RU2392795C2 - Nucleic acid structure and methods of obtaining oil with modified composition from seeds - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: transformed soya bean seeds contain a nucleic acid sequence identical to a fragment of soya bean intron FAD2-1A and a nucleic acid identical to a fragment of soya bean FADB gene. Seeds of the transformed plant, as well as oil and flour obtained therefrom contain oleic acid in amount ranging from approximately 42 wt % to approximately 85 wt % of the total content of fatty acids. Content of saturated fatty acids is less than 8 wt % of the total amount of fatty acids.

EFFECT: higher fatty acid content.

28, 37 dwg, 26 tbl, 31 ex

Description

Cross reference to related applications

This application claims under Section 35 of the U.S. Code to prioritize provisional patent application US No. 60/772614, entitled “Modified Gene Silencing,” which was filed February 13, 2006; US Provisional Application No. 60/781519, entitled “Soybean Seed and Oil Compositions and Method for Making Same,” which was filed March 10, 2006; and US Patent Application No. 11/376328, entitled “Nucleic Acid Constructs and Methods for Producing Altered Seed Oil Compositions”, which was filed March 16, 2006.

Include a sequence list

The present description of the invention includes, by reference, a paper copy of the sequence list and a computer form of the sequence list on a diskette containing a file named “Omni2 AS FILED.txt” of 60,690 bytes (measured in MS-DOS), which was recorded on September 25, 2003. and filed in US patent application No. 10/669888. The present description of the invention includes, by reference, a paper copy of the sequence list and a computer form of the sequence list on a diskette containing a file named “OmniChild.txt” of 61434 bytes (measured in MS-DOS), which was recorded on March 15, 2006.

FIELD OF THE INVENTION

The present invention relates to recombinant nucleic acid molecules, constructs and other agents associated with the coordinated manipulation of many genes in the pathway of fatty acid synthesis. In particular, the agents of the present invention are associated with a simultaneous increase in the expression of certain genes in the synthesis of fatty acids and inhibition of the expression of other genes in the same way. The present invention also relates to plants containing such agents, and in particular to plants containing such constructs that are characterized by altered seed oil formulations.

State of the art

Vegetable oils are used in various fields. New compositions of vegetable oils and more advanced methods for producing oil compositions from biosynthesized or natural plant sources are needed. Different fatty acid formulations are desirable depending on the intended use of the oil. Plants, in particular species that synthesize large amounts of oil in seeds, are an important source of oils for both food and industrial use. Seed oils are almost entirely composed of triacylglycerols, in which the fatty acids are esterified into the three hydroxyl groups of glycerol.

Soybean oil usually contains about 16-20% saturated fatty acids: 13-16% palmitate and 3-4% stearate. See publication of Gunstone et al., The Lipid Handbook, Chapman & Hall, London (1994). Soybean oils were modified by various selection methods in accordance with the requirements of specific markets. However, there is still no soybean oil that meets the requirements of major consumers, such as the food industry, which uses salad dressing oil, baking oil and frying oil, and industrial markets where soybean oil is used for the production of bio-diesel and biological lubricating oils. Previously used soybean oils were either too expensive or lacked an important food grade property, such as oxidation stability, good fried food or saturated fat content, or an important biofuel property, such as the required release of nitric oxide, cold resistance or fluidity in the cold.

Higher plants synthesize fatty acids in accordance with the usual metabolic pathway, which is the pathway fatty acid synthetase (FAS), localized in plastids. β-Ketoacyl-ACP synthases are important synthesis-limiting enzymes in plant cell FAS and exist in several variants. β-Ketoacyl-ACP synthase I catalyzes chain elongation to form palmitoyl-ACP (C16: 0), while β-ketoacyl-ACP synthase II catalyzes chain elongation to form stearoyl-ACP (C18: 0). β-Ketoacyl-ACP synthase IV is a variant of β-ketoacyl-ACP synthase II and can also catalyze chain extension to 18: 0-ACP. In soybeans, the main FAS products are 16: 0-ACP and 18: 0-ACP. Desaturation of 18: 0-ACP with the formation of 18: 1-ACP is catalyzed by a soluble delta-9-desaturase localized in plastids (also called “stearoyl-ACP desaturase”). See Voelker et al., 52 Annu. Rev. Plant Physiol. Plant Mol. Biol. 335-61 (2001).

FAS and delta-9 desaturase products in plastids, 16: 0-ACP, 18: -ACP and 18: 1-ACP, are hydrolyzed by specific thioesterases (FAT). Plant thioesterases can be assigned to two gene families based on sequence homology and substrate preference. The first family, FATA, includes long-chain acyl-ACP-thioesterases with primarily 18: 1-ACP activity. Enzymes of the second family, FATB, typically use 16: 0-ACP (palmitoyl-ACP), 18: 0-ACP (stearoyl-ACP) and 18: 1-ACP (oleoyl-ACP). Such thioesterases play an important role in determining the chain length during the biosynthesis of new fatty acids in plants; therefore, these enzymes can be used for various modifications of fatty acid compositions, in particular, for determining the relative ratios of different fatty acid groups present in seed oils.

The reaction products FATA and FATB, free fatty acids, are removed from plastids and converted into the corresponding esters of acyl-CoA. Acyl-CoA are substrates for the lipid biosynthesis pathway (Kennedy pathway), which is localized in the endoplasmic reticulum (ER). This pathway is responsible for the formation of membrane lipids, as well as for the biosynthesis of triacylglycerols, which form seed oil. In the endoplasmic reticulum there are additional membrane-forming desaturases that can further desaturate 18: 1 into polyunsaturated fatty acids. Delta-12 desaturase (FAD2) catalyzes the introduction of a double bond at 18: 1 to form linoleic acid (18: 2). Delta-15 desaturase (FAD3) catalyzes the introduction of a double bond at 18: 2 to form linolenic acid (18: 3).

Many complex biochemical pathways are currently susceptible to genetic manipulation, usually by suppressing or overexpressing individual genes. Further exploiting the potential for genetic manipulation of plants requires coordinated manipulation of many genes along the way. Various methods have been used to combine transgenes in a single plant, which include crossbreeding, retransformation, cotransformation, and the use of linked transgenes. For coordinated suppression of many endogenous plant genes, a chimeric transgene with associated incomplete gene sequences can be used. Designs based on viral polyproteins can be used to simultaneously introduce several coding genes into plant cells. See publication Halpin et al., Plant Mol. Biol. 47: 295-310 (2001).

Thus, the desired plant phenotype may require the expression of one or more genes and at the same time reduce the expression of another gene or genes. Therefore, there is a need for the simultaneous overexpression of one or more genes and the suppression or reduction of the expression of another gene or genes in plants using one transgenic construct.

SUMMARY OF THE INVENTION

The present invention relates to one or more recombinant nucleic acid molecules which, when introduced into a cell or organism, are able to suppress, at least partially reduce, reduce, significantly reduce or effectively eliminate the expression of at least one or more endogenous RNA FAD2, FAD3 or FATB and at the same time, coexpress, simultaneously express or coordinate production of one or more RNAs or proteins transcribed from the gene encoding beta-ketoacyl-ACP synthase I, beta- etoatsil-ACP synthase IV, delta-9-desaturase or CP4 EPSPS. The present invention also relates to plant cells and plants transformed with one or more nucleic acid molecules, seeds, oil and other products obtained from transformed plants.

The present invention also relates to a recombinant nucleic acid molecule comprising a first set of DNA sequences which, when expressed in a host cell, is capable of suppressing the endogenous expression of at least one, preferably two genes selected from the group consisting of FAD2, FAD3 and FATB genes; and a second set of DNA sequences, which, when expressed in a host cell, is capable of increasing the endogenous expression of at least one gene selected from the group consisting of beta-ketoacyl-ACP synthase I gene, beta-ketoacyl-ACP synthase IV gene, delta gene -9-desaturases and CP4 EPSPS.

The present invention further relates to a recombinant nucleic acid molecule containing a first set of DNA sequences which, when expressed in a host cell, is capable of forming a dsRNA construct and inhibiting endogenous expression of at least one, preferably two genes selected from the group consisting of FAD2, FAD3 and FATB, wherein the first set of DNA sequences includes a first non-coding sequence expressing a first RNA sequence that is at least 90% identical to the non-coding region of the FAD2 gene, the first antisense sequence expressing the first antisense RNA sequence capable of forming a double-stranded RNA molecule with the first RNA sequence, the second non-coding sequence expressing the second RNA sequence, which is at least 90% identical to the non-coding region of the FATB gene, and the second antisense sequence expressing a second antisense RNA sequence capable of forming a double-stranded molecule RNA with a second RNA sequence; and a second set of DNA sequences, which, when expressed in a host cell of a method, increase the endogenous expression of at least one gene selected from the group comprising beta-ketoacyl-ACP synthase I gene, beta-ketoacyl-ACP synthase IV gene, delta gene -9-desaturases and CP4 EPSPS.

The present invention relates to methods for transforming plants using these recombinant nucleic acid molecules. These methods include a method for creating a transformed plant with a high content of oleic acid, a reduced content of saturated fatty acids and a reduced content of polyunsaturated fatty acids in a seed, which comprises (A) transforming a plant cell with a recombinant nucleic acid molecule containing the first set of DNA sequences, which, when expressed in the host cell is capable of suppressing the endogenous expression of at least one, preferably two genes selected from PPA, including the FAD2, FAD3 and FATB genes, and a second set of DNA sequences, which, when expressed in a host cell, can increase the endogenous expression of at least one gene selected from the group comprising the beta-ketoacyl-ACP synthase I gene, beta gene β-ketoacyl ACP synthase IV, delta 9 desaturase gene and CP4 EPSPS; and (B) growing a transformed seed-forming plant with a high content of oleic acid, a reduced content of saturated fatty acids and a reduced content of polyunsaturated fatty acids compared to a seed of a plant having a similar genetic environment but not containing a recombinant nucleic acid molecule.

The present invention further relates to methods for transforming plant cells with recombinant nucleic acid molecules. These methods include a method for changing the composition of a plant cell oil, which comprises (A) transforming a plant cell with a recombinant nucleic acid molecule comprising a first set of DNA sequences that, when expressed in a host cell, is capable of suppressing the endogenous expression of at least one, preferably two genes selected from the group comprising the FAD2, FAD3 and FATB genes, and the second set of DNA sequences, which, when expressed in a host cell, is capable of increasing endogenous e SPRESSO at least one gene selected from the group consisting of a beta-ketoacyl-ACP synthase I, gene beta-ketoacyl-ACP synthase IV, the gene of delta-9-desaturase and CP4 EPSPS; and (B) growing a plant cell under conditions of transcription initiation of the first set of DNA sequences and the second set of DNA sequences, thereby changing the composition of the oil compared to a plant cell having a similar genetic environment but not containing a recombinant nucleic acid molecule.

The present invention also relates to a transformed plant containing a recombinant nucleic acid molecule comprising a first set of DNA sequences which, when expressed in a host cell, is capable of suppressing endogenous expression of at least one, preferably two genes selected from the group consisting of FAD2, FAD3 and FATB, and a second set of DNA sequences that, when expressed in a host cell, is capable of increasing the endogenous expression of at least one gene selected from a group comprising the beta-ketoacyl-ACP synthase I gene, the beta-ketoacyl-ACP synthase IV gene, the delta-9 desaturase gene and CA4 EPSPS. The present invention further relates to a transformed soybean plant with seed, the oil composition of which comprises 55-80 wt.% Oleic acid, 10-40 wt.% Linoleic acid, 6 wt.% Or less linolenic acid and 2-8 wt.% Saturated fatty acids, to the feed product, parts of the plant and seed obtained from this plant. Another embodiment of the present invention relates to a transformed soybean plant with seed, the oil of which comprises about 65-80% oleic acid, about 3-8% saturated fatty acids and about 12-32% polyunsaturated fatty acids. The present invention also relates to a feed product, plant parts, and seed obtained from such a plant. Another embodiment of the present invention relates to a transformed soybean plant with seed, the oil of which comprises about 65-80% oleic acid, about 2-3.5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids. The present invention also relates to a feed product, plant parts, and seed obtained from such a plant.

The present invention relates to soybean seed whose oil contains 55-80 wt.% Oleic acid, 10-40 wt.% Linoleic acid, 6 wt.% Or less linolenic acid and 2-8 wt.% Saturated fatty acids, and also applies to soybean seed, whose oil contains 65-80 wt.% oleic acid, 10-30 wt.% linoleic acid, 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids. Another embodiment of the present invention relates to soybean seed, which comprises about 65-80% oleic acid, about 3-8% saturated fatty acids, and about 12-32% polyunsaturated fatty acids. Another embodiment of the present invention relates to soybean seed, the oil of which comprises about 65-80% oleic acid, about 2-3.5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids.

The present invention also relates to soy products, the oil composition of which comprises 69-73 wt.% Oleic acid, 21-24 wt.% Linoleic acid, 0.5-3 wt.% Linoleic acid and 2-3 wt.% Saturated fatty acids.

The crude soybean oil of the present invention has a composition comprising 55-80 wt.% Oleic acid, 10-40 wt.% Linoleic acid, 6 wt.% Or less linolenic acid and 2-8 wt.% Saturated fatty acids. Another crude soybean oil of the present invention has a composition comprising 65-80 wt.% Oleic acid, 10-30 wt.% Linoleic acid, 6 wt.% Or less linolenic acid and 2-8 wt.% Saturated fatty acids. In another embodiment, the crude soybean oil of the present invention has a composition comprising about 65-80% oleic acid, about 3-8% saturated fatty acids, and about 12-32% polyunsaturated fatty acids. In another embodiment, the crude soybean oil of the present invention has a composition comprising about 65-80% oleic acid, about 2-3.5% saturated fatty acids, and about 16.5-33% polyunsaturated fatty acids.

The present invention also relates to soybean seed, the oil of which comprises from about 42 wt.% To about 85 wt.% Oleic acid and from about 8 wt.% To about 1.5 wt.% Of saturated fatty acids. In another embodiment, the soybean seed of the present invention has an oil composition comprising from about 42 wt.% To about 85 wt.% Oleic acid, from about 8 wt.% To about 1.5 wt.% Of saturated fatty acids, less than 35 wt.% linolenic acid, while the combined amount of oleic acid and linolenic acid is from about 65 wt.% to about 90 wt.% of the total oil composition; and said seed contains in the host cell a recombinant nucleic acid molecule with a DNA sequence comprising a FAD2-1 intron fragment of about 50 to about 400 consecutive nucleotides in length, 3'-UTR FATB and 5'-UTR FATB, heterologous beta-ketoacyl-ACP synthase IV and heterologous delta-9 desaturase.

The soybean seed of the present invention may have an oil composition comprising from about 50 wt.% To about 80 wt.% Oleic acid, from about 8 wt.% To about 1.5 wt.% Of saturated fatty acids, from about 2 wt.% up to about 45 wt.% linoleic acid, from about 4 wt.% to about 14 wt.% linolenic acid, while the combined amount of oleic acid and linolenic acid is from about 65 wt.% to about 90 wt.% of the total oil composition , and said seed contains a recombinant nucleic acid molecule with a DNA sequence comprising an int FAD2-1 in length from about 50 to about 400 consecutive nucleotides, coding region, and the TDB FATB 42 contiguous nucleotides of 5'-UTR FATB. In another embodiment, the soybean seed may comprise a recombinant nucleic acid molecule with a DNA sequence that inhibits the endogenous expression of FAD2 and FATB, said seed having an oil composition comprising 46-75 wt.% Oleic acid, 1.5-8.5 wt. .% saturated fatty acids, 2.5-38 wt.% linoleic acid and 4.5-17.5 wt.% linolenic acid.

The present invention also relates to a method for reducing the amount of suppression of the FAD2 gene as compared to the amount of suppression of the FAD2 gene achieved by expression of a dsRNA construct containing the recombinant FAD2 sequence including the entire FAD2 intron or all of the FAD2 UTR, by: i) expressing the recombinant FAD2 sequence in plant a cell, wherein the recombinant FAD2 sequence isolated from the endogenous FAD2 gene in the plant cell contains a FAD2 intron fragment or a FAD2 UTR fragment, and ii) suppressing endogenous g on FAD2 recombinant FAD2 sequence, wherein the amount of FAD2 gene suppression is less than the gene expression achieved by the expression of dtsRNKi construct comprising recombinant FAD2 sequence, including entire FAD2 intron or the entire UTR FAD2.

The present invention also relates to methods for changing the composition of oil in a plant cell by: transforming a plant cell with a FAD2 recombinant sequence isolated from a portion of the endogenous FAD2 gene, which includes a FAD2 intron fragment or a FAD2 UTR fragment, and growing a plant cell under conditions of transcription initiation of the FAD2 recombinant sequence, as a result, the composition of the oil changes compared to a plant cell having a similar genetic environment but not containing a recombinant sequence FAD2 operation. Another embodiment of the invention relates to a method for increasing oleic acid content and reducing saturated fatty acids in a plant seed by: i) shortening the length of the first recombinant FAD2 sequence to at least partially reduce the amount of suppression of the FAD2 gene in a plant transformed with the first recombinant FAD2 sequence, according to compared with the amount of suppression of the FAD2 gene in a plant cell having a similar genetic environment and a second recombinant sequence of FAD2, which consists of a more endogenous FAD2 sequence than the first recombinant FAD2 sequence; ii) expression of a recombinant FATB sequence capable of at least partially reducing the expression of the FATB gene in a plant cell compared to the inhibition of FATB in a plant cell having a similar genetic environment but not containing a recombinant FATB sequence; iii) growing a plant with a recombinant nucleic acid molecule containing a first recombinant FAD2 sequence and a recombinant FATB sequence; and iv) cultivating a plant forming a seed with a lower saturated fatty acid content compared to a seed of a plant having a similar genetic environment but not containing the first recombinant the FAD2 sequence and the recombinant FATB sequence.

Another embodiment of the present invention relates to a method for producing a transformed plant, the seed of which is characterized by a lower content of saturated fatty acids, by: transforming a plant cell with a recombinant nucleic acid molecule containing a recombinant DNA sequence that suppresses the endogenous expression of FAD2 and FATB, which includes the nucleic acid sequence of the recombinant gene FAD2 and recombinant FATB gene, while the FAD2 sequence does not contain the entire sequence elnost FAD2 intron; and growing a transformed plant forming a seed with a reduced content of saturated fatty acids, compared with the seed of a plant having a similar genetic environment, but not containing a recombinant DNA sequence.

Another embodiment of the present invention relates to a method for modulating the composition of fatty acids in oil from temperate oilseeds by isolating a genetic element of at least 40 nucleotides in length, capable of suppressing the expression of an endogenous gene in a fatty acid synthesis pathway; creating several shortened fragments of a genetic element; introducing all the truncated fragments into the plant cell of the temperate oilseed crop in order to create a transgenic plant and select a transgenic plant containing a truncated fragment of a certain length and a sequence that provides the desired change in the composition of fatty acids of the oil from the seeds.

The present invention also relates to soybean seed, the oil composition of which is characterized by a significantly lower content of saturated fatty acids and a moderately high content of oleic acid and which contains a DNA sequence that suppresses the endogenous expression of FAD2 in a plant cell, the DNA sequence having a recombinant FAD2 sequence including an intron fragment FAD2. Another embodiment of the present invention relates to a nucleic acid molecule comprising an FAD2-1A intron sequence of about 60 to about 320 consecutive nucleotides in length. An alternative embodiment of the present invention also relates to a soybean seed containing a first recombinant DNA sequence that inhibits the expression of an endogenous soybean FAD2-1 gene comprising a soybean FAD2-1 intron, and a second recombinant DNA sequence that expresses elevated levels of a gene selected from the group including the KAS I gene, delta-9 desaturase, KAS IV, and combinations thereof.

The present invention also relates to a plant cell of soybean seed, characterized by a composition of fatty acids of seed oil, in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content and the content of saturated fatty acids is less than 8 wt. .% of the total content of fatty acids. The present invention also relates to a plant cell of soybean seed, characterized by an oil composition, in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content and linolenic acid is less than about 3 wt.% Of the total fatty acid content.

The present invention also relates to a nucleic acid nucleic acid molecule with an FAD2-1A intron sequence of about 60 to about 320 consecutive nucleotides in length. The invention also includes a recombinant DNA construct comprising a soybean intron FAD2-1 fragment of about 20 to about 420 consecutive nucleotides in length and a soybean FATB gene fragment of from about 40 to about 450 consecutive nucleotides in length. Another embodiment of the invention relates to a recombinant nucleic acid molecule comprising a first DNA sequence that suppresses endogenous expression of soybean FAD2-1 and FATB, which comprises an FAD2-1 intron fragment of about 20 to about 420 consecutive nucleotides in length, 3'-UTR FATB soy, 5'-UTR of soybean FATB or the coding region of CTP, and a second recombinant DNA sequence that enhances the expression of at least one of the genes selected from the group consisting of beta-ketoacyl-ACP synthase IV and delta-9-desaturase.

The present invention also relates to unmixed soybean oil in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content and the saturated fatty acid content is from about 1.5 wt.% To about 8 wt. .% of the total content of fatty acids; unmixed soybean oil in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total fatty acid content and the saturated fatty acid content is about 8 wt.% or less of the total fatty acid content; unmixed soybean oil in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total fatty acid content and linolenic acid is less than 3 wt.% of the total fatty acid content; and unmixed soybean oil in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total fatty acid content, the saturated fatty acid content is about 8 wt.% or less of the total fatty acid content and linolenic content acid is about 1.5 wt.% or less of the total fatty acid content.

The present invention also relates to soybean flour obtained from soybean seed, characterized by the composition of fatty acids in seed oil, in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acids and saturated fatty acids less than 8 wt.% of the total content of fatty acids. Also included in the scope of the present invention is soybean flour derived from soybean seed, characterized by a fatty acid composition in the seed oil, in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content and linolenic acid content less than about 3 wt.% of the total fatty acid content.

The present invention also relates to a method for reducing the amount of suppression of the FAD2 gene as compared to the amount of suppression of the FAD2 gene resulting from expression of a dsRNA construct containing a heterologous FAD2 sequence including the entire FAD2 intron or all of the FAD2 UTR, by: i) expressing the heterologous FAD2 sequence in plant a cell, wherein the heterologous FAD2 sequence isolated from the endogenous FAD2 gene of the plant cell consists of a FAD2 intron fragment or a FAD2 UTR fragment, and ii) suppressing endogenous the FAD2 gene by the heterologous sequence of FAD2, wherein the amount of suppression of the FAD2 gene is less than the amount of gene expression resulting from the expression of the heterologous FAD2 sequence, including the entire FAD2 intron or the entire FAD2 UTR.

The present invention also relates to a method for changing the composition of a plant cell oil by transforming a plant cell with a FAD2 heterologous sequence isolated from a portion of the endogenous FAD2 gene, which includes a FAD2 intron fragment or a UTR FAD2 fragment, and growing a plant cell under conditions of transcription initiation of the heterologous FAD2 sequence, resulting of which there is a change in the composition of the oil compared with a plant cell having a similar genetic environment, but not containing a heterologous FAD2 sequence.

The present invention also relates to a method for increasing the content of oleic acid and reducing the content of saturated fatty acids in a plant seed, which comprises: i) shortening the length of the first heterologous FAD2 sequence to at least partially reduce the amount of suppression of the FAD2 gene in a plant transformed with the first heterologous FAD2 sequence, compared with the amount of suppression of the FAD2 gene in a plant cell having a similar genetic environment and a second heterologous sequence of FAD2, which consists of a more endogenous FAD2 sequence than the first heterologous FAD2 sequence, ii) expression of a heterologous FATB sequence capable of at least partially reducing the expression of the FATB gene in a plant cell compared to the inhibition of FATB in a plant cell having a similar genetic environment but not containing a heterologous FATB sequence, iii) growing a plant comprising a genome with a first heterologous FAD2 sequence and a heterologous FATB sequence, and iv) cultivating vanie plants forming seed with reduced saturated fatty acid content compared to seed of a plant having a similar genetic background but lacking the first heterologous FAD2 sequence and the heterologous FATB.

The present invention also relates to a method for modulating the composition of fatty acids in oil from temperate oilseeds, isolating a fragment of a genetic element of at least 40 nucleotides in length, capable of suppressing the expression of an endogenous gene in the synthesis of fatty acids; introducing the specified genetic element into the plant cell of the oilseed crop of the temperate zone; creating a transgenic plant and selecting a seed of a transgenic plant containing said genetic element that modulates the composition of fatty acids in seed oil.

Another embodiment of the present invention relates to a soybean seed cell characterized by a fatty acid composition in the seed oil, wherein the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content and the saturated fatty acid content is less than 8 wt.% Of the total content of fatty acids.

The present invention also relates to a heterologous nucleic acid molecule comprising a soybean FAD2-1 intron fragment of about 20 to about 420 consecutive nucleotides in length and a soybean FATB gene fragment of about 40 to about 450 consecutive nucleotides in length. Another embodiment of the present invention relates to a heterologous nucleic acid molecule comprising a nucleic acid sequence comprising a soybean FAD2-1 intron fragment of about 20 to about 420 nucleotides in length, a soybean FATB gene fragment of from about 40 to about 450 nucleotides in length, and a nucleic acid sequence, which increases the expression of beta-ketoacyl-ACP synthase IV or delta-9 desaturase or both together.

The present invention also relates to a method for reducing the content of linolenic acid in a soybean seed by: i) introducing a heterologous nucleic acid molecule into the soybean cell containing a nucleic acid sequence of at least two members of the FAD3 gene family; ii) expression of a nucleic acid sequence from a FAD2 gene capable of at least partially reducing the expression of an endogenous FAD3 gene in a plant cell; iii) growing a plant cell comprising a gene with a nucleic acid sequence of at least two members of the FAD3 gene family; and iv) cultivating said plant cell with a reduced linolenic acid content compared to a plant cell having a similar genetic environment but not containing at least two members of the FAD3 gene family. The present invention also relates to the construction of recombinant DNA with DNA fragments of at least two members of the FAD3 gene family.

The present invention also relates to unmixed soybean oil characterized by a fatty acid composition, in which the oleic acid content is from about 42 wt.% To about 85 wt.% Of the total fatty acid content, the saturated fatty acid content is about 8 wt.% Or less of the total fatty acid content and the content of linolenic acid is about 1.5 wt.% or less of the total fatty acid content.

Brief Description of the Figures

Figure 1-4 shows a typical configuration of a nucleic acid molecule.

5 (a) to (d) and 6 (a) to (c) illustrate illustrative configurations of a first set of DNA sequences.

7-20 depict nucleic acid molecules of the present invention.

On Fig shows the construction of pMON68537.

Figure 22 shows the construction of pMON68539.

DETAILED DESCRIPTION OF THE INVENTION

Description of nucleic acid sequences

SEQ ID NO: 1 is the nucleic acid sequence of intron 1 FAD2-1A.

SEQ ID NO: 2 is the nucleic acid sequence of intron 1 FAD2-1B.

SEQ ID NO: 3 is the nucleic acid sequence of the FAD2-1B promoter.

