RU2769543C2 - Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv - Google Patents
Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv Download PDFInfo
- Publication number
- RU2769543C2 RU2769543C2 RU2021121679A RU2021121679A RU2769543C2 RU 2769543 C2 RU2769543 C2 RU 2769543C2 RU 2021121679 A RU2021121679 A RU 2021121679A RU 2021121679 A RU2021121679 A RU 2021121679A RU 2769543 C2 RU2769543 C2 RU 2769543C2
- Authority
- RU
- Russia
- Prior art keywords
- response
- apoe
- patients
- chemotherapy
- allele
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к медицине, а именно к онкологии, и может быть использовано для прогнозирования отрицательного/положительного ответа (исхода) у пациенток III и IV стадийспорадического рака яичников после первой линии комбинированной химиотерапии (препараты платины-паклитаксел)с первичной или интервальной циторедукцией.The invention relates to medicine, namely to oncology, and can be used to predict a negative/positive response (outcome) in patients with stage III and IV sporadic ovarian cancer after the first line of combined chemotherapy (platinum-paclitaxel preparations) with primary or interval cytoreduction.
Среди онкологических заболеваний органов женской репродуктивной системы распространенный рак яичников (далее - РЯ) является первой по значимости причиной смертности, удельный вес составляет 5,5% [Каприн А.Д., Старинский В.В., Шахзадова А.О. Злокачественные новообразования в России в 2019 году (заболеваемость и смертность). М.: МНИОИ им. П.А. Герцена -филиал ФГБУ «НМИЦ радиологии» Минздрава России. 2020. 252 с].РЯ в 75% случаев диагностируется на III-IV стадиях, поэтому прогноз крайне неблагоприятен, и в странах Европейского Союза пятилетняя выживаемость составляет 30% [Рак яичников. http://www.oncology.ru/specialist/epidemiology/malignant/C56/].Among oncological diseases of the female reproductive system, advanced ovarian cancer (hereinafter referred to as OC) is the first leading cause of death, its share is 5.5% [Kaprin A.D., Starinsky V.V., Shakhzadova A.O. Malignant neoplasms in Russia in 2019 (morbidity and mortality). Moscow: MNIOI im. P.A. Herzen - branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia. 2020. 252]. OC in 75% of cases is diagnosed at stages III-IV, so the prognosis is extremely unfavorable, and in the countries of the European Union, the five-year survival rate is 30% [Ovarian cancer. http://www.oncology.ru/specialist/epidemiology/malignant/C56/].
Стандартной схемой первой линии химиотерапии больных с распространенным раком яичников III и IV стадий, проводимой в комбинации с циторедуктивной операцией, является внутривенное введение таксанов (паклитаксел, доцетаксел) с платиносодержащими препаратами (цисплатин, карбоплатин), которые являются важными и эффективными противоопухолевыми цитостатиками для начальной терапии злокачественных опухолей яичников[Рак яичников/ рак маточной трубы/ первичный рак брюшины. Клинические рекомендации Минздрава РФ. МКБ 10: С48/ C56/ С57. 2019]. В зависимости от состояния пациенток проводят первичную операцию по удалению опухоли с последующей химиотерапией, или интервальную (после 2-3 циклов индукционной химиотерапии) в случае пациенток с тяжелым соматическим статусом или крайней выраженностью распространенности опухолевого процесса.После операции таким пациенткам проводится дополнительно 3-4 курса ХТ[Клинические рекомендации. «Рак яичников/ рак маточной трубы/ первичный рак брюшины» 2020. Ассоциация онкологов России. С48.0, С48.1, С48.2, С56, С57; Тюляндина А.С., Румянцев А.А., Морхов К.Ю., Нечушкина В.М., Тюляндин С.А. Ретроспективный анализ отдаленных результатов применения первичной циторедукции и предоперационной химиотерапии на первом этапе лечения больных IIIC-IV стадий рака яичника // Злокачественные опухоли 2018; 3:86-94].The standard first-line chemotherapy regimen for patients with advanced stage III and IV ovarian cancer, carried out in combination with cytoreductive surgery, is intravenous administration of taxanes (paclitaxel, docetaxel) with platinum-containing drugs (cisplatin, carboplatin), which are important and effective antitumor cytostatics for initial therapy. malignant ovarian tumors [ovarian cancer / fallopian tube cancer / primary peritoneal cancer. Clinical recommendations of the Ministry of Health of the Russian Federation. ICD 10: C48 / C56 / C57. 2019]. Depending on the condition of the patients, a primary operation is performed to remove the tumor, followed by chemotherapy, or an interval operation (after 2-3 cycles of induction chemotherapy) in the case of patients with a severe somatic status or an extreme prevalence of the tumor process. After the operation, such patients undergo an additional 3-4 courses XT [Clinical guidelines. "Ovarian cancer / fallopian tube cancer / primary peritoneal cancer" 2020. Association of Oncologists of Russia. C48.0, C48.1, C48.2, C56, C57; Tyulandina A.S., Rumyantsev A.A., Morkhov K.Yu., Nechushkina V.M., Tyulyandin S.A. Retrospective analysis of long-term results of the use of primary cytoreduction and preoperative chemotherapy at the first stage of treatment of patients with IIIC-IV stages of ovarian cancer // Malignant tumors 2018; 3:86-94].
После проведения первой линии ХТ (6 циклов) проводится оценка объективного эффекта по критериям оценки ответа солидных опухолей (ResponseEvaluationCriteriaInSolidTumors -RECIST1.1) [EisenhauerEA, TherasseP, BogaertsJ, SchwartzLH, SargentD, FordR, DanceyJ, ArbuckS, GwytherS, MooneyM, RubinsteinL, ShankarL, DoddL, KaplanR, LacombeD, VerweijJ.Newresponseevaluationcriteriainsolidtumours: revisedRECISTguideline (version 1.1). Eur J Cancer. 2009в].After the first line of chemotherapy (6 cycles), the objective effect is evaluated according to the criteria for evaluating the response of solid tumors (ResponseEvaluationCriteriaInSolidTumors -RECIST1.1) [EisenhauerEA, TherasseP, BogaertsJ, SchwartzLH, SargentD, FordR, DanceyJ, ArbuckS, GwytherS, MooneyM, RubinsteinL, ShankarL , DoddL, KaplanR, LacombeD, VerweijJ. Newresponseevaluationcriteriainsolidtumours: revisedRECISTguideline (version 1.1). Eur J Cancer. 2009c].
Эпителиальный рак яичников (РЯ) характеризуется высокой чувствительностью к химиотерапии (XT). В большинстве случаев опухоль является чувствительной к производным платины и, рецидив наступает спустя год или более после первой линии ХТ [Oronsky, B., Ray, C.M., Spira, A.I. etal. A brief review of the management of platinum-resistant-platinum-refractory ovarian cancer. Med Oncol 34, 103 (2017). https://doi.org/10.1007/s12032-017-0960-z].В 75-85% случаев наблюдается полный или частичный ответ на терапию первой линии [Ulm M, Ramesh AV, McNamara KM, Ponnusamy S, Sasano H, Narayanan R. Therapeutic advances in hormone-dependent cancers: focus on prostate, breast and ovarian cancers. EndocrConnect. 2019 Feb 1;8(2):R10-R26. doi: 10.1530/EC-18-0425].Но у многих пациенток возникает резистентность во время лечения или вскоре после первой линии комбинированной химиотерапии. Зачастую применение противоопухолевых препаратов сопряжено с тяжелыми побочными эффектами. Идентификация молекулярных маркеров химиочувствительности и химиорезистентности существенно повысит эффективность противоопухолевой терапии, а разработка маркеров химиочувствительности новообразований поможет снизить затраты на терапию за счет более обоснованного использования дорогостоящих лекарств [Е.Н. Имянитов, В.М. Моисеенко. Применение молекулярно-генетического анализа для выбора противоопухолевой терапии. Вопросы онкологии.2008. Т.54. №2. Стр. 121-132].Epithelial ovarian cancer (OC) is characterized by high sensitivity to chemotherapy (XT). In most cases, the tumor is sensitive to platinum derivatives and recurrence occurs a year or more after the first line chemotherapy [Oronsky, B., Ray, C.M., Spira, A.I. etal. A brief review of the management of platinum-resistant-platinum-refractory ovarian cancer. Med Oncol 34, 103 (2017). https://doi.org/10.1007/s12032-017-0960-z]. In 75-85% of cases, there is a complete or partial response to first-line therapy [Ulm M, Ramesh AV, McNamara KM, Ponnusamy S, Sasano H, Narayanan R. Therapeutic advances in hormone-dependent cancers: focus on prostate, breast and ovarian cancers. EndocrConnect. 2019 Feb 1;8(2):R10-R26. doi: 10.1530/EC-18-0425]. But many patients develop resistance during treatment or shortly after first-line combination chemotherapy. Often, the use of anticancer drugs is associated with severe side effects. Identification of molecular markers of chemosensitivity and chemoresistance will significantly increase the effectiveness of antitumor therapy, and the development of markers of chemosensitivity of neoplasms will help reduce the cost of therapy due to more reasonable use of expensive drugs [E.N. Imyanitov, V.M. Moiseenko. Application of molecular genetic analysis for the choice of anticancer therapy. Issues of oncology.2008. T.54. No. 2. Page 121-132].
Хотя по всему миру ведутся исследования по идентификации факторов устойчивости злокачественных опухолей яичников ктаксанам, платиносодержащей терапии или их комбинации, в настоящее время не известны молекулярные механизмы, лежащие в основе различий ответа опухоли первичных пациентов с распространенным раком яичников на лечение первой линии терапии и нет соответствующих биологических маркеров.Although worldwide research is underway to identify resistance factors in ovarian malignancies to ctaxanes, platinum-containing therapy, or a combination of both, the molecular mechanisms underlying the differences in tumor response of primary patients with advanced ovarian cancer to first-line therapy are not currently known and there are no relevant biological markers.
Предшествующий уровень техники настоящего изобретенияBackground of the Invention
Для 25-15% пациенток терапия первой линии заведомо неэффективна, что ухудшает дальнейшее лечение и качество жизни.For 25-15% of patients, first-line therapy is obviously ineffective, which worsens further treatment and quality of life.
Известен способ для прогноза эффективности лечения РЯ (паклитаксел, циклофосфамид, бевацизумаб, циторедукция), основанный на определении в биологических жидкостях (кровь, моча, слюна, опухолевые выпоты) помимо СА 125 и НЕ 4 уровня экспрессии полипептида ММР9 (GenBankAccessionNumber: NP_004985-2), связывающегося с микрочастицами, содержащими аннексин 5. Повышенные значения служат маркерами рецидива (WO2018143896 (A1) - 2018-08-09).A known method for predicting the effectiveness of the treatment of OC (paclitaxel, cyclophosphamide, bevacizumab, cytoreduction), based on the determination in biological fluids (blood, urine, saliva, tumor effusions) in addition to CA 125 and
Существенным ограничением способа является невозможность предсказать ответ на первую линию терапии до лечения и неизвестна его эффективность в отношении платиновых препаратов.A significant limitation of the method is the inability to predict the response to the first line of therapy before treatment and its effectiveness in relation to platinum drugs is unknown.
Известен способ прогнозирования эффективности лечения рака яичников препаратами платины (цисплатин, карбоплатин, оксалиплатин, сатраплатин) на основе определения в опухолевых клетках аномальной экспрессии ряда генов(US 2006/0019268 A1 от 26.01.2006). Повышенный уровень экспрессии АРОЕ является маркером резистентности опухоли к препаратам платины. Эксперименты выполнялись на клеточных моделях (6 пар чувствительных и резистентных к цисплатину штаммов культур клеток карциномы яичников человека).A known method for predicting the effectiveness of treatment of ovarian cancer with platinum drugs (cisplatin, carboplatin, oxaliplatin, satraplatin) based on the determination of abnormal expression of a number of genes in tumor cells (US 2006/0019268 A1 dated 26.01.2006). An elevated level of APOE expression is a marker of tumor resistance to platinum preparations. The experiments were performed on cell models (6 pairs of cisplatin-sensitive and cisplatin-resistant strains of human ovarian carcinoma cell cultures).
Однако, существенным недостатком является то, что оценка экспрессии генов проводилась на модельных системах и не известно, сохраняются ли выявленные закономерности invivo у пациенток в условиях проведения первой линии комбинированной ХТ. Нет данных об изоформах АРОЕ в исследованных культурах клеток.However, a significant drawback is that the gene expression was assessed on model systems and it is not known whether the identified patterns persist in vivo in patients under the conditions of first-line combined chemotherapy. There are no data on APOE isoforms in the studied cell cultures.
Известен способ диагностики и прогноза ответа РЯ в ходе комбинированной адьювантной и неоадьювантной химиотерапии, основанный на определении числа копий и экспрессии генов в локусе MECOM: EVI1 (ectopicviralintegrationsite 1) и MDS1 (Myelodysplasiasyndrome- 1) в опухолевой ткани (US2015/0024956A1 от 22.01.2015).Белковый продукт гена является фактором транскрипции, вовлеченным во множество сигнальных путей как для коэкспрессии, так и для коактивации генов клеточного цикла. Пациенты были стратифицированы по типу ответа на первую линию терапии на два класса: 288 человек с полным ответом,121 пациентка с неполным ответом, включающим частичный ответ, стабилизацию и прогрессию опухоли. На основании экспрессии генов EVI1 и MDS1 в опухолевой ткани и амплификации локуса MECOM, ассоциированного с резистентностью к химиотерапии эпителиального рака яичников, предсказывается ответ на лечение первой линии. Дается заключение, что в случае выявления амплификации MECOM локуса терапия должна быть более интенсивной. Авторы использовали информацию об экспрессии и амплификации генов опухоли эпителиального рака яичников 524 пациенток из базы данных CancerGenomeAtlas (TCGA) из NationalInstituteHealth (NIH).A known method for diagnosing and predicting the response of OC during combined adjuvant and neoadjuvant chemotherapy, based on determining the number of copies and gene expression in the MECOM locus: EVI1 (ectopicviralintegrationsite 1) and MDS1 (Myelodysplasiasyndrome-1) in tumor tissue (US2015/0024956A1 dated 22.01.2015 ).The protein product of the gene is a transcription factor involved in a variety of signaling pathways for both coexpression and coactivation of cell cycle genes. Patients were stratified according to the type of response to first line therapy into two classes: 288 patients with a complete response, 121 patients with an incomplete response, including a partial response, stabilization and progression of the tumor. Based on the expression of the EVI1 and MDS1 genes in tumor tissue and amplification of the MECOM locus associated with resistance to chemotherapy in epithelial ovarian cancer, response to first-line treatment is predicted. It is concluded that if amplification of the MECOM locus is detected, therapy should be more intensive. The authors used information about the expression and amplification of tumor genes of epithelial ovarian cancer of 524 patients from the CancerGenomeAtlas (TCGA) database from the National Institute Health (NIH).
