RU2596404C1 - METHOD OF DETERMINING THE METHYLATION SITES PuCGPy REGULATORY REGIONS OF GENES-MARKERS OF COLORECTAL CANCER BY GLAD-PCR-ANALYSIS AND OLIGONUCLEOTIDE PRIMERS AND FLUORESCENT-LABELLED PROBES FOR REALISING SAID METHOD - Google Patents

Abstract

FIELD: biology.

SUBSTANCE: group of inventions refers to molecular biology and can be used in molecular-genetic diagnosis of oncological diseases. Method involves bio information analysis of previous publications on genes-tumor markers of colorectal cancer and extraction of genes, methylation of PuCGPy sites at regulatory regions of which occurs with high frequency in DNA cells of colorectal cancer, taking into account possibility of detecting gene methylation at early stages of disease and formation of panel of following genes-tumor markers of colorectal cancer: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1. It is followed by hydrolysis of highly pure genomic DNA of the analysed biomaterial methyl dependent site-specific DNA-endonuclease GlaI, ligation of universal oligonucleotide adapter with further amplification in real time using genomic primers and probes, complementary sequences of regulatory regions of genes CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1 in investigated DNA, and hybrid primers, 3'-ends of which is complementary 5'-ends of DNA in specified places hydrolysis GlaI, and remaining part is complementary to adapter sequence. Conclusion on presence of sequence of Pu(5mC)GPy (where 5mC is 5-methylcytosine, Pu - A or G, Py - T or C) in regulatory regions of genes CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1 is made at onset of fluorescent signal. Adapter sequence is universal oligonucleotide adapter 5'-CCTGCTCTTTCATCG-3'/3'-p-GGACGAGAAAGTAGC-p-5'.

EFFECT: using the inventions enables simplifying and improving accuracy of determining of PuCGPy sites methylation.

3 cl, 1 dwg, 4 tbl, 3 ex

Description

The invention relates to the fields of molecular biology, biotechnology and medicine, and can be used in molecular genetic diagnosis of cancer and to evaluate the effectiveness of anti-cancer therapy, namely for the methylation analysis of tumor markers of colorectal cancer in samples of biological material.

One of the most promising tools for molecular genetic diagnosis and monitoring of cancer today is epigenetic diagnosis, that is, the identification of the disease by identifying epigenetic markers. Epigenetic markers are chemical groups that attach to human genomic DNA (methylation of cytosine bases to form 5-methylcytosine, 5mC) or to histone complexes associated with it and affect the functional activity of genes. The most common epigenetic disorder during carcinogenesis is local hypermethylation of individual DNA regions, the so-called CpG islands, in the regulatory regions of cancer suppressor genes, which are normally devoid of methyl groups. It has now been shown that such aberrant methylation is characteristic of the initial stages of most non-hereditary (sporadic) forms of cancer, which on average account for more than 90% of all cases of malignant neoplasms.

To carry out the epigenetic diagnosis of malignant neoplasms, two key issues must be addressed:

a) what detection method should be used to determine the status of gene methylation?

b) methylation of regulatory regions of which genes is associated with a specific cancer?

To solve the first question, namely, to analyze the status of gene methylation, a number of methods are used that can be divided into four groups.

The first group of methods is based on bisulfite conversion of DNA, entailing changes in its nucleotide composition. Subsequently, the desired region of the converted genome can be amplified by PCR and sequenced to determine all methylated cytosine residues. If the researcher is interested in the methylation status of a particular CG dinucleotide, then simpler methods of analysis are used. So, it is possible to carry out methyl-sensitive PCR (another term used is “methyl-specific PCR”), in which two reactions are carried out using primers selected for cases of passage or failure of conversion in the studied dinucleotide. Another widely used method for determining methylation is the treatment of converted DNA with restriction endonucleases (COBRA method based on the appearance or disappearance of enzyme recognition sites in altered DNA). The disadvantages of the described methods include significant degradation and significant loss of nucleic acids during bisulfite conversion, which makes it difficult to analyze a small amount of material, the complexity, the cost of the study and the significant investment of time [Umer M, Herceg Z. Deciphering the epigenetic code: an overview of DNA methylation analysis methods // Antioxid Redox Signal. - 2013. - V. 18. - P. 1972-1986].

The second group of methods includes DNA hydrolysis procedures with methyl-sensitive endonucleases. Analysis of gene methylation status is based on the fact that these restriction enzymes are not able to recognize and cleave sequences containing methylated CG sites (for example, the HpaII enzyme that recognizes and hydrolyzes only unmethylated CCGG tetranucleotide). The results of the hydrolysis reaction can be analyzed by PCR with flanking primers. A significant limitation for the widespread use of these methods is the relatively small number of known restriction endonucleases that recognize sequences containing CG dinucleotides and are sensitive to methylation of cytosine residues in them [Shen L, Waterland RA. Methods of DNA methylation analysis // Curr Opin Clin Nutr Metab Care. - 2007. - V. 10. - P. 576-581]. This approach also does not allow the detection of partially methylated DNA, whereas just such a pattern of methylation of CpG islands is characteristic of the earliest stages of carcinogenesis.

The third group of methods is based on the use of methyl binding domain containing proteins (MBD proteins) for the isolation of methylated DNA and its subsequent amplification. For example, MethylMeter technology developed by specialists of the American company RiboMed (Canadian patent No. 2724343, publ. May 15, 2008) is known, which allows achieving high sensitivity and specificity. This technology is used by manufacturers of some test systems, for example, G-CIMP DecisionDX of the American company Castle Biosciences. To protect this test system, US application No. 2014272986 was published, published September 18, 2014. However, such methods remain very time-consuming, and a clear and quantitative analysis of the results requires sophisticated and expensive equipment.

The fourth group of methods is based on the use of site-specific methyl-dependent endonucleases. After their discovery and the start of commercial production of their preparations, it became possible to use this new class of enzymes in epigenetic studies. Unlike conventional restriction endonucleases, methyl-dependent enzymes recognize only methylated DNA sequences, which makes them another convenient tool for studying the methylation status of genes. The enzymes of this class include the endonucleases GlaI, BisI, BlsI, MteI and several others [http://russia.sibenzyme.com/products/m2_type], produced in Russia by SibEnzyme LLC.

