RU2774874C2 - Liver-specific structures, expression cassettes of factor viii and their application methods - Google Patents

Abstract

FIELD: gene therapy.

SUBSTANCE: group of inventions relates to gene therapy, in particular to target delivery of transgene-encoding structures to the liver for the expression of therapeutic proteins. Polynucleotide expression structures, and AAV vector containing a polynucleotide expression structure are proposed. A pharmaceutical composition for the treatment of hemophilia in a subject who needs it, and a pharmaceutical composition for the provision of a transgene that encodes a human Factor VIII for a subject who needs it, containing the specified AAV vector are also proposed. A method for the provision of a human Factor VIII for a subject who needs it, and a method for the induction of tolerance in a subject to a human Factor VIII are also proposed.

EFFECT: group of inventions provides for the expression of transgenes at high levels in liver cells, using the specified expression structures.

15 cl, 40 dwg, 9 tbl, 3 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority over U.S. Provisional Application No. 62/247,469, filed October 28, 2015; U.S. Provisional Application No. 62/307,897, filed March 14, 2016; U.S. Provisional Application No. 62/326,229, filed April 22, 2016; U.S. Provisional Application No. 62/315,438, filed March 30, 2016; and U.S. Provisional Application No. 62/355,106, filed June 27, 2016, the disclosure of which is incorporated herein by reference in its entirety.

FIELD OF TECHNOLOGY

[0002] This invention relates to the field of gene therapy, in particular the targeted delivery of constructs encoding a transgene to the liver for the expression of useful (therapeutic) proteins. In particular, the invention relates to the treatment of hemophilia, such as hemophilia A.

BACKGROUND OF THE INVENTION

[0003] Gene therapy can be used to genetically engineer a cell to have one or more inactivated genes and/or cause that cell to express a product that was not previously produced in that cell (for example, by introducing a transgene and/or by correcting the endogenous sequence) . Examples of the use of a transgene insert include introducing one or more genes encoding one or more novel therapeutic proteins, introducing a coding sequence encoding a protein that is not present in a cell or individual, introducing a wild-type gene into a cell that contains a mutated gene sequence, and/or introducing a sequence that encodes a structural nucleic acid such as microRNA or siRNA (siRNA - short interfering RNA). Examples of useful applications of "tweaking" the endogenous sequence of a gene include changes in disease-associated mutations, changes in sequences encoding splice sites, changes in regulatory sequences, and/or targeted changes in sequences encoding structural characteristics of a protein.

[0004] Liver gene transfer provides an effective means of delivering transgenes to a subject for the treatment and/or prevention of various disorders, including hemophilia and lysosomal storage diseases. See, for example, US Pat. No. 9,150,847 and US Publications Nos. 20130177983 and 20140017212. Liver gene therapy specific vectors have also been described. See, for example, WO 2014064277; WO2009130208; EP 2451474 B1, Chuah et al., (2014) Molecular Therapy, 22, 1605-1613; and Nair et al. (2014) Blood 123:3195-3199. These vectors may include a wild-type mouse small virus (MVM) intron sequence. See, for example, Haut and Pintel (1998) J. Virol. 72:1834-1843; Haut and Pintel (1998) Virol. 258:84-94.

[0005] All mammals have complex mechanisms that can regulate either the activation or suppression of cellular elements of the immune system. For example, dendritic cells (DCs) have been recognized as central players in the balance between immune activation and immune tolerance. They are the most potent antigen presenting cells in the immune system and specifically capture and present antigens to naive T cells. Immature DC interact with potential antigens through specific receptors such as Toll-like receptors, where the antigen is delivered into the cell by micropinocytosis. The antigen is then broken down into smaller peptides, which are presented to T cells via major histocompatibility complexes. In addition, mature DCs secrete inflammatory mediators such as IL-1β, IL-12, IL-6, and TNF, which also serve to activate T cells. On the other hand, DCs also play a role in inducing body tolerance to certain antigens in order to maintain central and peripheral tolerance. Tolerogenic DCs (tDCs) have low amounts of costimulatory signals on cell surfaces and have reduced expression of the inflammatory mediators described above. However, these tolDCs express large amounts of anti-inflammatory cytokines such as IL-10, and when these cells interact with naive T cells, the T cells become anergic/regulatory T cells (CD8+ Tregs). In fact, this process has been shown to be enhanced by repeated stimulation of T cells with these immature/tolerogenic DCs. Several factors have also been identified that work in conjunction with tolDC to induce different types of Tregs. For example, naive T cells, co-presented with tolDC and HGF (HGF - hepatocyte growth factor, hepatocyte growth factor), VIP peptide, TSLP (thymic stromal lymphopoietin, thymic stromal lymphopoietin) or vitamin D3, lead to the induction of CD4 + CD25 +Foxp3+Treg, co-presentation with TGF-β (TGF - transforming growth factor, transforming growth factor) or IL-10 leads to Tr1 Treg and co-presentation with corticosteroids, rapamycin, retinoic acid can lead to CD4+/CD8+Treg (Raker et al (2015) Front Immunol 6:art 569 and Osorio et al (2015) Front Immunol 6:art 535).

[0006] Hemophilias, such as hemophilia A and hemophilia B, are genetic disorders of the blood coagulation system characterized by bleeding into the joints and soft tissues, as well as excessive bleeding anywhere an injury or operation occurs. Hemophilia A is clinically indistinguishable from hemophilia B, but factor VIII (FVIII or F8) is deficient or absent in hemophilia A, and factor IX (FIX or F.IX) is deficient or absent in patients with hemophilia B. The F8 gene encodes a plasma glycoprotein that circulates combined with the von Willebrand factor in its inactive form. When the surface is damaged, an internal coagulation cascade is initiated and FVIII is released from the complex and activated. The activated form interacts with factor IX to activate factor X so that factor X becomes activated Xa, which ultimately leads to the change of fibrinogen to fibrin and induction of a clot. See Levinson et al. (1990) Genomics 7(1): 1-11. 40-50% of hemophilia A patients have a chromosomal inversion involving F8 intron 22 (also known as IVS22). The inversion is caused by an intrachromosomal recombination event between the 9.6 kb sequence. within intron 22 of the F8 gene and one of two closely related sequences with a reverse orientation, located at a distance of about 300 kb. distally to the F8 gene, resulting in an inversion of exons 1-22 with respect to exons 23-26. See, Textbook of Hemophilia. Lee et al. (ed.) 2005, Blackwell Publishing. Other hemophilia A patients have defects in F8, including active site mutations, as well as nonsense and missense mutations.

[0007] Clinically, patients with hemophilia A are evaluated and stratified depending on how often the patient has a bleeding episode and how long these episodes last. Both of these characteristics are directly dependent on the amount of FVIII protein in the patient's blood. Patients with severe hemophilia usually have less than 1% of normal blood levels of FVIII, experience bleeding after injury, and often have spontaneous joint bleeding. Moderate patients have 1-5% of normal FVIII levels, while mild patients have 6% or more of normal FVIII levels and have bleeding episodes only after major injury, trauma, or surgery (Kulkarni et al (2009) Haemophilia 15:1281-90). HemoAilia A patients are treated with FVIII protein replacement, either from human plasma or produced recombinantly, with the frequency of treatment based on the pattern of bleeding and the severity of the hemophilia. Patients with severe hemophilia A receive regular prophylactic treatment to prevent bleeding, while patients with less severe hemophilia A may receive treatment only as needed after injury.

[0008] Described gene therapy for patients with hemophilia A or B, including the introduction of a plasmid and other vectors (eg, AAV), encoding functional proteins FVIII or F.IX. (See, for example, US Pat. -1232 Graham et al (2008) Genet Vaccines Ther 3:6-9 Manno et al (2003) Blood 101(8):2963-72 Manno et al (2006) Nature Medicine 12 (3):342-7; Nathwani et al. (2011) Mol Ther 19(5):876-85; Nathwani et al. (2011) N Engl J Med. 365(25):2357-65 and Mcintosh et al (2013) Blood 121(17):3335-44). However, in these protocols, the formation of inhibitory antibodies to factor VIII or IX (antibody to FVIII or to F.IX) and antibodies to the delivery vehicle is a major complication in the treatment of hemophilia based on substitution of FVIII and F.IX. See, for example, Scott & Lozier (2012) Br J Haematol. 156(3):295-302.

[0009] However, there remains a need for liver-specific polynucleotides (expression constructs and transcription modules) that result in the expression of one or more transgenes (including transgenes encoding one or more proteins absent in hemophilia) in liver cells at high levels.

SUMMARY OF THE INVENTION

[0010] This invention describes compositions and methods for expressing a transgene in a liver cell. The transgene may be expressed extrachromosomally (episomal) or may be integrated into the genome of the liver cell (eg, via nuclease-mediated targeted integration, eg, into the albumin locus). In some embodiments, the transgene encodes a protein involved in the blood coagulation cascade. In preferred embodiments, the transgene encodes a FVIII polypeptide. The compositions and methods described herein result in high levels of protein production both in vitro and in vivo, including levels sufficient to produce clinically significant (therapeutic) effects in vivo.

[0011] In one aspect described herein, a polynucleotide expression construct is provided comprising at least one spacer sequence comprising an insulator sequence, a liver-specific enhancer sequence (e.g., a wild-type or mutant Serpin 1 enhancer sequence), a promoter sequence ( for example, a wild-type or mutant transthyretin (TTR) promoter) and a transgene (for example, a nuclease and/or a therapeutic protein, such as a protein that is absent and/or deficient in hemophilia or lysosomal storage disease). In some embodiments, the expression polynucleotide construct further comprises an intron sequence (eg, a wild-type or mutant small mouse virus (MVM) intron sequence). In some embodiments, the polynucleotide expression cassette contains two spacer sequences flanking a liver-specific enhancer sequence, a promoter sequence, an intron sequence and a transgene, and optionally a polyadenylation signal. Any insulator(s) sequence may be used, including, but not limited to, any wild-type or mutant insulator sequence (eg, one or more of SEQ ID NOs: 28, 29, 30 and/or 38 in any combination). In some embodiments, the polynucleotide expression construct comprises a polynucleotide designated CRMSBS1 (SEQ ID NO: 37) or CRMSBS2 (SEQ ID NO: 34).

[0012] In another aspect, described herein, there is provided a polynucleotide expression construct comprising a liver-specific enhancer sequence (e.g., a wild-type or mutant Serpin 1 enhancer sequence), a promoter sequence (e.g., a wild-type or mutant transthyretin (TTR) promoter). ), an intron sequence as shown in any of SEQ ID NOs: 15, 16, or 17, and a transgene (e.g., a nuclease and/or a therapeutic protein, such as a protein that is absent and/or deficient in hemophilia or lysosomal storage disease) . In some embodiments, the polynucleotide expression cassette further comprises at least one spacer sequence containing an insulator sequence and/or a polyadenylation signal.

[0013] In yet another aspect described herein, a polynucleotide expression construct is provided comprising a liver-specific enhancer sequence having mutations at positions 1, 5, 14, 32 and/or 39 of any of SEQ ID NOs: 1-13 ( e.g., as shown in SEQ ID NO: 35 or 36), a promoter sequence (e.g., a wild-type or mutant transthyretin (TTR) promoter), and a transgene (e.g., a nuclease and/or a therapeutic protein, such as a protein that is absent and/or the level of which is insufficient in hemophilia or lysosomal storage disease). In some embodiments, the expression polynucleotide constructs further comprise an intron sequence (e.g., a wild-type or mutant mouse small virus (MVM) intron sequence) and/or at least one spacer sequence containing an insulator sequence and/or a polyadenylation signal.

[0014] In other aspects, an AAV vector is provided comprising any of the polynucleotide expression constructs described herein (eg, in which the polynucleotide expression construct is between the 5' and 3' inverted terminal repeats (ICP) of the AAV vector).

[0015] In other aspects, provided herein are pharmaceutical compositions comprising one or more AAV vectors and/or one or more polynucleotide expression constructs as described herein.

[0016] Also provided are methods of providing a protein to a subject in need thereof, the method comprising administering to the subject's liver a polynucleotide expression construct, an AAV vector, or a pharmaceutical composition, as described herein, to the subject, wherein the transgene encodes the protein and the protein is produced in the subject . In some embodiments, the transgene is integrated into the genome of a liver cell of a subject. Optionally, the methods further comprise administering one or more nucleases to the subject, wherein the nuclease cleaves the endogenous albumin gene and the transgene integrates into the endogenous albumin gene. Also provided are methods for genetically modifying a cell to include a transgene (eg, which produces a protein), including methods for introducing the transgene into a cell (episomal or integrated via nuclease-mediated targeted integration). Also provided are methods of inducing tolerance in a mammal to a therapeutic protein, the method comprising genetically modifying a cell (e.g., a cell that has been modified to produce a protein as described herein) of a subject as described herein, and administering one or more steroids and /or B-cell inhibitors so that the mammal becomes tolerant to the therapeutic protein.

[0017] In one aspect described herein, there is provided a polynucleotide expression construct comprising an enhancer sequence (e.g., a wild-type or mutant Serpin 1 enhancer sequence), a promoter sequence (e.g., a transthyretin minimal gene promoter (TTRm)) and a transgene, and, optionally, a polyadenylation sequence (e.g., a synthetic polyadenylation (SPA) sequence and/or a signal peptide (SP). In some embodiments, the expression construct further comprises an intron sequence (e.g., a wild-type MVM sequence or a mutant MVM sequence and/or a chimeric intron) In some embodiments, the expression constructs comprise, in a 5' to 3' direction, an enhancer sequence, a promoter sequence, an intron sequence, a transgene (optionally containing a signal peptide), and a polyadenylation signal.

[0018] The expression cassette can be incorporated into any viral or non-viral vector, including, but not limited to, plasmid vectors, adenovirus vector, retroviral vectors, and an adeno-associated virus (AAV) vector. In a preferred embodiment of the invention, the expression construct is transferred to the AAV construct and further comprises 5' and 3' PICs flanking the expression constructs as described herein. Optionally, insulator (spacer) molecules are also included between one or more components of the expression construct, for example between the 5'-ICP and the enhancer and/or between the polyadenylation signal and the 3'-ICP. In some embodiments of the invention, the regions of the insulator (spacer) contain homologous arms to facilitate directed integration. In some embodiments of the invention, the structure is a structure as depicted in any of FIGS. 1, 2, 4, 6, 7, 10, 19, 20, or 25. Two exemplary constructs are shown in SEQ ID NO: 34 and SEQ ID NO: 37. Obviously, the individual components (promoter, isolator(s), enhancer , transgene) can be combined in any combination with other components, as described in this document.

[0019] In any of the polynucleotides described herein, the enhancer can be derived from the Serpin-1 enhancer. In some embodiments, the enhancer is a wild-type sequence. In other embodiments, the enhancer contains one or more modifications compared to the wild type, for example, the Serpin1 enhancer contains one or more nucleotide modifications, as depicted in FIG. 5, nucleotide modifications at one or more of residues 1, 5, 14, 32, and/or 39 of the sequence shown in any of SEQ ID NOs: 1-13. In some embodiments, the Serpin1 enhancer contains modifications at positions 1,5, 14, and 32 of any of SEQ ID NOs: 1-13, while in other embodiments, the Serpin1 enhancer contains a modification at positions 1, 14, 32, and 39 any of SEQ ID NOs: 1-13. Exemplary enhancer sequences are shown in SEQ ID NOs: 35 and 36. In some embodiments, the polynucleotides described herein contain 1, 2, 3, 4, 5 or more enhancer elements. In some embodiments of the invention, 1, 2, 3, 4, 5 or more enhancer elements are identical, with other embodiments of the invention using more than one type of enhancer.

[0020] Any of the polynucleotides described herein may additionally optionally contain an intron sequence. In some embodiments, the expression construct includes a chimeric intron sequence, such as shown in the lower panels of FIG. 6 and 7. The T-chimeric intron is a truncated version of the chimeric intron in pCI-neo (GenBank U47120). The chimeric intron in pCI-neo is the 5' splicing donor site from the human β-globin gene, as well as the branch point and 3' acceptor site of the immunoglobulin heavy chain variable region. The T-chimeric intron contains a 45 bp deletion. between the 5' splice donor and branch point. In other embodiments, expression constructs comprise a mutated MVM intron sequence (e.g., one or more of the mutations depicted in Figures 12, 13, and 14 (SEQ ID NOs: 15-17). Alternatively, expression constructs as described herein, may not have an intron sequence, such as shown in the constructs depicted in the middle panels of Figures 6, 7, 19 and 20.

[0021] The expression constructs of the invention may also include optimized insulator sequences between the AAV ICP and the expression cassette. In certain embodiments of the invention, the expression construct contains insulator (spacer) regions (for example, Inc1 and Inc3, SEQ ID NO: 15 or 28 and SEQ ID NO: 17 or 30, (respectively), as well as Inc2 (SEQ ID NO: 16 or 29) In certain embodiments, the expression construct contains Inc4 (SEQ ID NO: 38) Any of the insulator sequences can be used in both the 5' and 3' position, and any combination of insulator sequences can be used in the expression construct. Particularly preferred are combinations of Inc1 at position 5' and Inc3 at position 3'.

[0022] Expression constructs as described herein also contain and express one or more transgenes. Any transgene(s) may be expressed using the polynucleotides described herein, including, but not limited to, transgenes encoding functional protein variants that are absent or present in insufficient amounts in any genetic disease, including, but not limited to, lysosomal storage diseases. (for example, Gaucher disease, Fabry, Hunter, Hurler, Niemann-Pick, Phenylketonuria (PKU) and the like), metabolic diseases and/or blood diseases such as hemophilia and hemoglobinopathies and the like. See, for example, US Publication Nos. 20140017212 and 20140093913; U.S. Patent Nos. 9,255,250 and 9,175,280. Non-limiting examples of proteins that can be expressed as described herein include fibrinogen, prothrombin, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor XI, factor XII (Hageman factor), factor XIII (fibrin stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-like protease inhibitor, plasminogen, alpha 2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator-1 inhibitor, plasminogen activator-2 inhibitor, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase (NDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl-CoA carboxylase (PCC) (PCCA and/or PCCB subunits), glucose-6-phosphate transporter protein (G6PT) or glucose-6-phosphatase (G6Phase), LDL receptor (RLNP), A poB, LDLRAP-1, PCSK9, mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I) and OTC (ornithine transcarbamylase), ASS (argininosuccinate synthetase), ASL (argininosuccinate lyase) and/or ARG1 (arginase ), and/or solute transporter family type 25 protein (SLC25A13, aspartate/glutamate transporter), UGT1A1 or UDP glucuronyl transferase A1 polypeptide, fumarylacetoacetate hydrolyase (FAH), alanine glyoxylate aminotransferase (AGXT) protein, glyoxylate reductase/hydroxypyruvate reductase (GRHPR) protein , transthyretin (TTR) gene protein, ATP7 B protein, phenylalanine hydroxylase (PHA) protein, lipoprotein lyase (LPL) protein, engineered nuclease, engineered transcription factor, and/or engineered single chain variable antibody fragment (diabody, camel antibody, and the like). In one preferred embodiment of the invention, the transgene encodes a FVIII polypeptide. In some embodiments, the FVIII polypeptide contains a deletion of the B domain.

[0023] In some embodiments, the one or more transgenes include sequences encoding engineered nucleases (e.g., ZFNs (zinc finger nucleases), TALENs (transcriptional activator-like effector nucleases), TtAgo, and CRISPR/Cas systems). In other embodiments, the transgenes include sequences encoding engineered transcription factors (eg, ZFP-TF (zinc finger protein transcription factors), TALE-TFs, CRISPR/Cas-TF systems). The transgenes may also include sequences encoding a single chain antibody specific for the target of interest. In addition, the transgene may include sequences encoding structural RNA (eg, RNAi, shRNA (small hairpin RNA), miRNA (microRNA)).

[0024] In certain aspects, polynucleotides as described herein are introduced into a cell in such a way that they are episomal maintained while allowing expression of the transgene. In other aspects, expression constructs are randomly integrated into the genome of the cell into which they are introduced. In additional aspects, expression constructs allowing expression of the transgene are integrated into the genome via nuclease-mediated targeted integration.

[0025] In additional aspects, described herein are methods for expressing one or more transgenes in a liver cell, the methods comprising introducing one or more expression constructs as described herein into the cell such that the transgene is expressed in the cell. In some embodiments, the expression construct is carried by a viral or non-viral vector, preferably an AAV vector (eg, AAV2 or AAV2/6).

