RU2748380C1 - SET OF OLIGONUCLEOTIDE PRIMERS AND METHOD FOR GENOTYPING SINGLE NUCLEOTIDE POLYMORPHISM rs8065080 IN HUMAN TRPV1 GENE - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: technical solution relates to the field of biotechnology. The essence is a set of 3 primers for the determination of SNP rs8065080 in the TRPV1 gene, which have the activity of forward and reverse primers in the polymerase chain reaction and have the following structureForward1: 5’-TGTGCCGTTTCATGTTTGTCTTCG-3̓ (24 n.)Forward2: 5’-CTGTGCCGTTTCATGTTTGTCTTCA-3’ (25 n.)Reverse: 5’-TGAGGTAGGAGAATTGCTTGAACC-3’ (24 n.)Method for genotyping a single nucleotide polymorphism rs8065080 in the human TRPV1 1 gene, which consists in preparing reaction mixtures 1 and 2, containing components for carrying out the PCR reaction, to carry out AC-PCR, then the Forward1 primer and the Reverse primer according to claim 1 are added to the reaction mixture 1 , then the Forward2 primer and the Reverse primer according to claim 1 are added to the reaction mixture 2, then the analyzed DNA is added to the reaction mixture 1 and the reaction mixture 2, then the AC-PCR reaction is carried out for the reaction mixture 1 and the reaction mixture 2 according to the following program: 94°C – 3 minutes; further 33 cycles: 94°C – 30 sec, 64°C – 10 sec, 72°C – 20 sec; further 72°C – 2 min; then 4°С – ∞, at this the AC-PCR reaction is completed; then the amplification products are separated by electrophoresis in 1.5% agarose gel, then DNA is visualized by staining with ethidium bromide and subsequent UV irradiation. Identification of the rs8065080 single nucleotide polymorphism in the TRPV1 gene is a promising method for stratification of patients with a wide range of conditions accompanied by pain, such as various types of migraine, osteoarthritis, postherpetic neuralgia, diabetic, post-traumatic or postoperative neuropathic pain syndrome, which makes it possible to conduct an informed choice preventing the chronicity of pain in patients, taking into account the characteristics of the genome of a particular patient.EFFECT: makes it possible to conduct an informed choice preventing the chronicity of pain in patients, taking into account the characteristics of the genome of a particular patient.2 cl, 2 dwg, 1 tbl

Description

The claimed technical solution relates to biotechnology in general, in particular to genetic engineering, and can be used in medicine to determine the single nucleotide polymorphism rs8065080 in the gene encoding the TRPV1 receptor (type 1 vanilloid receptor) of a person. The claimed technical solution is generally based on the idea of using the known method of allele-specific polymerase chain reaction with electrophoretic detection of reaction products to provide a more accurate and reliable distinction between two alleles of the TRPV1 gene in human DNA samples, which makes it possible to reasonably choose a strategy for timely therapy in chronic and episodic migraine depending on the patient's genotype for the rs8065080 mutation.

Further, the applicant presents terms and definitions to avoid ambiguous understanding or interpretation of the application materials.

Polymerase chain reaction (hereinafter referred to as PCR) is a molecular biology method based on the mechanism of replication of deoxyribonucleic acid (DNA) in a cell using the DNA polymerase enzyme and allowing a significant increase in the amount of the target fragment by its multiple doubling.

Capsaicin, a pungent-tasting alkaloid found in various types of capsicum, is a TRPV1 receptor agonist and is used medicinally as a distraction and pain reliever.

The TRPV1 gene is a human gene encoding the vanilloid type 1 receptor (TRPV1).

Single nucleotide polymorphism (SNP) is the replacement of one nucleotide with another in the DNA sequence of the genome of representatives of one species or a homologous region of homologous chromosomes.

The rs8065080 or 1911A> G mutation is a substitution of nucleotide A for nucleotide G at position 1911 of the TRPV1 gene sequence, leading to the replacement of the isoleucine amino acid residue by the valine amino acid residue at position 585 of the amino acid sequence of the TRPV1 protein.

Allele - here - a variant of a DNA sequence that differs from another variant by replacing one nucleotide.

Complementarity is the correspondence of nucleotides in the sequences of two strands of nucleic acids, leading to the ability to form double-stranded complexes (structures) due to the formation of adenine-thymine and guanine-cytosine pairs.

