RU2781116C1 - Compositions and methods for treatment of cancer - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions is described, including an antibody capable of binding to soluble protein of human extracellular domain CD39 (NTFDase 1) and inhibiting its ATF-phase activity (options), a kit for detection of protein CD39, containing the above-mentioned antibody, and a recombinant host cell producing the above-mentioned antibody. In one of implementations, the antibody contains three sections of HCDR containing amino acid sequences SEQ ID NO: 8-10 and three sections of LCDR containing amino acid sequences SEQ ID NO: 11-13.

EFFECT: invention expands the arsenal of means capable of binding to human CD39 and inhibiting its ATF-phase activity.

33 cl, 13 dwg, 1 tbl, 11 ex

Description

Cross-reference to related applications

The present application claims priority from Provisional Applications US Patent Nos. 62/471,994, filed March 16, 2017, and 62/586,220, filed November 15, 2017; both of these applications are incorporated herein by reference in their entirety, including any figures.

Link to sequence listing

The present application is filed with the sequence listing in electronic format. The sequence listing is presented as a file named "CD39-6_ST25", created on March 15, 2018, which is 53 KB in size. The information contained in electronic format in the sequence listing is incorporated herein by reference in its entirety.

Field of invention

The present invention provides antigen-binding compounds (eg, antibodies) that inhibit the enzymatic activity of soluble human CD39. The present invention also relates to cells producing such compounds; methods of obtaining such compounds and antibodies, their fragments, variants and derivatives; pharmaceutical compositions containing the above compounds; methods of using said compounds for the diagnosis, treatment or prevention of diseases such as cancer.

State of the art

Eight different ENTPD genes code for member proteins of the NTPDase (NTPDase) family. Separate subtypes of NTFDases differ in their localization in the cell and functional properties. Plasma membrane bound nucleoside triphosphate diphosphohydrolases control nucleotide levels on the cell surface by hydrolyzing the c- and b-phosphates of nucleotides.

NTPDase 1 (ectonucleoside triphosphate diphosphohydrolase-1), also known as CD39/ENTPD1 or vascular CD39, functions in conjunction with another enzyme, CD73 (ecto-5'-nucleotidase), to hydrolyze extracellular adenosine triphosphate (ATP) and adenosine diphosphate (ADP) to form adenosine, which binds to adenosine receptors and inhibits T cell and natural killer (NK) responses, thereby suppressing the immune system. The formation of adenosine via the CD73/CD39 pathway is considered to be the main mechanism of the immunosuppressive function of regulatory T cells (Treg). The number of CD39+-Treg is increased in some human cancers; The important role of CD39+-Treg in promoting tumor growth and metastasis has been demonstrated using several in vivo models. At the same time, CD39 is also expressed by tumor cells, and CD39+ tumor cells can mediate immunosuppression through the adenosine pathway. CD39 in cancer cells has ATPase activity and together with CD73 forms adenosine. CD73+CD39+ cancer cells inhibit the proliferation of CD4 and CD8 T cells and the formation of cytotoxic effector CD8 T cells (CTL) in a CD39 and adenosine dependent manner. It has been reported that CD39 levels are increased in some solid tumors (colon and rectal cancer, head and neck cancer, pancreatic cancer) as well as in chronic lymphocytic leukemia. Antibodies that bind and inhibit CD39 in CD39 expressing cells are disclosed in WO 2009/095478. The "A1" antibody (eBiosciences, Inc.) is used for staining and does not have the ability to neutralize CD39 activity in cells. In the article by Hayes et al. (2015) Am. J. Transl. Res. 7(6):1181-1188 used an anti-CD39 antibody that binds FcγR and has an effector function and is also said to be blocking. Expression of CD39 on various cell types, including leukocytes and tumor cells, combined with the use of antibodies that either do not actually block CD39 or are not pure blockers, creates difficult conditions for assessing the underlying activity of antibodies. To date, the only described inhibitor of the active site of CD39 remains small molecular weight non-hydrolysable ATP analogs, an example of which is ARL67156, which indicates the need to develop compounds that can directly inhibit the active site. At the same time, ARL67156 is not specific for CD39 and also inhibits other STPDases, such as mouse STPDase-1, STPDase-3, NPP1, or STPDase-8, but is a weak competitive inhibitor (Levesque et al. (2007) Br J Pharmacol 152:141-150).

CD39 contains two transmembrane domains near the N- and C-termini, short cytoplasmic N- and C-terminal segments, and a large extracellular domain containing an active site. However, while CD39 is typically membrane anchored by two transmembrane domains at either end of the molecule, a soluble, catalytically active form of CD39 has also been recently reported in human and mouse circulation (Yegutkin et al., (2012 ) FASEB J. 26(9): 3875-3883). While various anti-CD39 antibodies have been described, no antibody has been shown to be capable of inhibiting the ATPase activity of soluble extracellular protein CD39.

SUMMARY OF THE INVENTION The present inventors have made antibodies that inhibit the enzymatic (ATPase) activity of the soluble (extracellular domain) human CD39 protein. These antibodies additionally bind an epitope present on the human CD39 protein expressed on the surface of cells, including tumor cells, and effectively inhibit the enzymatic (ATPase) activity of the cell membrane bound CD39 enzyme (CD39 expressed on the cell surface). These antibodies can be successfully used to achieve greater neutralization of CD39 activity in an individual by neutralizing both membrane-bound and soluble CD39 protein (an extracellular domain of a protein in solution), thereby reducing immunosuppression, for example, for the treatment of cancer and/or infectious disease. Although other anti-CD39 antibodies have previously been described that inhibit the enzymatic (ATPase) activity of the membrane-bound CD39 enzyme, these antibodies do not inhibit soluble CD39 protein that is not bound to the cell membrane.

Accordingly, in one embodiment, an antigen-binding domain or a protein containing such a domain, optionally an antibody or antibody fragment, is provided that binds to soluble CD39 (sCD39) protein and inhibits or neutralizes its ATPase activity. In one embodiment, the sCD39 protein does not contain the two transmembrane domains (ie, transmembrane domains near the N- and C-termini) found in membrane-bound CD39. In one embodiment, sCD39 is a non-membrane-bound sCD39 protein found in the circulation, eg, in a human. In one embodiment, sCD39 contains or consists of the amino acid sequence of SEQ ID NO: 44 (optionally further containing a C-terminal marker or other amino acid sequence not derived from CD39). In one embodiment, the protein, antibody, or antibody fragment inhibits the ATPase activity of sCD39 when incubated with sCD39 in solution, e.g., according to methods or assays performed in the absence of cells, as described herein (see, e.g., "Examples" sections). , "Methods"). In one embodiment, the protein, antibody, or antibody fragment specifically binds human CD39 protein in both soluble (extracellular domain protein) and membrane bound form.

Regardless of theory, some antibodies can neutralize membrane-bound CD39 by inhibiting the movement of membrane-bound CD39 (memCD39) domains, but do not have a similar effect on the activity of soluble CD39 protein (sCD39). It has been reported that memCD39 occurs in the form of a homomultimer, while sCD39 is a monomer, and, in addition, the transmembrane domains in memCD39 undergo dynamic movements that underlie functional binding to the active site. Therefore, unlike sCD39, memCD39 may be under conditions where antibody-mediated neutralization is possible. One possibility is that functional neutralization requires the use of a divalent antibody that simultaneously binds to two memCD39 molecules (eg, as part of a memCD39 homomultimer).

Antibodies of the present invention that neutralize sCD39 (and memCD39) activity may, in addition to being used as bivalent binding agents, also be effective as monovalent binding agents whether or not they target memCD39 in addition to sCD39. Therefore, in one embodiment, an antigen-binding protein is provided that binds univalently to human CD39 (sCD39 and/or memCD39) protein and neutralizes its enzymatic (ATPase) activity. An antigen binding protein may optionally be specified as binding to a single CD39 protein and/or carrying a single antigen binding domain capable of binding to a CD39 protein. In one embodiment, an antibody fragment, optionally an F(ab) fragment, single chain antibody, scFv, multispecific antibody, is provided that binds univalently to human CD39 protein (sCD39 and/or memCD39) and neutralizes its enzymatic (ATPase) activity. In one embodiment, the CD39 neutralizing antigen binding protein monovalently binding to human CD39 protein is a multispecific antigen binding protein, e.g., multispecific antibody, bispecific antibody, trispecific antibody, etc. In one embodiment, the CD39 neutralizing antigen-binding protein that binds univalently to the human CD39 protein comprises a first (or only) antigen-binding domain that binds CD39 (sCD39 and/or memCD39) and a second antigen-binding domain that binds a protein that is not CD39.

Preferably, in one embodiment, the antibody comprises a human Fc domain modified to reduce or substantially eliminate binding to the human Fcγ receptor, e.g., one or more (or all) of human CD16, CD32a, CD32b, and CD64. In one aspect, the CD39 inhibitory activity of the antibodies is independent of ADCC, CDC, or toxin-mediated depletion of CD39-expressing cells. These antibodies can be used as "pure" CD39 blockers, providing immunomodulatory activity.

In an alternative implementation, you can get a binding molecule that retains and/or mediates the effector function through its Fc domain. In one embodiment, the antibody comprises a human Fc domain that binds to a human Fcγ receptor, eg, one or more (or all) of human CD16, CD32a, CD32b, and CD64.

In yet another embodiment, the Fc region can be modified to reduce binding to the Fcγ receptor, optionally while retaining binding to one or more of the human Fcγ receptors, but reducing binding to one or more of the other human Fcγ receptors.

In one aspect, the antibodies specifically bind CD39 in vessels, eg, the antibody binds a polypeptide containing the sequence of SEQ ID NO: 1, but does not bind a secreted CD39 isoform polypeptide, eg, a CD39-L2 and/or -L4 polypeptide. An anti-CD39 antibody does not necessarily specifically bind CD39 in vessels, eg, the antibody binds a polypeptide containing the sequence of SEQ ID NO: 1, but does not bind a membrane-bound isoform of CD39, eg, a CD39-L1 and/or -L3 polypeptide.

The antibodies of the present invention can inhibit the enzymatic activity of the membrane-bound CD39 protein expressed on the surface of cells.

In one aspect, the CD39 inhibitory activity of the antibodies is independent of CD39 suppression.

The antibodies of the present invention can, in addition to inhibiting soluble CD39, inhibit the enzymatic activity of the membrane-bound CD39 protein expressed on the cell surface with or without induction of CD39 internalization and with or without CD16 (FcγIII receptor) binding and/or with directing ADCC and/or CDC to or without a cell expressing CD39. Antibodies do not necessarily retain the Fc domain and the ability to bind human FcRn.

Although antibodies that function by inducing ADCC and/or CDC may be effective even without completely neutralizing/inhibiting CD39 ATPase activity, provided sufficient antibody binds to the CD39 expressing cell to induce ADCC, neutralizing non-depleting antibodies may require a stronger inhibition of enzymatic activity of ATPase. In one embodiment, a non-depleting antibody can provide at least a 50%, 60%, 70%, 80%, or 90% reduction in the ATPase activity of soluble CD39 protein (e.g., as assessed by the methods described herein), optionally at a concentration compatible with administration of the antibody to a human. In one embodiment, a non-depleting antibody can provide at least a 70%, 80%, 90% reduction in the ATPase activity of a CD39-expressing cell (e.g., as measured by a reduction in AMP production by a CD39+ cell, e.g., B cell, Ramos cell line, as measured by methods described herein, optionally at a concentration compatible with administration of the antibody to a human.

The CD39 epitope to which the antibody binds is present on CD39 polypeptides expressed by a variety of cells, e.g., cancer cells, CD4 T cells, CD8 T cells, B cells, transfected cells, and is characterized by high affinity binding as measured by flow cytometry. .

The antibody may optionally be characterized by an EC ₅₀ value of, according to flow cytometry, no more than 2 μg/ml, no more than 1 μg/ml, no more than 0.5 μg/ml, no more than 0.1 μg/ml, or no more than 0, 05 μg/ml to bind to cells expressing the CD39 polypeptide on their surface. In one embodiment, the cells are cells modified to express CD39 on their surface. In one embodiment, the cells are cells that endogenously express CD39 on their surface, e.g., regulatory T cells (TReg), B cells, cancer cells, lymphoma cells (e.g., Ramos cells), leukemia cells, bladder cancer cells, glioma cells, glioblastoma cells, ovarian cancer cells, melanoma cells, prostate cancer cells, thyroid cancer cells, esophageal cancer cells, or breast cancer cells.

In one aspect, an anti-CD39 antibody is provided that is capable of: (a) inhibiting the enzymatic activity of a membrane-bound CD39 protein (e.g., comprising the amino acid sequence of SEQ ID NO: 1) expressed on a cell surface, and (b) inhibiting the enzymatic activity of a soluble CD39 protein (e.g., containing the amino acid sequence of SEQ ID NO: 44). In one embodiment, the antibodies do not substantially bind (eg, via their Fc domain) to human Fcγ receptors (eg, CD16, CD32a, CD32b, CD64) and/or C1q and/or do not substantially direct ADCC and/or CDC in relation to a cell expressing CD39. Antibodies do not necessarily retain the Fc domain and the ability to bind human FcRn.

In one embodiment, antibodies are administered in an amount effective to neutralize sCD39 and/or memCD39 enzymatic activity for the desired time, eg, 1 week, 2 weeks, months, prior to the next anti-CD39 antibody administration.

In one embodiment, the antibodies are administered at a dosage and/or frequency that provides a blood concentration of the antibody equal to at least EC ₅₀ , EC ₇₀ or EC ₁₀₀ to inhibit the ATPase activity of the sCD39 protein, and the specified concentration is optionally maintained for at least 1 week , 2 weeks, months or until the next injection of anti-CD39 antibodies.

In one aspect, the antibody binds an epitope on CD39 containing an amino acid residue (eg, one, two, or three of the residues) selected from the group consisting of R138, M139, and E142 (relative to SEQ ID NO: 1).

In one aspect, an anti-CD39 antibody is characterized by reduced binding (e.g., substantially complete loss of binding ability) to a CD39 polypeptide containing a mutation at one, two, or three of residues selected from the group consisting of: R138, M139, and E142 (on in relation to SEQ ID NO: 1) compared to the wild-type CD39 polypeptide (CD39 polypeptide according to SEQ ID NO: 1); the mutant CD39 polypeptide optionally contains the R138A, M139A and E142K mutations. In one optional aspect, the antibody has no loss of binding to any of the mutant CD39 polypeptides of Table 1 other than mutant 19. In another optional aspect, the anti-CD39 antibody has reduced binding (optionally reduced, but not substantially complete loss of binding; or optionally a substantially complete loss of binding ability) to a CD39 polypeptide containing a mutation at one, two, three or four of the residues selected from the group consisting of: Q96, N99, E143 and R147 (with respect to SEQ ID NO: 1 ), compared to a wild-type CD39 polypeptide (CD39 polypeptide according to SEQ ID NO: 1); the mutant CD39 polypeptide optionally contains mutations: Q96A, N99A, E143A and R147E.

In one aspect, the antibody binds an epitope on CD39 containing an amino acid residue (eg, one, two, three, or four of the residues) selected from the group consisting of Q96, N99, E143, and R147 (relative to SEQ ID NO: 1). In one aspect, the antibody is characterized by reduced binding (e.g., substantially complete loss of binding ability) to a mutant CD39 polypeptide containing a mutation at 1, 2, 3, or 4 residues selected from the group consisting of Q96, N99, E143, and R147 ( in relation to SEQ ID NO: 1), in each case compared with the binding between the antibody and the wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1

In one aspect, an antibody binds an epitope on CD39 containing (a) an amino acid residue (e.g., one, two, or three of the residues) selected from the group consisting of R138, M139, and E142 (with respect to SEQ ID NO: 1) and ( b) an amino acid residue (eg one, two, three or four residues) selected from the group consisting of Q96, N99, E143 and R147.

In one aspect, an anti-CD39 antibody has reduced (e.g., substantially no ability) binding to (a) a CD39 polypeptide containing a mutation at one, two, three, or four residues selected from the group consisting of: Q96, N99, E143 and R147 (with respect to SEQ ID NO: 1) and (b) a CD39 polypeptide containing a mutation at one, two or three residues selected from the group consisting of: R138, M139 and E142 (with respect to SEQ ID NO: 1 ), in each case compared to the wild-type CD39 polypeptide (the CD39 polypeptide according to SEQ ID NO: 1). The mutant CD39 polypeptide according to paragraph (a) optionally contains mutations: Q96A, N99A, E143A and R147E. The mutant CD39 polypeptide according to paragraph (b) optionally contains mutations: R138A, M139A and E142K. The antibody does not necessarily lack the ability to bind to any of the mutant CD39 polypeptides of Table 1 other than mutants 5 and 19.

In one aspect, the antibody binds an epitope on CD39 containing an amino acid residue (e.g., one, two, three, or four of the residues) selected from the group consisting of K87, E100, and D107 (with respect to SEQ ID NO: 1)

In one aspect, an anti-CD39 antibody is characterized by reduced binding (e.g., substantially complete loss of binding ability) to a CD39 polypeptide containing a mutation at one, two, three, or four residues selected from the group consisting of: K87, E100, and D107 ( with respect to SEQ ID NO: 1) compared to a wild-type CD39 polypeptide (CD39 polypeptide according to SEQ ID NO: 1); the mutant CD39 polypeptide optionally contains the mutations: K87A, E100A and D107A. The antibody is optionally not characterized by a loss of ability to bind to any of the mutant CD39 polypeptides of Table 1 other than mutant 15.

In one aspect, the antibody binds an epitope on CD39 containing an amino acid residue (e.g., one, two, three, or four of the residues) selected from the group consisting of N371, L372, E375, K376, and V377 (with respect to SEQ ID NO: 1 ).

In one aspect, an anti-CD39 antibody is characterized by reduced binding (e.g., substantially complete loss of binding ability) to a CD39 polypeptide containing a mutation at one, two, three, four, or five residues selected from the group consisting of: N371, L372, E375, K376 and V377 (relative to SEQ ID NO: 1) compared to wild-type CD39 polypeptide (CD39 polypeptide according to SEQ ID NO: 1); the mutant CD39 polypeptide optionally contains the mutations: N371K, L372K, E375A, K376G and V377S and a valine insert between residues 376 and 377. The antibody does not necessarily lack the ability to bind to any of the mutant CD39 polypeptides of Table 1, except for mutant 11.

In one embodiment, CD39 neutralizing antibodies in a purified form can be characterized by the ability to cause a decrease in the ATPase activity of the sCD39 protein in a cell-free assay, optionally attenuating AMP production from sCD39 by at least 70%, 80%, or 90%; optionally increasing the level of ATP present (compared to a negative control), for example, as assessed by the assays described herein. For example, inhibition of sCD39 can be assessed by determining the number of luminescence units proportional to the amount of ATP present after incubation with anti-CD39 antibody. In one embodiment, CD39-neutralizing antibodies may have an EC ₅₀ value in inhibiting the ATPase activity of the sCD39 protein of at most 1 μg/ml, optionally at most 0.5 μg/ml, optionally at most 0.1 μg/ml.

Inhibition of the ATPase activity of the sCD39 protein is optionally quantified using Cell Titer Glo™ (Promega), a cell-free version of the assay, in which a series of doses of test antibody are incubated with the soluble recombinant human CD39 protein described in the Examples, Methods, for 1 hour at 37°C, where 20 μM ATP was added to the plates for an additional 30 minutes at 37°C before addition of the Cell Titer Glo™ (CTG) reagent, and the amount of light emitted was quantified using an Enspire™ luminometer after incubation for 5 minutes in the dark (see, for example, "Examples", "Methods").

CD39-neutralizing antibodies in a purified form may optionally be further characterized by the ability to cause a decrease in the ATPase activity of CD39 in cells, optionally reducing the production of AMP by a CD39-expressing cell by at least 70%, 80%, or 90%. In one embodiment, CD39-neutralizing antibodies may have an EC ₅₀ value when ATPase activity is inhibited (e.g., an EC ₅₀ when AMP production is inhibited by a cell expressing CD39) of CD39 expressed by the cell of at most 1 μg/mL, optionally at most 0.5 μg/ml, optionally not more than 0.1 μg/ml.

Inhibition of the ATPase activity of CD39 expressed in a cell is optionally determined by assessing the neutralization of ATPase activity in Ramos cells by quantifying AMP generated from ATP hydrolysis (see, for example, "Examples", "Methods").

In one aspect, neutralization of the ATPase activity of a CD39-expressing cell is determined by contacting the CD39-expressing cells (e.g., Ramos lymphoma cells used herein, available commercially, e.g., from ATCC, accession number CRL-1596), in contact with the antibody. and assessment of AMP production, for example, using mass spectrometry, where a decrease in the level of AMP formed indicates a neutralization of ATPase activity. In this assay, the antibody optionally causes a decrease in the level of generated AMP by at least 70%, 80%, or 90%. The antibody optionally causes a decrease in the extracellular ATPase activity of B cells by at least 70%, 80%, or 90%.

In one aspect, a neutralizing anti-CD39 antibody is provided that binds an antigenic determinant present on both sCD39 and cell surface expressed CD39 (memCD39).

In one aspect, there is provided a neutralizing anti-CD39 antibody that competes for binding to an epitope on CD39 bound by an I-394 antibody (e.g., competing for binding to an epitope on a CD39 polypeptide with an antibody containing CDRs or variable regions of the I-394 heavy and light chain) .

In one aspect of any of the embodiments of the present invention, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with the I-394 monoclonal antibody (e.g., binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody containing CDRs or heavy and light chain variable regions of I-394). In one embodiment, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody comprising the VH and VL regions of SEQ ID NOs: 6 and 7, respectively.

In one embodiment, an anti-CD39 antibody binds to an epitope containing one, two, or three amino acid residues selected from the group consisting of CD39 amino acid residues bound by I-394.

In one aspect of any embodiment of the present invention, an antigen-binding compound (e.g., an antibody or antibody fragment) is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with an I-395 monoclonal antibody (e.g., binds the same the epitope itself, and/or competing for binding to a CD39 polypeptide with an antibody containing CDRs or I-395 heavy and light chain variable regions). In one aspect of any of the embodiments of the present invention, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with an I-396 monoclonal antibody (e.g., binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody containing CDRs or heavy and light chain variable regions of I-396). In one aspect of any of the embodiments of the present invention, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with the I-397 monoclonal antibody (e.g., binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody containing CDRs or heavy and light chain variable regions of I-397). In one aspect of any of the embodiments of the present invention, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with the I-398 monoclonal antibody (e.g., binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody containing CDRs or heavy and light chain variable regions of I-398). In one aspect of any of the embodiments of the present invention, an antigen-binding compound is provided that binds the same epitope and/or competes for binding to a CD39 polypeptide with the I-399 monoclonal antibody (e.g., binds the same epitope and/or competes for binding to a CD39 polypeptide with an antibody containing CDRs or heavy and light chain variable regions of I-399).

In one embodiment, the binding molecule (e.g., an antibody or antibody fragment) comprises a heavy chain variable domain (V _H ) containing heavy chain CDR1, 2, and 3 (e.g., as described herein) of antibody I-394, I-395, I -396, I-397, I-398, or I-399, and a light chain variable domain (V _L ) containing light chain CDR1, 2, and 3 (eg, those described herein) of the corresponding antibody I-394, I-395 , I-396, I-397, I-398, or I-399, or an amino acid sequence in which the CDR (or set of heavy and/or light chain CDRs) is at least 70%, 80%, 90%, or 95% identical amino acid sequence relative to said CDR (or said set of heavy and/or light chain CDRs). In one aspect of any of the embodiments herein, an antibody may comprise a heavy chain comprising three heavy chain variable region (VH) CDRs of an antibody I-394, I-395, I-396, I-397, I-398, or I-399 and a light chain containing three light chain variable region (VL) CDRs of the corresponding I-394, I-395, I-396, I-397, I-398, or I-399 antibody, the CDRs being optionally determined according to Kabat numbering schemes , Chothia or IMGT.

In one aspect, there is provided an antibody comprising an Fc domain modified (compared to a wild-type Fc domain of the same isotype) to reduce binding between the Fc domain and human CD16A, CD16B, CD32A, CD32B, and/or CD64 polypeptides, wherein said the antibody comprises: (i) a heavy chain containing the heavy chain variable region CDRs 1, 2 and 3 according to SEQ ID NO: 6, and (ii) a light chain containing the light chain variable region CDRs 1, 2 and 3 according to SEQ ID NO: 7. In one aspect, the Fc domain is modified (compared to a wild-type Fc domain of the same isotype) to reduce binding between the Fc domain and a human C1q polypeptide. In one embodiment, the antibody contains an amino acid substitution in the heavy chain constant region at any one, two, three, four, five or more residues selected from the group consisting of: 220, 226, 229, 233, 234, 235, 236, 237 , 238, 243, 264, 268, 297, 298, 299, 309, 310, 318, 320, 322, 327, 330 and 331 (EU Kabat numbering). In one embodiment, the antibody contains an amino acid substitution in the heavy chain constant region at any three, four, five or more residues selected from the group consisting of: 234, 235, 237, 322, 330, and 331.

In one embodiment, the antibodies are administered to the individual with cancer in an amount and at a frequency sufficient to neutralize sCD39 activity in the tumor microenvironment and/or in the bloodstream. In one embodiment, the antibodies are administered in an amount and at a frequency sufficient to reduce the formation and/or concentration of adenosine in the tumor microenvironment. In one embodiment, the antibodies are administered in an amount and at a frequency sufficient to reduce the formation and/or concentration of AMP and/or adenosine in the tumor microenvironment. In one embodiment, the antibodies are administered in an amount and at a frequency sufficient to neutralize CD39 activity expressed by the tumor cells. In one embodiment, antibodies are administered in an amount and at a frequency sufficient to neutralize CD39 activity expressed by leukocytes or lymphocytes, eg, CD4 T cells, CD8 T cells, TReg cells, and/or B cells.

Antibodies can be used to inhibit CD39-mediated ATP hydrolysis, for example, thereby reducing the concentration of adenosine in the tumor microenvironment and/or in the bloodstream. Thus, these antibodies can be used to reverse the immunosuppressive effects of CD39 and/or adenosine on T cells, B cells, and other cells that express adenosine receptors (A2A receptors), for example, in the treatment of cancer. In one embodiment, the CD39 antibody neutralizes adenosine-mediated inhibition of proliferation, cytokine production, cytotoxicity, and/or NFκB-b activity in T cells.

Antibodies can be used to inhibit the production, amount and/or concentration of adenosine in the tumor microenvironment and/or in the bloodstream.

In another aspect, a method of treating an individual is provided, comprising administering to the individual (eg, an individual with a disease, tumor, etc.) a therapeutically active amount of any of the anti-CD39 antigen-binding compounds described herein. In one aspect, there is provided a method of treating an individual, said method comprising, essentially consisting of, or consisting of administering to the individual (e.g., an individual with a disease, tumor, etc.) a therapeutically active amount of an antigen-binding compound of the present invention that inhibits a CD39 polypeptide . In one embodiment, an anti-CD39 antigen-binding compound (e.g., antibody) is administered to the individual in combination with a second therapeutic agent, optionally a therapeutic agent (e.g., antibody) that neutralizes human PD-1 inhibitory activity, optionally an anti-PD-1 antibody, optionally an anti-PD-L1 antibody. In one embodiment, an anti-CD39 antigen-binding compound (eg, an antibody) is administered to an individual with cancer who has responded poorly or is expected to respond to treatment with an agent that neutralizes human PD-1 inhibitory activity. In one embodiment, the antibody inhibits the CD39 polypeptide in a cellular assay. In one embodiment, the compound is a non-depleting antibody (an antibody that does not deplete the cells to which it binds, such as an antibody with a silent Fc fragment). The compound optionally binds to CD39 polypeptides in a bivalent manner. The antibody is optionally a chimeric, humanized or human antibody. The antibody optionally contains an IgG isotype heavy chain constant region (eg lgG1) modified to eliminate binding to human Fcγ receptors (eg CD16A, CD16B, CD32A, CD32B and/or CD64).