SEQ ID NO: 4 is the nucleic acid sequence of the genomic clone FAD2-1A.

SEQ ID NO: 5 and 6 are nucleic acid sequences, respectively, 3'-UTR and 5'-UTR FAD2-1A.

SEQ ID NO: 7-13 are nucleic acid sequences of introns 1, 2, 3A, 4, 5, 3B, and 3C of FAD3-1A, respectively.

SEQ ID NO: 14 is the nucleic acid sequence of intron 4 FAD3-1C.

SEQ ID NO: 15 is the nucleic acid sequence of the incomplete genomic clone FAD3-1A.

SEQ ID NO: 16 and 17 are nucleic acid sequences of 3'-UTR and 5'-UTR of FAD3-1A, respectively.

SEQ ID NO: 18 is the nucleic acid sequence of the incomplete genomic clone FAD3-1B.

SEQ ID NOS: 19-25 are nucleic acid sequences of introns 1, 2, 3A, 3B, 3C, 4, and 5 of FAD3-1B, respectively.

SEQ ID NOs: 26 and 27 are nucleic acid sequences of 3'-UTR and 5'-UTR of FAD3-1B, respectively.

SEQ ID NO: 28 is the nucleic acid sequence of the genomic clone FATB-1.

SEQ ID NOS: 29-35 are nucleic acid sequences for FATB-1 introns I, II, III, IV, V, VI, and VII, respectively.

SEQ ID NO: 36 and 37 are nucleic acid sequences of 3'-UTR and 5'-UTR of FATB-1, respectively.

SEQ ID NO: 38 is the nucleic acid sequence of the KAS I Cuphea pulcherrima gene.

SEQ ID NO: 39 is the nucleic acid sequence of the KAS IV Cuphea pulcherrima gene.

SEQ ID NOs: 40 and 41 are nucleic acid sequences of the delta-9 desaturase genes, respectively, of Ricinus communis and Simmondsia chinensis.

SEQ ID NO: 42 is the nucleic acid sequence of FATB-2 cDNA.

SEQ ID NO: 43 is the nucleic acid sequence of the genomic clone FATB-2.

SEQ ID NOS: 44-47 are nucleic acid sequences of FATB-2 introns I, II, III, and IV, respectively.

SEQ ID NO: 48-60 are nucleic acid sequences of polymerase chain reaction primers (PCR).

SEQ ID NOs: 61 and 62 are nucleic acid sequences of soybean 3'-UTR and 5'-UTR, respectively.

Definitions of terms

“ACP” means an acyl carrying protein. “Changed seed oil composition” means the composition of the seed oil of a transgenic or transformed plant of the present invention with altered or modified levels of fatty acids compared to seed oil of a plant having a similar genetic environment but not undergoing transformation.

“Antisense suppression” means gene-specific silencing induced by the introduction of an antisense RNA molecule.

“Coexpression of more than one agent, such as mRNA or protein” means the simultaneous expression of an agent in an overlapping time frame and in the same cell or tissue along with another agent. “Coordinated expression of more than one agent” means the co-expression of several agents that produce transcripts and proteins using a common or identical promoter.

“Complement” of a nucleic acid sequence means complement of a sequence throughout its length.

“Co-suppression” means a decrease in expression levels, usually at the level of RNA, of a particular endogenous gene or gene family as a result of the expression of a homologous sense construct capable of transcribing mRNA with the same number of strands as an endogenous gene transcript. Napoli et al., Plant Cell 2: 279-289 (1990); van der Krol et al., Plant Cell 2: 291-299 (1990).

“Unrefined soybean oil” means soybean oil extracted from soybean seeds that has not been refined, processed or mixed, although tar substances may be removed from such oil.

“STR” means a chloroplast transit peptide encoded by a “chloroplast transit peptide coding sequence”.

For proteins and nucleic acids, the term “isolated” means direct (for example, determining the sequence of a known protein or nucleic acid and creating a protein or nucleic acid with a sequence similar to at least partially the sequence of a known protein or nucleic acid) or indirect (for example, obtaining protein or nucleic acid from an organism related to a known protein or nucleic acid) obtaining a protein or nucleic acid from a known protein or nucleic acid slots. One of ordinary skill in the art will recognize other methods for “isolating” a protein or nucleic acid from a known protein or nucleic acid.

Double-stranded RNA (“dsRNA”), interfering double-stranded RNA (“dsRNA”) and interfering RNA (“RNAi”) are used to determine gene-specific silencing caused by the introduction of a construct capable of transcribing a molecule of at least partially double-stranded RNA. “DsRNA molecule” and “RNAi molecule” means a region of an RNA molecule containing segments with complementary nucleotide sequences that can hybridize with each other and form double-stranded RNA. Such double-stranded RNA molecules, when introduced into a cell or organism, are capable of at least partially reducing the level of mRNA present in the cell or cell of the body. In addition, dsRNA can be created by assembling in vivo the corresponding DNA fragments by illegal recombination and site-specific recombination described in international patent application No. PCT / US2005 / 004681, filed February 11, 2005, which is fully incorporated into the present description inventions by reference.

“Exon” means a segment of nucleic acid molecules, usually DNA, that encodes part or all of an expressed protein.

“Fatty acid” means free fatty acids and acyl groups of fatty acids.

“Gene” means a nucleic acid sequence that includes a 5'-terminal promoter region associated with gene product expression, any intron and exon regions, 3'- or 5'-terminal untranslated regions associated with gene product expression.

“Gene silencing” means suppressing gene expression or decreasing gene expression.

“Gene family” means two or more genes in the body that encode proteins having similar functional properties, and “member of the gene family” means any gene in the gene family found in the plant’s genetic material, for example, “member of the FAD2 gene family” is any FAD2 gene, found in the genetic material of the plant. An example of two members of a gene family are FAD2-1 and FAD2-2. The gene family can be further classified by nucleic acid sequence similarity. The FAD2 gene, for example, includes alleles at a given locus. A member of the gene family is preferably characterized by at least 60%, more preferably at least 70%, more preferably at least 80%, the nucleic acid sequence identity in the gene coding sequence.

“Heterologous” means not existing together in vivo.

A nucleic acid molecule is considered “introduced” if it is introduced into a cell or organism as a result of human manipulation, regardless of the method of administration. Examples of introduced nucleic acid molecules include, but are not limited to, nucleic acids that have been introduced into cells by transformation, transfection, injection, and projection, and nucleic acids introduced into the body by methods that include, but are not limited to, conjugation, endocytosis, and phagocytosis.

“Intron” means a segment of nucleic acid molecules, usually DNA, that does not encode part or all of the expressed protein and which, under endogenous conditions, is transcribed into RNA molecules but spliced from endogenous RNA before the RNA is translated into the protein. “Intron dsRNA molecule” and “intron RNAi molecule” mean a double-stranded RNA molecule which, when introduced into a cell or organism, is capable of at least partially reducing the level of mRNA present in a cell or cell of an organism, while the double-stranded RNA molecule is sufficiently identical to the gene intron present in a cell or organism to reduce the level of mRNA containing this intron sequence.

The “low saturated fatty acid” oil composition comprises from 3.6% to 8% saturated fatty acids.

“Soybean seed with an average oleic acid content” means a seed containing from 50% to 85% oleic acid in the composition of the seed oil.

The “low linolenic acid” oil composition comprises less than about 3 wt.% Linolenic acid of the total fatty acid content.

The term “non-coding” is used to define sequences of nucleic acid molecules that do not encode part or all of the expressed protein. Non-coding sequences include, but are not limited to introns, promoter regions, 3'-terminal untranslated regions (3'-UTR) and 5'-terminal untranslated regions (5'-UTR).

The term “oil composition” is used to determine the content of fatty acids.

A promoter that is “operably linked” to one or more nucleic acid sequences is capable of causing expression of one or more nucleic acid sequences, including many coding or non-coding nucleic acid sequences having a polycistronic configuration.

“Physically linked” nucleic acid sequences are nucleic acid sequences located in a single nucleic acid molecule.

“Plant” means whole plants, plant organs (eg leaves, stems, roots, etc.), seeds, plant cells and their offspring.

The term “plant cell” means, but is not limited to, suspension seed cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.

“Plant promoters” means, but are not limited to, viral plant promoters, promoters isolated from plants, and synthetic promoters that are able to function in a plant cell by stimulating mRNA expression.

“Polycistronic gene” or “polycistronic mRNA” means any gene or mRNA containing transcribed nucleic acid sequences that correspond to nucleic acid sequences of more than one gene that is targeted for suppression or expression. It is known that such polycistronic genes or mRNAs may contain sequences corresponding to introns, 5'-UTR, 3'-UTR, coding sequences of transit peptides, exons, or combinations thereof, and that a recombinant polycistronic gene or mRNA may contain, but is not limited to, sequences corresponding to one or more UTRs from one gene and one or more introns from the second gene.

“Seed-specific promoter” means a promoter that is preferably or exclusively active in the seed. “Preferred activity” means a promoter activity that is significantly higher in seed than in other tissues, organs or organelles of a plant. The term “seed-specific” means, but is not limited to, activity in the aleurone layer, endosperm and / or seed germ.

“Suppression of the semantic intron” means silencing a gene caused by the introduction of a semantic intron or fragment thereof. The suppression of the semantic intron is described, for example, by Fillatti in PCT publication WO 01/14538 A2.

“Simultaneous expression” of several agents, such as mRNA or protein, means the expression of an agent simultaneously with another agent. Such expression can only partially overlap and can also occur in different tissues or at different levels.

“Total oil content” means the total fatty acid content, regardless of the type of fatty acid. As used herein, the definition of “total oil content” does not include the glycerol backbone.

“Transgene” means a nucleic acid sequence associated with the expression of a gene introduced into the body. A transgene includes, but is not limited to, an endogenous gene or a gene that is not found in the body in vivo. “Transgenic plant" is any plant that stably contains a transgene with the possibility of its transmission by the plant through sexual or vegetative propagation.

The “zero saturated fatty acid” oil composition includes less than 3.6% saturated fatty acids.

With reference to proteins and nucleic acids in the present description of the invention, the usual capital letters, for example “FAD2”, are used to denote an enzyme, protein, polypeptide or peptide, and the capital letters printed in italics, for example “FAD2” , are used to denote nucleic acids including not limited to genes, cDNA and mRNA. A cell or organism may contain a family of several genes encoding a particular enzyme, and the capital letter following the designation of the gene (A, B, C) means a member of the family, i.e., FAD2-1A is a member of the gene family other than FAD2-1B.

In the value used here, any specified range includes the final values of this range, unless otherwise indicated.

A. Agents

The agents of the present invention are preferably “biologically active” with respect to a structural feature, such as the ability of a nucleic acid molecule to hybridize with another nucleic acid molecule or the ability of a protein to bind to an antibody (or compete with another molecule for such binding). Alternatively, such a trait may be defined as catalytically active, and thus may include the ability of the agent to mediate a chemical reaction or response. These agents are preferably “substantially pure”. The term “substantially pure” as used herein means a molecule separated substantially from all other molecules associated with it under natural environmental conditions. More preferably, the substantially pure molecule is the predominant species present in the preparation. A substantially pure molecule can be more than 60%, more than 75%, preferably more than 90%, and most preferably more than 95%, free of other molecules (except solvent) present in the natural mixture. The definition of “essentially pure” does not include molecules in natural environmental conditions.

The agents of the present invention may also be recombinant. As used herein, the term “recombinant” means any agent (for example, including, but not limited to, DNA or a peptide) that is obtained, however, by an indirect method, as a result of the manipulation of a human nucleic acid molecule. In addition, the agents of the present invention can be labeled with reagents that facilitate the detection of this agent, for example, fluorescent labels, chemical labels and / or modified bases.

The agents of the present invention include DNA molecules containing a nucleotide sequence that can be transcribed in sense or antisense orientation, resulting in the formation of at least one RNA molecule, which is at least partially double-stranded. In a preferred embodiment, the agent of the present invention is a double-stranded RNA molecule containing a nucleotide sequence that is a fragment of FAD2, FATB or FAD2 and FATB. In another embodiment, the agent of the present invention is a DNA molecule that can be transcribed to form a nucleotide sequence in a sense or antisense orientation in a host cell. In another embodiment, the nucleic acid molecule may comprise a nucleotide sequence in a sense and antisense orientation, or in another embodiment, the nucleic acid molecule may comprise a nucleotide sequence in a sense or antisense. Such nucleotide sequences may be operably linked to the same promoter, different promoters, one promoter, or several promoters. Such nucleotide sequences can be in a single DNA molecule or in several DNA molecules.

The agents of the present invention include nucleic acid molecules containing a DNA sequence that is at least 50%, 60% or 70% identical to the coding or non-coding region of the plant or the nucleic acid sequence complementary to the coding or non-coding region of the plant over the entire length. More preferred are DNA sequences that span at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to the coding or non-coding region of the plant, or a nucleic acid sequence complementary to the coding or non-coding region of the plant.

The term "identity", as is well known in this field, means the relationship between two or more polypeptide sequences or between two or more sequences of a nucleic acid molecule, determined by comparing these sequences. In this area, the term “identity” also means the degree of affinity between the polypeptide sequences and the sequences of a nucleic acid molecule, as determined by comparing the chains of such sequences. “Identity” can be easily calculated by known methods, which include, but are not limited to, the methods described in Computational Molecular Biology , Lesk, ed., Oxford University Press, New York 1988; Biocoinputing: Informatics and Genome Projects , Smith, ed., Academic Press, New York 1993; Computer Analysis of Sequence Data, Part I , Griffin and Griffin, eds., Humana Press, New Jersey 1994; Sequence Analysis in Molecular Biology , von Heinje, Academic Press 1987; Sequence Analysis Primer , Gribskov and Devereux, cds., Stockton Press, New York 1991; and Carillo and Lipman, SIAM J Applied Math , 48: 1073 1988.

Identity determination methods are designed to identify the greatest match between the analyzed sequences. In addition, methods for determining identity are codified in publicly available programs. Computer programs that can be used to determine the identity of two sequences include, but are not limited to, GCG; a package of five BLAST programs, of which three programs are for querying nucleotide sequences (BLASTN, BLASTX and TBLASTX) and two programs are for querying protein sequences (BLASTP and TBLASTN). BLASTX is available from the NCBI and other sources, such as BLAST Manual, Altschul et al., NCBI NLM NIH, Bethesda, MD 20894; Altschul et al., J. Mol. Biol. 215: 403-410 (1990). The well-known Smith-Waterman algorithm can also be used to determine identity.

When comparing polypeptide sequences, the following parameters are typically used: algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970); comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA 89: 10915-10919 (1992); penalty for breaking: 12; penalty for gap length: 4. A program that can be used with the above parameters is a publicly available program known as the “gap program” of the Genetics Computer Group (“GCG”) company, Madison, Wisconsin. The above parameters along with the absence of a penalty for the end gap are the default parameters for peptide comparison.

When comparing the sequences of nucleic acid molecules, the following parameters are used: algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970); comparison matrix: matches - +10; mismatches = 0; penalty for breaking: 50; Penalty for gap length: 3. The “% identity” value used here is determined using the above parameters as default parameters for comparing nucleic acid molecule sequences and the GCG “gap” program, version 10.2.

Subsets of the nucleic acid sequences of the present invention include fragmented nucleic acid molecules. “Fragmented nucleic acid molecule” means a portion of a larger nucleic acid molecule and may consist of a significant portion or the largest portion of a larger nucleic acid molecule. A fragmented nucleic acid molecule may include a shorter length of oligonucleotide from about 15 to about 400 consecutive nucleotides and more preferably from about 15 to about 45 consecutive nucleotides, from about 20 to about 45 consecutive nucleotides, from about 15 to about 30 consecutive nucleotides, from about 21 up to about 30 consecutive nucleotides, from about 21 to about 25 consecutive nucleotides, from about 21 to about 24 consecutive nucleotides, from about 19 to about 25 consecutive nucleotides, or about 21 after nucleotide sequence. Fragmented nucleic acid molecules may consist of a significant portion or the largest portion of the coding or non-coding region of a plant, or alternatively may include shorter oligonucleotides. In a preferred embodiment, the fragment is 100% identical to the coding or non-coding region of the plant. In another preferred embodiment, the fragment comprises part of a larger nucleic acid sequence. In another embodiment, the fragmented nucleic acid molecule comprises a nucleic acid sequence that includes at least 15, 25, 50, 100, 200, 300, or 400 consecutive nucleotides of the nucleic acid molecule of the present invention. In a preferred embodiment, the nucleic acid molecule comprises a nucleic acid sequence that includes at least 15, 25, 50, 100, 200, 300, or 400 consecutive nucleotides of a coding or non-coding region of a plant. In a most preferred embodiment, the nucleic acid molecule comprises a nucleic acid sequence that comprises about 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, or 90% of consecutive nucleotides of the entire coding or non-coding region. In a preferred embodiment, the entire coding or non-coding region may be a genetic element selected from the whole gene, one exon, one intron, a signal sequence or untranslated region (UTR). A genetic element that does not contain the complete sequence of the entire genetic element may be a fragment of a genetic element. In a preferred embodiment of the present invention, the genetic element has a length of at least 40 nucleotides. In one embodiment of the present invention, a gene fragment is part of the entire genetic element, and such a fragment contains sequential nucleotides of about 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the total genetic element. In one embodiment of the present invention, a fragmented nucleic acid molecule corresponds to about 5% -80%, about 10% -70%, about 10% -60%, about 10% -50%, about 25% -60%, about 25% - 50%, about 40% -60%, about 40% -80%, about 50% -90% of the length of the entire genetic element.

In a preferred embodiment, the FAD2-1 intron fragment comprises from about 20 to about 420, from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 100 to about 320, from about 150 to about 200, from about 150 to about 220, from about 150 to about 400, from about 200 to about 300, or from about 300 to about 400 consecutive nucleotides. In another preferred embodiment, the FAD2-1 intron fragment has a length of about 100, about 150, about 200, about 220, about 250, about 300, about 320, or about 350 consecutive nucleotides. In another preferred embodiment, the length of the FAD2-1 intron fragment is reduced by about 20, about 40, about 60, about 80, about 100, about 120, about 140, about 160, about 180, about 180, 200, about 220, about 240, about 260, about 280, about 290, about 300, about 320, about 340, about 360, about 380, about 400 consecutive nucleotides compared with the length of SEQ ID NO: 1. In all of these fragments of the FAD2-1 intron, truncation or deletion can be initiated at the 5'-end, 3'-end or within the FAD2-1 intron. In all of these fragments of the FAD2-1 intron, the sequence of the FAD2-1 intron may be SEQ ID NO: 1.

In a preferred embodiment, the FATB gene fragment comprises from about 80 to about 450, from about 100 to about 500, from about 70 to about 500, from about 200 to about 400, from about 150 to about 300, from about 250 to about 350 , from about 200 to about 350 consecutive nucleotides of the FATB gene. In a preferred embodiment, the FATB fragment is isolated from half of all FATB nucleotides starting at the 5 ′ end. In all of these FATB fragments, truncation or deletion can be started at the 5'-end, 3'-end or within the FATB. In a preferred embodiment, the FATB fragment is isolated from half of all FATB nucleotides, starting at the 5 ′ end of FATB, from a third of all FATB nucleotides closest to the 5 ′ end. In a particularly preferred embodiment, the FATB fragment comprises a transit peptide coding sequence that preferably encodes a chloroplast transit peptide. In a particularly preferred embodiment, the FATB fragment is a fragment of a transit peptide coding sequence that preferably encodes a chloroplast transit peptide. In another particularly preferred embodiment, the FATB fragment further comprises about 20, about 25, about 30, about 35, 38, 39, 40, 41, 42, 43, about 45, about 50, about 55, or about 60 consecutive nucleotides 5'-UTR FATB. In a most preferred embodiment, the fragment includes a combination of two or more non-contiguous fragments or individual genetic elements, such as 3'-UTR FATB fused to 5'-UTR FATB. The agents of the present invention include nucleic acid molecules. For example, in one embodiment of the invention, the nucleic acid molecule of the present invention includes, but is not limited to, the intron sequences of SEQ ID NO: 19, 20, 21, 22, 23, 25, 32, 33, 34, 35, 44, 45, 46 or 47 or fragments or complements thereof. In another embodiment, the nucleic acid molecule comprises a nucleic acid sequence that, when introduced into a cell or organism, is capable of suppressing the production of RNA or protein while simultaneously expressing, coexpressing or coordinated expression of another RNA or protein. In one embodiment, the nucleic acid molecule comprises a nucleic acid sequence that, when introduced into a cell or organism, is capable of suppressing, at least partially reducing, decreasing, significantly reducing, or effectively eliminating the expression of endogenous RNA FAD2, FAD3 and / or FATB while simultaneously expressing, coexpression or coordinated expression of at least one RNA product or protein beta-ketoacyl-ACP synthase I, beta-ketoacyl-ACP synthase IV, delta-9 desaturase and / or CP4 EPSPS.

As a result of the suppression of at least a partial decrease, decrease, significant reduction or effective elimination of the expression of at least one or more endogenous genes in a plant cell, the amount of FAD2 and / or FAD3 decreases, i.e., steady-state protein levels decrease and can be reduced the percentage of polyunsaturated fatty acids such as linoleate (C18: 2) and linolenate (C18: 3). Modification of the composition of fatty acids suitable for inclusion in triacylglycerols can affect the composition of oils in a plant cell. Thus, a decrease in the expression of FAD2 and / or FAD3 can cause an increase in the proportion of monounsaturated fatty acids such as oleate (C18: 1). As the amount of FATB in the plant cell decreases, the amount of saturated fatty acids such as palmitate and stearate decreases. Thus, a decrease in FATB expression may cause an increase in the proportion of unsaturated fatty acids such as oleate (18: 1). Simultaneous suppression of the expression of FAD2, FAD3 and FATB directs the FAS path towards an increase in monounsaturated fatty acids containing 18 carbon atoms, such as oleate (C18: 1). See US patent No. 5955650.

As a result of the increase in the amount of beta-ketoacyl ACP synthase I (KAS I) and / or beta-ketoacyl ACP synthase IV (KAS IV) in the plant cell, the percentage of 16: 0-ACP can be reduced, which causes an increase in the percentage 18: 0-ACP. A larger amount of 18: 0-ACP in combination with the simultaneous suppression of one or more of the FAD2, FAD3, and FATB genes can increase the oleate content (C18: 1) in the oil. As a result of the increase in the amount of delta-9-desaturase in the plant cell, the percentage of unsaturated fatty acids can be increased, which causes a general decrease in stearate and the total content of saturated fatty acids.

These combinations of increased and decreased expression of enzymes can be manipulated to obtain oil formulations, including fatty acids, with elevated levels of oleate, decreased levels of linoleate, linolenate, stearate and / or palmitate and a reduced total saturated fatty acid content. Gene expression in plants can be enhanced by introducing additional copies of the gene coding sequences into the plant cell, or preferably by introducing additional copies of the gene coding sequences into the plant genome. Overexpression can also be achieved by increasing the activity of regulatory mechanisms that regulate gene expression, that is, increase gene expression.

The production of CP4 EPSPS in a plant cell gives the plant cell resistance or glyphosate tolerance, which is a convenient method for identifying successful transformants based on glyphosate resistance.

Suppression of gene expression in plants, also known as gene silencing, occurs both at the transcriptional level and at the post-transcriptional level. There are various methods of suppressing the expression of endogenous sequences in a host cell, which include, but are not limited to, antisense suppression, cosuppression, ribozymes, combinations of sense and antisense double-stranded interfering RNA, promoter silencing, and DNA-binding proteins, such as zinc-containing finger-type proteins. (See, for example, WO 98/53083, WO 01/14538 and US patent No. 5759829 (Shewmaker)). Some of these mechanisms are associated with nucleic acid homology at the DNA or RNA level. Such homology means the similarity of DNA or protein sequences in one form or in different species. Gene silencing occurs when the DNA sequence introduced into the host cell is so homologous to the endogenous gene that transcription of the introduced DNA sequence causes transcriptional or post-transcriptional silencing of the endogenous gene. A homology sufficient to suppress expression in a steady state may correspond to at least 50%, approximately 60%, or approximately 70% identity of the entire DNA sequence of the coding or non-coding region of the plant or of a nucleic acid sequence complementary to the coding or non-coding region of the plant. More preferred are DNA sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at at least 99% or 100% identical to the coding or non-coding region of the plant, or a nucleic acid sequence complementary to the coding or non-coding region of the plant. In plants, sequence-specific silencing can be caused by double-stranded RNA molecules. Gene silencing is often defined as double-stranded RNA (dsRNAi) interference in plants, as RNA or RNAi interference in Caenorhabditis elegans and in animals, and as suppression in fungi.

In a preferred embodiment of the invention, the nucleic acid molecule of the present invention comprises a first set of DNA sequences, each of which has sufficient homology with one or more coding or non-coding sequences of a plant gene, so that if expressed, such a sequence can effectively eliminate, significantly reduce, or at least partially reduce the level of transcript or mRNA protein encoded by the gene from which it was isolated a coding or non-coding sequence, or any gene homologous to a coding or non-coding target sequence.

In a preferred embodiment of the invention, the nucleic acid molecule of the present invention includes: (a) a first set of DNA sequences, each of which has sufficient homology with one or more coding or non-coding sequences of a plant gene, so that if expressed, such a sequence can effectively eliminate, significantly reduce or at least partially reduce the level of the transcript or protein mRNA encoded by the gene from which was isolated to a coding or non-coding sequence, or any gene homologous to a non-coding target sequence, and (b) a second set of DNA sequences, each of which has sufficient homology with the plant gene, so that if expressed, such a sequence can at least partially amplify, increase or significantly increase the level of transcript or mRNA protein encoded by this gene.

As used herein, the “totality” of DNA sequences can be one or more sequences that encode or not encode a protein. For example, the first set of DNA sequences may include only a promoter, a non-coding region, and a terminator. A second set of DNA sequences may or may not be present after or before the first set of DNA sequences.

As used herein, “decreasing” the level or amount of an agent, such as a protein or mRNA, means reducing the level or amount compared to a cell or organism that lacks a DNA sequence capable of reducing the content of the agent. For example, “at least a partial decrease” means a reduction of at least 25%, “a significant reduction” means a decrease of at least 75%, and “effective elimination” means a decrease of more than 95%, while all decreases or the amount of agent is determined in comparison with a cell or organism in which there is no DNA sequence capable of reducing the content of the agent.

As used herein, an “elevated” or “increased” level or amount of an agent, such as a protein or mRNA, means that the level or amount is higher than the level or amount of an agent present in a cell, tissue or plant with a similar genetic environment, but in the absence of an introduced nucleic acid molecule encoding a given protein or mRNA. For example, a “at least partially elevated” level means an increase of at least 25%, a “significantly elevated” level means an increase of at least 100%, with all increases in levels or amounts of agent being determined compared to the level or amount of agent, present in a cell, tissue or plant with a similar genetic environment, but in the absence of an introduced nucleic acid molecule encoding a given protein or mRNA. In a preferred embodiment, the increase in expression may be any expression when the protein is heterologous to a given system. For example, expression of EPS4 CP4 may be an increase in expression if expression was not present in the plant prior to the introduction of the nucleic acid molecule encoding the protein.

