RU2769543C2 - Method for assessing primary response to combined chemotherapy of sporadic ovarian cancer of stages iii and iv - Google Patents

Abstract

FIELD: biotechnology; medicine.

SUBSTANCE: invention relates to biotechnology and medicine. The method for assessing the primary response to the combined chemotherapy before treatment is proposed, for which polymorphic alleles of АРОЕ - ɛ2, АРОЕ - ɛ3, АРОЕ - ɛ4 are detected.

EFFECT: method makes it possible to quickly obtain a noninvasively significant criterion for assessing the prognosis of the risk of developing a negative response to combined CT for patients with sporadic advanced ovarian cancer, which is a useful addition to the diagnostic complex for screening patients in the preoperative period and individualizes the approach to the treatment of patients with ovarian cancer.

1 cl, 4 dwg, 10 tbl, 3 ex

Description

The invention relates to medicine, namely to oncology, and can be used to predict a negative/positive response (outcome) in patients with stage III and IV sporadic ovarian cancer after the first line of combined chemotherapy (platinum-paclitaxel preparations) with primary or interval cytoreduction.

Among oncological diseases of the female reproductive system, advanced ovarian cancer (hereinafter referred to as OC) is the first leading cause of death, its share is 5.5% [Kaprin A.D., Starinsky V.V., Shakhzadova A.O. Malignant neoplasms in Russia in 2019 (morbidity and mortality). Moscow: MNIOI im. P.A. Herzen - branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia. 2020. 252]. OC in 75% of cases is diagnosed at stages III-IV, so the prognosis is extremely unfavorable, and in the countries of the European Union, the five-year survival rate is 30% [Ovarian cancer. http://www.oncology.ru/specialist/epidemiology/malignant/C56/].

The standard first-line chemotherapy regimen for patients with advanced stage III and IV ovarian cancer, carried out in combination with cytoreductive surgery, is intravenous administration of taxanes (paclitaxel, docetaxel) with platinum-containing drugs (cisplatin, carboplatin), which are important and effective antitumor cytostatics for initial therapy. malignant ovarian tumors [ovarian cancer / fallopian tube cancer / primary peritoneal cancer. Clinical recommendations of the Ministry of Health of the Russian Federation. ICD 10: C48 / C56 / C57. 2019]. Depending on the condition of the patients, a primary operation is performed to remove the tumor, followed by chemotherapy, or an interval operation (after 2-3 cycles of induction chemotherapy) in the case of patients with a severe somatic status or an extreme prevalence of the tumor process. After the operation, such patients undergo an additional 3-4 courses XT [Clinical guidelines. "Ovarian cancer / fallopian tube cancer / primary peritoneal cancer" 2020. Association of Oncologists of Russia. C48.0, C48.1, C48.2, C56, C57; Tyulandina A.S., Rumyantsev A.A., Morkhov K.Yu., Nechushkina V.M., Tyulyandin S.A. Retrospective analysis of long-term results of the use of primary cytoreduction and preoperative chemotherapy at the first stage of treatment of patients with IIIC-IV stages of ovarian cancer // Malignant tumors 2018; 3:86-94].

After the first line of chemotherapy (6 cycles), the objective effect is evaluated according to the criteria for evaluating the response of solid tumors (ResponseEvaluationCriteriaInSolidTumors -RECIST1.1) [EisenhauerEA, TherasseP, BogaertsJ, SchwartzLH, SargentD, FordR, DanceyJ, ArbuckS, GwytherS, MooneyM, RubinsteinL, ShankarL , DoddL, KaplanR, LacombeD, VerweijJ. Newresponseevaluationcriteriainsolidtumours: revisedRECISTguideline (version 1.1). Eur J Cancer. 2009c].

Epithelial ovarian cancer (OC) is characterized by high sensitivity to chemotherapy (XT). In most cases, the tumor is sensitive to platinum derivatives and recurrence occurs a year or more after the first line chemotherapy [Oronsky, B., Ray, C.M., Spira, A.I. etal. A brief review of the management of platinum-resistant-platinum-refractory ovarian cancer. Med Oncol 34, 103 (2017). https://doi.org/10.1007/s12032-017-0960-z]. In 75-85% of cases, there is a complete or partial response to first-line therapy [Ulm M, Ramesh AV, McNamara KM, Ponnusamy S, Sasano H, Narayanan R. Therapeutic advances in hormone-dependent cancers: focus on prostate, breast and ovarian cancers. EndocrConnect. 2019 Feb 1;8(2):R10-R26. doi: 10.1530/EC-18-0425]. But many patients develop resistance during treatment or shortly after first-line combination chemotherapy. Often, the use of anticancer drugs is associated with severe side effects. Identification of molecular markers of chemosensitivity and chemoresistance will significantly increase the effectiveness of antitumor therapy, and the development of markers of chemosensitivity of neoplasms will help reduce the cost of therapy due to more reasonable use of expensive drugs [E.N. Imyanitov, V.M. Moiseenko. Application of molecular genetic analysis for the choice of anticancer therapy. Issues of oncology.2008. T.54. No. 2. Page 121-132].

Although worldwide research is underway to identify resistance factors in ovarian malignancies to ctaxanes, platinum-containing therapy, or a combination of both, the molecular mechanisms underlying the differences in tumor response of primary patients with advanced ovarian cancer to first-line therapy are not currently known and there are no relevant biological markers.

Background of the Invention

For 25-15% of patients, first-line therapy is obviously ineffective, which worsens further treatment and quality of life.

A known method for predicting the effectiveness of the treatment of OC (paclitaxel, cyclophosphamide, bevacizumab, cytoreduction), based on the determination in biological fluids (blood, urine, saliva, tumor effusions) in addition to CA 125 and HE 4 expression levels of the MMP9 polypeptide (GenBankAccessionNumber: NP_004985-2) binding to microparticles containing annexin 5. Elevated values serve as markers of relapse (WO2018143896 (A1) - 2018-08-09).

A significant limitation of the method is the inability to predict the response to the first line of therapy before treatment and its effectiveness in relation to platinum drugs is unknown.

A known method for predicting the effectiveness of treatment of ovarian cancer with platinum drugs (cisplatin, carboplatin, oxaliplatin, satraplatin) based on the determination of abnormal expression of a number of genes in tumor cells (US 2006/0019268 A1 dated 26.01.2006). An elevated level of APOE expression is a marker of tumor resistance to platinum preparations. The experiments were performed on cell models (6 pairs of cisplatin-sensitive and cisplatin-resistant strains of human ovarian carcinoma cell cultures).

However, a significant drawback is that the gene expression was assessed on model systems and it is not known whether the identified patterns persist in vivo in patients under the conditions of first-line combined chemotherapy. There are no data on APOE isoforms in the studied cell cultures.