In yet another aspect, antibodies having improved stability and/or solubility in conventional pharmaceutical compositions can be advantageously combined with other antibodies in pharmaceutical compositions. In one embodiment, a pharmaceutical composition is provided comprising (i) an antibody that inhibits a CD39 polypeptide and has improved stability, e.g., an antibody that inhibits a CD39 polypeptide containing multiple aromatic residues in the CDR, and a modified human lgG1 Fc domain containing an amino acid substitution at any three, four, five or more residues at Kabat positions 234, 235, 237, 322, 330 and 331, and (ii) a second human IgG isotype antibody, said second antibody optionally having anti-cancer activity. In one embodiment, said second antibody is capable of inducing ADCC against the cell to which it binds, wherein the second antibody optionally binds to an antigen present on the tumor cell (tumor antigen). In one embodiment, the second antibody is capable of neutralizing the activity of a protein to which its hypervariable region binds. In one embodiment, a pharmaceutical composition is provided comprising (i) an antibody that inhibits a CD39 polypeptide and has improved stability, e.g., an antibody that inhibits a CD39 polypeptide containing multiple aromatic residues in the CDR, and a modified human lgG1 Fc domain containing an amino acid substitution at any three, four, five or more residues at Kabat positions 234, 235, 237, 322, 330 and 331, and (ii) a second human IgG isotype antibody, said second antibody neutralizing human PD-1 inhibitory activity and optionally being an antibody against PD-1 is optionally an anti-human PD-1 antibody. In one embodiment, both the anti-CD39 antibody and the second antibody comprise a modified human IgG1 Fc domain containing an amino acid substitution at any three, four, five or more residues at Kabat positions 234, 235, 237, 322, 330, and 331.

In one aspect, a method is provided for inhibiting ATP hydrolysis by a CD39-expressing cell (e.g., a leukocyte and/or a tumor cell of an individual), or a method for neutralizing the enzymatic activity of a CD39 cell, said method comprising: contacting a CD39-expressing cell with an antibody of the present invention, inhibitory CD39. In one embodiment, the step of contacting a CD39-expressing cell with an antigen-binding compound of the present invention comprises administering to an individual a therapeutically active amount of an antibody that inhibits CD39. In one embodiment, the individual is suffering from cancer.

In one aspect, a method is provided for reducing the level of adenosine present in a tumor environment (e.g., in an individual), said method comprising, essentially consisting of, or consisting of: administering to the individual a therapeutically active amount of an antibody of the present invention that inhibits a CD39 polypeptide. In one embodiment, the individual is suffering from cancer.

In one embodiment, the active amount of an antibody that inhibits a CD39 polypeptide is an amount to achieve and/or maintain (e.g., until the next administration of an antigen-binding compound) a blood concentration of at least EC ₅₀ , optionally EC ₇₀ , optionally essentially EC ₁₀₀ to inhibit CD39-mediated catabolism of ATP to AMP in an individual. In one embodiment, the active amount of an antigen-binding compound that inhibits a CD39 polypeptide is an amount to achieve an EC ₅₀ , optionally EC ₇₀ , optionally substantially EC ₁₀₀ to inhibit CD39-mediated ATP to AMP catabolism in human extravascular tissue. In one embodiment, the active amount of an antigen-binding compound that inhibits a CD39 polypeptide is an amount to achieve an EC ₅₀ , optionally EC ₇₀ , optionally substantially EC ₁₀₀ to inhibit CD39-mediated catabolism of ATP to AMP in a human. In one embodiment, the active amount of the antigen-binding compound that inhibits the CD39 polypeptide is from 1 to 20 mg/kg of body weight. In one embodiment, the active amount is administered to the individual weekly, every two weeks, monthly, or every two months.

The subject is not necessarily a person suffering from cancer or having a predisposition to cancer. The subject is optionally a human suffering from or prone to cancer characterized by malignant cells expressing CD39 and/or the presence (secretion or excretion) of soluble CD39 protein. The subject is optionally a human with or prone to cancer who has detectable levels of circulating soluble extracellular protein CD39 or tumor-infiltrating leukocytes expressing CD39.

Antibodies are optionally characterized by a binding affinity (K _D ) for a human CD39 polypeptide of less than (better than) 10 ^-9 M, preferably less than 10 ^-10 M, or preferably less than 10 ^-11 M, and/or binding to human CD39 with an EC ₅₀ value below (better binding than) 1 µg/ml, said antibody preferably having an EC _{50 of} not more than 0.5 µg/ml, optionally not more than 0.2 µg/ml, optionally not more than 0.1 µg/ml for binding to cells (eg, tumor cells) expressing human CD39 on the cell surface.

The antibodies are optionally chimeric, humanized or human antibodies.

The antibodies are optionally characterized by an EC ₅₀ to neutralize CD39 enzymatic activity in CD39 expressing cells (eg, Ramos tumor cells) of less than (better than) 1 μg/ml, optionally less than 0.5 μg/ml.

In one embodiment, the antibody is a monoclonal antibody or fragment thereof that retains binding specificity and the ability to neutralize CD39 enzymatic activity. In one embodiment, the antibody is an lgG1 antibody. For example, an antibody may be an antibody containing a human lgG1 isotype Fc domain modified to reduce binding between the Fc domain and the Fcγ receptor (eg, CD16). In one embodiment, the antigen-binding compound does not contain an Fc domain or contains an Fc domain that does not induce antibody-mediated cellular cytotoxicity (ADCC) and/or CDC; the antigen-binding compound optionally contains an Fc domain that does not bind to the FcγRIIIA (CD16) polypeptide. In one embodiment, an Fc domain (e.g., human IgG1, IgG2, IgG3, or IgG4 isotype) contains an amino acid modification (e.g., substitution) compared to a wild-type Fc domain, said substitution reducing the ability of the Fc domain (or antibodies containing it) bind to an Fcγ receptor (eg, CD16) and/or bind complement. In one embodiment, the antigen-binding compound is not associated with a toxic group.

The present invention also provides nucleic acids encoding a human antibody or a humanized antibody or antibody fragment having any of the above properties, a vector containing such a nucleic acid, a cell containing such a vector, and a method for producing a human anti-CD39 antibody, comprising culturing such a cell in conditions suitable for the expression of antibodies against CD39. The present invention also relates to compositions, for example, pharmaceutically acceptable compositions and kits, containing such proteins, nucleic acids, vectors and/or cells, and usually one or more additional ingredients, which may be active ingredients or inactive ingredients to aid formulation, delivery, stability or other characteristics of the composition (eg different carriers). The present invention also relates to various new and useful methods for the production and use of such antibodies, nucleic acids, vectors, cells, organisms and/or compositions, for example, in the modulation of CD39-mediated biological activities, for example, in the treatment of diseases associated with them, especially cancer.

The present invention also provides a method for enhancing the activity of lymphocytes (eg, T cells) in a subject in need thereof, or restoring the activity of lymphocytes (eg, T cells), or a method for attenuating adenosine-mediated inhibition of lymphocytes (eg, T cells), wherein said method comprises administering to the subject an effective amount of any of the foregoing compositions. In one embodiment, the subject is a patient suffering from cancer. For example, the patient may be suffering from a solid tumor, such as colorectal cancer, kidney cancer, ovarian cancer, lung cancer, breast cancer, or malignant melanoma. Alternatively, the patient may be suffering from a hemoblastosis, such as acute myeloid leukemia, chronic myeloid leukemia, multiple myeloma, or non-Hodgkin's lymphoma.

The present invention also provides a method of treating a disease in an individual, the treatment comprising administering to the individual an anti-CD39 antibody that neutralizes CD39 enzymatic activity for at least one administration cycle, wherein the anti-CD39 antibody is administered at least once, optionally at least twice, in amount to achieve and/or maintain between two successive injections the concentration of antibodies against CD39 in the blood (serum) or extravascular tissue (for example, surrounded by a tumor), which corresponds to at least an EC ₅₀ (for example, EC ₅₀ values ranging from 0, 01 to 0.5 µg/ml), optional EC ₇₀ or optional EC ₁₀₀ to neutralize CD39 enzymatic activity (e.g. EC ₁₀₀ values of 0.05 to 1 µg/ml, 0.1 to 1 µg/ml) . The antibody can, for example, be administered in an amount that provides and/or maintains a concentration in the bloodstream or in extravascular tissue (for example, surrounded by a tumor) equal to at least about 0.1 μg/ml, 0.5 μg/ml, 1 μg /ml or 2 µg/ml). For example, to achieve an extravascular concentration between 0.05 and 1 µg/mL, or 0.1 to 1 µg/mL, anti-CD39 antibody is administered in amounts to achieve a circulating anti-CD39 antibody concentration between 0.5 and 10 mcg/ml, or between 1 and 10 mcg/ml. Anti-CD39 antibody is optionally administered at least twice and in amounts to maintain at least the aforementioned concentration of anti-CD39 antibody for at least 1 week, 2 weeks, 3 weeks, 4 weeks between two consecutive administrations of anti-CD39 antibody and/or throughout the entire administration cycle.

The present invention also provides a method of treating a disease in an individual, the treatment comprising administering to the individual an anti-CD39 antibody that neutralizes CD39 enzymatic activity for at least one administration cycle, wherein the anti-CD39 antibody is administered at least once, optionally at least twice, in amount to achieve and/or maintain between two successive injections of anti-CD39 antibody concentration of anti-CD39 antibody in blood or tissue equal to at least 1 µg/ml, optionally at least 10 µg/ml, optionally from 1 to 100 µg/ml . Anti-CD39 antibody is optionally administered at least twice and in amounts to maintain a constant concentration of anti-CD39 antibody in blood or tissue of at least 1 μg/ml, optionally at least 10 μg/ml, optionally from 1 to 100 μg/ ml, for at least 1 week, 2 weeks, 3 weeks, 4 weeks, between two consecutive injections of antibodies against CD39 and/or during the entire injection cycle.

These aspects are described more fully in this document; additional aspects, features, and advantages are apparent from the description provided herein.

Brief description of the drawings

Figure 1 shows a typical screening result, which shows antibodies I-397, I-398 and I-399 compared with a positive control - antibody I-394.

Figure 2A shows that BY40, I-394, I-395, and I-396 antibodies inhibit cell membrane-bound CD39, with both I-394 and I-395 showing higher activity at all concentrations, as well as an increased degree maximum inhibition of cellular CD39 compared to BY40. Figure 2B shows that I-395 and I-396 antibodies inhibit soluble CD39 compared to negative control (BY40) and positive control (I-394) antibodies.

Figure 3A shows the position of residues mutated in mutants 5 (M5), 15 (M15) and 19 (M19) on the surface of the CD39 protein. Figure 3B shows the results of binding of various antibodies to mutants 5, 15 and 19.

Figure 4 shows the binding of the antibody I-394 to cells expressing human CD39, according to flow cytometry. I-394 binds human CD39-expressing cells (CHO-huCD39), cynomolgus monkey CD39-expressing cells (CHO-cyCD39), and Ramos lymphoma cells, but not mouse CD39-expressing cells (CHO-moCD39).

Figure 5 shows that antibody I-394 has high activity in blocking CD39 enzymatic activity in tumor (Ramos) cells, in cells expressing human CD39 (CHO-huCD39), and in cells expressing cynomolgus monkey CD39 (CHO-cyCD39) , according to the quantification of luminescence units proportional to the amount of ATP present.

Figure 6 shows that antibody I-394 has high activity in blocking the enzymatic activity of soluble recombinant human CD39 protein, as measured by luminescence units proportional to the amount of ATP present.

Figure 7 shows that antibody I-394 binds to human CD39, but does not bind to any isoforms of human CD39-L1, -L2, -L3, or -L4, as measured by ELISA.

Figure 8 shows an experimental procedure for evaluating the effect of ATP-mediated DC activation on CD4 T cell activation; ATP-activated DCs were washed and then incubated with allogeneic CD4 T cells (ratio 1 MoDC/4 T cells) with mixed lymphocyte response (MLR) monitored for 5 days. T cell activation and proliferation was analyzed by CD25 expression and Cell Trace Violet dilution by flow cytometry.

Figure 9 shows HLA-DR expression on moDC and Figure 10 shows CD83 expression on moDC. These figures show that the blocking antibody I-394 against CD39 and chemical inhibitors of CD39 lead to the activation of moDC at concentrations of 0.125 mm, 0.25 mm or 0.5 mm. However, anti-CD39 BY40 or anti-CD73 could not promote ATP-induced dendritic cell (DC) activation, indicating that the antibodies could not block enzymatic activity sufficiently to avoid ATP catabolism. The designations (from top to bottom) correspond to the columns on the graph from left to right.

Figure 11, which shows CD25 expression, demonstrates that MoDC activated in the presence of ATP is able to induce T cell activation and proliferation in an MLR assay; enhancement of ATP-mediated activation of MoDC by blocking antibody I-394 against CD39 resulted in more pronounced proliferation and activation of T cells. The designations (from top to bottom) correspond to the columns on the graph from left to right.

Detailed description of the invention

Definitions

The term "comprising" in this document can optionally be replaced by the expressions "essentially consisting of" or "consisting of".

Human CD39, also known as "vascular" CD39, NTPdase1, ENTPD1, ATPDase, and vascular ATP diphosphohydrolase, has ATPase activity. CD39 hydrolyzes extracellular ATP and ADP to AMP, which is then converted to adenosine by another enzyme, 5-strand nucleotidase. The amino acid sequence of the mature human vascular CD39 polypeptide chain is shown in Genbank under accession number P49961, the full description of which is incorporated herein by reference, and is:

Human CD39-L1, also known as NTPDase-2 or ENTPD2, is listed in Genbank under accession number NP_001237, the full disclosure of which is incorporated herein by reference, and is:

Human CD39-L2 is also known as NTPDase-6 or ENTPD6; ENTPD6 isoform 1 is listed in Genbank under accession number NP_001238, the full description of which is incorporated herein by reference, and is:

Human CD39-L3 is also known as NTPDase-3 or ENTPD3; the ENTPD3 isoform is shown in Genbank under accession number NP_001239, the full description of which is incorporated herein by reference, and is:

Human CD39-L1, also known as NTPDase-5 or ENTPD5, is listed in Genbank under accession number NP_001240 (predecessor), the full disclosure of which is incorporated herein by reference, and is:

In this context, "neutralize" or "neutralize" when referring to a CD39 polypeptide (e.g., "neutralize CD39", "neutralize CD39 activity", or "neutralize CD39 enzymatic activity") refers to a process in which ATP hydrolysis (ATPase) activity is inhibited. . This includes, in particular, the inhibition of CD39-mediated production of AMP and/or ADP, ie. inhibition of CD39-mediated ATP catabolism to AMP and/or ADP. For membrane bound CD39, it can be measured, for example, in a cellular assay that measures the ability of a test compound to directly or indirectly inhibit the conversion of ATP to AMP and/or ADP. For soluble CD39, it can be measured by incubating the recombinant soluble CD39 described herein with a test compound and directly or indirectly measuring the conversion of ATP to AMP and/or ADP. For example, ATP loss and/or AMP formation as described herein can be assessed. For example, the disappearance of ATP and/or the formation of AMP can be assessed by quantifying luminescence units proportional to the amount of ATP present. In one embodiment, the antibody preparation causes at least a 60% reduction in the conversion of ATP to AMP, at least a 70% reduction in the conversion of ATP to AMP, or at least an 80% or 90% reduction in the conversion of ATP to AMP according to, for example, the assays described in herein (eg disappearance of ATP and/or formation of AMP).

The expressions "cancer treatment", etc. mentioning a CD39 binding agent (e.g., an antibody) may include: (a) a method of treating cancer, said method comprising the step of administering (during at least one treatment session) a CD39 binding agent (preferably in a pharmaceutically acceptable carrier material ) to an individual, a mammal, especially a human, in need of such treatment, at a dose that allows to treat cancer (therapeutically effective amount), preferably at the dose (amount) specified herein; (b) the use of a CD39 binding agent for the treatment of cancer, or a CD39 binding agent for use in said treatment (especially in humans); (c) using a CD39 binding agent for the manufacture of a pharmaceutical preparation for the treatment of cancer, a method of using the CD39 binding agent for the manufacture of a pharmaceutical preparation for the treatment of cancer, optionally comprising mixing the CD39 binding agent with a pharmaceutically acceptable carrier or a pharmaceutical preparation containing an effective a dose of a CD39 binding agent suitable for the treatment of cancer; or (d) any combination of a), b) and c) in accordance with the subject matter of the invention suitable for patenting in the country where the application is filed.

As used herein, the term "antigen binding domain" refers to a domain containing a three-dimensional structure capable of immunospecifically binding to an epitope. Thus, in one embodiment, said domain may comprise a hypervariable region, optionally a VH and/or VL domain of an antibody chain, optionally at least a VH domain. In yet another embodiment, the binding domain may comprise at least one complementarity determining region (CDR) of the antibody chain. In yet another embodiment, the binding domain may comprise a polypeptide domain from a non-immunoglobulin backbone.

As used herein, the term "antibody" refers to polyclonal and monoclonal antibodies. Depending on the type of constant domain in heavy chains, antibodies belong to one of five main classes: IgA, IgD, IgE, IgG and IgM. Some of them are further subdivided into subclasses or isotypes, such as lgG1, lgG2, lgG3, lgG4, etc. A typical structural unit of an immunoglobulin (antibody) contains a tetramer. Each tetramer consists of two identical pairs of polypeptide chains, each pair containing one "light" (approximately 25 kDa) and one "heavy" chain (approximately 50-70 kDa). The N-terminus of each chain defines a variable region of approximately 100 to 110 or more amino acids that is primarily responsible for antigen recognition. The terms "light chain variable region" (V _L ) and "heavy chain variable region" (V _H ) refer to these light and heavy chains, respectively. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structure and three-dimensional configurations of the various classes of immunoglobulins are well known. IgG is a typical class of antibodies used herein because they are the most abundant antibodies in the physiological situation and are the easiest to obtain in the laboratory. The antibody is optionally a monoclonal antibody. Specific examples of antibodies are humanized, chimeric, human antibodies, or other antibodies suitable for humans. "Antibodies" also includes any fragments or derivatives of any of the antibodies described herein.

The term "specifically binds to" means that the antibody can preferentially bind in a competitive binding assay to a binding partner, such as CD39, as assessed using recombinant forms of the proteins, their epitopes, or native proteins present on the surface of an isolated target cell. Competition binding assays and other methods for determining specific binding are further described below and are well known in the art.

When an antibody is said to "compete with" a particular monoclonal antibody (for example, antibody I-394, I-395, I-396, I-397, I-398, or I-399), this means that the antibody competes with the monoclonal antibody. in a binding assay using recombinant CD39 molecules or surface expressed CD39 molecules. For example, if a test antibody weakens the binding of a reference antibody to a CD39 polypeptide or CD39 expressing cell in a binding assay, the antibody is said to "compete" with the reference antibody, respectively.

The term "affinity" as used herein refers to the binding strength of an antibody to an epitope. The affinity of an antibody is determined by the dissociation constant Kd, defined as [Ab] × [Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of unbound antibody, and [Ag] - molar concentration of unbound antigen. The affinity constant K _a is defined as 1/Kd. Methods for determining mAb affinity can be found in Harlow, et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988), Coligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, NY, (1992, 1993), and Muller, Meth. Enzymol. 92:589-601 (1983), which are incorporated herein by reference in their entirety. One standard method for determining mAb affinity well known in the art is the use of Surface Plasmon Resonance (SPR) based screening (eg by analysis with a BIAcore™ SPR analytical device).

As used herein, "determinant" refers to a site of interaction or binding to a polypeptide.

The term "epitope" refers to an antigenic determinant and is a region on an antigen to which an antibody binds. A protein epitope may contain amino acid residues directly involved in binding, as well as amino acid residues that are effectively blocked by a specific antigen-binding antibody or peptide, ie. amino acid residues in the fingerprint of an antibody. This is the simplest shape or smallest structural region on a complex antigen molecule that can be combined with, for example, an antibody or receptor. Epitopes may be linear or conformational/structural. The term "linear epitope" is defined as an epitope consisting of amino acid residues following each other in a linear sequence of amino acids (primary structure). The term "conformational or structural epitope" is defined as an epitope consisting of amino acid residues, not all of which are located next to each other, and thus are separate fragments of a linear amino acid sequence that approach each other when the molecule folds (secondary, tertiary and/or quaternary structures). The conformational epitope depends on the three-dimensional structure. Therefore, the term "conformational" is often used interchangeably with the term "structural".

The term "internalization", used interchangeably with the term "intracellular internalization", refers to molecular, biochemical and cellular phenomena associated with the process of translocation of a molecule from the extracellular surface of a cell to the intracellular surface of a cell. The processes responsible for the intracellular internalization of molecules are well known and may include, but are not limited to, the internalization of extracellular molecules (eg, hormones, antibodies, and small molecular weight organic compounds); membrane-associated molecules (eg, cell surface receptors); and complexes of membrane-associated molecules associated with extracellular molecules (eg, a ligand associated with a transmembrane receptor or an antibody associated with a membrane-associated molecule). Thus, "induction and/or enhancement of internalization" includes phenomena in which intracellular internalization is initiated and/or the rate and/or extent of intracellular internalization is increased.

The term "agent" is used herein to refer to a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials. The term "therapeutic agent" refers to an agent that has biological activity.

For purposes of the present invention, a "humanized" or "human" antibody refers to an antibody in which the constant and variable framework region of one or more human immunoglobulins are combined with a binding region, e.g., a CDR, of an animal-derived immunoglobulin. Such antibodies are designed to maintain the binding specificity of the antibody of the non-human animal from which the binding regions are derived and to prevent an immune response against the antibody of the non-human animal. Such antibodies can be obtained from transgenic mice or other animals "engineered" to produce specific human antibodies in response to antigen challenge (see, for example, Green et al. (1994) Nature Genet 7:13; Lonberg et al. (1994) Nature 368:856; Taylor et al (1994) Int Immun 6:579, the contents of which are incorporated herein by reference in their entirety). A fully human antibody can also be constructed using genetic or chromosomal transfection techniques, as well as phage display techniques, which are known in the art (see, for example, McCafferty et al. (1990) Nature 348:552-553). Human antibodies can also form B cells activated in vitro (see, for example, US Pat. Nos. 5,567,610 and 5,229,275, incorporated herein by reference in their entirety).

A “chimeric antibody” is an antibody molecule in which (a) a constant region or fragment thereof is altered, substituted or replaced in such a way that the antigen binding site (variable region) is linked to the constant region of a different or altered antibody class and/or animal species, or an antibody constant region that has a different effector function, or a completely different molecule that gives the chimeric antibody new properties, such as an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a fragment thereof, is altered, replaced, or replaced by a variable region having a different or modified antigenic specificity.

The term "hypervariable region" as used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region typically contains amino acid residues from the "complementarity determining region" or "CDR" (e.g., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al. -52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain; Chothia and Lesk, J. Mol. Biol 1987; 196: 901-917), or a similar system for determining the essential amino acids responsible for antigen binding. As a rule, the numbering of amino acid residues in this region is performed in the manner described in Kabat et al., supra. Phrases such as "Kabat position", "Kabat numbering of variable domain residues", and "according to Kabat" herein refer to this numbering system for heavy chain variable domains or light chain variable domains. When using the Kabat numbering system, the actual linear amino acid sequence of the peptide may contain fewer amino acids or additional amino acids corresponding to a shortening or insertion in the FR or CDR of the variable domain. For example, a heavy chain variable domain may include insertion of a single amino acid (Kabat residue 52a) after residue 52 of CDR H2 and insertion of residues (e.g., Kabat residues 82a, 82b, 82c, etc.) after heavy chain FR 82 residue. Kabat numbering of residues can be determined for a given antibody by aligning regions of antibody sequence homology with a "standard" Kabat numbered sequence.

By "framework" or "FR" residues, as used herein, is meant the region of the variable domain of an antibody, excluding regions defined as CDRs. The variable domain framework of each antibody can be further divided into contiguous regions separated by CDRs (FR1, FR2, FR3 and FR4).

The terms "Fc domain", "Fc fragment", and "Fc region" refer to the C-terminal fragment of an antibody heavy chain, e.g., from about amino acid (AA) 230 to about AA 450 γ (gamma) of a human heavy chain or the like. its sequences in the heavy chains of other types of antibodies (eg, α, δ, ε and μ for human antibodies) or their natural allotype. Unless otherwise noted, Kabat's conventional amino acid numbering for immunoglobulins is used throughout this specification (see Kabat et al. (1991) Sequences of Protein of Immunological Interest, 5th ed., United States Public Health Service, National Institute of Health, Bethesda, MD).

The terms "isolated", "purified" or "biologically pure" refer to material that is substantially or substantially free of the components that would normally accompany it in its natural state. Purity and homogeneity are usually determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The protein, which is the predominant species present in the formulation, is substantially purified.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical compound that mimics the corresponding natural amino acid, as well as to natural amino acid polymers and non-amino acid polymers not found in nature.

The term "recombinant" when referring to, for example, a cell or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein, or vector is modified by introducing a heterologous nucleic acid or protein, or altering a native nucleic acid or protein, or that that the cell is derived from a cell modified in this way. Thus, for example, recombinant cells express genes not found in the native (non-recombinant) form of the cell, or express native genes that are otherwise abnormally, underexpressed, or not expressed at all.

In this context, the term antibody "binding" a polypeptide or epitope means an antibody that binds the specified determinant with a certain specificity and/or affinity.

The term "identity" or "identical" in relation to comparing the sequences of two or more polypeptides refers to the degree of sequence relatedness between polypeptides, as determined by the number of matches between chains of two or more amino acid residues. "Identity" measures the percentage of identical matches between the smaller of two or more sequences with gap alignment (if any) performed by a particular mathematical model or computer program (ie, "algorithms"). The identity of related polypeptides is easily calculated by known methods. Such methods include those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48, 1073 (1988), but are not limited to.

Identity determination methods are designed to obtain the greatest match between the tested sequences. Methods for determining identity are described in publicly available computer programs. Computer-based methods for determining identity between two sequences include the GCG software package, including GAP (Devereux et al., Nucl. Acid. Res. 12, 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis .), in LASTP, BLASTN and FASTA (Altschul et al., J. Mol. Biol. 215, 403-410 (1990)). The public domain BLASTX program is available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB/NLM/NIH Bethesda, Md. 20894; Altschul et al., supra). In addition, the well-known Smith-Waterman algorithm can also be used to determine the identity.