Amplification is a multiple increase in the number of copies of a piece of DNA.

PCR amplification is a multiple increase in the number of copies of a piece of DNA during the polymerase chain reaction (PCR). The template for PCR is cDNA or genomic DNA.

PCR product is a DNA fragment resulting from PCR amplification.

Allele-specific PCR (AS-PCR) is a type of PCR amplification, for which allele-specific primers are used, each of which ensures the passage of PCR at the site of only one of the alleles with a selectivity of 100%.

Allele of the TRPV1 gene is a variant of the TRPV1 gene, characterized by the presence in position 1911 of the coding region of the DNA sequence of nucleotide A or G.

Oligonucleotide (oligodeoxyribonucleotide) is a short single-stranded DNA molecule, the length of which can be from several units to several tens of nucleotides.

Primer - an oligonucleotide used for PCR, the sequence of which is complementary to the nucleotide sequence of the DNA region adjacent to the target amplification region.

Forward primer - a primer whose sequence is complementary to the nucleotide sequence of a region of the first strand of a double-stranded DNA molecule adjacent to the beginning of the target region of amplification.

Reverse primer - a primer whose sequence is complementary to the nucleotide sequence of a region of the second strand of a double-stranded DNA molecule adjacent to the end of the target amplification region.

Annealing of a primer is the formation of a double-stranded structure due to the binding of a primer to a complementary region of a single-stranded DNA molecule.

The specificity of a primer is the ability of a primer to form a double-stranded structure only with a complementary region of a single-stranded DNA molecule. The more nucleotides in the primer sequence are complementary to the nucleotides in the DNA sequence, the higher the specificity of the primer. The identity of the nucleotide sequence of a specific primer and its annealing site is 100%. The lower the specificity of the primer, the higher the probability of the primer not binding to the desired annealing site.

Primer selectivity - the ability of a primer to form a double-stranded structure only with a specific (unique) variant of a region of a single-stranded DNA molecule.

Sequencing - Determination of the sequence of nucleotides (for nucleic acids) or amino acids (for polypeptides).

As is known in the art, TRPV1 receptors are non-selective cationic channels that are activated by capsaicin, protons, heating to temperatures higher than 43 ° C, endogenous lipids and inflammatory mediators [Tominaga et al., 1998, https://doi.org/10.1016 / S0896-6273 (00) 80564-4; Tominaga and Caterina, 2004, https://onlinelibrary.wiley.com/doi/epdf/10.1002/neu.20079]. TRPV1 receptors are localized on sensory neurons of the vagus and trigeminal nerve system, in the sympathetic nerve plexuses of the intestine, urinary bladder, in some structures of the central nervous system (striatum, hippocampus, cerebellar nucleus), as well as in epithelial cells of the intestine and urinary bladder, participating in this in the development of neurogenic pain and the mediation of chronic and mechanical pain [Devesa et al., 2011, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3218746/].

TRPV1 receptors are an integrator of various pain stimuli, their activation leads to the release of the main pain peptides in the human body: the so-called substance P (a neuropeptide responsible for the transmission of pain impulses to the central nervous system) and calcitonin-gene-linked peptide, which is key in migraine pain. This leads to an increase in the excitability of peripheral pain receptors and the development of neuropathic pain syndrome arising from structural and / or functional changes in the nervous system [Edvinsson et al., 1990, https://doi.org/10.1111/j.1476-5381.1990.tb15801 .x; Cortright and Szallasi, 2009, https://eurekaselect.net/article/14209; Stucky et al., 2009, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2683630/].

A number of studies have shown that the nonsynonymous single nucleotide polymorphism (hereinafter referred to as SNP) 1911A> G (rs8065080) in the TRPV1 gene, leading to the replacement of the amino acid isoleucine by valine at position 585 of the polypeptide sequence (Ile585Val), determines the functional activity of TRPV1 receptors, increasing or pain sensitivity and the level of risk of pain chronicity in various conditions [Binder et al., 2011, https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0017387; Forstenpointner et al., 2017, https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0183322; Okamoto et al., 2018, https://journals.sagepub.com/doi/10.1177/1744806918804439; Yakubova et al., 2020, https://link.springer.com/article/10.1007/s12031-020-01683-9].