[0026] In another aspect, provided herein is a method for expressing one or more transgenes in a living animal, the methods comprising administering one or more expression cassettes as described herein to a living animal. In some embodiments of the invention, the expression cassettes are administered to the animal's liver. In some embodiments, the expression construct is carried by a viral or non-viral vector, preferably an AAV vector (eg, AAV2, AAV2/6, or AAV2/8).

[0027] In some embodiments, provided herein are methods and compositions for expressing therapeutically relevant levels of one or more therapeutic proteins of one or more transgenes. In some embodiments of the invention, the expression of a transgene construct encoding a replacement protein results in 1% of normal levels of protein produced, while in others to 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30 %, 50%, 80%, 100%, 150%, 200% or more of normal levels of protein produced. In some preferred embodiments of the invention, the transgene encodes a FVIII protein and a therapeutically significant amount of the protein is produced. In some embodiments, as a result of using the methods and compositions of the invention, the amount of therapeutic protein in the blood of a human patient is increased, resulting in a reduction in clinical symptoms. In some aspects, the production of a therapeutic protein by the methods and compositions described herein in a human patient results in a reduction in blood clotting time after injury compared to an untreated or untreated patient. In some aspects, a human patient treated with the methods and compositions of the invention requires a reduced amount of replacement therapy than a patient who was not treated or compared to a patient prior to treatment.

[0028] In some embodiments, the method and compositions of the invention, as described herein, can be used to induce tolerance in a mammal to a therapeutic protein such that levels of the therapeutic protein encoded by the transgene remain at therapeutically relevant levels after a short increase in the number of antibodies to therapeutic proteins. Thus, provided herein is a method for inducing tolerance to a therapeutic protein in a subject, the method comprising genetically modifying a cell in the subject using the method described herein (e.g., such that the cell produces the therapeutic protein), optionally by treating the subject with additional compositions ( eg steroids and/or B-cell inhibitors) so that the animal becomes tolerant to the therapeutic protein. In some embodiments of the invention, the introduction (integration) of the therapeutic protein into the recipient cells is carried out simultaneously with treatment with an immunoinhibitory steroid or B-cell inhibitor, while in other cases, the immunomodulatory substances are not administered to the animal. In some cases, an immunomodulatory agent is administered only if antibodies to the therapeutic protein are produced. In additional cases, the administration of the immunomodulatory agent is stopped after some time.

[0029] In another aspect, pharmaceutical compositions are provided comprising one or more cells, expression constructs, and/or optionally the nucleases described herein.

[0030] In some aspects, this document describes methods and systems for targeted integration of a liver-specific expression cassette. Methods and systems include introducing one or more expression cassettes as described herein and introducing one or more nucleases specific for a target gene into a cell. Following nuclease-mediated cleavage of the target gene, the expression cassette is integrated into the gene by mechanisms dependent or independent of homologous recombination. In some embodiments, the target gene is an endogenous albumin gene.

[0031] For nuclease-mediated targeted integration of the expression constructs of this invention, any nuclease can be used, including, but not limited to, one or more zinc finger nucleases (ZFN), TALEN, CRISPR/Cas nucleases, and/or TtAgo nucleases, so that the expression construct integrates into the region (gene) cleaved by the nuclease(s). In certain embodiments of the invention, one or more pairs of nucleases are used. Nucleases can be introduced in the form of mRNA or can be introduced into the cell using non-viral or viral vectors. In some aspects, the nuclease polynucleotides can be delivered by a lentivirus or a non-integrating lentivirus. In others, the expression cassette can be delivered with AAV and/or DNA oligonucleotides.

[0032] In another aspect, provided herein are methods for providing one or more functional proteins that are absent or present in insufficient amounts in a mammal, or in a primate, such as a humanoid primate, such as a human patient with a disease (e.g., metabolic disease, lysosomal storage disease (LSD), hemoglobinopathies and/or hemophilia), for example, to treat the disease by providing protein(s) that are absent or present in insufficient amounts in the subject. In another aspect, provided herein are methods for providing a functional protein for the treatment of a disorder in which the protein is absent, deficient, or aberrantly expressed. In further embodiments, the methods include administering an expression cassette encoding a therapeutic protein useful in preventing or treating the disorder. In a further aspect, this document describes methods for providing a therapeutic protein to treat a disorder, wherein the therapeutic protein is a single chain antibody. In some embodiments, the methods include introducing an expression cassette (eg, an AAV vector) as described herein into the liver of a subject in need thereof. In other embodiments, the method comprises administering a modified cell (expressing a functional version of a protein that is aberrantly expressed in a subject from an expression cassette, as described) to a subject. Thus, the isolated cell may be administered to the subject (ex vivo cell therapy) or the cell may be modified if it is part of the subject (in vivo).

[0033] In any of the compositions and methods described, the expression cassettes and/or nucleases can be carried by an AAV vector, including, but not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, and AAVrh10, or a pseudotyped AAV such as AAV2/ 8, AAV8. 2, AAV2/5 and AAV2/6 and the like. In certain embodiments of the invention, polynucleotides (expression constructs and/or nucleases) are delivered using the same types of AAV vectors. In other embodiments of the invention, the polynucleotides are delivered using various types of AAV vectors. Polynucleotides can be delivered using one or more vectors. In some embodiments of the invention, the polynucleotides are delivered by intravenous (eg, portal vein) administration to the liver of an intact animal. In other embodiments of the invention, the polynucleotides are delivered by intravenous administration into a peripheral vein.

[0034] In any of the compositions and methods described herein, the protein encoded by the transgene may comprise an F8 protein, such as B domain deleted factor VIII (BDD-F8). In other embodiments of the invention, the protein encoded by the transgene contains a factor IX protein. In other embodiments of the invention, the protein encoded by the transgene contains a factor VII protein. In other embodiments, the protein encoded by the transgene contains a factor X protein. In some embodiments, the protein encoded by the transgene contains glucocerebrosidase. In other embodiments of the invention, the protein encoded by the transgene contains α-galactosidase. In additional embodiments of the invention, the protein encoded by the transgene contains iduronate-2-sulfatase. In some embodiments of the invention, the protein encoded by the transgene contains alpha-L-iduronidase. In additional embodiments of the invention, the protein encoded by the transgene contains sphingomyelin phosphodiesterase. In some embodiments, the transgene encodes a single chain antibody. In other embodiments of the invention, the transgene encodes a structural RNA. In any of the compositions or methods described herein, the transgene also contains a transcriptional regulator, while in others it does not, and transcription is regulated by an endogenous regulator. In another aspect, the methods of the invention comprise a composition for therapeutic treatment of a subject in need thereof. In some embodiments of the invention, the composition contains engineered stem cells containing a specific nuclease that is safe for their genes, and transgene-encoded factor VII, F8, F.IX, factor X, GBA, GLA, IDS, IDUA, a single-chain antibody and/or SMPD1 protein , or functional fragment and/or their truncation. In other embodiments, the composition comprises engineered stem cells that have been modified to express a transgene encoding factor VII, F8, F.IX, factor X, GBA, GLA, IDS, IDUA, a single chain antibody and/or SMPD1 protein, or a functional fragment and/or their truncation.

[0035] The methods described herein can be practiced in vitro, ex vivo, or in vivo. In certain embodiments of the invention, the compositions are administered to a living, intact mammal. The mammal may be at any stage of development at the time of delivery, such as rudimentary, fetal, neonatal, early, juvenile, or adult. Additionally, target cells may be healthy or diseased. In certain embodiments, one or more compositions are delivered intravenously (e.g., to the liver via a portal vein, e.g., by tail vein injection), intra-arterially, intraperitoneally, intramuscularly, into the liver parenchyma (e.g., by injection), into the hepatic artery (e.g., by injection) and/or through the bile ducts (eg, by injection).

[0036] To target the compositions to a particular cell type, eg, platelets, fibroblasts, hepatocytes, and the like, one or more of the administered compositions may be associated with a "homing" agent that specifically binds to a cell surface receptor. For example, the vector may be conjugated to a ligand (eg, galactose) for which certain cells of the liver system have receptors. The conjugation can be covalent, such as a cross-linking agent such as glutaraldehyde, or non-covalent, such as linking an avidinated ligand to a biotinylated vector. Another form of covalent conjugation is provided by constructing an AAV helper plasmid used to generate the bulk of the vector such that one or more encoded envelope proteins are a hybrid of the native AAV envelope protein and a peptide or protein ligand such that the ligand is exposed on the surface of the viral particle.

[0037] Also provided is a kit containing one or more of the expression constructs, AAV vectors, cell and/or pharmaceutical compositions described herein. The kit may further contain nucleic acids encoding nucleases (e.g., RNA molecules encoding ZFN, TALEN, or Cas and modified Cas proteins and guide RNAs) or aliquots of nuclease proteins, cells, instructions for performing the methods of the invention, and the like.

[0038] These and other aspects will be apparent to a qualified specialist in the context of the information set forth in this document as a whole.

BRIEF DESCRIPTION OF GRAPHICS

[0039] In FIG. 1 is a diagram showing the elements of the transgene cassette as well as the steps taken to identify improved enhancers and introns.

[0040] In FIG. 2 is a diagram showing the original TTRm promoter and HLP constructs with insulators 1-3 ("Inc1-3"). SerpE refers to the Serpin enhancer of the SERPINA1 gene, which is a Serpin regulatory element specific to the liver. TTRm refers to the minimal promoter of the transthyretin gene. HLP refers to a hybrid liver-specific promoter (Mcintosh et al., from the same source). hFVIII refers to a human factor VIII transgene with a deleted B domain. SP refers to a signal peptide. ICP refers to the inverted terminal repeat. SPA refers to a synthetic polyadenylation sequence.

[0041] In FIG. 3 is a graph showing the yield of different AAV constructs containing different insulator sequences or promoter regions. The figure shows improved yields from Inc1-Inc3 compared to Inc1-Inc2 in the context of the original TTRm promoter or HLP constructs. The virus was produced in HEK293 cells, output from two cell factories (2 CF). SerpE refers to the Serpin enhancer of the SERPINA1 gene, which is a Serpin regulatory element specific to the liver. TTRm refers to the minimal promoter of the transthyretin gene. HLP refers to a hybrid liver-specific promoter (Mcintosh et al., from the same source). hFVIII refers to a human factor VIII transgene with a deleted B domain. SP refers to a signal peptide. ICP refers to the inverted terminal repeat. SPA refers to a synthetic polyadenylation sequence.

[0042] In FIG. 4 schematically depicts the original construct, and constructs with new enhancers, designated CRMSBS1 and CRMSBS2, each carrying the human factor VIII transgene with a deleted (Factor VIII-BDD) B domain. "SerpE" refers to the Serpin enhancer of the SERPINA1 gene, which is a liver-specific Serpin regulatory element. "TTRm" refers to the minimal promoter of the transthyretin gene. "SBS" refers to the Sangamo Biosciences internal numeric reference. "hFVIII" refers to the human factor VIII BDD transgene. "SP" refers to a signal peptide. ICP refers to the inverted terminal repeat. "SPA" refers to a synthetic polyadenylation sequence. "Inc1" and "Inc3" are as shown above in FIG. 2.

[0043] In FIG. 5 (SEQ ID NOs: 1-13) shows an alignment of the SERPINA1 gene from several species, using an ENCODE alignment, of several species of the SERPINA1 gene. Identical residues are not shown (indicated by "."). Regions within the boxes, labeled 1-5, represent sites of sequence modification. Also, DNase I sensitivity regions in HepG2 cells are shown as black bars in the middle panel. CRMSBS1 includes changes to positions 1, 2, 3 and 4 in the box, and CRMSBS2 includes changes to positions 1, 3, 4 and 5 in the box. "CRM" refers to the cis-regulatory module. "SBS1/2" refers to Sangamo Biosciences internal numeric references for constructs 1 and 2. The light gray boxed area represents the SERPINA 1 gene sequences that were omitted.

[0044] In FIG. 6 schematically depicts CRMSBS1 and 2 constructs derived from CRMSBS1 without the MVM intron (CRMSBS1 Without Intron), or a truncated chimeric intron (CRMSBS1 T-Chimeric Intron), each construct containing the factor VIII BDD transgene. "CRM" refers to a cis-regulatory element. "SBS" refers to the Sangamo Biosciences internal numeric reference. "hFVIII" refers to human factor VIII-BDD. "SP" refers to a signal peptide. ICP refers to the inverted terminal repeat. "SPA" refers to a synthetic polyadenylation sequence. "Inc1" and "Inc3" are as shown above in FIG. 2.

[0045] In FIG. 7 schematically depicts CRMSBS2 and 2 constructs derived from CRMSBS2 without the MVM intron (CRMSBS2 Without Intron), or a truncated chimeric intron (CRMSBS2 T-Chimeric Intron), each construct containing the factor VIII BDD transgene. "CRM" refers to a cis-regulatory element. "SBS" refers to the Sangamo Biosciences internal numeric reference. "hFVIII" refers to human BDD factor VIII. "SP" refers to a signal peptide. ICP refers to the inverted terminal repeat. "SPA" refers to a synthetic polyadenylation sequence. "Inc1" and "Inc3" are as shown above in FIG. 2.

[0046] In FIG. 8A and 8B are graphs showing in vivo production of secreted human BDD factor VIII following administration of these constructs to mice. C57BL/6 mice were transduced with 6E+12 gv/kg (viral genomes per kg) of AAV2/6 hFVIII-BDD constructs. On FIG. 8A depicts the levels of secreted hFVIII-BDD on day 7 after administration, and FIG. 8B depicts secreted 4FVIII-BDD levels during the 28 day study. The left y-axis of each graph shows ng/mL and the right y-axis shows percentage of normal, where 1 U = 100% of normal = 200 ng/ml. *** denotes p >. 001, * stands for p>. 05. Each individual form within the groupings represents results from a single animal.

[0047] In FIG. 9A and 9B depict liver-specific expression of the F8-BDD cDNA after administration of the vectors as described in FIG. 7. In FIG. 9A depicts human factor VIII-BDD (hFVIII) mRNA levels assayed from the indicated tissues (brain, heart, kidney, lung, liver, spleen, testes). As shown, hFVIII-BDD mRNA was detected only in the liver and was not detected in other tissues, either from the original cDNA of the F8-BDD construct (open symbols) or from CRMSBS2 without intron (shaded symbols). On FIG. 9B shows the biodistribution of the vector (VV) genome from the same tissues shown in FIG. 9A. The AAV2/6 serotype was predominantly transduced in the liver.

[0048] In FIG. 10 is a schematic representation of the CRMSBS2 construct, and additional constructs (labeled CRMSBS2 SBR Introns 1, 2, or 3). All constructs include the human factor VIII BDD transgene. "CRM" refers to a cis-regulatory element. "SBS" refers to the Sangamo Biosciences internal numeric reference. "hFVIII" refers to the human factor VIII-BDD transgene. "SP" refers to a signal peptide. ICP refers to the inverted terminal repeat. "SPA" refers to a synthetic polyadenylation sequence. "MVM" refers to the MVM intron sequence.

[0049] In FIG. 11 is a schematic representation of the wild-type mouse small virus (MVM) intron ("MTV MVM") including partial sequence (SEQ ID NO: 14) and location of donors and acceptors. "D1" and "D2" refer to donors 1 and 2, respectively. "A1" and "A2" refer to acceptors 1 and 2, respectively. "IES" refers to the intron enhancer sequence. See also Haut and Pintel (1998) J. Virology 72:1834-1843 and Haut and Pintel (1998) Virology J. 258:84-94.

[0050] In FIG. 12 (SEQ ID NO: 15) depicts an overview of changes in the wild-type MVM intron in SBR Intron 1, which is used in the constructs described herein. Changes are marked in gray and include: a minor mutation for potential branch point acceptor 1 (PBPA1); mutated acceptor site 1 of the polypyrimidine tract, A1PPT(-); mutated acceptor site 1, A1(-); improved potential branch point 2 acceptor site, PBPA2(+); enhanced acceptor site 2 of the polypyrimidine tract, A2PPT (+, 8T) by adding more thymidines (T); Improved acceptor site 2, A2(+).

[0051] In FIG. 13 (SEQ ID NO: 16) depicts an overview of the changes in the wild-type MVM intron in SBR Intron 2, which is used in the constructs as described herein. Changes are marked in gray and include: a minor mutation for potential branch point acceptor 1 (PBPA1); mutated acceptor site 1 of the polypyrimidine tract, A1PPT(-); mutated acceptor site 1, A1(-); enhanced acceptor site 2 of the polypyrimidine tract, A2PPT (+, 8T) by adding more thymidines (T); Improved acceptor site 2, A2(+).

[0052] In FIG. 14 (SEQ ID NO: 17) depicts an overview of the changes in the wild-type MVM intron in SBR Intron 3, which is used in the constructs as described herein. Changes are marked in gray and include: mutation of the G-rich intron enhancer sequence, IES knockout (IES ko); a minor mutation for potential branch point acceptor 1 (PBPA1); mutated acceptor site 1 of the polypyrimidine tract, A1PPT(-); mutated acceptor site 1, A1(-); enhanced acceptor site 2 of the polypyrimidine tract, A2PPT (+, 9T) by adding more thymidines (T); Improved acceptor site 2, A2(+).

[0053] In FIG. 15A and 15B depict in vivo production of B-deleted human secreted factor VIII in mice with novel intron sequences. On FIG. 15 is a graph showing levels of human B-deleted factor VIII secreted in mice, represented as either ng/mL (left y-axis) or percent normal (right y-axis), 1 U = 100% normal = 200 ng/ml. C57BL/6 mice were transduced with 6E+12 gv/kg of AAV2/6 hFVIII constructs as indicated on the x-axis. On FIG. 15A shows secreted hFVIII levels on day 7. On FIG. 15B depicts peak levels of secreted hFVIII during the 28 day study. The numbers represent the average percentage of normal hFVIII levels for the group.

[0054] In FIG. 16A and 16B show that FVIII-BDD cDNA expression is liver specific. On FIG. 16A is a graph showing the mRNA values encoding human factor VIII (hFVIII) that were analyzed from tissues (brain, heart, kidney, lung, liver, spleen, testes) in the assay shown in FIG. 15. hFVIII mRNA was detected only in the liver and was not detected in other tissues, either from the original cDNA construct F8 (open symbols) or from CRMSBS2 SBR Intron 3 (shaded symbols). On FIG. 16B depicts the biodistribution of the vector (VV) genome from the same tissues analyzed in FIG. 16A. Serotype AAV2/6 was predominantly transduced in the liver, as previously published.

[0055] In FIG. 17A and 17B depict supraphysiological plasma levels of enzymatically active human factor VIII-BDD in mice suffering from hemophilia A. FIG. 17 is a graph showing the levels of enzymatically active secreted human factor VIII (hFVIII) with B-domain deleted in R593C mice suffering from hemophilia A, presented as a percentage of normal, 1 U = 100%. Hemophilia A R593C knockout mice were transduced with ~7E+12 gv/kg of the AAV2/6 hFVIII-BDD construct as shown on the x-axis. On FIG. 17A depicts the activity levels of secreted hFVIII on day 14. On FIG. 17B shows secreted hFVIII levels at day 42. The numbers represent the average percentage of normal hFVIII levels for the group.

[0056] Figure 18 is a graph showing bleeding time in hemophilia A R593C mice treated with F8 CRMSBS2 SBR Intron 3 cDNA. dissection of the tail vein.

[0057] In FIG. 19 schematically depicts CRMSBS1 and new generic constructs without the MVM intron or chimeric intron together with the B domain deleted factor VIII transgene and Inc1-Inc3. CRM refers to the cis-regulatory element. SBS refers to Sangamo Biosciences. hFVIII refers to human factor VIII. SP refers to a signal peptide. ICP refers to the inverted terminal repeat. SPA refers to a synthetic polyadenylation sequence. "Inc1" and "Inc3" are as shown above in FIG. 2.

[0058] In FIG. 20 schematically depicts CRMSBS2 and new type constructs without the MVM intron, chimeric intron or SBR Intron 3 together with the B domain deleted factor VIII transgene and Inc1-Inc3. CRM refers to the cis-regulatory element. SBS refers to Sangamo Biosciences. hFVIII refers to human factor VIII. SP refers to a signal peptide. ICP refers to the inverted terminal repeat. SPA refers to a synthetic polyadenylation sequence. "Inc1" and "Inc3" are as shown above in FIG. 2.