Antibody production

A CD39 antigen-binding domain, or a protein (e.g., an antibody or antibody fragment) containing such a domain that can be used to treat cancer and/or other diseases (e.g., an infectious disease), binds a soluble human CD39 polypeptide, e.g., a human CD39 polypeptide , lacking two transmembrane domains present in membrane-bound CD39 near the N- and C-termini, for example, a protein with an extracellular domain containing the amino acid sequence of SEQ ID NO: 44. In one embodiment, the agent inhibits the ATPase activity of CD39. In one embodiment, the antibody inhibits CD39-mediated adenosine formation. In one embodiment, the antibody inhibits CD39-mediated catabolism of ATP to AMP. In one embodiment, the antibody inhibits adenosine-mediated inhibition of lymphocyte (eg, T-cell) activity. In one aspect, the antibody is selected from a full length antibody, an antibody fragment, and a molecule derived from a synthetic or semi-synthetic antibody.

Antibodies that effectively inhibit the enzymatic (ATPase) activity of the soluble (and optionally membrane-bound) CD39 protein can, in one embodiment, immobilize or restrict movement of the domain of the soluble (and optionally membrane-bound) CD39 protein in one of its conformations, thereby preventing hydrolysis of its substrate. Antibodies can accomplish this by simultaneously binding to the C- and N-terminal domains of soluble (and optionally membrane-bound) CD39.

In one embodiment, a CD39 antigen-binding domain, or an antigen-binding protein that contains an antigen-binding domain (e.g., antibody or antibody fragment, multispecific binding protein, bispecific antibody, etc.), contains complementarity determining regions (CDRs). ), and frame regions (FR). Antigen binding domains can be designed or modified to provide desired and/or improved properties.

In one embodiment, the CD39 antigen-binding protein is capable of binding to and inhibiting the activity of a human CD39 polypeptide, wherein the antigen-binding protein comprises VH and VL, each of which contains a backbone (e.g., a backbone containing an amino acid sequence of human origin) and CDR1, CDR2, and CDR3. In one embodiment, the antigen binding protein restricts the movement of the CD39 domain upon binding to CD39. The VH and/or VL framework (eg FR1, FR2, FR3 and/or FR4) is not necessarily of human origin.

In a specific embodiment, binding molecules and domains can be derived from immunoglobulin variable domains, e.g., in the form of associated V _L and V _H domains located on two polypeptide chains, or a single chain antigen binding domain, e.g., scFv, V _H domain , V _L domain, dAb, V-NAR domain, or V _H H domain.

In one aspect, the CD39 binding agent is an antibody selected from a fully human antibody, a humanized antibody, and a chimeric antibody.

In one aspect, the agent is an antibody fragment comprising a constant or Fc domain derived from a human IgG1 constant or Fc domain, eg, modified as further described herein.

In one aspect, the agent comprises an antibody fragment selected from Fab fragment, Fab' fragment, Fab'-SH fragment, F(ab)2 fragment, F(ab')2 fragment, Fv fragment, lg heavy chain (llama or camel lg), V _HH fragment, single domain FV and single chain antibody fragment. In one aspect, the agent comprises a molecule derived from a synthetic or semi-synthetic antibody selected from scFV, dsFV, mini-antibody, diabody, triabody, kappabody, IgNAR; and multispecific (eg, bispecific) antibodies. The agent may optionally further comprise an Fc domain.

In one aspect, the antibody is in at least partially purified form.

In one aspect, the antibody is in substantially isolated form.

Antibodies can be obtained by various methods known in the art. In one embodiment, the antibodies of the present invention are obtained by selection from an antibody library (eg, a phage display library). In another embodiment, antibodies are produced by immunizing a non-human animal, preferably a mouse, with an immunogen containing a CD39 polypeptide, preferably a soluble human CD39 extracellular domain polypeptide. The CD39 polypeptide may optionally be or contain a fragment or derivative of a full-length CD39 polypeptide, usually an immunogenic fragment, i.e. a polypeptide fragment containing an epitope exposed on the surface of cells expressing the CD39 polypeptide. Such fragments typically contain at least about 7 consecutive amino acids of the mature polypeptide sequence, even more preferably at least about 10 consecutive amino acids of the polypeptide. Fragments are generally primarily derived from the extracellular domain of the receptor. In one embodiment, the immunogen comprises a wild-type human CD39 polypeptide in a lipid membrane, typically on the surface of a cell. In a particular embodiment, the immunogen comprises intact cells, in particular intact human cells, optionally processed or lysed. In yet another embodiment, the polypeptide is a recombinant CD39 polypeptide.

The step of immunizing a non-human mammal with an antigen can be carried out by any method of stimulating antibody production in a mouse well known in the art (see, for example, E. Harlow and D. Lane, Antibodies: A Laboratory Manual., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988, the full description of which is incorporated herein by reference). Isolation of antibody-producing hybridomas is well known and can be performed by any method well known in the art.

Antibodies can also be obtained by selection from combinatorial libraries of immunoglobulins, as described, for example, in the source (Ward et al. Nature, 341 (1989) p. 544, the full description of which is incorporated herein by reference).

The identification of one or more antibodies that bind to CD39, especially to substantially or substantially the same region on CD39 as the I-394 monoclonal antibody, can be easily accomplished using any of a variety of immunological screening assays that can evaluate antibody competition. Many such assays are widely used and well known in the art (see, for example, US Pat. No. 5,660,827, issued Aug. 26, 1997, specifically incorporated herein by reference).

For example, if the antibodies of interest are from different animals, or even of a different Ig isotype, a simple competition assay can be used in which control (eg, I-394) and test antibodies are mixed (or pre-adsorbed) and applied to a sample containing CD39 polypeptides. . Protocols based on Western blotting and the use of the BIACORE assay are suitable for use in such competitive studies.

In some embodiments, control antibodies (eg, I-394) are premixed with varying amounts of test antibodies (eg, in a ratio of about 1:10 or about 1:100) for some time prior to applying the CD39 antigen to the sample. In other embodiments, control antibodies and varying amounts of test antibodies can simply be mixed during exposure of the CD39 antigen sample. As long as it is possible to distinguish between bound and free antibodies (for example, using separation or washing techniques to remove unbound antibodies) and I-394 and test antibodies (for example, using species-specific or isotype-specific secondary antibodies or by specifically labeling I-394 with a detectable label), one can to determine whether test antibodies weaken the binding of I-394 to antigens. Binding of (labeled) control antibodies in the absence of a completely mismatched antibody can be used as a high control value. A low control value can be obtained by incubating labeled (I-394) antibodies with unlabeled antibodies of exactly the same type (I-394), which will compete to weaken the binding of labeled antibodies. In a test assay, a significant reduction in the reactivity of a labeled antibody in the presence of a test antibody is indicative of a test antibody that can recognize the same region or epitope on CD39. You can choose a test antibody that reduces the binding of I-394 to CD39 antigens by at least about 50%, such as at least about 60%, or more preferably at least about 80% or 90% (for example, about 65-100%), at any ratio of "I-394: test antibody" from about 1:10 to about 1:100. Such a test antibody preferably reduces I-394 binding to the CD39 antigen by at least about 90% (eg, about 95%).

Competition can also be assessed, for example, using flow cytometry. In such a test, cells bearing a given CD39 polypeptide can first be incubated with, for example, I-394 and then with a test antibody labeled with fluorochrome or biotin. An antibody is considered to compete with I-394 if the binding obtained by preincubation with a saturating amount of the corresponding I-394 is about 80%, preferably about 50%, about 40%, or less (e.g., about 30%, 20%, or 10%) of the binding (measured by fluorescence) obtained for a given antibody without pre-incubation with the corresponding I-394. Alternatively, an antibody is considered to compete with I-394 if the binding obtained using labeled (fluorochrome or biotin) I-394 antibody on cells pre-incubated with a saturating amount of test antibody is approximately 80%, preferably approximately 50%. , about 40% or less (eg, about 30%, 20%, or 10%) of the binding obtained without pre-incubation with the test antibody.

A simple competitive assay can also be used in which the antibody to be tested is pre-adsorbed and applied at a saturating concentration to a surface on which the CD39 antigen is immobilized. The surface in a simple competitive assay is preferably a BIACORE chip (or other carrier suitable for surface plasmon resonance analysis). A control antibody (eg, I-394) is then brought into contact with the surface at a concentration that saturates CD39 and the binding of the control antibody to CD39 and the surface is measured. This control antibody binding is compared to control antibody binding to a CD39-containing surface in the absence of test antibody. In a test assay, a significant reduction in CD39-containing surface binding by a control antibody in the presence of the test antibody indicates that the test antibody is "cross-reacting" with the control antibody. Any test antibody that reduces the binding of a control antibody (eg, I-394) to the CD39 antigen by at least about 30% or more, preferably by about 40%, can be considered an antibody that competes with the control antibody (eg, I-394 ). Such a test antibody preferably reduces the binding of a control antibody (eg, I-394) to the CD39 antigen by at least about 50% (eg, at least about 60%, at least about 70%, or more). It should be appreciated that the order of control and test antibodies may be reversed: i.e. in a competitive assay, one can first bind a control antibody to a surface and then bring the test antibody into contact with the surface. Preferably, the antibody with the higher affinity for the CD39 antigen binds to the surface first, as the amount of binding loss observed for the second antibody (assuming the antibodies cross-react) is expected to be greater. Additional examples of such assays are given, for example, in the article Saunal (1995) J. Immunol. Methods 183: 33-41, the description of which is incorporated herein by reference.

In one embodiment, the antibodies are validated by an immunoassay to test their ability to bind to soluble CD39 and/or CD39 expressing cells, eg cancer cells. For example, a blood test or tumor biopsy is performed and soluble CD39 is isolated and/or tumor cells are harvested. The ability of the antibody to bind to sCD39 and/or cells is then evaluated using standard methods well known to those of skill in the art. Antibodies can bind, for example, to a significant proportion (for example, 20%, 30%, 40%, 50%, 60%, 70%, 80% or more) of cells known to express CD39, for example, tumor cells obtained from a significant proportion individuals or patients (eg, 10%, 20%, 30%, 40%, 50% or more). Antibodies can be used for diagnostic purposes to determine the presence or level of sCD39 and/or malignant cells in a patient, for example, as a biomarker to assess whether a patient is suitable for treatment with an anti-CD39 agent or for use in the therapeutic methods described herein. document. To assess the binding of antibodies to sCD39 and/or cells, antibodies can be directly or indirectly labeled. In indirect labeling, a secondary labeled antibody is usually added.

Determining the binding capacity of an antibody in an epitope region can be performed by methods known to those skilled in the art. As one example of such mapping/characterization methods, an anti-CD39 antibody epitope region can be determined by footprinting using chemical modification of exposed amino/carboxyl groups in the CD39 protein. One specific example of such a footprinting technique is the use of HXMS (hydrogen-deuterium exchange detected by mass spectrometry), in which hydrogen/deuterium exchange of protons of amide groups of receptor and ligand proteins occurs, binding and reverse exchange, with the amide groups of the backbone of the molecule involved in protein binding, are protected from reverse exchange and therefore remain deuterated. Relevant regions can now be identified using peptic proteolysis, fast high performance liquid chromatographic microcolumn separation, and/or electrospray ionization mass spectrometry. See, for example, Ehring H, Analytical Biochemistry, Vol. 267 (2) pp. 252-259 (1999) Engen, J.R. and Smith, D.L. (2001) Anal. Chem. 73, 256A-265A. Another example of a suitable epitope detection technique is nuclear magnetic resonance (NMR) epitope mapping, which typically compares the position of signals in two-dimensional NMR spectra of a free antigen and an antigen complexed with an antigen-binding peptide, such as an antibody. The antigen is usually selectively labeled with a 15N isotopic label so that only signals corresponding to the antigen are visible in the NMR spectrum and no signals from the antigen-binding peptide are present. Antigen signals derived from amino acids involved in the interaction with the antigen binding peptide are usually characterized by a position shift in the spectrum of the complex compared to the spectrum of the free antigen, and thus the amino acids involved in the binding can be identified. See, for example, Ernst Schering Res Found Workshop. 2004; (44): 149-67; Huang et al., Journal of Molecular Biology, Vol. 281 (1) pp. 61-67 (1998); and Saito and Patterson, Methods. 1996 Jun; 9(3):516-24.

Epitope mapping/characterization can also be performed using mass spectrometry. See, for example, Downard, J. Mass Spectrom. 2000 Apr; 35 (4): 493-503 and Kiselar and Downard, Anal Chem. 1999 May 1; 71(9): 1792-1801. In the context of mapping and epitope detection, protease hydrolysis techniques can also be used. Regions/sequences corresponding to the antigenic determinant can be determined by protease digestion, for example, using trypsin at a ratio of approximately 1:50 to CD39 or o/n hydrolysis at pH 7-8 followed by mass spectrometry (MS) analysis to identify peptides. Peptides protected from trypsin digestion by a CD39 binding agent can be subsequently identified by comparing samples subjected to trypsin digestion and samples incubated with an antibody and then subjected to digestion, eg trypsin digestion (thus revealing the binding agent imprint). In addition, other enzymes, such as chymotrypsin, pepsin, etc., can be used alternatively in similar epitope characterization methods. In addition, enzymatic digestion can provide a quick way to analyze whether a potential antigenic determinant sequence is within a region of the CD39 polypeptide that is not surface-affected and thus likely not related to immunogenicity/antigenicity.

Site-directed mutagenesis is another technique useful for identifying a binding epitope. For example, in an "alanine scan", each residue in a protein segment is replaced with an alanine residue and the effects on binding affinity are measured. If the mutation results in a significant decrease in binding affinity, that residue is most likely involved in binding. Monoclonal antibodies specific for structural epitopes (ie, antibodies that do not bind the non-folding protein) can be used to verify that alanine substitution does not affect the folding of the protein as a whole. See, for example, Clackson and Wells, Science 1995; 267:383-386; and Wells, Proc Natl Acad Sci USA 1996; 93:1-6.

Electron microscopy can also be used to footprint epitopes. For example, Wang et al., Nature 1992; 355: 275-278 used a coordinated application of cryoelectron microscopy, 3D imaging and X-ray crystallography to determine the physical imprint of a Fab fragment on the capsid surface of native cowpea mosaic virus.

Other forms of "labelless" analysis for evaluating epitopes include surface plasmon resonance (SPR, BIACORE) and reflectometric interference spectroscopy (RifS). See, for example, Fagerstam et al., Journal Of Molecular Recognition 1990; 3:208-14; Nice et al., J. Chromatogr. 1993; 646:159-168; Leipert et al., Angew. Chem. Int. Ed. 1998; 37:3308-3311; Kroger et al., Biosensors and Bioelectronics 2002; 17:937-944.

It should also be noted that an antibody that binds the same or substantially the same epitope as an antibody can be detected in one or more of the typical competitive assays described herein.

After immunization and production of antibodies in the vertebrate or in the cell, specific selection steps can be performed to isolate the antibodies as desired. In this regard, in a specific embodiment, the present invention also relates to methods for producing such antibodies, including: (a) immunizing a non-human mammal with an immunogen containing a CD39 polypeptide; (b) obtaining antibodies from said immunized animal; and (c) selecting the antibodies obtained in step (b) that are capable of binding CD39. Selected antibodies capable of binding CD39 are then optionally purified and tested for the ability to inhibit CD39 ATPase activity (eg, according to any of the methods described herein).

Typically, an anti-CD39 antibody provided herein has an affinity for a CD39 polypeptide (e.g., the monomeric CD39 polypeptide prepared in the examples herein) in the range of about 10 ⁴ to about 10 ¹¹ M ^-1 (e.g., about 10 ⁸ to about 10 ¹⁰ m ^-1 ). For example, anti-CD39 antibodies may have a mean dissociation constant (K _D ) to CD39 of less than 1 x 10 ^-9 M, as determined, for example, by surface plasmon resonance (SPR) screening (for example, using a BIAcore SPR assay device). ™). In a more specific exemplary aspect, the present invention relates to anti-CD39 antibodies having a CD39 KD of from about 1x10 ^-8 M to about 1x10 ^-10 M, or from about 1x10 ^-9 M to about ^{1x10 -11} M .

Antibodies may have, for example, an average K _D of no more than (i.e., higher affinity) 100, 60, 10, 5, or 1 nanomoles, preferably in the sub-nanomolar range, or optionally no more than about 500, 200, 100, or 10 picomoles. K _D can be determined, for example, by immobilizing recombinantly produced human CD39 proteins on the chip surface, followed by applying the test antibody in solution. In one embodiment, the method further comprises step (d), selecting antibodies from step (b) that are capable of competing for CD39 binding with antibody I-394, I-395, I-396, I-397, I-398 or I-399.

In one aspect of any of the embodiments of the antibodies obtained in accordance with the present methods are monoclonal antibodies. In another aspect, the non-human animal used to produce antibodies according to the methods described herein is a mammal, such as a rodent, cattle, pig, poultry, horse, rabbit, goat, or sheep.

DNA encoding an antibody that binds an epitope present in CD39 polypeptides is isolated from the hybridoma and placed in an appropriate expression vector for transfection into an appropriate host. The host is then used to recombinantly produce the antibody or variants thereof, eg, a humanized version of the monoclonal antibody, active fragments of the antibody, chimeric antibodies containing an antigen-binding fragment of the antibody, or variants containing a detectable group.

DNA encoding the monoclonal antibodies of the present invention, such as antibody I-394, is readily isolated and sequenced using conventional procedures (eg, using oligonucleotide probes capable of specifically binding to genes encoding heavy and light chains of mouse antibodies). In one aspect, the present invention provides a nucleic acid encoding the heavy chain or light chain of an anti-CD39 antibody according to any embodiment of this document. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells, such as E. coli cells, COS monkey cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to synthesis of monoclonal antibodies in recombinant host cells. As described elsewhere herein, such DNA sequences can be modified for any of a number of purposes, such as to humanize antibodies, produce fragments or derivatives, or modify the sequence of an antibody, such as at an antigen binding site, to optimize antibody binding specificity. In one embodiment, an isolated nucleotide sequence is provided encoding the light chain and/or heavy chain of an antibody (e.g., I-394), as well as a recombinant host cell containing (e.g., in its genome) such a nucleic acid. Recombinant expression of a DNA encoding antibody, in bacteria is well known in the art (see, for example, Skerra et al., Curr. Opinion in Immunol., 5, pp. 256 (1993); and Pluckthun, Immunol. 130, p. 151 (1992) .

Once antibodies capable of binding to sCD39 and/or memCD39 and/or having other desirable properties have been identified, they are also generally evaluated using methods such as those described herein for their ability to bind to other polypeptides, including unrelated polypeptides. Ideally, antibodies bind with significant affinity only to CD39, and do not bind at a significant level to unrelated polypeptides or other polypeptides of the NTPDase family, in particular CD39-L1, L2, L3 and L4 or NTPDase-8. However, it should be appreciated that, provided the affinity for CD39 is significantly greater (e.g., 10, 100, 500, 1000, 10,000 or more times) than for other, unrelated polypeptides), antibodies are suitable for use in the methods of the present invention. .

In one embodiment, anti-CD39 antibodies can be generated that do not have significant specific binding to human Fcγ receptors, e.g., any or all of CD16A, CD16B, CD32A, CD32B, and/or CD64). Such antibodies may contain constant regions of various heavy chains that are notoriously unable to bind or have weak binding to Fcγ receptors. Alternatively, antibody fragments that do not contain (or contain fragments of) constant regions, such as P(ab')2 fragments, can be used to avoid binding to the Fc receptor. Fc receptor binding can be assessed according to methods known in the art, including, for example, testing the binding of an antibody to an Fc receptor protein in a BIACORE assay. Also, in general, any IgG antibody isotype in which the Fc fragment is modified (eg, by introducing 1, 2, 3, 4, 5 or more amino acid substitutions) can be used to minimize or eliminate binding to Fc receptors (see ., for example, WO 03/101485, the description of which is incorporated herein by reference). Assays, eg, cell-based assays for assessing Fc receptor binding, are well known in the art, and are described, for example, in WO 03/101485.

In one embodiment, the antibody may contain one or more specific mutations in the Fc region that result in "silent Fc" antibodies characterized by minimal interaction with effector cells. Silent effector functions can be obtained by mutation in the Fc region of antibodies; they are described in the art as N297A mutation, LALA mutations (Strohl, W., 2009, Curr. Opin. Biotechnol. Vol. 20(6):685-691); and D265A (Baudino et al., 2008, J. Immunol. 181: 6664-69) see also Heusser et al., WO 2012/065950, the descriptions of which are incorporated herein by reference. In one embodiment, the implementation of the antibody contains one, two, three or more amino acid substitutions in the hinge region. In one embodiment, the antibody is IgG1 or IgG2 and contains one, two or three substitutions at residues 233-236, optionally 233-238 (EC numbering). In one embodiment, the antibody is lgG4 and contains one, two or three substitutions at residues 327, 330 and/or 331 (EC numbering). Silent Fc IgG1 antibodies are exemplified by LALA mutants containing L234A and L235A mutations in the IgG1 Fc amino acid sequence. Another example of a silent Fc mutation is a mutation at residue D265 or at D265 and P329, for example, when used in the lgG1 antibody as a DAPA mutation (D265A, P329A) (US 6737056). Another silent IgG1 antibody contains a mutation at residue N297 (eg N297A, N297S mutation) which results in aglycosylated/non-glycosylated antibodies. Other silent mutations include: substitutions at residues L234 and G237 (L234A/G237A); replacements for residues S228, L235 and R409 (S228P/L235E/R409K,T,M,L); substitutions for the residues H268, V309, A330 and A331 (H268Q/V309L/A330S/A331S); substitutions in residues C220, C226, C229 and P238 (C220S/C226S/C229S/P238S); replacements for residues C226, C229, E233, L234 and L235 (C226S/C229S/E233P/L234V/L235A; replacements for residues K322, L235 and L235 (K322A/L234A/L235A); replacements for residues L234/L235 and L235 L235E/P331S ); replacements for residues 234, 235 and 297; replacements for the remains of E318, K320 and K322 (L235E/E318A/K320A/K322A); replacements for residues (V234A, G237A, P238S); substitutions for residues 243 and 264; replacements for residues 297 and 299; substitutions such that residues 233, 234, 235, 237 and 238 according to the EU numbering system contain a sequence selected from PAAAP, PAAAS and SAAAS (see WO 2011/066501).

In one embodiment, the implementation of the antibody may contain one or more specific mutations in the Fc region. For example, such an antibody may contain a human lgG1 Fc domain containing a mutation at Kabat residues 234, 235, 237, 330, and/or 331. One example of such an Fc domain includes substitutions at residues L234, L235 and P331 by Kabat (e.g., L234A/L235E/P331S or (L234F/L235E/P331S). Another example of such an Fc domain includes substitutions at residues L234, L235, G237 and P331 by Kabat (e.g. L234A/L235E/G237A/P331S) Another example of such an Fc domain includes substitutions at residues L234, L235, G237, A330 and P331 by Kabat (e.g. L234A/L235E/G237A/A330S/P331S In one embodiment, the antibody contains an Fc domain, optionally of the human lgG1 isotype, comprising: substitution L234X ₁ , substitution L235X2 and substitution P331X3, where X1 is any amino acid residue other than leucine, X2 is any amino acid residue other than leucine , and X ₃ is any amino acid residue other than proline; where X 1 is optionally alanine or phenylalanine or a conservative substitution thereof; where X 2 is optionally glutamic acid or a conservative substitution thereof; where X ₃ is optionally is a series or its conservative replacement. In another embodiment, the antibody contains an Fc domain, optionally of the human IgG1 isotype, containing: L234X ₁ substitution, L235X ₂ substitution, G237X ₄ substitution and P331X ₄ substitution, where X ₁ is any amino acid residue other than leucine, X ₂ is is any amino acid residue other than leucine, X ₃ is any amino acid residue other than glycine, and X ₄ is any amino acid residue other than proline; where X ₁ optionally represents alanine or phenylalanine or their conservative replacement; where X ₂ optionally represents glutamic acid or its conservative replacement; X ₃ is optionally an alanine or a conservative substitution thereof; X ₄ is optionally a series or a conservative substitution thereof. In another embodiment, the antibody contains an Fc domain, optionally of the human IgG1 isotype, containing: L234X ₁ substitution, L235X ₂ substitution, G237X ₄ substitution, G330X ₄ substitution, and P331X ₅ substitution, where X ₁ is any amino acid residue other than leucine , X ₂ is any amino acid residue other than leucine, X ₃ is any amino acid residue other than glycine, X ₄ is any amino acid residue other than alanine, and X ₅ is any amino acid residue other than proline; where X ₁ optionally represents alanine or phenylalanine or their conservative replacement; where X ₂ optionally represents glutamic acid or its conservative replacement; X ₃ is optionally an alanine or a conservative substitution thereof; X ₄ is optionally a series or conservative substitution thereof; X ₅ is optionally a series or a conservative substitution thereof. In the abbreviated notation used herein, the format is as follows: Wild-type residue: Position in polypeptide: Mutant residue, where the positions of the residues are indicated according to Kabat EC numbering.

In one embodiment, the antibody comprises a heavy chain constant region containing the amino acid sequence below, or an amino acid sequence at least 90%, 95%, or 99% identical to it, but retaining amino acid residues at Kabat positions 234, 235, and 331 (underlined ):

In one embodiment, the antibody comprises a heavy chain constant region containing the amino acid sequence below, or an amino acid sequence at least 90%, 95%, or 99% identical to it, but retaining amino acid residues at Kabat positions 234, 235, and 331 (underlined ):

In one embodiment, the antibody comprises a heavy chain constant region containing the amino acid sequence below, or an amino acid sequence at least 90%, 95%, or 99% identical to it, but retaining amino acid residues at positions 234, 235, 237, 330, and 331 by Kabat (underlined):

In one embodiment, the antibody contains a heavy chain constant region containing the amino acid sequence below, or a sequence at least 90%, 95%, or 99% identical to it, but retaining amino acid residues at positions 234, 235, 237, and 331 according to Kabat ( underlined):

Silent Fc antibodies result in no or low ADCC activity, meaning that silent Fc antibodies exhibit ADCC activity that is less than 50% specific cell lysis. Preferably, the antibody is substantially free of ADCC activity, for example, a silent Fc antibody exhibits an ADCC activity (specific cell lysis) that is less than 5% or less than 1%. Silent Fc antibodies can also result in the absence of FcγR-mediated CD39 cross-linking on the surface of a CD39-expressing cell.

In one embodiment, the antibody contains a heavy chain constant region substitution at any one, two, three, four, five or more residues selected from the group consisting of: 220, 226, 229, 233, 234, 235, 236, 237, 238, 243, 264, 268, 297, 298, 299, 309, 310, 318, 320, 322, 327, 330, 331 and 409 (Residue numbering in the heavy chain constant region corresponds to Kabat EU numbering). In one embodiment, the antibody contains a substitution at residues 234, 235, and 322. In one embodiment, the antibody contains a substitution at residues 234, 235, and 331. In one embodiment, the antibody contains a substitution at residues 234, 235, 237, and 331. In one embodiment, implementation of the antibody contains a substitution at residues 234, 235, 237, 330 and 331. In one embodiment, the Fc domain is of the human IgG1 subtype. Amino acid residues are indicated in accordance with the Kabat EC numbering. In one embodiment, the antibody contains an Fc domain containing an amino acid substitution that increases binding to human FcRn polypeptides to increase the in vivo half-life of the antibody. Representative mutations are described in Strohl, W., 2009, Curr. Opin. Biotechnol. vol. 20(6):685-691, the description of which is incorporated herein by reference. Examples of substitutions used in human IgG1 isotype antibodies are substitutions at residues M252, S254 and T256; replacements for the remains of T250 and M428; substitutions for the remainder of N434; substitutions for the residues H433 and N434; replacements for residues T307, E380 and N434; replacements for residues T307, E380 and N434; substitutions for residues M252, S254, T256, H433, N434 and 436; substitutions for the remainder of I253; substitutions for residues P257, N434, D376 and N434.