Существенным ограничением данного изобретения является то, что выборка представляла собой смешанную группу, включающую больных с ранними (13%) и поздними стадиями (87%) заболевания. Имеются существенные недостатки, связанные с материалом исследования, это: 1- инвазивность при взятии образца ткани; 2 - в опухоли часто присутствуют клетки разных клонов, которые отличаются между собой по профилю экспрессии и метилирования генов; 3-показатели экспрессии генов зависят от качества выделенной РНК и доли злокачественных клеток в образце; 4- невозможно предсказать ответ на лечение до операции, т.е. в случае неоадьювантной терапии пациент сразу получает препараты по стандартной схеме.A significant limitation of this invention is that the sample was a mixed group, including patients with early (13%) and late stages (87%) of the disease. There are significant drawbacks associated with the material of the study, these are: 1- invasiveness when taking a tissue sample; 2 - cells of different clones are often present in the tumor, which differ from each other in the profile of gene expression and methylation; 3-indicators of gene expression depend on the quality of the isolated RNA and the proportion of malignant cells in the sample; 4- it is impossible to predict the response to treatment before surgery, i.e. in the case of neoadjuvant therapy, the patient immediately receives drugs according to the standard scheme.
Большое число исследований показало, что индивидуальная реакция на лечение зависит от вариаций в последовательности молекул ДНК.A large number of studies have shown that individual response to treatment depends on variations in the sequence of DNA molecules.
В декабре 2014 года Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) был одобрен тест BRACAnalysisCDx™ , разработанный компанией MyriadGenetics, для назначения препарата Lynparza™M (олапариб, PARP -ингибитор) пациенткам с диагнозом РЯ дополнительно к стандартной терапии. Он основан на определении мутаций в генах BRCA1 и BRCA2 в геномной ДНК, полученной из образцов цельной крови, собранных в ЭДТА вакутейнеры. Однонуклеотидые мутации, а также небольшие вставки и делеции, идентифицируют с помощью полимеразной цепной реакции (ПЦР) и секвенированием по Сэнгеру. Наличие мутаций является критерием для выявления пациенток, которым назначение PARP -ингибитора увеличит период ремиссии и повысит эффективность лечения (FDA ApprovalOrder, December 19, 2014. http://www.accessdata.fda.gov/cdrh_docs/pdf14/P140020a.pdf).In December 2014, the BRACAnalysisCDx™ test, developed by MyriadGenetics, was approved by the Food and Drug Administration (FDA) for the administration of Lynparza™ M (olaparib, a PARP inhibitor) to patients diagnosed with OC in addition to standard therapy. It is based on the detection of mutations in the BRCA1 and BRCA2 genes in genomic DNA obtained from whole blood samples collected in EDTA vacutainers. Single nucleotide mutations, as well as small insertions and deletions, are identified by polymerase chain reaction (PCR) and Sanger sequencing. The presence of mutations is a criterion for identifying patients in whom the appointment of a PARP inhibitor will increase the period of remission and increase the effectiveness of treatment (FDA ApprovalOrder, December 19, 2014. http://www.accessdata.fda.gov/cdrh_docs/pdf14/P140020a.pdf).
Специальные разделы персонализованной медицины - фармакогенетика и фармакогеномика изучают наследственные факторы, лежащие в основе вариабельности индивидуальной чувствительности к лекарственным препаратам (M.Whirl-Carrillo, E.M. McDonagh, J. M. Hebert, L. Gong, K. Sangkuhl, C.F. Thorn, R.B. Altmanand T.E. Klein. "PharmacogenomicsKnowledgeforPersonalizedMedicine" ClinicalPharmacology&Therapeutics (2012) 92(4): 414-417).Special sections of personalized medicine - pharmacogenetics and pharmacogenomics study the hereditary factors underlying the variability of individual sensitivity to drugs (M.Whirl-Carrillo, E.M. McDonagh, J.M. Hebert, L. Gong, K. Sangkuhl, C.F. Thorn, R.B. Altmanand T.E. Klein. "PharmacogenomicsKnowledgeforPersonalizedMedicine" ClinicalPharmacology&Therapeutics (2012) 92(4): 414-417).
В 2000 году создана онлайн-база знаний по фармакогеномике (PharmGKB,https://www.pharmgkb.org/), финансируемая Национальным институтом здравоохранения и Национальным институтом общих медицинский наук США. Основная цель - сбор информации о влиянии аллельных вариантов генов на фармакологический ответ пациентов. Она включает результаты как широкомасштабных многоцентровых полногеномных исследований, так и отдельных исследовательских групп.In 2000, an online pharmacogenomics knowledge base (PharmGKB, https://www.pharmgkb.org/ ) was created, funded by the National Institutes of Health and the US National Institute of General Medical Sciences. The main goal is to collect information on the effect of allelic variants of genes on the pharmacological response of patients. It includes the results of both large-scale multicenter genome-wide studies and individual research groups.
На основании данных, включенных на настоящий момент в эту базу, наиболее изученными в отношении оценки ответа на лечение (безрецидивный период, общая выживаемость)после проведения первой линии стандартной комбинированной химиотерапии являются гены, вовлеченные в процессы репарации ДНК, метаболизм лекарственных препаратов и, в частности, влияющих на фармакокинетику платиновых соединений, эндотелиальные и эпителиальные факторы роста эндотелия сосудов, их рецепторы.Это варианты rs11615 и rs3212986 генов репарации ERCC1 и rs1799793 (ERCC2),rs6413432 гена CYP2E1(член семейства цитохрома P450 ферментов, метаболизирующих лекарственные средства), rs1142345 гена TPMT (тиопурин-S-метилтрансфераза, ген биотрансформацииксенобиотиков), rs1695 GSTP1 (глютатион-S-трансфераза, фермент детоксикацииксенобиотиков) [TzvetkovMV, BehrensG, O'BrienVP, HohlochK, BrockmöllerJ, BenöhrP.Pharmacogeneticanalysesofcisplatin-inducednephrotoxicityindicatearenoprotectiv eeffectofERCC1 polymorphisms. Pharmacogenomics. 2011 Oct;12(10):1417-27. doi: 10.2217/pgs.11.93; Khrunin A, Ivanova F, Moisseev A, Khokhrin D, Sleptsova Y, Gorbunova V, Limborska S. Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012 Jan;13(2):171-8. doi: 10.2217/pgs.11.140;Khrunin AV, Moisseev A, Gorbunova V, Limborska S. Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. Pharmacogenomics J. 2010 Feb;10(1):54-61. doi: 10.1038/tpj.2009.45;Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Lambrechts S, Lambrechts D, Despierre E, Van Nieuwenhuysen E, Smeets D, Debruyne PR, Renard V, Vroman P, Luyten D, Neven P, Amant F, Leunen K, Vergote I; Belgian and Luxembourg Gynaecological Oncology Group (BGOG). Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer.BMC PharmacolToxicol. 2015 Feb 27;16:2. doi: 10.1186/s40360-015-0001-5; Liblab S, Vusuratana A, Areepium N. ERCC1, XRCC1, and GSTP1 Polymorphisms and Treatment Outcomes of Advanced Epithelial Ovarian Cancer Patients Treated with Platinum-based Chemotherapy. AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925]. Based on the data currently included in this database, the genes involved in DNA repair processes, drug metabolism, and in particular , affecting the pharmacokinetics of platinum compounds, endothelial and epithelial vascular endothelial growth factors, their receptors. These are the rs11615 and rs3212986 variants of the ERCC1 and rs1799793 (ERCC2) repair genes, the rs6413432 of the CYP2E1 gene (a member of the cytochrome P450 family of enzymes that metabolize drugs), the rs1142345 of the TPMT gene (thiopurine-S-methyltransferase, xenobiotic biotransformation gene), rs1695 GSTP1 (glutathione-S-transferase, xenobiotic detoxification enzyme) [TzvetkovMV, BehrensG, O'BrienVP, HohlochK, BrockmöllerJ, BenöhrP.Pharmacogeneticanalysesofcisplatin-inducednephrotoxicityindicatearenoprotectiv eefismofERCC1. Pharmacogenomics. 2011 Oct;12(10):1417-27. doi: 10.2217/pgs.11.93; Khrunin A, Ivanova F, Moisseev A, Khokhrin D, Sleptsova Y, Gorbunova V, Limborska S. Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012 Jan;13(2):171-8. doi: 10.2217/pgs.11.140; Khrunin AV, Moisseev A, Gorbunova V, Limborska S. Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. Pharmacogenomics J. 2010 Feb;10(1):54-61. doi: 10.1038/tpj.2009.45; Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Lambrechts S, Lambrechts D, Despierre E, Van Nieuwenhuysen E, Smeets D, Debruyne PR, Renard V, Vroman P, Luyten D, Neven P, Amant F, Leunen K, Vergote I; Belgian and Luxembourg Gynaecological Oncology Group (BGOG). Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer.BMC PharmacolToxicol. 2015 Feb 27;16:2. doi: 10.1186/s40360-015-0001-5; Liblab S, Vusuratana A, Areepium N. ERCC1, XRCC1, and GSTP1 Polymorphisms and Treatment Outcomes of Advanced Epithelial Ovarian Cancer Patients Treated with Platinum-based Chemotherapy. AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925] .
Результаты ассоциации генотипа АА rs11615 ERCC1 с плохим ответом на лечение отличаются в исследованиях, проводимых в европейских и азиатских центрах, что может быть обусловлено этническими особенностями обследованных пациенток.The results of the association of the AA rs11615 ERCC1 genotype with a poor response to treatment differ in studies conducted in European and Asian centers, which may be due to the ethnic characteristics of the examined patients.
На эффективность терапии первой линии при РЯ выявлено влияние полиморфизмов rs3795247 ZNF100,rs7950311 TRIM5,rs2549714, rs6674079[JohnattySE, TyrerJP, KarS, etal.Genome-wide Analysis Identifies Novel Loci Associated with Ovarian Cancer Outcomes: Findings from the Ovarian Cancer Association Consortium. Clin Cancer Res. 2015 Dec 1;21(23):5264-76. doi: 10.1158/1078-0432.CCR-15-0632], rs9369421 VEGFA[He YJ, Winham SJ, Hoskins JM, Glass S, Paul J, Brown R, Motsinger-Reif A, McLeod HL. Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. Pharmacogenomics J. 2016 Jun;16(3):243-8. doi: 10.1038/tpj.2015.52]; rs1649942 NRG3[Huang RS, Johnatty SE, et al. Platinum sensitivity-related germline polymorphism discovered via a cell-based approach and analysis of its association with outcome in ovarian cancer patients. Clin Cancer Res. 2011 Aug 15;17(16):5490-500. doi: 10.1158/1078-0432.CCR-11-0724], rs2849380 BCL2[McWhinney-Glass S, Winham SJ, Hertz DL, Yen Revollo J, Paul J, He Y, Brown R, Motsinger-Reif AA, McLeod HL; Scottish Gynaecological Clinical Trials Group. Cumulative genetic risk predicts platinum/taxane-induced neurotoxicity. Clin Cancer Res. 2013 Oct 15;19(20):5769-76. doi: 10.1158/1078-0432.CCR-13-0774].The polymorphisms rs3795247 ZNF100, rs7950311 TRIM5, rs2549714, rs6674079[JohnattySE, TyrerJP, KarS, etal. Clinic Cancer Res. 2015 Dec 1;21(23):5264-76. doi: 10.1158/1078-0432.CCR-15-0632], rs9369421 VEGFA[He YJ, Winham SJ, Hoskins JM, Glass S, Paul J, Brown R, Motsinger-Reif A, McLeod HL. Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. Pharmacogenomics J. 2016 Jun;16(3):243-8. doi: 10.1038/tpj.2015.52]; rs1649942 NRG3 [Huang RS, Johnatty SE, et al. Platinum sensitivity-related germline polymorphism was discovered via a cell-based approach and analysis of its association with outcome in ovarian cancer patients. Clinic Cancer Res. 2011 Aug 15;17(16):5490-500. doi: 10.1158/1078-0432.CCR-11-0724], rs2849380 BCL2 [ McWhinney-Glass S, Winham SJ, Hertz DL, Yen Revollo J, Paul J, He Y, Brown R, Motsinger-Reif AA, McLeod HL; Scottish Gynaecological Clinical Trials Group. Cumulative genetic risk predicts platinum/taxane-induced neurotoxicity. Clinic Cancer Res. 2013 Oct 15;19(20):5769-76. doi: 10.1158/1078-0432.CCR-13-0774].
