RU2392324C2 - Concerned sequences linkage method - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: method facilitates linkage of sequences, coding immunoglobulin variable regions, T-cells receptors or B-cells receptors. Method is instrument of higher effectivity for making sequence data libraries. Capability of multiple RT-PCR with chain extension by interruption with employment of matrix, derived from single cell, provides highly effective creation of sister pairs libraries.

EFFECT: method is effective for linkage of two or few nucleotide sequences, coding domens or subunits of heteromeric protein as a result of single reaction performance.

51 cl, 25 dwg, 27 tbl, 14 ex

Description

FIELD OF THE INVENTION

The present invention relates to a multiple molecular amplification method capable of binding nucleotide sequences of interest by amplification, in particular by polymerase chain reaction (multiple PCR). The method is particularly effective for creating libraries of related pairs, as well as combinatorial libraries of sequences encoding the variable regions of immunoglobulins, T-cell receptors or B-cell receptors.

State of the art

Antigen-binding proteins involved in the immune response are present in mammals in the form of a large polyclonal set, which represents a wide variety of binding specificities. Such diversity is created by rearrangement of gene sequences encoding the variable regions of these binding proteins. Such binding proteins having variable regions include soluble and membrane bound forms of the B cell receptor (also known as immunoglobulins or antibodies) and membrane bound T cell receptors (TcR). As for immunoglobulins, their affinity increases after recognition of the antigen by the B-cell antigen receptor due to a process called “affinity maturation”, which involves the cycles of somatic overmutation of these variable region genes.

In addition, immunoglobulins or fragments thereof, such as Fab fragments, Fv fragments, and single chain Fv fragments (scFv), are subject to cloning and recombinant expression. However, all other binding proteins having variable regions can, in principle, be cloned and expressed in the same way as antibodies.

Known methods for isolating antibodies with the required binding specificity most often include obtaining hybridomas from immunized hosts followed by screening for specific clones or creating combinatorial libraries of expressed sequences in E. coli, consisting of variable domains of immunoglobulins, which are then enriched using methods such as, for example, phage display.

The main limitation associated with the use of hybrid technology to produce therapeutic antibodies is the absence of human lymphoma, which can be used as fusion cells for human B-lymphocytes. Heterohybridomas (i.e., human B cells fused to mouse lymphomas) are known to be unstable and thus rarely allow obtaining acceptable cell lines for the production of antibodies. Human B cells immortalized as a result of infection with the Epstein-Barr virus are characterized by the same signs of instability. The lack of reliable cellular methods for the production of human antibodies for therapeutic purposes can be offset by recent advances in molecular biology.

The use of combinatorial libraries and phage display allows you to create a wide range of antibody clones with potential diversity in excess of 10 ¹⁰ . From the above spectrum, one can select the type of binding to a specific target, thus creating a sub-library. Such a sub-library can be used to create polyclonal or monoclonal antibodies. The sequences encoding the variable regions (e.g., sequences encoding the variable region of the heavy chain and the variable region of the light chain of the immunoglobulin) that form the library can be amplified from lymphocytes, plasma cells, hybridomas, or any other population of cells expressing immunoglobulin. Modern methods for creating combinatorial libraries provide for the separate selection of sequences encoding variable regions from a population of cells. Thus, the initial pairing of sequences encoding the variable region of the heavy chain and the variable region of the light chain of immunoglobulin is lost. In the combinatorial library, these sequences are mated randomly, and the initial combinations of these variable sequences are formed only randomly. Therefore, to isolate sequences encoding the variable regions that are responsible for the required binding specificity, it is necessary to perform multi-stage screening. Such screening is usually performed in combination with enrichment methods for clones having the required specificity, such as phage or ribosome display. Even after diversity has been achieved, it may not be sufficient to isolate pairs of sequences encoding the variable regions in order to obtain binding proteins having the same high affinity that can be found in the original cells. In addition, the enrichment methods commonly used for screening combinatorial libraries introduce a significant standard error, for example, in the case of polypeptides with particularly low toxicity in E. coli, which affects the efficiency of chain folding, the rate of isolation slows down, or other parameters depending from the system, which further reduces the diversity of the library. In addition, clones derived from such combinatorial libraries often produce binding proteins with cross-reactivity against autoantigens, since these protein pairs, unlike the original pairs (hereinafter referred to as related pairs), are not subjected to in vivo negative selection for autoantigens like this occurs in the case of receptors for B- and T-lymphocytes at certain stages of their development. Therefore, it is desirable to clone the original pairs of sequences encoding variable regions. In addition, it is expected that the frequency of occurrence of clones with the required binding specificity will be significantly higher in the library of related pairs than in a conventional combinatorial library, especially if the cells of the source material were taken from a donor with a high frequency of occurrence of cells encoding pairs with specific binding, then immunocompetent or immunized donors have. From the above it follows that the library of sibling pairs does not have to be as large as the combinatorial library: a library of sibling pairs containing 10 ⁴ -10 ⁵ clones or even 10 ² -10 ³ clones obtained from a donor with an appropriate immune response can be quite sufficient to obtain binding proteins, representing a wide variety of required binding specificities.