In one embodiment, the antibody contains an Fc domain containing an amino acid substitution that confers reduced sensitivity to protease digestion. Matrix metalloproteinases (MMPs) are the most important family of proteinases associated with oncogenesis. Although cancer cells can express MMPs, the bulk of extracellular MMPs are synthesized by various types of stromal cells that infiltrate the tumor, and each of them produces a specific set of proteinases and proteinase inhibitors that are released into the extracellular space and specifically alter the environment around the tumor. MMPs present in the tumor microenvironment can cleave antibodies in the hinge region and thus can lead to inactivation of therapeutic antibodies that are intended to function in the tumor region. In one embodiment, an Fc domain containing an amino acid substitution has reduced sensitivity to cleavage by any one, two, three or more (or all) proteases selected from the group consisting of: GluV8, IdeS, gelatinase A (MMP2), gelatinase B (MMP-9), matrix metalloproteinase-7 (MMP-7), stromelysin (MMP-3), and macrophage elastase (MMP-12). In an aqueous embodiment, the cleavage degraded antibody contains an Fc domain containing an amino acid substitution at residues E233-L234 and/or L235. In one embodiment, the antibody contains an Fc domain containing an amino acid substitution at residues E233, L234, L235, and G236. In one embodiment of the invention, the antibody contains an Fc domain containing an amino acid substitution at one or more residues 233-238, for example, such that the sequence E233-L234-L235-G236 is replaced by P233-V234-A235 (G236 is deleted). See, for example, WO 99/58572 and WO 2012087746, the description of which is incorporated herein by reference.

At any desired stage, the ability of the antigen binding compound to inhibit CD39 enzymatic activity, in particular block the ATPase activity of sCD39 and reduce the production of ADP and AMP (and, together with CD73, adenosine) at the expense of soluble CD39 protein and optionally also cells expressing CD39 and, in turn, restore lymphocyte activity and/or attenuate adenosine-mediated inhibition of lymphocytes.

The inhibitory activity (eg, immunostimulatory potential) of an antibody can be assessed, for example, in an assay to detect the disappearance (hydrolysis) of ATP and/or the formation of AMP.

The ability of an antibody to inhibit soluble recombinant human CD39 protein can be tested by detecting ATP after incubation of the test antibody with soluble CD39 protein (for example, a protein containing the amino acid sequence of SEQ ID NO 44 or 45 produced in the Examples, Methods sections, optionally additionally containing a purification tag or other functional or non-functional amino acid sequence not derived from CD39). See, for example, "Examples. Methods". Briefly, ATP can be quantified using Cell Titer Glo™ (Promega) in an assay in which a set of test antibody doses is incubated with the soluble recombinant human CD39 protein described in Example 1 for 1 hour at 37°C. 20 μM ATP was added to the plates for an additional 30 minutes at 37° C. before adding the CTG reagent. The emitted light was quantified using an Enspire™ luminometer after a short incubation period of 5 minutes in the dark.

The ability of an antibody to inhibit cells expressing the CD39 protein can be tested by detecting ATP after the test antibody is incubated with cells (eg, Ramos cells, cells transfected with CD39, etc.). See, for example, "Examples, Methods". Cells can be incubated for 1 hour at 37°C with test antibody. The cells are then incubated with 20 μM ATP for another 1 hour at 37°C. The plates are centrifuged for 2 minutes at 400 g and the cell supernatant is transferred to a fluorescent microplate (white wells). CTG is added to the supernatant and the emitted light is quantified after a 5 minute incubation in the dark using an Enspire™ luminometer. The effectiveness of an anti-CD39 antibody is determined by comparing the light emitted in the presence of the antibody with ATP alone (maximum light emission) and ATP together with cells (minimum light emission).

A decrease in ATP hydrolysis to AMP and/or an increase in ATP and/or a decrease in AMP formation in the presence of an antibody indicates that the antibody inhibits CD39. In one aspect, an antibody preparation is capable of causing at least a 60% reduction in the enzymatic activity of a CD39 polypeptide expressed in a cell, wherein the antibody preferably causes at least a 70%, 80%, or 90% reduction in the enzymatic activity of a CD39 polypeptide in the cell, as determined by ATP detection using Cell Titer Glo™ (Promega) after incubation of cells expressing the CD39 polypeptide (eg, Ramos cells) with the test antibody, eg, as described in the Examples, Methods section.

In one aspect, the antibody preparation is capable of causing at least a 60% reduction in the enzymatic activity of a soluble recombinant CD39 polypeptide (e.g., in the absence of cells), preferably at least a 70%, 80%, or 90% reduction in the enzymatic activity of a soluble recombinant CD39 polypeptide, as determined by ATP detection. using Cell Titer Glo™ (Promega) after incubating a soluble recombinant CD39 polypeptide with a test antibody, for example, as described in the Examples, Methods section.

The activity of an antibody can also be measured by indirectly assaying its ability to modulate the activity of immune cells (e.g., immune cells expressing adenosine receptors; cells expressing the A2A receptor), such as attenuating adenosine-mediated inhibition of lymphocyte activity, or causing activation of lymphocyte activity. This can be done, for example, using a cytokine release assay. In another example, an antibody can be assessed in an indirect assay for its ability to modulate lymphocyte proliferation.

In one example, a method is provided for making or detecting an anti-CD39 antibody or antigen-binding domain, comprising the steps of:

(a) obtaining a plurality of samples containing an antibody that binds a human CD39 polypeptide (e.g., cell culture supernatants, hybridoma supernatants),

(b) purifying the samples to obtain a plurality of samples, each containing a purified monoclonal antibody, by bringing each of the antibody samples into contact with a soluble extracellular domain of the CD39 protein (for example, in the absence of cells) and assessing the neutralization of its ATPase activity and

(c) selecting an antibody from step (b) that results in neutralization of the ATPase activity, optionally selecting an antibody that results in at least 70%, optionally 80%, or optionally 90% neutralization. In one embodiment, step (a) comprises immunizing one or more non-human mammals with a CD39 polypeptide and obtaining from such a mammal a plurality of samples containing an antibody that binds the human CD39 polypeptide.

In one example, a method is provided for making or detecting an anti-CD39 antibody or antigen-binding domain, comprising the steps of:

(a) obtaining a plurality of purified antibodies that bind the human CD39 polypeptide,

(b) bringing each antibody into contact with the soluble extracellular domain of the CD39 protein and assessing the neutralization of its ATPase activity, and

(c) selecting an antibody from step (b) that results in at least 70%, optionally 80%, or optionally 90% neutralization of the ATPase activity.

In addition, the methods may optionally include the steps of:

(d) contacting each of the antibodies with C039 expressing cells, optionally human B cells, optionally human Ramos lymphoma cells, and assessing neutralization of ATPase activity; as well as

(e) selecting an antibody from step (d) that results in at least a 70%, optionally 80%, or optionally 90% reduction in ATPase activity. Steps (b) and (c) can be performed before or after steps (d) and (e).

Epitopes on CD39

In one aspect, the antibodies bind to an antigenic determinant present on CD39 expressed on the cell surface.

In one aspect, the antibodies bind to substantially the same epitope as the I-394, I-395, I-396, I-397, or I-398 antibodies. In one embodiment, the antibodies bind to a CD39 epitope that at least partially overlaps with or contains at least one epitope residue bound by the I-394, I-395, I-396, I-397, or I-398 antibody. Residues bound by an antibody can be referred to as being present on the surface of a CD39 polypeptide, for example, a CD39 polypeptide expressed on a cell surface.

The binding of an anti-CD39 antibody to cells transfected with CD39 mutants can be measured and compared to the ability of an anti-CD39 antibody to bind a wild-type CD39 polypeptide (eg, SEQ ID NO: 1). Weakening of binding between an anti-CD39 antibody and a mutant CD39 polypeptide (e.g., a mutant from Table 1) means that there is a decrease in binding affinity (e.g., as measured by known methods, polypeptides using Biacore) and/or a decrease in the overall binding capacity of the anti-CD39 antibody (eg, as measured by a decrease in Vmax in a graph of anti-CD39 antibody concentration versus polypeptide concentration). A significant reduction in binding indicates that the mutated residue is directly involved in binding to the anti-CD39 antibody or is in close proximity to the binding protein when the anti-CD39 antibody binds to CD39.

In some embodiments, a significant reduction in binding means that the reduction in the binding affinity and/or binding ability of the anti-CD39 antibody to the mutant CD39 polypeptide is greater than 40%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70% , greater than 75%, greater than 80%, greater than 85%, greater than 90%, or greater than 95% compared to the binding between the antibody and the wild-type CD39 polypeptide. In certain embodiments, binding is loosened below defined limits. In some embodiments, a significant reduction in binding is confirmed if the binding of the anti-CD39 antibody to the mutant CD39 polypeptide is less than 50% (e.g., less than 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10%) from the binding observed between the anti-CD39 antibody and the wild-type CD39 polypeptide.

In some embodiments, anti-CD39 antibodies are provided that exhibit significantly reduced binding to a mutant CD39 polypeptide wherein the residue in the segment comprising the amino acid residue bound by antibody I-394, I-395, I-396, I-397, I-398, or I-399 is substituted with a different amino acid compared to binding to a wild-type CD39 polypeptide that does not contain such substitution(s) (eg, the polypeptide of SEQ ID NO: 1).

In some embodiments, anti-CD39 antibodies (eg, other than I-394) are provided that bind an epitope on CD39 bound by the I-394 antibody.

In any embodiment of the present invention, an antibody can be characterized as an antibody other than BY40, BY12, or BA54g (or an antibody containing their CDR) referred to in PCT Publication No. WO 2009/095478, the disclosure of which is incorporated herein by reference.

In one aspect, anti-CD39 antibodies are characterized by reduced binding to a CD39 polypeptide containing a mutation at a residue selected from the group consisting of: Q96, N99, E143 and R147 (with respect to SEQ ID NO: 1); the mutant CD39 polypeptide optionally contains mutations: Q96A, N99A, E143A and R147E. In one aspect, anti-CD39 antibodies bind an epitope on CD39 containing an amino acid residue (e.g., one, two, three, or four residues) selected from the group consisting of Q96, N99, E143, and R147 (relative to SEQ ID NO: 1) .

In one embodiment, the antibody is characterized by reduced binding to a mutant CD39 polypeptide containing a mutation at one or more (or all) residues selected from the group consisting of R138, M139, and E142 (with respect to SEQ ID NO: 1) compared to binding the antibody to a wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1.

In one embodiment, the antibody is characterized by reduced binding to a mutant CD39 polypeptide containing a mutation at one or more (or all) residues selected from the group consisting of K87, E100, and D107 (with respect to SEQ ID NO: 1) compared to binding the antibody to a wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1.

In one embodiment, the antibody is characterized by reduced binding to a mutant CD39 polypeptide containing a mutation at one or more (or all) residues selected from the group consisting of N371, L372, E375, K376, and V377 (with respect to SEQ ID NO: 1) compared to antibody binding to a wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1.

Exemplary antibody variable region sequences

An exemplary pair of VH and VL of an anti-CD39 antibody of the present invention is the pair contained in antibody I-394, the amino acid sequence of the heavy chain variable region of which is indicated below (SEQ ID NO: 6), and the amino acid sequence of the light chain variable region of which is indicated below (SEQ ID NO: 7). CDRs according to Kabat numbering are underlined in SEQ ID NOs: 6 and 7. VH and VL optionally contain (eg, modified to include) human acceptor frameworks. In one embodiment, an anti-CD39 antibody of the present invention comprises the CDR1, CDR2, and/or CDR3 of a VH (e.g., according to Kabat numbering) of a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 6. In one embodiment, an anti-CD39 antibody of the present invention of the invention comprises the CDR1, CDR2 and/or CDR3 of the VL (e.g., according to Kabat numbering) of the light chain variable region comprising the amino acid sequence of SEQ ID NO: 7. In one embodiment, an anti-CD39 antibody of the present invention comprises a VH containing CDR1, CDR2 and /or a Kabat heavy chain variable region CDR3 containing the amino acid sequence of SEQ ID NO: 6, and a VL containing a Kabat light chain variable region CDR1, CDR2 and/or CDR3 containing the amino acid sequence of SEQ ID NO: 7.

An anti-CD39 antibody may, for example, comprise: HCDR1 comprising the amino acid sequence: DYNMH (SEQ ID NO: 8), or a sequence of at least 4 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; HCDR2 containing the amino acid sequence: YIVPLNGGSTFNQKFKG (SEQ ID NO: 9), or a sequence of at least 4, 5, 6, 7, 8, 9, or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid; HCDR3 containing the amino acid sequence: GGTRFAY (SEQ ID NO: 10) or a sequence of at least 4, 5 or 6 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid; An LCDR1 containing the amino acid sequence: RASESVDNFGVSFMY (SEQ ID NO: 11) or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid ; an LCDR2 region containing the amino acid sequence: GASNQGS (SEQ ID NO: 12) or a sequence of at least 4, 5 or 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; and/or an LCDR3 I-394 region containing the amino acid sequence: QQTKEVPYT (SEQ ID NO: 13) or a sequence of at least 4, 5, 6, 7 or 8 of its contiguous amino acids, where one or more of these amino acids may optionally be removed or replaced by another amino acid. CDR positions may correspond to Kabat numbering.

Another exemplary pair of VH and VL of an anti-CD39 antibody of the present invention is the pair contained in antibody I-395, the amino acid sequence of the heavy chain variable region of which is shown below (SEQ ID NO: 14) and the amino acid sequence of the light chain variable region which is listed below (SEQ ID NO: 15). CDRs according to Kabat numbering are underlined in SEQ ID NOs: 14 and 15. VH and VL optionally contain (eg, modified to include) human acceptor frameworks. In one embodiment, an anti-CD39 antibody of the present invention comprises the CDR1, CDR2, and/or CDR3 of a VH (e.g., according to Kabat numbering) of a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 14. In one embodiment, an anti-CD39 antibody of the present invention of the invention comprises CDR1, CDR2 and/or CDR3 of a VL (e.g., according to Kabat numbering) of a light chain variable region comprising the amino acid sequence of SEQ ID NO: 15. In one embodiment, an anti-CD39 antibody of the present invention comprises a VH containing CDR1, CDR2 and /or a Kabat heavy chain variable region CDR3 containing the amino acid sequence of SEQ ID NO: 14, and a VL containing a Kabat light chain variable region CDR1, CDR2 and/or CDR3 containing the amino acid sequence of SEQ ID NO: 15.

An anti-CD39 antibody may, for example, comprise: HCDR1 comprising the amino acid sequence: DYNMH (SEQ ID NO: 16), or a sequence of at least 4 contiguous amino acids thereof, where one or more of these amino acids may optionally be substituted with another amino acid; HCDR2 containing the amino acid sequence: YINPNNGGTTYNQKFKG (SEQ ID NO: 17), or a sequence of at least 4, 5, 6, 7, 8, 9, or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid; HCDR3 containing the amino acid sequence: GGTRFAS (SEQ ID NO: 18) or a sequence of at least 4, 5, 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; An LCDR1 containing the amino acid sequence: RASESVDNYGISFMY (SEQ ID NO: 19) or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid ; an LCDR2 region containing the amino acid sequence: AASTQGS (SEQ ID NO: 20) or a sequence of at least 4, 5 or 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; and/or an I-396 LCDR3 region containing the amino acid sequence: QQSKEVPFT (SEQ ID NO: 21) or a sequence of at least 4, 5, 6, 7 or 8 of its contiguous amino acids, where one or more of these amino acids may optionally be removed or replaced by another amino acid. CDR positions may correspond to Kabat numbering.

Another exemplary pair of VH and VL of an anti-CD39 antibody of the present invention is the pair contained in antibody I-396, the amino acid sequence of the heavy chain variable region of which is shown below (SEQ ID NO: 22) and the amino acid sequence of the light chain variable region which is listed below (SEQ ID NO: 23). CDRs according to Kabat numbering are underlined in SEQ ID NOs: 22 and 23. VH and VL optionally contain (eg, modified to include) human acceptor frameworks. In one embodiment, an anti-CD39 antibody of the present invention comprises a VH CDR1, CDR2, and/or CDR3 (e.g., according to Kabat numbering) of a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 22. In one embodiment, an anti-CD39 antibody of the present invention of the invention comprises the CDR1, CDR2 and/or CDR3 of a VL (e.g., according to Kabat numbering) of the light chain variable region comprising the amino acid sequence of SEQ ID NO: 23. In one embodiment, an anti-CD39 antibody of the present invention comprises a VH containing CDR1, CDR2 and /or a Kabat heavy chain variable region CDR3 containing the amino acid sequence of SEQ ID NO: 22, and a VL containing a Kabat light chain variable region CDR1, CDR2 and/or CDR3 containing the amino acid sequence of SEQ ID NO: 23.

An anti-CD39 antibody may, for example, comprise: HCDR1 comprising the amino acid sequence: DTYIN (SEQ ID NO: 24), or a sequence of at least 4 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; HCDR2 containing the amino acid sequence: RIDPANGNTKYDPKFQG (SEQ ID NO: 25), or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid; HCDR3 containing the amino acid sequence: WGYDDEEADYFDS (SEQ ID NO: 26) or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid ; An LCDR1 containing the amino acid sequence: RASESVDNYGISFMN (SEQ ID NO: 27) or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid ; an LCDR2 region containing the amino acid sequence: AASNQGS (SEQ ID NO: 28) or a sequence of at least 4, 5 or 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; and/or an I-396 LCDR3 region containing the amino acid sequence: HQSKEVPWT (SEQ ID NO: 29) or a sequence of at least 4, 5, 6, 7 or 8 of its contiguous amino acids, where one or more of these amino acids may optionally be removed or replaced by another amino acid. CDR positions may correspond to Kabat numbering.

Another exemplary pair of VH and VL of an anti-CD39 antibody of the present invention is the pair contained in antibody I-399, the amino acid sequence of the heavy chain variable region of which is shown below (SEQ ID NO: 30) and the amino acid sequence of the light chain variable region which is listed below (SEQ ID NO: 31). CDRs according to Kabat numbering are underlined in SEQ ID NOs: 30 and 31. VH and VL optionally contain (eg, modified to include) human acceptor frameworks. In one embodiment, an anti-CD39 antibody of the present invention comprises the CDR1, CDR2, and/or CDR3 of a VH (e.g., according to Kabat numbering) of a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30. In one embodiment, an anti-CD39 antibody of the present invention of the invention comprises the CDR1, CDR2 and/or CDR3 of a VL (e.g., according to Kabat numbering) of the light chain variable region comprising the amino acid sequence of SEQ ID NO: 31. In one embodiment, an anti-CD39 antibody of the present invention comprises a VH containing CDR1, CDR2 and /or a Kabat heavy chain variable region CDR3 containing the amino acid sequence of SEQ ID NO: 30, and a VL containing a Kabat light chain variable region CDR1, CDR2 and/or CDR3 containing the amino acid sequence of SEQ ID NO: 31.

An anti-CD39 antibody may, for example, comprise: HCDR1 comprising the amino acid sequence: SFWMN (SEQ ID NO: 32), or a sequence of at least 4 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; HCDR2 containing the amino acid sequence: EIDPSDFYTNSNQRFKG (SEQ ID NO: 33), or a sequence of at least 4, 5, 6, 7, 8, 9, or 10 of its contiguous amino acids, where one or more of these amino acids may optionally be substituted by another amino acid; HCDR3 containing the amino acid sequence: GDFGWYFDV (SEQ ID NO: 34) or a sequence of at least 4, 5 or 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted by another amino acid; LCDR1 containing the amino acid sequence: SASSSINSNYLH (SEQ ID NO: 35) or a sequence of at least 4, 5, 6, 7, 8, 9 or 10 of its contiguous amino acids, one or more of these amino acids optionally substituted by another amino acid ; an LCDR2 region containing the amino acid sequence: RTSNLAS (SEQ ID NO: 36) or a sequence of at least 4, 5 or 6 contiguous amino acids thereof, one or more of these amino acids optionally substituted with another amino acid; and/or an I-399 LCDR3 region containing the amino acid sequence: QQGSSLPRT (SEQ ID NO: 37) or a sequence of at least 4, 5, 6, 7 or 8 of its contiguous amino acids, where one or more of these amino acids may optionally be removed or replaced by another amino acid. CDR positions may correspond to Kabat numbering.

In any of the antibodies I-394, I-395, I-396 and I-399, the sequences HCDR1, 2, 3 and LCDR1, 2, 3 (each CDR independently or all CDRs) can be designated as being such according to the Kabat numbering system ( as indicated in the VH and VL sequences by underlining), the Chotia numbering system or the IMGT numbering system, or any other suitable numbering system.

In any aspect, said variable regions, FR and/or CDR sequences may contain one or more sequence modifications, such as a substitution (1, 2, 3, 4, 5, 6, 7, 8 or more sequence modifications). In one embodiment, the replacement is a conservative modification.

In yet another aspect, the anti-CD39 compound comprises a V _H domain having at least about 60%, 70%, or 80% sequence identity, optionally at least about 85%, 90%, 95%, 97%, 98%, or 99% identity to a VH domain according to SEQ ID NO: 6. In another aspect, an anti-CD39 antibody comprises a V _L domain having at least about 60%, 70%, or 80% sequence identity, optionally at least about 85%, 90 %, 95%, 97%, 98% or 99% identity with respect to the VL domain according to SEQ ID NO: 7.

Fragments and derivatives of antibodies (covered by the term "antibody" or "antibodies" in this application, unless otherwise indicated or if this is clearly not contrary to the context) can be obtained by methods known in the art. "Fragments" contain a portion of an intact antibody, typically an antigen binding site or variable region. Examples of antibody fragments include Fab, Fab', Fab'-SH, F(ab')2 and Fv fragments; diabody; any antibody fragment that is a polypeptide having a primary structure consisting of a single contiguous sequence of contiguous amino acid residues (referred to herein as a "single chain antibody fragment" or "single chain polypeptide"), including, without limitation, (1) single chain Fv molecules ( 2) single chain polypeptides containing only one light chain variable domain or a fragment thereof containing three light chain variable domain CDRs without an associated heavy chain fragment, and (3) single chain polypeptides containing only one heavy chain variable region or a fragment thereof containing three CDR of the heavy chain variable region, without the associated light chain fragment; and multispecific (eg, bispecific) antibodies formed from antibody fragments. This definition includes, but is not limited to, a nanobody, a domain antibody, a single domain antibody, or a "dAb".

In some embodiments, the antibody-producing hybridoma DNA can be modified prior to insertion into an expression vector, e.g., by replacing the coding sequence of the human heavy and light chain constant domains in place of a non-human homologous sequence (e.g., Morrison et al., PNAS pp. 6851 (1984 )), or by covalently attaching to the immunoglobulin coding sequence the entire coding sequence of the non-immunoglobulin polypeptide or a fragment thereof. Thus, "chimeric" or "hybrid" antibodies are obtained that have the binding specificity of the parent antibody. Typically, such non-immunoglobulin polypeptides replace the constant domains of an antibody.

The antibody is not necessarily humanized. "Humanized" forms of antibodies are specific chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (eg, Fv, Fab, Fab', F(ab')2 or other antigen-binding antibody subsequences) containing a minimal sequence derived from mouse immunoglobulin. For the most part, humanized antibodies are human (recipient) immunoglobulins in which residues from the complementarity determining region (CDR) of the recipient are replaced by residues from the CDR of the parent antibody (donor antibody) while maintaining the desired specificity, affinity, and capability of the parent antibody.

In some cases, Fv-framework residues of human immunoglobulin can be replaced by corresponding residues of non-human origin. In addition, humanized antibodies may contain residues that are not found in either the recipient antibody or the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, a humanized antibody contains substantially all of at least one, and typically two, variable domains in which all or substantially all of the CDRs correspond to the CDRs of the parent antibody and all or substantially all of the FRs are FRs. human immunoglobulin consensus sequence. The humanized antibody also optimally contains at least a portion of an immunoglobulin (Fc) constant region, typically a human immunoglobulin. For further information, see Jones et al., Nature, 321, pp. 522 (1986); Reichmann et al, Nature, 332, pp. 323 (1988); Presta, Curr. Op. Struct. Biol., 2, pp. 593 (1992); Verhoeyen et Science, 239, pp. 1534 and US Pat. No. 4,816,567, the entire disclosure of which is incorporated herein by reference). Methods for humanizing antibodies are well known in the art.

The choice of human variable domains, both light and heavy, for use in generating humanized antibodies is very important to reduce antigenicity. According to the so-called "best fit" method, the antibody variable domain sequence is screened against the entire library of known human variable domain sequences. The human sequence closest to the mouse sequence is then adopted as the human framework region (FR) for the humanized antibody (Sims et al., J. Immunol. 151, pp. 2296 (1993); Chothia and Lesk, J. Mol. 196 , 1987, pp. 901). Another method uses a specific structure from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same scaffold can be used for several different humanized antibodies (arter et al., PNAS 89, pp. 4285 (1992); Presta et al., J. Immunol., 151, p. 2623 (1993)).

In addition, it is important that the antibodies be humanized while retaining high affinity for CD39 and other favorable biological properties. To achieve this goal, according to one method, humanized antibodies are obtained by analyzing the original sequences and various conceptual humanized products using three-dimensional models of the original and humanized sequences. Three-dimensional immunoglobulin models are publicly available and familiar to those skilled in the art. There are computer programs that illustrate and display possible three-dimensional structures of selected candidate immunoglobulin sequences. The study of these images allows us to analyze the likely role of the residues in the functioning of the candidate immunoglobulin sequence. Thus, FR residues from the consensus and import sequences can be selected and combined to provide the desired characteristics of the antibody.

Another way to obtain "humanized" monoclonal antibodies is to use XenoMouse (Abgenix, Fremont, CA, USA) as the mouse used for immunization. XenoMouse is a mouse host with immunoglobulin genes replaced with functional human immunoglobulin genes. Thus, antibodies produced by this mouse or by hybridomas made from the B cells of this mouse are already humanized. XenoMouse is described in US Pat. No. 6,162,963, incorporated herein by reference in its entirety.

Human antibodies can also be obtained according to various other methods, for example by using other transgenic animals designed to express the human antibody repertoire for immunization (Jakobovitz et al., Nature 362 (1993) 255), or by selecting from antibody repertoires using phage display. Such techniques are known to the person skilled in the art and can be implemented starting with monoclonal antibodies, as described in this application.

An anti-CD39 antibody can be included in a pharmaceutical formulation containing it at a concentration of 1 mg/mL to 500 mg/mL, wherein the pH of said formulation is between 2.0 and 10.0. The formulation may further comprise a buffer system, preservative(s), tonicity agent(s), chelating agent(s), stabilizers and surfactants. In one embodiment, the pharmaceutical formulation is an aqueous formulation, i. composition containing water. Such a composition is usually a solution or suspension. In an additional embodiment, the implementation of the pharmaceutical composition is an aqueous solution. The term "water composition" is defined as a composition containing at least 50% (w/w) of water. Similarly, the term "aqueous solution" is defined as a solution containing at least 50% (w/w) of water, and the term "aqueous suspension" is defined as a suspension containing at least 50% (w/w) of water.