Известен способ прогнозирования эффективности лечения рака яичников цисплатином в комбинации с циклофосфамидом на основе определения полиморфизмов rs1142345 гена ТРМТ (тиопурин-S-метилтрансфераза, ген биотрансформацииксенобиотиков) и/или rs3219484 гена MUTYH (mutY ДНК гликозилаза) (RU 2582968 C2 от 27.04.2016).У носителей этих аллелей значительно снижена функция ферментов, участвующих в метаболизме лекарственных препаратов и репарации оксидативных повреждений ДНК соответственно. Критерием эффективности лечения являлось увеличение времени жизни без прогрессирования и/или снижение риска развития тяжелой нейтропении. У пациенток определяют аллельные варианты полиморфизма rs1142345 гена ТРМТ и/или полиморфизма rs3219484 гена MUTYH и в зависимости от аллельного статуса одного или обоих указанных полиморфизмов прогнозируют эффективность лечения цисплатином. Благоприятный прогноз определяется наличием у пациента двух аллелей дикого типа полиморфизма rs1142345 гена ТРМТ (генотип АА) и/или комбинации из аллелей дикого и мутантного типов полиморфизма rs3219484 гена MUTYH (генотип GA). В исследование были включены русские женщины (104 человека) 23-65 лет с эпителиальным раком яичников, независимо от стадии заболевания и режима химиотерапии.A known method for predicting the effectiveness of ovarian cancer treatment with cisplatin in combination with cyclophosphamide based on the determination of polymorphisms rs1142345 of the TPMT gene (thiopurine-S-methyltransferase, xenobiotic biotransformation gene) and/or rs3219484 of the MUTYH gene (mutY DNA glycosylase) (RU 2582968 C2 dated 04/27/2016). Carriers of these alleles have a significantly reduced function of enzymes involved in the metabolism of drugs and the repair of oxidative DNA damage, respectively. The criterion for the effectiveness of treatment was an increase in the time of survival without progression and / or a decrease in the risk of developing severe neutropenia. In patients, allelic variants of the rs1142345 polymorphism of the TPMT gene and/or the rs3219484 polymorphism of the MUTYH gene are determined and, depending on the allelic status of one or both of these polymorphisms, the effectiveness of cisplatin treatment is predicted. A favorable prognosis is determined by the presence in a patient of two wild-type alleles of the rs1142345 polymorphism of the TPMT gene (AA genotype) and/or a combination of wild-type and mutant alleles of the rs3219484 polymorphism of the MUTYH gene (GA genotype). The study included Russian women (104 people) aged 23-65 with epithelial ovarian cancer, regardless of the stage of the disease and the chemotherapy regimen.
Ограничением данного способа является неоднородность выборки пациенток, взятых в исследование. У 20% пациенток диагностированы I и II стадии заболевания. Ранние стадии сами по себе являются благоприятным прогнозом. Также лечение проводилось цисплатином с циклофосфамидом. В настоящее время общепринятым является назначение платиновых препаратов с таксанами.The limitation of this method is the heterogeneity of the sample of patients taken into the study. 20% of patients were diagnosed with stages I and II of the disease. The early stages are in themselves a favorable prognosis. She was also treated with cisplatin plus cyclophosphamide. It is now common practice to prescribe platinum drugs with taxanes.
Известно влияние полиморфизма генов репарации ERCC1, XRCC1 и GSTP1 на эффективность терапии первой линии эпителиального рака яичников [LiblabS, VusuratanaA, AreepiumN.ERCC1, XRCC1, andGSTP1 PolymorphismsandTreatmentOutcomesofAdvancedEpithelialOvarianCancerPatientsTreatedwithPlatinum-basedChemotherapy.AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925]. Ученые из Таиланда обнаружили, что гомозиготы A/AofERCC1C8092A (rs 3212986) преобладают среди резистентных к препаратам платины пациенток (75%/16,7% Р=0,046), а также обнаружили ассоциацию с анемией для генотипа A/GGSTP1 (rs1695) (81.8% vs 46.3%, p =0.036).The effect of polymorphisms of the ERCC1, XRCC1 and GSTP1 repair genes on the effectiveness of first-line therapy for epithelial ovarian cancer is known [LiblabS, VusuratanaA, AreepiumN.ERCC1, XRCC1, andGSTP1 PolymorphismsandTreatmentOutcomesofAdvancedEpithelialOvarianCancerPatientsTreatedwithPlatinum-basedChemotherapy.AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925]. Scientists from Thailand found that homozygotes A/AofERCC1C8092A (rs 3212986) predominate among platinum-resistant patients (75%/16.7% P=0.046) and also found an association with anemia for the A/GGSTP1 genotype (rs1695) (81.8 % vs 46.3%, p = 0.036).
В 2014 г выполнен ассоциативный анализ SNPrs698 гена ADH1C (алкогольдегидрогеназа 1 С) на полный ответ опухоли РЯ после лечения платиносодержащими препаратами [KhruninAV, KhokhrinDV, MoisseevAA, GorbunovaVA, LimborskaSA. Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer.Pharmacogenomics. 2014 Feb;15(3):329-37. doi: 10.2217/pgs.13.237. PMID: 24533712]. Ген ADH1C кодирует гамма-субъединицу фермента алкоголь-дегидрогеназы 1 класса, который метаболизирует широкий спектр субстратов, включая этанол, ретинол, гидроксистероиды, продукты перекисного окисления липидов. Однонуклеотидная замена в 8 экзоне гена приводит к замене аминокислоты (Ile350Val) и ослаблению функции фермента. Согласно данным авторов, генотип СТ ассоциирован с пониженной вероятностью полного ответа при лечении больных эпителиальным раком яичников цисплатином и циклофосфамидом по сравнению с генотипами СС+ТТ. Химиотерапию проводили по схеме CP: внутривенное введение цисплатин 100 мг/м2 + циклофосфамид 600 мг/м2 каждые 3 недели, на фоне противорвотных средств (дексаметазон + блокаторы 5-НТ3-рецепторов) и водной нагрузки. Для всех пациенток проведено 6 циклов химиотерапии. В анализ было включено 80 женщин, из которых у 36 наблюдался полный ответ, у 32 - частичный ответ, для 8 - стабилизация и у 4 пациенток наблюдалась прогрессия. В работе оценивалась связь генетического маркера с полным ответом опухоли на лечение.In 2014, an association analysis of SNPrs698 of the ADH1C gene (alcohol dehydrogenase 1 C) was performed on the complete response of the OC tumor after treatment with platinum-containing drugs [KhruninAV, KhokhrinDV, MoisseevAA, GorbunovaVA, LimborskaSA. Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer.Pharmacogenomics. 2014 Feb;15(3):329-37. doi: 10.2217/pgs.13.237. PMID: 24533712]. The ADH1C gene encodes the gamma subunit of class 1 alcohol dehydrogenase, which metabolizes a wide range of substrates, including ethanol, retinol, hydroxysteroids, and lipid peroxidation products. A single nucleotide substitution in the 8th exon of the gene leads to an amino acid substitution (Ile350Val) and a weakening of the enzyme function. According to the authors, the CT genotype is associated with a reduced probability of a complete response in the treatment of patients with epithelial ovarian cancer with cisplatin and cyclophosphamide compared with CC+TT genotypes. Chemotherapy was performed according to the CP scheme: intravenous administration of
Существенным ограничением работы является то, что группы сформированы из пациенток с разными стадиями заболевания. Известно, что ранние стадии заболевания являются хорошим прогоностическим фактором для РЯ. Второе ограничение: химиотерапия проводилась по схеме CP: внутривенное введение цисплатин+ циклофосфамид. В настоящее время общепринятой является схема лечения на основе платиновых препаратов и таксанов. Третье ограничение - группа пациенток включала как наследственный, так и спорадический РЯ. A significant limitation of the work is that the groups are formed from patients with different stages of the disease. It is known that the early stages of the disease are a good prognostic factor for OC. The second limitation: chemotherapy was carried out according to the CP scheme: intravenous administration of cisplatin + cyclophosphamide. Currently, the treatment regimen based on platinum drugs and taxanes is generally accepted. The third limitation is that the group of patients included both hereditary and sporadic OC.
Из известных технических решений наиболее близким по назначению и технической сущности к заявляемому объекту является способ идентификации пациентов с диагнозом серозная аденокарцинома III и IV стадии заболевания с повышенным риском неполного ответа после проведения первой линии адьювантной комбинированной химиотерапии на основе платиносодержащих препаратов, предусматривающий определение наличия в геноме пациента аллельного полиморфизма гена STAT3 (белковый продукт - фактор транскрипции), который ассоциируется с плохим ответом на лечение[Permuth-WeyJ, FulpWJ, ReidBM, ChenZ, GeorgeadesC, ChengJQ, MaglioccoA, ChenDT, Lancaster JM. STAT3 polymorphisms may predict an unfavorable response to first-line platinum-based therapy for women with advanced serous epithelial ovarian cancer. IntJCancer. 2016 Feb 1;138(3):612-9. doi: 10.1002/ijc.29799].Сравнивались две группы в зависимости от ответа на первую линию терапии. Полный ответ (361 женщина) означал исчезновение всех симптомов болезни при осмотре через 4 недели после окончания лечения. Вторая группа с неполным ответом (102 женщины) включала пациенток с частичной регрессией опухоли, стабилизацией и прогрессией заболевания. Для каждого SNP была применена модель логистической регрессии для предсказания вероятности плохого ответа на лечение. Наиболее значимая ассоциация показана для rs 62075772 [OR (95% CI): 2,42 (1,47-3,98), p = 0,0005] гена STAT3(белковый продукт - фактор транскрипции). Носительницы генотипов минорного аллеля G (GA+GG), у которых диагностированы III и IV стадии заболевания, имели меньшую вероятность полного ответа по сравнению с гомозиготными носительницами мажорного аллеля АА (р=0,08). Авторы заключают, что STAT3 генотип идентифицирует пациенток с повышенным риском неполного ответа, для которых предпочтительно применять новую терапевтическую комбинацию со STAT3 ингибитором.Of the known technical solutions, the closest in purpose and technical essence to the claimed object is a method for identifying patients diagnosed with serous adenocarcinoma of stage III and IV of the disease with an increased risk of incomplete response after the first line of adjuvant combined chemotherapy based on platinum-containing drugs, which involves determining the presence in the patient's genome allelic polymorphism of the STAT3 gene (protein product - transcription factor), which is associated with a poor response to treatment [Permuth-WeyJ, FulpWJ, ReidBM, ChenZ, GeorgeadesC, ChengJQ, MaglioccoA, ChenDT, Lancaster JM. STAT3 polymorphisms may predict an unfavorable response to first-line platinum-based therapy for women with advanced serous epithelial ovarian cancer. IntJCancer. 2016 Feb 1;138(3):612-9. doi: 10.1002/ijc.29799]. Two groups were compared depending on the response to the first line of therapy. A complete response (361 women) meant the disappearance of all symptoms of the disease when examined 4 weeks after the end of treatment. The second group with incomplete response (102 women) included patients with partial tumor regression, stabilization and progression of the disease. For each SNP, a logistic regression model was applied to predict the likelihood of a poor response to treatment. The most significant association was shown for rs 62075772 [OR (95% CI): 2.42 (1.47-3.98), p = 0.0005] of the STAT3 gene (protein product - transcription factor). Carriers of the genotypes of the minor G allele (GA+GG), who were diagnosed with stages III and IV of the disease, had a lower probability of a complete response compared to homozygous carriers of the major AA allele (p=0.08). The authors conclude that the STAT3 genotype identifies patients at increased risk of incomplete response who would benefit from the novel therapeutic combination with a STAT3 inhibitor.
Однако, пациентки, которым проводилась неоадьювантная терапия, были исключены из анализа. Не вычленялись спорадические раки от наследственно обусловленных, полиморфизм АРОЕ не учитывался.However, patients who received neoadjuvant therapy were excluded from the analysis. Sporadic cancers were not isolated from hereditary ones, APOE polymorphism was not taken into account.
Несмотря на то , что накоплено много знаний о полиморфных вариантах генов, влияющих на эффективность лечения рака яичников (РЯ) платиносодержащими препаратами в комбинации с таксанами, на сегодняшний день до начала лечения невозможно дать точный индивидуальный прогноз результативности первой линии стандартной терапии спорадического РЯ, и в клинической практике нет тестов для выявления предикативных маркеров, основанных на фармакогенетических разработках, позволяющих предсказать, каким будет индивидуальный ответ на стандартную терапию первой линии.Despite the fact that a lot of knowledge has been accumulated about the polymorphic variants of genes that affect the effectiveness of the treatment of ovarian cancer (OC) with platinum-containing drugs in combination with taxanes, today, before the start of treatment, it is impossible to give an accurate individual prediction of the effectiveness of the first line of standard therapy for sporadic OC, and in In clinical practice, there are no tests to identify predictive markers based on pharmacogenetic developments to predict what an individual's response to standard first-line therapy will be.