To create libraries of related pairs, it is necessary to bind sequences encoding the variable regions that were isolated from one cell. Currently, two different approaches are described that provide for related pairing of sequences encoding variable regions.

Intracellular PCR is an approach in which the permeability of a fixed population of cells is ensured and intracellular binding of immunoglobulin sequences encoding the variable region of the heavy chain and the variable region of the light chain is performed. Said binding can be accomplished by RT-PCR with chain overlapping (WO 93/03151) or by recombinant method (Chapal, N. et al. 1997, Bio Techniques 23, 518-524). The amplification process described in these publications is a three- or four-stage process involving i) reverse transcription using constant region primers forming immunoglobulin cDNAs, ii) PCR amplification of sequences encoding the variable regions of the heavy and light chains using primer sets , with overlapping or recombination sites, iii) binding by recombination, if this method is chosen, iv) implementation of nested PCR products that form restriction sites for cloning. Since the cells are permeable, there is a significant risk of amplification products leaving the cells, as a result of which permutation of sequences encoding the variable region of the heavy chain and the variable region of the light chain can occur, which leads to the loss of mating. Therefore, this method involves washing stages after each reaction, which makes the process time-consuming and reduces the effectiveness of the reactions.

Typically, intracellular PCR is ineffective and leads to low sensitivity. Therefore, the method of binding using intracellular PCR was not widely used, and the initial study could not be repeated to obtain reliable results confirming that binding actually occurs inside the cell. Meanwhile, with this method, it is necessary to avoid the rearrangement of sequences encoding the variable region of the heavy chain and the variable region of the light chain, as a result of which the destruction of related pairs occurs.

Another intracellular method is described in WO 01/92291. The indicated method is based on RNA transplacing and it achieves the connection of V _H and V _L coding mRNA inside the cell. This approach requires the presence of a DNA construct that carries out trans-splicing inside cells.

Unicellular PCR is another method of related mating of sequences encoding the variable region of the heavy chain and the variable region of the light chain (see, for example, Coronella, JA et al. 2000, Nucleic Acids Res. 28, E85; Wang, X., et al . 2000, J. Immunol. Methods 20, 217-225). In these publications, a method is described in which the population of immunoglobulin-expressing cells is distributed in test tubes, diluted to a density corresponding to one cell in one reaction mixture, as a result of which cloning eliminates the rearrangement of sequences encoding the variable region of the heavy chain and the variable region of the light chains. The described method consists of three to four stages, including i) reverse transcription using oligo-dT primers, random hexamer primers or primers for the constant region forming cDNAs, ii) fractionation of the cDNA product in several tubes and PCR amplification of individual sequences, encoding the variable regions of the chains (in separate tubes), using primer sets containing restriction sites for cloning, iii) implementation of the nested PCR products that form restriction sites and for cloning (optionally) and iv) linking sequences encoding the heavy chain variable region and light chain variable region, from separate tubes by cloning them into an appropriate vector, which in itself is a multistage process.

A person has two types of light chains: lambda (λ) and kappa (κ). It follows that for cDNA obtained from each individual cell, it is necessary to perform at least three separate PCR reactions, followed by analysis and cloning of the corresponding fragments in a single vector to achieve related mating. Thus, the above-described unicellular PCR method requires a large number of manipulations to create a library of related pairs. Although the library of sibling pairs does not have to be as large as a combinatorial library to obtain binding proteins representing a wide variety of binding specificities, the creation of a library containing, for example, 10 ⁴ -10 ⁵ clones, by the above-described unicellular PCR method still remains laborious task. In addition, a large number of manipulations significantly increases the risk of contamination and error caused by the human factor.