A known method for diagnosing and predicting the response of OC during combined adjuvant and neoadjuvant chemotherapy, based on determining the number of copies and gene expression in the MECOM locus: EVI1 (ectopicviralintegrationsite 1) and MDS1 (Myelodysplasiasyndrome-1) in tumor tissue (US2015/0024956A1 dated 22.01.2015 ).The protein product of the gene is a transcription factor involved in a variety of signaling pathways for both coexpression and coactivation of cell cycle genes. Patients were stratified according to the type of response to first line therapy into two classes: 288 patients with a complete response, 121 patients with an incomplete response, including a partial response, stabilization and progression of the tumor. Based on the expression of the EVI1 and MDS1 genes in tumor tissue and amplification of the MECOM locus associated with resistance to chemotherapy in epithelial ovarian cancer, response to first-line treatment is predicted. It is concluded that if amplification of the MECOM locus is detected, therapy should be more intensive. The authors used information about the expression and amplification of tumor genes of epithelial ovarian cancer of 524 patients from the CancerGenomeAtlas (TCGA) database from the National Institute Health (NIH).

A significant limitation of this invention is that the sample was a mixed group, including patients with early (13%) and late stages (87%) of the disease. There are significant drawbacks associated with the material of the study, these are: 1- invasiveness when taking a tissue sample; 2 - cells of different clones are often present in the tumor, which differ from each other in the profile of gene expression and methylation; 3-indicators of gene expression depend on the quality of the isolated RNA and the proportion of malignant cells in the sample; 4- it is impossible to predict the response to treatment before surgery, i.e. in the case of neoadjuvant therapy, the patient immediately receives drugs according to the standard scheme.

A large number of studies have shown that individual response to treatment depends on variations in the sequence of DNA molecules.

In December 2014, the BRACAnalysisCDx™ test, developed by MyriadGenetics, was approved by the Food and Drug Administration (FDA) for the administration of Lynparza™ ^M (olaparib, a PARP inhibitor) to patients diagnosed with OC in addition to standard therapy. It is based on the detection of mutations in the BRCA1 and BRCA2 genes in genomic DNA obtained from whole blood samples collected in EDTA vacutainers. Single nucleotide mutations, as well as small insertions and deletions, are identified by polymerase chain reaction (PCR) and Sanger sequencing. The presence of mutations is a criterion for identifying patients in whom the appointment of a PARP inhibitor will increase the period of remission and increase the effectiveness of treatment (FDA ApprovalOrder, December 19, 2014. http://www.accessdata.fda.gov/cdrh_docs/pdf14/P140020a.pdf).

Special sections of personalized medicine - pharmacogenetics and pharmacogenomics study the hereditary factors underlying the variability of individual sensitivity to drugs (M.Whirl-Carrillo, E.M. McDonagh, J.M. Hebert, L. Gong, K. Sangkuhl, C.F. Thorn, R.B. Altmanand T.E. Klein. "PharmacogenomicsKnowledgeforPersonalizedMedicine" ClinicalPharmacology&Therapeutics (2012) 92(4): 414-417).

In 2000, an online pharmacogenomics knowledge base (PharmGKB, https://www.pharmgkb.org/ ) was created, funded by the National Institutes of Health and the US National Institute of General Medical Sciences. The main goal is to collect information on the effect of allelic variants of genes on the pharmacological response of patients. It includes the results of both large-scale multicenter genome-wide studies and individual research groups.

Based on the data currently included in this database, the genes involved in DNA repair processes, drug metabolism, and in particular , affecting the pharmacokinetics of platinum compounds, endothelial and epithelial vascular endothelial growth factors, their receptors. These are the rs11615 and rs3212986 variants of the ERCC1 and rs1799793 (ERCC2) repair genes, the rs6413432 of the CYP2E1 gene (a member of the cytochrome P450 family of enzymes that metabolize drugs), the rs1142345 of the TPMT gene (thiopurine-S-methyltransferase, xenobiotic biotransformation gene), rs1695 GSTP1 (glutathione-S-transferase, xenobiotic detoxification enzyme) [TzvetkovMV, BehrensG, O'BrienVP, HohlochK, BrockmöllerJ, BenöhrP.Pharmacogeneticanalysesofcisplatin-inducednephrotoxicityindicatearenoprotectiv eefismofERCC1. Pharmacogenomics. 2011 Oct;12(10):1417-27. doi: 10.2217/pgs.11.93; Khrunin A, Ivanova F, Moisseev A, Khokhrin D, Sleptsova Y, Gorbunova V, Limborska S. Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012 Jan;13(2):171-8. doi: 10.2217/pgs.11.140; Khrunin AV, Moisseev A, Gorbunova V, Limborska S. Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. Pharmacogenomics J. 2010 Feb;10(1):54-61. doi: 10.1038/tpj.2009.45; Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Yan L, Shu-Ying Y, Shan K, Yip BH, Rong-Miao Z, Na W, Hai-Yan S. Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012 Mar;13(4):419-27. doi: 10.2217/pgs.11.181; Lambrechts S, Lambrechts D, Despierre E, Van Nieuwenhuysen E, Smeets D, Debruyne PR, Renard V, Vroman P, Luyten D, Neven P, Amant F, Leunen K, Vergote I; Belgian and Luxembourg Gynaecological Oncology Group (BGOG). Genetic variability in drug transport, metabolism or DNA repair affecting toxicity of chemotherapy in ovarian cancer.BMC PharmacolToxicol. 2015 Feb 27;16:2. doi: 10.1186/s40360-015-0001-5; Liblab S, Vusuratana A, Areepium N. ERCC1, XRCC1, and GSTP1 Polymorphisms and Treatment Outcomes of Advanced Epithelial Ovarian Cancer Patients Treated with Platinum-based Chemotherapy. AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925] .

The results of the association of the AA rs11615 ERCC1 genotype with a poor response to treatment differ in studies conducted in European and Asian centers, which may be due to the ethnic characteristics of the examined patients.

The polymorphisms rs3795247 ZNF100, rs7950311 TRIM5, rs2549714, rs6674079[JohnattySE, TyrerJP, KarS, etal. Clinic Cancer Res. 2015 Dec 1;21(23):5264-76. doi: 10.1158/1078-0432.CCR-15-0632], rs9369421 VEGFA[He YJ, Winham SJ, Hoskins JM, Glass S, Paul J, Brown R, Motsinger-Reif A, McLeod HL. Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. Pharmacogenomics J. 2016 Jun;16(3):243-8. doi: 10.1038/tpj.2015.52]; rs1649942 NRG3 [Huang RS, Johnatty SE, et al. Platinum sensitivity-related germline polymorphism was discovered via a cell-based approach and analysis of its association with outcome in ovarian cancer patients. Clinic Cancer Res. 2011 Aug 15;17(16):5490-500. doi: 10.1158/1078-0432.CCR-11-0724], rs2849380 BCL2 [ McWhinney-Glass S, Winham SJ, Hertz DL, Yen Revollo J, Paul J, He Y, Brown R, Motsinger-Reif AA, McLeod HL; Scottish Gynaecological Clinical Trials Group. Cumulative genetic risk predicts platinum/taxane-induced neurotoxicity. Clinic Cancer Res. 2013 Oct 15;19(20):5769-76. doi: 10.1158/1078-0432.CCR-13-0774].