Полученный нами опыт позволяет определять риск отрицательного ответа (стабилизация или прогрессия) или положительного (полный ответ, частичный ответ) на первую линию терапии пациенток с распространенным РЯ на основе определения полиморфных вариантов генов метаболизма методом полимеразной цепной реакции с последующим определением длин фрагментов рестрикции ампликонов (ПЦР/ПДРФ анализ).(Kondrashova TV, Neriishi K, Ban S, Ivanova TI, Krikunova LI, Shentereva NI, Smirnova IA, Zharikova IA, Konova MV, Taira S, Tsyb AF. Frequency ofhemochromatosis gene (HFE) mutations in Russian healthy women and patients withestrogendependent cancers. BiochimBiophysActa. 2006 Jan;1762(1):59-65; Ivanova T.I., Krikunova L.I., Ryabchenko N.I., et al. Association of the apolipoprotein E 2 allele with concurrent occurrence of endometrial hyperplasia and endometrial carcinoma . Oxidative Medicine and Cellular Longevity. - 2015. - Vol. 2015. - P. e 593658; Иванова Т.И., Сыченкова Н.И., Хорохорина В.А., Рябченко Н.И., Иванов С.А., Крикунова Л.И. Ассоциация аллеля Е4 (rs429358) гена аполипопротеина Е (АРОЕ) с серозной аденокарциномой яичников. // Вопросы онкологии. 2017. Т.63. №4. С.627-631; Иванова Т.И., Крикунова Л.И., Рябченко Н.И., Мкртчян Л.С., Хорохорина В.А., Ионцева С.А. Способ определения риска развития рака тела матки. Патент на изобретение № 2558059. 27.07.2015.(Бюл.№21); Т.I. Ivanova, A. L. Potapov, D. V. Zemskova, V. A. Khorokhorina, P. V. Shegai, S. A. Ivanov, and A. D. Kaprin. Evaluation of the association of rs4680 COMT polymorphism and clinical parameters of the tumor in colorectal cancer (a Pilot Study). Bull ExpBiol Med. 2020. V. 170. № 2. P. 254-257; Иванова Т. И., Сыченкова Н.И., Хорохорина В. А., Шинкаркина А.П., Конова М.В., Мурзаева А.В., Крикунова Л.И., Шегай П.В., Иванов С.А. Полиморфизм rs429358 АРОЕ у пациенток с диагнозом рак яичников. База данных №2020621162 от 08.07.2020; Иванова Т. И., Сыченкова Н.И., Хорохорина В. А., Шинкаркина А.П., Мурзаева А.В., Крикунова Л.И., Шегай П.В., Иванов С.А. Полиморфизм rs7412 APOE у пациенток с диагнозом рак яичников. База данных № 2020621180 от 10.07.2020].Our experience allows us to determine the risk of a negative response (stabilization or progression) or positive (complete response, partial response) to the first line of therapy in patients with advanced OC based on the determination of polymorphic variants of metabolism genes by polymerase chain reaction followed by determination of the lengths of amplicon restriction fragments (PCR). /RFLP analysis). ( Kondrashova TV, Neriishi K, Ban S, Ivanova TI, Krikunova LI, Shentereva NI, Smirnova IA, Zharikova IA, Konova MV, Taira S, Tsyb AF. Frequency of hemochromatosis gene (HFE) mutations in Russian healthy women and patients with estrogen dependent cancers. BiochimBiophysActa. 2006 Jan;1762(1):59-65; Ivanova TI, Krikunova LI, Ryabchenko NI, et al. Association of the
В соответствии с нашими данными обнаружено, что у пациенток с диагнозом распространенный РЯ, у которых отсутствуют часто встречающиеся мутации в генах BRCA1/2, имеющих любой из генотипов, в которых присутствует аллель АРОЕ -ε4(ε4/ε4; ε3/ε4; ε2/ε4), прогнозируют высокую вероятность отрицательного ответа на первую линию комбинированной ХТ. Известно, что аполипопротеин Е (АРОЕ) - липопротеин плазмы с широким спектром действия: регулирует обмен липидов, холестерина, функции макрофагов, влияет на пролиферацию Т-клеток, модулирует воспалительные и оксидативные процессы, участвует в процессах канцерогенеза. Показана экспрессия во многих тканях, в том числе в яичниках и макрофагах, причем уровень экспрессии значительно повышен в клетках злокачественных опухолей [Huang Y, Mahley RW.Apolipoprotein E: structure and function in lipid metabolism, neurobiology, and Alzheimer's diseases. Neurobiol Dis. 2014 Dec;72 Pt A:3-12. doi: 10.1016/j.nbd.2014.08.025; The Human Protein Atlas. https://www.proteinatlas.org/search/APOE]. Показано, что экспрессия АРОЕ ассоциирована с изменениями генов сигнального пути Notch, который играет важную роль как в развитии, так и в ответе на лечение пациенток с распространенным РЯ [US Preventive Services Task Force, Grossman DC, Curry SJ, Owens DK, Barry MJ, Davidson KW, Doubeni CA, Epling JW Jr, Kemper AR, Krist AH, Kurth AE, Landefeld CS, Mangione CM, Phipps MG, Silverstein M, Simon MA, Tseng CW. Screening for Ovarian Cancer: US Preventive Services Task Force Recommendation Statement. JAMA. 2018 Feb 13;319(6):588-594. doi: 10.1001/jama.2017.21926].In accordance with our data, it was found that in patients diagnosed with advanced OC, who do not have common mutations in the BRCA1/2 genes, and have any of the genotypes in which the APOE -ε4(ε4/ε4; ε3/ε4; ε2/ ε4), predict a high probability of a negative response to the first line of combined chemotherapy. It is known that apolipoprotein E (APOE) is a plasma lipoprotein with a wide spectrum of action: it regulates the metabolism of lipids, cholesterol, the functions of macrophages, affects the proliferation of T-cells, modulates inflammatory and oxidative processes, and participates in the processes of carcinogenesis. Shown expression in many tissues, including ovaries and macrophages, and the level of expression is significantly increased in cells of malignant tumors [Huang Y, Mahley RW. Apolipoprotein E: structure and function in lipid metabolism, neurobiology, and Alzheimer's diseases. Neurobiol Dis. 2014 Dec;72 Pt A:3-12. doi: 10.1016/j.nbd.2014.08.025; The Human Protein Atlas. https://www.proteinatlas.org/search/APOE]. It has been shown that APOE expression is associated with changes in the Notch signaling pathway genes, which play an important role both in the development and in response to treatment in patients with advanced OC [US Preventive Services Task Force, Grossman DC, Curry SJ, Owens DK, Barry MJ, Davidson KW, Doubeni CA, Epling JW Jr, Kemper AR, Krist AH, Kurth AE, Landefeld CS, Mangione CM, Phipps MG, Silverstein M, Simon MA, Tseng CW. Screening for Ovarian Cancer: US Preventive Services Task Force Recommendation Statement. JAMA. 2018 Feb 13;319(6):588-594. doi: 10.1001/jama.2017.21926].
Варианты гена APOE определяются двумя однонуклеотидными полиморфизмами (SNP): rs429358 и rs7412, и известны как аллели ε2, ε3 и ε4, которые определяют 6 генотипов: ε3ε3, ε3ε4, ε2ε3, ε2ε4, ε4ε4 и ε2ε2. Наиболее распространенным вариантом является аллель ε3. Гаплотип ε4 характеризуется совместными позициями аргининов 158 и 112 в аминокислотной последовательности белка АРОЕ, обусловленным однонуклеотидным полиморфизмом (SNP rs429358) в соответствующем кодоне: T (тимин) или C (цитозин). Генотип Т/Т - референтный, Т/С - гетерозигота, С/С - гомозиготный генотип по минорному аллелю.В случае ε3 в 112 аминокислотной последовательности белка - цистеин, обусловленный наличием тимина (Т) (Фиг.1).Variants of the APOE gene are defined by two single nucleotide polymorphisms (SNPs): rs429358 and rs7412, and are known as the ε2, ε3, and ε4 alleles, which define 6 genotypes: ε3ε3, ε3ε4, ε2ε3, ε2ε4, ε4ε4, and ε2ε2. The most common variant is the ε3 allele. The ε4 haplotype is characterized by joint positions of
Техническим результатом изобретения является оценка прогноза ответа опухоли на комбинированную ХТ для пациенток со спорадическим РЯ III и IV стадий и выбор оптимальной тактики лечения на основе идентификации генетического маркера. The technical result of the invention is to evaluate the prognosis of tumor response to combined CT for patients with sporadic OC stages III and IV and the choice of optimal treatment tactics based on the identification of a genetic marker.
Технический результат достигается тем, что также как и в известном способе у пациенток с эпителиальным РЯ III и IV стадий для предсказывания отрицательного или положительного ответа выделяют геномную ДНК, выявляют генный полиморфизм иThe technical result is achieved by the fact that, as in the known method, in patients with epithelial OC III and IV stages, genomic DNA is isolated to predict a negative or positive response, gene polymorphism is detected and
определяют ответ после проведения первой линии комбинированной химиотерапии платиносодержащими препаратами.determine the response after the first line of combined chemotherapy with platinum-containing drugs.
Особенностью изобретения является то, что у пациенток со спорадическим РЯ (отрицательный статус BRCA мутаций) до лечения выявляют полиморфные аллели АРОЕ-ε2, АРОЕ-ε3, АРОЕ-ε4, и если генотип содержит:A feature of the invention is that in patients with sporadic OC (negative status of BRCA mutations), polymorphic alleles APOE-ε2, APOE-ε3, APOE-ε4 are detected before treatment, and if the genotype contains:
- аллель АРОЕ-ε4, то прогнозируют отрицательный ответна первую линию комбинированной ХТ;- APOE-ε4 allele, then a negative response to the first line of combined chemotherapy is predicted;
- аллель АРОЕ-ε3ε3, то прогнозируют положительный ответ на первую линию комбинированной ХТ.- APOE-ε3ε3 allele, then a positive response to the first line of combined chemotherapy is predicted.
Новизна и изобретательский уровень данного изобретения заключается в том, что в уровне техники отсутствуют сведения о способах определения ответа пациенток на первую линию комбинированной ХТ (платиносодержащие препараты, таксаны, циторедукция) спорадического рака яичников, на основе определения генотипов, несущих аллели ε3, ε4, ε2 гена АРОЕ.The novelty and inventive level of this invention lies in the fact that in the prior art there is no information on how to determine the response of patients to the first line of combined chemotherapy (platinum-containing drugs, taxanes, cytoreduction) of sporadic ovarian cancer, based on the determination of genotypes carrying the alleles ε3, ε4, ε2 APOE gene.
Изобретение иллюстрируется подробным описанием, клиническим примером и иллюстрациями, на которых изображено:The invention is illustrated by a detailed description, a clinical example and illustrations, which show:
Фиг.1 - аллели ε3, ε4, ε2 гена АРОЕ.Figure 1 - alleles ε3, ε4, ε2 of the APOE gene.
Фиг.2 - распределение генотипов, содержащих аллель ε4 (С/С+Т/С) и без него (Т/Т) среди пациенток, ответивших и не ответивших на первую линию комбинированной ХТ спорадического РЯ.Figure 2 - distribution of genotypes containing the ε4 allele (C/C+T/C) and without it (T/T) among patients who responded and did not respond to the first line of combined CT of sporadic OC.
Фиг. 3 - частота лиц с генотипами АРОЕ (ε4+ содержащие аллель и ε4- без аллеля) в группах с отрицательным (Стаб+Прогрессия) и общим ответом (ПО+ЧО).Fig. 3 - frequency of individuals with APOE genotypes (ε4+ containing allele and ε4- without allele) in groups with negative (Stab+Progression) and overall response (PO+PR).
Фиг. 4 - распределение генотипов АРОЕ-ε3ε3 среди пациенток со спорадическим РЯ по типу ответа опухоли на первую линию комбинированной ХТ в комбинации с субоптимальной и неоптимальной циторедукцией.Fig. 4 - distribution of APOE-ε3ε3 genotypes among patients with sporadic OC according to the type of tumor response to the first line of combined chemotherapy in combination with suboptimal and non-optimal cytoreduction.
Способ осуществляют следующим образом.The method is carried out as follows.
У пациенток с распространенным РЯ берут периферическую кровь. Образцы крови забирают в вакутейнеры с этилендиаминуксусной калиевой солью (К2ЭДТА) и хранят при температуре минус 20°С. Геномную ДНК выделяют с помощью набора «WizardGenomic DNA PurificationKit» («Promega») в соответствии с протоколом производителя. Для определения концентрации выделенной ДНК используют спектрофотометр NanoDrop1000.Критерием хорошего качества очистки выделенной ДНК служит величина А260/А280 =1,8 (отношение абсорбции при длинах волн 260 и 280 нм).In patients with advanced OC, peripheral blood is taken. Blood samples are taken into evacuators with ethylenediamineacetic potassium salt (K2EDTA) and stored at minus 20°C. Genomic DNA was isolated using the WizardGenomic DNA PurificationKit (Promega) according to the manufacturer's protocol. To determine the concentration of the isolated DNA, a NanoDrop1000 spectrophotometer is used. The criterion for the good quality of purification of the isolated DNA is the value of A260/A280 = 1.8 (absorbance ratio at wavelengths of 260 and 280 nm).
Определяют мутации по 8 наиболее распространенным точкам: 5382insC,Mutations are determined by the 8 most common points: 5382insC,
4154delA,4154delA,
300T>G (C61G),300T>G (C61G),
185 del AG,185 del AG,
3819delGTAA,3819delGTAA,
3875delGTCT,3875delGTCT,
2080delA гена BRCA1,2080delA of the BRCA1 gene,
6174 delTBRCA2.6174 delTBRCA2.
Исследование проводят методом аллель-специфичной ПЦР в реальном времени c использованием наборов фирмы “Биолинк”, на амплификаторе ’’StepOnePlus’’ (AppliedBiosystems, CША). Для верификации положительных образцов используют секвенирование по Сэнгеру.The study is carried out by allele-specific real-time PCR using Biolink kits, on a ''StepOnePlus'' amplifier (AppliedBiosystems, USA). Sanger sequencing is used to verify positive samples.
Генотипирование АРОЕ осуществляют с помощью полимеразной цепной реакции (ПЦР) с последующей обработкой специфической рестриктазой (Cfo 1) и определением длин фрагментов рестрикции ПЦР/ПДРФ. В ПЦР реакцию берут 25 мкл реакционной смеси, состоящей из 50 нг ДНК, 0,5 мкмолей каждого праймера (прямой праймер GAGACGCGGGCACGGCTGTCC; обратный праймер GCACGCGGCCCTGTTCCACC, http://genome.cse.ucsc.edu/) , 0,2 ммолей дезоксинуклеотидтрифосфатов, 0,2 Ед на реакцию ХотСтарТагПолимеразы (Qiagen) c однократным буфером и Q-буфером(Qiagen). APOE genotyping is carried out using polymerase chain reaction (PCR) followed by treatment with a specific restriction enzyme (Cfo 1) and determination of the lengths of PCR/RFLP restriction fragments. In the PCR reaction, 25 µl of the reaction mixture consisting of 50 ng of DNA, 0.5 µmol of each primer (forward primer GAGACGCGGGCACGGCTGTCC; reverse primer GCACGCGGCCCTGTTCCACC, http://genome.cse.ucsc.edu/), 0.2 mmol of deoxynucleotide triphosphates, 0.2 U per HotStarTag Polymerase reaction (Qiagen) with 1X buffer and Q-buffer (Qiagen).