To obtain binding proteins with a high affinity corresponding to the affinity that is usually observed when an immune reaction arises, the pairing of sequences encoding variable regions in combination with their amplification is very promising. To create a library with a wide variety of clones, it is necessary to develop a highly efficient cloning method with a minimal risk of contamination and sequence rearrangement.

In addition, it is desirable to reduce the number of stages of cloning to achieve highly efficient creation of combinatorial libraries.

The essence of improvement

The present invention relates to an efficient method for linking two or more nucleotide sequences of interest, i.e. sequences encoding variable regions using multiple molecular amplification, such as multiple RT-PCR with chain extension by overlapping or multiple RT-PCR followed by ligation or recombination . This method can be performed in a single cell format, which makes highly efficient cloning of related pairs possible.

Brief Description of the Drawings

Figure 1 schematically shows the different types of end segments of chain extension by overlapping. Bold lines correspond to the gene-specific part of the primer, and normal lines correspond to the overlapping end segment. Vertical lines illustrate complementary areas. Primers facilitate the binding of two nucleotide sequences of interest. Figure 1 (I) shows two variants of the end segments of the chain extension by overlapping type I, where only the extension segments overlap fully or partially; figure 1 (II) shows the end segments of the chain extension by overlapping type II, where some 5'-terminal nucleotides of the extension segment of the first primer are complementary to the gene-specific part of the adjacent primer; figure 1 (III) shows the end segments of chain extension by overlapping type III, where all the extension segments are complementary to the gene-specific region of the adjacent primer.

Figure 2 schematically depicts a mixture of multiple primers to extend the chain by overlapping, used to bind sequences encoding the variable regions of immunoglobulin. Binding cDNAs encoding a light chain (LC) and a variable region of a heavy chain (V _H ) are shown as tubes with the 5 ′ and 3 ′ ends of the sense strands as well as the estimated size of the amplified product. Multiple primer sets for overlapping strand extension used to amplify coding sequences are shown by arrows. Curved arrows with dotted edges directed towards the 5'-ends show the cloning end segments. The end segments of chain elongation by overlapping are shown in bold lines. Restriction sites present in the end segments are indicated next to the end segment. The total number of primers in the mixture of multiple primers for extending the chain by overlapping is sixteen and divided into external primers including one primer for C _k and one primer for C _H1 , and primers for extending the chain by overlapping, including six primers for V _L and eight primers for V _N The primer for C _H1 hybridizes with the 5'-end of the constant domain 1 of the heavy chain. It is estimated that the product resulting from multiple RT-PCRs with chain extension by overlapping is approximately 1070 bp. and contains the entire light Kappa chain, consisting of a constant region, the J-gene and the V-gene (C _to + J _L + V _L ), and the variable region of the heavy chain, consisting of the V-gene, D-segment and J-gene (V _H + D + J _H ). The 5'- and 3'-ends indicate the direction of the open reading frame. Only a small portion of the sequence encoding the C _H1 region is amplified by a plurality of primer mixtures to extend the chain by overlapping, since the hybridization position of the C _H1 primer is adjacent to the J region of the heavy chain.

Figure 3 shows several schemes showing different directions of binding of the obtained products, depending on which primers have an end binding segment. The overlap area is shown in black. The 5'- and 3'-ends indicate the direction of the open reading frame. On figa depicts a diagram illustrating the orientation of the products “head segment - head segment”. 3B is a diagram illustrating the orientation of end-to-end segment products. On figs depicts a diagram illustrating the orientation of the “head segment - end segment”, where the first is the sequence encoding the light chain. 3D is a diagram illustrating the orientation of the “head segment - end segment”, where the first is the sequence encoding the heavy chain.

Figure 4 schematically shows the expression vector of the immunoglobulin pLL113, where the coding sequences are in the orientation of “head segment - end segment”. The vector shown includes the following elements: bla = promoter, expression of the ampicillin resistance gene. Amp = gene encoding ampicillin resistance. pUC ori = pUC replication start point. AdMLP = major late adenovirus promoter. Human IgG1 = sequence encoding an immunoglobulin heavy chain of the human G1 isotype. hGH pA = poly-A signal sequence of human growth hormone. bGH polyA = poly-A sequence of cattle growth hormone. Human kappa LC = human immunoglobulin light kappa chain coding sequence. FRT = Flp recognition target site. Hygromycin = gene encoding hygromycin resistance. SV40 polyA = poly-A signal sequence of vacuolating monkey virus.