A known method for predicting the effectiveness of ovarian cancer treatment with cisplatin in combination with cyclophosphamide based on the determination of polymorphisms rs1142345 of the TPMT gene (thiopurine-S-methyltransferase, xenobiotic biotransformation gene) and/or rs3219484 of the MUTYH gene (mutY DNA glycosylase) (RU 2582968 C2 dated 04/27/2016). Carriers of these alleles have a significantly reduced function of enzymes involved in the metabolism of drugs and the repair of oxidative DNA damage, respectively. The criterion for the effectiveness of treatment was an increase in the time of survival without progression and / or a decrease in the risk of developing severe neutropenia. In patients, allelic variants of the rs1142345 polymorphism of the TPMT gene and/or the rs3219484 polymorphism of the MUTYH gene are determined and, depending on the allelic status of one or both of these polymorphisms, the effectiveness of cisplatin treatment is predicted. A favorable prognosis is determined by the presence in a patient of two wild-type alleles of the rs1142345 polymorphism of the TPMT gene (AA genotype) and/or a combination of wild-type and mutant alleles of the rs3219484 polymorphism of the MUTYH gene (GA genotype). The study included Russian women (104 people) aged 23-65 with epithelial ovarian cancer, regardless of the stage of the disease and the chemotherapy regimen.

The limitation of this method is the heterogeneity of the sample of patients taken into the study. 20% of patients were diagnosed with stages I and II of the disease. The early stages are in themselves a favorable prognosis. She was also treated with cisplatin plus cyclophosphamide. It is now common practice to prescribe platinum drugs with taxanes.

The effect of polymorphisms of the ERCC1, XRCC1 and GSTP1 repair genes on the effectiveness of first-line therapy for epithelial ovarian cancer is known [LiblabS, VusuratanaA, AreepiumN.ERCC1, XRCC1, andGSTP1 PolymorphismsandTreatmentOutcomesofAdvancedEpithelialOvarianCancerPatientsTreatedwithPlatinum-basedChemotherapy.AsianPacJCancerPrev. 2020 Jul 1;21(7):1925-1929. doi: 10.31557/APJCP.2020.21.7.1925]. Scientists from Thailand found that homozygotes A/AofERCC1C8092A (rs 3212986) predominate among platinum-resistant patients (75%/16.7% P=0.046) and also found an association with anemia for the A/GGSTP1 genotype (rs1695) (81.8 % vs 46.3%, p = 0.036).

In 2014, an association analysis of SNPrs698 of the ADH1C gene (alcohol dehydrogenase 1 C) was performed on the complete response of the OC tumor after treatment with platinum-containing drugs [KhruninAV, KhokhrinDV, MoisseevAA, GorbunovaVA, LimborskaSA. Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer.Pharmacogenomics. 2014 Feb;15(3):329-37. doi: 10.2217/pgs.13.237. PMID: 24533712]. The ADH1C gene encodes the gamma subunit of class 1 alcohol dehydrogenase, which metabolizes a wide range of substrates, including ethanol, retinol, hydroxysteroids, and lipid peroxidation products. A single nucleotide substitution in the 8th exon of the gene leads to an amino acid substitution (Ile350Val) and a weakening of the enzyme function. According to the authors, the CT genotype is associated with a reduced probability of a complete response in the treatment of patients with epithelial ovarian cancer with cisplatin and cyclophosphamide compared with CC+TT genotypes. Chemotherapy was performed according to the CP scheme: intravenous administration of cisplatin 100 mg/m ² + cyclophosphamide 600 mg/m ² every 3 weeks, against the background of antiemetics (dexamethasone + 5-HT3 receptor blockers) and water load. All patients underwent 6 cycles of chemotherapy. The analysis included 80 women, of whom 36 had a complete response, 32 had a partial response, 8 had stabilization, and 4 patients had progression. The study evaluated the relationship of the genetic marker with the complete response of the tumor to treatment.

A significant limitation of the work is that the groups are formed from patients with different stages of the disease. It is known that the early stages of the disease are a good prognostic factor for OC. The second limitation: chemotherapy was carried out according to the CP scheme: intravenous administration of cisplatin + cyclophosphamide. Currently, the treatment regimen based on platinum drugs and taxanes is generally accepted. The third limitation is that the group of patients included both hereditary and sporadic OC.

Of the known technical solutions, the closest in purpose and technical essence to the claimed object is a method for identifying patients diagnosed with serous adenocarcinoma of stage III and IV of the disease with an increased risk of incomplete response after the first line of adjuvant combined chemotherapy based on platinum-containing drugs, which involves determining the presence in the patient's genome allelic polymorphism of the STAT3 gene (protein product - transcription factor), which is associated with a poor response to treatment [Permuth-WeyJ, FulpWJ, ReidBM, ChenZ, GeorgeadesC, ChengJQ, MaglioccoA, ChenDT, Lancaster JM. STAT3 polymorphisms may predict an unfavorable response to first-line platinum-based therapy for women with advanced serous epithelial ovarian cancer. IntJCancer. 2016 Feb 1;138(3):612-9. doi: 10.1002/ijc.29799]. Two groups were compared depending on the response to the first line of therapy. A complete response (361 women) meant the disappearance of all symptoms of the disease when examined 4 weeks after the end of treatment. The second group with incomplete response (102 women) included patients with partial tumor regression, stabilization and progression of the disease. For each SNP, a logistic regression model was applied to predict the likelihood of a poor response to treatment. The most significant association was shown for rs 62075772 [OR (95% CI): 2.42 (1.47-3.98), p = 0.0005] of the STAT3 gene (protein product - transcription factor). Carriers of the genotypes of the minor G allele (GA+GG), who were diagnosed with stages III and IV of the disease, had a lower probability of a complete response compared to homozygous carriers of the major AA allele (p=0.08). The authors conclude that the STAT3 genotype identifies patients at increased risk of incomplete response who would benefit from the novel therapeutic combination with a STAT3 inhibitor.

However, patients who received neoadjuvant therapy were excluded from the analysis. Sporadic cancers were not isolated from hereditary ones, APOE polymorphism was not taken into account.

Despite the fact that a lot of knowledge has been accumulated about the polymorphic variants of genes that affect the effectiveness of the treatment of ovarian cancer (OC) with platinum-containing drugs in combination with taxanes, today, before the start of treatment, it is impossible to give an accurate individual prediction of the effectiveness of the first line of standard therapy for sporadic OC, and in In clinical practice, there are no tests to identify predictive markers based on pharmacogenetic developments to predict what an individual's response to standard first-line therapy will be.