Comparison of agent levels is preferably performed in organisms with a similar genetic environment. Such a genetic environment preferably occurs when in the organisms being compared, sequences are characterized by 50% or more, more preferably 75% or more, and even more preferably 90% or more identical nuclear nuclear material. In another preferred embodiment of the invention, a similar genetic environment occurs when the organisms to be compared are plants and said plants are isogenic except for any genetic material originally introduced by plant transformation methods. The level or amount of the agent can be measured by any suitable method, non-limiting examples of which include comparing mRNA transcript levels, protein or peptide levels and / or phenotype, especially oil composition. As used herein, mRNA transcripts include processed and unprocessed mRNA transcripts, and proteins or peptides include proteins or peptides with or without post-translational modification.

The DNA sequences of the first set of DNA sequences can be coding sequences, intron sequences, 3'-UTR sequences, 5'-UTR sequences, promoter sequences, other non-coding sequences, or any combination of these sequences. The first set of DNA sequences encodes one or more sequences that, when expressed, are capable of selectively lowering the level of a protein or transcript, or both protein and transcript, encoded by a gene selected from the group consisting of FAD2, FAD3 and FATB. In a preferred embodiment of the invention, the first set of DNA sequences is capable of expressing antisense RNA in which individual antisense sequences may be linked in a single transcript or may be unrelated separate transcripts. In another preferred embodiment, the first set of DNA sequences are physically linked sequences capable of expressing one dsRNA molecule. In another preferred embodiment of the invention, the first set of DNA sequences is capable of expressing sense cosuppressive RNA in which individual sense sequences may be linked in a single transcript or may be unrelated separate transcripts. Typical variants of the first set of DNA sequences are given in Part B of the detailed description of the invention and in the examples.

The second set of DNA sequences encodes one or more sequences that, if expressed, are capable of increasing the level of a protein or transcript, or both protein and transcript, encoded by a gene selected from the group consisting of beta-ketoacyl-ACP synthase I (KAS I), beta -ketoacyl-ACP synthase IV (KAS IV), delta-9-desaturase and SP4 EPSPS. The DNA sequences of the second set of DNA sequences can be physically linked sequences. Typical variants of the second set of DNA sequences are given below in parts C and D of the detailed description of the invention.

Thus, the present invention relates to methods for changing the composition of fatty acids and compounds containing such fatty acids, such as oils, waxes and fats. The present invention also relates to methods for producing certain fatty acids in plant host cells. Such methods involve the use of the polygenic expression clusters provided herein to modify the FAS pathway in a plant host cell.

B. The first set of DNA sequences

In one embodiment of the present invention, the nucleic acid molecule comprises a first set of DNA sequences that, when introduced into a cell or organism, expresses one or more sequences capable of efficiently eliminating, significantly reducing, or at least partially reducing levels of transcripts or mRNA proteins encoded by one or more genes. Preferred embodiments of the invention include, as a target, an endogenous gene, a plant gene, and a non-viral gene. In one embodiment of the present invention, the gene is a FAD2, FAD3 or FATB gene.

In one embodiment of the invention, the nucleic acid molecule of the present invention includes a DNA sequence having significant homology with one or more coding or non-coding sequences from a plant gene, which, when introduced and expressed in a plant cell or plant, can effectively eliminate, significantly reduce, or at least partially reduce the level of transcript or mRNA protein encoded by the gene from which the coding or non-coding sequence has been isolated Attitude. The DNA sequences in the first set of DNA sequences transcribe RNA sequences or RNA fragments that are at least 90%, preferably at least 95%, more preferably at least 98% and most preferably 100% identical to the coding or non-coding region, isolated from the suppressed gene. This percent identity may be comparable to another nucleic acid fragment.

The non-coding sequence is preferably 3'-UTR, 5'-UTR, part of a sequence encoding a protein or intron from a plant gene. More preferably, the non-coding sequence is a promoter sequence, 3'-UTR, 5'-UTR or an intron from a plant gene. An intron can be localized between exons, in the 5'-UTR or 3'-UTR of the plant gene. The coding sequence is preferably part of a protein coding frame.

One or more sequences in the first set of DNA sequences can be designed to produce dsRNA, sense suppressor RNA, antisense RNA, or any other suppressor transcript to achieve the desired effect when introduced into a plant cell or plant. Such a DNA sequence may be a fragmented nucleic acid molecule.

A plant intron can be any plant intron from an endogenous or introduced gene. The nucleic acid sequences of such introns from organisms can be obtained or isolated from many sources, which include, but are not limited to, databases such as EMBL and the Genbank gene bank, which can be found on the Internet at ebi.ac.uk/swisprot/ ; expasy.ch/; embl-heidelberg.de/ and ncbi.nlm.nih.gov. The nucleic acid sequences of such introns can also be obtained without any restrictions from sources such as the GENSCAN program, which can be found on the Internet at genes.mit.edu/GENSCAN.html.

Additional introns can also be obtained by methods that include, but are not limited to, screening the genomic library with a probe for sequences of a known exon or intron, comparing the genomic sequence with the corresponding cDNA sequence, or cloning an intron, such as soybean cDNA, by comparative analysis with the genomic sequence from another organism such as, for example, Arabidopsis. In addition, other intron nucleic acid sequences should be known to one skilled in the art. The methods described above can also be used to isolate and obtain other non-coding sequences, which include, but are not limited to, promoter sequences, 3'-UTR sequences and 5'-UTR sequences.

The FAD2, Δ12 desaturase or omega-6 desaturase gene encodes an enzyme (FAD2) capable of catalyzing the introduction of a double bond into the acyl portion of a fatty acid at the twelfth position from the carboxyl end. The term “FAD2-1” refers to the FAD2 gene, which is specifically expressed in vivo in seed tissue, and the term “FAD2-2” refers to the FAD2 gene, which: (a) is different from the FAD2-1 gene and (b) expressed naturally in many tissues, including seed. Typical FAD2 sequences include, but are not limited to, those presented in US Patent Application No. 10/176149 filed June 21, 2002 and in SEQ ID NO: 1-6.

The “FAD3”, “Δ15 desaturase” or “omega-3-desaturase” gene encodes an enzyme (FAD3) capable of catalyzing the introduction of a double bond into the acyl portion of a fatty acid at the fifteenth position from the carboxyl end. The terms “FAD3-1, FAD3-A, FAD3-B, and FAD3-C” refer to members of the FAD3 gene family that are naturally expressed in many tissues, including the seed. Representative FAD3 sequences include, but are not limited to, those presented in US Patent Application No. 10/176149, filed June 21, 2002, and in SEQ ID NO: 7-27.

The “FATB” or “palmitoyl ACP thioesterase” gene encodes an enzyme (FATB) capable of catalyzing the hydrolytic cleavage of the carbon-sulfur complex thioester bond in the pantothenprostetin group of palmitoyl ACP as a preferred reaction. The specified enzyme can also catalyze the hydrolysis of other ACP fatty acid thioesters. Typical FATB-1 sequences include, but are not limited to, sequences presented in provisional patent application US No. 60/390185, filed June 21, 2002; in US patent No. 5955329, 5723761, 5955650 and 6331664 and in SEQ ID NO: 28-37. Typical FATB-2 sequences include, but are not limited to, the sequences set forth in SEQ ID NOS: 42-47.

C. Second set of DNA sequences

In one embodiment of the present invention, the nucleic acid molecule contains a second set of DNA sequences that, when introduced into a cell or organism, is able to partially increase, increase, increase or significantly increase levels of transcripts or mRNA proteins encoded by one or more genes. In one embodiment of the present invention, the gene is an endogenous gene. In another embodiment of the present invention, the gene may be a heterologous gene. In a preferred embodiment, heterologous and endogenous genes may be present in the same nucleic acid molecule. In one embodiment of the present invention, the gene is a plant gene. In another embodiment of the present invention, the gene is a truncated gene, wherein the truncated gene is capable of catalyzing a reaction catalyzed by the entire gene. In one embodiment of the present invention, the gene is a beta-ketoacyl ACP synthase I gene, a beta ketoacyl ACP synthase IV gene, a delta 9 desaturase gene, a EPS4 CP4 gene, or a combination of these genes.

The gene of the present invention may be any gene endogenous or introduced. The nucleic acid sequences of such genes can be obtained from many sources, which include, but are not limited to, databases such as EMBL and Genbank, which can be found on the Internet at ebi.ac.uk/swisprot/; expasy.ch/; embl-heidelberg.de/ and ncbi.nlm.nih.gov. The nucleic acid sequences of such genes can also be obtained from sources such as the GENSCAN program, which can be found on the Internet at genes.mit.edu/GENSCAN.html.

Additional genes can also be obtained by methods that include, but are not limited to, screening a genomic or cDNA library with a probe for sequences of known genes, cloning a gene by comparative analysis with a gene or probe from another organism, such as, for example, Arabidopsis. In addition, other nucleic acid sequences of genes should be known to those skilled in the art. Additional genes can, for example, be amplified by polymerase chain reaction (PCR) and used in one embodiment of the present invention. In addition, other nucleic acid sequences of genes should be known to those skilled in the art.

Automated nucleic acid synthesizers can be used for this purpose, as well as to create a nucleic acid molecule having a sequence found in a cell or organism. In addition to such synthesis, nucleic acid molecules can be used to identify pairs of primers that can be used in PCR to amplify and produce any desired nucleic acid molecule or fragment of the first gene.

The KAS I or beta-ketoacyl ACP synthase I gene encodes an enzyme (KAS I) capable of catalyzing the extension of the acyl portion of a fatty acid to form palmitoyl ACP (C16: 0). Typical KAS I sequences include, but are not limited to, those presented in US Pat. No. 5,457,599, PCT Publication WO 94/10189 and SEQ ID NO: 38.

The “KAS IV” or “beta-ketoacyl-ACP synthase IV” gene encodes an enzyme (KAS IV) that can catalyze the condensation of acyl-ACP with medium chain length and increase the production of 18: 0-ACP. Typical KAS IV sequences include, but are not limited to, those presented in PCT Publication WO 98/46776 and SEQ ID NO: 39.

The delta 9 desaturase, stearoyl ACP desaturase or omega 9 desaturase gene encodes an enzyme capable of catalyzing the introduction of a double bond into the acyl portion of a fatty acid at the ninth position from the carboxyl end. A preferred delta 9 desaturase of the present invention is a plant or cyanobacterial delta 9 desaturase and more preferably delta 9 desaturase, which is also found in an organism selected from the group consisting of Cartharmus tinctorius, Ricinus communis, Simmonsia chinensis and Brassica campestris. Typical delta-9 desaturase sequences include, but are not limited to, those disclosed in US Pat. No. 5,723,595 and SEQ ID NOS: 40-41.

The “CP4 EPSPS” or “CP4 5-enolpyruvyl-shikimate-3-phosphate synthase” gene encodes an enzyme (CP4 EPSPS) that is capable of reporting a significant degree of glyphosate resistance to the resulting plant cell or plants. The CP4 EPSPS sequence may be the CP4 EPSPS sequence derived from Agrobacterium tumefaciens sp. .

D. Recombinant vectors and constructs

One or more nucleic acid constructs of the present invention may be used to transform or transfect plants. Levels of products, such as transcripts or proteins, can be increased or decreased in an organism such as a plant, or such products can be localized in one or more specific organs or tissues of the body. For example, food levels can be increased or decreased in one or more plant tissues and organs, which include, but are not limited to, roots, tubers, stems, leaves, shoots, fruits, berries, nuts, bark, pods, seeds, and flowers. The preferred organ is the seed. For example, exogenous genetic material can be transferred to a plant cell that regenerates to form a whole, fertile, or sterile plant or part of a plant.

“Exogenous genetic material” can be any genetic material found in vivo or obtained from any source suitable for introduction into any organism. Such exogenous genetic material includes, but is not limited to, the molecules and nucleic acid constructs of the present invention. Exogenous genetic material can be transferred to the host cell using a DNA-based vector or construct designed for this purpose. Similarly, exogenous genetic material can be transferred to the host cell by the virus. Exogenous genetic material may contain a DNA sequence identical to the endogenous gene, but reintroduced into the host cell using a DNA-based vector or construct designed to suppress the expression of the endogenous gene. The creation of such a vector is described in this field (see, for example, Plant Molecular Biology: A Laboratory Manual, Clark (ed.), Springer, New York (1997)). In a preferred embodiment, the exogenous genetic material is recombinant DNA.

The construct or vector may include a promoter that functions in a plant cell, or a plant promoter for expression of a selected nucleic acid molecule. A number of promoters that are active in plant cells are described in the scientific literature, and CaMV 35S and FMV promoters are preferably used in plants. Other examples of preferred promoters include haricin bean and 7S alpha. Further preferred promoters are amplified or duplicated CaMV 35S and FMV 35S promoter variants. Odell et al., Nature 313: 810-812 (1985); US patent No. 5378619. Additional promoters suitable for use are described, for example, in US patent No. 5378619, 5391725, 5428147, 5447858, 5608144, 5614399, 5633441, 5633435 and 4633436. In addition, a tissue-specific enhancer can be used.

Particularly preferred promoters can also be used to express the nucleic acid molecule of the present invention in seeds or fruits. In a preferred embodiment, the promoter used is a seed-specific promoter. Examples of such promoters include 5'-terminal regulatory regions from genes such as napin (Kridl et al., Seed Sci. Res. 1: 209-219 (1991)), phaseolin, stearoyl-ACP desaturase, 7Sα, 7Sα '( Chen et al., Proc. Natl. Acad. Sci., 83: 8560-8564 (1986), USP, arceline and oleosin. Preferred promoters for expression in the seed are the promoters 7Sα, 7Sα ', napin and FAD2-1A.

The constructs or vectors may also contain other genetic elements, which include, but are not limited to, 3'-terminal transcription terminators, 3'-terminal polyadenylation signals, other untranslated nucleic acid sequences, transfer or targeted sequences, selectable or selectable markers, promoters, enhancers and operators. The constructs or vectors may also contain a gene without a promoter, which, after administration, can use the endogenous promoter.

Nucleic acid molecules that can be used to transform or transfect plants can be any nucleic acid molecules of the present invention. The present invention is not limited to the illustrated embodiments. Typical nucleic acid molecules are described in Part A of the detailed description of the invention, and other non-limiting typical nucleic acid molecules are described below and illustrated in FIGS. 1-4 and in the examples.

Variants of a nucleic acid molecule of the present invention are shown in FIGS. 1-4. As indicated above, the nucleic acid molecule contains (a) a first set of DNA sequences and (b) a second set of DNA sequences that are located in one or more regions of T-DNA, each of which is flanked by the right edge and the left edge. The direction of transcription in the T-DNA regions is indicated by arrows. The described nucleic acid molecules may contain DNA sequences arranged to form a monocistronic or polycistronic configuration. Preferred configurations include a configuration in which a first set of DNA sequences and a second set of DNA sequences are located in the same T-DNA region.

In each illustrated embodiment, the first set of DNA sequences includes one or more sequences that, if expressed, are capable of selectively reducing the content of one, two or all proteins and transcripts encoded by a gene selected from the group consisting of FAD2, FAD3 and FATB. Each sequence in the first set of DNA sequences is preferably capable, in the case of expression, of suppressing the expression of another gene, including, but not limited to, other members of the gene family. These sequences may include coding sequences, intron sequences, 3'-UTR sequences, 5'-UTR sequences, other non-coding sequences, and any combination of these sequences. The first set of DNA sequences can be expressed in any suitable form, for example, as a dsRNA construct, a sense cosuppressor construct, or an antisense construct. The first set of DNA sequences is operably linked to at least one promoter that causes expression of the sequences and can be any promoter that functions in a plant or any plant promoter. Preferred promoters include, but are not limited to, the napin promoter, the 7Sα promoter, the 7Sα ′ promoter, the arceline promoter, or the FAD2-1A promoter.

The second set of DNA sequences includes coding sequences, each of which is a DNA sequence encoding a sequence that, if expressed, is capable of increasing the content of a protein or transcript, or both protein and transcript, encoded by a gene selected from the group consisting of KAS I, KAS IV, delta-9-desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which may be any promoter that functions in a plant, or any plant promoter. Preferred promoters suitable for use in the second set of DNA sequences are the FMV promoter and / or seed specific promoters. Particularly preferred seed-specific promoters include, but are not limited to, the napin promoter, the 7Sα promoter, the 7Sα ′ promoter, the arceline promoter, the delta-9 desaturase promoter, or the FAD2-1A promoter.

In the embodiments of FIGS. 1 and 2, the first set of DNA sequences, if expressed, can form a dsRNA molecule capable of suppressing the expression of a protein or transcript, either protein or transcript encoded by a gene or transcribed from a gene selected from the group including FAD2, FAD3 and FATB. The first set of DNA sequences shown in FIG. 1 includes three non-coding sequences, each of which expresses an RNA sequence (not shown) that is identical to the non-coding region of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. Non-coding sequences express an RNA sequence that is at least 90% identical to the non-coding region of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. The first set of DNA sequences also includes three antisense sequences, each of which expresses an antisense RNA sequence (not shown) capable of forming a double-stranded RNA molecule with a corresponding RNA sequence (expressed by non-coding sequences).

Non-coding sequences can be separated from antisense sequences by a spacer sequence, preferably a sequence that stimulates the formation of a dsRNA molecule. Examples of such spacer sequences include those provided by Wesley et al., Plant J., 27 (6): 581-90 (2001) and Hamilton et al., Plant J., 15: 737-746 (1988). In a preferred embodiment, the spacer sequence is capable of forming a hairpin structure as described in the above publication by Wesley et al. Particularly preferred spacer sequences in this context are plant introns or parts thereof. A particularly preferred plant intron is the spliced intron. Splicable introns include, but are not limited to, an intron selected from the group consisting of PDK intron, FAD3-1A or FAD3-IB intron No. 5, FAD3 intron No. 1, FAD3 intron No. 3A, FAD3 intron No. 3B, FAD3 No. 3C, intron No. 4 FAD3, intron No. 5 FAD3, intron No. 1 FAD2 and intron FAD2-2. Preferred spliced introns include, but are not limited to, an intron selected from the group consisting of FAD3 intron No. 1, FAD3 intron No. 3A, FAD3 intron No. 3B, FAD3 intron No. 3C and No. 5 Fron. Other preferred spliced introns include, but are not limited to, a spliced intron from about 0.75 kb in length. to about 1.1 kb, capable of facilitating the formation of a hairpin-like RNA structure. One non-limiting example of a particularly preferred spliced intron is FAD3 intron No. 5.

Non-coding molecules with a sense orientation can optionally be separated from the corresponding antisense molecules with a spacer DNA segment. The spacer segment may be a gene fragment or artificial DNA. The spacer segment may be short to facilitate the formation of a hairpin structure of dsRNA or long to facilitate the formation of dsRNA without a hairpin structure. The spacer can be obtained by lengthening the chain of one of the sense or antisense molecules described in application for US patent 2005/0176670 A1. Alternatively, a sequence can be created with the orientation of the right edge-right edge (“RB-RB”) after introducing into the genome of the plant, as described in application for US patent 2005/0183170.

As shown in figure 1, the nucleic acid molecule includes two regions of T-DNA, each of which is flanked by the right edge and the left edge. The first T-DNA region includes a first set of DNA sequences operably linked to a promoter, wherein the first T-DNA region further includes a first part of a second set of DNA sequences that comprises a first promoter operably linked to a first coding sequence and a second promoter operably linked with a second coding sequence. The second T-DNA region includes the second part of the second set of DNA sequences, which contains a third promoter operably linked to the third coding sequence. In the preferred embodiment of FIG. 2, the nucleic acid molecule comprises a first T-DNA region that is flanked by a right edge and a left edge. The first and second sets of DNA sequences are located in the same region of T-DNA.

In the embodiments of the invention with the expression of the dsRNA shown in FIGS. 1 and 2, the order of the sequences can be changed compared to the illustrated and described order, however, non-coding sequences and antisense sequences are preferably located around the spacer sequence so that, in the case of expression, the first non-coding sequence can hybridize to the first antisense sequence, the second non-coding sequence can hybridize I with the second antisense sequence and the third non-coding sequence can hybridize with the third antisense sequence so that one dsRNA molecule can be formed. Non-coding sequences preferably have a sense orientation, and antisense sequences have an antisense orientation relative to the promoter. The number of non-coding, antisense and coding sequences and their relative positions in one or more regions of T-DNA can also be changed in any way acceptable to achieve the objectives of the present invention.

As shown in FIGS. 3 and 4, the illustrated nucleic acid molecule includes a T-DNA region flanked by a right edge and a left edge, in which the first and second sets of DNA sequences are located. The first set of DNA sequences is operably linked to a promoter and a transcription termination signal. The second set of DNA sequences includes a first promoter operably linked to a first coding sequence, a second promoter operably linked to a second coding sequence, and a third promoter operably linked to a third coding sequence. The transcription termination signal can be any transcription termination signal that functions in a plant, or any plant transcription termination signal. Preferred transcription termination signals include, but are not limited to, the Rubisco E9 3'-end pea sequence, Brassica 3'-end napin sequence, tml 3'-end sequence and nos 3'-terminal sequence.

In the embodiment of the invention shown in FIG. 3, the first set of DNA sequences in the case of expression can form a sense suppressor construct capable of suppressing the expression of one or more proteins or transcripts encoded or isolated from a gene selected from the group consisting of FAD2, FAD3 and FATB . The first set of DNA sequences includes three non-coding sequences, each of which expresses an RNA sequence (not shown), sufficiently identical to one or more non-coding regions of a gene selected from the group comprising the FAD2, FAD3 and FATB genes. Non-coding sequences express an RNA sequence that is at least 90% identical to one or more non-coding regions of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. The order of the non-coding sequences in the first set of DNA sequences can be changed in comparison with the illustrated and described in the present description of the invention, but the non-coding sequences have a semantic orientation relative to the promoter.

Figure 4 shows an embodiment of the invention in which the first set of DNA sequences in the case of expression can form an antisense construct capable of suppressing the expression of one or more proteins or transcripts encoded or isolated from a gene selected from the group consisting of FAD2, FAD3 and FATB. The first set of DNA sequences includes three antisense sequences, each of which expresses an RNA antisense sequence (not shown) that is identical to one or more non-coding regions of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. Antisense sequences express an RNA antisense sequence that is at least 90% identical to one or more non-coding regions of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. The order of the antisense sequences in the first set of DNA sequences can be changed compared to the illustrated and described in the present description of the invention, but the antisense sequences have an antisense orientation relative to the promoter.

The nucleic acid molecules described above are preferred since they achieve the objectives, possess the distinguishing features and advantages of the present invention. It should not be considered that the present invention is limited to the illustrated embodiments of the invention. The arrangement of the sequences in the first and second sets of DNA sequences in the nucleic acid molecule is not limited to the illustrated and described locations and can be changed in any way acceptable to achieve the goals and provide the distinctive features and advantages of the present invention described in the present description of the invention and illustrated in the accompanying drawings.

E. Transgenic organisms and methods for their preparation

Any molecules and nucleic acid constructs of the present invention can be permanently or temporarily introduced into a plant or plant cell. Preferred nucleic acid molecules and constructs of the present invention are described above in parts AD of the detailed description of the invention and in the examples. Another embodiment of the present invention relates to a method for creating transgenic plants, which typically includes the steps of selecting an acceptable plant or plant cell, transforming the plant or plant cell with a recombinant vector, and producing a transformed host cell.

In a preferred embodiment, a plant or cell isolated from a plant produces vegetable oils for food and industrial use. Especially preferred are oilseeds of the temperate zone. Plants of interest include, but are not limited to, rapeseed (canola and varieties high in erucic acid), corn, soybeans, cramps, mustard, castor oil plants, peanuts, sesame seeds, cotton, flax, safflower, oil palm, flaxseed, sunflower and coconut palm. The present invention equally relates to monocotyledonous or dicotyledonous species and is applicable to new and / or improved methods of transformation and regulation.

Methods and methods for introducing DNA into plant cells are well known to those skilled in the art, and virtually any methods for introducing nucleic acid molecules into a cell can be used in the present invention. Non-limiting examples of acceptable methods include: chemical methods; physical methods such as microinjection, electroporation, gene firing, microparticle bombardment, and vacuum infiltration; viral vectors and receptor-mediated mechanisms. Other methods for transforming a cell can be used, which include, but are not limited to, introducing DNA into plants by directly transferring DNA to pollen, directly injecting DNA into reproductive organs of a plant, or directly injecting DNA into immature embryo cells, followed by rehydration of the dried embryos.

A widely used system for introducing genes into plant cells is Agrobacterium mediated transport. See, for example, Fraley et al., Bio / Technology 3: 629-635 (1985); Rogers et al., Methods Enzymol. 153: 253-277 (1987). The transferred region of DNA is determined by the edge sequences, and penetrating DNA is usually introduced into the plant genome. Spielmann et al., Mol. Gen. Genet. 205: 34 (1986). Modern Agrobacterium-based transforming vectors can replicate in E. coli as well as in Agrobacterium, providing convenient manipulation. Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell (eds.), Springer-Verlag, New York, pp. 179-203 (1985).

Regeneration, development, and cultivation of plants from individual plant protoplast transformants and from various transformed explants are well known in the art. See publications by Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Weissbach and Weissbach, In: Methods for Plant Molecular Biology, Academic Press, San Diego, CA (1988). The plants of the present invention can be part of a selection program and can also be reproduced by apomixis. Methods for producing apomictic plants are well known in the art. See, for example, US patent No. 5811636.

In a preferred embodiment of the invention, the plant of the present invention containing nucleic acid sequences that, if expressed, are capable of selectively lowering the levels of the FAD2, FAD3 and / or FATB protein and / or the FAD2, FAD3 and / or FATB transcript, is crossed with another plant of the present invention containing nucleic acid sequences which, when expressed, are capable of overexpressing another enzyme. The above other enzyme is preferably selected from the group comprising beta-ketoacyl-ACP synthase I, beta-ketoacyl-ACP synthase IV, delta-9-desaturase and CP4 EPSPS.

In another embodiment, the plant of the present invention may be crossed with another transgenic or non-transgenic plant. The plant of the present invention can be crossed with another plant in which the oil composition is characterized by modified levels of fatty acids, for example, as a non-limiting example, a variety with a reduced level of linolenic acid in the oil composition can be cited. In a preferred embodiment, the plant of the present invention is crossed with a variety containing less than 3 wt.% Linolenic acid, or in another embodiment, the plant of the present invention is crossed with another plant containing more than 20 wt.% Stearic acid. Plants with modified levels of fatty acids are known in the art and are described, for example, in Hawkins and Kridl (1998) Plant Journal 13 (6): 743-752 and in US Pat. No. 6,365,802.

F. Products of the Present Invention

The plants of the present invention can be used in whole or in part. Preferred plant parts include reproductive or storage parts. The term “plant parts” as used herein includes, but is not limited to, seed, endosperm, ovule, pollen, roots, tubers, stems, leaves, shoots, fruits, berries, nuts, bark, pods, seeds and flowers. In a particularly preferred embodiment of the present invention, the seed is a part of the plant.