Genotyping by SNP 1911A> G (rs8065080) is a promising method for dividing into groups and further stratification of patients depending on the intensity of pain sensitivity and its results can be used to select further therapy tactics, mainly in medical institutions, to develop measures to prevent and reduce the incidence rate chronic diseases accompanied by pain syndrome.

Allele-specific polymerase chain reaction (AS-PCR) is one of the most commonly used highly sensitive and accessible methods for SNP determination.

Below is a description of eight existing methods for identifying SNP 1911A> G (rs8065080) in the TRPV1 gene, identified by the applicant from the studied prior art.

DNA for genotyping of the rs8065080 mutation was isolated from venous blood, cells of the oral mucosa, saliva, and other biological material from patients and donors of the control group using one of the standard methods.

To carry out the genotyping itself, the following methods were used:

1) polymorphism of the lengths of restriction fragments of PCR amplification products (PCR-RFLP) of the gene region containing the mutation [Er et al., 2018, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5883834/]. The disadvantage of the known method is the need for additional stages of purification of the originally obtained PCR product and its cleavage with a special restriction enzyme Hpy99I;

2) allele-specific real-time PCR using TaqMan probes [Lopez-Valverde et al., 2019, https://www.dovepress.com/genetic-study-in-patients-operated-dentally-and-anesthetized-with -arti-peer-reviewed-fulltext-article-JPR]. The disadvantage of the known method is that its applicability is limited by the higher cost of the required equipment and specific probes.

3) genotyping using the "KASPar SNP Genotyping System" [Valdes et al., 2011, https://ard.bmj.com/content/70/9/1556; Liviero et al., 2020, https://www.sciencedirect.com/science/article/pii/S1094553919302135?via%3Dihub];

4) Sanger sequencing of PCR amplification products of the gene region containing the mutation [van Esch et al., 2009, https://bmcgastroenterol.biomedcentral.com/articles/10.1186/1471-230X-9-97; Okamoto et al., 2018, https://journals.sagepub.com/doi/10.1177/1744806918804439],

5) Real-time PCR using TaqMan analysis technology [Kim et al, 2006, https://jmg.bmj.com/content/43/8/e40; Deering-Rice et al., 2016, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5122759/];

6) separation of PCR products by capillary electrophoresis using the SNPLex platform [Cantero-Recasens et al., 2010, https://www.jbc.org/content/285/36/27532.full];

7) next generation sequencing (NGS) - in particular, pyrosequencing on the PSQ HS96 platform [Binder et al., 2011, https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0017387; Forstenpointer et al., 2017, https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0183322] or using the specialized panel Ion 318 Chip [Kringel et al., 2017, https: // journals.plos.org/plosone/article?id=10.1371/journal.pone.0180116];

8) determination of the rs8065080 mutation in RNA isolated from human spinal ganglia using NGS sequencing [Wang et al., 2016, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5512168/].

The disadvantages of genotyping methods 3-8, in particular, using sequencing, are the relatively high cost of reagents, the complexity and high cost of equipment and software, as well as significant labor intensity. Their use can be economically feasible when genotyping is carried out simultaneously for a large number of mutations in several genes on a large number of studied samples.

The claimed technical solution uses the AC-PCR method with electrophoretic detection of reaction products using a set of allele-specific primers, which allows genotyping for the rs8065080 mutation with a reliability of up to 100%, which ensures the achievement of such a high level of reliability. To carry out AS-PCR, two amplification reactions are carried out in parallel, in each of which the forward primer contains a nucleotide at the 3 'end that is complementary to one of the alleles, and the reverse primer is the same for both reactions.

As of the date of submission of the application materials, the applicant did not find analogues, including domestic ones, the developed set of primers, as well as the claimed method for allele-specific PCR with electrophoretic detection of reaction products for genotyping by the rs8065080 mutation of the TRPV1 gene, therefore, the formula of the alleged invention is drawn up without a limiting part ...

The objective of the claimed technical solution is to eliminate the shortcomings of the world's known genotyping methods for the rs8065080 mutation, primarily related to the high cost of equipment and reagents, as well as the need for highly qualified personnel using these methods. These shortcomings do not make it possible to carry out genotyping for this mutation in most medical diagnostic laboratories and medical institutions. The claimed technical solution provides for genotyping for the rs8065080 mutation in the TRPV1 gene by a simple-to-use method without the use of expensive equipment and reagents. The claimed technical solution makes it possible to obtain a product of PCR amplification of the target gene fragment and conduct further genetic analysis to ensure the elimination of false negative results, as well as to achieve high reliability and reproducibility of positive results of PCR amplification.