[0059] In FIG. 21 is a graph showing the assessment of hFVIII levels and activity by in vitro expression of AAV F8 cDNA in HepG2 cells. AAV2/6 F8 cDNA (CRMSBS2 SBR Intron 3) was added to HepG2 cells at doses of viral genomes 4.8E+06, 2.4E+06, 1.2E+-6 and 0.6E+06 per 1E+05 cells in 24- hole bowl (denoted as the time t0 days). Supernatants were analyzed for secreted hFVIII levels by ELISA (leftmost bars) and APTT (activated partial thromboplastin time) clotting activity (rightmost bars) and chromogenic activity assay (middle bars) were analyzed for seven days (t7) after addition of AAV2 virus /6. The results showed a good correlation between secreted hFVIII levels and activity (reported as U/mL on the left axis and Percent of Normal on the right y-axis, 1 U/mL = 100 Percent of Normal). Data shown are n=6 biological repeats. The "whiskers" of the errors represent the standard error of the mean.

[0060] In FIG. 22 is a graph showing improved product yields in the context of the CRMSBS1 or CRMSBS2 intron series. The virus was produced in HEK293 cells, output from two cell factories (2 CF). CRM refers to the cis-regulatory element. SBS refers to Sangamo Biosciences. hFVIII refers to human factor VIII. SP refers to a signal peptide. ICP refers to the inverted terminal repeat. SPA refers to a synthetic polyadenylation sequence. Ins1 and Ins3 refer to insulator 1 and insulator 3, respectively.

[0061] In FIG. 23 is a graph showing hFVIII-BD production levels in wild-type mice using multiple AAV serotypes as shown. Male C57BL/6 mice were intravenously injected with 6E+10 gv/mouse (~2E+12 gv/kg) for constructs AAV2/5 and AAV2/9 or 6E+10 gv/mouse (~2E+12 gv/kg) and 1, 8E+11 gw/mouse (~ 7E+12 gw/kg) for constructs AAV2/6 and AAV2/8. The figure depicts supraphysiological hFVIII-BDD found in the plasma of all samples except for some of the lower doses of AAV2/6 and AAV 2/5.

[0062] In FIG. 24 is a graph showing the relative expression of the hFVIII-BDD transgene in wild-type mice when the transgene was delivered via AAV2/6, purified by either HEK293 (HEK) production or baculovirus production in Sf9 (Sf9) cells. Transgene used with original F8 cDNA (FIG. 4). Male C57BL/6 mice were injected with the original F8 cDNA by intravenous injection (tail vein) of 1.8E+11 gv/mouse (~7E+12 gv/kg) of the original AAV2/6 F8 cDNA produced by either HEK293 or Sf9/rBV cells. (recombinant baculovirus). Processing of the original F8 cDNA from HEK293 cells achieved a mean peak value of 142.1% ± 8.3% SOS (n=8) (measured by hFVIII ELISA) of normal human FVIII plasma levels. A similar level of 132.8% ± 18.6% SOS (n=5) (measured by hFVIII ELISA) was achieved after mice were injected with the original F8 (Sf9/rBV) cDNA.

[0063] In FIG. 25A and 25B depict the level of expression in mice of the cDNA donor of the CRBSBS2 SBR transgene Intron 3 (Ins1-Ins3). On FIG. 25A is a schematic of a donor, which is also shown in FIG. 10. In FIG. 25B shows the amount of hFVIII-BDD found in plasma, expressed both as ng/mL and as a percentage of normal (in normal human plasma). Male C57BL/6 mice were intravenously injected with 1.8E + 11 gv/mouse (~ 7E + 12 gv/kg) cDNA AAV2/6 CRMSBS2 SBR Intron 3 (n=8). Average peak plasma levels of hFVIII-BDD in C57BL/6 mice measured by hFVIII ELISA are shown.

[0064] In FIG. 26A and 26B depict dosing schedules for human FVIII-BDD in various non-human primate (NHP) studies, including studies with removal of all immunosuppression at day 103. On FIG. 26A shows an overview of the dosing of Rituxan and Solu-Medrol. Rituxan dosing (10 mg/kg, i.v.) was the pre-test drug, while daily dosing of methylprednisolone (Solu-Medrol) (10 mg/kg, i.m.) was administered until day 103. Figure 26B depicts dosing schedules for experiments with the addition of pre-test and post-test drug, as well as the dosing time of Rituxan and Solu-Medrol. Groups 1-5 followed the immunosuppression regimen with pre-test injection, while Groups 6-8 followed the immunosuppression regimen with post-test injection. The duration of the study was 56 days.

[0065] In FIG. 27 is a graph showing the correlation between hFVIII activity and NHP levels treated with AAV2/6 4F8 cDNA. Cynomolgus monkeys were injected with prescription buffer or 6E+12 gv/kg AAV2/6 4F8 cDNA (original vector). On FIG. 27 shows individual animals for the formulation control group (Group 1, animal IDs 1101-1102) and the 6E+12 gw/kg dose group (Group 3, animal IDs 3101-3103). On day 14 after addition of the test preparation, circulating hFVIII levels and activity were analyzed by ELISA or APTT clotting activity. Normal FVIII levels in cynomolgus monkeys are ~1 U/mL (~100% of normal) reflected in the clotting activity data for the formulation control group, as the clotting activity assay is not specific for human FVIII. The ELISA is specific for human FVIII and not for cynomolgus FVIII, so it is expected that there will be no hFVIII levels measured by ELISA in the formulation control group. Group 3 animals have supraphysiological levels and circulating hFVIII activity above 8 U/mL (800% of normal).

[0066] In FIG. 28A and 28B are graphs showing liver enzyme profiles in NHP treated with AAV 4F8 cDNA. Cynomolgus monkeys were injected with prescription buffer or 6E+12 gv/kg AAV2/6 4F8 cDNA (original vector). Representative animal liver enzyme profiles are shown for formulation control group (Group 1, animal ID 1101) and dose group 6E+12 gw/kg (Group 3, animal ID 3102) as an indicator of liver health. Alanine aminotransferase (ALT) and aspartate aminotransferase (ACT) are shown. Permissible upper limit reference values that are still in the normal range for cynomolgus monkeys for ALT are 126 U/L and 120 U/L for ACT. For both the formulation control group and the cDNA group AAV 4F8 6A+12 gv/kg (parent vector), ALT/AST levels were increased after liver biopsy (liver biopsy was performed on day 41), indicated by an asterisk. On the other hand, AAV 4F8 cDNA was well tolerated throughout the study (247 days).

[0067] In FIG. 29A to 29D are graphs showing a summary of human FVIII plasma levels for an NHP study using AAV donors bearing B domain deleted factor VIII (F8) proteins (FVIII-BDD). On FIG. 29A shows results for Group 2 animals (AAV2/6, 2E+12 gv/kg); On FIG. 29B shows results for Group 3 animals (AAV2/6, 6E+12 gv/kg); On FIG. 29C shows results for Group 4 animals (AAV2/8, 6E+12 gv/kg); and in FIG. 29D shows the results for Group 5 animals (AAV2/8, 6E+12 gv/kg). 1 U/ml of human factor VIII is considered physiologically normal and thus equals 100% of normal physiological circulating human factor VIII.

[0068] In FIG. 30 is a graph showing peak human FVIII antigen levels during the post-treatment study in non-human primates (NHP) with the indicated constructs (in AAV6 or AAV8 vectors). At dose levels of 2E+12 gv/kg (n=3), peaks of 111.0%, 493.9%, and 840.0% (overall mean 481.6% as measured by hFVIII ELISA) of normal hFVIII levels were achieved. human in blood plasma. At the higher dose of 6E+12 gv/kg (n=3), peaks of 450.0%, 625.6%, and 886.7% [654.1% overall mean] hFVIII plasma levels were achieved. The overall mean for AAV8 was 147.1%.

[0069] In FIG. 31A to 31C are graphs showing results from individual cynomolgus monkeys (n=3, animals 2101, 2102, and 2103) treated with a low dose (2E+12 gv/kg, Group 2) of AAV2/6-FVIII-BDD cDNA, in within 168 days after dosing. In all three graphs, plasma concentrations of FVIII-BDD measured by ELISA are shown in black. In addition, FVIII neutralizing antibody concentrations (shown as Bethesda units) in plasma are shown in grey. The dotted horizontal line represents the cut-off point of the Bethesda unit, below which values will not be considered positive for FVIII neutralizing antibodies. Solu-Medrol was stopped on day 103, as indicated by the dotted vertical line. Each plot shows results for one monkey: FIG. 31A depicts animal 2101; in FIG. 31B depicts animal 2102; and in FIG. 31C depicts animal 2103.

[0070] In FIG. 32A to 32C are graphs showing results from individual cynomolgus monkeys (n=3, animals 3101, 3102, and 3103) treated with a high dose (6E+12 gv/kg, Group 3) of AAV2/6-FVIII-BDD cDNA, in within 168 days after dosing. In all three graphs, plasma concentrations of FVIII-BDD measured by ELISA are shown in black. In addition, FVIII neutralizing antibody concentrations (shown as Bethesda units) in plasma are shown in grey. The dotted horizontal line represents the cut-off point of the Bethesda unit, below which values will not be considered positive for FVIII neutralizing antibodies. Solu-Medrol was stopped on day 103, as indicated by the dotted vertical line. Each plot shows results for one monkey: FIG. 32A depicts animal 3101; in FIG. 32B depicts an animal 3102; and in FIG. 32C depicts animal 3103.

[0071] In FIG. 33A to 33D are graphs showing results from individual cynomolgus monkeys (n=3, animals 4101, 4102 and 4103) treated with a high dose (6E+12 gv/kg, Group 4) of AAV2/8-FVIII-BDD cDNA, in within 168 days after dosing. In plots 33A-33C, plasma concentrations of FVIII-BDD measured by ELISA are shown in black. In addition, FVIII neutralizing antibody concentrations (shown as Bethesda units) in plasma are shown in grey. On FIG. 33D depicts the "blow-up" of the lower values in the plot for animal 4103 (note that the y-axis in Figs. /ml FVIII antigen). The dotted horizontal line represents the cut-off point of the Bethesda unit, below which values will not be considered positive for FVIII neutralizing antibodies. Solu-Medrol was stopped on day 103, as indicated by the dotted vertical line. Each plot shows results for one monkey: FIG. 33A depicts animal 4101; in FIG. 33B depicts animal 4102; in FIG. 33C and 33D show animal 4103.

[0072] In FIG. 34A to 34E are graphs showing results from individual cynomolgus monkeys (n=3) treated with a high dose (6E+12 gv/kg, Group 5) of AAV2/8-FVIII-BDD cDNA for 168 days post dosing. On FIG. 34A-34C plasma concentrations of FVIII-BDD measured by ELISA are shown in black. In addition, FVIII neutralizing antibody concentrations (shown as Bethesda units) in plasma are shown in grey. On FIG. 34D and 34E depict the "blow-ups" of the lower values on the graph (note that the y-axis in Figs. 34A-C is from 0-5 U/ml of FVIII antigen, while the axis in Figs. 34D and 34E is from 0- 1 U/ml FVIII antigen). The dotted horizontal line represents the cut-off point of the Bethesda unit, below which values will not be considered positive for FVIII neutralizing antibodies. Solu-Medrol was stopped on day 103, as indicated by the dotted vertical line. Each graph shows the results for one monkey (animal 5101: Fig. 34A, 5102: Fig. 34B and 5103: Fig. 34C).

[0073] In FIG. 35A and 35F are graphs showing the administration of hFVIII therapeutic to animals expressing the hFVIII transgenic. Cynomolgus monkeys from Groups 1, 3, 4 and 5 (animal ID 1101, 3101, 3103, 4103, 5101, 5102) were administered the biological preparation hFVIII Xyntha®, the administrations consisted of four weekly infusions of 25 U/kg Xyntha®, as shown in Fig. Fig. 35A-35F as inverted triangles. Xyntha® administrations corresponded to days 198, 205, 212, 219 (after cDNA addition of AAV test preparation 4F8 on day 0). Due to the short half-life of hFVIII and the weekly plasma collection, no increase in hFVIII levels from Xyntha® hFVIII biologic was observed. However, there was an increase in inhibitory antibodies after administration of Xyntha® (measurement in Bethesda units, BU) in formulation control group 1 (see animal ID 1101, which received no AAV 4F8 cDNA, Fig. 35A). As shown in FIG. 35A, BU reached ~0.9 BU/mL after Xyntha® administration, indicated by the gray area of the graph. Animal with unique ID 3103 had a high BE level, above BU/mL for many weeks, and the added hFVIII biologic test (indicated by dashed vertical lines) did not elicit additional detectable inhibitory antibodies (BE) (FIG. 35B). In all groups that received AAV 4F8 cDNA and had stable levels of hFVIII, no increase in inhibitory antibodies, BE, was observed (Figures 35C to F, indicated by gray arrows). On FIG. 35C shows that hFVIII levels for animal ID 3101 were stable for 19 weeks at ~150% of normal hFVIII levels, and FIG. 35D shows that hFVIII levels for animal ID 4103 were stable for 19 weeks at ~10% of normal hFVIII levels. On FIG. 35E shows that hFVIII levels for animal ID 5101 were stable for 19 weeks at ~15% of normal hFVIII levels, while FIG. 35F hFVIII levels for animal ID 5102 were stable for 19 weeks at ~35% of normal hFVIII levels. The dotted horizontal line represents the articulation point of the Bethesda unit, below which values would not be considered positive for FVIII neutralizing antibodies. The vertical dotted line represents the withdrawal of Solu-Medrol on day 103 of post-test drug administration in FIG. 35V, 35E and 35F.

[0074] In FIG. 36A and 36B depict in vitro expression of h VIII-BDD from an endogenous albumin locus in HepG2 cells. On FIG. 36A is a graph showing hFVIII-BDD detected in HepG2 cell supernatant over time (t = days) after administration of albumin-targeted ZFNs (SBS#47171/47898, AAV2/6-ZFN) and hFVIII-BDD AAV2/6 cDNA -FVIII-BDD (CRMSBS2 Without Intron) into HepG2 AAV2/6-FVIII-BDD cells introduced at 3.0E+04, 6.0E+04 and 1.2E+05 together with AAV2/6-ZFN 3.0E+05 . On FIG. 36B is a graph showing hFVIII cDNA alone (without ZFN). Data shown are n=3 biological repeats. The "whiskers" of the errors represent the standard error of the mean of the repetitions. The dotted line represents the limit of detection of hFVIII by ELISA.

[0075] In FIG. 37 is a graph showing in vitro detection of targeted integration of the hFVIII-BDD transgene into the endogenous albumin locus. Directional integration was detected by quantitative PCR containing an albumin insertion site. The 5' PCR primer was located within the endogenous human albumin locus, the PCR probe was located within the hFVIII-BDD ICR cassette, and the 3' primer was located within the hFVIII-BDD transgene. Displayed numbers are normalized to the GAPDH housekeeping gene.

[0076] In FIG. 38 is a graph showing peak levels of human FVIII antigen after treatment in non-human primates (NHP) according to the graph depicted in FIG. 26V. Groups 1-5 followed an immunosuppression (IS) regimen with injection of the pre-test drug. At dose levels of 6E+11 gv/kg (n=3, Group 3), the overall mean peak value was 5.7% (measured by hFVIII ELISA) of normal human plasma hFVIII levels. At the higher dose of 2E+12 gw/kg (n=3, Group 4), the overall mean peak values were 56.4%, and at 6E+12 gw/kg (n=3, Group 5), the overall mean Peak values were 229.0% (measured by hFVIII ELISA) of hFVIII plasma levels. Shaded gray are Groups 7 and 8, which followed the IS post-test drug regimen. At the 2E+12 gw/kg dose level (n=3, Group 7), the overall mean peak value was 87.9%, and for the 6E+12 gw/kg (n=3, Group 8) it was 101.7%. Groups 1 and 6 were composition control groups, designated Composition.

[0077] In FIG. 39 is a graph showing results after repeated administration to subjects in the 2E+11 gv/kg cohort depicted in FIG. 38 using the same serotype, resulting in detection of levels of circulating human FVIII antigen. Group 2, representing the initial dose of 2E+11 gv/kg (n=3), was re-assigned to the dose of 9E+11 gv/kg (n=3) on the 56th day of the study (Fig. 26B). The levels of circulating human FVIII antigen seven days after the second dose are shown, indicated by a semi-open circle (day 7 at the new dose of 9E+11 gv/kg). All other data is the same as in Fig. 38 (peak levels as on study day 56).

[0078] In FIG. 40A and 40B are graphs showing in vitro production and detection of hVIII from the endogenous albumin locus. On FIG. 40A depicts the total levels of hFVIII found in HepG2 cell supernatant after administration of albumin-targeted ZFNs (SBS#42906/43043) and hFVIII cDNA (CRMSBS2 SBR Intron 3) into HepG2 cells (analyzed on day 19). In this example, hFVIII cDNA was used in increasing doses from 3.0E+04, 6.0E+04 and 1.2E+05 along with ZFN 3.0E+05. Also shown is hFVIII cDNA with GFP (no ZFN) to control total virus added to cells, and one hFVIII cDNA (no ZFN), both of which show barely detectable secreted hFVIII. This is due to the fact that episomal hFVIII is degraded before the accumulation of a sufficient amount of detectable secreted hFVIII. Data shown are n=2 biological repeats. The "whiskers" of errors represent the standard error of the mean of technical and biological replicates. The dotted line represents the limit of detection of hFVIII by ELISA. On FIG. 40B depicts levels of targeted integration of endogenous albumin-hFVIII by NHEJ (non-homologous end joining) using qPCR. The 5' primer is located at the endogenous human albumin locus, the probe is located within the hFVIII ICR cassette, and the 3' primer is located within hFVIII.

DETAILED DESCRIPTION OF THE INVENTION

[0079] This document describes expression cassettes for transgene expression, in particular in liver cells. The constructs can be used to deliver any transgene(s) to liver cells, in vivo or in vitro, and can be used to treat and/or prevent any disease or disorder that can be alleviated by providing one or more transgenes. In contrast to currently used liver-targeted constructs, the constructs described herein include modified enhancer and/or intron sequences and furthermore express the transgene at high levels even without the use of the MVM intron. These constructs are also small, making them suitable for use with transgenes that are delivered using small vector systems such as AAV.

[0080] The constructs described herein can be used to express hFVIII BDD in the liver of non-human primates. Depending on the initial dose of hF8 AAV expression cassette cDNA, circulating hFVIII plasma levels were above 800% of normal circulating hFVIII. After these initial high doses, many animals expressed 10-150% of normal levels for more than eight weeks. In addition, some animals did not show an antibody response to hFVIII when injected with hFVIII protein (Xyntha®), suggesting that these animals developed tolerance to the hFVIIII protein during the course of the experiment.

General provisions

[0081] To implement the methods in practice, as well as in the preparation and use of the compositions described herein, unless otherwise indicated, conventional methods of molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related methods are used. areas that are within the competence of a person skilled in the art. These methods are fully described in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press, 1989 and Third Edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and updates from time to time; series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third Edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (P.M. Wassarman and A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P.B. Becker, ed.) Humana Press, Totova, 1999.

Definitions

[0082] The terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably to refer to a deoxyribonucleotide or ribonucleotide polymer, linear or circular conformation, and in either single or double stranded form. For the purposes of this invention, these terms should not be construed as limiting the length of the polymer. The terms may include known analogs of naturally occurring nucleotides, as well as nucleotides that are modified in the base, sugar, and/or phosphate moieties (eg, phosphorothioate backbones). In general, an analog of a particular nucleotide has the same base pairing specificity; that is, the analog of A will be a base pair with T.

[0083] The terms "polypeptide", "peptide", and "protein" are used interchangeably to refer to a polymer of amino acid residues. The term also refers to amino acid polymers in which one or more amino acids are chemical analogs or modified derivatives of the corresponding naturally occurring amino acids.

[0084] "Recombination" refers to the process of exchanging genetic information between two polynucleotides, including, but not limited to, nonhomologous end joining (NHEJ) capture and homologous recombination. For the purposes of this invention, the term "homologous recombination (HR)" refers to a specialized form of such exchange, which occurs, for example, in the repair of double-strand breaks in cells using homologous repair mechanisms.