In yet another embodiment, the pharmaceutical formulation is a lyophilized formulation to which diluents and/or diluents are added by the physician or patient prior to use.

In yet another embodiment, the pharmaceutical formulation is a dried (eg, lyophilized or spray dried) formulation ready for use without prior dissolution.

In an additional aspect, the pharmaceutical composition comprises an aqueous solution of such an antibody and a buffer, wherein the antibody is present at a concentration of 1 mg/mL or greater and the pH of said composition is from about 2.0 to about 10.0.

In yet another embodiment, the pH of the composition is in the range selected from the list consisting of from about 2.0 to about 10.0, from about 3.0 to about 9.0, from about 4.0 to about 8.5, from about 5.0 to about 8.0; and from about 5.5 to about 7.5.

In a further embodiment, the buffer is selected from the group consisting of sodium acetate, sodium carbonate, citrate, glycylglycine, histidine, glycine, lysine, arginine, sodium dihydrogen phosphate, sodium hydrogen phosphate, sodium phosphate and tris(hydroxymethyl)aminomethane, bicine, tricine, malic acid , succinate, maleic acid, fumaric acid, tartaric acid, aspartic acid, or mixtures thereof. Each of these specific buffers constitutes an alternate implementation.

In an additional embodiment, the formulation further comprises a pharmaceutically acceptable preservative. In an additional embodiment, the composition further comprises an isotonic agent. In an additional embodiment, the composition also contains a chelating agent. In an additional embodiment, the composition further comprises a stabilizer. In an additional embodiment, the composition further comprises a surfactant. For convenience, reference is made to Remington: The Science and Practice of Pharmacy, ^19th edition, 1995.

Other ingredients may be present in the peptide pharmaceutical formulation. Such additional ingredients may include humectants, emulsifiers, antioxidants, bulking agents, tonicity modifiers, chelating agents, metal ions, oily carriers, proteins (e.g., human serum albumin, gelatin, or proteins), and zwitterion (e.g., an amino acid, e.g., betaine, taurine, arginine, glycine, lysine and histidine). Such additional ingredients, of course, should not adversely affect the overall stability of the pharmaceutical composition.

Pharmaceutical compositions containing the antibody can be administered to a patient in need of such treatment in several areas, for example, in areas for topical application, for example, in areas of the skin and mucous membranes, in areas that allow absorption to be avoided, for example, when administered in artery, vein, heart and areas that involve absorption, for example, when injected into the skin, under the skin, into a muscle or into the abdominal cavity. Administration of pharmaceutical compositions to patients in need of such treatment may be by several routes, e.g., subcutaneous, intramuscular, intraperitoneal, intravenous, lingual, sublingual, buccal, orally, oral, stomach and intestines, nasal, pulmonary, e.g. via bronchioles and alveoli or combinations thereof, epidermal, dermal, transdermal, vaginal, rectal, ocular, eg via the conjunctiva, urethral and parenteral.

Suitable antibody formulations can also be determined by examining the experience with other already developed therapeutic monoclonal antibodies. Some monoclonal antibodies have been shown to be effective in clinical situations, such as Rituxan (rituximab), Herceptin (trastuzumab), Xolair (omalizumab), Bexxar (tositumomab), Campath (alemtuzumab), Zevalin, Oncolym and similar antibody-containing products . For example, a monoclonal antibody can be administered at a concentration of 10 mg/ml in 100 mg (10 ml) or 500 mg (50 ml) disposable vials, in an IV formulation containing 9.0 mg/ml sodium chloride, 7, 35 mg/ml sodium citrate dihydrate, 0.7 mg/ml polysorbate 80 and sterile water for injection. The pH is adjusted to 6.5. In another embodiment, the antibody is provided in a formulation containing about 20 mM Na citrate, about 150 mM NaCl, at a pH of about 6.0.

Diagnosis and treatment of diseases

Also provided are methods of treating a subject, in particular a human subject, using an anti-CD39 antibody described herein. In one embodiment, the present invention provides for the use of an antibody described herein in the manufacture of a pharmaceutical composition for administration to a human patient. Typically, an individual is suffering from or at risk of developing cancer or an infectious disease (eg, viral infection, bacterial infection). In one embodiment, the individual has a detectable soluble (extracellular) CD39 protein in the bloodstream and/or in a tissue sample (eg, in a tumor sample or tumor-adjacent tissue).

For example, in one aspect, there is provided a method for restoring or enhancing lymphocyte activity in an individual in need thereof, comprising the step of administering to said individual an anti-CD39 neutralizing antibody of the present invention. The antibody can be, for example, a human or humanized anti-CD39 antibody that specifically binds and neutralizes the ATPase activity of soluble and membrane forms of "vascular" CD39 without binding to CD39-L1, L2, L3 and/or L4, which optionally does not substantially bind to human CD16 (and furthermore, optionally does not bind to other human Fcγ receptors, e.g. CD32a, CD32b or CD64). Such antibodies are characterized by reduced unwanted side effects or toxicity due to lack of binding to isoforms other than vascular CD39 and reduced unwanted side effects or toxicity due to depletion or other Fc-mediated effects on CD39-expressing endothelial cells in the vasculature.

In one embodiment, said method is directed to increasing lymphocyte (e.g., T-cell) activity in an individual suffering from a disease that benefits from increased lymphocyte activity, or is caused or characterized by immunosuppression, immunosuppressive cells, or, for example, adenosine produced by CD4 T- cells, CD8 T cells, B cells). These methods are particularly useful, for example, in the treatment of an individual with a solid tumor and it is suspected that the tumor microenvironment (and CD39-mediated production of adenosine therein) may contribute to a lack of recognition by the immune system (avoidance of an immune response). The tumor environment (tumor tissue or tissue adjacent to the tumor) may, for example, be characterized by the presence of CD39-expressing immune cells, eg CD4 T cells, CD8 T cells, B cells.

More specifically, these methods and compositions are used to treat various types of cancer and other proliferative diseases and infectious diseases. Since these methods work by reducing the level of adenosine, which inhibits the activity of lymphocytes against target cells (for example, antitumor activity) and, possibly additionally, by increasing the level of ATP, which can enhance the antitumor activity of lymphocytes, they can be used in a very wide range cancer and infectious diseases. In one embodiment, anti-CD39 antibody compositions can be used to treat cancer in individuals who respond poorly to (or are not responsive to) treatment with an agent that neutralizes human PD-1 inhibitory activity, e.g., one that inhibits the interaction between PD-1 and PD. -L1. Typical examples of cancers that can be treated include, in particular, solid tumors, in which adenosine in the tumor microenvironment may play an important role in suppressing the antitumor immune response. In one embodiment, the human patient being treated with an anti-CD39 antibody has liver cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, including head and neck squamous cell carcinoma (HNSCC), breast cancer, lung, non-small cell lung cancer (NSCLC), castration-resistant prostate cancer (CRPC), melanoma, uterine cancer, colon cancer, rectal cancer, anal cancer, stomach cancer, testicular cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, childhood solid tumors, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal pelvis carcinoma, neoplasm central nervous system (CNS) disease, primary CNS lymphoma, tumor angiogenesis, spinal cord tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell carcinoma, cancer caused by environmental factors, including asbestos exposure, hematologic malignancies, including, for example, multiple myeloma, B-cell lymphoma, Hodgkin's lymphoma/primary B-cell mediastinal lymphoma, non-Hodgkin's lymphomas, acute myeloid lymphoma, chronic myelogenous leukemia, chronic lymphoid leukemia, follicular lymphoma, diffuse large B-cell cellular lymphoma, Burkitt's lymphoma, immunoblastic large cell lymphoma, progenitor B lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, mycosis fungoides, anaplastic large cell lymphoma, T-cell lymphoma, progenitor T-lymphoma, and any combinations of the indicated evils honest diseases. The present invention can also be used in the treatment of metastatic cancer. Patients can be tested or selected for one or more of the above clinical signs before, during or after treatment.

In one embodiment, an anti-CD39 antibody is used in the treatment of cancer characterized by detectable and/or elevated levels of soluble (extracellular) CD39 protein, e.g., in the bloodstream and/or in tissues, e.g., in a tumor or tissue adjacent to a tumor.

In one embodiment, an anti-CD39 antibody is used in the treatment of cancer characterized by malignant cells expressing CD39.

In one embodiment, the anti-CD39 antibody is administered in an amount to achieve and/or maintain in the individual (e.g., for 1, 2, 3, 4 weeks and/or until the next administration of the antigen binding compound) a blood concentration of at least least EC ₅₀ , optionally EC ₇₀ , optionally essentially EC ₁₀₀ to neutralize the enzymatic activity of CD39, optionally sCD39, optionally memCD39. In one embodiment, the active amount of an anti-CD39 antibody is an amount to achieve an EC ₅₀ , optionally EC ₇₀ , optionally substantially EC ₁₀₀ to neutralize CD39, optionally sCD39, optionally memCD39 enzymatic activity in an individual's extravascular tissue. In one embodiment, the active amount of an anti-CD39 antibody is an amount to achieve (or maintain) an individual's EC ₅₀ , optionally EC ₇₀ , optionally substantially EC ₁₀₀ to inhibit the neutralization of CD39, optionally sCD39, optionally memCD39 enzymatic activity.

In one embodiment, unlike some antibodies that target depletion of CD39-expressing tumor cells via ADCC (which, for example, may provide full efficacy at concentrations equal to or substantially less than concentrations that saturate the receptor), an anti-CD39 antibody optionally does not exhibit significant Fcγ receptor-mediated activity and is administered in an amount to neutralize enzymatic activity, optionally additional CD39 without significantly reducing CD39 expression levels, over a desired period of time, e.g., 1 week, 2 weeks , months, or until the next injection of anti-CD39 antibodies.

In one embodiment, the anti-CD39 antibody is administered in an amount to achieve and/or maintain (e.g., for 1, 2, 3, 4 weeks and/or until the next administration of the anti-CD39 antibody) an individual's blood concentration of at least EC ₅₀ , optionally EC ₇₀ , optionally essentially EC ₁₀₀ to inhibit CD39-mediated catabolism of ATP to AMP (e.g., as assessed by neutralization of sCD39 ATPase activity; as assessed by neutralization of ATPase activity of soluble (extracellular) CD39 protein, see Example 5).

In one embodiment, a method of treating or preventing cancer in an individual is provided, the method comprising administering to the individual suffering from the disease an amount of an anti-CD39 antibody to achieve or maintain a concentration in the bloodstream, optionally in an extravascular tissue of interest (e.g., tumor or tumor environment) in excess of the concentration required to achieve 50%, 70%, or complete (eg, 90%) saturation of the circulating CD39-expressing cell receptor (eg, as measured by the MIC). The concentration achieved is optionally at least 20%, 50% or 100% higher than the concentration required to saturate said receptor.

In one embodiment, a method of treating or preventing cancer in an individual is provided, the method comprising administering to the individual an anti-CD39 antibody in an amount to achieve or maintain, over time, a concentration in the bloodstream, optionally in an extravascular tissue of interest (e.g., a tumor or tumor environment). ) greater than EC ₅₀ , optionally EC ₇₀ , or optionally EC ₁₀₀ to bind CD39-expressing cells (e.g., as assessed by flow cytometry, titrating an anti-CD39 antibody on CD39-expressing cells, e.g., Ramos cells, as described in the Examples Methods"). The concentration achieved is optionally at least 20%, 50% or 100% greater than EC ₅₀ , optionally EC ₇₀ or optionally EC ₁₀₀ for binding to cells expressing CD39.

EC ₅₀ , EC ₇₀ or EC ₁₀₀ can be assessed, for example, in the CD39 enzyme neutralization cell assay shown in the Examples section of this document, for example, neutralization of ATPase activity in B cells by quantifying the hydrolysis of ATP to AMP (or ATP to adenosine), see "Examples, Methods". "EC ₅₀ " in relation to the neutralization of the enzyme activity of CD39 refers to the effective concentration of antibodies against CD39, which provides 50% of the maximum response or action in terms of neutralization of the enzyme activity. "EC ₇₀ " in relation to the neutralization of the enzymatic activity of CD39 refers to the effective concentration of antibodies against CD39, which provides 70% of the maximum response or effect. "EC ₁₀₀ " in relation to the neutralization of the enzyme activity of CD39 refers to the effective concentration of antibodies against CD39, which provides essentially the maximum response or effect in relation to the neutralization of the enzyme activity.

In some embodiments, particularly for the treatment of solid tumors, the concentration achieved should result in a tissue concentration (outside the vasculature, eg, in the tumor or tumor environment) corresponding to at least EC ₅₀ or EC ₇₀ . to neutralize enzymatic activity, optionally about or at least about EC ₁₀₀ .

In one embodiment, the amount of anti-CD39 antibody is from 1 to 20 mg/kg body weight. In one embodiment, the implementation of the specified amount is administered to the individual weekly, every two weeks, monthly or every two months.

In one embodiment, a method of treating a human subject suffering from cancer is provided, comprising administering to the subject an effective amount of an anti-CD39 antibody of the present invention for at least one administration cycle (optionally at least 2, 3, 4 or more administration cycles), wherein a cycle is a period of eight weeks or less, with one, two, three, or four doses of anti-CD39 antibody at a dose of 1-20 mg/kg body weight administered during each of at least one cycle. In one embodiment, the anti-CD39 antibody is administered by intravenous infusion.

Suitable treatment protocols for treating humans include, for example, administering an amount of anti-CD39 antibody to a patient as described herein, said method comprising at least one administration cycle during which at least one dose of anti-CD39 antibody is administered. Optionally, at least 2, 3, 4, 5, 6, 7, or 8 doses of anti-CD39 antibody are administered. In one embodiment, the implementation cycle of administration is from 2 weeks to 8 weeks.

In one embodiment, a method is provided for treating or preventing a disease (e.g., cancer, solid tumor, hemoblastosis) in an individual, said method comprising administering to the individual suffering from the disease (e.g., cancer, solid tumor, hemoblastosis) an anti-CD39 antibody that neutralizes CD39 enzymatic activity. , over at least one administration cycle, wherein the administration cycle comprises at least the first and second (and optionally 3, 4, 5, 6, 7 and/or 8 or further) administrations of the anti-CD39 antibody, wherein the anti-CD39 antibody administered in an amount to achieve or maintain, between two successive injections, a concentration of anti-CD39 antibody in the blood (serum) of at least 0.1 μg/ml, optionally at least 0.2 μg/ml, optionally at least 1 μg /ml or optionally at least 2 μg/ml (for example, for the treatment of hemoblastosis) or optionally at least about 1 μg/ml, 2 μg/ml, 10 μg /ml or 20 µg/ml, e.g. in the range 1-100 µg/ml, 1-50 µg/ml, 1-20 µg/ml or 1-10 µg/ml (e.g. for treatment of solid tumor, for treatment of hemoblastosis ). In one embodiment, a specified constant blood concentration is maintained, wherein said blood concentration does not fall substantially below a specified blood concentration for a specified time (e.g., between two antibody administrations, for a specified number of weeks, 1 week, 2 weeks, 3 weeks , 4 weeks), i.e. although the blood concentration may vary over the specified time, the specified maintenance blood concentration represents the minimum concentration. In one embodiment, a therapeutically active amount of an anti-CD39 antibody is an amount of such antibody capable of providing (at least) a blood and/or tissue concentration of EC ₅₀ , optionally a blood and/or tissue concentration of EC ₇₀ . optionally, a blood and/or tissue concentration of EC ₁₀₀ to neutralize CD39 enzymatic activity for at least about 1 week, about 2 weeks, or about a month after administration of the antibody.

Before or during treatment with an anti-CD39 antibody of the present invention, the presence or levels of soluble (extracellular) CD39 protein, CD39 expressing cells, adenosine, ATP, ADP and/or AMP levels in and/or near the patient's tumor can be assessed to determine if a patient is suitable for treatment (eg, predict the patient's ability to respond to treatment). The presence or elevated levels of soluble (extracellular) CD39, CD39-expressing cells, adenosine, ATP, ADP, and/or AMP may indicate that an individual is suitable for treatment (e.g., treatment is likely to be beneficial) with an anti-CD39 antibody according to of the present invention (including but not limited to an antibody that inhibits substrate-bound CD39).

Prior to or during treatment with an anti-CD39 antibody of the present invention, levels of adenosine, ADP, and/or AMP in and/or adjacent to a patient's tumor can optionally be assessed to determine if the patient is benefiting from treatment with an anti-CD39 antibody. Decrease in levels of adenosine, ATP, ADP and/or AMP after administration (or administration of an antibody) compared to levels before treatment (or administration of an antibody) may indicate that treatment with an anti-CD39 antibody of the present invention (including an antibody that inhibits associated with, but not limited to, a CD39 substrate) is beneficial to the individual. If treatment with an anti-CD39 antibody is beneficial to a patient, the methods may further optionally include administering an additional dose of anti-CD39 antibody to the patient (eg, while continuing treatment).

In one embodiment, assessing the levels of adenosine, ADP, and/or AMP in and/or adjacent to a patient's tumor comprises obtaining from the patient a biological sample of human tissue selected from the group consisting of cancer patient tissue, e.g., cancer tissue, tissue close to tumor, or tissue from the periphery of the cancer, tissue adjacent to the cancer, adjacent non-tumor tissue, or healthy adjacent tissue, and detecting levels of adenosine, ATP, ADP, and/or AMP in said tissue. Levels in a patient can be compared to a reference level, eg, corresponding to a healthy individual.

In one embodiment, the present invention provides a method for treating or preventing cancer in an individual in need thereof, said method comprising:

a) detecting soluble (extracellular) CD39 protein and/or cells expressing CD39 in the circulation or in the tumor environment, optionally within the tumor and/or in adjacent tissue, and

b) after determining that the level of soluble (extracellular) CD39 protein and/or CD39-expressing cells contained in the bloodstream or tumor environment does not necessarily correspond to a level elevated compared to the reference level (for example, corresponding to a healthy individual or an individual not receiving substantial benefit from an anti-CD39 antibody), administering an anti-CD39 antibody to an individual. CD39 expressing cells may include cancer cells or leukocytes, eg circulating or tumor infiltrating cells, eg CD4 T cells, CD8 T cells, Treg cells, B cells.

In one embodiment, the present invention provides a method for treating or preventing cancer in an individual in need thereof, said method comprising:

a) assessing the presence of detectable soluble (extracellular) CD39 in the individual, optionally in the circulation, optionally in the tumor and/or adjacent tissue, and

b) when a level of soluble (extracellular) CD39 is detected, optionally corresponding to a level elevated from the reference level (for example, corresponding to a healthy individual or an individual not significantly benefiting from an anti-CD39 antibody of the present invention), administering to the individual an anti-CD39 antibody of the present invention.

In any of the methods, detecting soluble CD39 protein and/or CD39-expressing cells (or adenosine, ATP, ADP, and/or AMP) in a tumor environment optionally includes obtaining a biological sample from an individual that contains cancerous and/or tumor-proximal tissue. or tissue from the periphery of the cancer (eg, tissue adjacent to the cancer, adjacent non-tumor tissue, or healthy adjacent tissue), and determining levels of sCD39 protein, CD39-expressing cells (or adenosine, ATP, ADP, and/or AMP). CD39 expressing cells may include, for example, tumor cells, CD4 T cells, CD8 T cells, Treg cells, B cells.

An individual suffering from cancer can be treated with an anti-CD39 antibody without the prior step of detecting and evaluating the presence of sCD39 and/or CD39 expression on circulating cells or on cells in the tumor microenvironment (e.g., tumor cells, CD4 T cells, CD8 T cells). , TReg cells, B cells). The method of treatment may optionally include the step of detecting a CD39 nucleic acid or polypeptide in a biological sample from an individual's blood or tumor (e.g., cancer tissue, tissue proximal to, or periphery of, the cancer, tissue adjacent to the cancer, adjacent non-tumor tissue or healthy adjacent tissue). Determination of the presence of CD39-expressing cells in a biological sample (e.g., strongly expressing; expressing CD39 at a high level, with a high intensity of anti-CD39 antibody staining compared to the reference) indicates that the patient has cancer, in which treatment with a CD39 inhibitory agent may bring significant benefits. In one embodiment, the method includes determining the level of expression of a CD39 nucleic acid or polypeptide in a biological sample and comparing this level with a reference level corresponding to a healthy individual. Determination of the presence of sCD39 protein and/or cells expressing a CD39 nucleic acid or polypeptide at a level higher than the reference level in a biological sample indicates that the patient has cancer that can be successfully treated using an anti-CD39 antibody of the present invention. In one embodiment, detecting a CD39 polypeptide in a biological sample comprises detecting a soluble extracellular CD39 protein. In one embodiment, detecting a CD39 polypeptide in a biological sample includes detecting a CD39 polypeptide expressed on the surface of a cancer cell, CD4 T cell, CD8 T cell, TReg cell, B cell. In one embodiment, determining the presence in a biological sample of cells expressing a CD39 nucleic acid or polypeptide is indicative of the presence of cancer in the patient, which can be successfully treated using an anti-CD39 antibody of the present invention. "Strongly expressed" in relation to a CD39 polypeptide means that the CD39 polypeptide is expressed in a significant number of cells taken from a given patient. Although the definition of "highly expressed" is not associated with an exact percentage, in some examples, a receptor that is considered "highly expressed" is present at least 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80% or more of tumor cells taken from the patient.

Determining whether an individual has a cancer characterized by cells expressing a CD39 polypeptide may, for example, include obtaining a biological sample (eg, by performing a biopsy) from an individual containing cells from the environment of the cancer (eg, tumor or tissue adjacent to the tumor), bringing these cells in contact with an antibody that binds the CD39 polypeptide, and determining the presence of expression of CD39 cells on their surface. Determining whether an individual has cells expressing CD39 does not necessarily involve performing an immunohistochemical analysis.

Antibody compositions can be used as monotherapy or in combination treatment with one or more other therapeutic agents, including agents commonly used for the particular therapeutic purpose for which the antibody is administered. The additional therapeutic agent will typically be administered in amounts and according to treatment regimens commonly used for that agent in monotherapy for the particular disease or condition being treated. Such therapeutic agents include, but are not limited to, anti-cancer agents and chemotherapeutic agents, for example, a chemotherapeutic agent capable of causing extracellular release of ATP from tumor cells.

In one embodiment, neutralizing anti-CD39 antibodies are unable to bind to human CD16 but enhance the activity of CD16-expressing effector cells (eg, NK or effector T cells). Accordingly, in one embodiment, the second or additional second therapeutic agent is an antibody or other protein containing an Fc domain capable of inducing ADCC against the cell to which it binds, for example, via CD16 expressed by an NK cell. Typically, such an antibody or other protein contains a domain that binds to an antigen of interest, for example, an antigen present in a tumor cell (tumor antigen) and an Fc domain or fragment thereof, and binds to the antigen through the antigen-binding domain and to Fcγ -receptors (for example, CD16) due to the Fc domain. In one embodiment, its ADCC activity is at least partially mediated by CD16. In one embodiment, the additional therapeutic agent is an antibody containing a native or modified human Fc domain, for example, the Fc domain of a human IgG1 or IgG3 antibody. The term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" is a term well known in the art and refers to a cell-mediated response in which non-specific cytotoxic cells expressing Fc receptors (FcRs) recognize the bound antibody on target cells and subsequently cause lysis of the target cell. Non-specific cytotoxic cells that mediate ADCC include natural killer cells (NK cells), macrophages, monocytes, neutrophils, and eosinophils. The term "antibody that induces ADCC" refers to an antibody that exhibits ADCC when measured by assay(s) known to those skilled in the art. Such activity is typically characterized by binding of the Fc region to various FcRs. Regardless of the specific mechanism, those skilled in the art would appreciate that the ability of an antibody to exhibit ADCC may be due, for example, to a particular subclass (eg, IgG1 or IgG3), mutations introduced into the Fc region, or modifications to carbohydrate structures in the Fc. - regions of the antibody. Examples of antibodies that induce ADCC include rituximab (for the treatment of lymphoma, CLL, trastuzumab (for the treatment of breast cancer), alemtuzumab (for the treatment of chronic lymphocytic leukemia) and cetuximab (for the treatment of colorectal cancer, head and neck squamous cell carcinoma) Examples of ADCC-enhancing antibodies include: GA-101 (hypofucosylated anti-CD20 antibody), margetuximab (Fc-boosted anti-HER2 antibody), mepolizumab, MEDI-551 (Fc-modified anti-CD19 antibody), obinutuzumab (glycosylation-modified/hypofucosylated antibody but are not limited to ocaratuzumab (Fc-modified anti-CD20 antibody), ^XmAb® 5574/MOR208 (Fc-modified anti-CD19 antibody).

In one embodiment, neutralizing anti-CD39 antibodies enhance the efficacy of agents that neutralize human PD-1 inhibitory activity, e.g., by inhibiting the interaction between PD-1 and PD-L1, especially in individuals who respond poorly to (or are unresponsive to) treatment with an inhibitor neutralizing agent. human PD-1 activity. Accordingly, in one embodiment, the second or additional second therapeutic agent is an antibody or other agent that neutralizes human PD-1 inhibitory activity.

Programmed death-1 (PD-1) protein (also referred to as "programmed cell death-1 protein") is an inhibitory member of the CD28 receptor family. The complete sequence of human PD-1 is in GenBank accession number U64863. Inhibition or neutralization of PD-1 inhibitory activity may involve the use of a polypeptide agent (e.g., antibody, Fc domain-fused polypeptide, immunoadhesin, etc.) that blocks PD-L1-induced PD-1 signaling. at least six PD-1/PD-L1 pathway blocking agents that are on the market or are being clinically evaluated. One agent is BMS-936558 (nivolumab/ONO-4538, Bristol-Myers Squibb; formerly known as MDX-1106). Nivolumab (trade name Opdivo®) is an FDA-approved fully human anti-PD-L1 IgG4-MAT that inhibits PD-L1 ligand binding to both PD-1 and CD80 and is described as a 5C4 antibody in WO 2006/121168, the description of which is incorporated herein by reference. For patients with melanoma, the most significant OR was observed at a dose of 3 mg/kg, while for other types of cancer it was 10 mg/kg. Nivolumab is usually administered at a dose of 10 mg/kg every 3 weeks until cancer progresses. The terms “reduces human PD-1 inhibitory activity,” “neutralizes PD-1,” or “neutralizes PD-1 inhibitory activity” refer to the process by which PD-1 signaling ability is inhibited by interaction of PD-1 with one or more of its binding partners, such as PD-L1 or PD-L2. An agent that neutralizes PD-1 inhibitory activity attenuates, blocks, inhibits, abrogates, or interferes with signaling resulting from the interaction of PD-1 with one or more of its binding partners, eg, PD-L1, PD-L2. Thus, such an agent can reduce the negative co-stimulatory signal mediated by cell surface proteins expressed on T lymphocytes by enhancing T cell effector functions such as proliferation, cytokine production and/or cytotoxicity.

MK-3475 (Merck's lgG4 human anti-PD1 mAb), also called lambrolizumab or pembrolizumab (trade name Keytruda®), is FDA-approved for the treatment of melanoma and is being tested in other cancers. Pembrolizumab was tested at 2 mg/kg or 10 mg/kg every 2 or 3 weeks until disease progression. MK-3475, also known as Merck 3745 or SCH-900475, is also described in WO 2009/114335.