The claimed technical solution also provides reliable identification of SNP rs8065080 of the TRPV1 gene in patients of a wide range of conditions accompanied by pain, such as various types of migraine, osteoarthritis, postherpetic neuralgia, diabetic, post-traumatic or postoperative neuropathic pain syndrome, which makes it possible to make a reasonable choice of timely therapy. preventing the chronicity of pain in patients, taking into account the characteristics of the genome of a particular patient.

The technical result of the claimed technical solution is the development of a set of primers with the activity of forward (F) and reverse (R) primers, making it possible to carry out selective PCR amplification of alleles for the rs8065080 mutation in the human TRPV1 gene for the purpose of further genotyping, as well as the development of a method for genotyping by mutation rs8065080 of the TRPV1 gene by AC-PCR, which ensures the reliability and reproducibility of the results of PCR amplification.

The essence of the claimed technical solution is a set of 3 primers for the determination of SNP rs8065080 in the TRPV1 gene, which have the activity of forward and reverse primers in the polymerase chain reaction and have the following structure

Forward1: 5̓᾽-TGTGCCGTTTCATGTTTGTCTTCG-3̓ (24 n.)

Forward2: 5'-CTGTGCCGTTTCATGTTTGTCTTCA-3 '(25 n.)

Reverse: 5'-TGAGGTAGGAGAATTGCTTGAACC-3 '(24 n.)

A method for genotyping a single nucleotide polymorphism rs8065080 in the human TRPV1 1 gene, which consists in preparing reaction mixtures 1 and 2, containing standard components for carrying out the PCR reaction, to carry out AC-PCR, then the Forward1 primer and the Reverse primer according to clause 1 are added to the reaction mixture 1. 1, then the Forward2 primer and the Reverse primer according to claim 1 are added to the reaction mixture 2, then the analyzed DNA is added to the reaction mixture 1 and the reaction mixture 2, then the AC-PCR reaction is carried out for the reaction mixture 1 and the reaction mixture 2 according to the following program: 94 ° С - 3 min; then 33 cycles: 94 ° С - 30 sec, 64 ° С - 10 sec, 72 ° С - 20 sec; further 72 ° С - 2 min; further 4 ° С - ∞, at this the AC-PCR reaction is completed; then the amplification products are separated by electrophoresis in 1.5% agarose gel, then DNA is visualized by staining with ethidium bromide and subsequent UV irradiation.

The claimed technical solution is illustrated in Fig. 1 - Fig. 2.

FIG. 1 shows a diagram of the amplification of a genome region containing a single nucleotide substitution by the AC-PCR method.

The designations in Fig. 1 mean:

РС1, РС2 - reaction mixtures 1 and 2, respectively,

→ - direction of the AC-PCR reaction,

5 ', 3' - the ends of the primers,

For-1, For-2 - primers Forward1, Forward2, respectively,

Rev - Reverse primer,

A, G - nucleotides,

||| - symbolic designation of the formation of a complementary pair A - G,

X is a symbolic designation of the impossibility of forming a pair A - A, G - G.

FIG. 2 shows the results of the electrophoretic separation of AC-PCR products carried out using the Forward1, Forward2 and Reverse primers (1.5% agarose gel).

DNA isolated from the venous blood of patients with pain syndromes was used as a matrix.

Positions in figure 2 denote:

1 - marker of fragment lengths,

2 - negative control,

3 - PCR product obtained as a result of PCR amplification of the AG heterozygote for the rs8065080 mutation of the TRPV1 gene,

4 - PCR product obtained as a result of PCR amplification of AA homozygote for the rs8065080 mutation of the TRPV1 gene,

5 - PCR product obtained as a result of PCR amplification of the AG heterozygote for the rs8065080 mutation of the TRPV1 gene,

6 - PCR product obtained as a result of PCR amplification of AA homozygote for the rs8065080 mutation of the TRPV1 gene,

7 - PCR product obtained as a result of PCR amplification of a GG homozygote for the rs8065080 mutation of the TRPV1 gene.