Due to the coincidence of the DNA sequence, which is the product of de novo methylation, and the substrate specificity of the GlaI enzyme, the researchers of SibEnzyme LLC developed a method called GLAD-PCR (GlaI hydrolysis and Ligation Adapter Dependent PCR), which allows determining the presence of Pu (5mC) GPy sites in the investigated DNA [Kuznetsov V.V. et al. The method for determining the nucleotide sequence of Pu (5mC) GPy in a given position of extended DNA // RF Patent No. 2525710 C1, publ. 08/20/2014, Bull. No. 23]. The method involves hydrolysis of DNA with GlaI enzyme, attachment of a specific adapter to the ends of the hydrolyzed DNA, and subsequent real-time PCR reaction from the primers surrounding the target DNA region. The method makes it possible to determine the presence of one or several Pu (5mC) GPy sites inside the studied DNA fragment. Thus, the GLAD-PCR method can be used to determine the methylation status of regulatory regions of genes.

This method has a number of advantages, consisting in simplicity of execution, the ability to detect only methylated sites in complex mixtures of DNA, and the ability to quantify their number. It should also be noted that the method has considerable versatility and can be used to analyze any complex mixtures of DNA, for example, DNA from tumors containing nucleic acids not only from malignant, but also from normal cells (vascular cells, connective tissue, etc.). ) Testing of GLAD-PCR showed that the method is highly sensitive, allowing the detection of methylated sites in highly diluted solutions.

This method is a universal method for the detection of methylation of Pu (5mC) GPy sites, which allows one to form and describe a specific gene panel specific for, for example, colorectal cancer. But in the description of the method itself, there are no gene panels specific for various types of oncology.

Colon and rectal cancer (colorectal cancer) is one of the most common types of malignant neoplasms. In the developed countries of the world, more than a million cases of this disease are diagnosed annually, and the mortality from cancer of this localization is more than 33% even in countries with a high level of cancer care [Walther A. et al. Genetic prognostic and predictive markers in colorectal cancer // Nat. Rev. Cancer - 2009. - V. 9. - P. 489-499]. As in the case of most other oncological diseases, the detection of this type of cancer in the early stages largely determines the success of treatment, which is why the development of sensitive molecular genetic, including epigenetic, methods for diagnosing colorectal cancer is undoubtedly an urgent task. However, the initial stages of the pathology of the internal organs are often not accompanied by anomalies determined by external examination or by patients who feel impaired body functions, which makes early diagnosis in these cases extremely difficult. Thus, the use of biochemical and genetic analyzes for the diagnosis of colorectal cancer is the preferred method for detecting the disease, especially since such diagnosis is possible at an asymptomatic stage [Gyparaki MT, Basdra EK, Papavassiliou AG. DNA methylation biomarkers as diagnostic and prognostic tools in colorectal cancer // J Mol Med (Berl). - 2013. - V. 91. - P. 1249-1256].

To develop an appropriate diagnostic system, it is necessary to find the answer to the second question: methylation of regulatory regions of which genes is associated with the development of colorectal cancer?

One of the first large-scale work on the search for marker genes for the epigenetic diagnosis of colorectal cancer was carried out in 2008 by Epigenomics AG (Germany) [Lofton-Day C et al. DNA methylation biomarkers for blood-based colorectal cancer screening // Clin Chem. - 2008. - V. 54. - P. 414-423]. At the first stage of work, methyl-sensitive restriction enzymes were used to analyze more than 600 candidate fragments of genomic DNA isolated from tumors and normal tissue. 56 DNA sections were selected that significantly differed in the degree of methylation in healthy and malignant cells. Further, these sites were additionally tested on microarrays and in real-time PCR. This reduced the number of genes most suitable for use as epigenetic markers of colorectal cancer to seven (SEPT9, NGFR, TMEFF2, ALX4, EYA4, FOXL2, SIX6).

In the future, a large number of authors published the results of their studies on tumor marker genes for the epigenetic diagnosis of colorectal cancer, carried out by various methods, including such modern approaches as the use of DNA microarrays (for example, Infinium HumanMethylation, Illumina, USA), limited (RRBS, Reduced Representation Bisulfite Sequencing) and genome-wide bisulfite sequencing (WGBS, Whole Genome Bisulphite Sequencing) with next generation sequencing systems (Next Generation Sequencing, NGS) [Reinders J. et al. // Epigenomics. - 2010. - V. 2. - P. 209-220; Kaneda A., Yagi K. // Cancer Sci. - 2011. - V. 102. - P. 18-24; Kibriya M.G. et al. // BMC Med Genomics. - 2011 .-- 4:50; Kim Y.H. et al. // Ann Surg Oncol. - 2011. - V. 18. - P. 2338-2347; Gu H. et al. // Nat Protoc. - 2011. - V. 6. - P. 468-481; Yi J.M. et al. // Tumour Biol. - 2012. - V. 33. - P. 363-372; Hinoue T. et al. // Genome Res. - 2012. - V. 22. - P. 271-282; Lange C.P. et al. // PLoS One. - 2012 .-- 7: e50266; Li H. et al. // Oncol Rep. - 2012. - V. 28. - P. 99-104; Roperch J.P. et al. // BMC Cancer. - 2013 .-- P. 13-566; Naumov V.A. // Epigenetics. - 2013. - V. 8. - P. 921-934; Chen Y.A. et al. // Epigenetics. - 2013. - V. 8. - P. 203-209; Harper K.N. et al. // Cancer Epidemiol Biomarkers Prev. - 2013. - V. 22. - P. 1052-1060; Mitchell S.M. et al. // BMC Cancer. - 2014 .-- P. 14-54; Melson J. et al. // Int J Cancer. - 2014 .-- V. 134. - P. 2656-2662; Papadia C. et al. // Inflamm Bowel Dis. - 2014. - V. 20. - P. 271-277].