MPDL3280A/RG7446 (atezolizumab, tradename Tecentriq™, anti-PD-L1 antibody from Roche/Genentech) is a human anti-PD-L1 mAb containing an engineered Fc domain designed to optimize efficacy and safety by minimizing FcγR binding and subsequent antibody-dependent cellular cytotoxicity (ADCC). Doses ≤1, 10, 15 and 25 mg/kg MPDL3280A were administered every 3 weeks for up to 1 year. In a phase 3 study, MPDL3280A is administered at NSCLC at a dose of 1200 mg by intravenous infusion every three weeks.

AMP-224 (Amplimmune and GSK) is an immunoadhesin containing the extracellular domain of PD-L2 attached to an Fc domain. Other examples of agents that neutralize PD-1 may include an antibody that binds PD-L2 (anti-PD-L2 antibody) and blocks the interaction between PD-1 and PD-L2.

Pidlizumab (CT-011; CureTech) (humanized anti-PD1 lgG1 mAb from CureTech/Teva), pidlizumab (CT-011; CureTech) (see eg WO 2009/101611) is another example; this drug was tested in thirty patients with rituximab-responsive relapsing FL who received CT-011 3 mg/kg IV every 4 weeks for 4 infusions in combination with rituximab at a dose of 375 mcg/m2 per week for 4 weeks starting at week 2 after the first infusion of ST-011.

In addition, known anti-PD-1 antibodies and other PD-1 inhibitors include AMP-224 (B7-DC/lgG1 fusion protein licensed from GSK), AMP-514 described in WO 2012/145493, MEDI-4736 antibody (durvalumab , trade name Imfinzi™, anti-PD-L1 antibody developed by AstraZeneca/Medlmmune) described in WO 2011/066389 and US 2013/034559, antibody YW243.55.S70 (anti-PD-L1 antibody) described in WO 2010/ 077634, MDX-1105, also known as BMS-936559, which is an anti-PD-L1 antibody developed by Bristol-Myers Squibb, described in WO 2007/005874, and antibodies and inhibitors described in WO 2006/121168, WO 2009/014708 , WO 2009/114335 and WO 2013/019906, the descriptions of which are incorporated herein by reference. Further examples of anti-PD1 antibodies are described in WO 2015/085847 (Shanghai Hengrui Pharmaceutical Co., Ltd.), e.g. SEQ ID NO: 8, respectively, and CDR1, 2, and 3 of the antibody heavy chain variable domain according to SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, respectively, where references to SEQ ID NO correspond to the numbering in the application WO 2015/085847, the description of which is incorporated herein by reference. In addition, antibodies that compete with any of these antibodies for binding to PD-1 or PD-L1 can be used. An exemplary anti-PD-1 antibody is pembrolizumab (commercialized by Merck & Co. under the name Keytruda™, see also WO 2009/114335, the disclosure of which is incorporated herein by reference).

In some embodiments, the PD-1 neutralizing agent is an anti-PD-L1 mAb that inhibits the binding of PD-L1 to PD-1. In some embodiments, the PD-1 neutralizing agent is an anti-PD1 mAb that inhibits the binding of PD-1 to PD-L1. In some embodiments, the PD-1 neutralizing agent is an immunoadhesin (e.g., an immunoadhesin containing an extracellular or PD-1 binding fragment of PD-L1 or PD-L2 attached to a constant region (e.g., the Fc region of an immunoglobulin sequence).

In methods of treatment, the CD39 binding compound and the second therapeutic agent may be administered separately, together, or sequentially, or as a mixture. In some embodiments, the antigen binding compound is administered prior to the administration of the second therapeutic agent. For example, the CD39 binding compound may be administered approximately 0-30 days prior to administration of the second therapeutic agent. In some embodiments, the CD39 binding compound is administered over about 30 minutes to about 2 weeks, from about 30 minutes to about 1 week, from about 1 hour to about 2 hours, from about 2 hours to about 4 hours, from about 4 hours to 6 hours, from about 6 hours to about 8 hours, from about 8 hours to 1 day, or from about 1 to 5 days before administration of the second therapeutic agent. In some embodiments, the CD39 binding compound is administered concurrently with the administration of the therapeutic agents. In some embodiments, the CD39 binding compound is administered after administration of the second therapeutic agent. For example, the CD39 binding compound can be administered approximately 0-30 days after administration of the second therapeutic agent. In some embodiments, the CD39 binding compound is administered over about 30 minutes to about 2 weeks, from about 30 minutes to about 1 week, from about 1 hour to about 2 hours, from about 2 hours to about 4 hours, from about 4 hours to 6 hours, from about 6 hours to about 8 hours, from about 8 hours to 1 day, or from about 1 to 5 days after administration of the second therapeutic agent.

Examples

Ways

Obtaining CD39 mutants

CD39 mutants were obtained by PCR. The amplified sequences were separated on an agarose gel and purified using the Macherey Nagel PCR Clean-Up Gel Extraction kit (accession number 740609). The purified PCR products obtained for each mutant were then ligated into an expression vector using the ClonTech InFusion system. Vectors containing mutated sequences were obtained in mini-preparative quantities and sequenced. After sequencing, vectors containing the mutated sequences were prepared in midi-prep quantities using the Promega Pure Yield™ Plasmid Midiprep System. HEK293T cells were grown in DMEM (Invitrogen), transfected with vectors using Lipofectamine 2000 (Invitrogen) and incubated at 37° C. in a CO2 incubator for 48 hours prior to transgene expression analysis. The mutants were transfected into Hek-293T cells as shown in the table below. The target amino acid mutations in Table 1 below are shown using the numbering according to SEQ ID NO: 1.

Cloning, production and purification of soluble huCD39 Molecular Biology

The huCD39 protein was cloned from human PBMC cDNA using primers TACGACTCACAAGCTTGCCGCCACCATGGAAGATACAAAGGAGTC (SEQ ID NO: 42) (forward) and CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCGACATAGGTGGAGTGGGAGAG (SEQ ID NO: 43) (reverse). The purified PCR product was then cloned into an expression vector using the InFusion cloning system. An M2 marker (FLAG marker underlined in SEQ ID NO: 45) was added to the C-terminal portion of the protein for the purification step; it should be appreciated that the CD39 extracellular domain protein (eg, SEQ ID NO: 45) in any embodiment may optionally not contain the M2 marker.

Expression and purification of the huCD39 protein

After validation of the cloned sequence, CHO cells were subjected to nucleofection and the production pool was subcloned to obtain a clone of cells producing the huCD39 protein. The supernatant of the huCD39 clone grown in the roller bottle was collected and purified using an M2 chromatographic column and eluted with the M2 peptide. The purified proteins were then loaded onto an S200 size exclusion chromatography column. The composition of the purified protein corresponding to the monomer was prepared in TBS buffer pH 7.5. The amino acid sequence of the recombinant CD39-M2 extracellular domain protein without the M2 marker was:

The final amino acid sequence of the recombinant CD39-M2 extracellular domain protein with the M2 marker was:

Inhibition of soluble CD39 enzymatic activity

Inhibition of enzymatic activity of produced soluble CD39 protein by antibodies was assessed using Cell Titer Glo™ (Promega, accession number G7571), which allowed ATP hydrolysis to be assessed using a reagent that generated a luminescent signal proportional to the amount of ATP present. Thus, inhibition of ATP hydrolysis mediated by soluble CD39 can be assessed. Briefly, doses of anti-CD39 antibody ranging from 100 μg/mL to 6×10 ^-3 μg/mL were incubated with 400 ng/mL soluble recombinant human CD39 protein containing the amino acid sequence described in Methods (SEQ ID NO: 45 ), for 1 hour at 37°C. 20 μM ATP was added to the plates for an additional 30 minutes at 37° C. before adding the CTG reagent (Cell Titer Glo). The light emitted was quantified with an Enspire™ Luminometer after a short incubation period of 5 minutes in the dark. The effectiveness of the CD39 antibody was determined by comparing the light emitted in the presence of the antibody with ATP alone (maximum light emission) and ATP together with soluble CD39 protein (minimum light emission).

Inhibition of the enzymatic activity of cellular CD39

Inhibition of CD39 enzymatic activity in CD39-expressing cells by antibodies was assessed using Cell Titer Glo™ (Promega, accession number G7571), which allowed the assessment of ATP hydrolysis with a reagent that generated a luminescent signal proportional to the amount of ATP present. Thus, the assay was designed to evaluate the inhibition of ATP hydrolysis by CD39 in cell culture supernatant. Briefly, 5×10 ⁴ human Ramos lymphoma cells, 5×10 ³ CHO cells expressing human CD39, cynomolgus CD39 and mouse CD39 were incubated for 1 hour at 37°C with anti-CD39 antibodies at a concentration of 30 μg/ml to 5×10 ^-4 µg/ml. Then the cells were incubated with 20 μm ATP for another 1 hour at 37°C. The plates were centrifuged for 2 minutes at 400 g and 50 μl of cell supernatant was transferred to a fluorescent microplate (white wells). 50 μl of CellTiter-Glo® (CTG) reagent was added to the supernatant and the emitted light was quantified after a 5 minute incubation in the dark using an Enspire™ luminometer. The effectiveness of the CD39 antibody was determined by comparing the light emitted in the presence of the antibody with ATP alone (maximum light emission) and ATP together with cells (minimum light emission).

Obtaining Antibodies: Immunization and Screening in Mice

To generate antibodies against human CD39, Balb/c mice were immunized with the recombinant human CD39-M2 extracellular domain protein described above. Mice received one primary immunization with an emulsion of 50 μg of CD39 protein and complete Freund's adjuvant ip, a 2nd immunization with an emulsion of 50 μg of CD39 protein and incomplete Freund's adjuvant ip, and finally a booster immunization with 10 μg of CD39 protein intravenously. Spleen immune cells were fused 3 days after booster immunization with immortalized X63.Ag8.653 B cells and cultured in the presence of irradiated spleen cells. Hybridomas were seeded in a semi-liquid medium containing methylcellulose, growing clones were selected using a clonepix 2 apparatus (Molecular Devices).

Example 1 Epitope mapping of known anti-CD39 neutralizing mAbs.

In order to investigate antibodies capable of inhibiting the enzymatic (ATPase) activity of cellular CD39, the inventors investigated the epitopes bound by antibodies reported to inhibit CD39 ATPase activity in cell assays: BY40 described in PCT Publication No. WO 2009/095478.

To determine the epitopes of antibodies against CD39, the inventors have developed mutants of CD39, defined by amino acid substitutions exposed on the surface of the CD39 molecule. The mutants were transfected into Hek-293T cells as shown in Table 1 using the numbering according to SEQ ID NO: 1.

A series of doses of I-394 (10 - 2.5 - 0.625 - 0.1563 - 0.0391 - 0.0098 - 0.0024 - 0.0006 μg/ml) were tested on 20 obtained mutants using flow cytometry. Both BY40 antibodies showed a complete loss of ability to bind to cells expressing the 5 CD39 mutant, with no loss of ability to bind to any other mutant. Mutant 5 contained amino acid substitutions at residues Q96, N99, E143, and R147. The position of mutant 5 on the surface of CD39 is shown in Figure 3A.

Example 2 Known anti-CD39 neutralizing mAbs are unable to inhibit the ATPase activity of the recombinant soluble CD39 protein.

Two antibodies reported to inhibit the ATPase activity of CD39 in cell assays (BY40 and BY12) were evaluated to determine if they were able to inhibit the ATPase activity of the recombinant soluble CD39 protein. Antibody inhibition of enzymatic activity of soluble CD39 protein prepared as described above was assessed using Cell Titer Glo™ (Promega, accession number G7571). Inhibition of the enzymatic activity of the cellular CD39 protein by antibodies was evaluated as described above.

As expected, BY40 inhibited the ATPase activity of the CD39 protein in cells. However, BY40 could not inhibit the enzymatic activity of soluble CD39 protein. Figure 2B shows a comparison of BY40 with the new antibodies listed herein.

Example 3: Screening for new mAbs to block sCD39 activity

Performed a series of immunizations in order to search for antibodies that neutralize the ATPase activity of sCD39. To obtain antibodies against human CD39, animals were immunized with the recombinant human CD39-M2 extracellular domain protein described above. A total of 15 series of immunizations were performed using different protocols and on different animals. This included various strains of mice, rats and rabbits.

In the original immunization protocols, the primary screen included testing the supernatant (SN) of growing clones by flow cytometry using wild-type and CHO cell lines expressing huCD39. Cells were stained with 0.1 μm and 0.005 μM CFSE, respectively. For screening by flow cytometry, all cells were mixed in the same way, and the presence of reactive antibodies in the supernatants was detected using a goat anti-mouse polyclonal antibody (pAb) labeled with APC. To obtain antibodies that bind huCD39, supernatants were screened for inhibition of soluble CD39 enzymatic activity using the screening assay developed and described above ("Methods").

The results showed that although a variety of specific C039-binding antibodies could be generated, none of the antibodies in any of the immunizations showed inhibition of soluble CD39 enzymatic activity. One possible reason for this is that the major CD39 epitopes do not include an epitope located at or near the CD39 catalytic site. Due to the small number of available antibodies that inhibit cellular CD39, and the known difficulty in inhibiting enzyme catalytic sites using antibodies, the absence of antibodies that neutralize sCD39 may indicate the impossibility of obtaining antibodies that inhibit soluble (extracellular domain) CD39. Other possible causes are related to non-functional screening assays and/or improper folding or functioning of soluble CD39 protein; in particular, the absence of an antibody capable of inhibiting soluble CD39 makes validation of the sCD39 blockade assay difficult.

Due to the lack of antibodies capable of inhibiting soluble CD39, an additional immunization was performed using a screening protocol designed to generate antibodies that bind the active center of CD39, detected by the epitope of the BY40 antibody. Briefly, the primary screening involved testing the supernatant (SN) of growing clones by flow cytometry using wild-type CHO and CHO cell lines expressing huCD39 as in previous immunizations, followed by screening for loss of binding ability of Hek-293T cells expressing the mutant 5 CD39 versus wild-type CD39 as shown in Table 1. Mutant 5 contained amino acid substitutions at residues Q96, N99, E143 and R147. However, the results again showed that while it was possible to generate many specific CD39-binding antibodies that showed loss of ability to bind to mutant 5, none of the antibodies in any of the initial immunizations showed inhibition of soluble CD39 enzymatic activity.

Example 4 Detection of the first antibody that inhibits sCD39 activity in an epitope-specific screen.

The inventors sought to identify anti-CD39 antibodies that do not bind to the Q96, N99, E143 and R147 region (determined using mutant 5) in order to obtain antibodies that do not compete with antibodies like BY40. Such antibodies, which should not be able to block the ATPase activity of CD39, can be used for pharmacological studies of antibodies that inhibit cellular CD39 binding to the BY40 binding site, for example, to detect and quantify free CD39 protein on cells in the presence of BY40 or BY40-noflo6Hbix antibodies. that inhibit cellular CD39.

Starting with the immunization results described in Example 3, where hybridomas were screened for loss of binding to CD39 mutant 5, a hybridoma was selected that was absent from those that showed loss of binding to CD39 mutant 5. This hybridoma (I-394) was among the expanded pool, possibly due to partial weakening of binding to mutant 5, but did not lose the ability to bind to mutant 5 and therefore was not initially taken into account.

In the context of the ongoing screening of supernatants after further vaccinations for inhibition of soluble CD39 enzymatic activity, the cloned and produced I-394 antibody was included in the screening as a control. Surprisingly, although the I-394 antibody was not among the clones retained during the epitope-specific screening, this antibody showed strong inhibition of soluble CD39 enzymatic activity in the assay described above ("Methods").

I-394 was produced with a modification that included mutations L234A/L235E/G237A/A330S/P331S (EC numbering according to Kabat) in human constant regions with the Fc domain of lgG1, resulting in the absence of N-linked glycosylation and the absence of binding to CD16A Fcγ receptors. , CD16B, CD32A, CD32B and CD64 human. Briefly, the VH and Vk sequences of antibody I-394 (VH and Vk variable regions shown in SEQ ID NOs 6 and 7, respectively) were cloned into expression vectors containing the hulgG1 constant domains carrying the above mutations and the huCk constant domain, respectively. The two resulting vectors were co-transfected into CHO cells. The created pool of cells was used for antibody production in CHO medium. The antibody was then purified using Protein A. The amino acid sequences of the respective I-394 heavy and light chains are shown below (Kabat CDRs underlined).

The I-394 antibody was then tested for loss of ability to bind to CD39 mutants as determined by amino acid substitutions exposed on the surface of the CD39 molecule. The mutants were transfected into Hek-293T cells as shown in Table 1 using the numbering according to SEQ ID NO: 1. A range of I-394 antibody doses were tested on 20 mutants by flow cytometry. As shown in Figure 3B, I-394 showed complete loss of binding to cells expressing the 19 CD39 mutant. Mutant 19 included substitutions at residues R138, M139 and E142. Thus, the main epitope of I-394 included one or more (or all) of the residues R138, M139 and E142.

Unlike the predecessor antibody BY40, which lost its ability to bind to mutant 5 and had the ability to inhibit cellular CD39 but not soluble CD39, antibody I-394 lost its ability to bind to neighboring mutant 19 along with greatly reduced binding to mutant 5 (however, some residual binding to mutant 5 was maintained). Interestingly, mutant 19 residues were in close proximity or adjacent to mutant 5 residues, so I-394 may represent an epitope shift from BY40. Thus, the I-394 antibody made it possible to identify a new valuable epitope for antibodies against CD39, which made it possible to inhibit the ATPase activity of the soluble CD39 protein. It also provided a specific positive control that allowed validation and testing of screening assays to detect additional antibodies neutralizing the ATPase activity of soluble CD39 protein.

Example 5: Epitope-non-specific screening for sCD39 neutralizing mAbs

Based on the results obtained for Example 4 showing the possibility of antibody-mediated inhibition of soluble CD39, fusion cells obtained from different immunizations using different protocols in Example 3 were reviewed to look for antibodies neutralizing the ATPase activity of sCD39.

Next, different approaches to screening for ATPase inhibition were evaluated. In one experiment, antibody I-394 was used to enrich the supernatants of hybridomas obtained from immunization in Example 3, which were found to be negative for the ability to inhibit the ATPase activity of soluble CD39. This addition of I-394 to the supernatant did not restore the ability of negative supernatants to inhibit CD39 ATPase activity. The I-394 antibody was then purified from the negative supernatant using protein A coated beads and recovery of the ability of the purified I-394 to inhibit ATPase activity was observed.

Based on the above results, new immunization and screening protocols were developed in which growing clones from new and past immunizations were screened by flow cytometry using wild-type and CHO cell lines expressing huCD39 without assessing inhibition of soluble ATPase activity. CD39 or cellular CD39 and no epitope bias screening. Although some hybridomas were reported to have lost their ability to bind to mutant 5 or 19, these data were not used for clone selection, but were retained only to save hybridomas for cloning in the event of negative results in the ATPase blocking assay. CD39-binding hybridomas were selected and cloned and then purified using protein A according to the following protocol:

- Add to 300 µl of hybridoma supernatant 10 µl of protein A beads

- Add NaCl to a final concentration of 1.5 M

- Shake the tubes for 3-4 hours at 4°C

- Centrifuge for 1 min at 1500 rpm

- Remove the supernatant and wash three times with 1 ml TBS

- Remove all TBS after third wash

- Add 50 µl 0.1 M citrate, pH3, homogenize and incubate at room temperature for 5 min

- Centrifuge the pellet for 1 minute at 1500 rpm.

- Collect 50 µl of eluate, quickly add 450 µl of TBS and store at 4°C.

Then, the obtained antibodies were then screened in a comparative analysis of the ability to inhibit the ATPase activity of CD39 to the same extent as I-394. The assays described above ("Methods") were used to inhibit soluble and cellular CD39 enzymatic activity. Surprisingly, some of the exemplary antibodies produced in this manner have shown inhibition of soluble CD39 (as well as inhibition of cellular CD39). Figure 1 shows a typical screening result showing antibodies I-397, I-398 and I-399 compared to a positive control - antibody I-394. Similarly, antibodies I-395 and I-396, obtained from various immunizations, inhibited the enzymatic activity of soluble CD39 protein. Figures 2A and 2B show the results for antibodies I-395 and I-396, for which there was more antibody for additional experiments to assess the neutralization of both soluble and cellular CD39. Figure 2A shows that antibodies I-395 and I-396 inhibited cell membrane-bound CD39 compared to antibodies BY40 and I-394, with both I-394 and I-395 showing increased activity and maximal inhibition of cell membrane CD39 versus BY40. Figure 2B shows that antibodies I-395 and I-396 inhibited soluble CD39 compared to antibodies BY40 and I-394. Although BY40 did not inhibit soluble CD39 at any concentration, I-394, I-395, and I-396 all inhibited soluble CD39, with I-394 showing the highest activity, followed by I-395, and then I-396, which had less activity. .

The results indicate the possibility that some factors in the hybridoma supernatants rapidly hydrolyzed ATP both in cell culture and in the analysis of soluble CD39 such that the ATP signal was not detected by antibody screening using conventional methods. This soluble factor may be CD39 or some other enzyme, such as that produced by a fusion partner.

The antibodies were then cloned with a modification that included mutations L234A/L235E/G237A/A330S/P331S (EC numbering according to Kabat) in human constant regions with the lgG1 Fc domain, resulting in the absence of N-linked glycosylation and the absence of binding to the Fcγ receptors of CD16A, Human CD16B, CD32A, CD32B and CD64, as shown herein for I-394. The resulting antibodies could then be titrated and further assessed for activity as shown in Examples 7-9 (titration, inhibition of ATPase activity) to determine the EC ₅₀ and IC ₅₀ and rank the antibodies according to their activity.

Example 6 Epitope mapping of sCD39 neutralizing mAbs.

As shown in Example 4, I-394 showed a complete loss of ability to bind to cells expressing CD39 mutant 19, but did not lose the ability to bind to mutant 5. To determine the epitopes of additional anti-CD39 antibodies from Example 5, they were tested for loss of ability to binding to the panel of CD39 mutants described in Example 1 and Table 1. Mutants were transfected into Hek-293T cells as shown in Table 1 using SEQ ID NO: 1 numbering. 0.625 - 0.1563 - 0.0391 - 0.0098 - 0.0024 - 0.0006 μg/ml) were tested on 20 obtained mutants by flow cytometry.

The results showed that the antibodies selected in Example 5 for their ability to inhibit soluble CD39 represented several different epitopes. Among the antibodies showing inhibition of soluble extracellular CD39 in Example 5, antibody I-395 was an example of an antibody showing loss of ability to bind to mutant 5 containing substitutions at residues Q96, N99, E143 and R147, as well as loss of ability to bind to mutant 19 containing substitutions at the residues R138, M139 and E142. Mutant 19 contained substitutions at residues Q96, R138, M139, and E142. Thus, the main CD39 epitope for I-395 contained one, two, three, or four residues Q96, N99, E143, and R147, and one, two, or three residues R138, M139, and E142.

On the other hand, antibody I-398 was an example of an antibody that showed a loss of ability to bind to mutant 19 containing substitutions at residues R138, M139 and E142, but was not characterized by a decrease or loss of ability to bind to mutant 5 containing substitutions at residues Q96 N99 , E143 and R147.

The other antibodies that showed inhibition of soluble extracellular CD39 in Example 5 had very different epitopes and showed no loss of binding to either mutant 5 or 19, indicating that soluble CD39 could be inhibited by binding to other sites on sCD39. For some antibodies, the loss of binding to one of the 20 mutants from Table 1 allowed the binding site to be located on CD39, while for others, the binding site has yet to be determined, as they did not lose the ability to bind to any of the 20 mutants. Among the antibodies that showed inhibition of soluble CD39 ATPase activity in Example 5, antibody I-396 showed a loss of ability to bind to mutant 15 containing substitutions K87A, E100A and D107A without loss of ability to bind to any of the other 20 mutants. Thus, the main epitope of this antibody on CD39 contained one or more (or all) of residues K87, E100 and D107. Antibody I-399 showed loss of ability to bind to mutant 11 containing the substitutions N371K, L372K, E375A, K376G, V377A and a valine insert between K376 and V377 (referred to in Table 1 as “377V insert”) without loss of ability to bind to any of 20 other mutants. Thus, the main epitope of this antibody on CD39 contained one or more (or all) of residues N371, L372, E375, K376 and V377. Figure 3A shows the position of residues mutated in mutants 5 (M5), 15 (M15) and 19 (M19) on the surface of the CD39 protein. Figure 3B shows the binding results of various antibodies to mutants 5, 15 and 19.

Thus, the results show the possibility of obtaining antibodies that inhibit soluble CD39 against various epitopes. These epitopes include epitopes defined by one or more of the residues of mutant 19 located near the binding site of BY40 or BY40-like antibodies inhibiting only cellular CD39 but not soluble CD39 (which lose the ability to bind to mutant 5), epitopes defined by at one or more of the residues of mutant 19, and also partially of mutant 5, indicating a possible slight shift compared to BY40 or BY40-like antibodies, epitopes determined by one or more of the residues of mutant 19, but not the residues of mutant 5, and also other epitopes, e.g., determined by one or more of the residues of mutant 11 or one or more of the residues of mutant 15, or epitopes of other additional antibodies not characterized by reduced binding to any of the mutants 5, 15 or 19, the localization of which is yet to be determined.

Example 7 Antibody Titration on CD39 Expressing Cells by Flow Cytometry.

Antibody I-394 was tested in two replicates for binding to CHO cells expressing human CD39, CHO cells expressing cynomolgus monkey (macaca flavicularis) CD39, CHO cells expressing mouse CD39, and human Ramos lymphoma cells (ATCC™, accession no. CRL-1596). Cells were incubated with various concentrations of unlabeled anti-CD39 antibody ranging from 30 μg/ml to 5×10 ^-4 μg/ml for 30 minutes at 4°C. After washing, cells were incubated with labeled goat anti-mouse H+L secondary antibody for 30 minutes at 4°C.

The results are shown in Figure 4. Antibody I-394 bound to cells expressing human CD39 (CHO-huCD39), cells expressing cynomolgus monkey CD39 (CHO-cyCD39), and Ramos lymphoma cells, but not cells expressing mouse CD39 ( CHO-moCD39). I-394 bound to Ramos cells with EC ₅₀ values of 0.16 μg/ml and 0.19 μg/ml in the first and second series of experiments. Several other anti-CD39 antibodies showed comparable EC ₅₀ values for binding to Ramos cells.

Example 8 Determination of IC50 for inhibition of cellular ATPase activity.

Antibody I-394 inhibition of CD39 ATPase activity in CD39 expressing cells was assessed using an assay used to inhibit cellular CD39 enzymatic activity as described above ("Methods").

The results are shown in Figure 5. I-394 had a high ability to block CD39 enzymatic activity in tumor cells (Ramos) and had increased activity compared to all other antibodies tested. I-394 also blocked CD39 enzymatic activity in cells expressing human CD39 (CHO-huCD39) and cells expressing cynomolgus monkey CD39 (CHO-cyCD39). Cells expressing mouse CD39 (CHO-moCD39) are shown as a negative control. The calculated IC ₅₀ (50% inhibition of CD39 enzyme activity expressed by 50,000 Ramos cells) was 0.05 μg/ml. The maximum inhibition achieved was 81.6%. Isotype control had no effect.