Программа амплификации (термоциклерMastercyclerNexus, Eppendorf):Amplification program (MastercyclerNexus thermal cycler, Eppendorf):
95°C - 15 мин95°C - 15 min
94°C - 30 с94°C - 30 s
67°C - 30 с67°C - 30 s
72°C - 1 мин72°C - 1 min
со 2 по 4 29 циклов 2 to 4 29 cycles
72°C - 10 мин72°C - 10 min
Ампликоны APOE (310 пар оснований) рестрицировали Cfo1 (Promega). Замена Т (тимин) на С (цитозин) ведет к образованию сайта рестрикции:APOE amplicons (310 bp) were digested with Cfo1 (Promega). Replacing T (thymine) with C (cytosine) leads to the formation of a restriction site:
5'…G CG↓C…3'5'…G CG↓C…3'
3'…C↑GC G…5'3'…C↑GC G…5'
Проводят переваривание при 37°C в течение 5 часов в объеме 10 мкл реакционной смеси, содержащей 4 мкл ампликона, 1 мкл х10 буфера В (Promega), 1 мкг БСА, 1 ЕД фермента CfoI. Продукты рестрикции фракционировали посредством электрофореза в 8% полиакриламидном геле.Digestion is carried out at 37°C for 5 hours in a volume of 10 μl of the reaction mixture containing 4 μl of amplicon, 1 μl x10 buffer B (Promega), 1 μg of BSA, 1 U of CfoI enzyme. The restriction products were fractionated by electrophoresis in 8% polyacrylamide gel.
Аллель АРОЕ -ε4 имеет 5 полос, соответствующие 72, 48, 39, 35 и 32 парам оснований. Аллель АРОЕ-ε2 на электрофореграмме имеет 4 полосы, соответствующие 91, 83, 39 и 32 парам оснований. Аллель АРОЕ-ε3 характеризуется 5 полосами, соответствующими 91, 49, 39, 36 и 32 парам оснований (Фиг. 2). Затем, по сочетанию аллелей определяют генотипы у женщин с распространенным РЯ, по которым судят о степени риска плохого ответа на первую линию комбинированной химиотерапии. The APOE -ε4 allele has 5 bands corresponding to 72, 48, 39, 35 and 32 base pairs. The APOE-ε2 allele on the electropherogram has 4 bands corresponding to 91, 83, 39 and 32 base pairs. The APOE-ε3 allele is characterized by 5 bands corresponding to 91, 49, 39, 36 and 32 base pairs (FIG. 2). Then, according to the combination of alleles, genotypes are determined in women with advanced OC, which are used to judge the degree of risk of a poor response to the first line of combined chemotherapy.
Первую линию комбинированной химиотерапии (6 курсов) проводили с первичной или интервальной циторедукцией по схеме: паклитаксел 175 мг/м2 в/в инфузия, карбоплатин AUC 5-6 в/в в 1-й день 21-дневного курса, или паклитаксел 175 мг/м2 в/в, цисплатин 60 мг/м2 в/в в 1-й день 21-дневного курса. The first line of combined chemotherapy (6 cycles) was performed with primary or interval cytoreduction according to the scheme: paclitaxel 175 mg/m 2 IV infusion, carboplatin AUC 5-6 IV on day 1 of a 21-day course, or paclitaxel 175 mg /m 2 IV,
После проведения первой линии ХТ (6 циклов) провели оценку объективного эффекта по критериям RECIST1.1 (ResponseEvaluationCriteriaInSolidTumors).After the first line chemotherapy (6 cycles), the objective effect was evaluated according to the RECIST1.1 criteria (ResponseEvaluationCriteriaInSolidTumors).
Исследование проводят путем сравнения частот генотипов и аллелей между группами с общим ответом на лечение (полный ответ + частичный ответ) и с плохим ответом (стабилизация +прогрессия) у пациенток с подтвержденным отрицательным статусом мутаций по 8 наиболее распространенным в России точкам генов BRCA1 и BRCA 2.The study is carried out by comparing the frequencies of genotypes and alleles between groups with an overall response to treatment (complete response + partial response) and with a poor response (stabilization + progression) in patients with confirmed negative mutation status for the 8 most common points of the BRCA1 and
Статистический анализ проводят стандартными методами с помощью пакета программ «WinSTAT 2003.1», интегрированного в Exel,SnpstatsSoft (http://bioinfo.iconcologia.net/snpstats/start.htm) и МedCalc, версия 14.8.1. При сравнении частот генотипов применялся точный двусторонний критерий Фишера. С целью выяснения взаимосвязей между первичным ответом на лечение и аллельным вариантом АРОЕ -ε4 (С) выполнялся анализ логистической регрессии. С помощью ROC (ReceiverOperatorCharacteristic) анализа проводят оценку прогностической значимости параметров, ассоциированных с плохим ответом на лечение. Определяют показатель прогностической эффективности AUC (AreaUnderCurve) - площадь под ROC кривой. Значение 0,5 демонстрирует непригодность потенциального маркера.Statistical analysis is carried out by standard methods using the WinSTAT 2003.1 software package integrated into Excel, SnpstatsSoft (http://bioinfo.iconcologia.net/snpstats/start.htm) and MedCalc, version 14.8.1. When comparing genotype frequencies, Fisher's exact two-tailed test was used. Logistic regression analysis was performed to elucidate the relationship between primary response to treatment and the APOE-ε4 (C) allelic variant. Using ROC (ReceiverOperatorCharacteristic) analysis, the predictive value of parameters associated with poor response to treatment is assessed. Determine the indicator of prognostic efficiency AUC (AreaUnderCurve) - the area under the ROC curve. A value of 0.5 demonstrates the unsuitability of the potential marker.
Прогностическую значимость аллеля АРОЕ -ε4(С) и генотипа ε3ε3 оценивают также по показателю отношения шансов (OR) -критерий, отражающий степень сопряженности признаков при 95% доверительном интервале (ДИ).The prognostic significance of the APOE -ε4(C) allele and the ε3ε3 genotype is also assessed by the odds ratio (OR) - a criterion that reflects the degree of conjugation of signs at a 95% confidence interval (CI).
При OR=1 отсутствует связь между генотипом и ответом на лечение. При OR>1, генетический маркер сопряжен с неблагоприятным ответом. При OR<1 маркер сопряжен с положительным ответом на первую линию терапии.At OR=1, there is no relationship between genotype and response to treatment. When OR>1, the genetic marker is associated with an adverse response. At OR<1, the marker is associated with a positive response to the first line of therapy.
Примеры реализации способа.Examples of the implementation of the method.
Пример 1. Определение предиктивного значения аллеля АРОЕ-ε4 и генотипов, несущих аллель АРОЕ-ε4 (С) в оценке повышенного риска неблагоприятного ответа на первую линию терапии среди пациенток со спорадическим распространенным РЯ. Example 1. Determination of the predictive value of the APOE-ε4 allele and genotypes carrying the APOE-ε4 (C) allele in assessing the increased risk of an adverse response to first-line therapy among patients with sporadic advanced OC.
Повышенный шанс неблагоприятного ответа на лечение РЯ определяют генотипы, несущие аллель АРОЕ-ε4 rs429358, C112Arg: Е4/Е3, или Е4/Е4, или Е2/Е4 гена АРОЕ.An increased chance of an unfavorable response to OC treatment is determined by genotypes carrying the APOE-ε4 allele rs429358, C112Arg: E4/E3, or E4/E4, or E2/E4 of the APOE gene.
Возможность использования предложенного способа для определения прогноза повышенного риска отрицательного ответа на первую линию комбинированной ХТ с первичной или интервальной циторедукцией среди пациенток с распространенным спорадическим РЯ подтверждает анализ результатов наблюдений 136 пациенток в возрасте от 17 до 72 лет (медиана 56 лет). Для всех пациенток по данным биопсии диагностирован распространенный РЯ III и IV стадии по FIGO (InternationalFederationofGynecology&Obstetrics) классификации, и подтвержден отрицательный статус по 8 распространенным в России мутациям BRCA1/2 генов. Подавляющее большинство составляли эпителиальные раки (98,5%, 134 человек), среди которых – серозная аденокарцинома(93%, 127 человек). Первая линия комбинированной химиотерапии (6-8 курсов) проводилась с первичной или интервальной циторедукцией по схеме: паклитаксел 175 мг/м2 в/в инфузия, карбоплатин AUC 5-6 в/в в 1-й день 21-дневного курса, или паклитаксел 175 мг/м2 в/в, цисплатин 60 мг/м2 в/в в 1-й день 21-дневного курса. The possibility of using the proposed method to determine the prognosis of an increased risk of a negative response to the first line of combined CT with primary or interval cytoreduction among patients with advanced sporadic OC is confirmed by the analysis of the results of observations of 136 patients aged 17 to 72 years (median 56 years). According to the biopsy data, advanced OC of stage III and IV according to the FIGO (International Federation of Gynecology & Obstetrics) classification was diagnosed for all patients, and the negative status was confirmed for 8 BRCA1/2 gene mutations common in Russia. The vast majority were epithelial cancers (98.5%, 134 people), among which was serous adenocarcinoma (93%, 127 people). The first line of combined chemotherapy (6-8 courses) was carried out with primary or interval cytoreduction according to the scheme: paclitaxel 175 mg/m 2 IV infusion, carboplatin AUC 5-6 IV on the 1st day of a 21-day course, or paclitaxel 175 mg/m 2 IV,
При осмотре через 4 неделипосле проведенного курса ХТ группа, показавшая общий ответ на лечение (полный ответ + частичный ответ), включала99 человек (средний возраст ± стандартное отклонение: 53,4±11,08 лет), с неблагоприятным ответом (стабилизация+прогрессия - 37 человек (средний возраст ± стандартное отклонение:54,8±14,42).Показатели эффективности лечения оценивали по критериям оценки эффекта в солидных опухолях (RECIST:ResponseEvaluationCriteriaInSolidTumors) на основании данных КТ, либо МРТ, либо УЗИ, а также по повышению уровня маркера СА125.When examined 4 weeks after the course of chemotherapy, the group that showed an overall response to treatment (complete response + partial response) included 99 people (mean age ± standard deviation: 53.4 ± 11.08 years), with an unfavorable response (stabilization + progression - 37 patients (mean age ± SD: 54.8 ± 14.42). Treatment efficacy was assessed by the criteria for evaluating the effect in solid tumors (RECIST: Response Evaluation Criteria In Solid Tumors) based on data from CT, or MRI, or ultrasound, as well as by increasing the level marker CA125.
За полный ответ принималось исчезновение всех измеряемых очагов, за неполный ответ - уменьшение на 30% суммы наибольших диаметров измеряемых очагов, за прогрессирование заболевания - увеличение на 20% суммы наибольших диаметров измеряемых очагов. Если изменения не соответствовали ни одному из перечисленных критериев, то определяли стабилизацию заболевания. For a complete response, the disappearance of all measured foci was taken, for an incomplete response - a decrease by 30% of the sum of the largest diameters of the measured foci, for the progression of the disease - an increase by 20% of the sum of the largest diameters of the measured foci. If the changes did not meet any of the listed criteria, then the stabilization of the disease was determined.
По возрасту группы значимо не отличались между собой (Р=0,298; двусторонний критерий Манн-Уитни). Определялись частоты по ε2/ε3/ε4 гаплотипамаполипопротеина Е (АРОЕ). Исследование проводилось путем сравнения частот генотипов и аллелей между группами с общим ответом на лечение (полный ответ + частичный ответ) и с неблагоприятным ответом (стабилизация +прогрессия). При сравнении частот генотипов применялся точный двусторонний критерий Фишера. Распределение генотипов, несущих аллель АРОЕ -ε4 (С)среди пациенток, ответивших и не ответивших на первую линию комбинированной ХТ спорадического РЯ приведено в таблице 1 (Фиг. 2, Фиг. 3). В качестве референтного аллеля используют аллель T.The groups did not differ significantly in age (P = 0.298; two-tailed Mann-Whitney test). Frequencies were determined by ε2/ε3/ε4 haplotype of mapolypoprotein E (APOE). The study was conducted by comparing the frequencies of genotypes and alleles between groups with an overall response to treatment (complete response + partial response) and with an unfavorable response (stabilization + progression). When comparing genotype frequencies, Fisher's exact two-tailed test was used. The distribution of genotypes carrying the APOE -ε4 (C) allele among patients who responded and did not respond to the first line of combined chemotherapy in sporadic OC is shown in Table 1 (Fig. 2, Fig. 3). The T allele is used as the reference allele.
Распределение генотипов с аллелем АРОЕ -ε4 в группах больных с распространенным спорадическим РЯ, давших общий ответ (полная регрессия опухоли+частичная регрессия) и не ответивших (прогрессия +стабилизация) на первую линию химиотерапииTable 1.
Distribution of genotypes with the APOE -ε4 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy
T/C+C/C
Число генотипов (%)4/4+3/4+2/4
T/C+C/C
Number of genotypes (%)
T/T
Число генотипов (%)3/3+2/3+2/2
T/T
Number of genotypes (%)
Показатели прогностической эффективности генотипов, несущих аллель АРОЕ -ε4, указаны в таблице 2.Indicators of predictive efficiency of genotypes carrying the APOE -ε4 allele are shown in Table 2.
Показатели предиктивной эффективности генотипов, несущих аллель АРОЕ -ε4Table 2.
Indicators of predictive efficiency of genotypes carrying the APOE -ε4 allele
Прогрессия
Число генотипов (%)Stabilization+
Progression
Number of genotypes (%)
Частичный ответ
Число гентипов (%)Full Answer+
Partial answer
Number of gentypes (%)
Распределение аллеля АРОЕ -ε4 среди пациенток, ответивших и не ответивших на первую линию комбинированной ХТ спорадического РЯ приведено в таблице 3, а в таблице 4 указаны показатели предиктовной эффективности аллеля АРОЕ -ε4 (С).The distribution of the APOE -ε4 allele among patients who responded and did not respond to the first line of combined CT in sporadic OC is shown in Table 3, and Table 4 shows the indicators of the predictive effectiveness of the APOE -ε4 allele (C).
Распределение аллеля АРОЕ -ε4 (С) в группах больных с распространенным спорадическим РЯ, давших общий ответ (полная регрессия опухоли+частичная регрессия) и не ответивших (прогрессия +стабилизация) на первую линию химиотерапииTable 3
Distribution of the APOE -ε4 (C) allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy
Таблица 4. Table 4
Показатели предиктивной эффективности аллеля АРОЕ -ε4 (С)Indicators of predictive efficiency of the APOE -ε4 allele (C)
Прогрессия
Число аллелей (%)Stabilization+
Progression
Number of alleles (%)
Частичный ответ
Число аллелей (%)Full Answer+
Partial answer
Number of alleles (%)
1.243 - 5.1222.57
1.243 - 5.122
0.305-0.61846%
0.305-0.618
0.696- 0.80475%
0.696-0.804
Выводы.Findings.