Some of the detected tumor markers are already used in commercial test systems for the diagnosis of colorectal cancer. In 2008-2012, Epigenomics AG (Germany) developed and patented the Epi proColon kit 2.0 test system for the diagnosis of colorectal cancer (international application No. WO 2005001142, published on January 6, 2005; US application No. 2014179563, published June 26, 2014) based on the detection of a specific epigenetic marker SEPT9 in peripheral blood [Heichman KA. Blood-based testing for colorectal cancer screening // Mol Diagn Ther. 2014. - V. 18. - P. 127-135]. Methylation of another gene (VIM, vimentin) in malignant cells served as the basis for creating the ColoGuard assay test system from LabCorp (USA) [Lao VV, Grady WM. Epigenetics and colorectal cancer // Nat Rev Gastroenterol Hepatol. - 2011. - V. 8. - P. 686-700]. However, such mono-test systems are not intended to make a final diagnosis, and their indicators can serve only as additional indicators of the development or absence of a disease.

In total, the data obtained by the researchers indicate the unreliability of diagnostics based on the analysis of a single gene and, accordingly, the relevance of the development and implementation of test systems based on determining the status of DNA methylation in the regulatory regions of a number of tumor markers, allowing for more reliable and accurate diagnosis. Known work of Lind et al., Who created a diagnostic kit for the analysis of methylation of six genes: CNRIP1, FBN1, INA, MAL, SNCA and SPG20 [Lind G.E. et al. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas // Mol Cancer 2011. - V 10. - P. 85].

The closest analogue (prototype) is a method for determining the diagnosis of cancer in an individual with suspected colorectal cancer (International Application No. WO 2014062218, IPC C12Q 1/68, publ. 04.24.2014), including: obtaining a sample from an individual suspected of having cancer ; hydrolysis of highly purified genomic DNA from the studied biomaterial using bisulfite DNA conversion; determining the presence or absence of a high level of gene expression (determining the methylation level of the regulatory regions of tumor markers using digital PCR) in relation to the normal basic standard for one diagnostic panel, including the following biomarkers: TFPI2, THBD, C9ORF50, ADHFE1, FGF12, PTPRT, ZNF568 , KIAA1026, SFMBT2, and / or AUTS2; and diagnosing cancer with a high level of expression relative to the normal baseline standard of at least one biomarker.

A disadvantage of the known analogues and prototype is the use of bisulfite DNA conversion, which is characterized by laboriousness, high cost of research and significant time, as well as degradation and significant loss of nucleic acids, which leads to a decrease in accuracy and makes it difficult to analyze a small amount of material.

The technical result of the invention is to simplify and improve the accuracy of the method for determining the methylation of PuCGPy sites of regulatory regions of tumor markers of colorectal cancer and the expansion of its functionality.

The specified technical result is achieved in that a method for determining methylation of PuCGPy sites of regulatory regions of colorectal cancer tumor marker genes by GLAD-PCR analysis, according to the invention, includes bioinformation analysis of previous publications on colorectal cancer tumor marker genes. The selection of tumor markers for colorectal cancer during bioinformation analysis is carried out by examining the nucleotide sequences of the putative regulatory regions of these genes, identifying the CpG islands located in them, analyzing the primary structure of the CpG islands and their compliance with the following selection criteria:

- the availability of data from published works showing a high frequency of methylation of the regulatory region of the gene in the studied samples of DNA samples from patients with colorectal cancer with a low frequency of methylation of this region in healthy donors or in adjacent normal tissues of the colon and rectum of cancer patients;

- the presence of a CpG island in the region of the beginning of the gene or in the region of the coding start point of the alternative protein isoform - the gene product;

- the presence of a potential GlaI endonuclease recognition site (PuCGPy) in the nucleotide sequence at a selected site;

- a sufficient distance (50 bp or more) between the two potential recognition sites of the GlaI endonuclease for simultaneous annealing of the fluorescently labeled probe and the genomic primer in this region and the possibility of selecting primers and probes for this region that are not subject to theoretical cross hybridization and with the adapter sequence;

- the value of G + C of the composition on the candidate site, not exceeding 80%;

- the uniqueness of the nucleotide sequence of the candidate site of analysis (non-inclusion in the number of repeating elements of the genome).

Finally, genes are selected whose methylation of regulatory regions has the highest frequency of methylation in the DNA of colorectal cancer cells, taking into account the possibility of detecting gene methylation in the early stages of the disease and form a panel of the following candidate genes for epigenetic markers of colorectal cancer: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1. Next, hydrolysis of highly purified genomic DNA from the studied biomaterial of methyl-dependent site-specific DNA endonuclease GlaI, ligation of the universal oligonucleotide adapter with subsequent amplification in real time using genomic primers and probes, complementary to the sequences of regulatory regions of the genes CNRIP1, ELRX1, RRX1, ELMX1, RMR1 ELRO1, ELRO1, ELMO1 RYR2, SEPT9b, SOCS3 and UCHL1 in the studied DNA, and hybrid primers, the 3′-ends of which are complementary to the 5′-ends of the DNA at the given GlaI hydrolysis sites, and the rest of the comple isentral to the adapter sequence, and conclude that the sequence Pu (5mC) GPy (where 5mC is 5-methylcytosine, Pu is A or G, Py is T or C) in the regulatory regions of the CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2 genes , SEPT9b, SOCS3, and UCHL1 for the appearance of a fluorescent signal. The universal oligonucleotide adapter 5′-CCTGCTCTTTCATCG-3 ′ / 3′-p-GGACGAGAAAGTAGC-p-5 ′, where p is phosphate, is used as the adapter sequence. Primers and probes contain sequences that have the structure represented in independent claim 3 of the claims.