Our experience allows us to determine the risk of a negative response (stabilization or progression) or positive (complete response, partial response) to the first line of therapy in patients with advanced OC based on the determination of polymorphic variants of metabolism genes by polymerase chain reaction followed by determination of the lengths of amplicon restriction fragments (PCR). /RFLP analysis). ( Kondrashova TV, Neriishi K, Ban S, Ivanova TI, Krikunova LI, Shentereva NI, Smirnova IA, Zharikova IA, Konova MV, Taira S, Tsyb AF. Frequency of hemochromatosis gene (HFE) mutations in Russian healthy women and patients with estrogen dependent cancers. BiochimBiophysActa. 2006 Jan;1762(1):59-65; Ivanova TI, Krikunova LI, Ryabchenko NI, et al. Association of the apolipoprotein E 2 allele with concurrent occurrence of endometrial hyperplasia and endometrial carcinoma. Oxidative Medicine and Cellular Longevity. - 2015. - Vol. 2015. - P. e 593658; Ivanova T.I., Sychenkova N.I., Horohorina V.A., Ryabchenko N.I., Ivanov S.A., Krikunova L.I. Allele Association E4 (rs429358) of the apolipoprotein E (APOE) gene with serous ovarian adenocarcinoma // Problems of Oncology 2017. V.63. I., Mkrtchyan L.S., Khorokhorina V.A., Iontseva S.A. Method for determining the risk of developing uterine cancer Patent for invention No. 2558059. 27.07.2015. (Bulletin No. 21); T.I. Ivanova , AL Potapov, DV Zemskova, VA Khorokhorina, PV Shegai, SA Ivanov, and AD Kaprin. Evaluation of the association of rs4680 COMT polymorphism and clinical parameters of the tumor in colorectal cancer (a Pilot Study). Bull Exp Biol Med. 2020. V. 170. No. 2. P. 254-257; Ivanova T. I., Sychenkova N. I., Khorokhorina V. A., Shinkarkina A. P., Konova M. V., Murzaeva A. V., Krikunova L. I., Shegay P. V., Ivanov S. .BUT. rs429358 APOE polymorphism in patients diagnosed with ovarian cancer. Database No. 2020621162 dated 07/08/2020; Ivanova T. I., Sychenkova N. I., Khorokhorina V. A., Shinkarkina A. P., Murzaeva A. V., Krikunova L. I., Shegay P. V., Ivanov S. A. rs7412 APOE polymorphism in patients diagnosed with ovarian cancer. Database No. 2020621180 dated 07/10/2020].

In accordance with our data, it was found that in patients diagnosed with advanced OC, who do not have common mutations in the BRCA1/2 genes, and have any of the genotypes in which the APOE -ε4(ε4/ε4; ε3/ε4; ε2/ ε4), predict a high probability of a negative response to the first line of combined chemotherapy. It is known that apolipoprotein E (APOE) is a plasma lipoprotein with a wide spectrum of action: it regulates the metabolism of lipids, cholesterol, the functions of macrophages, affects the proliferation of T-cells, modulates inflammatory and oxidative processes, and participates in the processes of carcinogenesis. Shown expression in many tissues, including ovaries and macrophages, and the level of expression is significantly increased in cells of malignant tumors [Huang Y, Mahley RW. Apolipoprotein E: structure and function in lipid metabolism, neurobiology, and Alzheimer's diseases. Neurobiol Dis. 2014 Dec;72 Pt A:3-12. doi: 10.1016/j.nbd.2014.08.025; The Human Protein Atlas. https://www.proteinatlas.org/search/APOE]. It has been shown that APOE expression is associated with changes in the Notch signaling pathway genes, which play an important role both in the development and in response to treatment in patients with advanced OC [US Preventive Services Task Force, Grossman DC, Curry SJ, Owens DK, Barry MJ, Davidson KW, Doubeni CA, Epling JW Jr, Kemper AR, Krist AH, Kurth AE, Landefeld CS, Mangione CM, Phipps MG, Silverstein M, Simon MA, Tseng CW. Screening for Ovarian Cancer: US Preventive Services Task Force Recommendation Statement. JAMA. 2018 Feb 13;319(6):588-594. doi: 10.1001/jama.2017.21926].

Variants of the APOE gene are defined by two single nucleotide polymorphisms (SNPs): rs429358 and rs7412, and are known as the ε2, ε3, and ε4 alleles, which define 6 genotypes: ε3ε3, ε3ε4, ε2ε3, ε2ε4, ε4ε4, and ε2ε2. The most common variant is the ε3 allele. The ε4 haplotype is characterized by joint positions of arginines 158 and 112 in the amino acid sequence of the APOE protein, due to single nucleotide polymorphism (SNP rs429358) in the corresponding codon: T (thymine) or C (cytosine). Genotype T/T - reference, T/C - heterozygous, C/C - homozygous genotype for the minor allele.

The technical result of the invention is to evaluate the prognosis of tumor response to combined CT for patients with sporadic OC stages III and IV and the choice of optimal treatment tactics based on the identification of a genetic marker.

The technical result is achieved by the fact that, as in the known method, in patients with epithelial OC III and IV stages, genomic DNA is isolated to predict a negative or positive response, gene polymorphism is detected and

determine the response after the first line of combined chemotherapy with platinum-containing drugs.

A feature of the invention is that in patients with sporadic OC (negative status of BRCA mutations), polymorphic alleles APOE-ε2, APOE-ε3, APOE-ε4 are detected before treatment, and if the genotype contains:

- APOE-ε4 allele, then a negative response to the first line of combined chemotherapy is predicted;

- APOE-ε3ε3 allele, then a positive response to the first line of combined chemotherapy is predicted.

The novelty and inventive level of this invention lies in the fact that in the prior art there is no information on how to determine the response of patients to the first line of combined chemotherapy (platinum-containing drugs, taxanes, cytoreduction) of sporadic ovarian cancer, based on the determination of genotypes carrying the alleles ε3, ε4, ε2 APOE gene.

The invention is illustrated by a detailed description, a clinical example and illustrations, which show:

Figure 1 - alleles ε3, ε4, ε2 of the APOE gene.

Figure 2 - distribution of genotypes containing the ε4 allele (C/C+T/C) and without it (T/T) among patients who responded and did not respond to the first line of combined CT of sporadic OC.

Fig. 3 - frequency of individuals with APOE genotypes (ε4+ containing allele and ε4- without allele) in groups with negative (Stab+Progression) and overall response (PO+PR).

Fig. 4 - distribution of APOE-ε3ε3 genotypes among patients with sporadic OC according to the type of tumor response to the first line of combined chemotherapy in combination with suboptimal and non-optimal cytoreduction.

The method is carried out as follows.

In patients with advanced OC, peripheral blood is taken. Blood samples are taken into evacuators with ethylenediamineacetic potassium salt (K2EDTA) and stored at minus 20°C. Genomic DNA was isolated using the WizardGenomic DNA PurificationKit (Promega) according to the manufacturer's protocol. To determine the concentration of the isolated DNA, a NanoDrop1000 spectrophotometer is used. The criterion for the good quality of purification of the isolated DNA is the value of A260/A280 = 1.8 (absorbance ratio at wavelengths of 260 and 280 nm).

Mutations are determined by the 8 most common points: 5382insC,

4154delA,

300T>G (C61G),

185 del AG,

3819delGTAA,

3875delGTCT,

2080delA of the BRCA1 gene,

6174 delTBRCA2.

The study is carried out by allele-specific real-time PCR using Biolink kits, on a ''StepOnePlus'' amplifier (AppliedBiosystems, USA). Sanger sequencing is used to verify positive samples.