Any plants or parts thereof of the present invention can be processed to produce feed, flour, protein or oil products. In a preferred embodiment of the present invention, a plant of the present invention is used containing the oil of the fatty acid composition of the present invention. A particularly preferred part of the plant for this purpose is seed. In a preferred embodiment, the feed, flour, protein, or oil product is intended to feed livestock, fish, or humans. Methods for producing feed, flour, protein and oil products are known in the art. See, for example, US Pat. Nos. 4,957,748, 5,100,679, 5,219,596, 5,936,069, 6,050,076, 6,146,669 and 6,156,227. In a preferred embodiment, the protein product is a high protein product. Such a high protein product preferably contains protein in an amount of more than 5% w / v, more preferably in an amount of 10% w / v. and even more preferably in an amount of 15% w / v.

In a preferred embodiment, the oil product is a high oil product in which the oil content obtained from a plant or part of the present invention exceeds 5% w / v, more preferably 10% w / v. and even more preferably 15% w / v. In a preferred embodiment, the oil product is a liquid with a volume of more than 1, 5, 10 or 50 liters. The present invention relates to oil obtained from plants of the present invention or by the method of the present invention. Such an oil may be characterized by increased oxidation stability. In addition, such an oil may be a minor or major component of any product obtained.

In addition, such an oil may be mixed with other oils. In a preferred embodiment, the oil obtained from plants of the present invention or by the method of the present invention comprises more than 0.5%, 1%, 5%, 10%, 25%, 50%, 75% or 90% by volume or weight the oil component of any product. In another embodiment, the oil product may be mixed and may comprise more than 10%, 25%, 35%, 50%, or 75% of the volume of the mixture. The oil obtained from the plant of the present invention can be mixed with one or more organic solvents or petroleum distillates.

Plant seeds can be placed in a container. As used herein, a container is any object suitable for storing such seeds. The container preferably contains more than about 500, 1000, 5000 or 25000 seeds, of which at least about 10%, 25%, 50%, 75% or 100% of the seeds are obtained from the plant of the present invention. The present invention also relates to a container for more than about 10,000, more preferably about 20,000 and even more preferably about 40,000 seeds, of which more than about 10%, more preferably about 25%, more preferably 50% and even more preferably about 75% or 90% of the seeds are seeds obtained from a plant of the present invention. The present invention also relates to a container containing more than about 10 kg, more preferably about 25 kg and even more preferably about 50 kg of seeds, more than about 10%, more preferably about 25%, more preferably about 50% and even more preferably about 75% or 90% of the seeds are seeds obtained from a plant of the present invention.

G. Oil Compositions

For many oil applications, the saturated fatty acid content is preferably less than 8 wt.% And more preferably about 2-3 wt.%. Saturated fatty acids have high melting points, which are undesirable in many applications. When used as feed or fuel, saturated fatty acids cause turbidity at low temperatures and impart poor cold flow properties to the fuel, such as loss of fluidity and clogging of the filter when cold. Low saturated fatty acid oil products are more preferred by consumers and the food industry, as they are considered more beneficial and / or may be labeled “saturated fat free products” in accordance with FDA regulations. In addition, oils with a low content of saturated fatty acids reduce or eliminate the need to remove solid components from the oil by cooling for use in food, for example, as a salad dressing oil. In applications involving bio-diesel and lubricating oils, low saturated fatty acid oils provide improved cold flow properties and will not cloud at low temperatures.

The factors that determine the physical properties of a particular oil are complex. Palmitic, stearic and other saturated fatty acids are usually solid at room temperature, in contrast to unsaturated fatty acids, which remain liquid. Since saturated fatty acids do not have double bonds in the acyl chain, they remain resistant to oxidation at elevated temperatures. Saturated fatty acids are important ingredients in margarines and chocolate, but lower levels of saturated fatty acids are desirable for many applications in the food industry.

Oleic acid has one double bond, but remains relatively stable at high temperatures, and oils with high levels of oleic acid are suitable for cooking and other applications requiring heating. It has recently been recommended to consume more oil with a high oleic acid content, since oleic acid appears to lower blood levels of low density lipoproteins (“LDL”) without affecting high density lipoprotein (“HDL”) levels. However, it is desirable to limit the oleic acid content somewhat, since, decomposing at high temperatures, oleic acid forms compounds with unpleasant odors and reduces the number of compounds with pleasant odors resulting from the oxidation of linoleic acid. Neff et al., JAOCS, 77: 1303-1313 (2000); Warner et al., J. Agric. Food Chem. 49: 899-905 (2001). Preferred oils contain oleic acid in an amount of 65-85 wt.% Or less, which limits the formation of unpleasant odors during cooking, for example, for frying oil and fried foods. Other preferred oils contain oleic acid in an amount of more than 55 wt.% To improve oxidation stability.

Linoleic acid is the main polyunsaturated fatty acid in foods and an important nutrient for humans. Linoleic acid is a desirable component in many cooking-related applications, being the main precursor to fried food odors, such as 2,4-decadienal, which give a good taste to fried foods. However, linoleic acid is characterized by poor resistance to heat. In preferred edible oils, the content of linoleic acid is 10% by mass or more to enhance the formation of substances giving the smell of fried foods, and also 25% by mass or less to reduce the formation of unpleasant odors. Linoleic acid has cholesterol-lowering properties, although an excess of linoleic acid in the diet can reduce the ability of human cells to protect themselves from oxidation, resulting in an increased risk of cardiovascular disease. Toborek et al., Am. J. Clin. J. 75: 119-125 (2002). See Flavor Chemistry of Lipid Foods, editors D.B. Min & T.H. Smouse, Am. Oil Chem. Soc., Champaign, IL (1989).

Linoleic acid, which has a lower melting point than oleic acid, further contributes to the improvement of cold flow required in applications associated with biological diesel fuel and biological lubricating oils. Preferred oils for most applications are characterized by a linoleic acid content of 30% by weight or less, since the oxidation of linoleic acid limits the storage and use of oil for frying, feed, food, fuel and lubricating oils. See Physical Properties of Fats, Oils, and Emulsifiers, ed. N. Widlak, AOCS Press (1999); Erhan & Asadauskas, Lubricant Basestocks from Vegetable Oils, Industrial Crops and Products, 11: 277-282 (2000). In addition, the high content of linoleic oil in livestock feed can cause an undesirably high content of linoleic acid in milk of dairy cattle and, therefore, poor oxidation stability and unpleasant odor. Timmons et al., J. Dairy Sci. 84: 2440-2449 (2001). In the widely used oil composition, the content of linoleic acid is 10-25 wt.%.

Linolenic acid is also an important component of human nutrition. This acid is used for the synthesis of long chain fatty acids of the ω-3 family and prostaglandins secreted from them. However, the double bonds of this acid are highly susceptible to oxidation; therefore, oils with a high content of linolenic acid deteriorate quickly under the influence of air, especially at high temperatures. It is often necessary to partially hydrogenate these oils before using them in foods to slow the formation of unpleasant odors and rancidity when the oil is heated, but hydrogenation causes the formation of harmful trans fatty acids, which can contribute to cardiovascular diseases. To improve oxidation stability and reduce the need for hydrogenation of the oil, preferred oils contain linolenic acid in an amount of 8 wt.% Or less, 6% or less, 4% or less, less than about 3% and more preferably in an amount of 0.5-2 wt. % of the total fatty acid content of the oil of the present invention.

The soybean oil of the present invention can also be used as a mixing source for the manufacture of a mixed oil product. A mixing source means that the soybean oil of the present invention can be mixed with other vegetable oils to improve characteristics such as fatty acid composition, odor, and oxidation stability of other oils. The amount of soybean oil used according to the present invention depends on the desired properties to be obtained in the final blended oil product. Examples of mixed oil products include, but are not limited to, margarines, shortenings, frying oils, salad dressing oils, etc. The soybean oil of the present invention may be a blended oil, a synthesized oil, or, in a preferred embodiment, an oil obtained from an oilseed with an appropriate oil composition. Oil obtained directly from oilseed is unmixed oil. In another embodiment, the oil is obtained directly from ripened oilseed. In one embodiment, a mature oilseed is defined as a crop that is harvested on the field for commercial agricultural purposes, such as selling for cooking. In a preferred embodiment, the oil is soybean oil. The oil may be a crude oil, for example, crude soybean oil, or may be a processed oil, for example, the oil may be refined, bleached, deodorized and / or subjected to removal of solid components by cooling. As used herein, the term “purification” means a process for treating natural or processed fat or oil to remove contaminants, in which the fat or oil is treated with caustic, then centrifuged, washed with water and heated in vacuo. “Decolorization” means the process of treating fat or oil to remove or reduce the amount of coloring matter in the fat or oil. Discoloration can be accomplished by treating fat or oil with activated carbon or diatomaceous earth. “Deodorization” means the process of removing components from fat or oil that impart unpleasant odors to the final product, which can be accomplished using a high vacuum and washing with superheated steam. “Removing solid components by cooling” means the process of removing saturated glycerides from the oil, which can be accomplished by cooling the oil and removing cured parts of the fat.

A preferred oil of the present invention is characterized by a low content of saturated fatty acids or the absence of saturated fatty acids. In other preferred embodiments, the oils of the present invention are characterized by increased oleic acid content, reduced saturated fatty acid content, and reduced polyunsaturated fatty acid content. In other preferred embodiments, the oils of the present invention are characterized by an increased content of oleic acid and a reduced content of saturated fatty acids. In a preferred embodiment, the oil is soybean oil. The percentage of fatty acids or levels of fatty acids are expressed in mass percent.

In a first embodiment, the oil of the present invention preferably contains 55-80% oleic acid, about 12-43% polyunsaturated fatty acids and 2-8% saturated fatty acids; more preferably, the oil contains 55-80% oleic acid, about 14-42% polyunsaturated fatty acids and 3-6% saturated fatty acids; and even more preferably, the oil contains 55-80% oleic acid, about 16.5-43% polyunsaturated fatty acids and 2-3.6% saturated fatty acids.

In a second embodiment, the oil of the present invention preferably comprises 65-80% oleic acid, about 12-33% polyunsaturated fatty acids and 2-8% saturated fatty acids; more preferably, the oil contains 65-80% oleic acid, about 14-32% polyunsaturated fatty acids and 3-6% saturated fatty acids; even more preferably, the oil contains 65-80% oleic acid, about 16.5-33% polyunsaturated fatty acids and 2-3.6% saturated fatty acids.

In a third embodiment, the oil of the present invention preferably contains from about 42% to about 85% oleic acid and from about 8% to about 1.5% saturated fatty acids; more preferably, the oil contains a combined amount of oleic acid and linolenic acid from about 65% to about 95% by weight of the total oil composition. Even more preferably, the oil of the present invention contains a combined amount of oleic acid and linolenic acid from about 75% to about 90%, from about 75% to about 95%, from about 75% to about 85%, from about 65% to about 90%, from about 70% to about 90 wt.% of the total oil composition.

In a fourth embodiment of the invention, the oil of the present invention contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 6% to about 15 wt.% Linolenic acid; more preferably, the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, less than 35 wt.% linolenic acid; even more preferably, the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, about 9 wt.% linolenic acid.

In a fifth embodiment, the oil of the present invention contains from about 50% to about 85% oleic acid and from about 8% to about 1.5% saturated fatty acids; more preferably from about 50% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 4% to about 14 wt.% linolenic acid; more preferably, the oil contains from about 50% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, less than 35 wt.% linolenic acid; even more preferably, the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 2% to about 45 wt.% linolenic acid.

In another embodiment, the oil of the present invention contains about 65-80% oleic acid, about 3-8% saturated fatty acids, and about 12-32% polyunsaturated fatty acids. In another embodiment, the oil of the present invention contains about 65-80% oleic acid, about 2-3.5% saturated fatty acids, and about 16.5-33% polyunsaturated fatty acids.

In a particularly preferred embodiment, the oil of the present invention contains about 47-83% oleic acid and about 5% saturated fatty acids; about 60-80% oleic acid and about 5% saturated fatty acids; about 50-85% oleic acid and about 2-7% saturated fatty acids; about 55-85% oleic acid and about 2.5-7% saturated fatty acids; about 47-88% oleic acid and about 3-7% saturated fatty acids; about 43-85% oleic acid and about 5-7% saturated fatty acids; about 81-85% oleic acid and about 5% saturated fatty acids; about 74-83% oleic acid and about 6% saturated fatty acids; about 65-87% oleic acid and about 6% saturated fatty acids; about 66-80% oleic acid and about 6% saturated fatty acids; about 42-77% oleic acid with about 5-8% saturated fatty acids; about 60-77% oleic acid and about 6% saturated fatty acids; about 70-81% oleic acid and about 5-7% saturated fatty acids; about 52-71% oleic acid and about 5-7% saturated fatty acids; about 44-71% oleic acid and about 6% saturated fatty acids; about 61-71% oleic acid and about 8% saturated fatty acids; about 57-71% oleic acid and about 7% saturated fatty acids; about 23-58% oleic acid and about 8-14% saturated fatty acids; about 20-70% oleic acid and about 6% saturated fatty acids; about 21-35% oleic acid and about 5-6% saturated fatty acids; or about 19-28% oleic acid and about 5% saturated fatty acids.

In other embodiments, the percentage of oleic acid is 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, or 80% or more, or is in the range of 50 % to 80%, from 55% to 80%, from 55% to 75%, from 55% to 65%, from 60% to 85%, from 60% to 80%, from 60% to 75%, from 60% up to 70%, from 65% to 85%, from 65% to 80%, from 65% to 75%, from 65% to 70% or from 69% to 73%. Suitable ranges for the percentage of oleic acid in the oils of the present invention also include ranges in which the lower limit is selected from the following percentages: 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 , 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80%; and the upper limit is selected from the following percentage values: 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 , 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90%.

In these other embodiments, the percentage of linoleic acid in the oil of the present invention is in the range of 10% to 40%, 10% to 39%, 10% to 30%, 10% to 29%, 10% to 28%, from 10% to 25%, from 10% to 21%, from 10% to 20%, from 11% to 30%, from 12% to 30%, from 15% to 25%, from 20% to 25 %, from 20% to 30% or from 21% to 24%. Acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include ranges in which the lower limit is selected from the following percentages: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 23, 24, 25, 26, 27, 28, 29 or 30%; and the upper limit is selected from the following percentage values: 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 %

In these other embodiments, the percentage of linolenic acid in the oil of the present invention is 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4.5% or less, 4% or less, 3.5% or less, 3% or less, 2.5% or less, 2% or less; or is in the range from 0.5% to 2%, from 0.5% to 3%, from 0.5% to 4.5%, from 0.5% to 6%, from 3% to 5%, from 3% to 6%, from 3% to 8%, from 1% to 2%, from 1% to 3%, or from 1% to 4%. In these other embodiments, the percentage of saturated fatty acids in the oil composition of the present invention is 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4% or less, 3.6% or less or is in the range from 2% to 3%, from 2% to 3 , 6%, from 2% to 4%, from 2% to 8%, from 3% to 15%, from 3% to 10%, from 3% to 8%, from 3% to 6%, from 3.6 % to 7%, from 5% to 8%, from 7% to 10% or from 10% to 15%.

In other embodiments, saturated fatty acids in the oil of the present invention comprise a combination of palmitic and stearic fatty acids. In one embodiment, the percentage of saturated fatty acids is about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4, 5% or less, about 4% or less, about 3.5% or less, about 3% or less, about 2.5% or less; about 2% or less; or is in the range from 0.5% to 2%, from 0.5% to 3%, from 0.5% to 4.5%, from 0.5% to 6%, from 0.5% to 7% , from 0.5% to 8%, from 0.5% to 9%, from 1% to 4%, from 1% to 5%, from 1% to 6%, from 1% to 7%, from 1% up to 8%, from 1% to 9%, from 1.5% to 5%, from 1.5% to 6%, from 1.5% to 7%, from 1.5% to 8%, from 1, 5% to 9%, from 2% to 5%, from 2% to 6%, from 2% to 7%, from 2% to 8%, from 2% to 9%, from 3% to 5%, from 3 % to 6%, from 3% to 7%, from 3% to 8%, from 3% to 9%, from 4% to 7%, from 4% to 8%, from 4% to 9%, from 5% up to 7%, from 5% to 8% and from 5% to 9%. In these embodiments, acceptable ranges of the percentage of saturated fatty acids in the oils of the present invention also include ranges in which the lower limit is selected from the following percentages: 0.5, 1, 1.5, 2, 2.5, 3, 3 5, 4, 4,5, 5, 5,5, 6 or 6,5%; and the upper limit is selected from the following percentage values: 11, 10, 9, 8, 7, 6, 5, 4,5, 4, 3,5, 3, 2,5, 2, 1,5, 1 or 0,5 %

In other embodiments, the percentage of palmitic fatty acid in the oil of the present invention is 6% or less, 5% or less, 4.5% or less, 4% or less, 3.5% or less, 3% or less , 2.5% or less, 2% or less, or in the range from 0.5% to 2%, from 0.5% to 3%, from 0.5% to 4.5%, from 0.5% up to 6%, from 1% to 3%, from 1% to 4%, from 1% to 5%, from 1% to 6%, from 1.5% to 2%, from 1.5% to 3%, from 1.5% to 4%, from 1.5% to 4.5%, from 1.5% to 5.5%, from 1.5% to 6%, from 1.5% to 6.5% , from 1.5% to 7%, from 2% to 3%, from 2% to 3.5%, from 2% to 4%, from 2% to 4.5%, from 2% to 5%, from 2% to 6%, from 2% to 7%, from 2% to 8%, from 3% to 5%, from 3% to 6%, from 3% to 7%, from 3% to 8%, from 3% to 9%. In these embodiments, acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include ranges in which the lower limit is selected from the following percentages: 0.5, 1, 1.5, 2, 2.5, 3, 3, 5, 4, 4,5, 5, 5,5, 6, 6,5, 7 or 7,5%; and the upper limit is selected from the following percentage values: 11, 10, 9, 8, 7, 6, 5, 4,5, 4, 3,5, 3 or 2%.

In other embodiments, the percentage of stearic fatty acid in the oil of the present invention is 3% or less, 2.5% or less, 2% or less, or in the range of 0.5% to 1%, 0.5 % to 1.5%, from 0.5% to 2%, from 0.5% to 2.5%, from 0.5% to 3%, from 0.5% to 4%, from 1% to 2 %, from 1% to 3%, from 1% to 4%, from 1.5% to 2%, from 1.5% to 3% or from 1.5% to 4%. In these embodiments, acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include ranges in which the lower limit is selected from the following percentages: 0.5, 1, 1.5, 2, 2.5, 3 or 3, 5%; and the upper limit is selected from the following percentage values: 3.5, 3, 2.5, 2 or 1.5%.

The oil of the present invention is particularly suitable as a baking or frying oil. Due to the reduced content of polyunsaturated fatty acids, the oil of the present invention does not require the lengthy treatment necessary for conventional oils, since fewer odor or color compounds are present in said oil. In addition, the low saturated fatty acid content of the oil of the present invention improves the cold flow properties of the oil and eliminates the need to heat the stored oil to prevent it from crystallizing or solidifying. Improved fluidity in the cold also increases the drainage of oil from fried products after they are removed from the oil for frying, which allows to obtain a product with a lower fat content. See publication Bouchon et al., J. Food Science 66: 918-923 (2001). The low content of linolenic acid in the oil of the present invention is particularly beneficial in frying to reduce unpleasant odors.

The oil of the present invention is well suited for use as a salad dressing oil (oil that remains clear at refrigerator temperatures of 40-50 ° F). Improved transparency at refrigerator temperatures due to its low saturated fatty acid content and moderate linoleic acid content reduces or eliminates the need to remove solid components from the oil by cooling to use as a salad dressing oil.

In addition, the moderate content of linoleic acid and the low content of linolenic acid in the oil of the present invention makes it suitable for producing shortening, margarine and other semi-solid vegetable fats used in food products. The production of such fats typically involves the hydrogenation of unsaturated oils such as soybean oil, corn oil or canola oil. The increased oxidation and odor resistance of the oil of the present invention means that this oil does not require hydrogenation to the same extent as conventional vegetable oil intended for use as margarine or shortening, which reduces production costs and the production of harmful trans isomers.

The oil of the present invention is also suitable for use as a raw material for the production of biological diesel fuel, in particular due to the fact that biological diesel fuel made from such an oil is characterized by improved cold fluidity, better flammability (cetane number), better oxidation resistance and smaller nitric oxide emulsions. Biological diesel fuel is an alternative diesel fuel, usually containing methyl esters of saturated, monounsaturated or polyunsaturated C ₁₆ -C ₂₂ fatty acids. The cetane number is a measure of flammability - the shorter the ignition delay time of the fuel in the engine, the higher the cetane number. The ASTM Biological Diesel Standard (D 6751-02) requires a minimum cetane number of 47.

The use of bio-diesel in conventional diesel engines significantly reduces the amount of pollutants, such as sulfates, carbon monoxide and particles, compared to petroleum diesel, and its use in school buses can significantly reduce the effects on children of toxic diesel emissions. A limitation for the use of 100% conventional biofuel diesel is the high cloud point of standard biofuel from soybean (2 ° C) compared to diesel fuel number 2 (-16 ° C). Dunn et al., Recent. Res. Devel in Oil Chem., 1: 31-56 (1997). Biological diesel fuel made from the oil of the present invention is characterized by a better (lower) cloud point and clogging of the filter in the cold state and can also be used in mixtures to improve the low temperature properties of biological diesel fuel made from inexpensive but highly saturated sources of fat, such like animal fats (beef tallow, pork lard, chicken fat) and palm oil. Biological diesel fuel can also be mixed with petroleum diesel fuel in any proportion.

Biological diesel fuel is usually obtained by extraction, filtering and purification of soybean oil to remove free fats and phospholipids, followed by transesterification of the oil with methanol to form methyl esters of fatty acids. See, for example, US Patent No. 5891203. The resulting methyl esters of soybean oil are commonly defined as “biological diesel fuel”. The oil of the present invention can also be used as diesel without the formation of methyl esters, for example, by mixing acetals with this oil. See, for example, US Pat. No. 6,013,114. Due to its improved cold flow and oxidation stability, the oil of the present invention can also be used as a lubricating oil and as a diesel fuel additive. See, for example, US patents Nos. 5888947, 5454842 and 4557734.

The soybeans and oils of the present invention are also suitable for use in various soya products made from whole soybeans, such as soy milk, soybean oil, natto and tempeh, and in soya products made from processed soybeans and soybean oil, including soybean cereals, soy flour, soy protein concentrate, soy protein extracts, textured soy protein concentrate, hydrolyzed soy protein, whipped dressing, baking oil, salad dressing oil, shortening and lecithin. Whole soybeans are also edible and are usually sold to customers raw, fried, or as edamame (green soybeans). Soy milk, which is usually obtained by soaking and grinding whole soybeans, can be used as it is, spray dried or processed to produce soy yogurt, soy cheese, tofu or yuba. Soy or oil of the present invention can be successfully used in these and other soy products due to improved oxidation resistance, lower content of precursors of substances that cause unpleasant odors, and low content of saturated fatty acids.

G. Modulation Suppression

Another embodiment of the invention relates to a method for modulating levels of gene suppression. Modulation of gene suppression can cause more or less gene suppression. Suppression of the gene product can be achieved by introducing into the plant genome the constructs of the present invention. Similarly, gene suppression can be modulated by introducing the constructs of the present invention into the plant genome. Other examples of methods for modulating gene suppression include, but are not limited to, antisense suppression methods, cosuppression, introducing interfering RNA (dsRNAi), using transgenic animals, creating hybrids and ribozymes using the construct of the present invention. The following examples are provided by way of illustration and do not limit the scope of the present invention.

Gene suppression can be modulated by changing the length of the transcribed DNA used for suppression, the sequence of which is isolated from the gene intended for suppression. Many methods can be used to suppress a gene using post-transcriptional gene silencing mechanisms. Without limiting itself to theory, it can be assumed that these methods include the expression of an RNA molecule that hybridizes with another RNA molecule. It is very surprising that favorable results are achieved when using an RNA molecule of a certain length to modulate or moderate suppression of the level of stability of expression of the endogenous target gene.

Suppression of the FAD2-1 gene causes an increase in oleic acid levels and a decrease in linoleic acid levels. With strong suppression of FAD2-1, oleic acid levels can exceed 65%, which causes a decrease in palmitic acid and linolenic acid levels. For example, when suppressing FAD2-1, oleic acid levels can reach 85%, while the combined levels of palmitic and stearic acids are reduced to about 10%. Similarly, suppression of FATB results in decreased levels of saturated fatty acids, mainly palmitate. By suppressing FAD2 and FATB in such a way that oleic acid levels are approximately 85%, the saturated fatty acid content is approximately 10%. By suppressing FAD2 and FATB in such a way that oleic acid levels exceed 85%, the content of saturated fatty acids may be lower than 10%.

In accordance with the present invention, the levels of saturated fatty acids can be reduced to less than 10% without increasing the oleic acid content above 85%. In one embodiment, the suppression of FAD2 is modulated by decreasing the length of the FAD2-1 intron introduced into the plant. Less suppression of FAD2 corresponds to average oleic acid levels of about 40-85% oleic acid. FAD2 suppression decreases as the length of the introduced FAD2-1 intron fragment decreases. For example, the intron FAD2-1, whose length is reduced by at least 100 consecutive nucleotides, reduces the suppression of FAD2 and a corresponding increase in the level of oleic acid and a decrease in the levels of linoleic acid.

The relationship between a decrease in suppression of an endogenous gene and a decrease in the length of homologous DNA can be determined empirically by introducing DNA of different lengths. For example, the amount of suppression reduction achieved by decreasing the length of the introduced homologous DNA can be determined by removing the extension portions of the introduced homologous DNA and analyzing the expression of the target gene.

It is within the scope of the present invention to provide a moderate suppression of FAD2 while greatly reducing the levels of saturated fatty acids in a plant. In such plants, oleic acid levels can be 40-85%. Similarly, incomplete FATB suppression occurs when the combined 3'-terminal and 5'-terminal untranslated regions are introduced as compared to the introduction of the unprocessed FATB gene into the host cell. Similarly, FATB suppression levels are reduced when a 5'-end portion of an open reading frame is introduced into the host cell, which encodes mainly the chloroplast transit peptide. In cells containing FAD2 and FATB, suppressed by the methods of the present invention, the levels of oleic acid can be 40-85%, while the levels of saturated fatty acids can be 1-9%.