The indicated technical result is also achieved by creating a set of oligonucleotide primers and fluorescently-labeled probes to identify malignant lesions of the colon and rectum by analyzing PuCGPy sites in DNA samples of methylation sites of regulatory regions of tumor markers by GLAD-PCR (independent claim 3 of the claims ) having the following structure:

- for specific primers and probe on the plot of the regulatory region of the CNRIP1 gene (5` → 3`):

CNRIP1_g GCCAGACCCTCGCCCAGACA

CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1

CNRIP1_h CCTGCTCTTTCATCGGCGA;

- for specific primers and probe on the plot of the regulatory region of the ELMO1 gene (5` → 3`):

ELMO1_g GGGTCGCCGGAGCTCTGA

ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1

ELMO1_h CCTGCTCTTTCATCGGCCG;

- for specific primers and probe on the site of the regulatory region of the ESR1 gene (5` → 3`):

ESR1_g CGCAGGGCAGAAGGCTCAGAA

ESR1_z FAM-TGCTCTTTTTTCCAGGTGGCCCGCC-BHQ1

ESR1_h CCTGCTCTTTCATCGGTGT;

- for specific primers and probe on the regulatory region of the FBN1 gene (5` → 3`):

FBN1_g GTAGCGGCCACGACTGGGA

FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1

FBN1_h CCTGCTCTTTCATCGGCGG;

- for specific primers and probe per region of the regulatory region of the RXRg gene (5` → 3`):

RXRg_g GCCGCCGTCACCGCTACT

RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1

RXRg_h CCTGCTCTTTCATCGGCCG;

- for specific primers and probe per region of the regulatory region of the RYR2 gene (5` → 3`):

RYR2_g GGGGACCACGGAGGCGACT

RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1

RYR2_h CCTGCTCTTTCATCGGCGT;

- for specific primers and probe on the plot of the regulatory region of the SEPT9b gene (5` → 3`):

SEPT9b_g GCAGGAGGCTGTATTTGGG

SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1

SEPT9b_h CCTGCTCTTTCATCGGCGG;

- for specific primers and probe on the regulatory region of the SOCS3 gene (5` → 3`):

SOCS3_g CAGTCCCGGGGGCCCTTCT

SOCS3_z FAM-TGCTCCCCACCCGGCCACACTACTCC-BHQ1

SOCS3_h CCTGCTCTTTCATCGGCGG;

- for specific primers and probe per region of the regulatory region of the UCHL1 gene (5` → 3`):

UCHL1_g GCAGAACCAAGCGAGGGGGGAA

UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1

UCHL1_h CCTGCTCTTTCATCGGCTG,

where g is the genomic primer (genome); z — fluorescently-labeled probe ( z ond); h is a hybrid primer ( h ybrid); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

The analysis results are taken into account by the method of hybridization-fluorescence detection of PCR amplification products in real time.

The invention is illustrated by the following graphic material.

In FIG. Figure 1 shows the analysis of the methylation status of PuCGPy sites in the regulatory region of the RYR2 gene. Panel A shows a fragment of the nucleotide sequence; shows the binding sites of the genomic primer, probe and genome-specific 3′-tetranucleotides of hybrid primers. Panel B shows the fluorescence accumulation curves during PCR using seven different hybrid primers. Capital letters “GCGT” indicate the selected hybrid primer corresponding to the point of DNA hydrolysis at the most frequently methylated seventh PuCGPy site in the amplicon.

The invention is illustrated by the following examples 1-3, which implements a method for determining methylation of PuCGPy sites of regulatory regions of colorectal cancer tumor markers by GLAD-PCR analysis, as well as the composition of oligonucleotide primers and fluorescently-labeled probes for implementing this method.

Example 1. The development of specific primers and fluorescently-labeled probes on the sites of CpG islands of regulatory regions of tumor markers of colorectal cancer.

The study of published data on gene methylation in oncopathology of the lower intestine, RRBS sequencing data (Reduced Representation Bisulfite Sequencing, bisulfite sequencing of limited samples of loci) in the ENCODE / HudsonAlpha project and subsequent bioinformation analysis of the nucleotide sequences of the candidate gene sequences plots of CpG islands of regulatory regions of colorectal cancer tumor marker genes that meet the criteria for analysis by GLAD-PCR ( ablation. 1).

At the first stage of the work, the literature data of recent years on gene methylation in oncopathology of the lower intestine, RRBS sequencing (Reduced Representation Bisulfite Sequencing, bisulfite sequencing of limited locus samples) were analyzed in the ENCODE / HudsonAlpha project and a list of 57 genes was compiled. which methylation occurs with high frequency in the DNA of colorectal cancer cells. This list includes the following genes: SEPT9, SYNE1, FGF12, GAD2, HAND1, CACNA1G, CNRIP1, TLX2, LOX, LAMA1, GAS7, SLC6A15, BOLL, TFPI2, SOCS3, TRH, MDFI, C1orf70, RUNX3, TMPFF WNT5A, IGFBP7, TFPI2, FOXE1, NPY, WIF1, CIDEB, RIC3, KCNQ5, COL4A1, SPG20, SND1, PENK, CDO1, THBD, EDIL3, DUSP26, UCHL1, STOX2, ELMO1, SLC2AL, ESLAAL10 FLI1, RXRg, RYR2, PRKAR1B, BEND5, ITGA4, ADHFE1, NGFR, GATA4, NEYROG1, FBN1. When choosing genes for this list, the number of analyzed samples in the experiments described by the authors of the articles was also taken into account, since reliable data can be obtained only with a large number of DNA samples in the sample. Great importance was also attached to such a property described by the authors as the possibility of detecting gene methylation in the early stages of the disease, although, unfortunately, the number of publications that examined the dependence of gene methylation on the stage of oncopathology is very small.

At the second stage of the work, the nucleotide sequences of the putative regulatory regions of these 57 genes were examined and the CpG islands located in them were identified. The primary structures of CpG islands were analyzed for their compliance with the selection criteria:

1) The availability of data from published works showing a high frequency of methylation of the regulatory region of a gene in the studied samples of DNA samples from patients with colorectal cancer with a low frequency of methylation of this region in healthy donors or in adjacent normal tissues of the colon and rectum of cancer patients.

2) The presence of a CpG island in the region of the beginning of the gene (or in the region of the coding start point of an alternative protein isoform — the gene product), which in most cases is evidence of the regulation of the activity of this gene by methylation of this region.