Further, the applicant gives an example of a specific implementation of the claimed technical solution.

As part of the claimed technical solution, the applicant selected primer sequences for AS-PCR, specific to regions of the human TRPV1 gene, based on the sequence of the genome region placed in the GenBank database (Accession No. NG_029716). The synthesis of the selected primers, in accordance with the order of the applicant, were performed at Evrogen (Russia).

The developed primers were tested using DNA samples isolated from the blood of 46 patients with clinically verified diagnoses of "episodic migraine" or "chronic migraine" and 50 donors of the control group [Yakubova et al., 2020, https://link.springer.com / article/10.1007/s12031-020-01683-9].

Characterization of the primer set and amplifiable locus of the TRPV1 gene.

Annealing sites of primers Forward1 and Forward2, 24 and 25 nucleotides long, respectively, whose sequences differ by one nucleotide substitution at the 3 'end, are located on the TRPV1 gene sequence so that the localization of the 3' terminal nucleotide of the primer coincides with the localization of the rs8065080 mutation (pos . 37236-37259 and 37235-37259, respectively, in sequence NG_029716). The annealing site of the reverse primer (pos. 37640-37663) is located on the TRPV1 gene sequence at a distance that provides a 428 bp and 429 bp PCR product when using forward primers Forward1 and Forward2, respectively (see Table).

Table

The structure of the set of the claimed primers for the detection of SNP rs8065080 in the TRPV1 gene

Primer designation Primer sequence, 5 '→ 3' Localization in the TRPV1 gene sequence (NG_029716), nucleotides Amplicon length,
p.n. Forward1 TGTGCCGTTTCATGTTTGTCTTCG
37236-37259 428-429 Forward2 CTGTGCCGTTTCATGTTTGTCTTCA 37235-37259 Reverse TGAGGTAGGAGAATTGCTTGAACC 37640-37663

From the data shown in the Table, it can be concluded that the applicants have developed a set of primers that allows to reliably identify SNP rs8065080 of the TRPV1 gene.

Further, the applicants give Examples 1-3, which present an algorithm for identifying SNP rs8065080 in the TRPV1 gene using human whole blood as biological material.

Example 1. Isolation of genomic DNA from whole blood.

Isolation of genomic DNA from whole blood of patients with diseases accompanied by pain, prone to chronicity, is carried out according to one of the standard methods, for example, using a set of reagents "DNA-express-blood" [Litekh, Russia; http://www.lytech.ru/product/genetika-cheloveka/vydelenie-dnk/dna-express-blood/] or the ExtractDNA Blood kit [Evrogen, Russia; https://evrogen.ru/products/ExtractDNAblood/ExtractDNAblood/] or a similar kit according to the manufacturer's recommendations. For the subsequent carrying out of the AC-PCR reactions, take, for example, 0.5 μl of DNA per reaction.

Example 2. Carrying out AS-PCR.

To carry out the AC-PCR reaction, prepare reaction mixtures 1 and 2 containing components, for example, produced by Evrogen, Russia, for the PCR reaction, which coincide in the following general components:

10 × TaqPol buffer (Evrogen, Russia) - 1.0 μl

MgCl ₂ , 25 mM - 0.5 μl

DNTPs solution (25 mM) - 0.4 μl

TaqPol DNA polymerase (Evrogen, Russia), 5 units / μl - 0.2 μl (1 unit)

H ₂ O - up to 10 μl

At the same time, the applicant explains that these components produced by Eurogen, Russia are given to illustrate the implementation of the claimed technical solution. The use of components from other manufacturers does not limit the scope of patent claims, since the set of components does not affect the achievement of the claimed technical result.

Reaction mixtures 1 and 2 differ from each other in the set of declared primers:

- the declared Forward1 and Reverse primers are added to the reaction mixture 1 to the components described above, for example, in an amount of 5 pmol each, respectively;

- the declared Forward2 and Reverse primers are added to the reaction mixture 2 to the components described above, for example, in an amount of 5 pmol each, respectively.

Next, the analyzed DNA is added to reaction mixture 1 and reaction mixture 2 in an amount of, for example, 0.5 μl of DNA per reaction.

