM). 7. The method according to any one of paragraphs. 1-6, characterized in that the engineered human T cell does not induce a GVHD response in humans. 8. Constructed human T-cell that contains a nucleic acid having a sequence selected from SEQ ID No: 80, 82, 84 or 86 and which expresses TIM obtained by the method according to any one of paragraphs. 1-7. 9. A T cell pharmaceutical composition comprising a T cell and a pharmaceutically acceptable excipient, wherein the T cell is the engineered human T cell of claim 8 and is suitable for use in the treatment of cancer. 10. An engineered human T cell according to claim 8 or a pharmaceutical composition according to claim 9 for use in therapy. 11. The use of an engineered human T cell according to claim 8 or a pharmaceutical composition containing it in the treatment of cancer. 12. A vector for the construction of human T cells, characterized in that it contains a nucleic acid selected from SEQ ID No: 80, 82, 84 or 86. 13. The vector according to claim 12, characterized in that the nucleic acid sequence is SEQ ID No: 80, 82 or 84. 14. A human T cell expressing TIM and containing a nucleic acid encoding that TIM, characterized in that TIM is a polypeptide with a sequence selected from SEQ ID No: 81, 83, 85, or 87.

Images