3) The presence of a potential GlaI endonuclease recognition site (PuCGPy) in a nucleotide sequence at a selected site.

4) A sufficient distance (50 bp or more) between two potential GlaI endonuclease recognition sites for simultaneous annealing of a fluorescently labeled probe and a genomic primer in this region and the possibility of selecting a primer and probe for this region that are not subject to theoretical cross-hybridization between by itself and with the adapter sequence.

5) The G + C value of the composition on the candidate site does not exceed 80%, which is caused by the limitations of the in vitro DNA amplification system, which uses HotStart Taq DNA polymerase.

6) The uniqueness of the nucleotide sequence of the candidate region of the analysis (its non-inclusion in the number of repetitive elements of the genome) in order to avoid nonspecific annealing of the selected genomic primer in other regions of the genome, which can lead to a significant decrease in the amplification efficiency and difficulty in detecting the results during real-time PCR.

As a result of the bioinformation analysis of the regulatory regions of each of the listed genes, 9 regions from these regions (Table 1) that satisfy all the required criteria for the analysis using the GLAD-PCR method were selected and specific primers and probes for the selected areas of regulatory regions of tumor markers (Table 2).

Table 1

Regulatory regions of tumor markers are promising for GLAD-PCR analysis

Gene The official name for the gene encoded by the HGNC nomenclature Chromosome The coordinates of the plot on the chromosome (version of the human genome GRCh37 / hg19) CNRIP1 Cannabinoid receptor interacting protein 1 2 68546267 - 68547417 ELMO1 Engulfment and cell motility 1 7 37487377 - 37488726 ESR1 Estrogen receptor 1 6 152128781 - 152129818 Fbn1 Fibrillin 1 fifteen 48936811 - 48938011 Rxrg Retinoid X receptor, gamma one 165414180 - 165414720 Ryr2 Ryanodine receptor 2 one 237205258 - 237206918 Sept9b Septin 9 beta 17 77372490 - 77374140 SOCS3 Suppressor of cytokine signaling 3 17 76354655 - 76355605 UCHL1 Ubiquitin carboxyl-terminal esterase L1 four 41258784 - 41259887

The sequences of regulatory regions of genes used in the work according to the human genome GRCh37 / hg19 were obtained from the international GenBank database. To analyze and calculate primers and probes, to study their specificity, we used the Vector NTI 11.5 family of computer programs (Invitrogen, USA) and the US National Biotechnology Information Center database online resources (Blast NCBI, http: //blast.ncbi.nlm.nih .gov / Blast.cgi).

table 2

Specific primers and probes on regions of regulatory regions of tumor markers

Gene Designation and 5 '-> 3' sequence * CNRIP1 CNRIP1_g GCCAGACCCTCGCCCAGACA
CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
CNRIP1_ih CGTCATTAGGCTGGATGCGCA ELMO1 ELMO1_g GGGTCGCCGGAGCTCTGA
ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
ELMO1_ih CGCCAGCCCAGGAAACTTTAC ESR1 ESR1_g CGCAGGGCAGAAGGCTCAGAA
ESR1_z FAM-TGCTCTTTTTTCCAGGTGGCCCGCC-BHQ1
ESR1_ih CGGGACATGCGCTGCGTC Fbn1 FBN1_g GTAGCGGCCACGACTGGGA
FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
FBN1_ih CCGGCTGCACCCACTGGA Rxrg RXRg_g GCCGCCGTCACCGCTACT
RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1
RXRg_ih GTGCCACCCGGTAGGGACC Ryr2 RYR2_g GGGGACCACGGAGGCGACT
RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
RYR2_ih CGGGGGTGATGGTGCAGGA Sept9b SEPT9b_g GCAGGAGGCTGTATTTGGG
SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
SEPT9b_ih CGCTGCCGTTTAACCCTTG SOCS3 SOCS3_g CAGTCCCGGGGGCCCTTCT
SOCS3_z FAM-TGCTCCCCACCCGGCCACACTACTCC-BHQ1
SOCS3_ih CAAGGGCGCAGCGTGGGA UCHL1 UCHLl_g GCAGAACCAAGCGAGGGGGGAA
UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
UCHLl_ih GGGGCCCGGCCGTACCAC

* Note: g - genomic primer; z — fluorescently-labeled probe; ih is an additional genomic primer (instead of hybrid), subsequently replaced by a hybrid primer in GLAD-PCR (example 2); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

Real-time PCR was carried out in a volume of 20 μl in three repetitions on a CXF-96 detection amplifier (Bio-Rad, USA) according to a program universal for all amplified sections: 95 ° C for 3 min, then 5 cycles without detection: 95 ° C 10 s, 61 ° C 15 s, 72 ° C 20 s; then 50 cycles with detection through the FAM channel at the annealing stage: 95 ° C for 10 sec, 61 ° C for 15 sec, 72 ° C for 20 sec. The concentrations of the PCR reaction components were similar to those indicated in Example 2. In the experiments, healthy donor leukocyte DNA was obtained and purified as described previously [Abdurashitov MA et al. Restriction analysis of human DNA - new opportunities in DNA diagnostics. Medical genetics. 2007. - T. 6. - S. 29-36]. The amplification results were as expected. The sequences of the designed primers and probes are presented in table 2. Subsequently, when conducting GLAD-PCR, one of the primers, indicated in the table as “ih” (instead of hybrid), was replaced with a selected hybrid primer (example 2).

Example 2. Search methylated sites PuCGPy for GLAD-PCR analysis

The methylation status of PuCGPy sites within the selected DNA regions was studied in order to select the optimal sites for further GLAD-PCR analysis of clinical samples. To search for promising Pu (5mC) GPy sites within the selected regions of the regulatory regions of tumor markers, we used DNA preparation from colorectal cancer cells of the SW837 line (colon adenocarcinoma cell line), isolated by the known method [Sambrook J., Russel D. Molecular cloning : a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.]. The search was carried out by selecting hybrid primers for nearby PuCGPy sites for no more than 400 bp. from the position of the genomic primer. Used the methodology, the structure of the oligonucleotide adapter and hybrid primers according to the known method [Kuznetsov V. Century et al. The method for determining the nucleotide sequence of Pu (5mC) GPy in a given position of extended DNA // RF Patent No. 2525710 C1, publ. 08/20/2014, Bull. No. 23].