Then, for both reaction mixtures, an AC-PCR reaction is carried out, for example, in a C1000 ThermalCycler thermal cycler (Bio-Rad, USA) according to the following program:

94 ° C - 3 min

33 cycles: 94 ° C - 30 sec

64 ° C - 10 sec

72 ° C - 20 sec

72 ° C - 2 min

4 ° С - ∞.

Figure 1 shows a diagram of the amplification of a genome region containing a single nucleotide substitution by AC-PCR.

From the diagram shown in Fig. 1, it can be seen that:

- the presence of nucleotide A at the 3'-end of the Forward1 primer ensures the formation of a complementary pair A - G, which is necessary for the AC-PCR reaction in the presence of allele G, and the impossibility of the reaction in the presence of allele A;

- the presence of nucleotide G at the 3'-end of the Forward2 primer ensures the formation of a complementary A - G pair, which is necessary for the AC-PCR reaction in the presence of allele A, and the impossibility of the reaction in the presence of allele G.

Example 3. Detection of amplification products.

Separation of amplification products is carried out by electrophoresis in 1.5% agarose gel. DNA visualization is carried out by staining with ethidium bromide and subsequent UV irradiation using, for example, the GelDocXR + gel documentation system (Bio-Rad, USA).

An electrophoretogram of the results of the separation of PCR amplification products is shown in FIG. 2.

Figure 2 shows the results of electrophoretic separation of the products of allele-specific PCR carried out using the primers Forward1, Forward2 and Reverse (1.5% agarose gel) on a DNA matrix isolated from the blood of patients with clinically verified diagnoses of "episodic migraine" or "chronic migraine".

From the photograph shown in Fig. 2, it follows that:

- the length of the formed AC-PCR products, measured using the fragment length marker 1, is less than 500 base pairs;

- negative control 2 indicates the absence of foreign DNA in the reaction mixtures;

- in sample 3, 2 products are formed, which corresponds to the AG heterozygote genotype for the rs8065080 mutation of the TRPV1 gene;

- sample 4 produces a product only in reaction mixture 1, which corresponds to the AA homozygote genotype for the rs8065080 mutation of the TRPV1 gene;

- in sample 5, 2 products are formed, which corresponds to the AG heterozygote genotype for the rs8065080 mutation of the TRPV1 gene;

- sample 6 produces a product only in reaction mixture 1, which corresponds to the AA homozygote genotype for the rs8065080 mutation of the TRPV1 gene;

- sample 7 produces a product only in reaction mixture 2, which corresponds to the genotype of the homozygote GG for the rs8065080 mutation of the TRPV1 gene.

Thus, it was shown that for all the studied samples, only one PCR product was obtained, the length of which corresponded to the expected one (428 bp and 429 bp for reactions using forward primers Forward1 and Forward2, respectively). The presence of an amplification product when using a combination of Forward1 and Reverse primers indicates the presence of allele A in the analyzed DNA, and the presence of an amplification product when using a combination of Forward2 and Reverse primers indicates the presence of allele G in analyzed DNA. There are no nonspecific reaction products, which confirms the achievement of the applicant's goal - the claimed set of primers has 100% selectivity.

In order to verify the results of AS-PCR for a number of DNA samples obtained from patients with clinically verified diagnoses of "episodic migraine" or "chronic migraine", PCR amplification of the TRPV1 gene region was carried out using primers, the sequences of which are given in the source [van Esch et al, 2009, https://bmcgastroenterol.biomedcentral.com/articles/10.1186/1471-230X-9-97]. Then the obtained PCR amplification products were sequenced according to Sanger. In all cases, the results of determination by AC-PCR and sequencing methods coincided, which indicates 100% reliability of the results obtained (illustrations are not provided by the applicant, in order to avoid overloading the text with unnecessary information).

Thus, the applicant has proved that the developed primers can be effectively used for the AC-PCR for the purpose of reliable genotyping for the rs8065080 mutation in the human TRPV1 gene.

From the above, it can be concluded that the applicant has achieved the set objectives and the declared technical results, i.e. a set of primers with the activity of forward (F) and reverse (R) primers was developed, making it possible to carry out close to 100% selective PCR amplification of alleles for the rs8065080 mutation in the human TRPV1 gene for the purpose of further genotyping, and a method for genotyping for the rs8065080 gene mutation was developed TRPV1 by AC-PCR, which ensures the reliability and reproducibility of the results of PCR amplification.