Example 9 Determination of IC50 to Inhibit ATPase Activity of Recombinant Soluble CD39 Protein.

Antibody I-394 inhibition of the ATPase activity of soluble CD39 protein was assessed using assays used to inhibit soluble CD39 enzymatic activity described above ("Methods"). The results are shown in Figure 6. I-394 inhibited the enzymatic activity of soluble CD39 protein. The comparative BY40 antibody did not inhibit the enzymatic activity of the soluble CD39 protein. The calculated IC ₅₀ was 0.003 μg/ml. The maximum inhibition achieved was 74.9%.

Example 10. Titration of solid-phase ELISA on CD39-L1, L2, L3, L4 isoforms.

Antibody I-394 was tested for binding to recombinant human CD39 isoforms (Rec-huCD39 isoforms); isoforms containing the amino acid sequences shown below were immobilized in a 96-well plate in PBS 1X at a concentration of 500 ng/ml or 1 μg/ml at 4° C. overnight. The wells were washed with Tween-20 TBS and further saturated for 2 hours at room temperature in TBS blocking buffer. The concentration of the primary antibody in the dose range was incubated in TBS blocking buffer for 2 hours at room temperature. The wells were washed with TBS tween-20. The secondary antibody (GAM-HRP or GAH-HRP in TBS blocking buffer) was incubated for 1 hour at room temperature and developed with TMB. Optical density was measured on Enspire™ at OD=450.

Amino acid sequence of cloned huCD39 (vascular isoform): human CD39-L1, also known as NTPDase-2 or ENTPD2:

Human CD39-L2, also known as NTPDase-6 or ENTPD6:

Human CD39-L3, also known as NTPDase-3 or ENTPD3:

Human CD39-L4, also known as NTPDase-5 or ENTPD5:

I-394 binds to CD39 but not to any of the CD39-L1, -L2, -L3 or -L4 isoforms. Isotype control (IC) antibodies did not bind to any of the CD39 or CD39-L molecules. The results are shown in Figure 7.

Example 11 Dendritic Cell Activation

Although ATP has a pro-inflammatory effect, it is believed that CD39-mediated ATP catabolism is able to impair dendritic cell (DC) activation, which in turn affects an enhanced adaptive immune response against tumor antigen. To assess the ability of CD39 blockade using an anti-CD39 antibody to overcome a CD39-mediated change in dendritic cell (DC) activation in the presence of ATP, we incubated monocyte-derived DCs (moDCs) with anti-CD39 antibodies in the presence of ATP.

Briefly, human monocytes were purified from healthy human blood and differentiated into MoDC in the presence of GMCSF and IL-4 for 6 days. MoDC was then activated in the presence of ATP (Sigma, 0.25-1 mM) for 24 hours, DC activation was assessed by analysis of CD80, CD83 and HLA-DR expression by flow cytometry. In some cases, MoDCs were pre-incubated for 1 hour in the presence of CD39 inhibitor: ARL6716 (Tocris, 250 μM), CD73 inhibitor: APCP (Tocris, 50 μM), anti-CD39 blocking antibody I-394 or BY40 (for BY40 see WO 2009 /095478), or a blocking antibody against CD73. LPS (Invivogen, 10 ng/ml) was used as a positive control. To assess the net effect of ATP-mediated DC activation on CD4 T cell activation, ATP-activated DCs were washed and then incubated with allogeneic CD4 T cells (at a ratio of 1 MoDC/4 T cells) to evaluate the mixed lymphocyte response (MLR) in within 5 days. T cell activation and proliferation was analyzed by CD25 expression and dilution with Cell Trace Violet by flow cytometry (Figure 8).

The results are shown in Figures 9, 10 and 11. In the presence of a negative control (medium), activation of moDC was observed in the presence of 1 mM ATP, however ATP at 0.125 mM, 0.25 mM or 0.5 mM did not allow activation of moDC. The addition of chemical inhibitors of CD39, which are believed to completely block CD39 enzymatic activity by binding to the active site, resulted in the activation of moDC at each concentration of 0.125 mM, 0.25 mM, or 0.5 mM. At the same time, anti-CD39 antibodies, such as BY40, or anti-CD73 antibodies were not able to stimulate ATP-induced activation of dendritic cells (DC), indicating the inability of these antibodies to block enzymatic activity sufficiently to eliminate ATP catabolism. Surprisingly, the anti-CD39 blocking antibody I-394 (shown in the figures at 10 μg/mL), essentially completely blocking CD39 ATPase activity and therefore capable of conferring ATP accumulation, allowed moDC activation as assessed by HLA-DR expression or CD83 at each concentration of 0.125 mM, 0.25 mM, or 0.5 mM (Figures 9 and 10). Interestingly, MoDCs activated in the presence of ATP are able to induce improved T cell activation and proliferation in the MLR assay. In addition, enhancement of ATP-mediated MoDC activation with the anti-CD39 blocking antibody I-394 resulted in enhanced T cell proliferation and activation (Figure 11).

Assessing the ability of CD39 inhibitors to activate DC in the presence of ATP provides a way to detect and evaluate anti-CD39 antibodies capable of achieving a high degree of CD39 inhibition.

The possibility of using anti-CD39 antibodies to attenuate the immunosuppressive effect exerted by CD39 on DCs may provide an enhancement of the adaptive immune response to antigens, especially to tumor cells. In addition, such CD39 antibodies may be of particular interest when used to enhance the immunogenic effects of chemotherapeutic agents. Numerous chemotherapeutic agents that cause tumor cell necrosis are able to induce ATP; their combined use with anti-CD39 antibodies may be particularly useful in enhancing the antitumor response under these conditions.

All sources, including publications, patent applications, and patents, cited herein are incorporated herein by reference in their entirety and to the same extent as if the inclusion of each source by reference were separately and expressly set forth in their entirety. herein (to the maximum extent permitted by law), notwithstanding any express inclusion of specific documents made elsewhere in this document.

The use of the singular and similar references is to be construed as inclusive of both the singular and the plural, unless otherwise specified herein or clearly inconsistent with the context.

Unless otherwise noted, all exact values given herein represent their respective approximate values (for example, all exact approximate values given for a particular parameter or measurement may be considered to also include the corresponding approximate measurement, modified where appropriate by the addition of the word "approximately").

The description in this document of any aspect or implementation variant, using terms such as "comprising", "having", or "comprising" with reference to a specific element or elements, is intended to provide support for a similar aspect or implementation variant in this document that " consists of", "essentially consists of", or "essentially contains" that particular element or elements, unless otherwise specified herein or contrary to the context explicitly (for example, it should be understood that the composition described herein as containing a particular element also describes a composition consisting of that element, unless otherwise specified herein or in conflict with the context explicitly).

The use of all possible examples or language indicating specific examples (for example, "such as") in this document is intended solely to better illuminate the invention and does not impose a limitation on the essence of the invention, unless otherwise indicated in the claims. No wording in the description of the invention should be construed as indicating any element not included in the claims, essential for the practical implementation of the invention.

--->

Sequence listing

<110> INNEIT PHARMA

<120> COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCER

<130>CD39-6

<150> US 62/471,994

<151> 2017-03-16

<150> US 62/586,220

<151> 2017-11-15

<160> 45

<170> PatentIn version 3.5

<210> 1

<211> 510

<212> PROTEIN

<213> HOMO SAPIENS

<400> 1

Met Glu Asp Thr Lys Glu Ser Asn Val Lys Thr Phe Cys Ser Lys Asn

1 5 10 15

Ile Leu Ala Ile Leu Gly Phe Ser Ser Ile Ile Ala Val Ile Ala Leu

20 25 30

Leu Ala Val Gly Leu Thr Gln Asn Lys Ala Leu Pro Glu Asn Val Lys

35 40 45

Tyr Gly Ile Val Leu Asp Ala Gly Ser Ser His Thr Ser Leu Tyr Ile

50 55 60

Tyr Lys Trp Pro Ala Glu Lys Glu Asn Asp Thr Gly Val Val His Gln

65 70 75 80

Val Glu Glu Cys Arg Val Lys Gly Pro Gly Ile Ser Lys Phe Val Gln

85 90 95

Lys Val Asn Glu Ile Gly Ile Tyr Leu Thr Asp Cys Met Glu Arg Ala

100 105 110

Arg Glu Val Ile Pro Arg Ser Gln His Gln Glu Thr Pro Val Tyr Leu

115 120 125

Gly Ala Thr Ala Gly Met Arg Leu Leu Arg Met Glu Ser Glu Glu Leu

130 135 140

Ala Asp Arg Val Leu Asp Val Val Glu Arg Ser Leu Ser Asn Tyr Pro

145 150 155 160

Phe Asp Phe Gln Gly Ala Arg Ile Ile Thr Gly Gln Glu Glu Gly Ala

165 170 175

Tyr Gly Trp Ile Thr Ile Asn Tyr Leu Leu Gly Lys Phe Ser Gln Lys

180 185 190

Thr Arg Trp Phe Ser Ile Val Pro Tyr Glu Thr Asn Asn Gln Glu Thr

195 200 205

Phe Gly Ala Leu Asp Leu Gly Gly Ala Ser Thr Gln Val Thr Phe Val

210 215 220

Pro Gln Asn Gln Thr Ile Glu Ser Pro Asp Asn Ala Leu Gln Phe Arg

225 230 235 240

Leu Tyr Gly Lys Asp Tyr Asn Val Tyr Thr His Ser Phe Leu Cys Tyr

245 250 255

Gly Lys Asp Gln Ala Leu Trp Gln Lys Leu Ala Lys Asp Ile Gln Val

260 265 270

Ala Ser Asn Glu Ile Leu Arg Asp Pro Cys Phe His Pro Gly Tyr Lys

275 280 285

Lys Val Val Asn Val Ser Asp Leu Tyr Lys Thr Pro Cys Thr Lys Arg

290 295 300

Phe Glu Met Thr Leu Pro Phe Gln Gln Phe Glu Ile Gln Gly Ile Gly

305 310 315 320

Asn Tyr Gln Gln Cys His Gln Ser Ile Leu Glu Leu Phe Asn Thr Ser

325 330 335

Tyr Cys Pro Tyr Ser Gln Cys Ala Phe Asn Gly Ile Phe Leu Pro Pro

340 345 350

Leu Gln Gly Asp Phe Gly Ala Phe Ser Ala Phe Tyr Phe Val Met Lys

355 360 365

Phe Leu Asn Leu Thr Ser Glu Lys Val Ser Gln Glu Lys Val Thr Glu

370 375 380

Met Met Lys Lys Phe Cys Ala Gln Pro Trp Glu Glu Ile Lys Thr Ser

385 390 395 400

Tyr Ala Gly Val Lys Glu Lys Tyr Leu Ser Glu Tyr Cys Phe Ser Gly

405 410 415

Thr Tyr Ile Leu Ser Leu Leu Leu Gln Gly Tyr His Phe Thr Ala Asp

420 425 430

Ser Trp Glu His Ile His Phe Ile Gly Lys Ile Gln Gly Ser Asp Ala

435 440 445

Gly Trp Thr Leu Gly Tyr Met Leu Asn Leu Thr Asn Met Ile Pro Ala

450 455 460

Glu Gln Pro Leu Ser Thr Pro Leu Ser His Ser Thr Tyr Val Phe Leu

465 470 475 480

Met Val Leu Phe Ser Leu Val Leu Phe Thr Val Ala Ile Ile Gly Leu

485 490 495

Leu Ile Phe His Lys Pro Ser Tyr Phe Trp Lys Asp Met Val

500 505 510

<210> 2

<211> 472

<212> PROTEIN

<213> HOMO SAPIENS

<400> 2

Met Ala Gly Lys Val Arg Ser Leu Leu Pro Pro Leu Leu Leu Ala Ala

1 5 10 15

Ala Gly Leu Ala Gly Leu Leu Leu Leu Cys Val Pro Thr Arg Asp Val

20 25 30

Arg Glu Pro Pro Ala Leu Lys Tyr Gly Ile Val Leu Asp Ala Gly Ser

35 40 45

Ser His Thr Ser Met Phe Ile Tyr Lys Trp Pro Ala Asp Lys Glu Asn

50 55 60

Asp Thr Gly Ile Val Gly Gln His Ser Ser Cys Asp Val Pro Gly Gly

65 70 75 80

Gly Ile Ser Ser Tyr Ala Asp Asn Pro Ser Gly Ala Ser Gln Ser Leu

85 90 95

Val Gly Cys Leu Glu Gln Ala Leu Gln Asp Val Pro Lys Glu Arg His

100 105 110

Ala Gly Thr Pro Leu Tyr Leu Gly Ala Thr Ala Gly Met Arg Leu Leu

115 120 125

Asn Leu Thr Asn Pro Glu Ala Ser Thr Ser Val Leu Met Ala Val Thr

130 135 140

His Thr Leu Thr Gln Tyr Pro Phe Asp Phe Arg Gly Ala Arg Ile Leu

145 150 155 160

Ser Gly Gln Glu Glu Gly Val Phe Gly Trp Val Thr Ala Asn Tyr Leu

165 170 175

Leu Glu Asn Phe Ile Lys Tyr Gly Trp Val Gly Arg Trp Phe Arg Pro

180 185 190

Arg Lys Gly Thr Leu Gly Ala Met Asp Leu Gly Gly Ala Ser Thr Gln

195 200 205

Ile Thr Phe Glu Thr Thr Ser Pro Ala Glu Asp Arg Ala Ser Glu Val

210 215 220

Gln Leu His Leu Tyr Gly Gln His Tyr Arg Val Tyr Thr His Ser Phe

225 230 235 240

Leu Cys Tyr Gly Arg Asp Gln Val Leu Gln Arg Leu Leu Ala Ser Ala

245 250 255

Leu Gln Thr His Gly Phe His Pro Cys Trp Pro Arg Gly Phe Ser Thr

260 265 270

Gln Val Leu Leu Gly Asp Val Tyr Gln Ser Pro Cys Thr Met Ala Gln

275 280 285

Arg Pro Gln Asn Phe Asn Ser Ser Ala Arg Val Ser Leu Ser Gly Ser

290 295 300

Ser Asp Pro His Leu Cys Arg Asp Leu Val Ser Gly Leu Phe Ser Phe

305 310 315 320

Ser Ser Cys Pro Phe Ser Arg Cys Ser Phe Asn Gly Val Phe Gln Pro

325 330 335

Pro Val Ala Gly Asn Phe Val Ala Phe Ser Ala Phe Phe Tyr Thr Val

340 345 350

Asp Phe Leu Arg Thr Ser Met Gly Leu Pro Val Ala Thr Leu Gln Gln

355 360 365

Leu Glu Ala Ala Ala Val Asn Val Cys Asn Gln Thr Trp Ala Gln Gln

370 375 380

Leu Leu Ser Arg Gly Tyr Gly Phe Asp Glu Arg Ala Phe Gly Gly Val

385 390 395 400

Ile Phe Gln Lys Lys Ala Ala Asp Thr Ala Val Gly Trp Ala Leu Gly

405 410 415

Tyr Met Leu Asn Leu Thr Asn Leu Ile Pro Ala Asp Pro Pro Gly Leu

420 425 430

Arg Lys Gly Thr Asp Phe Ser Ser Trp Val Val Leu Leu Leu Leu Phe

435 440 445

Ala Ser Ala Leu Leu Ala Ala Leu Val Leu Leu Leu Arg Gln Val His

450 455 460

Ser Ala Lys Leu Pro Ser Thr Ile

465 470

<210> 3

<211> 484

<212> PROTEIN

<213> HOMO SAPIENS

<400> 3

Met Lys Lys Gly Ile Arg Tyr Glu Thr Ser Arg Lys Thr Ser Tyr Ile

1 5 10 15

Phe Gln Gln Pro Gln His Gly Pro Trp Gln Thr Arg Met Arg Lys Ile

20 25 30

Ser Asn His Gly Ser Leu Arg Val Ala Lys Val Ala Tyr Pro Leu Gly

35 40 45

Leu Cys Val Gly Val Phe Ile Tyr Val Ala Tyr Ile Lys Trp His Arg

50 55 60

Ala Thr Ala Thr Gln Ala Phe Phe Ser Ile Thr Arg Ala Ala Pro Gly

65 70 75 80

Ala Arg Trp Gly Gln Gln Ala His Ser Pro Leu Gly Thr Ala Ala Asp

85 90 95

Gly His Glu Val Phe Tyr Gly Ile Met Phe Asp Ala Gly Ser Thr Gly

100 105 110

Thr Arg Val His Val Phe Gln Phe Thr Arg Pro Pro Arg Glu Thr Pro

115 120 125

Thr Leu Thr His Glu Thr Phe Lys Ala Leu Lys Pro Gly Leu Ser Ala

130 135 140

Tyr Ala Asp Asp Val Glu Lys Ser Ala Gln Gly Ile Arg Glu Leu Leu

145 150 155 160

Asp Val Ala Lys Gln Asp Ile Pro Phe Asp Phe Trp Lys Ala Thr Pro

165 170 175

Leu Val Leu Lys Ala Thr Ala Gly Leu Arg Leu Leu Pro Gly Glu Lys

180 185 190

Ala Gln Lys Leu Leu Gln Lys Val Lys Glu Val Phe Lys Ala Ser Pro

195 200 205

Phe Leu Val Gly Asp Asp Cys Val Ser Ile Met Asn Gly Thr Asp Glu

210 215 220

Gly Val Ser Ala Trp Ile Thr Ile Asn Phe Leu Thr Gly Ser Leu Lys

225 230 235 240

Thr Pro Gly Gly Ser Ser Val Gly Met Leu Asp Leu Gly Gly Gly Ser

245 250 255

Thr Gln Ile Ala Phe Leu Pro Arg Val Glu Gly Thr Leu Gln Ala Ser

260 265 270

Pro Pro Gly Tyr Leu Thr Ala Leu Arg Met Phe Asn Arg Thr Tyr Lys

275 280 285

Leu Tyr Ser Tyr Ser Tyr Leu Gly Leu Gly Leu Met Ser Ala Arg Leu

290 295 300

Ala Ile Leu Gly Gly Val Glu Gly Gln Pro Ala Lys Asp Gly Lys Glu

305 310 315 320

Leu Val Ser Pro Cys Leu Ser Pro Ser Phe Lys Gly Glu Trp Glu His

325 330 335

Ala Glu Val Thr Tyr Arg Val Ser Gly Gln Lys Ala Ala Ala Ser Leu

340 345 350

His Glu Leu Cys Ala Ala Arg Val Ser Glu Val Leu Gln Asn Arg Val

355 360 365

His Arg Thr Glu Glu Val Lys His Val Asp Phe Tyr Ala Phe Ser Tyr

370 375 380

Tyr Tyr Asp Leu Ala Ala Gly Val Gly Leu Ile Asp Ala Glu Lys Gly

385 390 395 400

Gly Ser Leu Val Val Gly Asp Phe Glu Ile Ala Ala Lys Tyr Val Cys

405 410 415

Arg Thr Leu Glu Thr Gln Pro Gln Ser Ser Pro Phe Ser Cys Met Asp

420 425 430

Leu Thr Tyr Val Ser Leu Leu Leu Gln Glu Phe Gly Phe Pro Arg Ser

435 440 445

Lys Val Leu Lys Leu Thr Arg Lys Ile Asp Asn Val Glu Thr Ser Trp

450 455 460

Ala Leu Gly Ala Ile Phe His Tyr Ile Asp Ser Leu Asn Arg Gln Lys

465 470 475 480

Ser Pro Ala Ser

<210> 4

<211> 529

<212> PROTEIN

<213> HOMO SAPIENS

<400> 4

Met Phe Thr Val Leu Thr Arg Gln Pro Cys Glu Gln Ala Gly Leu Lys

1 5 10 15

Ala Leu Tyr Arg Thr Pro Thr Ile Ile Ala Leu Val Val Leu Leu Val

20 25 30

Ser Ile Val Val Leu Val Ser Ile Thr Val Ile Gln Ile His Lys Gln

35 40 45

Glu Val Leu Pro Pro Gly Leu Lys Tyr Gly Ile Val Leu Asp Ala Gly

50 55 60

Ser Ser Arg Thr Thr Val Tyr Val Tyr Gln Trp Pro Ala Glu Lys Glu

65 70 75 80

Asn Asn Thr Gly Val Val Ser Gln Thr Phe Lys Cys Ser Val Lys Gly

85 90 95

Ser Gly Ile Ser Ser Tyr Gly Asn Asn Pro Gln Asp Val Pro Arg Ala

100 105 110

Phe Glu Glu Cys Met Gln Lys Val Lys Gly Gln Val Pro Ser His Leu

115 120 125

His Gly Ser Thr Pro Ile His Leu Gly Ala Thr Ala Gly Met Arg Leu

130 135 140

Leu Arg Leu Gln Asn Glu Thr Ala Ala Asn Glu Val Leu Glu Ser Ile

145 150 155 160

Gln Ser Tyr Phe Lys Ser Gln Pro Phe Asp Phe Arg Gly Ala Gln Ile

165 170 175

Ile Ser Gly Gln Glu Glu Gly Val Tyr Gly Trp Ile Thr Ala Asn Tyr

180 185 190

Leu Met Gly Asn Phe Leu Glu Lys Asn Leu Trp His Met Trp Val His

195 200 205

Pro His Gly Val Glu Thr Thr Gly Ala Leu Asp Leu Gly Gly Ala Ser

210 215 220

Thr Gln Ile Ser Phe Val Ala Gly Glu Lys Met Asp Leu Asn Thr Ser

225 230 235 240

Asp Ile Met Gln Val Ser Leu Tyr Gly Tyr Val Tyr Thr Leu Tyr Thr

245 250 255

His Ser Phe Gln Cys Tyr Gly Arg Asn Glu Ala Glu Lys Lys Phe Leu

260 265 270

Ala Met Leu Leu Gln Asn Ser Pro Thr Lys Asn His Leu Thr Asn Pro

275 280 285

Cys Tyr Pro Arg Asp Tyr Ser Ile Ser Phe Thr Met Gly His Val Phe

290 295 300

Asp Ser Leu Cys Thr Val Asp Gln Arg Pro Glu Ser Tyr Asn Pro Asn

305 310 315 320

Asp Val Ile Thr Phe Glu Gly Thr Gly Asp Pro Ser Leu Cys Lys Glu

325 330 335

Lys Val Ala Ser Ile Phe Asp Phe Lys Ala Cys His Asp Gln Glu Thr

340 345 350

Cys Ser Phe Asp Gly Val Tyr Gln Pro Lys Ile Lys Gly Pro Phe Val

355 360 365

Ala Phe Ala Gly Phe Tyr Tyr Thr Ala Ser Ala Leu Asn Leu Ser Gly

370 375 380

Ser Phe Ser Leu Asp Thr Phe Asn Ser Ser Thr Trp Asn Phe Cys Ser

385 390 395 400

Gln Asn Trp Ser Gln Leu Pro Leu Leu Leu Pro Lys Phe Asp Glu Val

405 410 415

Tyr Ala Arg Ser Tyr Cys Phe Ser Ala Asn Tyr Ile Tyr His Leu Phe

420 425 430

Val Asn Gly Tyr Lys Phe Thr Glu Glu Thr Trp Pro Gln Ile His Phe

435 440 445

Glu Lys Glu Val Gly Asn Ser Ser Ile Ala Trp Ser Leu Gly Tyr Met

450 455 460

Leu Ser Leu Thr Asn Gln Ile Pro Ala Glu Ser Pro Leu Ile Arg Leu

465 470 475 480

Pro Ile Glu Pro Pro Val Phe Val Gly Thr Leu Ala Phe Phe Thr Ala

485 490 495

Ala Ala Leu Leu Cys Leu Ala Phe Leu Ala Tyr Leu Cys Ser Ala Thr

500 505 510

Arg Arg Lys Arg His Ser Glu His Ala Phe Asp His Ala Val Asp Ser

515 520 525

asp

<210> 5

<211> 428

<212> PROTEIN

<213> HOMO SAPIENS

<400> 5

Met Ala Thr Ser Trp Gly Thr Val Phe Phe Met Leu Val Val Ser Cys

1 5 10 15

Val Cys Ser Ala Val Ser His Arg Asn Gln Gln Thr Trp Phe Glu Gly

20 25 30

Ile Phe Leu Ser Ser Met Cys Pro Ile Asn Val Ser Ala Ser Thr Leu

35 40 45

Tyr Gly Ile Met Phe Asp Ala Gly Ser Thr Gly Thr Arg Ile His Val

50 55 60

Tyr Thr Phe Val Gln Lys Met Pro Gly Gln Leu Pro Ile Leu Glu Gly

65 70 75 80

Glu Val Phe Asp Ser Val Lys Pro Gly Leu Ser Ala Phe Val Asp Gln

85 90 95

Pro Lys Gln Gly Ala Glu Thr Val Gln Gly Leu Leu Glu Val Ala Lys

100 105 110

Asp Ser Ile Pro Arg Ser His Trp Lys Lys Thr Pro Val Val Leu Lys

115 120 125

Ala Thr Ala Gly Leu Arg Leu Leu Pro Glu His Lys Ala Lys Ala Leu

130 135 140

Leu Phe Glu Val Lys Glu Ile Phe Arg Lys Ser Pro Phe Leu Val Pro

145 150 155 160

Lys Gly Ser Val Ser Ile Met Asp Gly Ser Asp Glu Gly Ile Leu Ala

165 170 175

Trp Val Thr Val Asn Phe Leu Thr Gly Gln Leu His Gly His Arg Gln

180 185 190

Glu Thr Val Gly Thr Leu Asp Leu Gly Gly Ala Ser Thr Gln Ile Thr

195 200 205

Phe Leu Pro Gln Phe Glu Lys Thr Leu Glu Gln Thr Pro Arg Gly Tyr

210 215 220

Leu Thr Ser Phe Glu Met Phe Asn Ser Thr Tyr Lys Leu Tyr Thr His

225 230 235 240

Ser Tyr Leu Gly Phe Gly Leu Lys Ala Ala Arg Leu Ala Thr Leu Gly

245 250 255

Ala Leu Glu Thr Glu Gly Thr Asp Gly His Thr Phe Arg Ser Ala Cys

260 265 270

Leu Pro Arg Trp Leu Glu Ala Glu Trp Ile Phe Gly Gly Val Lys Tyr

275 280 285

Gln Tyr Gly Gly Asn Gln Glu Gly Glu Val Gly Phe Glu Pro Cys Tyr

290 295 300

Ala Glu Val Leu Arg Val Val Arg Gly Lys Leu His Gln Pro Glu Glu

305 310 315 320

Val Gln Arg Gly Ser Phe Tyr Ala Phe Ser Tyr Tyr Tyr Asp Arg Ala

325 330 335

Val Asp Thr Asp Met Ile Asp Tyr Glu Lys Gly Gly Ile Leu Lys Val

340 345 350

Glu Asp Phe Glu Arg Lys Ala Arg Glu Val Cys Asp Asn Leu Glu Asn

355 360 365

Phe Thr Ser Gly Ser Pro Phe Leu Cys Met Asp Leu Ser Tyr Ile Thr

370 375 380

Ala Leu Leu Lys Asp Gly Phe Gly Phe Ala Asp Ser Thr Val Leu Gln

385 390 395 400

Leu Thr Lys Lys Val Asn Asn Ile Glu Thr Gly Trp Ala Leu Gly Ala

405 410 415

Thr Phe His Leu Leu Gln Ser Leu Gly Ile Ser His

420 425

<210> 6

<211> 116

<212> PROTEIN

<213> MUS MUSCULUS

<400> 6

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Asn Met His Trp Val Lys Gln Ser His Gly Arg Thr Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Val Pro Leu Asn Gly Gly Ser Thr Phe Asn Gln Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Val Asn Thr Ser Ser Arg Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Ala Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Thr Arg Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ala