The structure of the hybrid primer is a 19-link sequence of the following composition: 5′-CCTGCTCTTTCATCGgYNN-3 ′, where the 15-link part of the primer complementary to the universal oligonucleotide adapter is highlighted, and gYNN is a 4-link, complementary to the genomic sequence of the methylase GlaI. This structure implies 32 variants of hybrid primers corresponding to different points of DNA hydrolysis at the Pu (5mC) GPy site.

1.5 n.a. of methyl-dependent site-specific GlaI DNA endonuclease was added to 45 ng of the DNA preparation. and buffer components to achieve the following composition in a volume of 21.7 μl: 20 mM Tris-SO ₄ , pH 8.0, 4 mM MgCl ₂ , 1 mM β-mercaptoethanol, 100 ng / μl BSA. Hydrolysis was carried out for 30 min at 30 ° C, followed by inactivation of GlaI at 65 ° C for 20 min.

Then, ATP was added to the GlaI hydrolyzate to a final concentration of 0.5 mM, β-mercaptoethanol to 6.8 mM, the universal oligonucleotide adapter 5′-CCTGCTCTTTCATCG-3 ′ / 3′-p-GGACGAGAAAGTAGC-p-5 ′, to the final concentrations of 0.5 μM and 1000 ea highly active T4 DNA ligase. The adapter ligation reaction was carried out in 30 μl of the reaction mixture for 15 min at 25 ° С, then the ligase was thermally inactivated at 65 ° С for 20 min.

For real-time PCR, the following components were added to the ligase mixture until the final concentrations were reached in a final volume of 60 μl: 50 mM Tris-SO ₄ , pH 9.0, 30 mM KCl, 10 mM ammonium sulfate, 3 mM MgCl ₂ , 0.2 mm mixture of deoxyribonucleoside triphosphates, 0.01% Tween-20, a mixture of genomic primer, hybrid primer and probe of 0.4 μm each and 0.05 EA / μl Hot Start DNA polymerase. To increase the amplification efficiency of GC-rich DNA regions, a stabilizer was used. The resulting reaction mixture (60 μl) was divided into three equal parts.

Table 3

Search Results for PuCGPy Sites Promising GLAD-PCR Analysis

Gene Chromosome Website PuCGPy Coordinates of the site on the chromosome (version of the human genome GRCh37 / hg19) Amplon site number Hybrid primer
(designation) CNRIP1 2 Gcgc 68546267 - 68547417 2 CCTGCTCTTTCATCGGCGA
(CNRIP1_h) ELMO1 7 Gcgc 37487377 - 37488726 3 CCTGCTCTTTCATCGGCCG
(ELMO1_h) ESR1 6 Gcgt 152128781 - 152129818 3 CCTGCTCTTTCATCGGTGT
(ESR1_h) Fbn1 fifteen Gcgc 48936811 - 48938011 3 CCTGCTCTTTCATCGGCGG
(FBN1_h) Rxrg one Gcgc 165414513 - 165414516 one CCTGCTCTTTCATCGGCCG
(RXRg_h) Ryr2 one Gcgc 237205258 - 237206918 7 CCTGCTCTTTCATCGGCGT
(RYR2_h) Sept9b 17 Gcgc 75368983 - 75368986 one CCTGCTCTTTCATCGGCGG
(SEPT9b_h) SOCS3 17 Gcgc 76354655 - 76355605 one CCTGCTCTTTCATCGGCGG
(SOCS3_h) UCHL1 four Gcgc 41258784 - 41259887 2 CCTGCTCTTTCATCGGCTG
(UCHL1_h)

* Note: h - stands for hybrid primer (hybrid); underlining highlighted 15-link part of the primer, complementary to the universal oligonucleotide adapter.

Real-time PCR reaction was carried out in a volume of 20 μl in three repetitions on a CXF-96 detection amplifier (Bio-Rad, USA) according to the program: 95 ° C for 3 min, then 5 cycles without detection: 95 ° C for 10 sec, 61 ° C 15 sec; 72 ° C 20 sec; then 50 cycles with detection (FAM channel) at the annealing stage: 95 ° С 10 sec, 61 ° С 15 sec, 72 ° С 20 sec. The results were analyzed using the CXF-96 amplifier software and interpreted based on the presence (or absence) of intersection of the fluorescence curves of the samples with the threshold lines, which corresponded to the presence or absence of the threshold cycle value “Cq” in the corresponding column of the result table of the amplifier program.

In FIG. Figure 1 shows an example of a search for the most frequently methylated PuCGPy site in a selected region of the regulatory region of the RYR2 gene. As can be seen from FIG. 1, this turned out to be the seventh site in the amplicon, which corresponds to the hybrid primer 5′-CCTGCTCTTTCATCGGCGT-3 ′.

The search results for Pu (5mC) GPy sites in the regions of CpG islands of the regulatory regions of tumor markers are summarized in Table 3.

Example 3. GLAD-PCR analysis of methylation status of tumor markers of colorectal cancer

Samples of the surgical material of tumors (n = 13), normal intestinal mucosa (n = 4) and endoscopic samples (n = 2) from patients with colorectal cancer were obtained from the FSUE Seversky Biophysical Research Center of the FMBA of Russia (Seversk, Tomsk Region, Russian Federation ) For GLAD-PCR analysis of the methylation status of PuCGPy sites at specific positions of the DNA region of a specific gene, genomic DNA preparations isolated from clinical samples using a known method were used [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.], Which were treated with RNAse A to purify RNA impurities and fragmented with TaqI restriction restriction endonuclease for more complete DNA hydrolysis. The concentration of DNA samples (ng / μl) was determined spectrophotometrically. The GLAD-PCR reaction was carried out as described in Example 2. 9 ng DNA was taken into the reaction, PCR was carried out in three repetitions for each sample (3 ng DNA, i.e., ~ 10 ³ copies of the genome per reaction). One of the genomic primers in PCR was replaced with a matched one, as described in example 2, i.e. hybrid primer.