The claimed technical solution eliminates the shortcomings of the world's known methods of genotyping for the rs8065080 mutation, primarily associated with the high cost of equipment and reagents, as well as the need for highly qualified personnel using these methods. The claimed technical solution provides for genotyping for the rs8065080 mutation in the TRPV1 gene by a simple-to-use method without the use of expensive equipment and reagents. The claimed technical solution makes it possible to obtain a product of PCR amplification of the target gene fragment and conduct further genetic analysis to ensure the elimination of false negative results, as well as to achieve high reliability and reproducibility of positive results of PCR amplification.

The claimed technical solution provides reliable identification of SNP rs8065080 of the TRPV1 gene in patients of a wide range of conditions accompanied by pain, such as various types of migraine, osteoarthritis, postherpetic neuralgia, diabetic, post-traumatic or postoperative neuropathic pain syndrome, which makes it possible to make an informed choice of timely therapy that prevents chronicity of pain in patients, taking into account the characteristics of the genome of a particular patient.

The claimed technical solution meets the "novelty" criterion for inventions, since no technical solutions have been identified from the investigated prior art that have the claimed set of distinctive features that ensure the achievement of the declared results.

The claimed technical solution satisfies the criterion of "inventive step" applied to inventions, since the applicant did not identify technical solutions from the investigated prior art, characterized by a specific set of oligonucleotides developed by the applicants that have the activity of forward (F) and reverse (R) primers, enabling selective PCR - amplification of alleles for the rs8065080 mutation in the human TRPV1 gene for the purpose of further genotyping.

The claimed technical solution meets the criterion of "industrial applicability" for inventions, since the claimed technical solution can be implemented using standard equipment and known techniques.

Sequence Listing - Rule 13ter

SEQ ID NO: 1 gg cca aaa cat cta tat gta tcc 23 SEQ ID NO: 2 ga tat ctc ttt tac ctt ctg gtc 23 SEQ ID NO: 3 aac atc atg agt cca gta atg gg 23 SEQ ID NO: 4 gta cag tag gat tat cct ctg atc 24

--->

<110> Federal State Autonomous Educational
institution of higher education "Kazan
(Volga Region) Federal University "(FGAOU
VO KFU) <120> A set of primers for the identification of RNA strains
Puumala orthohantavirus, distributed in
Republic of Tatarstan <140> Current application <141> 11/14/2019 <160> one <210> SEQ ID NO: 1 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> gg cca aaa cat cta tat gta tcc

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 2 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> ga tat ctc ttt tac ctt ctg gtc

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 3 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> aac atc atg agt cca gta atg gg

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 4 <211> 24 <212> Nucleotide <213> Puumala orthohantavirus <400> gta cag tag gat tat cct ctg atc

<---

Claims (12)

1. A set of 3 oligonucleotide primers for the determination of SNP rs8065080 in the human TRPV1 gene, which have the activity of forward and reverse primers in the polymerase chain reaction and have the following structure: Forward1: 5'-TGTGCCGTTTCATGTTTGTCTTCG-3 '(24 n.) Forward2: 5'-CTGTGCCGTTTCATGTTTGTCTTCA-3 '(25 n.) Reverse: 5'-TGAGGTAGGAGAATTGCTTGAACC-3 '(24 N.). 2. A method for genotyping a single nucleotide polymorphism rs8065080 in the human TRPV1 1 gene, which consists in the fact that for AS-PCR prepare reaction mixtures 1 and 2 containing components for carrying out the PCR reaction, then the Forward1 primer and the Reverse primer according to claim 1 are added to the reaction mixture 1, then the Forward2 primer and the Reverse primer according to claim 1 are added to the reaction mixture 2, then the analyzed DNA is added to reaction mixture 1 and reaction mixture 2, then for reaction mixture 1 and reaction mixture 2, the AC-PCR reaction is carried out according to the following program: 94 ° C - 3 min; then 33 cycles: 94 ° С - 30 sec, 64 ° С - 10 sec, 72 ° С - 20 sec; further 72 ° С - 2 min; further 4 ° С - ∞, at this the AC-PCR reaction is completed; then the amplification products are separated by electrophoresis in 1.5% agarose gel, then DNA is visualized by staining with ethidium bromide and subsequent UV irradiation.

Images