При распространенном спорадическом РЯ аллель АРОЕ -ε4 (С) rs429358 значимо сопряжен с неблагоприятным ответом на лечение первой линии комбинированной ХТ (Р=0,014), шанс отрицательного ответа увеличен в 2,57 раза (OR=2,57; 95% ДИ [1.243 - 5,122]).In advanced sporadic OC, the APOE -ε4 (C) rs429358 allele is significantly associated with an unfavorable response to first-line combined chemotherapy (P=0.014), the chance of a negative response increased by 2.57 times (OR=2.57; 95% CI [1.243 - 5.122]).
При распространенном спорадическом РЯ генотипы АРОЕ 4/4+3/4+2/4 (T/C+C/C) значимо (Р=0,0126) сопряжены с неблагоприятным ответом на лечение первой линии, шанс плохого ответа увеличен в 3 раза (OR=3,03; 95% ДИ [1.32 - 6.88]).In advanced sporadic OC, APOE genotypes 4/4+3/4+2/4 (T/C+C/C) are significantly (P=0.0126) associated with an unfavorable response to first-line treatment, the chance of a poor response is increased by 3 times (OR=3.03; 95% CI [1.32 - 6.88]).
Пример 2. Определение предиктивного значения генотипов, несущих аллель АРОЕ -ε2 (rs7412, Т) в оценке повышенного риска неблагоприятного ответа на первую линию терапии среди пациенток со спорадическим распространенным РЯ.Example 2. Determination of the predictive value of genotypes carrying the APOE -ε2 allele (rs7412, T) in assessing the increased risk of an adverse response to first-line therapy among patients with sporadic advanced OC.
Число пациенток с генотипами АРОЕ, несущими аллель ε2, составляло 19 человек (14%). Большинство лиц этот аллель не имели (117 человек). По возрасту группы значимо не отличались между собой (Р=0,66, Крускалл-Уоллес тест). The number of patients with APOE genotypes carrying the ε2 allele was 19 (14%). Most individuals did not have this allele (117 people). The groups did not differ significantly in age (P=0.66, Kruskall-Wallace test).
Распределение генотипов с аллелем АРОЕ -ε2 в группах пациенток с распространенным спорадическим РЯ, давших общий ответ (полная регрессия опухоли+частичная регрессия)и не ответивших (прогрессия +стабилизация) на первую линию химиотерапии показано в таблице 5. Частота пациенток с аллелем ε2 в группах с плохим и положительным ответом одинакова и составляла 14% (5/37 и 14/99) (Таблица 6), различия статистически не значимы (Р>0,999). The distribution of genotypes with the APOE -ε2 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy is shown in Table 5. The frequency of patients with the ε2 allele in groups with a poor and positive response is the same and amounted to 14% (5/37 and 14/99) (Table 6), the differences are not statistically significant (P>0.999).
Распределение генотипов с аллелем АРОЕ -ε2 в группах больных с распространенным спорадическим РЯ, давших общий ответ (полная регрессия опухоли+частичная регрессия) и не ответивших (прогрессия + стабилизация) на первую линию химиотерапииTable5.
Distribution of genotypes with the APOE -ε2 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy
С/Т+Т/Т
Число генотипов (%)2/3+2/4+2/2
S/T+T/T
Number of genotypes (%)
С/С
Число генотипов (%)3/3+3/4+4/4
S/S
Number of genotypes (%)
Показатели ассоциации генотипов, несущих аллель АРОЕ -ε2, с ответом на лечение первой линии комбинированной химиотерапииTable 6
Association indicators of genotypes carrying the APOE -ε2 allele with response to first-line combination chemotherapy treatment
Прогрессия
Число генотипов (%)Stabilization+
Progression
Number of genotypes (%)
Частичный ответ
Число гентипов (%)Full Answer+
Partial answer
Number of gentypes (%)
(95% Доверительный интервал)OR
(95% Confidence interval)
(0.35 - 2.83)0.95
(0.35 - 2.83)
Вывод. Генотипы с аллелем АРОЕ ε2 не ассоциированы с ответом опухоли на первую линию комбинированной ХТ и не являются соответствующим маркером.Conclusion. Genotypes with the APOE ε2 allele are not associated with the tumor response to the first line of combined chemotherapy and are not an appropriate marker.
Пример 3. Результаты применения логистической регрессии для выявления вероятности прогноза первичного ответа по наличию аллеля АРОЕ ε4. Зависимая переменная - первичный ответ на лечение: общий ответ (полная регрессия+частичная регрессия) или отрицательный ответ (стабилизация+прогрессия).Example 3. Results of applying logistic regression to determine the probability of predicting a primary response by the presence of the APOE ε4 allele. The dependent variable is the primary response to treatment: overall response (complete regression + partial regression) or negative response (stabilization + progression).
Среди обследованных пациенток РЯ с III и IV стадиями заболевания для 95 человек известен статус циторедукции: среди тех, у кого выявлен плохой первичный ответ неоптимальная операция проведена у 8 человек, субоптимальная - у 9 и оптимальная - у 1 пациентки. В группе с общим ответом неоптимальная операция проведена у 4 женщин, у 34 - оптимальная и у 39 - субоптимальная. Объем произведенной циторедукции является известным прогностическим фактором РЯ. При оценке объема первичной циторедукции оптимальной считается та, у которой оставшиеся максимальные размеры опухоли не превышают 1 см; субоптимальной циторедукции соответствовал размер оставшихся опухолевых масс 1-2 см и в случае превышения 2 см - объем операции считался неоптимальным. Анализ логистической регрессии на модели -2 Log Правдоподобие с предикторами АРОЕ ε4 (1 или 0) и вид циторедукции (0,1,2) выявил статистически значимую повышенную вероятность неблагоприятного ответа у носительниц аллеля АРОЕ ε4. Результаты логистической регрессии представлены в таблице 7. По величине AUC (площадь под ROC кривой, AreaUnderCurve) равным 0,839 тест имеет высокую прогностическую ценность. Показатель AUC только для одного предиктора (вид циторедукции) меньше и равен 0,770. В ROC анализе принято считать, что маркер является хорошим классификатором при AUC больше 7.Among the examined patients with OC with III and IV stages of the disease, the status of cytoreduction was known for 95 people: among those who had a poor primary response, non-optimal surgery was performed in 8 people, suboptimal - in 9 and optimal - in 1 patient. In the group with an overall response, a suboptimal operation was performed in 4 women, in 34 - optimal, and in 39 - suboptimal. The amount of cytoreduction performed is a known prognostic factor for OC. When assessing the volume of primary cytoreduction, the one in which the remaining maximum tumor size does not exceed 1 cm is considered optimal; suboptimal cytoreduction corresponded to the size of the remaining tumor masses of 1-2 cm, and in case of excess of 2 cm, the volume of the operation was considered suboptimal. Logistic regression analysis on the -2 Log Likelihood model with predictors APOE ε4 (1 or 0) and type of cytoreduction (0,1,2) revealed a statistically significant increased probability of an unfavorable response in carriers of the APOE ε4 allele. The results of the logistic regression are presented in table 7. With an AUC (area under the ROC curve, AreaUnderCurve) of 0.839, the test has a high predictive value. The AUC for only one predictor (type of cytoreduction) is less than 0.770. In ROC analysis, it is generally accepted that the marker is a good classifier with an AUC greater than 7.
Результаты применения логистической регрессии для выявления вероятности прогноза первичного ответа при учете двух предикторов: наличие аллеля АРОЕ ε4 и вид циторедукции
(оптимальная, субоптимальная и неоптимальная)Table 7
The results of applying logistic regression to identify the probability of predicting the primary response when two predictors are taken into account: the presence of the APOE ε4 allele and the type of cytoreduction
(optimal, suboptimal and suboptimal)
95% ДИAUC
95% CI
0,750-0,9070.839
0.750-0.907
1,50-16,705.01
1.50-16.70
2,73-31,259.24
2.73-31.25
Примечание: OR отношение шансов, ДИ доверительный интервал.Note: OR odds ratio, CI confidence interval.
Выведено уравнение модели, с помощью которого рассчитывается вероятность неблагоприятного ответа (P), ориентируясь на наличие или отсутствие аллеляАРОЕ ε4 и вид циторедукции:The equation of the model is derived, with the help of which the probability of an unfavorable response (P) is calculated, focusing on the presence or absence of the APOE ε4 allele and the type of cytoreduction:
Р= P=
Р= P=
A =logit(p)= константа + коэффициент+ коэффициентциторедукцияA =logit(p)= constant + factor + coefficient cytoreduction
Для носительниц аллеля АРОЕ ε4, которым проведена неоптимальная операция вероятность отрицательного первичного ответа равна 0,85. У лиц, у которых этот аллель отсутствует, вероятность плохого ответа равна 0,53.For carriers of the APOE ε4 allele who underwent a suboptimal operation, the probability of a negative primary response is 0.85. In individuals lacking this allele, the probability of a poor response is 0.53.
При субоптимальной циторедукции вероятность отрицательного первичного ответа для носительниц АРОЕε4 в четыре раза выше по сравнению с теми, у которых нет данного аллеля, и равна 0,39 и 0,11 соответственно. В случае оптимальной операции вероятность плохого ответа у носительниц АРОЕ ε4 равна 0,07и 0,01 у тех лиц, у которых его нет.With suboptimal cytoreduction, the probability of a negative primary response for carriers of APOEε4 is four times higher compared to those who do not have this allele, and is equal to 0.39 and 0.11, respectively. In the case of an optimal operation, the probability of a poor response in APOE ε4 carriers is 0.07 and 0.01 in those individuals who do not have it.
Выводы. Аллель АРОЕ ε4 увеличивает прогностическую значимость модели предсказания первичного отрицательного ответа при комбинированной ХТ в сочетании с неоптимальной и субоптимальной циторедукцией. По величине AUC (0,839) тест имеет высокую прогностическую ценность.Findings. The APOE ε4 allele increases the prognostic value of the model for predicting the primary negative response in combined CT in combination with suboptimal and suboptimal cytoreduction. In terms of AUC (0.839), the test has a high predictive value.
Пример 4Example 4
Анализ распределения генотипа АРОЕ -ε3ε3 среди больных с распространенным спорадическим РЯ, показавших ответ (полная регрессия опухоли+частичная регрессия) и не ответивших (прогрессия +стабилизация) на первую линию химиотерапии, у которых операция проводилась в субоптимальном или неоптимальном режиме.Analysis of the distribution of the APOE -ε3ε3 genotype among patients with widespread sporadic OC who showed a response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy , in whom the operation was performed in a suboptimal or non-optimal mode.
Возможность использования предложенного способа для определения прогноза положительного ответа на первую линию комбинированной ХТ с первичной или интервальной циторедукцией среди пациенток с распространенным спорадическим РЯ подтверждает анализ результатов наблюдений 59 пациенток в возрасте от 22 до 72 лет (медиана 56 лет). Был произведен анализ значимости полиморфизма АРОЕ в ответе на лечение первой линии в группе пациенток со спорадическим распространенным РЯ, у которых операция проводилась в субоптимальном или неоптимальном режиме. Доля пациенток, которым циторедукция выполнялась в неоптимальном объеме, составляла 19% (11/59). Исследовалось распределение референтного генотипа АРОЕ -ε3ε3 и остальных пяти генотипов (ε2ε3+ε2ε2+ε3ε4+ε4ε4+ε2ε4) в двух подгруппах пациенток в зависимости от типа ответа опухоли: общий ответ (полный ответ+частичный ответ) и отрицательный ответ (стабилизация+прогрессия). Данные приведены в таблицах 3 и 4. Среди носительниц генотипов АРОЕ -ε3ε3 численность группы с общим ответом превышала более чем в пять раз число лиц с отрицательным ответом. Доли пациенток с генотипом АРОЕ -ε3ε3 составляли 67% (28/42) в группе с общим ответом и 29 % (5/17) в группе с отрицательным ответом (Таблица 8). Различия в распределении генотипов между группами статистически значимы (Р=0,0203). Фиг.4 демонстрирует большее число генотипов АРОЕ -ε3ε3 среди пациенток со спорадическим РЯ, показавших общий ответ опухоли на первую линию комбинированной ХТ в комбинации с субоптимальной и неоптимальной циторедукцией.The possibility of using the proposed method to determine the prognosis of a positive response to the first line of combined CT with primary or interval cytoreduction among patients with advanced sporadic OC is confirmed by the analysis of the results of observations of 59 patients aged 22 to 72 years (median 56 years). An analysis was made of the significance of APOE polymorphism in response to first-line treatment in a group of patients with sporadic advanced OC, in whom the operation was performed in a suboptimal or non-optimal mode. The proportion of patients who underwent suboptimal cytoreduction was 19% (11/59). The distribution of the reference APOE genotype -ε3ε3 and the remaining five genotypes (ε2ε3+ε2ε2+ε3ε4+ε4ε4+ε2ε4) in two subgroups of patients depending on the type of tumor response was studied: overall response (complete response + partial response) and negative response (stabilization + progression) . The data are shown in tables 3 and 4. Among the carriers of the APOE -ε3ε3 genotypes, the number of the group with a general response was more than five times greater than the number of individuals with a negative response. The proportions of patients with the APOE -ε3ε3 genotype were 67% (28/42) in the overall response group and 29% (5/17) in the negative response group (Table 8). Differences in the distribution of genotypes between groups are statistically significant (P=0.0203). Figure 4 shows a greater number of APOE -ε3ε3 genotypes among patients with sporadic OC who showed an overall tumor response to first line combined chemotherapy in combination with suboptimal and suboptimal cytoreduction.