[0085] In some descriptions, one or more target nucleases, as described herein, create a double strand break (DSB) in a target sequence (eg, cell chromatin) at a predetermined site (eg, albumin gene). The DCR provides construct integration as described in this document. Optionally, the construct has homology to the nucleotide sequence at the break. The expression construct may be physically integrated, or alternatively, the expression cassette is used as a template to repair the break by homologous recombination, which results in the introduction of all or part of the nucleotide sequence as an expression cassette into the cell chromatin. Thus, the first sequence in the cellular chromatin can be changed and in certain embodiments of the invention can be converted to a sequence present in the expression cassette. Thus, the use of the terms "substitute" or "substitution" can be understood as the substitution of one nucleotide sequence for another (ie, sequence substitution in the informational sense) and does not necessarily require physical or chemical substitution of one polynucleotide for another.

[0086] In any of the methods described herein, the exogenous nucleotide sequence ("expression construct" or "expression cassette" or "vector") may contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, those thereby stimulating homologous recombination to insert a non-identical sequence into the region of interest. Thus, in certain embodiments, portions of the expression cassette sequence that are homologous to sequences in the region of interest exhibit about 80% to 99% (or any integer in that range) sequence identity with the genomic sequence that is replaced. In other embodiments, the homology between the expression cassette and the genomic sequence is greater than 99%, for example, if only one nucleotide differs between the homologous regions of the expression cassette and the genomic sequences by more than 100 contiguous base pairs. In some cases, the non-homologous portion of the expression cassette may contain sequences not present in the region of interest so that new sequences are introduced into the region of interest. In these cases, the non-homologous sequence is typically flanked by sequences of 50-1000 base pairs (or any integer value in that range) or any number of base pairs greater than 1000 that are homologous or identical to sequences in the region of interest.

[0087] The term "sequence" refers to a nucleotide sequence of any length, which may be DNA or RNA; may be linear, circular or branched, and may also be single or double stranded. The term "transgene" refers to a nucleotide sequence that is introduced into the genome. The transgene can be of any length, for example, from 2 to 100,000,000 nucleotides in length (or any integer in this range or greater), preferably from about 100 to 100,000 nucleotides in length (or any integer in this range), more preferably from about 2000 to 20000 nucleotides in length (or any value in this range) and even more preferably from about 5 to 15 kb. n (or any value in this range).

[0088] A "chromosome" is a chromatin complex containing the entire genome or a portion of a cell's genome. A cell's genome is often characterized by its karyotype, which is the totality of all the chromosomes that contain the cell's genome. The genome of a cell may contain one or more chromosomes.

[0089] An "episome" is a replicating nucleic acid, nucleoprotein complex, or other structure comprising a nucleic acid that is not part of a cell's chromosomal karyotype. Examples of episomes include plasmids and some viral genomes. The liver-specific constructs described herein may be episomal maintained or, alternatively, may be stably integrated into a cell.

[0090] An "exogenous" molecule is one that is not normally present in a cell, but can be introduced into the cell by one or more genetic, biochemical, or other means. "Normal presence in a cell" is defined in relation to the specific developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is only present during embryonic muscle development is an exogenous molecule with respect to a mature muscle cell. Similarly, a heat shock induced molecule is an exogenous molecule with respect to a cell that has not been subjected to heat shock. An exogenous molecule may comprise, for example, a functioning variant of a malfunctioning endogenous molecule or a malfunctioning variant of a normally functioning endogenous molecule.

[0091] The exogenous molecule may be, inter alia, a small molecule, such as one generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex containing one or more of the above molecules. Nucleic acids include DNA and RNA, may be single or double stranded; may be linear, branched or ring; and can be of any length. Nucleic acids include those capable of forming duplexes as well as triplex-forming nucleic acids. See, for example, US Pat. Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, deubiquitinases, integrases, recombinases, ligases, topoisomerases, gyrase and helicase.

[0092] An exogenous molecule can be the same type of molecule as an endogenous molecule, such as an exogenous protein or nucleic acid. For example, the exogenous nucleic acid may contain the infecting viral genome, a plasmid or episome introduced into the cell, or a chromosome that is not normally present in the cell. Methods for introducing exogenous molecules into cells are known to those skilled in the art and include, but are not limited to, lipid-mediated transfer (i.e. via liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment , calcium phosphate co-precipitation, DEAE-dextran mediated transfer, and viral vector mediated transfer. The exogenous molecule can also be the same type of molecule as the endogenous molecule but derived from a different species than the cell. For example, a human nucleic acid sequence may be introduced into a cell line originally derived from a mouse or hamster. Methods for introducing exogenous molecules into plant cells are known to those skilled in the art and include, but are not limited to, protoplast transformation, silicon carbide (e.g., WHISKERS™), Agrobacterium-mediated transformation, lipid-mediated transfer (i.e., via liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment (eg, using a "gene gun"), calcium phosphate coprecipitation, DEAE-dextran mediated transfer, and viral vector mediated transfer.

[0093] In contrast, an "endogenous" molecule is one that is normally present in a particular cell at a particular stage of development under particular environmental conditions. For example, an endogenous nucleic acid may comprise a chromosome, a mitochondrial, chloroplast, or other organelle genome, or a naturally occurring episomal nucleic acid. Additional endogenous molecules may include proteins, such as transcription factors and enzymes.

[0094] As used herein, the term "exogenous nucleic acid product" includes both polynucleotide and polypeptide products, such as transcription products (polynucleotides, such as RNA) and translation products (polypeptides).

[0095] A "fusion" molecule is one in which two or more subunit molecules are linked, preferably covalently. The subunit molecules may be of the same chemical type or may be of different chemical types. Examples of fusion molecules include, but are not limited to, fusion proteins (eg, a fusion between a protein DNA binding domain and a cleavage domain), fusions between a polynucleotide DNA binding domain (eg, sgRNA) operably associated with a cleavage domain, and fusion nucleic acids. (eg, nucleic acids encoding a fusion protein).

[0096] Expression of a fusion protein in a cell can result from delivery of the fusion protein into the cell, or delivery of a polynucleotide encoding the fusion protein into the cell, the polynucleotide being transcribed and the transcript translated to generate the fusion protein. Trans-splicing, polypeptide cleavage, and polypeptide ligation may also be involved in protein expression in a cell. Methods for delivering polynucleotides and polypeptides to cells are presented elsewhere in this specification.

[0097] "Gene" for the purposes of this description includes the region of DNA encoding the gene product (see below), as well as all regions of DNA that regulate the production of the gene, regardless of whether such regulatory sequences are adjacent to the coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and control regions. loci.

[0098] The term "gene expression" refers to the conversion of information contained in a gene into a gene product. A gene product can be a direct transcriptional product of a gene (eg, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNAs that are modified by methods such as capping, polyadenylation, methylation, and editing, as well as proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0099] The term "modulation" of gene expression refers to a change in the activity of a gene. Modulation of expression may include, but is not limited to, gene activation and gene repression. Genome editing (eg, cleavage, alteration, inactivation, random mutation) can be used to modulate expression. The term "gene inactivation" refers to any decrease in gene expression compared to a cell that does not contain ZFP, TALE, or the CRISPR/Cas system, as described herein. Thus, gene inactivation can be partial or complete.

[0100] A "region of interest" is any region of cellular chromatin, such as, for example, a gene or non-coding sequence within or adjacent to a gene, in which binding of an exogenous molecule is desired. The binding may be for targeted DNA cleavage and/or targeted recombination. The region of interest may be present in a chromosome, episome, organelle genome (eg mitochondrion, chloroplast) or, for example, the infecting viral genome. The region of interest may be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions either upstream or downstream of the coding region. The region of interest can be as small as a single base pair, or up to 2000 base pairs in length, or any integer number of base pairs.

[0101] The term "eukaryotic" cells includes, but is not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells (e.g., T cells), including stem cells (pluripotent and multipotent).

[0102] The terms "operably linked" and "operably linked" (or "operably associated") are used interchangeably with reference to a juxtaposition of two or more components (such as elements of a sequence) in which the components are arranged such that both components function normally such that enables at least one of the components to mediate a function that affects at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operably linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is typically operably linked in a cis configuration to, but not necessarily directly adjacent to, a coding sequence. For example, an enhancer is a transcriptional regulatory sequence that is operably linked to a coding sequence although they are not contiguous.

[0103] A "functional fragment" of a protein, polypeptide, or nucleic acid is a protein, polypeptide, or nucleic acid whose sequence is not identical to the full-length protein, polypeptide, or nucleic acid, but which retains the same function as the full-length protein, polypeptide, or nucleic acid. A functional fragment may have more, fewer, or the same number of residues as the corresponding native molecule and/or may contain one or more amino acids or nucleotide substitutions. Methods for determining the function of a nucleic acid (eg, coding function, ability to hybridize with another nucleic acid) are well known in the art. Likewise, methods for determining protein function are also well known. For example, human factor VIII, with its B domain removed, is a functional fragment of the full-length factor VIII protein.

[0104] A polynucleotide "vector" or "construct" is capable of transferring gene sequences to target cells. In general, "vector construct", "expression vector", "expression construct", "expression cassette" and "gene transfer vector" means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. . Thus, the term includes cloning and expression vehicles as well as integrating vectors.

[0105] The terms "subject" and "patient" are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. . Accordingly, the term "subject" or "patient" as used herein means any mammalian patient or subject to whom the expression cassettes of this invention may be administered. Subjects of this invention include patients with the disorder.

Liver-Specific Expression Constructs

[0106] This document describes expression cassettes (constructs) for use in directing expression of a transgene in a liver cell, including in vivo after administration of the expression cassette (set) to a subject (eg, delivery to the liver). The expression construct can be maintained episomal and direct expression of the transgene extrachromosomally, or alternatively, the expression construct can be integrated into the genome of the liver cell, for example, via nuclease-mediated targeted integration.

[0107] The polynucleotide expression construct contains an enhancer sequence, a promoter sequence, and one or more transgenes. Optionally, one or more of the following is included: an intron sequence, a polyadenylation sequence, and/or a signal peptide. Any enhancer sequence can be used in the expression constructs described herein. In certain embodiments, the enhancer is a wild-type or modified Serpin1 enhancer (Chuah et al., (2014) Molecular Therapy, 22, 1605-1613; Nair et al., (2014) Blood, 123, 3195-3199) .

[0108] In preferred embodiments, the Serpin1 enhancer contains one or more mutations (eg, point mutations) compared to the wild type, for example, the Serpin1 enhancer contains one or more nucleotide modifications as depicted in FIG. 5, namely nucleotide modifications at one or more of residues 1, 5, 14, 32 and/or 39 of the sequence shown in any of SEQ ID NOs: 1-13. In certain embodiments, the Serpin1 enhancer contains modifications at positions 1, 5, 14, and 32 (constructs designated CRMSBS1) of any of SEQ ID NOs: 1-13, while in other embodiments, the Serpin1 enhancer contains a modification at positions 1 , 14, 32, and 39 (constructs designated CRMSBS2) or any of SEQ ID NOs: 1-13. Exemplary enhancer sequences are shown below:

CRMSBS1 (SEQ ID NO: 35):

CRMSBS2 (SEQ ID NO: 36): 5'

[0109] Similarly, any promoter sequence can be used in the expression cassettes of this invention. In certain embodiments of the invention, the promoter is a constitutive promoter. In other embodiments, the promoter is an inducible or tissue-specific promoter. In some embodiments, the promoter is a liver-specific promoter. In certain embodiments of the invention, the promoter is the minimal promoter of the transthyretin (TTRm) gene. In other embodiments, the promoter is the alpha-1 antitrypsin (hAAT) gene promoter.

[0110] Any of the polynucleotides described herein may additionally optionally contain an intron sequence. In certain embodiments, the expression construct includes a truncated chimeric intron sequence (T-chimeric intron), for example, as depicted in the lower panels of FIG. 6, 7, 19 and 20. The T-chimeric intron is a truncated version of the chimeric intron in pCI-neo (GenBank U47120). The chimeric intron in pCI-neo is the 5' splicing donor site from the human β-globin gene, as well as the branch point and 3' acceptor site of the immunoglobulin heavy chain variable region. The T-chimeric intron contains a 45 bp deletion. between the 5' splice donor and branch point. In other embodiments, the expression constructs comprise a mutated MVM intron sequence (eg, one or more of the mutations depicted in Figures 12, 13, and 14 (SEQ ID NOs: 15-17).

[0111] Alternatively, expression constructs as described herein may not have an intron sequence, such as shown in the constructs depicted in the middle panels of FIG. 6, 7, 19 and 20. An exemplary construct with annotations including a factor VIII transgene is shown below and it will be apparent that the F8 transgene can be replaced by any transgene and that the promoter and insulator sequences can be further modified as described herein: hF8 cDNA, without intron (full sequence including promoter module, poly A and Inc, CRMSBS2 Without intron) (SEQ ID NO: 34):

5'

[0112] Another exemplary construct with annotations including a factor VIII transgene is shown below, and it will also be apparent that the F8 transgene can be replaced by any transgene and that the promoter and insulator sequences can be further modified as described herein:

[0113] 4F8 cDNA including intron (full sequence including promoter module, poly A and Inc, CRMSBS2 SBR Intron 3) (SEQ ID NO: 37):

[0114] In preferred embodiments, the constructs described herein contain insulator (spacer) sequences as depicted in FIG. 1, 2, 4, 6, 7, 10, 19, 20 and 25. Exemplary insulator sequences include Inc1: 5' GGAACCATTGCCACCTTCA (SEQ ID NO: 28); Inc2: 5' CTATCCATTGCACTATGCT (SEQ ID NO: 29); Inc3: 5' TTTCTGTAACGATCGGG (SEQ ID NO: 30) and Inc4: 5' TTGAATTCATAACTATCCCAA (SEQ ID NO: 38).

[0115] Obviously, any transgene can be used in the constructs described in this document. In addition, the individual components (promoter, enhancer, insulator, transgene, and the like) of the constructs described herein can be mixed and matched in any combination.

[0116] The constructs described herein may be contained in any viral or non-viral vector. The constructs may be episomal maintained or may be integrated into the cell's genome (eg, via nuclease-mediated targeted integration).

[0117] Non-viral vectors include DNA or RNA plasmids, DNA MC, naked nucleic acid, and nucleic acid contained in a delivery vehicle such as a liposome, nanoparticle, or poloxamer. Viral vectors that can be used to transfer the expression cassettes described herein include, but are not limited to, retroviral, lentiviral, adenovirus, adeno-associated, vaccinia, and herpes simplex virus vectors. Integration into the host genome is possible using gene transfer techniques with retrovirus, lentivirus, and adeno-associated virus vectors, and as described herein, can be facilitated through nuclease-mediated integration.

[0118] In certain preferred embodiments, the constructs are incorporated into an adeno-associated virus ("AAV") vector or vector system that can be episomally maintained or integrated into the liver cell genome (eg, via nuclease-mediated targeted integration). Recombinant AAV vector constructs have been presented in a number of publications, including US Pat. No. 5,173,414; Tratschin et al., Mol. cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. cell. Biol. 4:2072-2081 (1984); Hermonat (Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0119] Thus, in certain embodiments of the invention, the expression construct is transferred to AAV constructs and additionally contains 5' and 3' ICP flanking elements of the expression construct (e.g., enhancer, promoter, facultative intron, transgene, and the like), as described in this document. Optionally, spacer molecules are also included between one or more components of the expression construct, for example between the 5' ICP and the enhancer and/or between the polyadenylation signal and the 3' ICP. Spacers can function as homologous arms to facilitate recombination to a "safe" locus (eg albumin). In certain embodiments of the invention, the structure is a structure as depicted in any of FIGS. 1, 2, 4, 6, 7, 10, 18, 19, 20 or 25.

[0120] In certain embodiments of the invention, AAV vectors, as described herein, can be obtained from any AAV. In certain embodiments, the AAV vector is derived from a defective and non-pathogenic parvovirus adeno-associated virus type 2. All such vectors are derived from a plasmid that retains only the 145 bp AAV inverted terminal repeats flanking the transgene expression cassette. The key features of this vector system are efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh. 10 and any new AAV serotype can also be used in accordance with this invention. In some embodiments, a chimeric AAV is used, where the viral origins of the LTR (long terminal repeat) viral nucleic acid sequences are heterologous with respect to the viral origins of the capsid sequences. Non-limiting examples include a chimeric virus with AAV2-derived PrEP and capsids derived from AAV5, AAV6, AAV8, or AAV9 (i.e., AAV2/5, AAV2/6, AAV2/8, and AAV2/9, respectively).

[0121] Retroviral vectors include those based on murine leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al. , J. Virol 66:2731-2739 (1992), Joharm et al., J. Virol 66:1635-1640 (1992), Sommerfelt et al., Virol 176:58-59 (1990) ; Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).

[0122] The constructs described herein can also be included in the adenoviral vector system. Adenovirus vectors are capable of very high efficiency transduction in many cell types and do not require cell division. With these vectors, a high titer and a high level of expression are obtained. This vector can be obtained in large quantities in a relatively simple system.

[0123] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical studies (Dunbar et al., Blood 85:3048-305 (1995); Kohn et al., Nat. Med. 1:1017-102 ( 1995); Malech et al., PNAS 94:22 12133-12138 (1997)). PA317/pLASN was the first therapeutic vector used in a gene therapy study. (Blaese et al., Science 270:475-480 (1995)). Transduction efficiencies of 50% or more have been observed with MFG-S packaged vectors. (Ellem et al., Immunol Immunother. 44(1):10-20 (1997); Dranoff et al., Hum. Gene Ther. 1:111-2 (1997).

[0124] Replication-deficient recombinant adenoviral vectors (Ad) can also be used with the polynucleotides described herein. Most adenoviral vectors are designed such that the transgene replaces the Ad E1a, E1b and/or E3 genes; subsequently, the replication-defective vector propagates in human 293 cells, which ensure the functioning of the deleted gene in the trans position. Ad vectors can transform several tissue types in vivo, including nondividing, differentiated cells such as those found in liver, kidney, and muscle. Ordinary Ad vectors are characterized by the ability to carry a large volume. An example of the use of the Ad vector in a clinical study included polynucleotide therapy for antitumor immunization by intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9 (1998)). Additional examples of the use of adenoviral vectors for gene transfer in clinical research include Rosenecker et al., Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).

[0125] Packaging cells are used to generate viral particles that are capable of infecting a host cell. Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus, and ψ2 cells or PA317 cells, which package retrovirus. Typically, viral vectors used in gene therapy are generated by a producer cell line that packages a nucleic acid vector into a viral particle. Vectors typically contain the minimum viral sequences necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are provided in trans by a packaging cell line. For example, AAV vectors used in gene therapy typically only have inverted terminal repeat (INR) sequences from the AAV genome that are required for packaging and integration into the host genome. The viral DNA is packaged into a cell line that contains a helper plasmid encoding other AAV genes, namely rep and cap, but does not contain the ICP sequence. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of the AAV genes from the helper plasmid. The helper plasmid is not packaged in significant quantities due to the lack of ICP sequence. The level of adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. In some embodiments of the invention, AAV is obtained using a baculovirus expression system.

[0126] In many gene therapy applications, it is desirable that the gene therapy vector be delivered to a specific tissue type with a high degree of specificity. Accordingly, the viral vector can be modified to obtain cell type specificity by expressing the ligand as a fusion protein to the viral envelope protein on the outer surface of the virus. The ligand is selected based on its affinity for a receptor known to be present on the cell type of interest. For example, in Han et al., Proc. Natl. Acad. sci. USA 92:9747-9751 (1995), it is reported that Moloney's mouse leukemia virus can be modified to express human heregulin fused to gp70, wherein the recombinant virus infects certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs in which the target cell expresses the receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (eg, FAB or Fv) that have a specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be designed to contain specific uptake sequences that promote uptake of the vector by certain target cells.

[0127] The polynucleotides described herein may include one or more non-natural bases and/or backbones. In particular, an expression cassette as described herein may include methylated cytosines to achieve transcriptional rest in the region of interest.

[0128] In addition, expression constructs as described herein may also include additional transcriptional or translational regulatory or other sequences, e.g., Kozak sequences, additional promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites and/or polyadenylation signals. In addition, control elements of genes of interest can be operably linked to reporter genes to create chimeric genes (eg, reporter expression cassettes).

transgenes

[0129] The constructs described herein can be used to deliver any transgene to the liver. Exemplary transgenes (also referred to as genes of interest and/or exogenous sequences) include, but are not limited to, any polypeptide coding sequence (e.g., cDNA), promoter sequences, enhancer sequences, epitope tags, marker genes, cleavage enzyme recognition sites, and various types of expression constructs. . Marker genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding stained or fluorescent or luminescent proteins (e.g. , green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins that mediate enhanced cell growth and/or gene amplification (eg, dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tar, HA, or any detectable amino acid sequence.