APOE genotyping is carried out using polymerase chain reaction (PCR) followed by treatment with a specific restriction enzyme (Cfo 1) and determination of the lengths of PCR/RFLP restriction fragments. In the PCR reaction, 25 µl of the reaction mixture consisting of 50 ng of DNA, 0.5 µmol of each primer (forward primer GAGACGCGGGCACGGCTGTCC; reverse primer GCACGCGGCCCTGTTCCACC, http://genome.cse.ucsc.edu/), 0.2 mmol of deoxynucleotide triphosphates, 0.2 U per HotStarTag Polymerase reaction (Qiagen) with 1X buffer and Q-buffer (Qiagen).

Amplification program (MastercyclerNexus thermal cycler, Eppendorf):

95°C - 15 min

94°C - 30 s

67°C - 30 s

72°C - 1 min

2 to 4 29 cycles

72°C - 10 min

APOE amplicons (310 bp) were digested with Cfo1 (Promega). Replacing T (thymine) with C (cytosine) leads to the formation of a restriction site:

5'…G CG↓C…3'

3'…C↑GC G…5'

Digestion is carried out at 37°C for 5 hours in a volume of 10 μl of the reaction mixture containing 4 μl of amplicon, 1 μl x10 buffer B (Promega), 1 μg of BSA, 1 U of CfoI enzyme. The restriction products were fractionated by electrophoresis in 8% polyacrylamide gel.

The APOE -ε4 allele has 5 bands corresponding to 72, 48, 39, 35 and 32 base pairs. The APOE-ε2 allele on the electropherogram has 4 bands corresponding to 91, 83, 39 and 32 base pairs. The APOE-ε3 allele is characterized by 5 bands corresponding to 91, 49, 39, 36 and 32 base pairs (FIG. 2). Then, according to the combination of alleles, genotypes are determined in women with advanced OC, which are used to judge the degree of risk of a poor response to the first line of combined chemotherapy.

The first line of combined chemotherapy (6 cycles) was performed with primary or interval cytoreduction according to the scheme: paclitaxel 175 mg/m ² IV infusion, carboplatin AUC 5-6 IV on day 1 of a 21-day course, or paclitaxel 175 mg /m ² IV, cisplatin 60 mg/m ² IV on the 1st day of the 21-day course.

After the first line chemotherapy (6 cycles), the objective effect was evaluated according to the RECIST1.1 criteria (ResponseEvaluationCriteriaInSolidTumors).

The study is carried out by comparing the frequencies of genotypes and alleles between groups with an overall response to treatment (complete response + partial response) and with a poor response (stabilization + progression) in patients with confirmed negative mutation status for the 8 most common points of the BRCA1 and BRCA 2 genes in Russia .

Statistical analysis is carried out by standard methods using the WinSTAT 2003.1 software package integrated into Excel, SnpstatsSoft (http://bioinfo.iconcologia.net/snpstats/start.htm) and MedCalc, version 14.8.1. When comparing genotype frequencies, Fisher's exact two-tailed test was used. Logistic regression analysis was performed to elucidate the relationship between primary response to treatment and the APOE-ε4 (C) allelic variant. Using ROC (ReceiverOperatorCharacteristic) analysis, the predictive value of parameters associated with poor response to treatment is assessed. Determine the indicator of prognostic efficiency AUC (AreaUnderCurve) - the area under the ROC curve. A value of 0.5 demonstrates the unsuitability of the potential marker.

The prognostic significance of the APOE -ε4(C) allele and the ε3ε3 genotype is also assessed by the odds ratio (OR) - a criterion that reflects the degree of conjugation of signs at a 95% confidence interval (CI).

At OR=1, there is no relationship between genotype and response to treatment. When OR>1, the genetic marker is associated with an adverse response. At OR<1, the marker is associated with a positive response to the first line of therapy.

Examples of the implementation of the method.

Example 1. Determination of the predictive value of the APOE-ε4 allele and genotypes carrying the APOE-ε4 (C) allele in assessing the increased risk of an adverse response to first-line therapy among patients with sporadic advanced OC.

An increased chance of an unfavorable response to OC treatment is determined by genotypes carrying the APOE-ε4 allele rs429358, C112Arg: E4/E3, or E4/E4, or E2/E4 of the APOE gene.

The possibility of using the proposed method to determine the prognosis of an increased risk of a negative response to the first line of combined CT with primary or interval cytoreduction among patients with advanced sporadic OC is confirmed by the analysis of the results of observations of 136 patients aged 17 to 72 years (median 56 years). According to the biopsy data, advanced OC of stage III and IV according to the FIGO (International Federation of Gynecology & Obstetrics) classification was diagnosed for all patients, and the negative status was confirmed for 8 BRCA1/2 gene mutations common in Russia. The vast majority were epithelial cancers (98.5%, 134 people), among which was serous adenocarcinoma (93%, 127 people). The first line of combined chemotherapy (6-8 courses) was carried out with primary or interval cytoreduction according to the scheme: paclitaxel 175 mg/m ² IV infusion, carboplatin AUC 5-6 IV on the 1st day of a 21-day course, or paclitaxel 175 mg/m ² IV, cisplatin 60 mg/m ² IV on day 1 of a 21-day course.

When examined 4 weeks after the course of chemotherapy, the group that showed an overall response to treatment (complete response + partial response) included 99 people (mean age ± standard deviation: 53.4 ± 11.08 years), with an unfavorable response (stabilization + progression - 37 patients (mean age ± SD: 54.8 ± 14.42). Treatment efficacy was assessed by the criteria for evaluating the effect in solid tumors (RECIST: Response Evaluation Criteria In Solid Tumors) based on data from CT, or MRI, or ultrasound, as well as by increasing the level marker CA125.

For a complete response, the disappearance of all measured foci was taken, for an incomplete response - a decrease by 30% of the sum of the largest diameters of the measured foci, for the progression of the disease - an increase by 20% of the sum of the largest diameters of the measured foci. If the changes did not meet any of the listed criteria, then the stabilization of the disease was determined.

The groups did not differ significantly in age (P = 0.298; two-tailed Mann-Whitney test). Frequencies were determined by ε2/ε3/ε4 haplotype of mapolypoprotein E (APOE). The study was conducted by comparing the frequencies of genotypes and alleles between groups with an overall response to treatment (complete response + partial response) and with an unfavorable response (stabilization + progression). When comparing genotype frequencies, Fisher's exact two-tailed test was used. The distribution of genotypes carrying the APOE -ε4 (C) allele among patients who responded and did not respond to the first line of combined chemotherapy in sporadic OC is shown in Table 1 (Fig. 2, Fig. 3). The T allele is used as the reference allele.

Table 1.
Distribution of genotypes with the APOE -ε4 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy Clinical indicators APOE E2/E3/E4 genotypes, rs429358 (T/C) genotypes 4/4+3/4+2/4
T/C+C/C
Number of genotypes (%) 3/3+2/3+2/2
T/T
Number of genotypes (%) Stabilization + Progression 15(11.11%) 22(16.30%) Age (mean ± standard deviation) 53.6±16.41 56.59±12.95 Full answer + Partial answer 18(13.33%) 80(59.26%) Age (mean ± standard deviation) 56.68±8.38 52.95±11.63

Indicators of predictive efficiency of genotypes carrying the APOE -ε4 allele are shown in Table 2.