One embodiment of the present invention relates to a method for modulating gene suppression, which reduces suppression compared to suppression of a genetic element that is a complete gene, a complete exon, a complete intron, a complete signal sequence or a complete UTR, which includes creating a recombinant nucleic acid molecule containing an endogenous fragment sequences from a given genetic element, initiation of expression of a recombinant nucleic acid molecule in a host cell, and suppression of an endogenous gene by a recombinant nucleic acid molecule. A repressed gene can be any gene, including FAD2 and FATB. One embodiment of the invention relates to a method for modulating suppression of FAD2 or FATB, which comprises: expressing an incomplete sequence of the FAD2 or FATB genetic element in the host cell, wherein the FAD2 or FATB genetic element is derived from the endogenous FAD2 or FATB gene in the host cell, the sequence of the genetic the FAD2 or FATB element can be the FAD2 or FATB gene, the exon FAD2 or FATB, the intron FAD2 or FATB, the coding region of the transit peptide FAD2 or FATB or UTR FAD2 or FATB, and an incomplete sequence of the genetic element FAD2 or FATB less than the full sequence of the genetic element FAD2 or FATB; and suppression of the endogenous FAD2 or FATB gene by an incomplete sequence of the FAD2 or FATB genetic element, wherein the levels of suppression of the endogenous FAD2 or FATB gene in the host cell are lower than the levels of suppression of the endogenous FAD2 or FATB gene in the host cell with a similar genetic environment and the second FAD2 nucleic acid sequence or FATB containing the entire sequence of the genetic element FAD2 or FATB.

Another embodiment of the present invention relates to a method for changing the composition of a plant cell oil, which comprises transforming a plant cell with a recombinant nucleic acid molecule containing a DNA sequence that inhibits the endogenous expression of FAD2, FATB or FAD2 and FATB, the DNA sequence comprising the FAD2 nucleic acid sequence FATB or FAD2 and FATB, which is shorter than the complete sequence of the entire genetic element selected from a gene, exon, intron, coding region transit peptide, 3'-UTR, 5'-UTR and an open reading frame; and growing a plant cell under conditions of transcription initiation of the indicated DNA sequence, resulting in a change in the composition of the oil compared to a plant cell having a similar genetic environment but not containing a recombinant nucleic acid molecule. The FAD2 or FATB genetic element may be shorter by 50, 75, 100, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 800, 1000, 2000, 3000 or 4000 nucleotides. The length of the FAD2 or FATB genetic element may be 50, 75, 100, 150, 175, 200, 220, 250, 300, 320, 350, 400, 420, 450, 500, 550, 600, 800, or 1000 nucleotides.

Another embodiment of the present invention relates to a method for increasing oleic acid content and reducing saturated fatty acids in a plant seed, which comprises: i) shortening the DNA sequence of the exogenous FAD2 gene in the host cell so as to at least partially reduce the amount of suppression of FAD2 expression in a transformed plant compared to the suppression of the expression of FAD2 in a host cell with a similar genetic environment and the complete DNA sequence of the exogenous FAD2 gene; and ii) growing a plant with a nucleic acid molecule comprising a shortened FAD2 DNA sequence, wherein the shortened FAD2 DNA sequence at least partially suppresses the endogenous expression of FAD2; and iii) cultivating a plant producing a seed with a reduced saturated fatty acid content compared to a seed of a plant having a similar genetic environment but not containing a shortened FAD2 DNA sequence. The value by which the DNA sequence of the exogenous FAD2 gene should be shortened in order to at least partially reduce the suppression of the endogenous FAD2 gene can be determined empirically by introducing DNA of different lengths. For example, the amount of suppression reduction achieved by reducing the length of the introduced homologous DNA can be determined by removing the extension portions of the introduced homologous DNA and analyzing the expression of the target gene. The amount of suppression of FAD2 expression can be determined as the average of three or more, six or more, ten or more, fifteen or more, twenty or more seeds of the plant.

Another embodiment of the present invention relates to a method for producing a transformed plant containing a seed with a reduced content of saturated fatty acids, which comprises transforming a plant cell with a recombinant nucleic acid molecule containing a DNA sequence that suppresses the endogenous expression of FAD2 and FATB, wherein the DNA sequence contains a nucleic acid sequence FAD2, which is shorter than the complete sequence of the entire genetic element selected from the gene, e a kzon, an intron coding for the transit peptide and UTR regions; and growing a transformed plant forming a seed with a reduced content of saturated fatty acids compared to a seed of a plant having a similar genetic environment but not containing the indicated recombinant nucleic acid molecule.

Another embodiment of the present invention relates to a method for modulating the composition of fatty acids of an oil obtained from oilseeds of the temperate zone, which comprises isolating a genetic element of at least 40 nucleotides in length, capable of suppressing the expression of an endogenous gene in the synthesis of fatty acids; the creation of several shortened fragments of a genetic element; the introduction of all shortened fragments into the plant cell of the oilseed crop of the temperate zone in order to create transgenic plants and the selection of a transgenic plant containing a shortened fragment of a certain length and a sequence that causes the desired change in the composition of fatty acids in the oil from the seeds. In a preferred embodiment of the invention, the above method also includes constructing a recombinant DNA containing at least two truncated fragments of two different endogenous genes, causing different desired changes in the composition of the fatty acids of the oil from the seeds; introducing a recombinant DNA construct into the temperate oilseed plant cell in order to create transgenic plants and selecting a transgenic plant containing at least two truncated fragments, in which the composition of the fatty acids in the seed oil has several desired changes caused by at least two truncated fragments .

Another embodiment of the present invention relates to soybean seed, in which the oil composition is characterized by a significantly lower content of saturated fatty acids and a moderately high content of oleic acid and which contains a DNA sequence that suppresses the endogenous expression of FAD2 in the host cell, while the DNA sequence has a nucleic acid sequence FAD2, which is shorter than the complete sequence of the entire genetic element selected from the gene, exon, intron, coding region of the tra peptide and operating actions UTR.

The following examples are illustrative and do not limit the scope of the present invention.

All publications, patents, and patent applications cited in this specification are incorporated by reference, as if each individual publication, patent, or patent application was individually incorporated by reference.

EXAMPLES

Example 1. Isolation of FATB-2 Sequences

The sheet tissue taken from Asgrow soybean cultivar A3244 is ground in liquid nitrogen and stored at -80 ° C until use. Six ml of sodium dodecyl sulfate (SDS) extraction buffer (650 ml of sterile ddH ₂ O, 100 ml of 1 M Tris-Cl pH 8, 100 ml of 0.25 M EDTA, 50 ml of 20% SDS, 100 ml of 5 M NaCl, 4 μl of beta-mercaptoethanol) is added to 2 ml of frozen / crushed leaf tissue and the mixture is incubated at 65 ° C for 45 minutes. The sample is shaken every 15 minutes. 2 ml of ice-cooled 5 M potassium acetate solution was added to the sample, the sample was shaken and incubated on ice for 20 minutes. 3 ml of CHCl _{3 was} added to the sample and shaken for 10 minutes.

The sample is centrifuged at 10,000 rpm for 20 minutes and the supernatant is collected. 2 ml of isopropanol is added to the supernatant and mixed. The sample is centrifuged at 10,000 rpm for 20 minutes and the supernatant is drained. The pellet was resuspended in 200 μl of RNase and incubated at 65 ° C for 20 minutes. Add 300 μl ammonium acetate / isopropanol (1: 7) and mix. The sample is then centrifuged at 10,000 rpm for 15 minutes and the supernatant is discarded. The precipitate was washed with 500 μl of 80% ethanol and air dried. The genomic DNA pellet was resuspended in 200 μl T10E1 (10 mM Tris: 1 mM EDTA).

The soybean FATB-2 cDNA sequence (SEQ ID NO: 42) is used to create thirteen oligonucleotides forming this gene: F1 (SEQ ID NO: 48), F2 (SEQ ID NO: 49), F3 (SEQ ID NO: 50), F4 (SEQ ID NO: 51), F5 (SEQ ID NO: 52), F6 (SEQ ID NO: 53), F7 (SEQ ID NO: 54), R1 (SEQ ID NO: 55), R2 (SEQ ID NO : 56), R3 (SEQ ID NO: 57), R4 (SEQ ID NO: 58), R5 (SEQ ID NO: 59) and R6 (SEQ ID NO: 60). These oligonucleotides are used in pairs for PCR amplification from isolated soybean genomic DNA: pair 1 (F1 + R1), pair 2 (F2 + R1), pair 3 (F3 + R2), pair 4 (F4 + R3), pair 5 (F5 + R4), pair 6 (F6 + R5) and pair 7 (F7 + R6). PCR amplification for pair 5 is performed as follows: 1 cycle, 95 ° C for 10 minutes; 30 cycles, 95 ° C for 15 seconds, 43 ° C for 30 seconds, 72 ° C for 45 seconds; 1 cycle, 72 ° C for 7 minutes. For all other pairs of oligonucleotides, amplification by PCR is performed as follows: 1 cycle, 95 ° C for 10 minutes; 30 cycles, 95 ° C for 15 seconds, 48 ° C for 30 seconds, 72 ° C for 45 seconds; 1 cycle, 72 ° C for 7 minutes. Positive fragments are obtained using primer pairs 1, 2, 4, 5, 6, and 7. Each fragment is cloned in pCR2.1 vector (Invitrogen). Fragments 2, 4, 5, and 6 confirm and sequence. Four sequences are combined to form a genomic sequence for the FATB-2 gene (SEQ ID NO: 43).

When comparing the genomic sequence with the cDNA sequence in the soybean FATB-2 gene, four introns were identified: intron I (SEQ ID NO: 44) is located from base 119 to base 1333 of the genomic sequence (SEQ ID NO: 43) and has a length of 1215 p. about.; intron II (SEQ ID NO: 45) is located from base 2231 to base 2568 of the genomic sequence (SEQ ID NO: 43) and has a length of 338 bp .; intron III (SEQ ID NO: 46) is located from base 2702 to base 3342 of the genomic sequence (SEQ ID NO: 43) and has a length of 641 bp .; and intron IV (SEQ ID NO: 47) is located from base 3457 to base 3823 of the genomic sequence (SEQ ID NO: 43) and has a length of 367 bp

Example 2. Suppressor structures

2A. Constructions FAD2-1

Intron No. 1 FAD2-1A (SEQ ID NO: 1) was cloned into the pCGN3892 expression polygenic cluster in a sense and antisense orientation. The pCGN3892 vector contains the soybean 7S promoter and the 3'-end of rbcS pea. Both fusion genes are then separately ligated with the pCGN9372 vector, which contains the CP4 EPSPS gene regulated by the FMV promoter. The resulting expression constructs (pCGN5469 sense construct and pCGN5471 antisense construct) are used to transform soy.

The FAD2-1B intron (SEQ ID NO: 2) is fused to the 3'-end of FAD2-1A intron No. 1 in plasmid pCGN5468 (contains the soybean promoter 7S fused to the FAD2-1A intron (sense) and the 3'-end of pea rbcS) or in plasmid pCGN5470 (contains the soybean 7S promoter fused to the intron FAD2-1A (antisense) and the 3'-end of rbc pea), respectively, in the sense and antisense orientation. The resulting fusion combinations of introns are then separately ligated with the vector pCGN9372, which contains the EPS4 CP4 gene regulated by the FMV promoter. The resulting expression constructs (pCGN5485, sense intron FAD2-1A, FAD2-1B and pCGN5486, antisense intron FAD2-1A and FAD2-1B) are used to transform soy.

2B. Constructions FAD3-1

Introns No. 1, No. 2, No. 4 and No. 5 (respectively, SEQ ID NO: 7, 8, 10 and 11) FAD3-1A, introns No. 3C (SEQ ID NO: 23) and No. 4 (SEQ ID NO: 24) FAD3-1B separately ligated with pCGN3892 in the sense or antisense orientation. pCGN3892 contains the soybean 7S promoter and the 3'-end of rbcS pea. These fusion introns are ligated with the pCGN9372 vector, which contains the CP4 EPSPS gene regulated by the FMV promoter, for incorporation into soy. The resulting expression constructs (pCGN5455, sense intron No. 4 FAD3-1A; pСGN5459, antisense intron No. 4 FAD3-1A; pCGN5456, sense intron No. 5 FAD3; pCGN5460, antisense intron No. 5 FAD3-1A; pCGN5466, antisense 1A; pCGN5473, antisense intron No. 1 FAD3-1A) is used to transform soy.

2C. FATB constructs

The soybean FATB intron II sequence (SEQ ID NO: 30) was amplified by PCR using the incomplete genomic clone FATB-1 as a template. Amplification by PCR is performed as follows: 1 cycle, 95 ° C for 10 minutes; 25 cycles, 95 ° C for 30 seconds, 62 ° C for 30 seconds, 72 ° C for 30 seconds; 1 cycle, 72 ° C for 7 minutes. As a result of amplification by PCR, a product of 854 bp in length is obtained containing transformed restriction sites at both ends. The PCR product was cloned directly into the pCGN3892 polygenic expression cluster in a sense orientation using XhoI sites created at the 5 ′ ends of the PCR primers to form pMON70674. The pCGN3892 vector contains the soybean 7S promoter and the 3'-end of rbcS pea. pMON70674 is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 CP4 gene regulated by the FMV promoter. The resulting gene expression construct pMON70678 was used to transform soybean using Agrobacterium methods.

Two other expression constructs are created containing the soybean FATB-1 intron II sequence (SEQ ID NO: 30). The pMON70674 vector was cut by NotI and ligated with the pMON70675 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the KAS IV gene regulated by the napin promoter, thereby obtaining pMON70680. The expression vector pMON70680 is then cut with SnaBI and ligated to the gene fused to the hyogioba delta-9 desaturase gene (SEQ ID NO: 41) in a sense orientation regulated by the 7S promoter. Expression constructs pMON70680 and pMON70681 are used for soybean transformation using Agrobacterium methods.

2D. Combined designs

Expressing constructs are created containing different permutations of the first set of DNA sequences. The first set of DNA sequences includes any of the sequences described, or illustrated in FIGS. 5 and 6, or any other set of DNA sequences containing different combinations of non-coding or coding regions of the sense, antisense or sense and antisense sequences FAD2, FAD3 and FATB capable of forming dsRNA constructs semantic suppressor constructions, antisense constructions or various combinations of the above constructions.

Figure 5 (a) - (c) shows the first few sets of DNA sequences capable of expressing semantic suppressor or antisense constructs of the present invention, non-coding sequences of which are presented in tables 1 and 2 below. Non-coding sequences can be separate sequences, combinations sequences (e.g., 5'-UTR associated with 3'-UTR) or any combination of the above sequences. For the expression of the semantic suppressor construct, all non-coding sequences are sense sequences, and for the expression of the antisense construct, all non-coding sequences are antisense sequences. 5 (d) shows a first set of DNA sequences that is capable of expressing sense and antisense constructs of the present invention.

Figures 6 (a) - (c) show the first few sets of DNA sequences capable of expressing the dsRNA constructs of the present invention, the non-coding sequences of which are shown in Tables 1 and 2 below. The first set of DNA sequences shown in Fig. 6 contains pairs of related sense and antisense sequences arranged so that, for example, RNA expressed by the first sense sequence is capable of forming double-stranded RNA with antisense RNA, ex ressirovannoy first antisense sequence. For example, as shown in FIG. 6 (a) and in illustrative combination No. 1 (Table 1), the first set of DNA sequences includes a sense sequence FAD2-1, a sense sequence FAD3-1, an antisense sequence FAD2-1, and an antisense sequence FAD3-1 . Both antisense sequences correspond to sense sequences; therefore, the expression products of the first set of DNA sequences can form double-stranded RNA with each other. The sense sequences can be separated from the antisense sequences by a spacer sequence, preferably a sequence that stimulates the formation of a dsRNA molecule. Examples of such spacer sequences include sequences presented in the above publication by Wesley et al. and Hamilton et al., Plant J., 15: 737-746 (1988). A promoter is any promoter that functions in a plant, or any plant promoter. Non-limiting examples of acceptable promoters are given in Part D of the detailed description of the invention.

The first set of DNA sequences is introduced into the expression construct in a sense or antisense orientation using different DNA manipulation methods. If there are convenient restriction sites in the DNA sequences, such sites are introduced into the expression construct by digestion with restriction endonucleases and ligation with the construct cleaved at one or more existing cloning sites. If there are no convenient DNA restriction sites in the DNA sequences in the construct or DNA sequence, they are modified in various ways to facilitate cloning of the DNA sequences in the construct. Examples of DNA modification methods include PCR, ligation with a synthetic linker or adapter, in vitro site-directed mutagenesis, extension or shortening of protruding 5 ′ or 3 ′ ends, and the like. The above and other DNA manipulation methods are well known to those skilled in the art.

The pMON97552 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 140 consecutive nucleotides from the 3 ′ end, operably linked to 42 consecutive 5′-UTR FATB-1α nucleotides, followed by the coding region of CTP FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-1α in the antisense orientation, followed by 42 consecutive 5'-UTR FATB-1α nucleotides in the antisense orientation followed by soybean intron 1 FAD2-1A (SEQ ID NO: 1), mind shortened by 140 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked to the 3'-end segment of the H6 polyadenylation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-end termination sequence of peas Rubisco E9, while all sequences are flanked by the right edge (RB) and the left edge (LB). The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93758 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 160 consecutive nucleotides from the 5′-end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soybean FAD2-1A (SEQ ID NO: 1), reduced by 160 consecutive nucleotides from the 5'-end and located in the antisense orientation, which is functional It is directly linked to the 3'-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one molecule DNA The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON97553 vector contains the soybean 7Sα ′ promoter operably linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 200 consecutive nucleotides from the 3 ′ end and ligated to 42 consecutive 5′-UTR FATB-1α nucleotides, per which follows the coding region of CTP FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-1α in the antisense orientation, followed by 42 consecutive nucleotides 5'-UTR FATB-1α in the antisense orientation, followed by intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 200 of sequential nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked to the 3'-end segment of the H6 polyadenation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-end termination sequence of peas Rubisco E9, while all sequences are flanked right edge (RB) and left edge (LB) in one DNA molecule. The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93770 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 240 consecutive nucleotides from the 3′-end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soy FAD2-1A (SEQ ID NO: 1), reduced by 240 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functional It is directly linked by the 3'-terminal segment of H6 polyadenylation to the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of pea Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one DNA molecule . The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93759 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 240 consecutive nucleotides from the 5′-end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soybean FAD2-1A (SEQ ID NO: 1), reduced by 240 consecutive nucleotides from the 5'-end and located in the antisense orientation, which is functional It is directly linked to the 3'-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, with all sequences flanked by the right edge (RB) and left edge (LB) in one molecule DNA The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON97554 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 260 consecutive nucleotides from the 3′-end and ligated to 42 consecutive 5′-UTR FATB-1α nucleotides, per which follows the coding region of CTP FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-1α in the antisense orientation, followed by 42 consecutive nucleotides 5'-UTR FATB-1α in the antisense orientation, followed by soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by and 260 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked to the 3'-end segment of H6 polyadenylation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-terminal termination sequence of the pea Rubisco E9, all the sequences are flanked by the right edge (RB) and the left edge (LB) in one DNA molecule. The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93771 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 300 consecutive nucleotides from the 3 ′ end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soy FAD2-1A (SEQ ID NO: 1), reduced by 300 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functional It is directly linked to the 3'-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one molecule DNA The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON97555 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3 ′ end and ligated to 42 consecutive 5′-UTR FATB-1α nucleotides, per which follows the coding region of CTP FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-1α in the antisense orientation, followed by 42 consecutive nucleotides 5'-UTR FATB-1α in the antisense orientation, followed by intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 of sequential nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked to the 3'-end segment of the H6 polyadenylation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-terminal termination sequence of pea Rubisco E9, while all sequences are flanked right edge (RB) and left edge (LB) in one DNA molecule. The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93760 vector contains the soybean 7Sα ′ promoter operably linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 5 ′ end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soybean FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 5'-end and located in the antisense orientation, which is functional It is directly linked to the 3'-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one molecule DNA The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93772 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 360 consecutive nucleotides from the 3 ′ end and ligated to 3′-UTR FATB-1α, followed by 5 '-UTR FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 soybean FAD2-1A (SEQ ID NO: 1), reduced by 360 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functional It is directly linked to the 3'-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one molecule DNA The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON97556 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 380 consecutive nucleotides from the 3 ′ end and ligated to 42 consecutive 5′-UTR FATB-1α nucleotides, per which follows the coding region of CTP FATB-1α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-1α in the antisense orientation, followed by 42 consecutive nucleotides 5'-UTR FATB-1α in the antisense orientation, functionally related to soybean intron 1 FAD2-1A (SEQ ID NO: 1), um which is 380 consecutive nucleotides from the 3'-end and is in the antisense orientation, which is functionally linked to the 3'-end segment of the H6 polyadenylation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, while all sequences are flanked by the right edge (RB) and the left edge (LB) in one DNA molecule. The resulting gene expressing construct is used for transformation by the methods provided herein.

The pMON93764 vector contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 400 consecutive nucleotides from the 3 ′ end and ligated to the coding region of the CTP FATB-1α, followed by the coding region CTP FATB-2α, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-2α in the antisense orientation, followed by the coding region of CTP FATB-1α in the antisense orientation, followed by intron 1 FAD2-1A soybeans (SEQ ID NO: 1), reduced by 400 consecutive nukes leotides from the 3'-end and located in the antisense orientation, which is functionally linked to the coding region of the CTP FATB-2α in the antisense orientation, followed by 42 consecutive nucleotides 5'-UTR FATB-2α in the antisense orientation, functionally associated with the 3'-terminal an H6 polyadenylation segment with the EPS4 CP4 gene operably linked to the EFMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence, all sequences being flanked by the right edge (RB) and left edge (LB) in one DNA molecule. The resulting gene expressing construct is used for transformation by the methods provided herein.

Table 1 Illustrative Combinations Non-coding or coding sequences (semantic or antisense) First Second Third Fourth one FAD2-1A or B FAD3-1A or B or C 2 FAD3-1A or B or C FAD2-1A or B 3 FAD2-1A or B FAD3-1A or B or C another sequence of FAD3-1A or B or C four FAD2-1A or B FAD3-1A or B or C FATB-1 5 FAD2-1A or B FATB-1 FAD3-1A or B or C 6 FAD3-1A or B or C FAD2-1A or B FATB-1 7 FAD3-1A or B or C FATB-1 FAD2-1A or B 8 FATB-1 FAD3-1A or B or C FAD2-1A or B 9 FATB-1 FAD2-1A or B FAD3-1A or B or C 10 FAD2-1A or B FAD3-1A or B or C another sequence of FAD3-1A or B or C FATB-1 eleven FAD3-1A or B or C FAD2-1A or B another sequence of FAD3-1A or B or C FATB-1 12 FAD3-1A or B or C another sequence of FAD3-1A or B or C FAD2-1A or B FATB-1 13 FAD2-1A or B FAD3-1A or B or C FATB-1 another sequence of FAD3-1A or B or C fourteen FAD3-1A or B or C FAD2-1A or B FATB-1 another sequence of FAD3-1A or B or C fifteen FAD3-1A or B or C another sequence of FAD3-1A or B or C FATB-1 FAD2-1A or B 16 FAD2-1A or B FATB-1 FAD3-1A or B or C another sequence of FAD3-1A or B or C 17 FAD3-1A or B or C FATB-1 FAD2-1A or B another sequence of FAD3-1A or B or C eighteen FAD3-1A or B or C FATB-1 another sequence of FAD3-1A or B or C FAD2-1A or B 19 FATB-1 FAD2-1A or B FAD3-1A or B or C another sequence of FAD3-1A or B or C twenty FATB-1 FAD3-1A or B or C FAD2-1A or B another sequence of FAD3-1A or B or C 21 FATB-1 FAD3-1A or B or C another sequence of FAD3-1A or B or C FAD2-1A or B 22 FAD2-1A or B FAD3-1A or B or C FATB-2 23 FAD2-1A or B FATB-2 FAD3-1A or B or C 24 FAD3-1A or B or C FAD2-1A or B FATB-2 25 FAD3-1A or B or C FATB-2 FAD2-1A or B 26 FATB-2 FAD3-1A or B or C FAD2-1A or B 27 FATB-2 FAD2-1A or B FAD3-1A or B or C 28 FAD2-1A or B FAD3-1A or B or C another sequence of FAD3-1A or B or C FATB-2 29th FAD3-1A or B or C FAD2-1A or B another sequence of FAD3-1A or B or C FATB-2 thirty FAD3-1A or B or C another sequence of FAD3-1A or B or C FAD2-1A or B FATB-2 31 FAD2-1A or B FAD3-1A or B or C FATB-2 another sequence of FAD3-1A or B or C 32 FAD3-1A or B or C FAD2-1A or B FATB-2 another sequence of FAD3-1A or B or C 33 FAD3-1A or B or C another sequence of FAD3-1A or B or C FATB-2 FAD2-1A or B 34 FAD2-1A or B FATB-2 FAD3-1A or B or C another sequence of FAD3-1A or B or C 35 FAD3-1A or B or C FATB-2 FAD2-1A or B another sequence of FAD3-1A or B or C 36 FAD3-1A or B or C FATB-2 another sequence of FAD3-1A or B or C FAD2-1A or B 37 FATB-2 FAD2-1A or B FAD3-1A or B or C another sequence of FAD3-1A or B or C 38 FATB-2 FAD3-1A or B or C FAD2-1A or B another sequence of FAD3-1A or B or C 39 FATB-2 FAD3-1A or B or C another sequence of FAD3-1A or B or C FAD2-1A or B

table 2 Correlation of SEQ ID NO: with the sequences in table 1 FAD2-1A FAD2-1V FAD3-1A FAD3-1V FAD3-1C FATB-1 FATB-2 3'-UTR SEQ ID NO: 5 no SEQ ID NO: 16 SEQ ID NO: 26 SEQ ID NO: 61 SEQ ID NO: 36 no 5'-UTR SEQ ID NO: 6 no SEQ ID NO: 17 SEQ ID NO: 27 SEQ ID NO: 62 SEQ ID NO: 37 no 5 '+ 3'-UTR (or 3' + 5'-UTR) Related SEQ ID NO: 5 and 6 no Related SEQ ID NO: 16 and 17 Related SEQ ID NO: 26 and 27 no Related SEQ ID NO: 36 and 37 no Intron No. 1 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 7 SEQ ID NO: 19 no SEQ ID NO: 29 SEQ ID NO: 44 Intron No. 2 no no SEQ ID NO: 8 SEQ ID NO: 20 no SEQ ID NO: 30 SEQ ID NO: 45 Intron No. 3 no no No no no SEQ ID NO: 31 SEQ ID NO: 46 Intron No. 3A no no SEQ ID NO: 9 SEQ ID NO: 21 no no no Intron No. 3B no no SEQ ID NO: 12 SEQ ID NO: 22 no no no Intron No. 3C no no SEQ ID NO: 13 SEQ ID NO: 23 no no no Intron No. 4 no no SEQ ID NO: 10 SEQ ID NO: 24 SEQ ID NO: 14 SEQ ID NO: 32 SEQ ID NO: 47 Intron No. 5 no no SEQ ID NO: 11 SEQ ID NO: 25 no SEQ ID NO: 33 no Intron No. 6 no no No no no SEQ ID NO: 34 no Intron No. 7 no no No no no SEQ ID NO: 35 no

Example 3. Combined designs

7-15, the promoters are shown by arrows, coding sequences (both coding and non-coding) are shown by pentagons facing the transcription direction, sense sequences are indicated in plain text and antisense sequences are indicated by inverted text. The following abbreviations are used in these figures: 7Sa = 7Sα promoter; 7Sa '= 7Sα' promoter; Br napin = napin promoter Brassica; FMV = FMV promoter; ARC = arceline promoter; RBC E9 3 '= termination signal Rubisco E9; Nos 3 '= termination signal nos; TML 3 '= tml termination signal; napin 3 '= napin termination signal; 3 '(in the same frame as FAD or FAT) = 3'-UTR; 5 '(in the same frame as FAD or FAT) = 5'-UTR; Cr = Cuphea pulcherrima; Gm = Glycine max .; Rc = Ricinus communis; FAD2 = FAD2 allele of the delta-9-stearoyl desaturase gene; and Intr or Inr = intron.