Table 4

GLAD-PCR screening for epigenetic tumor markers for methylation correlating with colorectal cancer in clinical specimens

Clinical No. Ryr2 CNRIP1 ESR1 Fbn1 SOCS3 UCHL1 Sept9b Rxr1g ELMO1 1 CRC + + + + + + - + + 2 CRC + + + + + + + + - 3 CRC + + + + + + + - - 4 CRC + + + - + + + + - 5 CRC + + - + + + + + + 6 CRC + + + + + - + + + 7 CRC + + + + - + + + - 8 CRC + + + + + + - - - 9 CRC + + + + + + + + + 10 CRC + - - - + - + + + 11 CRC + + + + - - + + + 12 CRC + + + + + + - + + 13 CRC + + + + + + + - + 14e CRC + + + + + + + - - 15e CRC + + + + - + - - - 10 norms - - - - - - - - - 11 norms - - - - - - - - - 12 norms - - - - - - - - - 13 norms - - - - - - - - - The number (%) of detected CRC samples fifteen
(one hundred %) fourteen
(93%) 13
(87%) 13
(87%) 12
(80%) 12
(80%) eleven
(73%) 10
(67%) 8
(53%)

* Notes: “norms” - samples of intact mucosa; "CRC" - samples of colorectal cancer; "E CRC" - samples obtained by endoscopic examination of patients with colorectal cancer.

The results of the screening are presented in table 4. The analyzed sample was considered positive when the fluorescence accumulation curve had a characteristic exponential growth phase and the average Ct value for the sample was less than the lower boundary of the range of threshold cycles for 4 samples of intact mucosa (10-13 norms ) for 1 or more cycles. The analyzed sample was considered negative if the average “Ct” value for the sample fell within the range of threshold cycle values for intact mucosa samples, was greater or not determined.

As can be seen from table 4, the genes RYR2, CNRIP1, ESR1, FBN1, SOCS3 and UCHL1 turned out to be the most promising for GLAD-PCR analysis of clinical samples of colorectal cancer, methylation of whose regulatory regions was detected in 80-100% of the studied colorectal cancer samples.

Thus, Example 3 shows the possibility of successfully applying the GLAD-PCR method to identify malignant lesions of the colon and rectum using the developed set of oligonucleotide primers and fluorescently-labeled probes for GLAD-PCR analysis of methylation status of given PuCGPy sites in the regulatory regions of genes tumor markers of colorectal cancer.

application

LIST OF SEQUENCES

<110> Federal budget institution of science "State

 Scientific Center of Virology and Biotechnology "Vector" »(FBUN

 SSC WB "Vector")

<120> A set of oligonucleotide primers and fluorescently-labeled probes for the identification of malignant lesions of the colon and rectum by analysis of PuCGPy sites in DNA methylation samples at the specified positions of the regulatory regions of the CNRIP1, ELMO1, ESR1, FBN1, RXRg, RY3, STR9, RYB2, RYR2, RYB2, UCHL1 by GLAD-PCR method

<210> 9

<212> DNA

<213> Homo sapiens

<223> Sequences for specific primers and probes on sites of CpG islands of regulatory regions of tumor markers CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1

<400> 1 for specific primers and probe on the sites of CpG islands of regulatory regions of the CNRIP1 tumor marker gene (5` → 3`):

CNRIP1_g 5`-GCCAGACCCTCGCCCAGACA-3` (20 n) CNRIP1_z 5`-FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1-3` (20 n) CNRIP1_h 5`-CCTGCTCTTTCATCGGCGA-3` (19 n)

<400> 2 for specific primers and probe on the sites of CpG islands of regulatory regions of the ELMO1 tumor marker gene (5` → 3`):

ELMO1_g 5`-GGGTCGCCGGAGCTCTGA-3` (18 n) ELMO1_z 5`-FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1-3` (23 n) ELMO1_h 5`-CCTGCTCTTTCATCGGCCG-3` (19 n)

<400> 3 for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker ESR1 (5` → 3`):

ESR1_g 5`-CGCAGGGCAGAAGGCTCAGAA-3` (21 n) ESR1_z 5`-FAM-TGCTCTTTTTTAGAGGTGGCCCGCC-BHQ1-3` (24 n) ESR1_h 5`-CCTGCTCTTTCATCGGTGT-3` (19 n)

<400> 4 for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (5` → 3`):

FBN1_g 5`-GTAGCGGCCACGACTGGGA-3` (19 n) FBN1_z 5`-FAM-CAGCCGCCGCCGCCTCCTC-BHQ1-3` (19 n) FBN1_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 n)

<400> 5 for specific primers and probe on the sites of CpG islands of the regulatory regions of the tumor marker RXRg (5` → 3`):

RXRg_g 5`-GCCGCCGTCACCGCTACT-3` (18 n) RXRg_z 5`-FAM-CCACCGCCGTCGCTGCTGC-BHQ1-3` (19 n) RXRg_h 5`-CCTGCTCTTTCATCGGCCG-3` (19 n)

<400> 6 for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker RYR2 (5` → 3`):

RYR2_g 5`-GGGGACCACGGAGGCGACT-3` (19 n) RYR2_z 5`-FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1-3` (27 n) RYR2_h 5`-CCTGCTCTTTCATCGGCGT-3` (19 n)

<400> 7 for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker SEPT9b (5` → 3`):

SEPT9b_g 5`-GCAGGAGGCTGTATTTGGG-3` (19 n) SEPT9b_z 5`-FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1-3` (27 n) SEPT9b_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 n)

<400> 8 for specific primers and probe for sites of CpG islands of regulatory regions of the SOCS3 gene tumor marker (5` → 3`):

SOCS3_g 5`-CAGTCCCGGGGGGCCCTTCT-3` (19 n) SOCS3_z 5`-FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1-3` (22 n) SOCS3_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 n)