115

<210> 7

<211> 111

<212> PROTEIN

<213> MUS MUSCULUS

<400> 7

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Phe

20 25 30

Gly Val Ser Phe Met Tyr Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Asn Leu Leu Ile Tyr Gly Ala Ser Asn Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Arg Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Ala Asp Asp Thr Ala Met Tyr Phe Cys Gln Gln Thr Lys

85 90 95

Glu Val Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 8

<211> 5

<212> PROTEIN

<213> MUS MUSCULUS

<400> 8

Asp Tyr Asn Met His

fifteen

<210> 9

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 9

Tyr Ile Val Pro Leu Asn Gly Gly Ser Thr Phe Asn Gln Lys Phe Lys

1 5 10 15

gly

<210> 10

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 10

Gly Gly Thr Arg Phe Ala Tyr

fifteen

<210> 11

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 11

Arg Ala Ser Glu Ser Val Asp Asn Phe Gly Val Ser Phe Met Tyr

1 5 10 15

<210> 12

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 12

Gly Ala Ser Asn Gln Gly Ser

fifteen

<210> 13

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 13

Gln Gln Thr Lys Glu Val Pro Tyr Thr

fifteen

<210> 14

<211> 116

<212> PROTEIN

<213> Mus musculus

<400> 14

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Arg Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Asn Met His Trp Val Lys Lys Asn His Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Asn Pro Asn Asn Gly Gly Thr Thr Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asn Thr Ser Ser Lys Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Gly Gly Thr Arg Phe Ala Ser Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ala

115

<210> 15

<211> 111

<212> PROTEIN

<213> Mus musculus

<400> 15

Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr

20 25 30

Gly Ile Ser Phe Met Tyr Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ala Ser Thr Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Glu Asp Asp Thr Ala Met Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 16

<211> 5

<212> PROTEIN

<213> Mus musculus

<400> 16

Asp Tyr Asn Met His

fifteen

<210> 17

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 17

Tyr Ile Asn Pro Asn Asn Gly Gly Thr Thr Tyr Asn Gln Lys Phe Lys

1 5 10 15

gly

<210> 18

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 18

Gly Gly Thr Arg Phe Ala Ser

fifteen

<210> 19

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 19

Arg Ala Ser Glu Ser Val Asp Asn Tyr Gly Ile Ser Phe Met Tyr

1 5 10 15

<210> 20

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 20

Ala Ala Ser Thr Gln Gly Ser

fifteen

<210> 21

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 21

Gln Gln Ser Lys Glu Val Pro Phe Thr

fifteen

<210> 22

<211> 122

<212> PROTEIN

<213> Mus musculus

<400> 22

Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Ile Val Ser Gly Phe Asn Ile Lys Asp Thr

20 25 30

Tyr Ile Asn Trp Val Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile

35 40 45

Gly Arg Ile Asp Pro Ala Asn Gly Asn Thr Lys Tyr Asp Pro Lys Phe

50 55 60

Gln Gly Lys Ala Thr Met Thr Ser Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Leu His Leu Ser Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Trp Gly Tyr Asp Asp Glu Glu Ala Asp Tyr Phe Asp Ser Trp

100 105 110

Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

115 120

<210> 23

<211> 111

<212> PROTEIN

<213> Mus musculus

<400> 23

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr

20 25 30

Gly Ile Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ala Ser Asn Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile Leu

65 70 75 80

Pro Met Glu Glu Val Asp Ala Ala Met Tyr Phe Cys His Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 24

<211> 5

<212> PROTEIN

<213> Mus musculus

<400> 24

Asp Thr Tyr Ile Asn

fifteen

<210> 25

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 25

Arg Ile Asp Pro Ala Asn Gly Asn Thr Lys Tyr Asp Pro Lys Phe Gln

1 5 10 15

gly

<210> 26

<211> 13

<212> PROTEIN

<213> Mus musculus

<400> 26

Trp Gly Tyr Asp Asp Glu Glu Ala Asp Tyr Phe Asp Ser

1 5 10

<210> 27

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 27

Arg Ala Ser Glu Ser Val Asp Asn Tyr Gly Ile Ser Phe Met Asn

1 5 10 15

<210> 28

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 28

Ala Ala Ser Asn Gln Gly Ser

fifteen

<210> 29

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 29

His Gln Ser Lys Glu Val Pro Trp Thr

fifteen

<210> 30

<211> 118

<212> PROTEIN

<213> Mus musculus

<400> 30

Pro Val Gln Leu Gln Gln Pro Gly Ala Glu Val Val Met Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Phe

20 25 30

Trp Met Asn Trp Met Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asp Pro Ser Asp Phe Tyr Thr Asn Ser Asn Gln Arg Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Gly Asp Phe Gly Trp Tyr Phe Asp Val Trp Gly Thr Gly Thr

100 105 110

Ser Val Thr Val Ser Ser

115

<210> 31

<211> 108

<212> PROTEIN

<213> Mus musculus

<400> 31

Glu Ile Val Leu Thr Gln Ser Pro Thr Thr Met Thr Ser Ser Pro Gly

1 5 10 15

Glu Lys Ile Thr Phe Thr Cys Ser Ala Ser Ser Ser Ile Asn Ser Asn

20 25 30

Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Phe Ser Pro Lys Leu Leu

35 40 45

Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Thr Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Gly Thr Met Glu

65 70 75 80

Ala Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Gly Ser Ser Leu Pro

85 90 95

Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 32

<211> 5

<212> PROTEIN

<213> Mus musculus

<400> 32

Ser Phe Trp Met Asn

fifteen

<210> 33

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 33

Glu Ile Asp Pro Ser Asp Phe Tyr Thr Asn Ser Asn Gln Arg Phe Lys

1 5 10 15

gly

<210> 34

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 34

Gly Asp Phe Gly Trp Tyr Phe Asp Val

fifteen

<210> 35

<211> 12

<212> PROTEIN

<213> Mus musculus

<400> 35

Ser Ala Ser Ser Ser Ile Asn Ser Asn Tyr Leu His

1 5 10

<210> 36

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 36

Arg Thr Ser Asn Leu Ala Ser

fifteen

<210> 37

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 37

Gln Gln Gly Ser Ser Leu Pro Arg Thr

fifteen

<210> 38

<211> 330

<212> PROTEIN

<213> HOMO SAPIENS

<400> 38

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys

1 5 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr

65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

100 105 110

Pro Ala Pro Glu Ala Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

115 120 125

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

130 135 140

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

145 150 155 160

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

165 170 175

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

180 185 190

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

195 200 205

Lys Ala Leu Pro Ala Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

210 215 220

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

225 230 235 240

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

245 250 255

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

260 265 270

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

275 280 285

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

290 295 300

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

305 310 315 320

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

325 330

<210> 39

<211> 330

<212> PROTEIN

<213> HOMO SAPIENS

<400> 39

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys

1 5 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr

65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

100 105 110

Pro Ala Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

115 120 125

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

130 135 140

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

145 150 155 160

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

165 170 175

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

180 185 190

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

195 200 205

Lys Ala Leu Pro Ala Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

210 215 220

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

225 230 235 240

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

245 250 255

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

260 265 270

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

275 280 285

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

290 295 300

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

305 310 315 320

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

325 330

<210> 40

<211> 330

<212> PROTEIN

<213> HOMO SAPIENS

<400> 40

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys

1 5 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr

65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

100 105 110

Pro Ala Pro Glu Ala Glu Gly Ala Pro Ser Val Phe Leu Phe Pro Pro

115 120 125

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

130 135 140

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

145 150 155 160

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

165 170 175

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

180 185 190

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

195 200 205

Lys Ala Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

210 215 220

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

225 230 235 240

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

245 250 255

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

260 265 270

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

275 280 285

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

290 295 300

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

305 310 315 320

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

325 330

<210> 41

<211> 330

<212> PROTEIN

<213> HOMO SAPIENS

<400> 41

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys

1 5 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr

65 70 75 80

Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

100 105 110

Pro Ala Pro Glu Ala Glu Gly Ala Pro Ser Val Phe Leu Phe Pro Pro

115 120 125

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

130 135 140

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

145 150 155 160

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

165 170 175

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

180 185 190

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

195 200 205

Lys Ala Leu Pro Ala Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

210 215 220

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

225 230 235 240

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

245 250 255

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

260 265 270

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

275 280 285

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

290 295 300

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

305 310 315 320

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

325 330

<210> 42

<211> 45

<212> DNA

<213> HOMO SAPIENS

<400> 42

tacgactcac aagcttgccg ccaccatgga agatacaaag gagtc 45

<210> 43

<211> 64

<212> DNA

<213> HOMO SAPIENS

<400> 43

ccgccccgac tctagatcac ttgtcatcgt catctttgta atcgacatag gtggagtggg 60

agg 64

<210> 44

<211> 478

<212> PROTEIN

<213> HOMO SAPIENS

<400> 44

Met Glu Asp Thr Lys Glu Ser Asn Val Lys Thr Phe Cys Ser Lys Asn

1 5 10 15

Ile Leu Ala Ile Leu Gly Phe Ser Ser Ile Ile Ala Val Ile Ala Leu

20 25 30

Leu Ala Val Gly Leu Thr Gln Asn Lys Ala Leu Pro Glu Asn Val Lys

35 40 45

Tyr Gly Ile Val Leu Asp Ala Gly Ser Ser His Thr Ser Leu Tyr Ile

50 55 60

Tyr Lys Trp Pro Ala Glu Lys Glu Asn Asp Thr Gly Val Val His Gln

65 70 75 80

Val Glu Glu Cys Arg Val Lys Gly Pro Gly Ile Ser Lys Phe Val Gln

85 90 95

Lys Val Asn Glu Ile Gly Ile Tyr Leu Thr Asp Cys Met Glu Arg Ala

100 105 110

Arg Glu Val Ile Pro Arg Ser Gln His Gln Glu Thr Pro Val Tyr Leu

115 120 125

Gly Ala Thr Ala Gly Met Arg Leu Leu Arg Met Glu Ser Glu Glu Leu

130 135 140

Ala Asp Arg Val Leu Asp Val Val Glu Arg Ser Leu Ser Asn Tyr Pro

145 150 155 160

Phe Asp Phe Gln Gly Ala Arg Ile Ile Thr Gly Gln Glu Glu Gly Ala

165 170 175

Tyr Gly Trp Ile Thr Ile Asn Tyr Leu Leu Gly Lys Phe Ser Gln Lys

180 185 190

Thr Arg Trp Phe Ser Ile Val Pro Tyr Glu Thr Asn Asn Gln Glu Thr

195 200 205

Phe Gly Ala Leu Asp Leu Gly Gly Ala Ser Thr Gln Val Thr Phe Val

210 215 220

Pro Gln Asn Gln Thr Ile Glu Ser Pro Asp Asn Ala Leu Gln Phe Arg

225 230 235 240

Leu Tyr Gly Lys Asp Tyr Asn Val Tyr Thr His Ser Phe Leu Cys Tyr

245 250 255

Gly Lys Asp Gln Ala Leu Trp Gln Lys Leu Ala Lys Asp Ile Gln Val

260 265 270

Ala Ser Asn Glu Ile Leu Arg Asp Pro Cys Phe His Pro Gly Tyr Lys

275 280 285

Lys Val Val Asn Val Ser Asp Leu Tyr Lys Thr Pro Cys Thr Lys Arg

290 295 300

Phe Glu Met Thr Leu Pro Phe Gln Gln Phe Glu Ile Gln Gly Ile Gly

305 310 315 320

Asn Tyr Gln Gln Cys His Gln Ser Ile Leu Glu Leu Phe Asn Thr Ser

325 330 335

Tyr Cys Pro Tyr Ser Gln Cys Ala Phe Asn Gly Ile Phe Leu Pro Pro

340 345 350

Leu Gln Gly Asp Phe Gly Ala Phe Ser Ala Phe Tyr Phe Val Met Lys

355 360 365

Phe Leu Asn Leu Thr Ser Glu Lys Val Ser Gln Glu Lys Val Thr Glu

370 375 380

Met Met Lys Lys Phe Cys Ala Gln Pro Trp Glu Glu Ile Lys Thr Ser

385 390 395 400

Tyr Ala Gly Val Lys Glu Lys Tyr Leu Ser Glu Tyr Cys Phe Ser Gly

405 410 415

Thr Tyr Ile Leu Ser Leu Leu Leu Gln Gly Tyr His Phe Thr Ala Asp

420 425 430

Ser Trp Glu His Ile His Phe Ile Gly Lys Ile Gln Gly Ser Asp Ala

435 440 445

Gly Trp Thr Leu Gly Tyr Met Leu Asn Leu Thr Asn Met Ile Pro Ala

450 455 460

Glu Gln Pro Leu Ser Thr Pro Leu Ser His Ser Thr Tyr Val

465 470 475

<210> 45

<211> 486

<212> PROTEIN

<213> HOMO SAPIENS

<400> 45

Met Glu Asp Thr Lys Glu Ser Asn Val Lys Thr Phe Cys Ser Lys Asn

1 5 10 15

Ile Leu Ala Ile Leu Gly Phe Ser Ser Ile Ile Ala Val Ile Ala Leu

20 25 30

Leu Ala Val Gly Leu Thr Gln Asn Lys Ala Leu Pro Glu Asn Val Lys

35 40 45

Tyr Gly Ile Val Leu Asp Ala Gly Ser Ser His Thr Ser Leu Tyr Ile

50 55 60

Tyr Lys Trp Pro Ala Glu Lys Glu Asn Asp Thr Gly Val Val His Gln

65 70 75 80

Val Glu Glu Cys Arg Val Lys Gly Pro Gly Ile Ser Lys Phe Val Gln

85 90 95

Lys Val Asn Glu Ile Gly Ile Tyr Leu Thr Asp Cys Met Glu Arg Ala

100 105 110

Arg Glu Val Ile Pro Arg Ser Gln His Gln Glu Thr Pro Val Tyr Leu

115 120 125

Gly Ala Thr Ala Gly Met Arg Leu Leu Arg Met Glu Ser Glu Glu Leu

130 135 140

Ala Asp Arg Val Leu Asp Val Val Glu Arg Ser Leu Ser Asn Tyr Pro

145 150 155 160

Phe Asp Phe Gln Gly Ala Arg Ile Ile Thr Gly Gln Glu Glu Gly Ala

165 170 175

Tyr Gly Trp Ile Thr Ile Asn Tyr Leu Leu Gly Lys Phe Ser Gln Lys

180 185 190

Thr Arg Trp Phe Ser Ile Val Pro Tyr Glu Thr Asn Asn Gln Glu Thr

195 200 205

Phe Gly Ala Leu Asp Leu Gly Gly Ala Ser Thr Gln Val Thr Phe Val

210 215 220

Pro Gln Asn Gln Thr Ile Glu Ser Pro Asp Asn Ala Leu Gln Phe Arg

225 230 235 240

Leu Tyr Gly Lys Asp Tyr Asn Val Tyr Thr His Ser Phe Leu Cys Tyr

245 250 255

Gly Lys Asp Gln Ala Leu Trp Gln Lys Leu Ala Lys Asp Ile Gln Val

260 265 270

Ala Ser Asn Glu Ile Leu Arg Asp Pro Cys Phe His Pro Gly Tyr Lys

275 280 285

Lys Val Val Asn Val Ser Asp Leu Tyr Lys Thr Pro Cys Thr Lys Arg

290 295 300

Phe Glu Met Thr Leu Pro Phe Gln Gln Phe Glu Ile Gln Gly Ile Gly

305 310 315 320

Asn Tyr Gln Gln Cys His Gln Ser Ile Leu Glu Leu Phe Asn Thr Ser

325 330 335

Tyr Cys Pro Tyr Ser Gln Cys Ala Phe Asn Gly Ile Phe Leu Pro Pro

340 345 350

Leu Gln Gly Asp Phe Gly Ala Phe Ser Ala Phe Tyr Phe Val Met Lys

355 360 365

Phe Leu Asn Leu Thr Ser Glu Lys Val Ser Gln Glu Lys Val Thr Glu

370 375 380

Met Met Lys Lys Phe Cys Ala Gln Pro Trp Glu Glu Ile Lys Thr Ser

385 390 395 400

Tyr Ala Gly Val Lys Glu Lys Tyr Leu Ser Glu Tyr Cys Phe Ser Gly

405 410 415

Thr Tyr Ile Leu Ser Leu Leu Leu Gln Gly Tyr His Phe Thr Ala Asp

420 425 430

Ser Trp Glu His Ile His Phe Ile Gly Lys Ile Gln Gly Ser Asp Ala

435 440 445

Gly Trp Thr Leu Gly Tyr Met Leu Asn Leu Thr Asn Met Ile Pro Ala

450 455 460

Glu Gln Pro Leu Ser Thr Pro Leu Ser His Ser Thr Tyr Val Asp Tyr

465 470 475 480

Lys Asp Asp Asp Asp Lys

485

<---

Claims (41)

1. An antibody capable of binding to the soluble human CD39 extracellular domain protein (NTPDase 1) and inhibiting its ATPase activity, said antibody comprising: (a) HCDR1 containing the amino acid sequence DYNMH (SEQ ID NO: 8); HCDR2 containing the amino acid sequence YIVPLNGGSTFNQKFKG (SEQ ID NO: 9); HCDR3 containing the amino acid sequence GGTRFAY (SEQ ID NO: 10); LCDR1 containing the amino acid sequence RASESVDNFGVSFMY (SEQ ID NO: 11); LCDR2 containing the amino acid sequence GASNQGS (SEQ ID NO: 12); and LCDR3 containing the amino acid sequence QQTKEVPYT (SEQ ID NO: 13), (b) HCDR1 containing the amino acid sequence DYNMH (SEQ ID NO: 16); HCDR2 containing the amino acid sequence YINPNNGGTTYNQKFKG (SEQ ID NO: 17); HCDR3 containing the amino acid sequence GGTRFAS (SEQ ID NO: 18); LCDR1 containing the amino acid sequence RASESVDNYGISFMY (SEQ ID NO: 19); LCDR2 containing the amino acid sequence AASTQGS (SEQ ID NO: 20); and LCDR3 containing the amino acid sequence QQSKEVPFT (SEQ ID NO: 21), (c) HCDR1 containing the amino acid sequence DTYIN (SEQ ID NO: 24); HCDR2 containing the amino acid sequence RIDPANGNTKYDPKFQG (SEQ ID NO: 25); HCDR3 containing the amino acid sequence WGYDDEEADYFDS (SEQ ID NO: 26); LCDR1 containing the amino acid sequence RASESVDNYGISFMN (SEQ ID NO: 27); LCDR2 containing the amino acid sequence AASNQGS (SEQ ID NO: 28); and an LCDR3 containing the amino acid sequence HQSKEVPWT (SEQ ID NO: 29), or (d) HCDR1 containing the amino acid sequence SFWMN (SEQ ID NO: 32); HCDR2 containing the amino acid sequence EIDPSDFYTNSNQRFKG (SEQ ID NO: 33); HCDR3 containing the amino acid sequence GDFGWYFDV (SEQ ID NO: 34); LCDR1 containing the amino acid sequence SASSSINSNYLH (SEQ ID NO: 35); LCDR2 containing the amino acid sequence RTSNLAS (SEQ ID NO: 36); and LCDR3 containing the amino acid sequence QQGSSLPRT (SEQ ID NO: 37). 2. An antibody according to claim 1, characterized in that said antibody inhibits the ATPase activity of the CD39 protein in the presence of exogenously added ATP, wherein the concentration of exogenously added ATP is optionally 20 μM. 3. An antibody according to claim 1 or 2, characterized in that said antibody is capable of binding human CD39 protein on the cell surface and inhibiting the ATPase activity of said CD39 protein on the cell surface. 4. An antibody according to any one of the preceding claims, characterized in that said CD39 soluble extracellular domain contains the amino acid sequence of SEQ ID NO: 44 or 45. 5. An antibody according to any one of the preceding claims, characterized in that said antibody is substantially incapable of binding to human CD16, CD32a, CD32b and/or CD64 polypeptides. 6. An antibody according to any of the preceding claims, characterized in that said antibody contains an Fc domain, wherein said Fc domain optionally contains an amino acid modification compared to the wild-type Fc domain and is characterized by reduced binding or loss of the ability to bind to one or more or all human CD16A, CD16B, CD32A, CD32B and/or CD64 Fcγ receptors. 7. An antibody according to any one of the preceding claims, characterized in that said antibody is a full length antibody or an antibody fragment. 8. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of causing a decrease in the ATPase activity of the human CD39 extracellular domain protein in solution by more than 50%, optionally by more than 80%. 9. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of causing a decrease in the extracellular ATPase activity of a cell expressing CD39 by at least 80%. 10. An antibody according to any one of the preceding claims, characterized in that said antibody is characterized by an EC50 to inhibit CD39 ATPase activity of not more than 1 μg/ml, wherein the inhibition of CD39 enzymatic activity is determined by assessing the neutralization of ATPase activity in Ramos cells by quantitative determination of ATP. 11. An antibody according to any one of the preceding claims, characterized in that said antibody is characterized by an EC50 for binding to Ramos cells, which, as determined by flow cytometry, is not more than 2 µg/ml, optionally not more than 1 µg/ml, not more than 0.5 mcg/ml, not more than 0.1 mcg/ml. 12. An antibody capable of binding to human soluble CD39 protein (NTPDase-1) and inhibiting its ATPase activity, said antibody being selected from the group consisting of: (a) an antibody comprising (i) a heavy chain comprising variable heavy chain CDRs 1, 2, and 3 of SEQ ID NO: 6, and (ii) a light chain comprising variable light chain CDRs 1, 2, and 3 of SEQ ID NO: : 7; (b) an antibody comprising (i) a heavy chain comprising variable heavy chain CDRs 1, 2, and 3 of SEQ ID NO: 14, and (ii) a light chain comprising variable light chain CDRs 1, 2, and 3 of SEQ ID NO: : fifteen; (c) an antibody comprising (i) a heavy chain comprising the heavy chain variable region CDRs 1, 2, and 3 of SEQ ID NO: 22, and (ii) a light chain comprising the light chain variable region CDRs 1, 2, and 3 of SEQ ID NO: : 23; and (d) an antibody comprising (i) a heavy chain comprising the heavy chain variable region CDRs 1, 2, and 3 of SEQ ID NO: 30, and (ii) a light chain comprising the light chain variable region CDRs 1, 2, and 3 of SEQ ID NO: : 31. 13. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of causing an increase in cell surface expression of an activation marker in monocyte-derived dendritic cells (moDCs) when such moDCs are incubated in vitro with said antibody and ATP. 14. An antibody according to claim 13, characterized in that the concentration of exogenously added ATP is 0.125 mM, 0.25 mM or 0.5 mM. 15. An antibody according to claim 13 or 14, characterized in that the increase in expression of the activation marker on the cell surface is assessed by incubating moDC in the presence of ATP for 24 hours and analyzing the expression of CD80, CD83 and/or HLA-DR on the surface of moDC cells using flow cytometry. 16. The antibody according to paragraphs. 13-15, characterized in that the increase in cell surface marker expression is at least 40%, 50%, 75%, or 80% compared to a negative control, such as medium. 17. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of enhancing T cell proliferation when T cells are co-cultured in vitro with CD39-expressing DC cells in the presence of ATP. 18. An antibody according to any of the preceding claims, characterized in that said antibody is characterized by reduced binding to a mutant CD39 polypeptide containing a mutation at the position of residues Q96, N99, E143 and R147 with respect to SEQ ID NO: 1, in each case compared to binding said antibody to a wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1. 19. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of causing an increase in cell surface expression of an activation marker in monocyte-derived dendritic cells when such moDCs are incubated in vitro with said antibody and ATP. 20. An antibody according to claim 19, characterized in that the concentration of exogenously added ATP is 0.125 mM, 0.25 mM or 0.5 mM. 21. The antibody according to paragraphs. 19, 20, characterized in that the increase in expression of the activation marker on the cell surface is assessed by incubating moDC in the presence of ATP for 24 hours and analyzing the expression of CD80, CD83 and/or HLA-DR on the surface of moDC cells using flow cytometry. 22. The antibody according to paragraphs. 19-21, characterized in that the increase in cell surface marker expression is at least 40%, 50%, 75%, or 80% compared to a negative control, such as medium. 23. An antibody according to any one of the preceding claims, characterized in that said antibody is capable of enhancing T cell proliferation when T cells are co-cultured in vitro with CD39-expressing DC cells in the presence of ATP. 24. An antibody according to any of the preceding claims, characterized in that said antibody is characterized by reduced binding to a mutant CD39 polypeptide containing mutations R138A, M139A and E142K with respect to SEQ ID NO: 1, in each case compared to the binding of the antibody to the CD39 polypeptide wild type containing the amino acid sequence of SEQ ID NO: 1. 25. An antibody according to any one of the preceding claims, characterized in that said antibody is characterized by reduced binding to a mutant CD39 polypeptide containing mutations K87A, E100A and D107A with respect to SEQ ID NO: 1, in each case compared to the binding of the antibody to the CD39 polypeptide wild type containing the amino acid sequence of SEQ ID NO: 1. 26. An antibody according to any of the preceding claims, characterized in that said antibody is characterized by reduced binding to a mutant CD39 polypeptide containing mutations N371K, L372K, E375A, K376G and V377S and a valine insertion between residues 376 and 377 with respect to SEQ ID NO: 1 , in each case compared to the binding of the antibody to a wild-type CD39 polypeptide containing the amino acid sequence of SEQ ID NO: 1. 27. An antibody according to any of the preceding claims, characterized in that said antibody is a free antibody, optionally an antibody not bound to a cytotoxic agent. 28. An antibody according to any of the preceding claims, characterized in that said antibody is an antibody fragment, optionally an antibody fragment that does not contain an Fc domain. 29. An antibody according to any of the preceding claims, characterized in that said antibody is an antibody containing a human Fc domain modified to weaken the binding between the Fc domain and the human Fcγ receptor. 30. An antibody according to any one of the preceding claims, characterized in that said antibody has a KD for binding to a CD39 polypeptide of less than 10 ⁻⁹ M as determined by surface plasmon resonance. 31. An antibody according to any one of the preceding claims, characterized in that said antibody comprises a modified human IgG1 Fc domain comprising N-linked glycosylation of residue N297 by Kabat and containing an amino acid substitution at residue positions 234 and 235 by Kabat, optionally additionally at residue 331 according to Kabat, optionally at residues 234, 235, 237 according to Kabat and at residues 330 and/or 331 according to Kabat, and the Fc domain optionally contains substitutions L234A/L235E/P331S, substitutions L234F/L235E/P331S, substitutions L234A/L235E/G237A /P331S or L234A/L235E/G237A/A330S/P331S replacements. 32. Kit for the detection of protein CD39 containing the antibody according to any one of paragraphs. 1-31, optionally further comprising a labeled secondary antibody specifically recognizing the antibody of any one of the preceding claims. 33. A recombinant host cell that produces an antibody according to any one of paragraphs. 1-31.

Images