Table 2.
Indicators of predictive efficiency of genotypes carrying the APOE -ε4 allele Stabilization+
Progression
Number of genotypes (%) Full Answer+
Partial answer
Number of gentypes (%) R OR(95% confidence interval) Sensitivity (95% CI) Specificity (95% CI) 15 (40.5%) 18(18%) 0.0126 3.03 (1.32 - 6.88) 45% (0.298-0.620) 78% (0.695- 0.853)

The distribution of the APOE -ε4 allele among patients who responded and did not respond to the first line of combined CT in sporadic OC is shown in Table 3, and Table 4 shows the indicators of the predictive effectiveness of the APOE -ε4 allele (C).

Table 3
Distribution of the APOE -ε4 (C) allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy Clinical indicators APOE rs429358 alleles (T/C) Number of alleles (%) С Number of alleles (%) T Stabilization + Progression 16(6%) 58(21%) Full answer+Partial answer 19(7%) 177(66%)

Table 4

Indicators of predictive efficiency of the APOE -ε4 allele (C)

Stabilization+
Progression
Number of alleles (%) Full Answer+
Partial answer
Number of alleles (%) R OR95% Confidence interval Sensitivity 95% Confidence interval Specificity 95% Confidence interval 16 (21.62%) 19(9.69%) 0.014 2.57
1.243 - 5.122 46%
0.305-0.618 75%
0.696-0.804

Findings.

In advanced sporadic OC, the APOE -ε4 (C) rs429358 allele is significantly associated with an unfavorable response to first-line combined chemotherapy (P=0.014), the chance of a negative response increased by 2.57 times (OR=2.57; 95% CI [1.243 - 5.122]).

In advanced sporadic OC, APOE genotypes 4/4+3/4+2/4 (T/C+C/C) are significantly (P=0.0126) associated with an unfavorable response to first-line treatment, the chance of a poor response is increased by 3 times (OR=3.03; 95% CI [1.32 - 6.88]).

Example 2. Determination of the predictive value of genotypes carrying the APOE -ε2 allele (rs7412, T) in assessing the increased risk of an adverse response to first-line therapy among patients with sporadic advanced OC.

The number of patients with APOE genotypes carrying the ε2 allele was 19 (14%). Most individuals did not have this allele (117 people). The groups did not differ significantly in age (P=0.66, Kruskall-Wallace test).

The distribution of genotypes with the APOE -ε2 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy is shown in Table 5. The frequency of patients with the ε2 allele in groups with a poor and positive response is the same and amounted to 14% (5/37 and 14/99) (Table 6), the differences are not statistically significant (P>0.999).

Table5.
Distribution of genotypes with the APOE -ε2 allele in groups of patients with advanced sporadic OC who gave an overall response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy Clinical indicators APOE E2/E3/E4 genotypes, rs7412 (T/C) genotypes 2/3+2/4+2/2
S/T+T/T
Number of genotypes (%) 3/3+3/4+4/4
S/S
Number of genotypes (%) Stabilization + Progression 5(4%) 32(23.5%) Age (mean±standard deviation) 47.8±26.59 56.56±11.66 Full answer+Partial answer 14(10%) 85(62.5%) Age (mean±standard deviation) 52.79±10.91 53.81±11.24

Table 6
Association indicators of genotypes carrying the APOE -ε2 allele with response to first-line combination chemotherapy treatment Stabilization+
Progression
Number of genotypes (%) Full Answer+
Partial answer
Number of gentypes (%) R OR
(95% Confidence interval) 5 (14%) 14(14%) >0.999 0.95
(0.35 - 2.83)

Conclusion. Genotypes with the APOE ε2 allele are not associated with the tumor response to the first line of combined chemotherapy and are not an appropriate marker.

Example 3. Results of applying logistic regression to determine the probability of predicting a primary response by the presence of the APOE ε4 allele. The dependent variable is the primary response to treatment: overall response (complete regression + partial regression) or negative response (stabilization + progression).

Among the examined patients with OC with III and IV stages of the disease, the status of cytoreduction was known for 95 people: among those who had a poor primary response, non-optimal surgery was performed in 8 people, suboptimal - in 9 and optimal - in 1 patient. In the group with an overall response, a suboptimal operation was performed in 4 women, in 34 - optimal, and in 39 - suboptimal. The amount of cytoreduction performed is a known prognostic factor for OC. When assessing the volume of primary cytoreduction, the one in which the remaining maximum tumor size does not exceed 1 cm is considered optimal; suboptimal cytoreduction corresponded to the size of the remaining tumor masses of 1-2 cm, and in case of excess of 2 cm, the volume of the operation was considered suboptimal. Logistic regression analysis on the -2 Log Likelihood model with predictors APOE ε4 (1 or 0) and type of cytoreduction (0,1,2) revealed a statistically significant increased probability of an unfavorable response in carriers of the APOE ε4 allele. The results of the logistic regression are presented in table 7. With an AUC (area under the ROC curve, AreaUnderCurve) of 0.839, the test has a high predictive value. The AUC for only one predictor (type of cytoreduction) is less than 0.770. In ROC analysis, it is generally accepted that the marker is a good classifier with an AUC greater than 7.

Table 7
The results of applying logistic regression to identify the probability of predicting the primary response when two predictors are taken into account: the presence of the APOE ε4 allele and the type of cytoreduction
(optimal, suboptimal and suboptimal) predictor Odds Constant AUC
95% CI Correct Prediction OR 95% CI Significance level for the predictor Significance level for the model APOE ε4 1.612 -4.305 0.839
0.750-0.907 84% 5.01
1.50-16.70 0.0087 <0.0001 Type of cytoreduction 2.224 9.24
2.73-31.25 0.0003 Stage Not included in the model >0.05

Note: OR odds ratio, CI confidence interval.

The equation of the model is derived, with the help of which the probability of an unfavorable response (P) is calculated, focusing on the presence or absence of the APOE ε4 allele and the type of cytoreduction:

P=

P=

+ коэффициент

циторедукцияA =logit(p)= constant + factor

+ coefficient

cytoreduction

For carriers of the APOE ε4 allele who underwent a suboptimal operation, the probability of a negative primary response is 0.85. In individuals lacking this allele, the probability of a poor response is 0.53.

With suboptimal cytoreduction, the probability of a negative primary response for carriers of APOEε4 is four times higher compared to those who do not have this allele, and is equal to 0.39 and 0.11, respectively. In the case of an optimal operation, the probability of a poor response in APOE ε4 carriers is 0.07 and 0.01 in those individuals who do not have it.

Findings. The APOE ε4 allele increases the prognostic value of the model for predicting the primary negative response in combined CT in combination with suboptimal and suboptimal cytoreduction. In terms of AUC (0.839), the test has a high predictive value.

Example 4

Analysis of the distribution of the APOE -ε3ε3 genotype among patients with widespread sporadic OC who showed a response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy , in whom the operation was performed in a suboptimal or non-optimal mode.