3A. DsRNA constructs

7 to 9 show the nucleic acid molecules of the present invention in which the first sets of DNA sequences can express dsRNA constructs. The first set of DNA sequences shown in Figs. 7-9 includes pairs of related sense and antisense sequences arranged in such a way that, for example, RNA expressed by the first sense sequence can form double-stranded RNA with antisense RNA expressed by the first antisense sequence. The sense sequences may be located adjacent to the antisense sequences or may be separated from the antisense sequences by a spacer sequence, as shown in FIG. 9.

The second set of DNA sequences includes coding sequences, each of which is a DNA sequence encoding a sequence that, when expressed, can increase the protein or transcript, or both the protein and the transcript encoded by a gene selected from the group consisting of KAS I, KAS IV, delta -9-desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which can be any promoter that functions in a plant, or any plant promoter, and can be an FMV promoter, a napin promoter, a 7S (7Sα or 7Sα ') promoter, an arcelin promoter, a delta-9 desaturase promoter, or a promoter FAD2-1A.

As shown in FIG. 7, the sequences of intron 1 are FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16), or 3'-UTR FATB-1 (SEQ ID NO: 36) soybeans are amplified by PCR to form PCR products that include re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. Vectors containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 'terminal termination sequence, and R. communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40 ), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, are cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON68539 shown in FIG. 7 is used for transformation by the methods described in the present description.

The sequences of intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1A (SEQ ID NO: 10) and intron II FATB-1 (SEQ ID NO: 30) are amplified by soybean PCR to generate PCR products, containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68540 shown in FIG. 7 is used for transformation by the methods described in the present description.

The sequences of intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1A (SEQ ID NO: 10) and intron II FATB-1 (SEQ ID NO: 30) are amplified by soybean PCR to generate PCR products, containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when the 5 FAD3-1A soybean (SEQ ID NO: 11) splice with a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence is separated using the XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON68544 shown in FIG. 7 is used for transformation by the methods described in the present description.

The sequences of intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1A (SEQ ID NO: 10), intron II FATB-1 (SEQ ID NO: 30), and intron 4 FAD3-1B (SEQ ID NO: 24) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68546 shown in FIG. 7 is used for transformation by the methods described in the present description.

As shown in FIG. 8, the sequences of intron 1 are FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68536 shown in FIG. 8 is used for transformation by the methods described in the present description.

The sequences of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 of FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. A vector containing the R. communis delta-9-desaturase (FAB2) gene (SEQ ID NO: 40), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, is cut with the corresponding restriction enzymes and ligated at the top of the 3 ′ terminal termination sequence tml. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68537 shown in FIG. 8 is used for transformation by the methods described in the present description.

The sequences of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense or antisense orientation when the 5 FAD3-1A soybeans (SEQ ID NO: 11) are split in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using the XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the KAS IN gene of C. pulcherrima (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON68538 shown in FIG. 8 is used for transformation by the methods described in the present description.

As shown in Fig. 9, the sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FAD3-1B (SEQ ID NO: 26) the soybean is amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80622 shown in FIG. 9 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation when separated by a splice intron 5 FAD3-1A soybean (SEQ ID NO: 11) in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence using XhoI sites created at 5'- primer ends for PCR. This vector is then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80623 shown in FIG. 9 is used for transformation by the methods described in the present description.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated with each other), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO: 27 and 26, ligated with each other) soybeans are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct O5 shown in FIG. 9 is used for transformation by the methods described in the present description.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated each other) and 3'-UTR FAD3-1A (SEQ ID NO: 16) the soybean is amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene-expressing construct O6 shown in FIG. 9 is used for transformation by methods described in the present description of the invention.

3B. Semantic suppressor constructions

10-13 and 19-20, the nucleic acid molecules of the present invention are shown in which the first sets of DNA sequences are capable of expressing meaningful suppressor constructs. The second set of DNA sequences includes coding sequences, each of which is a DNA sequence encoding a sequence which, if expressed, is capable of increasing the level of a protein or transcript, or both a protein and a transcript encoded by a gene selected from the group consisting of KAS I, KAS IV, delta-9-desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter that is any promoter that functions in a plant, or any plant promoter and can be an FMV promoter, a napin promoter, a 7S (7Sα or 7Sα ') promoter, an arceline promoter, a delta-9 desaturase promoter, or a FAD2 promoter -1A.

As shown in figure 10, the sequence of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1C (SEQ ID NO: 14), intron II FATB-1 (SEQ ID NO: 30), intron 4 FAD3-1A (SEQ ID NO: 10) and intron 4 FAD3-1B (SEQ ID NO: 24) the soybeans are PCR-amplified to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα ′ soybean promoter and the 3 ′ terminal termination sequence of Rubisco E9 peas using the XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68522 shown in FIG. 10 is used for transformation by the methods described in the present description.

The sequences of intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1A (SEQ ID NO: 10), intron 4 FAD3-1B (SEQ ID NO: 24), and intron II FATB-1 (SEQ ID NO: 30) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. Vectors containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, and R. communis delta-9 desaturase gene (FAB2) (SEQ ID NO: 40 ), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, are cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON80614, shown in FIG. 10, is used for transformation by the methods described herein.

The sequences of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON68531 shown in FIG. 10 is used for transformation by the methods described in the present description.

The sequences of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. Vectors containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 'terminal termination sequence, and R. communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40 ), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, are cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expressing construct pMON68534 shown in FIG. 10 is used for transformation by the methods described in the present description of the invention.

The sequences of the intron 1 FAD2-1 (SEQ ID NO: 1 or 2), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The PCR product was cloned in a sense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the R. communis delta-9-desaturase (FAB2) gene (SEQ ID NO: 40), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON68535 shown in FIG. 10 is used for transformation by the methods described in the present description.

As shown in FIG. 11, the sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80605 shown in FIG. 11 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON80606 shown in FIG. 11 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the R. communis delta-9-desaturase (FAB2) gene (SEQ ID NO: 40), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON80607 shown in FIG. 11 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 3'-UTR FATB-1 (SEQ ID NO: 36) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sa 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 3 ′ terminal termination sequence. Vectors containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, and R. communis delta-9 desaturase gene (FAB2) (SEQ ID NO: 40 ), regulated by the soybean FAD2 promoter and the 3'-terminal FAD2 termination sequence, are cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene-expressing construct pMON80614 shown in FIG. 11 is used for transformation by the methods described herein.

As shown in FIG. 12, the sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the soybean 7Sα promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80629 shown in FIG. 12 is used for transformation by the methods described in the present description.

The sequences of intron 1 FAD2-1 (SEQ ID NO: 1 or 2), intron 4 FAD3-1A (SEQ ID NO: 10), intron II FATB-1 (SEQ ID NO: 30), and intron 4 FAD3-1A (SEQ ID NO: 10) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the soybean 7Sα promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expressing construct pMON81902 shown in FIG. 12 is used for transformation by the methods provided in the present description of the invention.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FAD3-1 (SEQ ID NO: 17 and 16, ligated with each other, or 27 and 26, ligated with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated with each other) soybeans are amplified by PCR to form PCR products, containing re-created restriction sites at both ends. The FAD2-1 PCR product was cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. Similarly, the FAD3-1 PCR product is cloned in a sense orientation in a vector containing the soybean 7Sα promoter and the 3'-terminal termination sequence tml using XhoI sites created at the 5'-ends of the PCR primers. The FATB-1 PCR product was cloned in a sense orientation in a vector containing the arselin promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. These vectors are cut NotI and ligated with the vector pMON41164 containing the EPS4 EPS4 gene, regulated by the FMV promoter, and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct O1 shown in FIG. 12 is used for transformation by the methods presented in the present description of the invention.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FAD3-1 (SEQ ID NO: 17 and 16, ligated with each other, or 27 and 26, ligated with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated with each other) soybeans are amplified by PCR to form PCR products, containing re-created restriction sites at both ends. The FAD2-1 PCR product was cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. Similarly, the FAD3-1 PCR product is cloned in a sense orientation in a vector containing the soybean 7Sα promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. The FATB-1 PCR product was cloned in a sense orientation in a vector containing the arselin promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. These vectors are cut NotI and ligated with the vector pMON41164 containing the EPS4 EPS4 gene regulated by the FMV promoter and the 3 'terminal termination sequence of pea Rubisco E9. A vector containing the KAS IN gene of C. pulcherrima (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene-expressing construct O2 shown in FIG. 12 is used for transformation by the methods presented in the present description of the invention.

As shown in FIG. 13, sequences 5′-UTR-3′-UTR FAD2-1 (SEQ ID NOs: 6 and 5 ligated to each other), 5′-UTR-3′-UTR FATB-1 (SEQ ID NO: 37 and 36 ligated to each other), 3'-UTR FAD3-1A (SEQ ID NO: 16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO: 27 and 26, ligated to each other on the other hand, soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. These vectors are then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated into pMON41164 vector. The resulting gene-expressing construct O7 shown in FIG. 13 is used for transformation by methods described in the present description of the invention.

Soybean intron 1 FAD2-1 (SEQ ID NO: 1 or 2) is amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. The sequences 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated with each other), 3'-UTR FAD3-1A and (SEQ ID NO: 16) and 5'-UTR-3 The '-UTR FAD3-1B (SEQ ID NOs: 27 and 26, ligated with each other) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the soybean 7Sα promoter and the 3-terminal nos termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. These vectors are then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the pMON41164 vector. The resulting gene expression construct O9 shown in FIG. 13 is used for transformation by the methods described in the present description of the invention.

As shown in FIG. 19, non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FAD2-1 (SEQ ID NO: 1 and 5-6) and non-coding sequences of FATB-1 (SEQ ID NO: 29 -37) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5'end of the PCR primers. These vectors are then cut with NotI and ligated with the pMON80612 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct shown in FIG. 19-A is used for transformation by the methods provided in the present specification.

The DNA sequence containing the delta-9 desaturase gene, regulated by the 7S alpha promoter and the 3'-terminal TML termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting expression construct shown in FIG. 19-B is used for transformation by the methods provided herein.

A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the haricotin bean promoter and the 3'-terminal napin termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting gene-expressing construct shown in FIG. 19-C is used for transformation by the methods provided in the present specification.

As shown in FIG. 20, non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FAD2-1 (SEQ ID NO: 1 and 5-6), non-coding sequences of FATB-1 (SEQ ID NO: 29 -37), non-coding sequences of FAD3-1A (SEQ ID NO: 7-13 and 16-17) and non-coding sequences of FAD3-1B (SEQ ID NO: 19-27) of soy are amplified by PCR to form PCR products containing re-created sites restriction at both ends. PCR products were cloned in a sense orientation in a vector containing the 7Sα ′ soybean promoter and the 3-terminal tml termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. These vectors are then cut with NotI and ligated with the pMON80612 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct shown in FIG. 20-A is used for transformation by the methods provided herein.

The DNA sequence containing the delta-9 desaturase gene, regulated by the 7S alpha promoter and the 3'-terminal TML termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting expression construct shown in FIGS. 20-B is used for transformation by the methods described in the present description of the invention.

A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica haricot bean promoter and the 3'-terminal napin termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting gene-expressing construct shown in FIGS. 20-C is used for transformation by the methods described in the present specification.

Vector pMON93501 contains soybean intron 1 FAD2-1A (SEQ ID NO: 1), functionally linked to the 7Sα 'soybean promoter and the 3'-terminal termination sequence H6, C. pulcherrima KAS IV gene (SEQ ID NO: 39), functionally linked to the Brassica napin promoter and the Brassica napin 3'-terminal termination sequence, the Ricinus communis delta-9 desaturase gene (US Patent Application Publication No. 2003/00229918 A1) operably linked to the soybean 7SA promoter and the nos 3'-terminal termination sequence, and the EPS4 CP4 gene functionally linked to the EFMV promoter (a constitutive promoter obtained and figwort mosaic virus) and the 3'-terminal pea Rubisco termination sequence, all sequences are flanked by boundary elements T-DNA Agrobacterium, i.e. DNA right edge (RB) and the left edge DNA (LB). The resulting gene expressing construct is used for transformation by the methods provided herein.

3C. Antisense Constructions

Fig. 14 shows nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing antisense constructs, and Figs. 15-18 show the nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing combinations of sense and antisense constructions. The second set of DNA sequences includes coding sequences, each of which is a DNA sequence encoding a sequence which, if expressed, is capable of increasing the level of a protein or transcript, or both a protein and a transcript encoded by a gene selected from the group consisting of KAS I, KAS IV, delta-9-desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter that is any promoter that functions in a plant, or any plant promoter and can be an FMV promoter, a napin promoter, a 7S (7Sα or 7Sα ') promoter, an arceline promoter, a delta-9 desaturase promoter, or a FAD2 promoter -1A.

As shown in FIG. 14, the sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the CP4 EPSPS gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80615 shown in FIG. 14 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct pMON80616 shown in FIG. 14 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products are cloned in antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination sequence using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the R.communis delta-9-desaturase (FAD2) gene (SEQ ID NO: 40), regulated by the soybean FAD2 promoter and the nos 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMOB41164. The resulting gene expression construct pMON80617 shown in FIG. 14 is used for transformation by the methods described in the present description.

The sequences 3'-UTR FAD2-1 (SEQ ID NO: 5), 3'-UTR FATB-1 (SEQ ID NO: 36) and 3'-UTR FAD3-1A (SEQ ID NO: 16) of the soybean are amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. PCR products were cloned in an antisense orientation in a vector containing the soybean 7Sα promoter and the 3ml tml termination sequence using XhoI sites created at the 5'end of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene expression construct pMON80630 shown in FIG. 14 is used for transformation by the methods described in the present description.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated together). 3'-UTR FAD3-1A (SEQ ID NO: 16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO: 27 and 26, ligated with each other) soybeans are amplified by PCR to form PCR products, containing re-created restriction sites at both ends. PCR products were cloned in anti-mouse orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml end termination sequence tml using XhoI sites created at the 5 ′ ends of the PCR primers. This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the Brassica napin 3 ′ terminal termination sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene-expressing construct O8 shown in FIG. 14 is used for transformation by the methods provided in the present description of the invention.

As shown in FIG. 15, sequences 5′-UTR-3′-UTR FAD2-1 (SEQ ID NOs: 6 and 5 ligated with each other), 5′-UTR-3′-UTR FAD3-1A (SEQ ID NO: 17 and 16, ligated with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO: 37 and 36, ligated with each other) soybeans are amplified by PCR to form PCR products containing reconstituted restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence, with an additional 7Sα soybean promoter between sense and antisense sequences, using XhoI sites created at the 5'-ends of PCR primers . This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct O3 shown in FIG. 15 is used for transformation by the methods provided in the present description of the invention.

The sequences 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO: 6 and 5, ligated with each other), 5'-UTR-3'-UTR FAD3-1A (SEQ ID NO: 27 and 26, ligated each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NOs: 37 and 36, ligated with each other) the soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα 'soybean promoter and the 3'-terminal tml termination sequence, with an additional 7Sα soybean promoter between sense and antisense sequences, using XhoI sites created at the 5'-ends of PCR primers . This vector is then cut with NotI and ligated with the pMON41164 vector containing the EPS4 EPS4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the Brassica napin promoter and the 3 ′ terminal Brassica napin sequence, was cut with the corresponding restriction enzymes and ligated with the vector pMON41164. The resulting gene expression construct O4 shown in FIG. 15 is used for transformation by the methods described in the present description of the invention.

As shown in FIG. 16, non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FATB-1 (SEQ ID NO: 29-37) and non-coding sequences of FAD2-1 (SEQ ID NO: 1 and 5 -6) soybeans are amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination sequence. This vector is then cut with the appropriate restriction endonuclease and ligated with the pMON80612 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct shown in FIG. 16-A is used for transformation by the methods provided herein.

The DNA sequence containing the delta-9 desaturase gene, regulated by the 7S alpha promoter and the 3'-terminal TML termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting expression construct shown in FIG. 16-B is used for transformation by methods described in the present description of the invention.

A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the haricotin bean promoter and the 3'-terminal napin termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting gene-expressing construct shown in FIG. 16-C is used for transformation by the methods provided in the present specification.

As shown in FIG. 17, non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FATB-1 (SEQ ID NO: 29-37), non-coding sequences of FAD2-1 (SEQ ID NO: 1 and 5 -6) and non-coding sequences of FAD3-1A (SEQ ID NO: 7-13 and 16-17) the soybean is amplified by PCR to form PCR products containing re-created restriction sites at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml tml termination termination sequence. This vector is then cut with the corresponding restriction endonuclease and ligated with the pMON80612 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence. The resulting gene-expressing construct shown in FIG. 17-A is used for transformation by the methods provided herein.

The DNA sequence containing the delta-9 desaturase gene, regulated by the 7S alpha promoter and the 3'-terminal TML termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression constructs. The resulting expression construct shown in FIGS. 17-B is used for transformation by the methods provided herein.

A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the haricotin bean promoter and the 3'-terminal napin termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting gene-expressing construct shown in FIGS. 17-C is used for transformation by the methods provided herein.

As shown in FIG. 18, non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FATB-1 (SEQ ID NO: 29-37), non-coding sequences of FAD2-1 (SEQ ID NO: 1 and 5 -6), non-coding sequences FAD3-1A (SEQ ID NO: 7-13 and 16-17) and non-coding sequences FAD3-1B (SEQ ID NO: 19-27) soybeans are amplified by PCR to form PCR products, including re-created sites restriction at both ends. PCR products are cloned in a sense and antisense orientation in a vector containing the 7Sα ′ soybean promoter and the 3ml tml termination sequence. This vector is then cut with the corresponding restriction endonuclease and ligated with the pMON80612 vector containing the EPS4 CP4 gene regulated by the FMV promoter and the Rubisco pea 3 ′ terminal termination sequence. The resulting gene-expressing construct shown in FIG. 18-A is used for transformation by the methods provided herein.

The DNA sequence containing the delta-9 desaturase gene, regulated by the 7S alpha promoter and the 3'-terminal TML termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting expression construct shown in FIG. 18-B is used for transformation by methods described in the present description of the invention.

A vector containing the C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by the haricotin bean promoter and the 3'-terminal napin termination sequence, is cut with the corresponding restriction enzymes and ligated with the above expression construct. The resulting gene-expressing construct shown in FIG. 18-C is used for transformation by the methods provided in the present description of the invention. The above nucleic acid molecules are preferred embodiments of the invention to achieve the objectives, features and advantages of the present invention. It should not be considered that the present invention is limited to the illustrated variants of the invention. The location of the sequences in the first and second sets of DNA sequences in the nucleic acid molecule is not limited to the illustrated and described locations and can be changed in any way acceptable for the implementation of the objectives, features and advantages of the present invention, presented in the present description of the invention, illustrated in the accompanying drawings and covered by the claims inventions.

3D In vivo assembly

One object of the present invention is a DNA construct used to assemble a recombinant transcription unit in a plant chromosome in planta that is capable of forming double-stranded RNA. The assembly of such constructs and methods for assembling an in vivo recombinant transcription unit for gene suppression are described in international patent application No. PCT / US2005 / 00681, which is incorporated herein by reference in its entirety.

pMON93505 is a construct used for in vivo assembly that contains two segments of T-DNA flanked by the edge elements of Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from the 3 ′ end and ligated to 3′-UTR FATB-1a, per which is followed by 5'-UTR FATB-1a, C. pulcherrima KAS IV gene (SEQ ID NO: 39), functionally linked to the Brassica napin promoter and the Brassica 3'-terminal termination sequence, Ricinus communis delta-9 desaturase gene (publication US patent application No. 2003/00229918 A1), functionally linked to the soybean 7SA promoter and the nos 3'-terminal termination sequence, and the EPSPS gene CP, functional but related eFMV promoter and the 3'-terminal sequence of the pea Rubisco terminator E9, wherein all sequences are flanked by boundary elements T-DNA Agrobacterium, i.e. DNA right edge (RB) and the left edge DNA (LB). In the same construction, in the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6, functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from 3 'end and ligated to 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON93506 is an in vivo assembly construct that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA contains the soybean 7Sα ′ promoter functionally linked to the intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from the 3'-end and ligated to 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a, the Ricinus communis delta-9 desaturase gene (US Patent Application Publication No. 2003/00229918 A1), operably linked to the soybean 7SA promoter and the nos 3'-terminal termination sequence, and the EPS4 CP4 gene, functionally linked to the eFMV promoter and the 3'-terminal termination sequence of pea Rubisco E9, with all sequences flanked by LB and RB. In the same vector, in the second segment of T-DNA, there is a 3'-terminal termination sequence functionally linked to soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from the 3'-end and ligated from 3 ' -UTR FATB-1a followed by 5'-UTR FATB-1a flanked by another RB and LB. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean 7Sα 'promoter functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON95829 is an in vivo assembly construct that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right edge DNA (RB) and left edge DNA (LB). The first T-DNA contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from the 3'-end and ligated to 42 consecutive 5'-UTR FATB-1a nucleotides followed by the coding region of the chloroplast transit peptide (“CTP”) FATB-1, and the EPS2 gene CP2 functionally linked to the EFMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence, all sequences being flanked by Agrobacterium T-edge elements , i.e., right edge DNA (RB) and left edge DNA (LB). In the same vector, in the second segment of T-DNA flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from 3 'end and ligated to 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region of the chloroplast transit peptide FATB-1 (“CTP”). The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON97595 is an in vivo assembly construct that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains the 7Sα'coi promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3'-end and ligated with 42 consecutive 5'-UTR FATB- nucleotides 1a, followed by the coding region of the chloroplast transit peptide (“CTP”) FATB-1a, and the EPS4 CP4 gene, operably linked to the EFMV promoter and the Rubisco E9 pea 3 ′ terminal termination sequence, with all sequences flanked by T-DNA curved elements , i.e., right edge DNA (RB) and left edge DNA (LB). In the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3'-end and ligated to 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region of the CTP FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON97581 is a construct used for in vivo assembly that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right edge DNA (RB) and left edge DNA (LB). The first T-DNA segment contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3 ′ end and ligated to the coding region of the chloroplast transit peptide (“CTP” ) FATB-1a, and the EPS4 CP4 gene, operably linked to the EFMV promoter and the 3 ′ terminal termination sequence of pea Rubisco E9, all sequences being flanked by the Agrobacterium T-DNA edge elements, i.e., the right-hand (RB) DNA and the left-hand DNA (LB). In the same design, in the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from 3 '-terminal and ligated to the coding region of CTP FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON97596 is an in vivo assembly construct that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3 ′ end and ligated from 180 bp. The 5'-end of the coding region of the chloroplast transit peptide (“CTP”) FATB-1, and the CP4 EPSPS gene, functionally linked to the EFMV promoter and the 3'-terminal termination sequence of pea Rubisco E9, with all sequences flanked by Agrobacterium T-edge elements , i.e., right edge DNA (RB) and left edge DNA (LB). In the same design, in the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from 3 '-end and ligated with 180 bp 5'-end of the coding region of the CTP FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean 7Sα 'promoter functionally linked to intron 1 FAD2-1A and soybean FATB-1a DNA fragments in the sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON97597 is a construct used for in vivo assembly that contains two T-DNA segments flanked by the edge elements of Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from the 3 ′ end and ligated from 120 bp. The 5'-end of the coding region of the chloroplast transit peptide (“CTP”) FATB-1a, and the EPS4 CP4 gene, operably linked to the EFMV promoter and the Rubisco E9 pea 3'-terminal termination sequence, with all sequences flanked by Agrobacterium T-edge elements , i.e., right edge DNA (RB) and left edge DNA (LB). In the same design, in the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 320 consecutive nucleotides from 3 '-end and ligated with 120 bp 5'-end of the coding region of the CTP FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

pMON97598 is an in vivo assembly construct that contains two T-DNA segments flanked by the edge elements of an Agrobacterium T-DNA, i.e., right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains the soybean 7Sα ′ promoter functionally linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 340 consecutive nucleotides from the 3 ′ end and ligated to the coding region of the chloroplast transit peptide (“CTP” ) FATB-1a, and the EPS4 CP4 gene, operably linked to the EFMV promoter and the 3 ′ terminal termination sequence of pea Rubisco E9, all sequences being flanked by the Agrobacterium T-DNA edge elements, i.e., the right-hand (RB) DNA and the left-hand DNA (LB). In the same construct, in the second T-DNA segment flanked by another RB and LB, there is a 3'-terminal termination sequence H6 functionally linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), reduced by 340 consecutive nucleotides from 3 '-terminal and ligated to the coding region of CTP FATB-1a. The resulting gene expressing construct is used for transformation by the methods provided herein.

When two T-DNA segments of the above construction are introduced into the same chromosome locus of the host organism in the RB-RB orientation, the assembled transcription unit contains the soybean promoter 7Sα 'functionally linked to intron 1 FAD2-1A and soybean fragments FATB-1a in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientations are capable of forming double-stranded RNA, which effectively suppresses FAD2-1A and FATB.

Example 4. Plant transformation and analysis

The constructs of Examples 2 and 3 are stably introduced into soybeans (for example, Asgrow cultivars A4922, Asgrow cultivars A3244 or Asgrow cultivars A3525) by the methods described above, including those presented in McCabe et al., Bio / Technology 6: 923-926 (1988), or by Agrobacterium mediated transformation method. Transformed soybean plants are identified by selection on a medium containing glyphosate. Fatty acid compositions are analyzed by gas chromatography in the seeds of soybean lines transformed with the above structures. In addition, any constructs may contain other sequences of interest, as well as different combinations of promoters.

For some applications, modified fatty acid formulations are determined in developing seeds, while in other cases, for example, when performing an oil profile analysis, determining fatty acid modifications that occur later in the FAS pathway, or detecting minor modifications in the fatty acid composition, mature ones are preferably used. seeds. In addition, it may be desirable to analyze the oil and / or fatty acid content of individual seeds, especially when determining the modification of oil in fissile seed populations of R ₁ . As used herein, generation R ₀ means a plant obtained by the transformation / regeneration methods described herein, and generation R ₁ means seeds obtained from “their own” transgenic plant R ₀ . R ₁ plants are grown from R ₁ seeds.