Распределение генотипа АРОЕ -ε3ε3 среди больных с распространенным спорадическим РЯ, показавших ответ (полная регрессия опухоли+частичная регрессия) и не ответивших (прогрессия +стабилизация) на первую линию химиотерапииTable 8
Distribution of the APOE -ε3ε3 genotype among patients with advanced sporadic OC who showed a response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy
Число генотипов (%)3/3
Number of genotypes (%)
Число генотипов (%)2/3+2/2+2/4+4/4+3/4
Number of genotypes (%)
В таблице 9 приведены показатели предиктивной эффективности генотипа АРОЕ -ε3ε3 в отношении благоприятного ответа на лечение ХТ первой линии спорадического РЯ у больных III и IV стадий с субоптимальной и неоптимальной циторедукцией.Table 9 shows the indicators of predictive efficacy of the APOE -ε3ε3 genotype in relation to a favorable response to treatment of first-line chemotherapy in sporadic OC in patients with stages III and IV with suboptimal and non-optimal cytoreduction.
Показатели предиктивной эффективности генотипа АРОЕ -ε3ε3Table 9
Indicators of predictive efficiency of the APOE genotype -ε3ε3
Частичный ответ
Число гентипов (доля среди лиц данной категории)Full Answer+
Partial answer
Number of gentypes (proportion among persons of this category)
Прогрессия
Число генотипов (доля среди лиц данной категории)Stabilization+
Progression
Number of genotypes (proportion among individuals of this category)
(0,067-0,718)0.208
(0.067-0.718)
(0.691-0.934)85%
(0.691-0.934)
(0.288- 0.645)46%
(0.288- 0.645)
Вывод: Благоприятный ответ злокачественной опухоли яичников на первую линию комбинированной ХТ в комбинации с субоптимальной и неоптимальной циторедукцией определяется наличием у пациентки двух аллелей ε3 АРОЕ. Генотип АРОЕ -ε3ε3 имеет шанс положительного ответа на лечение почти в 5 раз выше по сравнению с другими генотипами АРОЕ (95% ДИ: 1.32 - 13.74).Conclusion: A favorable response of a malignant ovarian tumor to the first line of combined chemotherapy in combination with suboptimal and suboptimal cytoreduction is determined by the presence of two ε3 APOE alleles in the patient. The APOE -ε3ε3 genotype has an almost 5-fold higher chance of a positive response to treatment compared to other APOE genotypes (95% CI: 1.32 - 13.74).
Пример 5Example 5
Результаты применения логистической регрессии для выявления вероятности прогноза первичного ответа по наличию генотипов АРОЕ ε3ε3 . Зависимая переменная - первичный ответ на лечение: общий ответ (полная регрессия+частичная регрессия) или отрицательный ответ (стабилизация+прогрессия).The results of applying logistic regression to identify the probability of predicting the primary response by the presence of APOE ε3ε3 genotypes. The dependent variable is the primary response to treatment: overall response (complete regression + partial regression) or negative response (stabilization + progression).
Среди обследованных пациенток с диагнозом РЯ III и IV стадий заболевания для 95 человек известен статус циторедукции. Объем произведенной циторедукции является известным прогностическим фактором РЯ. При оценке объема первичной циторедукции оптимальной считается та, у которой оставшиеся максимальные размеры опухоли не превышают 1 см; субоптимальной циторедукции соответствовал размер оставшихся опухолевых масс 1-2 см и в случае превышения 2 см - объем операции считался неоптимальным. Анализ логистической регрессии на модели -2 Log Правдоподобие с предикторами АРОЕ ε3ε3 (1 или 0) и вид циторедукции (0,1,2) выявил статистически значимую повышенную вероятность положительного ответа у носительниц генотипа АРОЕ ε3ε3. Результаты логистической регрессии представлены в таблице 10. По величине AUC (площадь под ROC кривой, AreaUnderCurve) равным 0,859 тест имеет высокую прогностическую ценность.Among the examined patients with a diagnosis of OC III and IV stages of the disease for 95 people, the status of cytoreduction is known. The amount of cytoreduction performed is a known prognostic factor for OC. When assessing the volume of primary cytoreduction, the one in which the remaining maximum tumor size does not exceed 1 cm is considered optimal; suboptimal cytoreduction corresponded to the size of the remaining tumor masses of 1-2 cm, and in case of excess of 2 cm, the volume of the operation was considered suboptimal. Logistic regression analysis on the -2 Log Likelihood model with predictors APOE ε3ε3 (1 or 0) and type of cytoreduction (0,1,2) revealed a statistically significant increased probability of a positive response in carriers of the APOE ε3ε3 genotype. The results of the logistic regression are presented in table 10. With an AUC (area under the ROC curve, AreaUnderCurve) of 0.859, the test has a high predictive value.
Результаты применения логистической регрессии для выявления вероятности прогноза первичного ответа при учете двух предикторов: наличие генотипа АРОЕ ε3ε3 и вид циторедукции ( оптимальная, субоптимальная и неоптимальная)Table 10
The results of applying logistic regression to identify the probability of predicting the primary response when taking into account two predictors: the presence of the APOE ε3ε3 genotype and the type of cytoreduction (optimal, suboptimal and non-optimal)
циентыcoefficient
patients
95% ДИAUC
95% CI
0,773-0,9220.859
0.773-0.922
0,023-0,4370.101
0.023-0.437
2,939-45,53711.57
2.939-45.537
Примечание: OR отношение шансов, ДИ доверительный интервал.Note: OR odds ratio, CI confidence interval.
Выведено уравнение модели, с помощью которого рассчитывается вероятность неблагоприятного ответа (P), ориентируясь на наличие или отсутствие генотипа АРОЕ ε3ε3 и вид циторедукции.An equation of the model is derived, with the help of which the probability of an unfavorable response (P) is calculated, focusing on the presence or absence of the APOE ε3ε3 genotype and the type of cytoreduction.
Р= P=
Р= P=
A =logit(p)= константа + коэффициент+ коэффициентциторедукцияA =logit(p)= constant + factor + factor cytoreduction
Для носительниц генотипа АРОЕ ε3ε3, которым проведена неоптимальная операция вероятность отрицательного первичного ответа равна 0,44. У лиц, у которых этот генотип отсутствует, вероятность неблагоприятного ответа выше в два раза и равна 0,89.For carriers of the APOE ε3ε3 genotype who underwent a suboptimal operation, the probability of a negative primary response is 0.44. In individuals who do not have this genotype, the probability of an adverse response is twice as high and equal to 0.89.
При субоптимальной циторедукции вероятность неблагоприятного первичного ответа для носительниц АРОЕε3ε3 почти в 6 раз ниже по сравнению с теми, у которых нет данного генотипа, и равна 0,07 и 0,40 соответственно. В случае оптимальной операции вероятность отрицательного ответа у носительниц генотипа АРОЕ ε3ε3 менее 0,01, а у тех, у кого он отсутствует, - 0,05.With suboptimal cytoreduction, the probability of an unfavorable primary response for carriers of APOEε3ε3 is almost 6 times lower compared to those who do not have this genotype, and is equal to 0.07 and 0.40, respectively. In the case of an optimal operation, the probability of a negative response in carriers of the APOE ε3ε3 genotype is less than 0.01, and in those who do not have it, it is 0.05.
Выводы. Генотип АРОЕ ε3ε3 понижает вероятность неблагоприятного прогноза первичного ответа злокачественной опухоли яичников после первой линии комбинированной ХТ с циторедукцией и увеличивает прогностическую значимость модели предсказания первичного ответа при комбинироаванной ХТ. По величине AUC (0,859) тест имеет высокую прогностическую ценность.Findings. The APOE ε3ε3 genotype reduces the probability of an unfavorable prognosis of the primary response of a malignant ovarian tumor after the first line of combined chemotherapy with cytoreduction and increases the prognostic value of the model for predicting the primary response in combined chemotherapy. In terms of AUC (0.859), the test has a high predictive value.
Подтверждение достижения технического результата Confirmation of achievement of the technical result
Представленный нами способ по сравнению с прототипом позволяет расширить прогноз отрицательного ответа на первую линию адьювантной и неоадьювантной комбинированной ХТ с циторедукцией у пациенток с распространенным РЯ.The method presented by us in comparison with the prototype allows us to expand the prognosis of a negative response to the first line of adjuvant and neoadjuvant combined chemotherapy with cytoreduction in patients with advanced OC.
Полученный результат подтвержден наблюдениями 136 женщин со спорадическим распространенным РЯ III и IV стадии по ФИГО классификации, среди которых у 37 человек наблюдался отрицательный ответ (Стабилизация+Прогрессирование) и у 99 обнаружен общий ответ (Частичный+Полный ответ).The obtained result was confirmed by observations of 136 women with sporadic advanced OC III and IV stages according to FIGO classification, among which 37 people had a negative response (Stabilization + Progression) and 99 had an overall response (Partial + Complete response).
Сравнение результатов анализа генетических показателей оценки развития ответа на первую линию терапии по предлагаемому способу и прототипу показывает эффективность аллеля АРОЕ -ε4 в прогнозе отрицательного ответа, а генотипа ε3ε3в прогнозе положительного ответа для пациенток со спорадическим РЯ III и IV стадии, которым проводилась комбинированная неоадьювантная или адьювантная химиотерапия таксанами и платиносодержащими препаратами.Comparison of the results of the analysis of genetic indicators for assessing the development of response to the first line of therapy according to the proposed method and the prototype shows the effectiveness of the APOE -ε4 allele in predicting a negative response, and the ε3ε3 genotype in predicting a positive response for patients with sporadic OC stage III and IV, who underwent combined neoadjuvant or adjuvant chemotherapy with taxanes and platinum-containing drugs.
В группе пациенток с отрицательным ответом на лечение уровень значимости превышения частоты аллеля АРОЕ -ε4 по сравнению с группой лиц, показавших общий ответ на ХТ, высокий (Р=0,0162), а шанс плохого ответа у носительниц генотипов с АРОЕ -ε4 повышен почти в 3 раза (OR=2,87; 95% CI 1.27 - 6.40) (Пример 1. Таблицы 1-4, Фиг. 2, 3). Это указывает на значимую ассоциацию аллеля АРОЕ -ε4 с отрицательным ответом на комбинированную ХТ в адьювантном и неоадьювантном режиме и его роль в отсутствии положительного ответа на первую линию комбинированной ХТ. Примеры 1 и 3 доказывают, что предлагаемый способ при лечении спорадического распространенного РЯ прогнозирует развитие неблагоприятного ответа на комбинированную ХТ в адьювантном и неоадьювантном режиме. Среди носительниц генотипов АРОЕ -ε3ε3 численность группы с общим ответом превышала более чем в пять раз число лиц с отрицательным ответом. Различия в распределении генотипов между группами статистически значимы (Р=0,0203), шанс положительного прогноза ответа на лечение в 4,8 раз выше по сравнению с другими генотипами АРОЕ (95% ДИ: 1.32 - 13.74). Примеры 4 и 5 доказывают, что предлагаемый способ при лечении спорадического распространенного РЯ прогнозирует развитие общего ответа на комбинированную ХТ в комбинации с субоптимальной и неоптимальной циторедукцией.In the group of patients with a negative response to treatment, the level of significance of the excess frequency of the APOE -ε4 allele compared to the group of individuals who showed a general response to chemotherapy is high (P = 0.0162), and the chance of a poor response in carriers of the APOE -ε4 genotypes is increased almost 3 times (OR=2.87; 95% CI 1.27 - 6.40) (Example 1. Tables 1-4, Fig. 2, 3). This indicates a significant association of the APOE -ε4 allele with a negative response to combined chemotherapy in adjuvant and neoadjuvant regimens and its role in the absence of a positive response to first-line combined chemotherapy. Examples 1 and 3 prove that the proposed method in the treatment of sporadic advanced OC predicts the development of an unfavorable response to combined chemotherapy in adjuvant and neoadjuvant modes. Among the carriers of the APOE -ε3ε3 genotypes, the number of the group with a common response was more than five times greater than the number of individuals with a negative response. Differences in the distribution of genotypes between groups are statistically significant (P = 0.0203), the chance of a positive prognosis of response to treatment is 4.8 times higher compared with other APOE genotypes (95% CI: 1.32 - 13.74). Examples 4 and 5 prove that the proposed method in the treatment of sporadic advanced OC predicts the development of a general response to combined chemotherapy in combination with suboptimal and non-optimal cytoreduction.
Клинические примеры.Clinical examples.
Пример 1Example 1
Пациентка А. 55 лет, поступила в гинекологическое отделение МРНЦ им. А.Ф. Цыба - Филиал ФГБУ "НМИЦ Радиологии" Минздрава России с диагнозом: Рак яичников IV aст, с T3cN0M1a Асцит. Карциноматоз брюшины. Гидроторакс слева.Patient A., aged 55, was admitted to the gynecological department of the MRRC named after. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IV ast, with T3cN0M1a Ascites. Peritoneal carcinomatosis. Hydrothorax on the left.
При поступлении обследована: СА 125 - 17353,5 Ед/мл. СКТ: образование левого яичника до 9см в диаметре. КТ- признаки карциноматоза брюшины малого таза, инфильтрация большого сальника. Асцит. Жидкость в левой плевральной полости.Upon admission, the patient was examined: CA 125 - 17353.5 U/ml. SKT: formation of the left ovary up to 9 cm in diameter. CT - signs of carcinomatosis of the peritoneum of the small pelvis, infiltration of the greater omentum. Ascites. Fluid in the left pleural cavity.
В отделении проведено комбинированное лечение (3 курса ПХТ + хирургическое лечение + 3 курса ПХT). На первом этапе проводилось 3 курса неоадьювантной ПХТ, далее - интервальная циторедуктивная операция (лапаротомия: экстирпация матки с придатками, оментэктомия, тазовая перитонэктомия. Остаточная опухоль > 2cм).The department provided combined treatment (3 courses of PCT + surgical treatment + 3 courses of PCT). At the first stage, 3 courses of neoadjuvant PCT were performed, followed by interval cytoreductive surgery (laparotomy: extirpation of the uterus with appendages, omentectomy, pelvic peritonectomy. Residual tumor > 2 cm).
Гистологическое заключение - в левом яичнике инвазивный рост серозной аденокарциномы highgrade с признаками терапевтического патоморфоза I степени по Г.А. Лавниковой. На поверхности маточных труб, тела матки с прорастанием в параметрий и толщу миометрия и на поверхности брюшины рост серозной аденокарциномы. В большом сальнике инвазивный рост серозной аденокарциномы.Histological conclusion - in the left ovary there is an invasive growth of high grade serous adenocarcinoma with signs of therapeutic pathomorphosis of the 1st degree according to G.A. Lavnikova. On the surface of the fallopian tubes, the body of the uterus with germination in the parameters and thickness of the myometrium and on the surface of the peritoneum, the growth of serous adenocarcinoma. In the greater omentum, invasive growth of serous adenocarcinoma.