[0130] In a preferred embodiment, the transgene contains a polynucleotide encoding any polypeptide whose expression is desired in a cell, including, but not limited to, antibodies, antigens, enzymes, receptors (cell surface or nuclear), hormones, lymphokines, cytokines, reporter polypeptides , growth factors and functional fragments of any of the above. The coding sequences may be, for example, cDNA.

[0131] In certain embodiments, the transgene(s) encode(s) functional protein variants that are absent or deficient in any genetic disease, including, but not limited to, lysosomal storage diseases (e.g., Gaucher, Fabry, Hunter disease). , Hurler, Niemann-Pick and the like), metabolic diseases and/or blood diseases such as hemophilia and hemoglobinopathies and the like. See, for example, US patent No. 20140017212 and 20140093913; U.S. Patent Nos. 9,255,250 and 9,175,280.

[0132] For example, the transgene may contain a sequence encoding a polypeptide that is absent or non-functional in a subject having a genetic disease, including, but not limited to, any of the following genetic diseases: achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency (OMIM No. 102700 ), adrenoleukodystrophy, Ecardi syndrome, alpha-1 antitrypsin deficiency, alpha thalassemia, androgen insensitivity syndrome, Apert syndrome, arrhythmogenic right ventricular dysplasia, telangiectatic ataxia, Barth's syndrome, beta thalassemia, blue vesicular nevus syndrome, Canavan disease, chronic granulomatous diseases (CGD), crying cat syndrome, cystic fibrosis, Derkum's disease, ectodermal dysplasia, Fanconi anemia, fibrodysplasia ossificans progressive, fragile X syndrome, galactosemia, Gaucher disease, generalized gangliosidoses (eg, GM1), hemochromatosis, hemoglobin C in 6 mutation ^-m codon beta-globin a (HbC), hemophilia, Huntington's disease, Hurler's syndrome, hypophosphatasia, Klinefelter's syndrome, Krabbe's disease, Langer-Giedion's syndrome, leukocyte adhesion deficiency (LAD, OMIM No. 116920), leukodystrophy, QT interval prolongation syndrome, Marfan's syndrome, Möbius's syndrome, mucopolysaccharidosis (MPS), patellar nail syndrome, nephrogenic diabetes insipidus, neurofibromatosis, Niemann-Pick disease, osteogenesis imperfecta, porphyria, Prader-Willi syndrome, progeria, Proteus syndrome, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Schwachmann syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, thrombocytopenia syndrome of aplasia of the radius (TAR syndrome), Treacher-Collins syndrome, trisomy , tuberous sclerosis, Turner syndrome, urea cycle disorder, Hippel-Lindau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Visco syndrome tta-Aldrich, X-linked lymphoproliferative disease (XLP, OMIM #308240), acquired immune deficiencies, lysosomal storage diseases (eg, Gaucher disease, GM1, Fabry disease, and Tay-Sachs disease), mucopolysaccharidoses (eg, Hunter disease, Hurler disease), hemoglobinopathies (eg, sickle cell disease, HbC, α-thalassemia, β-thalassemia); and hemophilia.

[0133] Non-limiting examples of proteins (including functional fragments thereof, such as truncated versions) that can be expressed as described herein include fibrinogen, prothrombin, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor XI, factor XII (Hageman factor), factor XIII (fibrin stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-like protease inhibitor, plasminogen, alpha 2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator-1 inhibitor, plasminogen activator-2 inhibitor, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase (IDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl-CoA carboxylase (PCC) (PCCA and/or PCCB subunits), glucose-6 transporter protein -phosphate (G6PT) or glucose-6-phosphatase (G6Phase), LDL receptor (LDL), ApoB, LDLRAP-1, PCSK9, mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I) and OTC (ornithine transcarbamylase), ASS (argininosuccinate synthetase), ASL (argininosuccinate lyase), and/or ARG1 (arginase), and/or solute transporter family type 25 protein (SLC25A13, aspartate/glutamate transporter), UGT1A1 glucuronyl transferase A1 polypeptide or UDP, fumarylacetoacetate hydrolyase (FAH), alanine glyoxylate aminotransferase (AGXT) protein, glyoxylate reductase/hydroxypyruvate reductase (GRHPR) protein, transthyretin (TTR) gene protein, ATP7B protein, phenylalanine hydroxylase (PHA) protein, lipoprotein lyase (LPL) protein, engineered nuclease, engineered transcription factor and/or a therapeutic single chain antibody.

[0134] In certain embodiments of the invention, the transgene may contain a marker gene (described above) that allows the selection of cells that have undergone targeted integration, and an associated sequence encoding additional functionality. Non-limiting examples of marker genes include GFP, drug susceptibility selection marker(s), and the like.

[0135] The constructs described herein can also be used to deliver non-coding transgenes. Serial coding antisense RNAs, RNAi, shRNAs and microRNAs (miRNAs) can also be used for targeted insertions.

[0136] In certain embodiments, the transgene includes sequences (e.g., coding sequences, also referred to as transgenes) greater than 1 kb, e.g., 2 to 200 kb, 2 to 10 kb. b.s. (or any value in that range). The transgene may also include one or more nuclease target sites.

[0137] Upon integration (eg, via nuclease-mediated integration), the transgene may be inserted into an endogenous gene such that all, some, or none of the endogenous gene is expressed.

Nucleases

[0138] As noted above, expression cassettes can be maintained episomal or can be integrated into the cell's genome. Integration can be random. Preferably, integration of the transgene construct(s) is targeted by cleaving the target gene with one or more nucleases (e.g., zinc finger nucleases ("ZFN"), TALEN, TtAgo, CRISPR/Cas nuclease systems, and homing endonucleases) and the construct integrated with either by homology-directed repair (HDR), or by capturing the end during processes that trigger non-homologous end joining (NHEJ). See, for example, US Pat. Nos. 9,255,250; 9,200,266; 9,045,763; 9,005,973; 9,150,847; 8,956,828; 8,945,868; 8,703,489; 8,586,526; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,067,317; 7,262,054; 7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; US Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983; 20130196373 and 20150056705, which are incorporated herein by reference in their entirety for all purposes.

[0139] Any nuclease can be used for targeted integration of the expression construct of the transgene.

[0140] In certain embodiments, the nuclease comprises a zinc finger nuclease (ZFN) that contains a zinc finger DNA-binding domain and a cleavage (nuclease) domain. See, for example, US Pat. Nos. 9,255,250; 9,200,266; 9,045,763; 9,005,973; 9,150,847; 8,956,828; 8,945,868; 8,703,489; 8,586,526; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,067,317; 7,262,054; 7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861.

[0141] In other embodiments, the nuclease contains TALEN, which includes a TAL effector DNA-binding domain and a cleavage (nuclease) domain. See, for example, US Pat. No. 8,586,526 and US Publication No. 20130196373.

[0142] In additional embodiments, the nuclease comprises a CRISPR/Cas nuclease system that includes one target site recognition guide RNA and one or more cleavage domains. See, for example, US Patent Publication No. 20150056705. In some embodiments, the CRISPR-Cpf1 system is used (see Fagerlund et al., (2015) Genom Bio 16:251). It is understood that the term "CRISPR/Cas system" refers to CRISPR/Cas and CRISPR/Cfp1 systems.

[0143] Nuclease cleavage domains can be wild-type or mutated, including non-naturally occurring (engineered) cleavage domains that form obligate heterodimers. See, for example, US Pat. Nos. 8,623,618; 7,888,121; 7,914,796; and 8,034,598 and U.S. Patent No. 20110201055.

[0144] The nuclease(s) can make one or more double-stranded and/or single-stranded cuts at the target site. In certain embodiments of the invention, the nuclease contains a catalytically inactive cleavage domain (eg, FokI and/or Cas protein). See, for example, US Pat. Nos. 9,200,266; 8,703,489 and Guillinger et al. (2014) Nature Biotech. 32(6):577-582. The catalytically inactive cleavage domain can, in combination with the catalytically active domain, act as a niqase to make a single strand cut. Therefore, two nikases can be used in combination to create a double-strand cut in a particular region. Additional niqases are known in the art, for example, McCaffery et al. (2016) Nucleic Acids Res. 44(2):e11.doi:10.1093/nar/gkv878. Epub October 19, 2015.

[0145] In certain embodiments, the nuclease cleaves a "safe" gene (e.g., CCR5, Rosa, albumin, AAVS1, and the like. See, e.g., US Pat. Nos. 7,888,121; 7,972,854; 7,914,796; ; Публикации патентов США 20030232410; 20050208489; 20050026157; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 и 20130177960. В предпочтительных вариантах реализации изобретения нуклеаза расщепляет эндогенный ген альбумина, так что экспрессионная кассета интегрируется в эндогенный локус альбумина клетки печени Albumin-specific nucleases are described, for example, in US Pat. No. 9,150,847 and US Publications Nos.

Delivery

[0146] The constructs described herein (and/or nucleases) can be delivered in vivo or ex vivo by any suitable means to any cell type, preferably to the liver (liver delivery). Similarly, when used in combination with nucleases for targeted integration, nucleases can be delivered in polynucleotide and/or protein form, e.g. using non-viral vector(s), viral vector(s) and/or in RNA form, e.g. form of mRNA.

[0147] Methods for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolisting, virosomes, liposomes, immunoliposomes, other nanoparticles, polycation or lipid: nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake. Ultrasonication can also be used to deliver nucleic acids, such as the Sonitron 2000 system (Rich-Mar). Additional exemplary nucleic acid delivery systems include those provided by AmaxaBiosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, Massachusetts) and Copernicus Therapeutics Inc. (see, for example, US 6008336).

[0148] In preferred embodiments, the expression constructs are AAV vectors. Optional nucleases can be introduced in mRNA form or using one or more viral vectors (AAV, Ad, and the like). Administration can be by any method in which the polynucleotides are delivered to the desired target cells. Both in vivo and ex vivo methods are contemplated. Intravenous injection into the portal vein is the preferred method of administration. Other in vivo modes of administration include, for example, direct injection into the liver lobes or bile duct and intravenous injection distal to the liver, including through the hepatic artery, direct injection into the liver parenchyma, injection through the hepatic artery, and/or retrograde injection through pancreatic tree. Ex vivo modes of administration include in vitro transduction of resected hepatocytes or other liver cells followed by infusion of the transduced resected hepatocytes back into the portal vasculature, liver parenchyma, or biliary tree of the human patient, see, for example, Grossman et al., (1994) Nature Genetics , 6:335-341.

[0149] In systems involving delivery of more than one polynucleotide (eg, a construct as described herein and a nuclease in polynucleotide form), two or more polynucleotide(s) are delivered using one or more of the same and/or different vectors. For example, a nuclease in polynucleotide form can be delivered in mRNA form, and liver-specific constructs as described herein can be delivered by other means such as viral vectors (e.g., AAV), minicircle DNA, plasmid DNA, linear DNA, liposomes, nanoparticles and the like.

[0150] Pharmaceutically acceptable carriers are determined in part by the particular composition administered, as well as by the particular route used to administer said composition. Accordingly, there is a wide range of suitable formulations of available pharmaceutical compositions, as described below (see, for example, Remington's Pharmaceutical Sciences, 17e ed., 1989).

[0151] The effective amount of the expression cassette (and optional nuclease(s) and/or modified cells) to be administered will vary from patient to patient. Accordingly, effective amounts are best determined by the physician prescribing said compositions (eg, cells), and appropriate doses can be readily determined by one of ordinary skill in the art. Analysis of the level of the therapeutic polypeptide in serum, plasma, or other tissues, as well as comparison with baseline levels prior to administration, can determine whether the amount administered is too low, in the correct range, or too high. Suitable schemes for initial and subsequent introductions are also variable, but are typical of the initial introduction, after which, if necessary, carry out subsequent introductions. Subsequent administrations can be carried out at variable intervals, from daily administration to annual administration, as well as administration once every few years. One of skill in the art will appreciate that suitable immunosuppressive methods can be recommended to prevent inhibition or blocking of transduction by immunosuppression of delivery vectors, see, for example, Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0152] Formulations for both ex vivo and in vivo administration include suspensions (eg, genetically modified cells, liposomes, or nanoparticles) in liquid or emulsified liquids. Active ingredients are often mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, the composition may contain minor amounts of adjuvants such as wetting or emulsifying agents, pH buffering agents, stabilizing agents, or other agents that enhance the effectiveness of the pharmaceutical composition.

Applications

[0153] The methods and compositions disclosed herein are intended to provide therapy for any disease by providing a transgene that expresses a product that is absent or deficient in the disease, or otherwise treats or prevents the disease. The cell may be modified in vivo or may be modified ex vivo and then administered to a subject. Thus, the methods and compositions provide for the treatment and/or prevention of such genetic diseases.

[0154] The following examples include exemplary embodiments of the present invention, wherein the nuclease optionally used comprises a zinc finger nuclease (ZFN). It should be understood that the examples are for illustrative purposes only and that other nucleases may be used, e.g., TALEN, CRISPR/Cas systems, homing endonucleases (meganucleases) having engineered DNA binding domains and/or DNA binding domain fusions of homing endonucleases. (meganucleases) of natural origin and heterologous cleavage and/or fusion domains of meganucleases and TALE proteins. In addition, it will be understood that expression constructs as described herein can be transferred to other vectors (other than AAV) to obtain the same results in the treatment and/or prevention of disorders caused by insufficient protein production.

EXAMPLES Example 1: DNA Construction Methods

[0155] The general structure and approach used to develop exemplary constructs containing human Factor VIII cDNA is depicted in FIG. 1. Constructs include a liver-specific enhancer, a liver-specific promoter, an optional intron, insulator sequences, and a transgene (e.g., a codon-optimized human factor VIII transgene with a B-domain deleted), a synthetic polyadenylation sequence, a spacer, and 5'/3' inventive end repeats. All constructs were assembled using standard molecular biology cloning techniques.

[0156] As shown in FIG. 1, during the development of the vector, several stages were carried out. First, we investigated the effect of construct components on the virus yield obtained during the manufacturing process. The effect of the sequence of insulator regions in the constructs was studied using three potential insulator sequences as shown: Inc1: 5' GGAACCATTGCCACCTTCA (SEQ ID NO: 28), Inc2: 5' CTATCCATTGCACTATGCT (SEQ ID NO: 29), and Inc3: 5' TTTCCTGTAACGATCGGG ( SEQ ID NO: 30). The insulator regions were then inserted into the transgene expression cassette, where the insulator that was used between the 5' ICP sequence and the start of the enhancer/promoter sequence was always Inc1. However, either Ins2 or Ins3 sequences were linked at the 3' end of the construct to the synthetic poly A sequence SPA51 (5' AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGTT, SEQ ID NO: 31) as follows: Hhc2-SPA51: 5' ATAAAATATCTTTATTCATTACATCTGTGTGTTGGTTTTTTGTGTGTTCTATTCCATT GCACTATGCT, SEQ ID NO: 32, SEQ ID NO: 32 -SPA51: 5' AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGTTTTCCTGTA ACGATCGGG, SEQ ID NO: 33. In some embodiments, Inc4 is associated with SPA51.

[0157] Ins sequence variants have also been used in expression constructs where the SerpE-TTRm-MVM promoter region was replaced with a hybrid liver promoter (HLP - hybrid liver promoter, McIntosh et al., ibid.). These structures are shown in Fig. 2. These constructs were then packaged into AAV2/6 particles using HEK293 cells, where yields were obtained from two cell factories (Yuan et al., (2011) Hum Gene Ther., 22, 613-624, 2011). The yield (vector genomes) for constructs containing modified insulator sequences was found to be almost three log higher for constructs containing the original promoter region, where the expression cassette was flanked by Inc1 and Inc3 insulator regions at the 5' and 3' ends, respectively ( Fig. 3). In addition, these insulator sequences were also inserted into the modified CRMSBS1 and CRMSBS2 constructs described in step 2 below (FIGS. 19 and 20) and tested for viral yield (FIGS. 22). The data showed an 8-10-fold improvement in viral yield for the new construct compared to the original construct.

[0158] In step 2, point mutations were introduced into the Serpin 1 enhancer to create the first two derived vectors CRMSBS1 and CRMSBS2 (FIG. 4). These vectors differ in their enhancer sequences where point mutations have been introduced, as shown in FIG. 5. The specific changes are as follows: for CRMSBS1, denoted as 1, 2, 3 and 4 as shown in FIG. 5, the following substitutions were made, respectively: 1=G to A, 2=C to G, 3=T to C, and 4=G to A. Similarly, for CRMSBS2, positions 1, 3, 4, and 5 were changed as follows: 1=G on A, 3=T on C, 4=G on A and 5=C on T.

[0159] In step 3, constructs were made to examine the sequence of the intron in the vector. As shown in FIG. 6 and 7, the intron sequences in the CRMSBS2 and CRMSBS2 vectors were modified by deletion of the MVM intron ("CRMSBS1 Without Intron", Fig. 6, and "CRMSBS2 Without Intron", Fig. 7). In another embodiment, a T-chimeric intron sequence ("CRMSBS1 T-chimeric intron", Fig. 6, and "CRMSBS2 T-chimeric intron", Fig. 7) was tested.

[0160] For step 4, changes were made to the MVM intron by introducing mutations targeting the splicing donor and acceptor sites. Maps of these vectors are shown in Fig. 10, where the altered introns are referred to as SBR Introns 1-3. The MVM intron has two potential donor sites and two potential acceptor sites of these donors (see FIG. 11 for illustration). On FIG. 11, the two donor sites are labeled D1 and D2, and their respective acceptor sites are depicted as A1 and A2. Splicing boundaries formed by D1-A1 and D2-A2 splicing are depicted above the gene as dotted lines. A partial sequence of the MVM intron is depicted below the gene in FIG. 11 (SEQ ID NO: 14) and also indicates the location (underlined) of the intronic enhancer sequence (IES) and A1 and A2 acceptor sites (Haut and Pintel, (1998) J Virol, 72:1834-1843; Haut and Pintel, (1998) Virol J, 258:84-94). Three introns were designed for testing and are depicted in FIG. 10 and are designated SBR Intron 1-3 (intron sequences are given in SEQ ID NOs: 15-17). The activity of expressed hFVIII delivered with the AAV F8 cDNA was also evaluated in vitro. AAV2/6 F8 cDNA (CRMSBS2 SBR Intron 3) was added to HepG2 cells at doses of 4.8E+06, 2.4E+06, 1.2E+06 and 0.6E+06 vector genomes/mL per 1E+05 cells per 24-well dish (denoted as time, t0 days). Supernatants were analyzed for levels of secreted hFVIII by ELISA and an APTT (activated partial thromboplastin time) assay for coagulation activity and chromogenic activity assay were performed for seven days (t7) after the addition of AAV2/6 virus (methods see below). The results (FIG. 21) showed a good correlation between levels and activity of secreted hFVIII. Data shown are n=6 biological repeats. The "whiskers" of the errors represent the standard error of the mean of the repetitions.

[0161] These constructs were then tested in vivo as described below.

Quantitative PCR

[0162] qRT-PCR (for human factor VIII mRNA levels): Mouse tissue was lysed using FastPrep and Lysing Matrix D (MP Biomedicals, Santa Ana, CA) according to the manufacturer's instructions. RNA/DNA was isolated from mouse tissue using the AllPrep DNA/RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad, CA). The extracted RNA was then used to generate cDNA using the Quantitect cDNA Synthesis Kit (Qiagen, Carlsbad, CA). Quantitative PCR was then performed using the SsoAdvanced Univesal Probes Supermix (Biorad, Hercules, Calif.) on a Biorad CFX 96 using labeled primer/probe assays from IDT (Coralville, Iowa). The mouse GAPDH assay was Mm.PT.39a.1. For specific detection of human factor VIII mRNA, primer/probe assays have been common; Forward primer (GGAGATGAAGAAGGAGGACTTTG) (SEQ ID NO: 18), probe (ACATCTACGACGAGGACGAGAACCA) (SEQ ID NO: 19) and Reverse primer (TCCACAGCAGCAATGAAGTAG) (SEQ ID NO: 20). Quantitative qRT-PCR (not absolute) was used with normalization to GAPDH for each sample, and the final data analysis was reported as relative to one mouse sample, which was set to 1.0. No template controls and no reverse transcriptase controls were performed on all samples and showed no detectable signal.