The possibility of using the proposed method to determine the prognosis of a positive response to the first line of combined CT with primary or interval cytoreduction among patients with advanced sporadic OC is confirmed by the analysis of the results of observations of 59 patients aged 22 to 72 years (median 56 years). An analysis was made of the significance of APOE polymorphism in response to first-line treatment in a group of patients with sporadic advanced OC, in whom the operation was performed in a suboptimal or non-optimal mode. The proportion of patients who underwent suboptimal cytoreduction was 19% (11/59). The distribution of the reference APOE genotype -ε3ε3 and the remaining five genotypes (ε2ε3+ε2ε2+ε3ε4+ε4ε4+ε2ε4) in two subgroups of patients depending on the type of tumor response was studied: overall response (complete response + partial response) and negative response (stabilization + progression) . The data are shown in tables 3 and 4. Among the carriers of the APOE -ε3ε3 genotypes, the number of the group with a general response was more than five times greater than the number of individuals with a negative response. The proportions of patients with the APOE -ε3ε3 genotype were 67% (28/42) in the overall response group and 29% (5/17) in the negative response group (Table 8). Differences in the distribution of genotypes between groups are statistically significant (P=0.0203). Figure 4 shows a greater number of APOE -ε3ε3 genotypes among patients with sporadic OC who showed an overall tumor response to first line combined chemotherapy in combination with suboptimal and suboptimal cytoreduction.

Table 8
Distribution of the APOE -ε3ε3 genotype among patients with advanced sporadic OC who showed a response (complete tumor regression + partial regression) and did not respond (progression + stabilization) to the first line of chemotherapy Type of response to treatment APOE ε2/ε3/ε4 genotypes 3/3
Number of genotypes (%) 2/3+2/2+2/4+4/4+3/4
Number of genotypes (%) Full answer+Partial answer 28 (66.67) 14 (33.33) Stabilization + Progression 5 (29.41) 12(70.59)

Table 9 shows the indicators of predictive efficacy of the APOE -ε3ε3 genotype in relation to a favorable response to treatment of first-line chemotherapy in sporadic OC in patients with stages III and IV with suboptimal and non-optimal cytoreduction.

Table 9
Indicators of predictive efficiency of the APOE genotype -ε3ε3 Full Answer+
Partial answer
Number of gentypes (proportion among persons of this category) Stabilization+
Progression
Number of genotypes (proportion among individuals of this category) R OR (95% Confidence Interval) Sensitivity (95% CI) Specificity (95% CI) 28(67%) 5 (29%) 0.019 0.208
(0.067-0.718) 85%
(0.691-0.934) 46%
(0.288- 0.645)

Conclusion: A favorable response of a malignant ovarian tumor to the first line of combined chemotherapy in combination with suboptimal and suboptimal cytoreduction is determined by the presence of two ε3 APOE alleles in the patient. The APOE -ε3ε3 genotype has an almost 5-fold higher chance of a positive response to treatment compared to other APOE genotypes (95% CI: 1.32 - 13.74).

Example 5

The results of applying logistic regression to identify the probability of predicting the primary response by the presence of APOE ε3ε3 genotypes. The dependent variable is the primary response to treatment: overall response (complete regression + partial regression) or negative response (stabilization + progression).

Among the examined patients with a diagnosis of OC III and IV stages of the disease for 95 people, the status of cytoreduction is known. The amount of cytoreduction performed is a known prognostic factor for OC. When assessing the volume of primary cytoreduction, the one in which the remaining maximum tumor size does not exceed 1 cm is considered optimal; suboptimal cytoreduction corresponded to the size of the remaining tumor masses of 1-2 cm, and in case of excess of 2 cm, the volume of the operation was considered suboptimal. Logistic regression analysis on the -2 Log Likelihood model with predictors APOE ε3ε3 (1 or 0) and type of cytoreduction (0,1,2) revealed a statistically significant increased probability of a positive response in carriers of the APOE ε3ε3 genotype. The results of the logistic regression are presented in table 10. With an AUC (area under the ROC curve, AreaUnderCurve) of 0.859, the test has a high predictive value.

Table 10
The results of applying logistic regression to identify the probability of predicting the primary response when taking into account two predictors: the presence of the APOE ε3ε3 genotype and the type of cytoreduction (optimal, suboptimal and non-optimal) predictor coefficient
patients Constant AUC
95% CI Correct Prediction OR 95% CI Significance level for the predictor Significance level for the model APOE ε3ε3 -2.2968 -2.8264 0.859
0.773-0.922 85.26% 0.101
0.023-0.437 0.002 <0.0001 Type of cytoreduction 2.4483 11.57
2.939-45.537 0.0005 Stage Not included in the model >0.05

Note: OR odds ratio, CI confidence interval.

An equation of the model is derived, with the help of which the probability of an unfavorable response (P) is calculated, focusing on the presence or absence of the APOE ε3ε3 genotype and the type of cytoreduction.

P=

P=

+ коэффициент

циторедукцияA =logit(p)= constant + factor

+ factor

cytoreduction

For carriers of the APOE ε3ε3 genotype who underwent a suboptimal operation, the probability of a negative primary response is 0.44. In individuals who do not have this genotype, the probability of an adverse response is twice as high and equal to 0.89.

With suboptimal cytoreduction, the probability of an unfavorable primary response for carriers of APOEε3ε3 is almost 6 times lower compared to those who do not have this genotype, and is equal to 0.07 and 0.40, respectively. In the case of an optimal operation, the probability of a negative response in carriers of the APOE ε3ε3 genotype is less than 0.01, and in those who do not have it, it is 0.05.

Findings. The APOE ε3ε3 genotype reduces the probability of an unfavorable prognosis of the primary response of a malignant ovarian tumor after the first line of combined chemotherapy with cytoreduction and increases the prognostic value of the model for predicting the primary response in combined chemotherapy. In terms of AUC (0.859), the test has a high predictive value.

Confirmation of achievement of the technical result

The method presented by us in comparison with the prototype allows us to expand the prognosis of a negative response to the first line of adjuvant and neoadjuvant combined chemotherapy with cytoreduction in patients with advanced OC.

The obtained result was confirmed by observations of 136 women with sporadic advanced OC III and IV stages according to FIGO classification, among which 37 people had a negative response (Stabilization + Progression) and 99 had an overall response (Partial + Complete response).

Comparison of the results of the analysis of genetic indicators for assessing the development of response to the first line of therapy according to the proposed method and the prototype shows the effectiveness of the APOE -ε4 allele in predicting a negative response, and the ε3ε3 genotype in predicting a positive response for patients with sporadic OC stage III and IV, who underwent combined neoadjuvant or adjuvant chemotherapy with taxanes and platinum-containing drugs.