<400> 9 for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker UCHL1 (5` → 3`):

UCHLl_g 5`-GCAGAACCAAGCGAGGGGGGAA-3` (21 n) UCHL1_z 5`-FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1-3` (24 n) UCHLl_h 5`-CCTGCTCTTTCATCGGCTG-3` (19 n)

where g is the genomic primer (genome); z — fluorescently-labeled probe ( z ond); h is a hybrid primer ( h ybrid); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

Claims (3)

1. A method for determining methylation of PuCGPy sites of regulatory regions of colorectal cancer tumor markers by GLAD-PCR analysis, characterized in that it includes bioinformation analysis of previous publications on colorectal cancer tumor genes; selection of genes whose methylation of PuCGPy sites of regulatory regions occurs with high frequency in the DNA of colorectal cancer cells, taking into account the possibility of detecting gene methylation in the early stages of the disease and the formation of a panel of the following tumor markers of colorectal cancer: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 and UCHL1; hydrolysis of highly purified genomic DNA from the studied biomaterial of the methyl-dependent site-specific DNA endonuclease GlaI, ligation of a universal oligonucleotide adapter followed by real-time amplification using genomic primers and probes complementary to the sequences of regulatory regions of the genes CNRIP1, ELMRRR, ESR1RR1R SEPT9b, SOCS3, and UCHL1 in the studied DNA, and hybrid primers, the 3'-ends of which are complementary to the 5'-ends of the DNA at the given GlaI hydrolysis sites, and the rest is complementary to the adapter of the sequence, and conclude that the sequence Pu (5mC) GPy (where 5mC is 5-methylcytosine, Pu is A or G, Py is T or C) in the regulatory regions of the CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b genes , SOCS3 and UCHL1 by the appearance of a fluorescent signal, moreover, the universal oligonucleotide adapter 5'-CCTGCTCTTTCATCG-3 '/ 3'-p-GGACGAGAAAGTAGC-p-5', where p is phosphate and the primers and probes contain sequences, are used as the adapter sequence which have the structure represented in independent claim 3 of the formula. 2. The method according to p. 1, characterized in that the selection of tumor markers of colorectal cancer during bioinformation analysis is carried out by examining the nucleotide sequences of the regulatory regions of these genes, identifying the CpG islands located in them, analyzing the primary structure of the CpG islands and their compliance with the following criteria of choice:
- the availability of data from published works showing a high frequency of methylation of the regulatory region of the gene in the studied samples of DNA samples from patients with colorectal cancer with a low frequency of methylation of this region in healthy donors or in adjacent normal tissues of the colon and rectum of cancer patients;
- the presence of a CpG island in the region of the beginning of the gene or in the region of the coding start point of the alternative protein isoform - the gene product;
- the presence of a potential GlaI endonuclease recognition site (PuCGPy) in the nucleotide sequence at a selected site;
- a sufficient distance (50 bp or more) between the two potential recognition sites of the GlaI endonuclease for simultaneous annealing of the fluorescently labeled probe and the genomic primer in this region and the possibility of selecting primers and probes for this region that are not subject to theoretical cross hybridization and with the adapter sequence;
- the value of G + C composition on the candidate site, not exceeding 80%;
- the uniqueness of the nucleotide sequence of the candidate site of analysis (non-inclusion in the number of repeating elements of the genome). 3. A set of oligonucleotide primers and fluorescently-labeled probes for the identification of malignant lesions of the colon and rectum by analyzing PuCGPy sites in DNA methylation samples at specified positions in the regulatory regions of tumor markers by GLAD-PCR with the following structure:
- for specific primers and probe on the plot of the regulatory region of the CNRIP1 gene (5` → 3`):
CNRIP1_g GCCAGACCCTCGCCCAGACA
CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
CNRIP1_h CCTGCTCTTTCATCGGCGA;
- for specific primers and probe on the plot of the regulatory region of the ELMO1 gene (5` → 3`):
ELMO1_g GGGTCGCCGGAGCTCTGA
ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
ELMO1_h CCTGCTCTTTCATCGGCCG;
- for specific primers and probe on the site of the regulatory region of the ESR1 gene (5` → 3`):
ESR1_g CGCAGGGCAGAAGGCTCAGAA
ESR1_z FAM-TGCTCTTTTTTCCAGGTGGCCCGCC-BHQ1
ESR1_h CCTGCTCTTTCATCGGTGT;
- for specific primers and probe on the regulatory region of the FBN1 gene (5` → 3`):
FBN1_g GTAGCGGCCACGACTGGGA
FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
FBN1_h CCTGCTCTTTCATCGGCGG;
- for specific primers and probe per region of the regulatory region of the RXRg gene (5` → 3`):
RXRg_g GCCGCCGTCACCGCTACT
RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1
RXRg_h CCTGCTCTTTCATCGGCCG;
- for specific primers and probe per region of the regulatory region of the RYR2 gene (5` → 3`):
RYR2_g GGGGACCACGGAGGCGACT
RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
RYR2_h CCTGCTCTTTCATCGGCGT;
- for specific primers and probe on the plot of the regulatory region of the SEPT9b gene (5` → 3`):
SEPT9b_g GCAGGAGGCTGTATTTGGG
SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
SEPT9b_h CCTGCTCTTTCATCGGCGG;
- for specific primers and probe on the regulatory region of the SOCS3 gene (5` → 3`):
SOCS3_g CAGTCCCGGGGGCCCTTCT
SOCS3_z FAM-TGCTCCCCACCCGGCCACACTACTCC-BHQ1
SOCS3_h CCTGCTCTTTCATCGGCGG;
- for specific primers and probe per region of the regulatory region of the UCHL1 gene (5` → 3`):
UCHLl_g GCAGAACCAAGCGAGGGGGGAA
UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
UCHLl_h CCTGCTCTTTCATCGGCTG,
where g is the genomic primer (genome); z — fluorescently-labeled probe (zond); h - hybrid primer (hybrid); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

Images