[0163] qPCR (for vector genome assays, HS): Mouse tissue was lysed using FastPrep and Lysing Matrix D (MP Biomedicals, Santa Ana, CA) according to the manufacturer's instructions. RNA/DNA was isolated from mouse tissue using an AllPrep DNA/RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad, CA). The extracted DNA was used for quantitative PCR with a TaqMan Fast Universal PCR Master Mix, without AmpErase UNG (Applied Biosystems, Fother City, CA) on an AB 7300 real-time PCR system (Applied Biosystems, Fother City, CA). For specific detection of human factor VIII, a primer/probe assay has been common; forward primer (CCTGGCCAGTTCCTGCT) (SEQ ID NO: 21), probe (TTCTGCCACATCAGCAGCCACCA) (SEQ ID NO: 22) and reverse primer (GGCCTCCATGCCATCATG) (SEQ ID NO: 23). No matrix controls were performed on all samples and showed no detectable signal. A qPCR DNA standard curve was generated from seven consecutive 4-fold dilutions of a known amount of purified, linearized human factor VIII plasmid.

[0164] qPCR (for targeted integration by NHEJ using HepG2 cells) - DNA was isolated from human HepG2 cells using QIAamp DNA micro according to the manufacturer's instructions (Qiagen, Carlsbad, CA). Quantitative PCR was then performed using the SsoAdvanced Univesal Probes Supermix (Biorad, Hercules, Calif.) on a Biorad CFX 96 using labeled primer/probe assays from IDT (Coralville, Iowa). The mouse GAPDH assay was Hs.PT.39a.22214836. For specific detection of targeted human factor VIII integration by NHEJ at the endogenous human albumin locus, primer/probe assays have been common; Forward primer (AGTGCAAAGTAACTTAGAGTGACT) (SEQ ID NO: 24), probe (CCATCACTAGGGGTTCCTGCGGCCT) (SEQ ID NO: 25) and Reverse primer (CCTGAAGGTGGCAATGGT) (SEQ ID NO: 26). For the purposes of this study, we used qPCR (not absolute) normalized to GAPDH for each sample, and the final data analysis was reported as relative to one sample, which was set to 1.0. No template control, no transcriptase control, and no ZFN controls were performed and showed no detectable signal.

[0165] qPCR (for targeted integration into mouse tissues via NHEJ and HDR) - Mouse tissue was lysed using FastPrep and Lysing Matrix D (MP Biomedicals, Santa Ana, CA) according to the manufacturer's instructions. RNA/DNA was isolated from mouse tissue using the AllPrep DNA/RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad, CA). Quantitative PCR was then performed using the SsoAdvanced Univesal Probes Supermix (Biorad, Hercules, Calif.) on a Biorad CFX 96 using labeled primer/probe assays from IDT (Coralville, Iowa). The mouse GAPDH assay was Mm.PT.39a.1. For specific detection of target integration of human factor 8 cDNA produced by NHEJ into the endogenous mouse albumin locus, primer/probe assay has been common; Forward primer (GTGTAGCAGAGGAACCATT, SEQ ID NO: 39), probe (CCATCACTAGGGGTTCCTGCGGCCT, SEQ ID NO: 40) and Reverse primer (GTTAATATTCACCAGCAGCCT, SEQ ID NO: 41). For specific detection of targeted ZFN integration by NHEJ at the endogenous mouse albumin locus, primer/probe assays have been common; Forward primer (AGTGTAGCAGAGGAACCA, SEQ ID NO: 42), probe (CCATCACTAGGGGTTCCTGCGGCCT, SEQ ID NO: 43) and Reverse primer (CAGGGTGAGCCCAGAAAC, SEQ ID NO: 44). For specific detection of targeted human factor 8 integration by HDR at the endogenous mouse albumin locus, primer/probe assays have been common; Forward primer (AACTTTGAGTGTAGCAGAGAGG, SEQ ID NO: 45), probe (TACCGGAGGAGCAAACAGGGACTA, SEQ ID NO: 46) and Reverse primer (CTCTACGAAATGTGCAGACAGA, SEQ ID NO: 47). For the purposes of this study, we used qPCR (not absolute) with the final analysis of the data given as relative to a single sample, which was set to 1.0. No template control, no transcriptase control, and no ZFN controls were performed and showed no detectable signal.

[0166] Indel (insertions and deletions) - Mouse tissue was lysed using FastPrep and Lysing Matrix D (MP Biomedicals, Santa Ana, CA) according to the manufacturer's instructions. RNA/DNA was isolated from mouse tissue using an AllPrep DNA/RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad, CA). The extracted DNA was used for PCR and deep sequencing to measure indels at the mouse albumin locus.

[0167] Plasma - Blood was collected from all mice on Day 7, 14, 21 (non-fatal) and Day 28 or longer as indicated (fatal) for studies on C57BL/6. Blood was collected from all mice on Days 8, 14, 21, 28, 35 and 42 (non-fatal) for studies in mice with hemophilia A. All blood was collected in tubes containing sodium citrate and processed into plasma. Non-fatal blood samples were collected through the submandibular vein or retro-orbital sinus. Blood at the time of sacrifice of the experimental animal was collected by cardiac puncture or from the vena cava. Plasma was separated and stored at -60 to -80° C. until used in the ELISA assay or the Chromogenix Coamatic activity assay described below.

[0168] Liver - For studies on C57BL/6, mice were sacrificed on the 28th day, and the liver, spleen, testicles, brain, heart, lungs and kidneys were collected and weighed. The left lateral lobe of the liver was separated and divided into 3 parts and quickly frozen in liquid nitrogen separately from the rest of the liver. The remaining lobes of the liver and other tissues (whole) were quickly frozen in liquid nitrogen. Frozen samples were stored at -60 to -80° C. until processed for RNA/DNA extraction.

[0169] In Vitro Studies, HepG2 AAV F8 cDNA/ZFN. Human HepG2 liver cells were maintained according to the manufacturer's recommendations (ATCC, Manassas, VA). On the day of the experiment, HepG2 cells were washed, trypsinized and counted. The ZFNs used were specific for the human albumin intron locus, SBS47171 on the left and SBS47898 on the right. ZFN along with 4F8 cDNA (CRMSBS2 No Intron) were delivered as AAV2/6, and designated as time zero. AAV2/6 ZFN were delivered at 3.0E+05, and AAV2/6 hFVIII cDNA CRMSBS2 No intron at 3.0E+04, 6.0E+04 and 1.2E+05 for 1E+05 cells per well 24 -well plate. The next day, the media were changed. Supernatants were analyzed for secreted hFVIII using hFVIII ELISA, described below, at time points t3, t5 and t7 days after the addition of the AAV2/6 virus.

[0170] In vitro studies, HepG2 cDNA of AAV F8. Human HepG2 liver cells were maintained according to the manufacturer's recommendations (ATCC, Manassas, VA). On the day of the experiment, HepG2 cells were washed, trypsinized and counted. AAV2/6 hF8 cDNA (CRMSBS2 SBR Intron 3) was delivered at doses of 6.0E+06, 1.2E+06, 2.4E+06 and 4.8E+06 per 1E+05 cells per well of a 24-well plate. The media was exchanged at time t3 (t=day). Supernatants were analyzed at time points t5 and t7 after addition of AAV 2/6 virus for secreted hFVIII levels using Affinity Biologies 4FVIII ELISA, and for hFVIII activity using the chromogenic assay and coagulation activity assay described below.

[0171] Human factor VIII ELISA. ELISA hFVIII Affinity Biologies (Mouse and HepG2 cells). Secreted human factor VIII levels were determined using the Affinity Biologicals (Canada) ELISA kit (FVIII-AG) according to the manufacturer's protocol, except for the human factor VIII standard. The human factor VIII standard used in the ELISA assay is recombinant purified human factor VIII (#F0016-06) from US Biologicals (Salem, MA). Briefly, mouse plasma was added to the plate, incubated by shaking at room temperature for one and a half hours, followed by washing three times with the wash buffer provided in the kit. The detection antibody provided with the kit was added and incubated for forty-five minutes at room temperature, followed by washing three times with the wash buffer provided in the kit. The TMB substrate provided in the kit was added and left for 10 minutes. The reaction was stopped with stop solution and the absorbance was read at 450 nM using a scanning spectrophotometer to read the plates.

[0172] Regular ELISA hFVIII (Javanese, macaques). The levels of hFVIII secreted in NHP plasma were determined using a standard ELISA. Polystyrene microplates (Corning, 96-well high-binding half-plates) were coated overnight at 4°C with anti-murine hFVIII monoclonal antibody (Green Mountain, Burlington, VT) in 0.2 M carbonate bicarbonate buffer at pH 9.4 ( Thermo Fisher Scientific, Waltham, Massachusetts). The next day, the plates were washed four times using 1x TBST (Thermo Fisher Scientific, Waltham, MA). The 96-well plates were then blocked for two hours at room temperature using 3% BSA/TBS blocking buffer and then washed four times with 1x TBST. Plasma was added to the plate and incubated by shaking at room temperature for two hours followed by washing four times with 1x TBST. A detection antibody, a biotinylated anti-mouse FVIII monoclonal antibody (Green Mountain, Burlington, Vermont), was added and incubated for one hour at room temperature, followed by washing four times with 1X TBST. Streptavidin HRP (horseradish peroxidase) (Jackson ImmunoResearch, West Grove, PA) was added and incubated for one hour at room temperature and then washed four times with 1x TBST. TMB Ultra (Thermo Fisher Scientific, Waltham, MA) was added and allowed to stand for ten minutes, the reaction was stopped with stop solution and absorbance measured at 450 nM with a scanning spectrophotometer to read the plates. Background absorbance readings were negligible (usually 0).

[0173] Chromogenic analysis of human factor VIII activity. Secreted human factor VIII plasma activity was determined using the Diapharma Chromogenic Coamatic Factor VIII assay (West Chester, Ohio) according to the manufacturing protocol, except for the human factor VIII standard. The human factor VIII standard used in the ELISA assay is recombinant purified human factor VIII (#F0016-06) from US Biologicals (Salem, MA).

[0174] Coagulation Activity Assay The activity of secreted human factor VIII in HepG2 supernatant (or cynomolgus monkey plasma) was determined using activated partial thromboplastin (aPTT) time analysis by Diagnostica Stago (Boston, Massachusetts) according to the manufacturing protocol, except for the standard human factor VIII and human factor VIII deficient plasma. The human factor VIII standard was the same as used in the ELISA assay (recombinant purified human factor VIII, #F0016-06 from US Biologicals, Salem, MA). The FVIII deficient reagent used in the coagulation activity assay was FVIII-CD<1% FVIII activity (frozen, FVIII deficient) from Haematologic Technologies, Inc. (Essex Junction, Vermont). Briefly, the standard or sample was added to cuvettes containing a steel ball. FVIII-CD<1% FVIII activity was added and the PTT Automate provided with the kit was incubated at 37° C. for one hundred and eighty seconds. The STA CaCl ₂ provided with the kit was added to the reaction while the steel ball was moving in the cuvette. The coagulation time was measured from the addition of STA CaCl ₂ until the movement of the steel ball was stopped. Incubation and time recording for this assay was performed using a Start Stago hemostasis analyzer.

Example 2: In vivo studies

[0175] Wild Type Mice: C57BL/6 mice, eight to ten weeks old, were used in in vivo studies. The study was conducted in accordance with the animal welfare law for the humane care and use of animals. Test preparations (constructs containing AAV viruses) were thawed at room temperature prior to dosing, and all animals received one intravenous injection (IV) of 200 μl. Table 1 below shows the study design for the in vivo study of the constructs in FIG. 8 (depicted in Figs. 4, 6 and 7). Table 2 shows a test design for testing the structures shown in FIG. 15. The doses were 1.8E+11 gw per mouse, which is approximately 7E+12 gw/kg. All animals received a subsequent intraperitoneal injection of 200 µl of cyclophosphamide on Days 0 and 14. Lethal and non-lethal blood draws were performed as indicated in Tables 1 and 2.

[0176] Blood was collected from all mice on Day 7, 14, 21 (non-fatal) and Day 28 (fatal). All blood was collected in tubes containing sodium citrate and processed into plasma. Non-fatal blood samples were collected through the submandibular vein or retro-orbital sinus. Blood at the time of sacrifice of the experimental animal was collected by cardiac puncture or from the vena cava. Plasma was separated and stored at -60 to -80° C. until used in the ELISA assay described below.

[0177] All animals were sacrificed on the 28th day, and the liver, spleen, testes, brain, heart, lungs and kidneys were collected and weighed. The left lateral lobe of the liver was separated and divided into 3 parts and quickly frozen in liquid nitrogen separately from the rest of the liver. The remaining lobes of the liver and other tissues (whole) were quickly frozen in liquid nitrogen. Frozen samples were stored at -60 to -80° C. until processed for RNA/DNA extraction.

[0178] As shown in FIG. 8 and 15, after administration, all test constructs resulted in in vivo production of the transgene (human secreted factor VIII with B-domain deleted) in vivo on day 7 (Fig. 8A and Fig. 15A) and day 28 (Fig. 8B and Fig. 15B). In addition, as shown in FIG. 9 and 16, the transgene was expressed only in the liver and not expressed in other tissues (FIGS. 9A and 16A) and the AAV vector transduces mainly liver cells (analysis of vector genome biodistribution is depicted in FIGS. 9B and 16B). In these datasets, human factor VIII-BDD mRNA (hFVIII-BDD) was analyzed from tissues (brain, heart, kidney, lung, liver, spleen, testis) in the assay shown in Table 1 by qRT-PCR as described above in Example 1. In addition, the vector genome distribution was analyzed in the same tissues by qPCR (see Example 1) and the results are shown in FIG. 9V/16V. These data indicate that the AAV2/6 vector mainly transduces the liver.

[0179] Constructs designed to study the effectiveness of intron modifications were tested in vivo as well as in the study shown in Table 2, and data for 7 days and at peak levels are depicted in FIG. 15. hFVIII-BDD mRNA was also analyzed (FIG. 16A) as well as vector genome distribution (FIG. 16B) and showed that hF8 mRNA expression is liver specific and AAV2/6 preferentially transduces the liver.

[0180] Thus, the constructs described herein provide reliable expression of the transgene after delivery to the liver.

[0181] An additional study was conducted to check whether the observed levels of hFVIII-BDD in vivo were sensitive to the serotype of the AAV used. Male C57BL/6 mice were intravenously injected with 6E+10 gv/mouse (~2E+12 gv/kg) or 1.8E+11 gv/mouse (~7E+12 gv/kg) of the original cDNA F8 AAV2/5, AAV2/6 , AAV2/8 or AAV2/9. Transduction of mice with serotype AAV2/6, which are known to be ineffective in mouse liver transduction, was achieved at 6E+10 gv/mouse (~2E+12 gv/kg) with a mean of 91.9% +/- 15.5 SOS (n=6) from normal hFVIII plasma levels in humans. At a higher dose of ~7E+12 gv/kg, a mean peak plasma 4FVIII was achieved after six independent in vivo mouse studies of 169.2% +/- 10.1 SOS (n=36). The mean peak levels for AAV2/8 at 2E+12 gw/kg were 320% and 323.6% at 6E+12 gw/kg. For AAV2/9 at 2E+12 gw/kg, the average peak level was 389.6% (see Fig. 23 also showing results using AAV2/5 and AAV2/6).

[0182] Studies were also conducted to determine if the production method used to create AAV had an effect on the resulting expression of hFVIII-BDD in vivo. Male C57BL/6 mice were injected with the original F8 cDNA by intravenous injection (tail vein) of 1.8E+11 gv/mouse (~7E+12 gv/kg) of the original AAV2/6 F8 cDNA produced by either HEK293 or Sf9/rBV cells. (recombinant baculovirus). Processing of the original F8 cDNA from HEK293 cells achieved a mean peak value of 142.1%±8.3% SOS (n=8) (measured by hFVIII ELISA) of normal human FVIII plasma levels. A similar level of 132.8% ± 18.6% SOS (n=5) (measured by hFVIII ELISA) was achieved after mice were injected with the original F8 (Sf9/rBV) cDNA (FIG. 24).

[0183] The studies were repeated for comparison with the F8 CRMSBS2 SBR Intron 3 cDNA (see Fig. 10). Male C57BL/6 mice were intravenously injected with 1.8E+11 gv/mouse (~6E+12 gv/kg) cDNA AAV2/6 CRMSBS2 SBR Intron 3 (n=8). Average peak plasma levels of 4FVIII in C57BL/6 mice measured by hFVIII ELISA are shown (FIG. 25).

[0184] Hemophilia A mice: The constructs were also tested in the R593A mouse model of hemophilia A (Bril et al. (2006) Thromb Haemost 95(2):341-7; Chavez et al., (2012) Hum Gen Ther ., 23(4):390). These mice had inactivation of the endogenous mouse F8 gene. In addition, they carried a mutant human FVIII-R593C transgene under the control of a mouse albumin promoter such that they expressed undetectable amounts of the mutant human protein, but were considered tolerant of human FVIII expression due to the small amount of mutant FVIII R593A protein produced. The line was originally FVB but was backcrossed to C57BL/6 mice for at least 5 generations at the Jackson Laboratory. The study was conducted in accordance with the animal welfare law for the humane care and use of animals. The test preparations were thawed at room temperature prior to dosing, and all animals received one intravenous (IV) injection of 200 μl. The doses were 1.8E+11 gw per mouse, which is approximately 7E+12 gw/kg. The design of the study is shown below in Table 3:

Table 3: CRMSBS2 SBR Intron 3 in Hemophilia A Mutant Mice

[0185] The study was conducted for three months, showing representative results of a three-month study, the results of both day 14 and day 42 (Fig. 17) show that the FVIII-BDD transgene was expressed at levels >300% of protein levels FVIII detected in normal human plasma on both days 14 (FIG. 17A) and 42 (FIG. 17B).

[0186] To test the functionality and therapeutic efficacy of hFVIII in a mouse model of hemophilia A, a tail vein transection (TVT) model was used. Briefly, mice were initially anesthetized with isoflurane and anesthesia was maintained with an anesthetic mask throughout the study. Immediately after the start of anesthesia, the mice were placed on a heating pad (set at 37° C.) with a temperature probe between the stomach and the heating pad, ensuring that the mouse head was correctly positioned in the anesthesia mask. Using a marker block for measurement, the tail was marked with a marker pen at "12 o'clock", which corresponded exactly to 2.5 mm in diameter, after which the tail was immersed in a collecting tube with saline (37° C. saline). The tail was immersed in saline at a predetermined temperature for 10 minutes before bleeding began. The tail was then placed in the cutting block marked from "13" indicating "15 o'clock" about ten seconds before incision (to facilitate cutting of the left lateral tail vein). Exactly at t=0 minutes, a 1 mm deep tail incision was made laterally on the left side of the mouse tail, thereby cutting the lateral tail vein. Immediately thereafter, the tail was immersed in a preheated saline collecting tube. The first episode of bleeding was recorded within three minutes. If the first bleeding exceeded three minutes, the animal was euthanized and replaced. Three minutes after the damage, the collecting tube was replaced with a new preheated collecting tube with saline. All episodes of the second bleeding recorded an additional 57 minutes. If the bleeding stopped after 15, 30, or 45 minutes, the wound was gently wiped twice with saline-soaked gauze. Immediately after the test, the tail was again immersed in saline. After t=60 minutes, the mice were euthanized while they were still under full anesthesia. Bleeding time was reported as the sum of first and second bleeding. The first and second bleedings were lysed and stored for subsequent measurements of hemoglobin associated with blood loss. (Johansen et al., Haemophilia, (2016) doi:10.1111/hae.12907).

[0187] The results demonstrate a significant reduction in time to achieve hemostasis (p<0.0001) in hemophilia A R593C mice after tail vein dissection (FIG. 18), demonstrating therapeutic efficacy in these mice.

[0188] Non-human primates: Experiments were performed on NHPs (non-human primates) using hFVIII-BDD cDNA constructs, where AAV2/6 and AAV2/8 serotypes were evaluated. In Table 4 below and in FIG. 26B shows the distinguishing features of the dosing groups. The difference between the F8 transgene expression cassette, designated "cDNA1" (Groups 2-4 of Table 4 below) and "cDNA2" (Group 5 of Table 4 below), is that the "cDNA2" donor had a slightly different promoter module (liver hybrid promoter , see Mcintosh et al (2013) Blood 121(17):3335), but the rest of the F8-BDD transgene expression cassette (including the coding region) was the same. For these experiments, the dosing regimen shown in FIG. 26A (where rituximab was the pre-test drug administered and the steroid was administered simultaneously with the test drug and daily thereafter).