In the group of patients with a negative response to treatment, the level of significance of the excess frequency of the APOE -ε4 allele compared to the group of individuals who showed a general response to chemotherapy is high (P = 0.0162), and the chance of a poor response in carriers of the APOE -ε4 genotypes is increased almost 3 times (OR=2.87; 95% CI 1.27 - 6.40) (Example 1. Tables 1-4, Fig. 2, 3). This indicates a significant association of the APOE -ε4 allele with a negative response to combined chemotherapy in adjuvant and neoadjuvant regimens and its role in the absence of a positive response to first-line combined chemotherapy. Examples 1 and 3 prove that the proposed method in the treatment of sporadic advanced OC predicts the development of an unfavorable response to combined chemotherapy in adjuvant and neoadjuvant modes. Among the carriers of the APOE -ε3ε3 genotypes, the number of the group with a common response was more than five times greater than the number of individuals with a negative response. Differences in the distribution of genotypes between groups are statistically significant (P = 0.0203), the chance of a positive prognosis of response to treatment is 4.8 times higher compared with other APOE genotypes (95% CI: 1.32 - 13.74). Examples 4 and 5 prove that the proposed method in the treatment of sporadic advanced OC predicts the development of a general response to combined chemotherapy in combination with suboptimal and non-optimal cytoreduction.

Clinical examples.

Example 1

Patient A., aged 55, was admitted to the gynecological department of the MRRC named after. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IV ast, with T3cN0M1a Ascites. Peritoneal carcinomatosis. Hydrothorax on the left.

Upon admission, the patient was examined: CA 125 - 17353.5 U/ml. SKT: formation of the left ovary up to 9 cm in diameter. CT - signs of carcinomatosis of the peritoneum of the small pelvis, infiltration of the greater omentum. Ascites. Fluid in the left pleural cavity.

The department provided combined treatment (3 courses of PCT + surgical treatment + 3 courses of PCT). At the first stage, 3 courses of neoadjuvant PCT were performed, followed by interval cytoreductive surgery (laparotomy: extirpation of the uterus with appendages, omentectomy, pelvic peritonectomy. Residual tumor > 2 cm).

Histological conclusion - in the left ovary there is an invasive growth of high grade serous adenocarcinoma with signs of therapeutic pathomorphosis of the 1st degree according to G.A. Lavnikova. On the surface of the fallopian tubes, the body of the uterus with germination in the parameters and thickness of the myometrium and on the surface of the peritoneum, the growth of serous adenocarcinoma. In the greater omentum, invasive growth of serous adenocarcinoma.

After the operation, 3 courses of adjuvant PCT were performed. Chemotherapy was carried out according to the scheme: paclitaxel 175 mg/m ² on the 1st day + cisplatin 60 mg/m ² on the 1st day; cycle 21 days.

The patient was found to be BRCA negative and APOE ε3ε4 genotype. Carrying the ε4 allele indicates a high risk of incomplete response. Based on this, the woman is included in the risk group for incomplete response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.

After completion of treatment, CA 125 - 72.5 U / ml. According to the CT scan, the formations on the peritoneum were of the same size.

Conclusion: stabilization.

Example 2

Patient B., 34 years old, was admitted to the gynecological department of the MRRC. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IVb st. cT3cN0M1b. Metastatic liver disease. Ascites.

Examination revealed an increase in tumor markers CA 125 -1000 U/ml. MRI of the pelvic organs revealed cystic-solid formations of both ovaries up to 6 cm, effusion in the small pelvis, carcinomatosis of the peritoneum of the small pelvis. According to PET-metastatic lesion of the peritoneum with damage to the parenchyma of the left lobe of the liver up to 3 cm.

Combined treatment (surgical treatment + 6 courses of chemotherapy) was carried out. Cytoreductive operation was performed in volume: extirpation of the uterus with appendages, omentectomy, pelvic perionectomy. Residual tumor >2 cm. Subsequently, 6 courses of adjuvant PCT were performed according to the scheme: Paclitaxel 175 mg/m ² on the 1st day + cisplatin 60 mg/m ² on the 1st day; cycle 21 days.

Histological conclusion: invasive growth of high grade serous adenocarcinoma in both ovaries; in the greater omentum, peritoneum - high grade serous adenocarcinoma.

The woman was found to be BRCA negative and APOE ε3ε3 genotype. The presence of the homozygous APOE ε3ε3 genotype indicates a high probability of a positive response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.

When examined after 4 weeks: CA 125 - 34.51 U / ml. According to MRI and CT scans, there are no signs of a tumor lesion of the pelvic organs.

The conclusion is a complete regression.

Example 3

Patient G, 57 years old, was admitted to the gynecological department of the MRRC. A.F. Tsyba - Branch of the Federal State Budgetary Institution "NMITs Radiology" of the Ministry of Health of Russia with a diagnosis of Ovarian cancer IVb st. cT3N0M1b. Ascites Carcinomatosis of the peritoneum. Metastatic lesion of the greater omentum and anterior abdominal wall. Metastases in the right lung. Exudative pleurisy.

CA 125 - 3210 U\ml. SKT - focal lesion of the lower lobe of the right lung, fluid in the pleural cavities. MRI of the pelvic organs - the formation of both ovaries, peritoneal carcinomatosis, metastatic lesion of the greater omentum.

The department carried out combined treatment (4 cycles of PCT + surgery + 2 cycles of PCT). PCT regimen: paclitaxel 175 mg/m + carboplatin 6 AUC on day 1; cycle 21 days. Surgical treatment was performed in the following volume: laparotomy, cytoreductive operation, extirpation of the uterus with appendages, omentectomy. Residual tumor > 2 cm.

Histological conclusion: in the ovaries, the greater omentum invasive growth of high grade serous adenocarcinoma.

After the 6th course, the patient showed progression of the disease against the background of PCT. An increase in tumor markers, an increase in ascites, exudative pleurisy, and an increase in metastatic foci on the peritoneum were noted.

The woman had a negative BRCA status and the APOE ε3ε4 genotype. Carriage of the ε4 allele indicates a high risk of incomplete response, so the patient is included in the risk group for incomplete response to the first line of combined chemotherapy. Evaluation of an objective response confirmed the prediction.

Conclusion: disease progression.

Thus, the predictive indicators of the APOE -ε4 (C) rs429358 allele and the ε3ε3 genotype according to the proposed method are quite high and significant, which proves the possibility of its application to identify individuals with an increased chance of a negative response to combined chemotherapy in adjuvant and neoadjuvant patients with sporadic advanced OC. mode.

The proposed method allows you to quickly obtain in a non-invasive way a significant criterion for assessing the prognosis of the risk of developing a negative response to combined chemotherapy in adjuvant and neoadjuvant modes for patients with sporadic advanced OC, which is a useful addition to the diagnostic complex for screening patients in the preoperative period and individualizes the approach to treating patients RY.

Claims (3)

A method for assessing the primary response to ongoing combined chemotherapy of stage III and IV sporadic ovarian cancer, including the first-line combined chemotherapy with platinum-containing drugs with the isolation of genomic DNA and the determination of gene polymorphism, characterized in that polymorphic alleles APOE - ɛ2, APOE - ɛ3 are detected before treatment, APOE - ɛ4, and if the genotype contains: allele APOE - ɛ4, then a negative response to the first line of combined chemotherapy is predicted; APOE allele - ɛ3ɛ3 , then a positive response to the first line of combined chemotherapy is predicted.

Images