Fatty acid compositions are determined for the seed of soybean lines transformed with the constructs of Example 3. One to ten seeds of transgenic and control soybean lines are ground separately using a tissue homogenizer (Pro Scientific) for oil extraction. Soybean seed oil is extracted overnight in 1.5 ml of heptane containing triheptadecanoin (0.50 mg / ml). From aliquots of 200 μl of extracted oil, methyl esters are obtained by adding 500 μl of sodium methoxide in absolute methanol. The derivative formation reaction is carried out for 20 minutes at 50 ° C. This reaction is stopped by the simultaneous addition of 500 μl of 10% (w / v) sodium chloride and 400 μl of heptane. The resulting methyl fatty acid esters extracted with hexane were examined by gas chromatography (GC) in a Model 6890 gas chromatograph from Hewlett-Packard (Palo Alto, CA). The indicated gas chromatograph is equipped with a Supercowax 250 column (30 m, inner diameter 0.25 mm, film thickness 0.25 microns) (Supelco, Bellefonte, PA). The temperature of the column during injection is 175 ° C, while a temperature change is programmed from 175 ° C to 245 ° C to 175 ° C at a speed of 40 ° C / min. The temperatures of the doser and detector are 250 ° C and 270 ° C, respectively.

Example 5. Synthesized liquid fuel with improved properties of biological diesel fuel

The following mixtures of methyl esters of fatty acids are present in the composition of fatty acids of synthesized liquid fuels: 73.3% oleic acid, 21.4% linoleic acid, 2.2% palmitic acid, 2.1% linolenic acid and 1.0% stearic acid (all values are expressed in mass percent). Purified fatty acid methyl esters are purchased from Nu-Chek Prep., Ind., Elysian, MN, USA. The cetane number and ignition delay of the composition were determined at a southwestern research institute using an ignition quality analyzer (“IQT”) 613 (Southwest Research Institute, San Antonio, Texas, USA).

The ignition quality analyzer consists of a constant-volume combustion chamber with electric heating, a fuel injection system and a computer used to monitor the experiment, record and interpret data. The fuel injection system includes a fuel nozzle forming an inlet to the combustion chamber. A needle sensor in the fuel injector detects the flow of fuel into the combustion chamber. A pressure sensor connected to the combustion chamber measures the pressure in the cylinder and the pressure in the combustion chamber. The ignition quality analyzer is mainly used to measure the time from the start of fuel injection into the combustion chamber to the start of combustion. The thermodynamic conditions in the combustion chamber are controlled with high accuracy for a consistent measurement of the ignition delay time.

To determine the cetane number and the ignition delay, the test fuel is filtered through a 5 micron filter. The fuel tank, injection line and nozzle are purged with pressurized nitrogen. The fuel tank is then cleaned with a non-fiber cloth. A portion of the test fuel is used to flush the fuel tank, injection line, and nozzle. The tank is filled with test fuel and all air is removed from the system. A pressure of 3.5 atm (50 psi) is generated in the tank. This method consists in injecting under high pressure a precisely measured amount of the test fuel into a combustion chamber that is filled with air to achieve the required pressure and temperature. The measurement consists of determining the time from the start of injection to the start of combustion, which is often defined as the ignition delay time. This definition is based on the measured needle lift and pressure in the combustion chamber. The usual procedure for determining the cetane number requires the creation of a surface temperature of 567.5 ° C and an air pressure of 2.1 MPa.

Fuel with a known injection delay is fed into the IQT combustion chamber at the beginning of the day to ensure that normal parameters are created in this device. Then test the test synthetic fuel. Then, the known fuel is examined again to verify that the system parameters are set correctly. Immediately after attaching the fuel tank to the fuel injection pump, the computer controller initiates the test process. The computer controls the entire process, including air supply, fuel injection and removal of combustion products. Fuel combustion is repeated 32 times.

The ignition delay time is the time from the start of injection to the start of combustion. This parameter is determined on the basis of needle lift and cylinder pressure. Raising the injection needle indicates the start of injection. The pressure in the cylinder decreases slightly due to the cooling effect of fuel evaporation. The onset of combustion is defined as the time of pressure recovery in the cylinder, which increases due to combustion until the pressure preceding fuel injection is reached.

The measured ignition delay time is used to determine the cetane number based on a calibration curve that is entered into the data collection and preprocessing program. A calibration curve determining the cetane number as a function of the ignition delay time is obtained using mixtures of reference fuels and control NEG fuels. In the case of test fuels that are liquid at room temperature, the calibration curve is checked daily using at least one reference fuel with a known cetane number (Ryan, "Correlation of Physical and Chemical Ignition Delay to Cetane Number", SAE Paper 852103 (1985) ; Ryan, "Diesel Fuel Ignition Quality as Determined in a Constant Volume Combustion Bomb", SAE Paper 870586 (1986); Ryan, "Development of a Portable Fuel Cetane Quality Monitor", Belvoir Fuels and Lubricants Research Facility Report No. 277, May (1992); Ryan, "Engine and Constant Volume Bomb Studies of Diesel Ignition and Combustion", SAE Paper 881616 (1988); and Allard et al. "Diesel Fuel Ignition Quality as Determined in the Ignition Quality Tester (" IQT ")" SAE Paper 961182 (1996)). As shown in table 3, the synthesized oil has cetane numbers and ignition delay times suitable for using oils with a given composition without any limitation as biological diesel fuel.

Table 3 Fuel name Number
test Cetane number Cetane number standard deviation Ignition Delay (ms) Ignition delay standard deviation Check-high ¹ 1777 49.55 0.534 4,009 0,044 Check-high 1778 49.33 0.611 4,028 0.051 Average 49.4 4.02 Synthesized oil 1779 55.02 1,897 3,622 0.116 Synthesized oil 1780 55.65 1,807 3,583 0.109 Synthesized oil 1781 55.63 1,649 3,583 0,098 Average 55,4 3.60 Check-high 1786 49.2 0.727 4.04 0,061 ¹ Fuel called “Check-High” is a calibration fuel. This fuel should have a cetane number equal to 49.3 ± 0.5. The parameters of the device are checked using calibration fuel before and after testing the synthetic test fuel.

Density (ASTM D-4052), cloud point (ASTM D-2500), pour point (ASTM D-97), and cold clogging temperature (IP 309 / ASTM D-6371) are determined for the synthesized oil in accordance with the protocols ASTM D Test Guidelines. ASTM D test reports are provided by the American Society for Testing Materials, 100 Barr Harbor Drive, West Conshohocken, PA, USA. The results of these tests are shown in table 4. As shown in table 4, the synthesized oil has indicators suitable for the use of oils with this composition without any restrictions as biological diesel fuel.

Table 4 Test Method results Density ASTM D-4052 0.8792 g / ml Cloud point ASTM D-2500 -18 ° C Pour point ASTM D-97 -21 ° C Cold filter clogging temperature IP 309 (similar to ASTM D-6371) -21 ° C

Nitric oxide emission levels are evaluated by determining the unsaturation levels of biofuels by measuring fuel density and calculating estimated emission levels or by direct measurement. In addition, standard methods exist for directly measuring nitric oxide emission levels. Based on the assessment of the overall unsaturation of the synthesized oil, it was found that the synthesized oil is characterized by lower levels of nitric oxide emission compared to methyl esters of fatty acids obtained from ordinary soybean oil. Oils containing a greater number of double bonds, that is, having a higher degree of unsaturation, emit more nitric oxide. This oil has a total of 123 double bonds compared to 153 double bonds of regular soybean oil, as shown in table 5.

Table 5 Synthetic oil 73% oleic acid (18: 1) × 1 double bond = 73 22% linoleic acid (18: 2) × 2 double bonds = 44 2% linolenic acid (18: 3) × 3 double bonds = 6 The total number of double bonds 123 Regular soybean oil 23% oleic acid (18: 1) × 1 double bond = 23 53% linoleic acid (18: 2) × 2 double bonds = 106 8% linolenic acid (18: 3) × 3 double bonds = 24 The total number of double bonds 153

According to the National Renewable Energy Laboratory, Contract No. ACG-8-17106-02 Final Report, The Effect Of Biodiesel Composition On Engine Emissions From A DDC Series 60 Diesel Engine, (June 2000), the release of nitric acid with biological diesel can be calculated using the formula = 46.959x - 36.388, where y means the emission of oxide in grams / braking power in horsepower × hour (g / hp · hour); and x is the density of biological diesel fuel. This formula is based on a regression analysis of nitric acid emission data from a test of 16 biological diesel fuels. When performing this test, a calibration engine of the 1991 Detroit Diesel Corporation production model series 60 was used.

The density of the synthesized oil was determined at a southwestern research institute using ASTM D4052. The result shown in table 4, is used in the above equation to predict the value of the emission of nitric oxide, equal to 4.89 g / hp · hour. The result obtained is comparable to that of the control soy product. A report from the National Renewable Energy Laboratory provides data on the density and emission of nitric oxide for control biological diesel fuel from soybeans (IGT soybean methyl ester). The density of the control biological diesel fuel is 0.8877 g / ml, therefore, the calculated value of the emission of nitric oxide is equal to 5.30 g / hp · h. The calculated value of the release is similar to the experimental value of the release of nitric oxide, equal to 5.32 g / hp · h. Synthetic oil is characterized by better values compared to control fuel and is suitable for use without any restrictions as biological diesel fuel.

Example 6. The optimal composition of fatty acids necessary to ensure normal levels of lipids in serum

The properties of the compositions of vegetable oils in relation to lowering cholesterol were determined in order to identify fatty acid compositions that have a more favorable effect on serum lipids compared to regular soybean oil (i.e. lower LDL cholesterol and higher HDL cholesterol). Published equations derived from 27 clinical trials (Mensink, R.P. and Katan, M.B. Arteriosclerosis and Thrombosis, 12: 911-919 (1992)) were used to compare the effects on human serum lipid levels of new seed oil formulations with conventional soybean oil.

The following table 6 presents the results of changes in serum lipids when lipids are replaced by 30% of the energy of food created by carbohydrates. The results show that soybean oil already has a beneficial effect on serum lipid levels when it replaces carbohydrates in the diet. The composition of said oil can be improved by lowering saturated fat levels and adjusting linoleic acid to 10-30% of the total fatty acid content, preferably to about 15-25% of the total fatty acid content. When the proportion of linoleic acid is less than 10% of the total fatty acid content, the new formulation increases LDL cholesterol compared to control soybean oil, even if the saturated fat content is 5% of the total fatty acid content. As the proportion of linoleic acid increases, the ability of the composition to increase serum HDL levels decreases. Therefore, the preferred content of linoleic acid in the oil should be approximately 15-25% of the total content of fatty acids.

Table 6 Fatty acid S16: 0 C18: 0 S18: 1 S18: 2 S18: 3 Other
(C20: 1) Serum Lipids Control soybean oil (%) 11,000 4,000 23,400 53,200 7,800 0,600 The proportion of 30% fat E (%) 3,300 1,200 7,020 15,960 2,340 0.180 Calculation of LDL (mg / dl) 4,224 1,536 1,685 8,778 1,287 0,043 -6,033 Calculation of HDL (mg / dl) 1,551 0.564 2,387 4,469 0.655 0,061 9,687 3% 18: 1, <6% saturated fatty acids (%) 3,000 2,000 85,000 3,000 3,000 4,000 The proportion of 30% fat E (%) 0,900 0,600 25,500 0,900 0,900 1,200 Calculation of LDL (mg / dl) compared to control oil (mg / dl) 1,152 0.768 6,120 0.495 0.495 0.288 -5,578 0.555 Calculation of HDL (mg / dl) compared to control oil (mg / dl) 0.423 0.282 8,670 0.252 0.252 0.408 10,287 0,600 10% 18: 2, <6% saturated fatty acids (%) 3,000 2,000 72,000 10,000 3,000 10,000 The proportion of 30% fat E (%) 0,900 0,600 21,600 3,000 0,900 3,000 Calculation of LDL (mg / dl) compared to control oil (mg / dl) 1,152 0.768 5,184 1,650 0.495 0.720 -6.129 - 0,096 Calculation of HDL (mg / dl) compared to control oil (mg / dl) 0.423 0.282 7,344 0.840 0.252 1,020 10,161 0.474 20% 18: 2, <6% saturated fatty acids (%) 3,000 2,000 65,000 20,000 3,000 7,000 The proportion of 30% fat E (%) 0,900 0,600 19,500 6,000 0,900 2,100 Calculation of LDL (mg / dl) compared to control oil (mg / dl) 1,152 0.768 4,680 3,300 0.495 0.504 -7,059 - 1,026 Calculation of HDL (mg / dl) compared to control oil (mg / dl) 0.423 0.282 6,630 1,680 0.252 0.714 9,981 0.294 21% 18: 2, <3.2% saturated fatty acids (%) 2,000 1,000 72,000 21,000 1,000 3,000 The proportion of 30% fat E (%) 0,600 0,300 21,600 6,300 0,300 0,900 Calculation of LDL (mg / dl) compared to control oil (mg / dl) 0.768 0.384 5,184 3,465 0.165 0.216 -7.878 -1.845 Calculation of HDL (mg / dl) compared to control oil (mg / dl) 0.282 0.141 7,344 1,764 0,084 0,306 9,921 0.234 30% 18: 2, <6% saturated fatty acids (%) 3,000 2,000 57,000 30,000 3,000 5,000 The proportion of 30% fat E (%) 0,900 0,600 17,100 9,000 0,900 1,500 Calculation of LDL (mg / dl) compared to control oil (mg / dl) 1,152 0.768 4,104 4,950 0.495 0.360 - 7,989 -1.956 Calculation of HDL (mg / dl) compared to control oil (mg / dl) 0.423 0.282 5,814 2,520 0.252 0.510 9,801 0.114

Example 7

The following fourteen steps illustrate the creation of the pMON68537 vector, intended for plant transformation to suppress the FAD2, FAD3 and FATB genes and overexpression of delta-9 desaturase in soy. In particular, this design includes the 7Salpha promoter functionally linked to the intron and 3'-UTR of soybean in sense orientation, that is, intron No. 1 FAD2-1A, 3'-UTR FAD3-1A, 3'-UTR FATB-1, hairpin loop-forming splicable intron and complementary series of soybean intron and 3'-UTR in antisense orientation, i.e. 3'-UTR FATB-1, 3'-UTR FAD3-1A and intron No. 1 FAD2-1A, and soybean promoter FAD2, stimulating delta-9 desaturase.

Stage 1 Soybean intron No. 5 FAD3-1A, which is part of the spliced intron of the dsRNA construct, is amplified by PCR using soybean genomic DNA as a template, with the following primers:

5'-end primer = 19037 = ACTAGTATATTGAGCTCATATTCCACTGCAGTGGATATT

GTTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGG

ATATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC

3'- end primer = 19045 =

ACTAGTATATTGAGCTCATATTCCTGCAGGATATTCTCGAG

ATATTCACGGTAGTAATCTCCAAGAACTGGTTTTGCTGCTTGTGTCTGCAGTGAATC

These primers add cloning sites to the 5'- and 3'-ends. To the 5'-end: SleI, SacI, BstXI, PmeI, NheI, MluI, HindIII, XmaI, SmaI, SalI. To the 3'-end: SreI, SacI, Sse8387I, XhoI. Soy Intron No. 5 FAD3-1A, a PCR product, was cloned into pCT2.1, creating KAWHIT03.0065. KAWHIT03.0065 was then cleaved with SpeI and the ends were filled with Pfu polymerase and pMON68526 (empty vector resistant to chloramphenicol (hereinafter referred to as CM), HindIII was cleaved and the ends were filled with Pfu polymerase. KAWHIT03.0065 and pMON68526 were ligated to form pON68 No. 5AON68MON 5MON68MON 5MON68526. soybeans with multiple cloning sites in a vector resistant to amphenicol).

Stage 2 Soy 3'-UTR FATB-1 is amplified with the following primers:

18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (addition of Bsp120I to the 5'-end) and 18661 = GGGCCCGATTTGAAATGGTTAACG. The PCR product is ligated with pCR2.1, creating KAWHIT03.0036.

Stage 3 . KAWHIT03.0036 cleave Bsp120I and EcoRI and clone into KAWHIT03.0032 (an empty CM-resistant vector with a multiple cloning site), creating KAWHIT03.0037 (3'-UTR FATB-1 in an empty CM-resistant vector).

Stage 4 . Soy 3'-UTR FAD3-1A is amplified with the following primers:

18639 = GGGCCCGTTTCAAACTTTTTGG (addition of Bsp120I to the 5'-end) and 18549 = TGAAACTGACAATTCAA. The PCR product is ligated with pCR2.1, creating KAWHIT03.0034.

Stage 5 . KAWHIT03.0034 cleaved Bsp120I and EcoRI and ligated with KAWHIT03.0032 (empty CM-resistant vector with multiple cloning site), creating KAWHIT03.0035 (3'-UTR FAD3-1A in an empty CM-resistant vector).

Stage 6 . Sron Intron No. 1 FAD2-1A was amplified by PCR using soybean genomic DNA as a template with the following primers: 5'-terminal primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (addition of the Bsp120I site to the 5'-end); and 3'-terminal primer = 18664 = CTGTGTCAAAGTATAAACAAGTTCAG. The resulting PCR product is cloned into pCR2.1, creating KAWHIT03.0038.

Stage 7 . Soybean intron No. 1 FAD2-1A, a PCR product, in KAWHIT03.0038, was cloned into KAWHIT03.0032 (an empty CM-resistant vector with a multiple cloning site) using restriction sites Bsp120I and EcoRI. The resulting plasmid is KAWHIT03.0039 (intron No. 1 FAD2-1A in an empty CM-resistant vector).

Stage 8 . KAWHIT03.0039 cleave AscI and HindIII and pMON68541 (AMP-resistant base vector with dsRNA intron No. 5 FAD3-1A) cleave MluI and HindIII. Soybean intron No. 1 FAD2-1A is directionally cloned into pMON68541, creating KAWHIT03.0071 (soybean intron No. 1 FAD2-1A with soybean intron No. 5 FAD3-1A).

Stage 9 . KAWHIT03.0035 (3'-UTR FAD3-1A in a CM-resistant vector) cleave AscI and HindIII and KAWHIT03.0071 (AMP-resistant base vector with dsRNA intron FAD2-1A and intron No. 5 FAD3-1A) cleave MluI and HindIII. Soybean 3'-UTR FAD3-1A was directionally cloned into KAWHIT03.0071, creating KAWHIT03.0072 (intron No. 1 FAD2-1A and 3'-UTR FAD3-1A with sron intron No. 5 FAD3-1A).

Stage 10 . KAWHIT03.0037 (3'-UTR FATB-1 in a CM-resistant vector) cleave AscI and HindIII and KAWHIT03.0072 cleave MluI and HindIII. 3'-UTR FATB-1 was directionally cloned into KAWHIT03.0072, creating KAWHIT03.0073 (intron FAD2-1A, 3'-UTR FAD3-1A, 3'-UTR FATB-1 soybean with intron No. 5 FAD3-1A).

Stage 11 . KAWHIT03.0073 cleaved BstXI and SalI, and the fragment containing the intron FAD2-1A, 3'-UTR FAD3-1A and 3'-UTR FATB-1 was gel purified. In another tube, KAWHIT03.0073 cleaved XhoI and Sse83871. The intron / 3'-UTR fragment is cloned into KAWHIT03.0073 in the opposite orientation at another site of soybean intron No. 5 FAD3-1A, creating KAWHIT03.0074 (soybean intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soybean, semantic 3'-UTR FATB-1 soybean, spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAT3-1A soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soy).

Stage 12 . To link the dsRNA construct with the 7S alpha promoter and the 3'-terminal TML sequence, KAWHIT03.0074 and pMON68527 (cluster 7Sa '/ 3'-terminal TML sequence) cleaved SacI and ligated with each other, creating pMON68563 (7S alpha promoter - sense intron No. 1 FAD2-1A, semantic 3'-UTR FAD3-1A soybeans, semantic 3'-UTR FATB-1 soybeans, spliced antisense 3'-UTR FATB-1 soybeans, antisense 3'-UTR FAD3-1A soybeans, antisense intron No. 1 FAD2 -1A soybeans is the 3'-terminal sequence of TML).

Stage 13 . To introduce the assembled dsRNA construct into pMON70682, the vectors pMON68563 and pMON70682 cleave NotI and ligate with each other, creating pMON68536, including the 7S alpha promoter, functionally linked to the double-stranded RNA construct of sense intron No. 1 FAD2-1A, sense 3'-UTR soybean, semantic 3'-UTR FATB-1 soybean, spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soybean terminator 3'-terminal sequence of TML).

Stage 14 . pMON68536 cleaves AscI and RsrII and pMON68529 (which contains the selectable CP4 marker fused to the FMV promoter and the 3 ′ end of RBCS, and the soybean FAD2 promoter that stimulates delta-9 desaturase) cleave SanDI and AscI. A portion of the dsRNAs of the vector pMON68536 is directionally cloned into pMON68529, creating pMON68537 (7Salfa promoter functionally linked to the double-stranded RNA construct of sense intron No. 1 FAD2-1a, sense 3'-UTR FAD3-1A soy, sense 3'-UTR FATB-1, and spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soybean and TML 3'-terminal sequence terminator, soybean FAD2 promoter, stimulating delta-9-desaturase).

Example 8

The following fifteen steps illustrate the creation of the vector pMON68539 (FIG. 22), designed to transform plants to suppress the FAD2, FAD3 and FATB genes and overexpression of delta-9 desaturase and KAS IV enzyme in soy. In particular, this design includes the 7Salpha promoter functionally linked to the intron and 3'-UTR of soybean in sense orientation, that is, intron No. 1 FAD2-1A, 3'-UTR FAD3-1A, 3'-UTR FATB-1, hairpin loop-forming spliceable intron, a complementary series of the intron and 3'-UTR of soybean in antisense orientation, i.e. 3'-UTR FATB-1, 3'-UTR FAD3-1A and intron No. 1 FAD2-1A, soybean promoter FAD2, stimulating delta-9- desaturase, and the napin promoter, stimulating KAS IV.

Stage 1 Soybean intron No. 5 FAD3-1A, which is part of the spliced intron in the dsRNA construct, is amplified by PCR using soybean genomic DNA as a template, with the following primers:

5'-end primer = 19037 =

ACTAGTATATTGAGCTCATATTCCACTGCAGTGGATATTG

TTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGGA

TATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC

3'-end primer = 19045 =

ACTAGTATATTGAGCTCATATTCCTGCAGGATATTCTCGAG

ATATTCACGGTAGTAATCTCCAAGAACTGGTTTTGCTGCTTGTGTCTGCAGTGAATC

These primers add cloning sites to the 5'- and 3'-ends. To the 5'-end: SpeI, SacI, BstXI, PmeI, NheI, MluI, HindIII, XmaI, SmaI, SalI. To the 3'-end: SpeI, SacI, Sse8387I, XhoI. Soy Intron No. 5 FAD3-1A, a PCR product, was cloned into pCR2.1, creating KAWHIT03.0065. Then KAWHIT03.0065 was cleaved with SpeI and the ends were filled with Pfu polymerase, pMON68526 (empty CM-resistant vector) was cleaved with HindIII and the ends were filled with Pfu polymerase. KAWHIT03.0065 and pMON68526 are ligated to create pMON68541 (soybean intron No. 5 FAD3-1A with multiple cloning sites in an AMP-resistant vector).

Stage 2 Soy 3'-UTR FATB-1 is amplified with the following primers:

18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (addition of Bsp120I to the 5'-end) and 18661 = GGGCCCGATTTGAAATGGTTAACG. The PCR product is then ligated with pCR2.1, creating KAWHIT03.0036.

Stage 3 . KAWHIT03.0036 cleave Bsp120I and EcoRI and clone into KAWHIT03.0032 (an empty CM-resistant vector with a multiple cloning site), creating KAWHIT03.0037 (3'-UTR FATB-1 in an empty CM-resistant vector).

Stage 4 . Soy 3'-UTR FAD3-1A is amplified with the following primers:

18639 = GGGCCCGTTTCAAACTTTTTGG (addition of Bsp120I to the 5'-end) and 18549 = TGAAACTGACAATTCAA. The PCR product is ligated with pCR2.1, creating KAWHIT03.0034.

Stage 5 . KAWHIT03.0034 cleaved Bsp120I and EcoRI and ligated with KAWHIT03.0032 (an empty CM-resistant vector with a multiple cloning site), thereby obtaining KAWHIT03.0035 (3'-UTR FAD3-1A in an empty CM-resistant vector).

Stage 6 . Sron Intron No. 1 FAD2-1A was amplified by PCR using soybean genomic DNA as a template with the following primers: 5'-terminal primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (addition of the Bsp120I site to the 5'-end); and 3'-terminal primer = 18664 = CTGTGTCAAAGTATAAACAAGTTCAG. The resulting PCR product is cloned into pCR2.1, creating KAWHIT03.0038.

Stage 7 . Soybean intron No. 1 FAD2-1A, a PCR product, in KAWHIT03.0038, was cloned into KAWHIT03.0032 (an empty CM-resistant vector with a multiple cloning site) using restriction sites Bsp120I and EcoRI. The resulting plasmid is KAWHIT03.0039 (intron No. 1 of soybean FAD2-1A in a CM-resistant vector).

Stage 8 . KAWHIT03.0039 cleave AscI and HindIII and the vector pMON68541 (AMP-resistant base vector with dsRNA intron No. 5 FAD3-1A) cleave MluI and HindIII. Soybean intron No. 1 FAD2-1A is directionally cloned into pMON68541 (FAD3-1A intron No. 5 in an AMP-resistant vector with multiple cloning sites), creating KAWHIT03.0071 (soybean intron No. 1 FAD2-1A with soybean intron No. 5 FAD3-1A) .

Stage 9 . KAWHIT03.0035 (3'-UTR FAD3-1A in a CM-resistant vector) cleave AscI and HindIII and KAWHIT03.0071 (AMP-resistant base vector with dsRNA intron FAD2-1A and intron No. 5 FAD3-1A) cleave MluI and HindIII. Soybean 3'-UTR FAD3-1A was directionally cloned into KAWHIT03.0071, creating KAWHIT03.0072 (soybean intron 1 FAD2-1A and 3'-UTR FAD3-1A soybean intron No. 5 FAD3-1A).

Stage 10 . KAWHIT03.0037 (3'-UTR FATB-1 in a CM-resistant vector) cleave AscI and HindIII and KAWHIT03.0072 cleave MluI and HindIII. 3'-UTR FATB-1 was directionally cloned into KAWHIT03.0072, creating KAWHIT03.0073 (intron FAD2-1A, 3'-UTR FAD3-1A, 3'-UTR FATB-1 soybean with intron No. 5 FAD3-1A).

Stage 11 . KAWHIT03.0073 cleave BstXI and SalI, and the fragment containing the intron FAD2-1A, 3'-UTR FAD3-1A and 3'-UTR FATB-1 was gel purified. In another tube, KAWHIT03.0073 cleaved XhoI and Sse83871. The intron / 3'-UTR fragment is cloned into KAWHIT03.0073 in the opposite orientation at another site of soybean intron No. 5 FAD3-1A, creating KAWHIT03.0074 (soybean intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soybean, semantic 3'-UTR FATB-1 soybean, spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAT3-1A soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soy).