После операции проведено 3 курса адьювантной ПХТ. Химиотерапия проводилась по схеме: паклитаксел 175 мг/м2 в 1-й день + цисплатин 60 мг/м2 в 1-й день; цикл 21 день.After the operation, 3 courses of adjuvant PCT were performed. Chemotherapy was carried out according to the scheme: paclitaxel 175 mg/m 2 on the 1st day +
У пациентки был выявлен негативный BRCA статус и генотип АРОЕ ε3ε4. Носительство аллеля ε4 указывает на высокий риск неполного ответа. На основании этого женщина включена в группу риска по неполному ответу на первую линию комбинированной ХТ. Оценка объективного ответа подтвердила прогноз.The patient was found to be BRCA negative and APOE ε3ε4 genotype. Carrying the ε4 allele indicates a high risk of incomplete response. Based on this, the woman is included in the risk group for incomplete response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.
После завершения лечения СА 125 - 72,5 Ед/мл. По данным СКТ образования на брюшине прежних размеров.After completion of treatment, CA 125 - 72.5 U / ml. According to the CT scan, the formations on the peritoneum were of the same size.
Заключение: стабилизация.Conclusion: stabilization.
Пример 2Example 2
Пациентка Б., 34 года, поступила в гинекологическое отделение МРНЦ им. А.Ф. Цыба - Филиал ФГБУ "НМИЦ Радиологии" Минздрава России с диагнозом: Рак яичников IVb ст. cT3cN0M1b. Метастатическое поражение печени. Асцит. Patient B., 34 years old, was admitted to the gynecological department of the MRRC. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IVb st. cT3cN0M1b. Metastatic liver disease. Ascites.
При обследовании выявлено увеличение опухолевых маркеров СА 125 -1000 Ед\мл. По данным МРТ органов малого таза - выявлены кистозно-солидные образования обоих яичников до 6см, выпот в малом тазу, карциноматоз брюшины малого таза. По данным ПЭТ- метастатическое поражение брюшины с поражением паренхимы левой доли печени до 3 см.Examination revealed an increase in tumor markers CA 125 -1000 U/ml. MRI of the pelvic organs revealed cystic-solid formations of both ovaries up to 6 cm, effusion in the small pelvis, carcinomatosis of the peritoneum of the small pelvis. According to PET-metastatic lesion of the peritoneum with damage to the parenchyma of the left lobe of the liver up to 3 cm.
Проведено комбинированное лечение (хирургическое лечение + 6 курсов ПХТ). Циторедуктивная операция произведена в объеме: экстирпация матки с придатками, оментэктомия, тазовая перионэктомия. Остаточная опухоль >2см. В последующем проведено 6 курсов адьювантной ПХТ по схеме: Паклитаксел 175 мг/м2 в 1-й день + цисплатин 60 мг/м2 в 1-й день; цикл 21 день. Combined treatment (surgical treatment + 6 courses of chemotherapy) was carried out. Cytoreductive operation was performed in volume: extirpation of the uterus with appendages, omentectomy, pelvic perionectomy. Residual tumor >2 cm. Subsequently, 6 courses of adjuvant PCT were performed according to the scheme: Paclitaxel 175 mg/m 2 on the 1st day +
Гистологическое заключение: в обоих яичниках инвазивный рост серозной аденокарциномы highgrade; в большом сальнике, брюшине – серозная аденокарцинома highgrade.Histological conclusion: invasive growth of high grade serous adenocarcinoma in both ovaries; in the greater omentum, peritoneum - high grade serous adenocarcinoma.
У женщины был выявлен негативный BRCA статус и генотип АРОЕ ε3ε3. Наличие гомозиготного генотипа АРОЕ ε3ε3 указывает на высокую вероятность положительного ответа на первую линию комбинированной ХТ. Оценка объективного ответа подтвердила прогноз.The woman was found to be BRCA negative and APOE ε3ε3 genotype. The presence of the homozygous APOE ε3ε3 genotype indicates a high probability of a positive response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.
При обследовании через 4 недели: СА 125 - 34,51 Ед/мл. По данным МРТ и СКТ признаков опухолевого поражения органов малого таза нет.When examined after 4 weeks: CA 125 - 34.51 U / ml. According to MRI and CT scans, there are no signs of a tumor lesion of the pelvic organs.
Заключение - полная регрессия.The conclusion is a complete regression.
Пример 3Example 3
Пациентка Г, 57 лет, поступила в гинекологическое отделение МРНЦ им. А.Ф. Цыба - Филиал ФГБУ "НМИЦ Радиологии" Минздрава России с диагнозом: Рак яичников IVb ст. cT3N0M1b. Асцит Карциноматоз брюшины. Метастатическое поражение большого сальника и передней брюшной стенки. Метастазы в правом легком. Экссудативный плеврит.Patient G, 57 years old, was admitted to the gynecological department of the MRRC. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IVb st. cT3N0M1b. Ascites Carcinomatosis of the peritoneum. Metastatic lesion of the greater omentum and anterior abdominal wall. Metastases in the right lung. Exudative pleurisy.
СА 125 - 3210 Ед\мл. СКТ - очаговое поражение нижней доли правого легкого, жидкость в плевральных полостях. МРТ органов малого таза - образования обоих яичников, карциноматоз брюшины, метастатическое поражение большого сальника.CA 125 - 3210 U\ml. SKT - focal lesion of the lower lobe of the right lung, fluid in the pleural cavities. MRI of the pelvic organs - the formation of both ovaries, peritoneal carcinomatosis, metastatic lesion of the greater omentum.
В отделении проведено комбинированное лечение (4 цикла ПХТ+операция+2 цикла ПХТ). Схема ПХТ: паклитаксел 175 мг/м + карбоплатин 6 AUC в 1-й день; цикл 21 день. Хирургическое лечение выполнено в объеме: лапаротомия, циторедуктивная операция экстирпация матки с придатками, оментэктомия. Остаточная опухоль > 2 см.The department carried out combined treatment (4 cycles of PCT + surgery + 2 cycles of PCT). PCT regimen: paclitaxel 175 mg/m + carboplatin 6 AUC on day 1; cycle 21 days. Surgical treatment was performed in the following volume: laparotomy, cytoreductive operation, extirpation of the uterus with appendages, omentectomy. Residual tumor > 2 cm.
Гистологическое заключение: в яичниках, большом сальнике инвазивный рост серозной аденокарциномы highgrade.Histological conclusion: in the ovaries, the greater omentum invasive growth of high grade serous adenocarcinoma.
После 6 курса у пациентки выявлено прогрессирование заболевания на фоне проведения ПХТ. Отмечено увеличение опухолевых маркеров, увеличение асцита, экссудативного плеврита, увеличение метастатических очагов на брюшине.After the 6th course, the patient showed progression of the disease against the background of PCT. An increase in tumor markers, an increase in ascites, exudative pleurisy, and an increase in metastatic foci on the peritoneum were noted.
У женщины был выявлен негативный BRCA статус и генотип АРОЕ ε3ε4.Носительство аллеля ε4 указывает на высокий риск неполного ответа, поэтому пациентка включена в группу риска по неполному ответу на первую линию комбинированной ХТ. Оценка объективного ответа подтвердила прогноз.The woman had a negative BRCA status and the APOE ε3ε4 genotype. Carriage of the ε4 allele indicates a high risk of incomplete response, so the patient is included in the risk group for incomplete response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.
Заключение: прогрессирование заболевания.Conclusion: disease progression.
Таким образом, предикативные показатели аллеля АРОЕ -ε4 (С) rs429358 и генотипа ε3ε3 по предлагаемому способу достаточно высоки и значимы, что доказывает возможность его применения для выявления среди пациенток со спорадическим распространенным РЯ лиц с повышенным шансом отрицательного ответа на комбинированную ХТ в адьювантном и неоадьювантном режиме.Thus, the predictive indicators of the APOE -ε4 (C) rs429358 allele and the ε3ε3 genotype according to the proposed method are quite high and significant, which proves the possibility of its application to identify individuals with an increased chance of a negative response to combined chemotherapy in adjuvant and neoadjuvant patients with sporadic advanced OC. mode.
Предлагаемый способ позволяет быстро получить неинвазивным способом значимый критерий для оценки прогноза риска развития отрицательного ответа на комбинированную ХТ в адьювантном и неоадьювантном режиме для пациенток со спорадическим распространенным РЯ, что является полезным дополнением к диагностическому комплексу при скрининге больных в предоперационный период и индивидуализирует подход к лечению пациенток РЯ.The proposed method allows you to quickly obtain in a non-invasive way a significant criterion for assessing the prognosis of the risk of developing a negative response to combined chemotherapy in adjuvant and neoadjuvant modes for patients with sporadic advanced OC, which is a useful addition to the diagnostic complex for screening patients in the preoperative period and individualizes the approach to treating patients RY.
Claims (3)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2021121679A RU2769543C2 (en) | 2021-07-21 | 2021-07-21 | Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2021121679A RU2769543C2 (en) | 2021-07-21 | 2021-07-21 | Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv |
Publications (3)
Publication Number | Publication Date |
---|---|
RU2021121679A RU2021121679A (en) | 2021-10-18 |
RU2021121679A3 RU2021121679A3 (en) | 2022-02-11 |
RU2769543C2 true RU2769543C2 (en) | 2022-04-01 |
Family
ID=78261346
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2021121679A RU2769543C2 (en) | 2021-07-21 | 2021-07-21 | Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2769543C2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020176846A2 (en) * | 2019-02-28 | 2020-09-03 | The Rockefeller University | Apoe genotyping in cancer prognostics and treatment |
RU2760185C2 (en) * | 2015-08-20 | 2021-11-22 | Ипсен Биофарм Лтд. | Combination therapy using liposomal irinotecan and parp inhibitor for the treatment of cancer |
-
2021
- 2021-07-21 RU RU2021121679A patent/RU2769543C2/en active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2760185C2 (en) * | 2015-08-20 | 2021-11-22 | Ипсен Биофарм Лтд. | Combination therapy using liposomal irinotecan and parp inhibitor for the treatment of cancer |
WO2020176846A2 (en) * | 2019-02-28 | 2020-09-03 | The Rockefeller University | Apoe genotyping in cancer prognostics and treatment |
Non-Patent Citations (1)
Title |
---|
Т.И.ИВАНОВА et al. Полиморфизм АРОЕ и показатели оксидативного статуса плазмы у больных раком яичников. Материалы Первого Международного Форума онкологии и радиологии. Москва, 23-28 сентября 2018, 1171. * |
Also Published As
Publication number | Publication date |
---|---|
RU2021121679A3 (en) | 2022-02-11 |
RU2021121679A (en) | 2021-10-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Nault et al. | Clinical impact of genomic diversity from early to advanced hepatocellular carcinoma | |
Nault et al. | Molecular classification of hepatocellular adenoma associates with risk factors, bleeding, and malignant transformation | |
Konopka et al. | PIK3CA mutations and amplification in endometrioid endometrial carcinomas: relation to other genetic defects and clinicopathologic status of the tumors | |
US20090298082A1 (en) | Biomarker panels for predicting prostate cancer outcomes | |
US20170211153A1 (en) | Algorithmic Approach for Determining the Plasma Genome Abnormality PGA and the Urine genome abnormality UGA scores based on Cell Free cfDNA Copy Number Variations in Plasma and Urine. | |
US10407731B2 (en) | Biomarker panels for predicting prostate cancer outcomes | |
Unfried et al. | Identification of coding and long noncoding RNAs differentially expressed in tumors and preferentially expressed in healthy tissues | |
Zhao et al. | Flap endonuclease 1 (FEN1) as a novel diagnostic and prognostic biomarker for gastric cancer | |
KR20150028232A (en) | Breast cancer prognosis, prediction of progesterone receptor subtype and prediction of response to antiprogestin treatment based on gene expression | |
Dang et al. | Cell-free DNA alterations in the AR enhancer and locus predict resistance to AR-directed therapy in patients with metastatic prostate cancer | |
Dey et al. | Matrix metalloproteinase3 gene promoter polymorphisms and their haplotypes are associated with gastric cancer risk in eastern Indian population | |
Paige et al. | WWOX tumour suppressor gene polymorphisms and ovarian cancer pathology and prognosis | |
Yu et al. | Reduced mitochondrial DNA copy number in Chinese patients with osteosarcoma | |
Shiomi et al. | Comprehensive genomic analysis contrasting primary colorectal cancer and matched liver metastases | |
RU2769543C2 (en) | Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv | |
Zhou et al. | Identification of small nucleolar RNA SNORD60 as a potential biomarker and its clinical significance in lung adenocarcinoma | |
Yuan et al. | Telomere maintenance associated mutations in the genetic landscape of gynecological mucosal melanoma | |
Brand et al. | Association of polymorphisms in TGFB1 and prostate cancer prognosis | |
Chang et al. | Prognostic significance of E-cadherin and ZEB1 expression in intraductal papillary mucinous neoplasm | |
Zhang et al. | Primary macronodular adrenal hyperplasia (PMAH) can be generated by a new ARMC5 germline variant (c. 52C> T (p. Gln18X)) | |
Abyarghamsari et al. | Study of the relationship between ercc1 polymorphisms and response to platinum-based chemotherapy in iranian patients with colorectal and gastric cancers | |
Matevska-Geshkovska et al. | Influence of MSI and 18q LOH markers on capecitabine adjuvant monotherapy in colon cancer patients | |
Abdollahi et al. | Epigenetic regulation of circ-HIPK3, circ-PVT1, miR-25, and miR-149 in radiosensitivity of breast cancer | |
Doraczyńska-Kowalik et al. | Genetics and Oncology (part 2.). Fundamentals of personalised medicine in the treatment of breast and ovarian cancer | |
Lan et al. | High concordance of mutation patterns in 10 common mutated genes between tumor tissue and cell-free DNA in metastatic colorectal cancer |