Table 4: NHP groups with FVIII transgene cassette

[0189] Cynomolgus monkeys injected with prescription buffer or 6E+12 gv/kg cDNA

AAV2/6 hF8 (original). On the 14th day after the addition of the test preparation, the levels and activity of circulating hFVIII were analyzed by ELISA or clotting activity (see Fig. 27). Normal FVIII levels in cynomolgus monkeys are ~1U/mL reflected in the clotting activity data for the formulation control group, as the clotting activity assay is not specific for human FVIII. The ELISA is specific for human FVIII and not for cynomolgus FVIII, so it is expected that there will be no hFVIII levels measured by ELISA in the formulation control group. Individual animals are shown for the formulation control group (Group 1, animal IDs 1101-1102) and dose group 6E+12 gw/kg (Group 3, animal IDs 3101-3103). Group 3 animals have supraphysiological levels and circulating hFVIII activity above 8 U/mL.

[0190] As an indicator of liver status after treatment, liver enzymes were measured for the formulation control group (Group 1, animal ID 1101) and the 6E+12 gw/kg dose group (Group 3, animal ID 3102). Alanine aminotransferase (ALT) and aspartate aminotransferase (ACT) were measured. Permissible upper limit reference values for cynomolgus monkeys for ALT are 126 U/L and 120 U/L for ACT. For both the formulation control group and the cDNA group AAV mF8 6E+12 gv/kg (baseline), ALT/AST levels were increased after liver biopsy (liver biopsy was performed on day 41), which is indicated by an asterisk. Otherwise, the AAV 4F8 cDNA was well tolerated throughout the study (247 days) (see FIGS. 28A and 28B).

[0191] The data is shown in FIG. 29, with the data set for each monkey shown in the graphs. The data show that higher doses (comparison of Fig. 29A with Fig. 29B) of the test preparation in the background of the AAV6 serotype produced FVIII-BDD expression at nearly 10-fold levels compared to normal human plasma. Data for the test drug in serotype AAV2/8 showed an increase in FVIII activity, but not to the same extent as for AAV2/6.

[0192] After the initial 14 day period described above, the experiment continued until 247 days after a single dose of AAV-FVIII-BDD. The co-dosing of the steroid was discontinued on the 103rd day. Plasma levels of hFVIII-BDD in monkeys were determined using a standard ELISA as follows. 96-well half HB (high binding) polystyrene microplates (Corning) were coated overnight at 4°C with anti-murine hFVIII monoclonal antibody (Green Mountain, Burlington, VT) in 0.2 M carbonate bicarbonate buffer at pH 9.4 (Thermo Fisher Scientific, Waltham, MA). The next day, the plates were washed four times using 1x TBST (Thermo Fisher Scientific, Waltham, MA). The 96-well plates were then blocked for two hours at room temperature using 3% BSA/TBS blocking buffer and then washed four times with 1x TBST. Plasma was added to the plate and incubated by shaking at room temperature for two hours followed by washing four times with 1x TBST. A detection antibody, a biotinylated anti-mouse FVIII monoclonal antibody (Green Mountain, Burlington, Vermont), was added and incubated for one hour at room temperature, followed by washing four times with 1X TBST. Streptavidin HRP (horseradish peroxidase) (Jackson ImmunoResearch, West Grove, PA) was added and incubated for one hour at room temperature and then washed four times with 1x TBST. TMB Ultra (Thermo Fisher Scientific, Waltham, MA) was added and allowed to stand for ten minutes, the reaction was stopped with stop solution and absorbance measured at 450 nM with a scanning spectrophotometer to read the plates. Background absorbance readings were negligible (usually 0). The presence of FVIII inhibitory antibodies was determined using the Bethesda assay (eg, see Rasper et al (1975) Thromb Diath Haemorrh 34:869-72). ELISA analysis was used to assess peak levels of human FVIII antigen during the course of the study. At dose levels of 2E+12 gv/kg (n=3), peaks of 111.0%, 493.9%, and 840.0% (overall mean 481.6% as measured by hFVIII ELISA) of normal hFVIII levels were achieved. human in blood plasma. At the higher dose of 6E+12 gv/kg (n=3), peaks of 450.0%, 625.6%, and 886.7% [654.1% overall mean] hFVIII plasma levels were achieved ( Fig. 30).

[0193] The study described in Table 4 was conducted and the levels of FVIII-BDD and any FVIII inhibitory antibodies were measured. For low-dose (n=3) animals containing FVIII-BDD cDNA in AAV2/6 treated at 2E+12 gv/kg, after detecting sustained hFVIII antigen (Ag) levels, hFVIII-BDD levels decreased while increasing Bethesda units (BE). BU decreased over time, and AG hFVIII increased (Fig. 31). The results showed that after the withdrawal of immunosuppressive therapy, the levels (as measured by ELISA) of the human FVIII antigen decreased.

[0194] For high dose animals (n=3) containing FVIII-BDD cDNA in AAV2/6, treated at a dose of 6E+12 gv/kg, a similar pattern was observed (see Fig. 32). However, in one animal, 3101, no anti-FVIII antibodies were detected after removal of Solu-Medrol, despite a detectable and sustained level of FVIII antigen (which is 200% of normal hFVIII levels), which may indicate that the animal is tolerant to the human FVIII antigen.

[0195] When the AAV2/8 serotype was used for high dose delivery, similar results were observed, except that the amount of hFVIII antigen detected in plasma was less than when using the AAV2/6 vector (Fig. 33). Similarly, when the FVIII-BDD cDNA of another promoter module (Group 5 described above) was tested in the AAV2/8 vector, plasma levels of hFVIII-BDD were the same as in Group 4 (FIG. 34). However, as noted above, there were two individuals that maintained a detectable level of FVIII-BDD expression (5101 and 5102) and an individual in Group 4 (4103, Fig. 33D) with no detectable antibody response after removal of Solu-Medrol, again suggestive about antigen tolerization after sustained response levels observed during the first days of the experiment.

[0196] As shown in FIG. 34D, Animal #5101 appears to have become tolerant to hFVIII-BDD, as after methylprednisolone withdrawal, hFVIII-BDD levels remained stable for 8 weeks at approximately 0.1 U/mL (which is 10% of normal nFVIII levels) . Also, as shown in FIG. 34E, Animal #5102 appears to have become tolerant to hFVIII-BDD as after methylprednisolone withdrawal, hFVIII-BDD levels remained stable for 8 weeks at approximately 0.6 U/mL (which is 60% of normal hFVIII levels) . It is worth noting that normal human plasma levels of 4FVIII are approximately 1 U/mL or 200 ng/mL, and that even 1% to 5% expression of normal levels (>0.001 U/mL) can be of therapeutic efficacy (Llung, RC ( 1999) Thromb Haemost 82(2):525-530).

[0197] NHP experiments were also performed as described above, except that different immunosuppression regimens were investigated. For these experiments, the dosing regimen shown in FIG. 26B, with some groups (1-5) receiving immunosuppressive treatment administered prior to test drug administration, while other groups (6-8) received immunosuppression after test drug administration.

[0198] As shown in FIG. 38, at dose levels of 6E+11 gv/kg (n=3, Group 3), the overall mean peak value was 5.7% (measured by hFVIII ELISA) of normal human plasma levels of hFVIII. At the higher dose of 2E+12 gw/kg (n=3, Group 4), the overall mean peak values were 56.5%, and at 6E+12 gw/kg (n=3, Group 5), the overall mean Peak values were 229.0% (measured by hFVIII ELISA) of hFVIII plasma levels. At the 2E+12 gw/kg dose level (n=3, Group 7), the overall mean peak value was 87.9%, and for the 6E+12 gw/kg (n=3, Group 8) it was 101.7%. Groups 1 and 6 were composition control groups, designated Composition. In addition, as shown in FIG. 39, repeated dosing with the same serotype resulted in detectable levels of circulating human FVIII antigen. These results indicate that prior immunosuppressive treatment of animals may be beneficial in maximizing therapeutic protein expression. In addition, pre-treatment allows re-dose when no neutralizing antibodies have been produced after the first dose. Fig. 39 also shows the dose effect of hFVIII expression in treated animals in response to different dose ranges of FVIII-BDD cDNA. Since even 1-5% plasma FVIII protein is thought to have significant therapeutic efficacy in humans, clinical doses in the E11 range (resulting in 5.7-12.0 percent of normal levels in this experiment) are likely to have significant therapeutic benefit. Thus, the data show that the constructs described herein result in therapeutic levels of transgene production in vivo.

Example 3 Nuclease-Mediated Targeted Integration

[0199] The constructs described in Examples 1 and 2 were also evaluated for expression

when used in combination with albumin-specific nucleases for targeted integration of the expression construct into the albumin gene locus. In particular, the constructs were injected into HepG2 cells with albumin-specific zinc finger nucleases. See, for example, US patent No. 9,150,847; 9,255,250 and US Patent Publication No. 20130177983; 20150159172; 20150056705 and 20150166618.

[0200] Human HepG2 liver cells were maintained according to the manufacturer's recommendations (ATCC, Manassas, Va.). On the day of the experiment, HepG2 cells were washed, trypsinized and counted. The ZFNs used were specific for the human albumin intron locus along with the human factor VIII cDNA-BDD (hFVIII) CRMSBS2 No intron, delivered as AAV2/6, and designated as time zero. AAV2/6 ZFN were delivered at 3.0E+05, and AAV2/6 hFVIII cDNA CRMSBS2 No intron at 3.0E+04, 6.0E+04 and 1.2E+05 for 1E+05 cells per well 24 -well plate. Thus, the expression constructs were administered at increasing doses from 3.0E+04.6.0E+04 and 1.2E+05 along with ZFN 3.0E+05. Control samples included the introduction of the CRMSGS2 SBR Intron 3 transgene alone or with GFP, ZFN only, or GFP alone. The next day, the media were changed. Supernatants were analyzed for secreted hFVIII using hFVIII ELISA, described below, 19 days after addition of the AAV2/6 virus.

[0201] Secreted levels of human factor VIII-BDD were determined using the Affinity Biologicals (Canada) ELISA kit (FVIII-AG) according to the manufacturer's protocol, except for the human factor VIII standard. The human factor VIII standard used in the ELISA assay is recombinant purified human factor VIII (#F0016-06) from US Biologicals (Salem, MA). Briefly, the HepG2 supernatant was added to the plate, incubated by shaking at room temperature for one and a half hours, followed by washing three times with the wash buffer provided in the kit. The detection antibody provided with the kit was added and incubated for forty-five minutes at room temperature, followed by washing three times with the wash buffer provided in the kit. The TMB substrate provided in the kit was added and left for 10 minutes. The reaction was stopped with stop solution and the absorbance was read at 450 nM using a scanning spectrophotometer to read the plates.

[0202] Total hFVIII-BDD protein levels found in HepG2 cell supernatant over time (t=days) after administration of albumin-targeted ZFNs (SBS#47171/47898, see PCT Patent Application Publication WO 2015/089077) and the specified design (Fig. 36). In the presence of both the FVIII BDD expression construct and ZFN, secreted FVIII BDD was detected in the supernatant three days post-treatment with the highest dose of the FVIII BDD transgene and then detected at a lower dose on day five and detected at all levels on day seven . In the absence of ZFN, FVIII BDD in the supernatant was practically not detectable above the background level of the assay on the seventh day. Data shown are n=3 biological repeats. The "whiskers" of errors represent the standard error of the mean of technical repetitions. The dotted line represents the limit of detection of hFVIII by ELISA. Secreted hFVIII-BDD was poorly detected in the absence of ZFN, as episomal hFVIII-BDD was likely diluted or degraded to accumulate a sufficient amount of detectable secreted hFVIII-BDD from this episome.

[0203] In addition, as determined by quantitative PCR (using the 5' primer located within the endogenous human albumin locus, the probe is within the hFVIII-BDD ICP cassette, and the 3' primer is within the hFVIII-BDD), targeted integration ( using NHEJ) of these constructs was achieved only in the presence of albumin-specific ZFNs (Fig. 37). Thus, these data demonstrate successful integration of the hFVIII-BDD cassette and expression of the encoded F8 protein.

[0204] These experiments were repeated, testing a different set

albumin-specific ZFNs (SBS#42906/43043, see patent application publication WO 2015/089046). The results (FIGS. 40A and 40B) show FVIII protein expression in the supernatant of these cells and targeted integration of the transgene.

[0205] The albumin-specific ZFNs and constructs are then delivered in vivo to animals as essentially described in Examples 1 and 2. The constructs are integrated into the endogenous albumin locus and express the transgene.

[0206] The experimental design of the in vivo studies is shown below in Table 5.

Briefly, F1 generation male C57BL/6 mouse pups were used for the in vivo study (test preparation is indicated in Table 5). The study used ZFN SBS#48641 and SBS#31523 (See US Patent Publication 2014-0017212). The study was conducted in accordance with the animal welfare law for the humane care and use of animals. Test preparations were thawed at room temperature prior to dosing and all animals received one 100 μl subcutaneous injection as described below. The ZFN dose was 1.5 U+11 gv/mouse and the F8 cDNA dose was 1.5 U+11 gv/mouse. Blood was collected after euthanasia from two or three pups per group on each of days 7, 14, 21 and 28 and processed to plasma for analysis of circulating plasma levels of 4FVIII using mouse hFVIII ELISA. Tissues were harvested from all mice for analysis of gene modification levels by deep sequencing (indels, insertions and deletions), mRNA analysis by RT-PCR, vector genome analysis by qPCR, and targeted integration analysis by qPCR.

a: Total dose of AAV calculated using a body weight of 1.2 g

b: Injected once in one volume of 100 µl.

[0207] The levels of F8 found in plasma are shown in Table 6 below, as is the amount of targeted integration of the FVIII-BDD transgene.

Table 6: F8 expression and transgene integration

*: data not provided

HC: not significantly above background

[0208] Thus, FVIII was detected in mouse pups after the introduction of albumin-specific nucleases and the FVIII-BDD transgene. The transgene insertion was also detected in greater numbers in mice treated with both ZFN and the transgene.

[0209] Thus, nuclease-mediated targeted integration of the constructs described herein allows expression of the transgene in liver cells.

[0210] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

[0211] Although the present invention has been described in detail by way of illustration and example for purposes of clarity of understanding, it will be apparent to those skilled in the art that various changes and modifications may be practiced without departing from the spirit or scope of the invention. Accordingly, the above descriptions and examples should not be construed as limiting.

Positions indicated on the graphic materials:

FIG. 5

1ʺ Scale

2ʺ хр14

3ʺ spaces

4ʺ Man

5ʺ Chimpanzee

6ʺ Gorilla

7ʺ Orangutan

8ʺ Gibbon

9ʺ Rhesus

10ʺ Crab-Eating Macaque

11ʺ Baboon

12ʺ Green monkey

13ʺ Galago

14" Mouse

15ʺ HepG2 Sig

16ʺ Blat sequence

17ʺ HepG2 Original

18ʺ Alignment Multiz 100 Vertebrates

19' HepG2 DNase I DGF Hot spots from ENCODE/UW

20' HepG2 DNase I DGF Peaks from ENCODE/UW

21' HepG2 DNase I DGF Signal per Base from ENCODE/UW

22ʺ Your Blat Search Sequence

23ʺ (RefSeq, GenBank, CCDS, Rfam, tRNA and Comparative Genomics)

24' HepG2 DNase I DGF Raw Signal from ENCODE/U

--->

SEQUENCE LISTING

<110> SANGAMO BIOSCIENCES, INC.

<120> LIVER-SPECIFIC CONSTRUCTS, FACTOR VIII EXPRESSION CASSETTES AND

METHODS OF USE THEREOF

<130> 8325-0150.40

<140> PCT/US2016/042099

<141> 2016-07-13

<150> 62/355.106

<151> 2016-06-27

<150> 62/326.229

<151> 2016-04-22

<150> 62/315.438

<151> 2016-03-30

<150> 62/307.897

<151> 2016-03-14

<150> 62/247.469

<151> 2015-10-28

<160> 47

<170>PatentIn version 3.5

<210> 1

<211> 40

<212> DNA

<213> Homo sapiens

<400> 1

gtcaccccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 2

<211> 40

<212> DNA

<213> Pan troglodytes

<400> 2

gtcaccccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 3

<211> 40

<212> DNA

<213> Gorilla sp.

<400> 3

gtcaccccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 4

<211> 40

<212> DNA

<213> Pongo sp.

<400> 4

gtcaccccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 5

<211> 40

<212> DNA

<213> Unknown

<220>

<223> Description of Unknown: Oligonucleotide from

Gibbon species

<400> 5

gtcaccccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 6

<211> 40

<212> DNA

<213> Macaca mulatta

<400> 6

atcaccccag ttaccgggagg agcaaacagg gactaagttc 40

<210> 7

<211> 40

<212> DNA

<213> Macaca fascicularis

<400> 7

atcaccccag ttaccgggagg agcaaacagg gactaagttc 40

<210> 8

<211> 40

<212> DNA

<213> Papio sp.

<400> 8

atcaccccag ttaccgggagg agcaaacagg gactaagttc 40

<210> 9

<211> 40

<212> DNA

<213> Chlorocebus sabaeus

<400> 9

atcaccccag ttaccgggagg agcaaacagg gactaagttc 40

<210> 10

<211> 40

<212> DNA

<213> Unknown

<220>

<223> Description of Unknown: Oligonucleotide from

Callitrichidae family

<400> 10

gtcagcccag ttatcgggagg agcaaacagg ggctaagtcc 40

<210> 11

<211> 39

<212> DNA

<213> Saimiri sp.

<400> 11

gtcagcccag ttacgggagg agcaaacagg gctaagtcc 39

<210> 12

<211> 38

<212> DNA

<213> Unknown

<220>

<223> Description of Unknown: Oligonucleotide from

bush baby species

<400> 12

gtcacccagt tatcagggag caaacagggag ctaagtcc 38

<210> 13

<211> 40

<212> DNA

<213> Mus sp.