Stage 12 . To link the dsRNA construct with the 7S alpha promoter and the 3'-terminal TML sequence, KAWHIT03.0074 and pMON68527 (cluster 7Sa '/ 3'-terminal TML sequence) cleaved SacI and ligated with each other, creating pMON68563 (7S alpha promoter - sense intron No. 1 FAD2-1A, semantic 3'-UTR FAD3-1A soybeans, semantic 3'-UTR FATB-1 soybeans, spliced antisense 3'-UTR FATB-1 soybeans, antisense 3'-UTR FAD3-1A soybeans, antisense intron No. 1 FAD2 -1A soybeans is the 3'-terminal sequence of TML).

Stage 13 . To introduce the assembled dsRNA construct into pMON70682, the vectors pMON68563 and pMON70682 cleave NotI and ligate with each other, creating pMON68536, including the 7S alpha promoter, functionally linked to the double-stranded RNA construct of sense intron No. 1 FAD2-1A, sense 3'-UTR soybean, semantic 3'-UTR FATB-1 soybean, spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soybean terminator 3'-terminal sequence of TML).

Stage 14 . pMON68536 cleaves AscI and RsrII and pMON68529 (which contains the selectable CP4 marker fused to the FMV promoter and the 3 ′ end of RBCS, and the soybean FAD2 promoter that stimulates delta-9 desaturase) cleave SanDI and AscI. A portion of the dsRNAs of the vector pMON68536 is directionally cloned into pMON68529, creating pMON68537 (7Salfa promoter functionally linked to the double-stranded RNA construct of sense intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, sense 3'-UTR FATB-1, and spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soybean, antisense intron No. 1 FAD2-1A soybean and TML 3'-terminal sequence terminator, soybean FAD2 promoter, stimulating delta-9-desaturase).

Stage 15 . pMON68537 cleave SanDI and AscI; and pMON70683 (napin stimulating Kas IV) cleave AscI and RsrII. The napin / Kas IV fragment is directedly cloned into pMON68537, creating pMON68539 (7Salfa promoter functionally linked to the double-stranded RNA construct of sense intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, sense 3'-UTR FATB-1 soy , spliced intron No. 5 FAD3-1A soybean, antisense 3'-UTR FATB-1 soybean, antisense intron No. 5 FAD3-1A soybean, antisense intron No. 1 FAD2-1A soybean and terminator 3'-terminal sequence TML, soybean FAD2 promoter stimulating delta-9 desaturase and the napin promoter stimulating Kas IV).

Example 9

This example illustrates the transformation of plants to produce soy plants with suppressed genes.

The transforming vector pMON68537 obtained in Example 7 was used to introduce into the soybean the double-stranded RNA-forming intron / 3'-UTR construct in order to suppress the Δ12 desaturase, Δ15 desaturase and FATB genes. The pMON68537 vector also contains the delta-9 desaturase (FAB2) and CP4 genes. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with dsrnc-expressing constructs with the intron / 3'-UTR. The oil compositions in the seed pool R ₁ and the individual seed R ₁ indicate a change in the composition of mono- and polyunsaturated fatty acids in the oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 7). For example, suppression of FAD2 allows plants with a high content of oleic acid ester compounds to be obtained; suppression of FAD3 allows to obtain plants with a reduced content of compounds of ester of linolenic acid; and suppression of FATB allows to obtain plants with a reduced content of ester compounds of saturated fatty acids, such as palmitates and stearates. Selection can be made from such lines depending on the required relative composition of fatty acids. Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the constructs.

Example 10

This example illustrates the transformation of plants to produce soy plants with suppressed genes.

The transforming vector pMON68539 obtained in Example 3 is used to introduce into the soybean the double-stranded RNA-forming intron / 3'-UTR construct in order to suppress the Δ12 desaturase, Δ15 desaturase and FATB genes. The pMON68539 vector also contains the Kas IV and CP4 genes. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with dsrnc-expressing constructs with the intron / 3'-UTR. The composition of the oil in the seed pool R ₁ and a single seed R ₁ indicate a change in the composition of mono- and polyunsaturated fatty acids in the oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 8). For example, suppression of FAD2 allows plants with a high content of oleic acid ester compounds to be obtained; suppression of FAD3 allows to obtain plants with a reduced content of compounds of ester of linolenic acid; and suppression of FATB allows to obtain plants with a reduced content of ester compounds of saturated fatty acids, such as palmitates and stearates. Selection can be made from such lines depending on the required relative composition of fatty acids. Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the constructs.

Table 7

The composition of fatty acids in individual R1 seeds obtained as a result of pMON68537 transformations

Table 8

The composition of fatty acids in individual R1 seeds obtained as a result of pMON68539 transformations

Example 11

The construction of pMON95829, similar to that described in Example 3D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1 intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide. The genomes of the transformed plants are then examined for the simultaneous sequential introduction of the first T-DNA and the second T-DNA, that is, with the assembly “right edge with right edge”. The study is performed by hybridization mapping methods using southern blotting. Transformed soy plants with a preferred configuration in the genome are transferred to a greenhouse to produce seeds.

For example, in R ₀ plants transformed with the pMON95829 construct, leaf tissue is taken and analyzed by Southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the assembly of both T-DNAs with the orientation of the right edge - right edge (“RB-RB”). Typically, approximately 25% of all transformants contain correctly assembled T-DNAs with an RB-RB orientation.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON95829, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the construct pMON95829, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 9). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 9

The composition of fatty acids in individual R1 seeds obtained as a result of pMON95829 transformations

Example 12

The pMON93505 construct, similar to that described in Example 3D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide. The genomes of the transformed plants are then examined for the simultaneous sequential insertion of the first T-DNA and the second T-DNA, that is, with the assembly “right edge with right edge”. The study is performed by hybridization mapping methods using southern blotting. Transformed soy plants with a preferred configuration in the genome are transferred to a greenhouse to produce seeds.

For example, in R ₀ plants transformed with the pMON93505 construct, leaf tissue is taken and analyzed by Southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the assembly of both T-DNAs with the orientation of the right edge - right edge (“RB-RB”). Typically, approximately 25% of all transformants contain correctly assembled T-DNAs with an RB-RB orientation.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93505, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93505 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 10). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 10

The composition of fatty acids in individual R1 seeds obtained as a result of pMON93505 transformations

Example 13

The pMON93506 construct, similar to that described in Example 3D, is used to introduce the FAD2-1A intron construct into a soybean that forms a double-stranded RNA to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide. The genomes of the transformed plants are then examined for the simultaneous sequential insertion of the first T-DNA and the second T-DNA, that is, with the assembly “right edge with right edge”. The study is performed by hybridization mapping methods using southern blotting. Transformed soy plants with a preferred configuration in the genome are transferred to a table for seed production.

For example, in R ₀ plants transformed with the pMON93506 construct, leaf tissue is taken and analyzed by Southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the assembly of both T-DNAs with the orientation of the right edge - right edge (“RB-RB”). Typically, approximately 25% of all transformants contain correctly assembled T-DNAs with an RB-RB orientation.

Fatty acid compositions are analyzed by gas chromatography on the seed of soybean lines transformed with the construct pMON93506, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93506 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 11). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 11

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93506

Example 14

The pMON93501 construct, similar to that described in Example 3B, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography on the seed of soybean lines transformed with the construct pMON93501, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. Six seeds of R ₁ are first harvested from soybean plants transformed with the construct pMON93501, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 12). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 12

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93501

Example 15

The pMON97552 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography on the seed of soybean lines transformed with the construct pMON97552, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON97552 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 13). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 13

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON97552

Example 16

The pMON93758 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93758, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93758 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 14). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 14

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93758

Example 17

The pMON97553 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON97553, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soy plants transformed with the pMON97553 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 15). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 14

The composition of fatty acids in individual seeds R1 obtained as a result of transformations of pMON97553

Example 18

The pMON93770 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93770, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93770 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. The collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 16). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 16

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93770

Example 19

The pMON93759 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93759, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soy plants transformed with the pMON93759 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 17). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 17

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93759

Example 20

The pMON97554 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON97554, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON97554 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 18). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 18

The composition of fatty acids in individual R1 seeds obtained as a result of pMON97554 transformations

Example 21

The pMON93771 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93771, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soy plants transformed with the pMON93771 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 19). For example, suppression of FAD2 allows you to get plants with a high content of oleic acid ester compounds.

Table 19

The composition of fatty acids in individual seeds R1 obtained as a result of transformations of pMON93771

Example 22

The pMON97555 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON97555, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON97555 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 20). For example, suppression of FAD2 allows plants with a high content of oleic acid ester compounds to be obtained.

Table 20

The composition of fatty acids in individual R1 seeds obtained as a result of pMON97555 transformations

Example 23

The pMON93760 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93760, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soy plants transformed with the pMON93760 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 21). For example, the FAD2-1 intron, reduced by 320 consecutive nucleotides from the 5'-end (SEQ ID NO: 1) and capable of generating dsRNA, at least partially inhibits FAD2.

Table 21

The composition of fatty acids in individual R1 seeds obtained as a result of pMON93760 transformations

Example 24

The pMON93772 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93772, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93772 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 22). For example, the FAD2-1 intron, reduced by 360 consecutive nucleotides from the 3'-end (SEQ ID NO: 1) and capable of generating dsRNA, at least partially inhibits FAD2 in some transformations.

Table 22

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON93772

Example 25

The pMON97556 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON97556, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON97556 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. The collected positive averaged seeds indicate a change in the composition of mono- and polyunsaturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 23). For example, the FAD2-1 intron, reduced by 200 consecutive nucleotides from the 3'-end (SEQ ID NO: 1) and capable of generating dsRNA, at least partially inhibits FAD2.

Table 23

The composition of fatty acids in individual R1 seeds obtained as a result of pMON97556 transformations

Example 26

The pMON93764 construct, similar to that described in Example 2D, is used to introduce into the soybean the double-stranded RNA construct of the FAD2-1A intron to suppress the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow cultivar A4922) using an ABI strain of Agrobacterium tumefaciens (Martinell, US Patent No. 6384301). The selectable marker CP4 allows identification of transformed soybean plants by selection on a medium containing glyphosate herbicide.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the construct pMON93764, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six R ₁ seeds are collected from soybean plants transformed with the pMON93764 construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of saturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean (see table 24). For example, the FAD2-1 intron reduced by 400 consecutive nucleotides from the 3'-end (SEQ ID NO: 1) and capable of generating dsRNA does not substantially reduce the expression of FAD2.

Table 24

The composition of fatty acids in individual R1 seeds obtained as a result of pMON93764 transformations

Example 27

TaqMan analysis is designed to quantify nucleic acids by selective amplification and real-time fluorescence measurements (also referred to as real-time PCR). This method is used to determine the degree of suppression of the target transcript in developing transgenic seeds. To determine the absolute levels of the transcript of the target mRNA in the sample, a standard curve is constructed for each TaqMan experiment. For this purpose, different amounts of the cloned sequence of the soybean target gene, diluted in 20 ng of total RNA from canola, are amplified in parallel with samples of unknown amounts of the target. The accuracy of the number of copies of the transcript determined by this method has an error margin of 25%.

To obtain the matrix material, total RNA is extracted in an ABI 6100 nucleic acid preparation apparatus and 20 ng for each TaqMan sample is used. Samples are analyzed in an ABI 700 sequence detection device using the chemistry of the masterbatch by one-step reverse transcriptase PCR and an ABI prism. Then, a graph of counting values (Ct) is constructed by the TaqMan method obtained by performing the TaqMan PCR reaction, depending on the known amount of the synthetic target sequence to calculate linear regression in order to determine the amount of the target DNA FAD2-1 in an unknown sample based on the count values by the method TaqMan obtained at the end of each TaqMan PCR reaction.

Plants were transformed with the constructs pMON68540, pMON68546 or pMON80623 that suppressed FAD2-1A (see section 3A and FIG. 7 for descriptions of the constructs).

Total RNA is obtained from null and transformed plants using an ABI 6100 nucleic acid preparation device. Transformed plants are third-generation homozygous plants and contain more than 50% oleic acid. Primers for FAD2-1A, primers for FAD2-1B, or primers for FAD2-2A are added in separate TaqMan samples to total RNA from each test plant. Samples are analyzed in an ABI 700 sequence detection device using the chemistry of the masterbatch by one-step reverse transcriptase PCR and an ABI prism.

All transgenic plants significantly reduce the levels of FAD2-1A and FAD2-1B transcripts. None of the transgenic plants even partially reduces the levels of FAD2-2A or FAD2-2B.

Comparison of the levels of FAD2-1A transcripts in null plants reveals natural differences between plants. FAD2-1A mRNA in developing seeds is analyzed using PCR primers that form the probe sequence in many plants. Seeds with a mass of crude tissue of 0.2 g are obtained from four different zero plants-segregants of R ₂ belonging to different lines. The test is carried out pools of seeds of R ₂ having the same size and obtained from four different zero segregants. PCR reactions were performed in triplicate and the results were normalized by comparing with the amount of 18S RNA in each sample. The biological variability of the FAD2-1A transcripts in different plants is low. Three of the four samples have a normalized TaqMan count value (Ct) of approximately 65, and one of the samples has a normalized TaqMan count value of approximately 50.

Example 28

A fragment of 200 consecutive nucleotides of the soybean FAD2-1 intron 1 sequence (SEQ ID NO: 1) is amplified by PCR to obtain PCR products containing the first 200 nucleotides of SEQ ID NO: 1, starting at the 5'-end of SEQ ID NO: 1 . PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml terminal termination sequence tml using the restriction sites created at the 5'end of the PCR primers. This vector is then cut with a restriction enzyme and ligated with a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and the 3 ′ endpoint sequence of pea Rubisco E9. The resulting gene expressing construct is used for transformation by the methods provided herein.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the indicated construct, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six seeds of R ₁ are collected from soybean plants transformed with the indicated construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of saturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean.

Example 29

A fragment of 180 consecutive nucleotides of the soybean FAD2-1 intron 1 sequence (SEQ ID NO: 1) was amplified by PCR to obtain PCR products containing the first 180 nucleotides of SEQ ID NO: 1, starting from the 3'-end of SEQ ID NO: 1 . PCR products are cloned in a sense orientation in a vector containing the 7Sα 'soybean promoter and the 3ml terminal termination sequence tml using the restriction sites created at the 5'end of the PCR primers. This vector is then cut with a restriction enzyme and ligated with a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and the 3 ′ endpoint sequence of pea Rubisco E9. The resulting gene expressing construct is used for transformation by the methods provided herein.

Fatty acid compositions are analyzed by gas chromatography in the seed of soybean lines transformed with the indicated construct, as described in Example 4, to identify methyl ester compounds of fatty acids extracted from seeds. First, six seeds of R ₁ are collected from soybean plants transformed with the indicated construct, and the composition of the fatty acids in each individual seed is determined. Since the plants R ₁ obtained as a result of each transformation are split into transgenes, they give seeds with both the usual composition and modified variants. Positive seeds are harvested and averaged for each transformation. Collected positive averaged seeds indicate a change in the composition of saturated fatty acids in oil from seeds of transgenic soybean lines compared to oil from seeds of non-transformed soybean.

Example 30

pMON97562 contains the soybean 7Sα ′ promoter operably linked to the soybean intron 1 FAD2-1A (SEQ ID NO: 1), which is reduced by 100 consecutive nucleotides from the 3 ′ end and linked to the 5′-UTR of FAD3-1A, followed by 3 '-UTR FAD3-1A associated with 5'-UTR FAD3-1B, followed by 3'-UTR FAD3-1B, followed by 5'-UTR FATB-1a, followed by 3'-UTR FATB-1a, operably linked to 70 nucleotides of FAD3-1A intron 4, operably linked to antisense 3'-UTR FATB-1a, followed by antisense 5'-UTR FATB-1a, associated with antisense 3'-UTR FAD3-1B orientation followed by 5'- UTR FAD3-1B in antisense orientation associated with 3'-UTR FAD3-1A in antisense orientation, followed by 5'-UTR FAD3-1A in antisense orientation, followed by soybean intron 1 FAD2-1A (SEQ ID NO: 1 ), reduced by 100 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked to the 3'-end segment of the H6 polyadenylation with the EPS4 CP4 gene, functionally linked to the EFMV promoter and the 3'-terminal termination sequence of peas Rubisco E9, all sequences are flanked by the right edge (RB) and the left m edge (LB) in one DNA molecule. The resulting gene-expressing construct is used to transform soybean by the methods presented in the present description of the invention. The compositions of fatty acids are determined by gas chromatography in the seed of soybean lines transformed by the indicated construction, in accordance with the description given in Example 4. Table 25 shows the compositions of typical seeds. Level 18: 3 reduced by about 1%.

Table 25

The composition of fatty acids in individual seeds of R1 obtained as a result of transformations of pMON97562

Example 31

pMON97563 contains the soybean 7Sα ′ promoter operably linked to soybean intron 1 FAD2-1A (SEQ ID NO: 1), which is reduced by 100 consecutive nucleotides from the 3 ′ end and linked to the 5′-UTR of FAD3-1A, followed by 3 The '-UTR FAD3-1A associated with the 5'-UTR FAD3-1B followed by the 3'-UTR FAD3-1B associated with the 5'-UTR FAD3-1C followed by the 3'-UTR FAD3-1C which is followed by the coding region of CTP FATB-1a, followed by the coding region of CTP FATB-2a, functionally linked to 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of CTP FATB-2a in the antisense orientation, followed by t coding region CTP FATB-1a in the antisense orientation, associated with the 3'-UTR FAD3-1C in the antisense orientation, followed by 5'-UTR FAD3-1C in the antisense orientation, associated with 3'-UTR FAD3-1B in the antisense orientation followed by 5'-UTR FAD3-1B in the antisense orientation, associated with 3'-UTR FAD3-1A in the antisense orientation, followed by 5'-UTR FAD3-1A in the antisense orientation, followed by intron 1 FAD2-1A soybeans (SEQ ID NO: 1), reduced by 100 consecutive nucleotides from the 3'-end and located in the antisense orientation, which is functionally linked with a 3-terminal segment of H6 polyadenylation with the EPS4 CP4 gene functionally linked to the EFMV promoter and the 3 ′ terminal termination sequence of pea Rubisco E9, all sequences being flanked by the right edge (RB) and left edge (LB) in one DNA molecule. The resulting gene-expressing construct is used to transform plants by the methods presented in the present description of the invention. The compositions of fatty acids are determined by gas chromatography in the seed of soybean lines transformed by the indicated construction, in accordance with the description given in Example 4. Table 26 shows the compositions of typical seeds. Level 18: 3 reduced by about 1%.

Table 26

The composition of fatty acids in individual R1 seeds obtained as a result of pMON97563 transformations

All compositions presented in the present description of the invention and the claims can be obtained and / or methods for producing these compositions can be performed without undue experimentation in view of the present description of the invention. Although the compositions of the present invention and methods for their preparation are described as preferred embodiments of the invention, it should be apparent to those skilled in the art that the compositions and / or methods, as well as the step or sequence of steps of the methods of the present invention can be introduced changes not going beyond the scope and essence of the invention. In particular, it is obvious that instead of the agents contemplated herein, other agents chemically and physiologically related may be used to achieve similar or similar results. All such substitutions and modifications obvious to those skilled in the art are within the spirit, scope and concept of the invention defined in the appended claims.

Claims (28)

1. Soybean seed, characterized by the composition of fatty acids in seed oil, in which the oleic acid content is from about 42 to about 85 wt.% Of the total fatty acid content and the content of saturated fatty acids is less than 8 wt.% Of the total fatty acid content where the specified plant further comprises a genome, including:
(i) a first nucleic acid sequence that is at least 90% identical to a soybean FAD2-1A intron fragment between 20 and 420 consecutive nucleotides in length, and
(ii) a second nucleic acid sequence that is at least 90% identical to a soybean FADB gene fragment between 40 and 450 consecutive nucleotides in length. 2. Soybean seed according to claim 1, where the specified genome further comprises a nucleic acid sequence that increases the expression of beta-caroacyl-ACP synthase IV or delta-9-desaturase or both together. 3. Soybean seed according to claim 1, wherein said fragment of said soybean FAD2-1 intron and said fragment of said soybean FATB gene are transcribed in a sense and antisense orientation to form RNA, which is at least partially double-stranded. 4. Soybean seed according to claim 1, wherein said nucleic acid sequence that suppresses the expression of endogenous FAD2-1 gene and soybean FATB gene is assembled as a functional unit of transcription after introduction to the plant chromosome. 5. Soybean seed according to claim 4, wherein said fragment of said soybean FAD2-1 intron and said fragment of said soybean FATB gene are transcribed in sense and antisense orientation with the formation of RNA, which is at least partially double-stranded. 6. Soybean seed according to claim 1, where the first nucleic acid sequence is at least 90% identical to a soybean FAD2-1A intron fragment between 20 and 420 consecutive nucleotides in length, inhibits the expression of endogenous soybean FAD2-1 and the gene further comprises a sequence a nucleic acid that enhances the expression of beta-ketoacyl-ACP synthase IV or delta-9 desaturase or both together. 7. A soybean seed cell characterized by a fatty acid composition in a seed oil in which the oleic acid content is from about 42 to about 85 wt.% Of the total fatty acid content and the saturated fatty acid content is less than 8 wt.% Of the total fatty acid content acids, where the specified seed contains:
(i) a nucleic acid sequence that is at least 95% identical to a soybean FAD2-1A intron fragment of a length between 20 and 420 consecutive nucleotides, and
(ii) a nucleic acid sequence that is at least 95% identical to a soybean FADB gene fragment between 40 and 450 consecutive nucleotides in length. 8. Unmixed soybean oil obtained from a seed characterized by a fatty acid composition in which the oleic acid content is from about 42 to about 85 wt.% Of the total fatty acid content and the content of saturated fatty acids is about 8 wt.% Or less of the total the content of fatty acids, where the specified seed additionally contains a genome, including:
(i) a nucleic acid sequence that is at least 90% identical to a soybean FAD2-1A intron fragment of a length between 20 and 420 consecutive nucleotides, and
(ii) a nucleic acid sequence that is at least 90% identical to a soybean FADB gene fragment between 40 and 450 consecutive nucleotides in length. 9. Soybean flour obtained from soybean seed, characterized by the composition of fatty acids in seed oil, in which the oleic acid content is from about 42 to about 85 wt.% Of the total fatty acid content and the content of saturated fatty acids is less than 8 wt.% from the total content of fatty acids, where the specified seed additionally contains a genome, including:
(i) a nucleic acid sequence that is at least 95% identical to a soybean FAD2-1A intron fragment between 20 and 420 consecutive nucleotides in length, and
(ii) a nucleic acid sequence that is at least 95% identical to a soybean FADB gene fragment between 40 and 450 consecutive nucleotides in length. 10. Unmixed soybean oil characterized by a fatty acid composition in which the oleic acid content is from about 42 to about 85 wt.% Of the total fatty acid content, the saturated fatty acid content is about 8 wt.% Or less of the total fatty acid content and the linolenic acid content is about 1.5 wt.% or less of the total fatty acid content. 11. Soybean seed according to claim 1, where the oleic acid content is from about 50 to about 80 wt.% Of the total content of fatty acids. 12. Soybean seed according to claim 1, where the oleic acid content is from about 46 to about 75 wt.% Of the total content of fatty acids. 13. Soybean seed according to claim 2, where the oleic acid content is from about 50 to about 80 wt.% Of the total content of fatty acids. 14. Soybean seed according to claim 2, where the oleic acid content is from about 46 to about 75 wt.% Of the total content of fatty acids. 15. Soybean seed according to claim 6, where the oleic acid content is from about 50 to about 80 wt.% Of the total content of fatty acids. 16. Soybean seed according to claim 6, where the oleic acid content is from about 46 to about 75 wt.% Of the total content of fatty acids. 17. The soybean seed of claim 1, wherein said first nucleic acid sequence is at least 95% identical to a soybean FAD2-1A intron fragment is from about 100 to about 320 nucleotides in length, and said combination of two nucleic acid sequences contains fragment FATB-1 5 'UTR. 18. Soybean seed according to claim 1, wherein said first nucleic acid sequence is at least 95% identical to the soybean FAD2-1A intron fragment, selected from the group consisting of: from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200 , from about 150 to about 220, from about 150 to about 400, from about 200 to about 300, and from about 300 to about 400 nucleotides in length. 19. Soybean seed according to claim 2, where the specified first nucleic acid sequence, at least 95% identical to the fragment of the soybean FAD2-1A intron, is from about 100 to about 320 nucleotides in length. 20. Soybean seed according to claim 2, where the specified first nucleic acid sequence is at least 95% identical to the fragment of the soybean FAD2-1A intron, selected from the group consisting of: from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200 , from about 150 to about 220, from about 150 to about 400, from about 200 to about 300, and from about 300 to about 400 nucleotides in length. 21. The soybean seed of claim 6, wherein said first nucleic acid sequence is at least 95% identical to the soybean FAD2-1A intron fragment, from about 100 to about 320 nucleotides in length. 22. Soybean seed according to claim 6, where the specified first nucleic acid sequence, at least 95% identical to the fragment of the soybean FAD2-1A intron, is selected from the group consisting of: from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200 , from about 150 to about 220, from about 150 to about 400, from about 200 to about 300, and from about 300 to about 400 nucleotides in length. 23. The soybean seed according to claim 1, wherein said first nucleic acid sequence contains a fragment 100% identical to a soybean FAD2-1A intron fragment between 20 and 420 consecutive nucleotides in length, and said combination of the two sequences is 100% identical to soybean FATB-1 and is from about 40 to about 450 nucleotides in length, and the specified genome further comprises a nucleic acid sequence that increases the expression of beta-ketoacyl-ACP synthase IV or delta-9 desaturase, or both together. 24. The soybean seed of claim 2, wherein said first nucleic acid sequence contains a fragment 100% identical to a soybean intron FAD2-1A fragment between about 20 and about 420 nucleotides long and a soybean FATB-1 sequence from about 40 to about 450 nucleotides long in length, where the specified sequence FATB-1 contains a fragment of UTR. 25. Soybean seed according to claim 6, where the specified nucleic acid sequence that suppresses the expression of endogenous soybean FAD2-1, contains a fragment 100% identical to the fragment of the soybean FAD2-1A intron with a length between approximately 20 and approximately 420 nucleotides. 26. Soybean seed according to claim 1, where the first nucleic acid sequence is at least 95% identical to the soybean FAD2-1A intron fragment, and the second nucleic acid sequence is at least 95% identical to the soybean FADB gene fragment. 27. The soybean seed of claim 1, wherein said soybean FATB gene fragment is a coding sequence for a soybean FATB transit peptide and about 45 consecutive nucleotides of said SATFATB-1 5 ′ UTR. 28. The soybean seed of claim 1, wherein said soybean FATB gene fragment is a coding sequence for a soybean FATB transit peptide and about 42 consecutive nucleotides of said soybean FATB-1 5 ′ UTR.

Images