<400> 13

gtcaccacag ttattggtag agcaaacagg ggctatgtcc 40

<210> 14

<211> 88

<212> DNA

<213> Minute virus of mice

<400> 14

aagaggtaag ggtttaaggg atggttggtt ggtggggtat taatgtttaa ttacctgttt 60

tacaggcctg aaatcacttg gttttaggg 88

<210> 15

<211> 92

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 15

aagaggtaag ggtttaaggg atggttggtt ggtggggcat taatgtttaa ttacctgaac 60

gacgcgccac taatcacttt ttttcaggtt gg 92

<210> 16

<211> 92

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 16

aagaggtaag ggtttaaggg atggttggtt ggtggggcat taatgtttaa ttacgacaac 60

gacgcgcctg aaatcacttt ttttcaggtt gg 92

<210> 17

<211> 94

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 17

aagaggtaag ggtttaagtt atcgttagtt cgtgcaccat taatgtttaa ttacctggag 60

cacctgcctg aaatcacttt ttttttcagg ttgg 94

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 18

ggagatgaag aaggaggact ttg 23

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 19

acatctacga cgaggacgag aacca 25

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 20

tccacagcag caatgaagta g 21

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 21

ccctgggccag ttcctgct 18

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 22

ttctgccaca tcagcagcca cca 23

<210> 23

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 23

ggcctccatg ccatcatg 18

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 24

agtgcaaagt aacttagagt gact 24

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 25

ccatcactag gggttcctgc ggcct 25

<210> 26

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 26

cctgaaggtg gcaatggt 18

<210> 27

<400> 27

000

<210> 28

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 28

ggaaccattg ccaccttca 19

<210> 29

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 29

ctatccattg cactatgct 19

<210> 30

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 30

ttttcctgtaa cgatcggg 18

<210> 31

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 31

aataaaatat ctttattttc attacatctg tgtgttggtt ttttgtgtgt t 51

<210> 32

<211> 69

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 32

ataaaatatc tttattttca ttacatctgt gtgttggttt tttgtgtgtt ctatccattg 60

cactatgct 69

<210> 33

<211> 68

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 33

aataaaatat ctttattttc attacatctg tgtgttggtt ttttgtgtgt tttcctgtaa 60

cgatcggg 68

<210> 34

<211> 4800

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

polynucleotide

<400> 34

gcggcctaag cttggaacca ttgccacctt cagggggagg ctgctggtga atattaacca 60

120

gtctgcacat ttcgtagagc gagtgttccg atactctaat ctccctaggc aaggttcata 180

tttgtgtagg ttacttattc tccttttgtt gactaagtca ataatcagaa tcagcaggtt 240

tggagtcagc ttggcaggga tcagcagcct gggttggaag gagggggtat aaaagcccct 300

tcaccaggag aagccgtcac acagatccac aagctcctgc tagtatgcag atcgagctct 360

ccacctgctt ctttctgtgc ctgttgagat tctgcttcag cgccaccagg agatactacc 420

tgggggctgt ggagctgagc tgggactaca tgcagtctga cctgggggag ctgcctgtgg 480

atgccaggtt cccccccaga gtgcccaaga gcttcccctt caacacctct gtggtgtaca 540

agaagaccct gtttgtggag ttcactgacc acctgttcaa cattgccaag cccaggcccc 600

cctggatggg cctgctgggc cccaccatcc aggctgaggt gtatgacact gtggtgatca 660

ccctgaagaa catggccagc caccctgtga gcctgcatgc tgtgggggtg agctactgga 720

aggcctctga gggggctgag tatgatgacc agaccagcca gagggagaag gaggatgaca 780

aggtgttccc tgggggcagc cacacctatg tgtggcaggt gctgaaggag aatggcccca 840

tggcctctga ccccctgtgc ctgacctaca gctacctgag ccatgtggac ctggtgaagg 900

acctgaactc tggcctgatt ggggccctgc tggtgtgcag ggagggcagc ctggccaagg 960

agaagaccca gaccctgcac aagttcatcc tgctgtttgc tgtgtttgat gagggcaaga 1020

gctggcactc tgaaaccaag aacagcctga tgcaggacag ggatgctgcc tctgccaggg 1080

cctggcccaa gatgcacact gtgaatggct atgtgaacag gagcctgcct ggcctgattg 1140

gctgccacag gaagtctgtg tactggcatg tgattggcat gggcaccacc cctgaggtgc 1200

acagcatctt cctggagggc cacaccttcc tggtcaggaa ccacaggcag gccagcctgg 1260

agatcagccc catcaccttc ctgactgccc agaccctgct gatggacctg ggccagttcc 1320

tgctgttctg ccacatcagc agccaccagc atgatggcat ggaggcctat gtgaaggtgg 1380

1440

atgatgacct gactgactct gagatggatg tggtgaggtt tgatgatgac aacagcccca 1500

gcttcatcca gatcaggtct gtggccaaga agcaccccaa gacctgggtg cactacattg 1560

ctgctgagga ggaggactgg gactatgccc ccctggtgct ggcccctgat gacaggagct 1620

acaagagcca gtacctgaac aatggccccc agaggattgg caggaagtac aagaaggtca 1680

ggttcatggc ctacactgat gaaaccttca agaccaggga ggccatccag catgagtctg 1740

gcatcctggg ccccctgctg tatggggagg tgggggacac cctgctgatc atcttcaaga 1800

accaggccag caggccctac aacatctacc cccatggcat cactgatgtg aggcccctgt 1860

acagcaggag gctgcccaag ggggtgaagc acctgaagga cttccccatc ctgcctgggg 1920

agatcttcaa gtacaagtgg actgtgactg tggaggatgg ccccaccaag tctgacccca 1980

ggtgcctgac cagatactac agcagctttg tgaacatgga gagggacctg gcctctggcc 2040

tgattggccc cctgctgatc tgctacaagg agtctgtgga ccagaggggc aaccagatca 2100

tgtctgacaa gaggaatgtg atcctgttct ctgtgtttga tgagaacagg agctggtacc 2160

tgactgagaa catccagagg ttcctgccca accctgctgg ggtgcagctg gaggaccctg 2220

agttccaggc cagcaacatc atgcacagca tcaatggcta tgtgtttgac agcctgcagc 2280

tgtctgtgtg cctgcatgag gtggcctact ggtacatcct gagcattggg gcccagactg 2340

acttcctgtc tgtgttcttc tctggctaca ccttcaagca caagatggtg tatgaggaca 2400

ccctgaccct gttccccttc tctggggaga ctgtgttcat gagcatggag aaccctggcc 2460

tgtggattct gggctgccac aactctgact tcaggaacag gggcatgact gccctgctga 2520

aagtctccag ctgtgacaag aacactgggg actactatga ggacagctat gaggacatct 2580

ctgcctacct gctgagcaag aacaatgcca ttgagcccag gagcttcagc cagaatccac 2640

ccgtccttaa gcgccatcag cgcgagatca ccaggaccac cctgcagtct gaccaggagg 2700

agattgacta tgatgacacc atctctgtgg agatgaagaa ggaggacttt gacatctacg 2760

acgaggacga gaaccagagc cccaggagct tccagaagaa gaccaggcac tacttcattg 2820

ctgctgtgga gaggctgtgg gactatggca tgagcagcag cccccatgtg ctgaggaaca 2880

gggcccagtc tggctctgtg ccccagttca agaaggtggt gttccaggag ttcactgatg 2940

gcagcttcac ccagcccctg tacagagggg agctgaatga gcacctgggc ctgctgggcc 3000

3060

ggccctacag cttctacagc agcctgatca gctatgagga ggaccagagg cagggggctg 3120

agccaggaa gaactttgtg aagcccaatg aaaccaagac ctacttctgg aaggtgcagc 3180

accacatggc ccccaccaag gatgagtttg actgcaaggc ctgggcctac ttctctgatg 3240

tggacctgga gaaggatgtg cactctggcc tgattggccc cctgctggtg tgccacacca 3300

acaccctgaa ccctgcccat ggcaggcagg tgactgtgca ggagtttgcc ctgttcttca 3360

ccatctttga tgaaaccaag agctggtact tcactgagaa catggagagg aactgcaggg 3420

ccccctgcaa catccagatg gaggacccca ccttcaagga gaactacagg ttccatgcca 3480

tcaatggcta catcatggac accctgcctg gcctggtgat ggcccaggac cagaggatca 3540

ggtggtacct gctgagcatg ggcagcaatg agaacatcca cagcatccac ttctctggcc 3600

atgtgttcac tgtgaggaag aaggaggagt acaagatggc cctgtacaac ctgtaccctg 3660

gggtgtttga gactgtggag atgctgccca gcaaggctgg catctggagg gtggagtgcc 3720

tgattgggga gcacctgcat gctggcatga gcaccctgtt cctggtgtac agcaacaagt 3780

gccagacccc cctgggcatg gcctctggcc acatcaggga cttccagatc actgcctctg 3840

gccagtatgg ccagtgggcc cccaagctgg ccaggctgca ctactctggc agcatcaatg 3900

3960

tccatggcat caagacccag ggggccaggc agaagttcag cagcctgtac atcagccagt 4020

tcatcatcat gtacagcctg gatggcaaga agtggcagac ctacaggggc aacagcactg 4080

gcaccctgat ggtgttcttt ggcaatgtgg acagctctgg catcaagcac aacatcttca 4140

acccccccat cattgccaga tacatcaggc tgcaccccac ccactacagc atcaggagca 4200

ccctgaggat ggagctgatg ggctgtgacc tgaacagctg cagcatgccc ctgggcatgg 4260

agagcaaggc catctctgat gccagatca ctgccagcag ctacttcacc aacatgtttg 4320

ccacctggag ccccagcaag gccaggctgc atctgcaggg caggagcaat gcctggaggc 4380

cccaggtcaa caaccccaag gagtggctgc aggtggactt ccagaagacc atgaaggtga 4440

ctggggtgac cacccagggg gtgaagagcc tgctgaccag catgtatgtg aaggagttcc 4500

tgatcagcag cagccaggat ggccaccagt ggaccctgtt cttccagaat ggcaaggtga 4560

aggtgttcca gggcaaccag gacagcttca cccctgtggt gaacagcctg gacccccccc 4620

tgctgaccag atacctgagg attcaccccc agagctggggt gcaccagatt gccctgagga 4680

tggaggtgct gggctgtgag gcccaggacc tgtactgagg atccaataaa atatctttat 4740

tttcattaca tctgtgtgtt ggttttttgt gtgttttcct gtaacgatcg ggctcgagcg 4800

<210> 35

<211> 72

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 35

gggggaggct gctggtgaat attaaccaag atcagcccag ttaccgggagg agcaaacagg 60

ggctaagttc ac 72

<210> 36

<211> 72

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 36

gggggaggct gctggtgaat attaaccaag atcaccccag ttaccgggagg agcaaacagg 60

gactaagttc ac 72

<210> 37

<211> 4894

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

polynucleotide

<400> 37

gcggcctaag cttggaacca ttgccacctt cagggggagg ctgctggtga atattaacca 60

120

gtctgcacat ttcgtagagc gagtgttccg atactctaat ctccctaggc aaggttcata 180

tttgtgtagg ttacttattc tccttttgtt gactaagtca ataatcagaa tcagcaggtt 240

tggagtcagc ttggcaggga tcagcagcct gggttggaag gagggggtat aaaagcccct 300

tcaccaggag aagccgtcac acagatccac aagctcctga agaggtaagg gtttaagtta 360

tcgttagttc gtgcaccatt aatgtttaat tacctggagc acctgcctga aatcattttt 420

ttttcaggtt ggctagtatg cagatcgagc tctccacctg cttctttctg tgcctgttga 480

gattctgctt cagcgccacc aggagatact acctgggggc tgtggagctg agctgggact 540

acatgcagtc tgacctgggg gagctgcctg tggatgccag gttccccccc agagtgccca 600

agagcttccc cttcaacacc tctgtggtgt acaagaagac cctgtttgtg gagttcactg 660

accacctgtt caacattgcc aagcccaggc ccccctggat gggcctgctg ggccccacca 720

tccaggctga ggtgtatgac actgtggtga tcaccctgaa gaacatggcc agccaccctg 780

tgagcctgca tgctgtgggg gtgagctact ggaaggcctc tgagggggct gagtatgatg 840

accagaccag ccagagggag aaggaggatg acaaggtgtt ccctgggggc agccacacct 900

atgtgtggca ggtgctgaag gagaatggcc ccatggcctc tgaccccctg tgcctgacct 960

acagctacct gagccatgtg gacctggtga aggacctgaa ctctggcctg attggggccc 1020

tgctggtgtg cagggagggc agcctggcca aggagaagac ccagaccctg cacaagttca 1080

tcctgctgtt tgctgtgttt gatgagggca agagctggca ctctgaaacc aagaacagcc 1140

tgatgcagga cagggatgct gcctctgcca gggcctggcc caagatgcac actgtgaatg 1200

gctatgtgaa caggagcctg cctggcctga ttggctgcca caggaagtct gtgtactggc 1260

atgtgattgg catgggcacc acccctgagg tgcacagcat cttcctggag ggccacacct 1320

tcctggtcag gaaccacagg caggccagcc tggagatcag ccccatcacc ttcctgactg 1380

cccagaccct gctgatggac ctgggccagt tcctgctgtt ctgccacatc agcagccacc 1440

agcatgatgg catggaggcc tatgtgaagg tggacagctg ccctgaggag ccccagctga 1500

ggatgaagaa caatgaggag gctgaggact atgatgatga cctgactgac tctgagatgg 1560

atgtggtgag gtttgatgat gacaacagcc ccagcttcat ccagatcagg tctgtggcca 1620

agaagcaccc caagacctgg gtgcactaca ttgctgctga ggaggaggac tgggactatg 1680

cccccctggt gctggcccct gatgacagga gctacaagag ccagtacctg aacaatggcc 1740

cccagaggat tggcaggaag tacaagaagg tcaggttcat ggcctacact gatgaaacct 1800

tcaagaccag ggaggccatc cagcatgagt ctggcatcct gggccccctg ctgtatgggg 1860

aggtggggga caccctgctg atcatcttca agaaccaggc cagcaggccc tacaacatct 1920

acccccatgg catcactgat gtgaggcccc tgtacagcag gaggctgccc aagggggtga 1980

agcacctgaa ggacttcccc atcctgcctg gggagatctt caagtacaag tggactgtga 2040

ctgtggagga tggccccacc aagtctgacc ccaggtgcct gaccagatac tacagcagct 2100

ttgtgaacat ggagagggac ctggcctctg gcctgattgg ccccctgctg atctgctaca 2160

aggagtctgt ggaccagagg ggcaaccaga tcatgtctga caagaggaat gtgatcctgt 2220

tctctgtgtt tgatgagaac aggagctggt acctgactga gaacatccag aggttcctgc 2280

ccaaccctgc tggggtgcag ctggaggacc ctgagttcca ggccagcaac atcatgcaca 2340

gcatcaatgg ctatgtgttt gacagcctgc agctgtctgt gtgcctgcat gaggtggcct 2400

actggtacat cctgagcatt ggggcccaga ctgacttcct gtctgtgttc ttctctggct 2460

acaccttcaa gcacaagatg gtgtatgagg acaccctgac cctgttcccc ttctctgggg 2520

agactgtgtt catgagcatg gagaaccctg gcctgtggat tctgggctgc cacaactctg 2580

acttcaggaa caggggcatg actgccctgc tgaaagtctc cagctgtgac aagaacactg 2640

gggactacta tgaggacagc tatgaggaca tctctgccta cctgctgagc aagaacaatg 2700

ccattgagcc caggagcttc agccagaatc cacccgtcct taagcgccat cagcgcgaga 2760

tcaccaggac caccctgcag tctgaccagg aggagattga ctatgatgac accatctctg 2820

tggagatgaa gaaggaggac tttgacatct acgacgagga cgagaaccag agccccagga 2880

gcttccagaa gaagaccagg cactacttca ttgctgctgt ggagaggctg tgggactatg 2940

gcatgagcag cagcccccat gtgctgagga acagggccca gtctggctct gtgccccagt 3000

tcaagaaggt ggtgttccag gagttcactg atggcagctt cacccagccc ctgtacagag 3060

gggagctgaa tgagcacctg ggcctgctgg gcccctacat cagggctgag gtggaggaca 3120

acatcatggt gaccttcagg aaccaggcca gcaggcccta cagcttctac agcagcctga 3180

tcagctatga ggaggaccag aggcagggggg ctgagcccag gaagaacttt gtgaagccca 3240

atgaaaccaa gacctacttc tggaaggtgc agcaccacat ggcccccacc aaggatgagt 3300

ttgactgcaa ggcctgggcc tacttctctg atgtggacct ggagaaggat gtgcactctg 3360

gcctgattgg ccccctgctg gtgtgccaca ccaacaccct gaaccctgcc catggcaggc 3420

aggtgactgt gcaggagttt gccctgttct tcaccatctt tgatgaaacc aagagctggt 3480

acttcactga gaacatggag aggaactgca gggccccctg caacatccag atggaggacc 3540

ccaccttcaa ggagaactac aggttccatg ccatcaatgg ctacatcatg gacaccctgc 3600

ctggcctggt gatggcccag gaccagagga tcaggtggta cctgctgagc atgggcagca 3660

atgagaacat cccagcatc cacttctctg gccatgtgtt cactgtgagg aagaaggagg 3720

agtacaagat ggccctgtac aacctgtacc ctggggtgtt tgagactgtg gagatgctgc 3780

ccagcaaggc tggcatctgg agggtggagt gcctgattgg ggagcacctg catgctggca 3840

tgagcaccct gttcctggtg tacagcaaca agtgccagac ccccctgggc atggcctctg 3900

gccacatcag ggacttccag atcactgcct ctggccagta tggccagtgg gcccccaagc 3960

tggccaggct gcactactct ggcagcatca atgcctggag caccaaggag cccttcagct 4020

ggatcaaggt ggacctgctg gcccccatga tcatccatgg catcaagacc cagggggcca 4080

ggcagaagtt cagcagcctg tacatcagcc agttcatcat catgtacagc ctggatggca 4140

agaagtggca gacctacagg ggcaacagca ctggcaccct gatggtgttc tttggcaatg 4200

tggacagctc tggcatcaag cacaacatct tcaacccccc catcattgcc agatacatca 4260

ggctgcaccc cacccactac agcatcagga gcaccctgag gatggagctg atgggctgtg 4320

acctgaacag ctgcagcatg cccctgggca tggagagcaa ggccatctct gatgcccaga 4380

tcactgccag cagctacttc accaacatgt ttgccacctg gagccccagc aaggccaggc 4440

tgcatctgca gggcaggagc aatgcctgga ggccccaggt caacaacccc aaggagtggc 4500

tgcaggtgga cttccagaag accatgaagg tgactggggt gaccacccag ggggtgaaga 4560

gcctgctgac cagcatgtat gtgaaggagt tcctgatcag cagcagccag gatggccacc 4620

agtggaccct gttcttccag aatggcaagg tgaaggtgtt cggggcaac caggacagct 4680

tcacccctgt ggtgaacagc ctggaccccc ccctgctgac cagatacctg aggattcacc 4740

cccagagctg ggtgcaccag attgccctga ggatggaggt gctgggctgt gaggcccagg 4800

acctgtactg aggatccaat aaaatatctt tattttcatt acatctgtgt gttggtttt 4860

tgtgtgtttt cctgtaacga tcgggctcga gcgc 4894

<210> 38

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

oligonucleotide

<400> 38

ttgaattcat aactatccca a 21

<210> 39

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 39

gtgtagcaga gaggaaccat t 21

<210> 40

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 40

ccatcactag gggttcctgc ggcct 25

<210> 41

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 41

gttaatttc accagcagcc t 21

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 42

agtgtagcag agaggaacca 20

<210> 43

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 43

ccatcactag gggttcctgc ggcct 25

<210> 44

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 44

cagggtgagc ccagaaac 18

<210> 45

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 45

aactttgagt gtagcagaga gg 22

<210> 46

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

probe

<400> 46

taccggagga gcaaacaggg acta 24

<210> 47

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Synthetic

primer

<400> 47

ctctacgaaa tgtgcagaca ga 22

<---

Claims (23)

1. Polynucleotide expression construct containing, from 5' to 3': a first insulator sequence containing SEQ ID NO: 28, a Serpin 1 enhancer sequence comprising SEQ ID NO: 36, minimal TTR promoter sequence, an intron sequence containing nucleotides 340-432 of SEQ ID NO: 37, transgene encoding human Factor VIII, polyadenylation signal sequence and a second insulator sequence comprising SEQ ID NO: 30. 2. Polynucleotide expression construct containing SEQ ID NO: 37. 3. Polynucleotide expression construct containing SEQ ID NO: 34. 4. An AAV vector containing a polynucleotide expression construct according to any one of paragraphs. 1-3, characterized in that the polynucleotide expression construct is located between the 5' and 3' inverted terminal repeats (ICP) of the AAV vector, and the specified AAV vector allows the expression of the transgene in the cell transduced by the specified vector. 5. The AAV vector according to claim 4, wherein the ICPs are AAV2 ICPs. 6. An AAV vector according to claim 4 or 5, characterized in that the vector contains an AAV6 capsid. 7. Pharmaceutical composition for the treatment of hemophilia in a subject in need thereof, containing the AAV vector according to paragraphs. 4-6. 8. Pharmaceutical composition for providing a transgene that encodes human Factor VIII, the subject in need of it, and the specified composition contains the AAV vector according to any one of paragraphs. 4-6. 9. A method for providing human Factor VIII to a subject in need thereof, wherein the method includes administering to the subject's liver an AAV vector according to any one of paragraphs. 4-6 or a pharmaceutical composition according to claim 7 or 8, wherein human Factor VIII is produced in the subject, said subject having insufficient levels of Factor VIII, and optionally said subject suffering from hemophilia. 10. The method of claim 9, wherein the transgene is integrated into the genome of the liver cell. 11. The method of claim 9 or 10, further comprising administering one or more nucleases to the subject, wherein the nuclease cleaves the endogenous albumin gene and the transgene integrates into the endogenous albumin gene. 12. A method for inducing tolerance in a subject to human Factor VIII, the method comprising modifying a cell in said subject to obtain human Factor VIII in accordance with the method of any one of claims. 9-11, and treating said subject with one or more steroids and/or B cell inhibitors such that the subject becomes tolerant to human Factor VIII. 13. A method of providing human Factor VIII to a subject in need thereof, the method comprising administering to the liver of said subject an AAV vector containing a polynucleotide expression construct comprising SEQ ID NO: 37, wherein human Factor VIII is produced in the subject and said subject is deficient Factor VIII level. 14. The method of claim 13, wherein the subject suffers from hemophilia A. 15. The method according to any one of paragraphs. 9-14, characterized in that the subject is a human.

Images