Fig. 5A shows a gel after electrophoresis showing the results of a two-stage multiple RT-PCR with chain extension by overlapping followed by a semi-nested PCR. Amplification products were obtained from cDNA isolated from individual cells of Chinese hamster ovary (CHO) Flp-In pLL113. Lanes 1-12 indicate samples, and arrows indicate the correct products of multiple RT-PCR nested with chain extension by overlapping 1076 bp in length .; M1 stands for 100 bp ladder. W denotes water used as a negative control. C denotes a positive control cDNA sample isolated from the HB-8501 cell line. Separately, a less contrasting invention of the same W, C bands and a 100 bp ladder is presented. to isolate individual DNA fragments. On figv given a schematic representation of the gel shown in figa, which illustrates the corresponding fragments of the gel.

Figure 6 shows several photographs and a graphical representation of the gels after electrophoresis, which presents the results of a single-stage multiple RT-PCR with chain extension by overlapping without additional amplification by the method of PCR. In all blocks, M1 stands for a 100 bp ladder, and M2 stands for a 500 bp ladder. 6A shows a gel after electrophoresis with amplification products isolated from a lysate corresponding to 100, 10, 1 or 0 cells. The arrow indicates the product of chain extension by overlapping. On figv given a schematic representation of the gel shown in figa. On figs shows the gel after electrophoresis, confirming the presence of the product obtained by lengthening the chain by overlapping, in bands corresponding to 100 and 1 cell, figa. On fig.6D shows the gel after electrophoresis, which shows the cleavage by restriction enzymes NheI and NcoI of the product obtained by elongation of the chain by overlapping, from the strip corresponding to 1 cell in figs.

Figure 7 shows the gel after electrophoresis, which shows the results of a single-stage multiple RT-PCR with chain extension by overlapping and subsequent amplification by the method of semi-nested PCR. M1 denotes a 100 bp ladder, and M2 denotes a 500 bp ladder. These results were obtained by using mixtures of multiple primers for chain extension by overlapping, containing a primer for C _H1 , C _H2 , C _H3 , C _H4 or C _H5 as an external primer when performing multiple RT-PCR with chain extension by overlapping. These reactions were performed in cell lysates corresponding to 100, 10, 1 or 0 cells. The size of the product obtained by extending the chain by overlapping is shown by the arrow.

Figure 8 shows the gel after electrophoresis, which shows the results of a single-stage multiple RT-PCR with chain extension by overlapping and subsequent amplification by the method of semi-nested PCR using enriched human B-lymphocytes as a matrix. M1 stands for 100 bp ladder. Lanes 5 and 6 correspond to the size of the product obtained by chain elongation by overlapping.

On figa schematically shows the expression vectors of mammals (Em465 / 01P582 / Em465 / 01P581) used to obtain cell lines expressing the lambda chain of IgG1, where the coding sequences are in the orientation of the “head segment - head segment”. These vectors include the following elements: Amp = gene encoding ampicillin resistance. pUC ori = pUC replication start point. AdMLP = major late adenovirus promoter. EFP = promoter of elongation factor. Leader AP = leader sequence of alkaline phosphatase. VH = sequence encoding the variable region of the heavy chain. IgG1 HC = sequence encoding the constant region of the heavy chain of the immunoglobulin isotype G1. rBG polyA = poly-A signal sequence of rabbit beta globulin. bGH polyA = poly-A sequence of cattle growth hormone. Leader IgK = sequence encoding the leader sequence of the kappa chain of the mouse. IgL (1b or 1c) = sequence encoding the lambda light chain of an immunoglobulin family of 1b or 1c. FRT = Flp recognition target site. Hygromycin = gene encoding hygromycin resistance. SV40 polyA = poly-A signal sequence of vacuolating monkey virus. Figures 9B and 9C show agarose gels stained with ethidium bromide containing PCR products isolated from CHO cell lines Flp-In / Em464 / 01P581 and CHOFlp-In / Em464 / 01P582, respectively. Lanes 1-4 correspond to concentrations of the total RNA template equal to 50 pg, 5 pg, 0.5 pg or 0 pg, which were used to perform multiple RT-PCR with chain extension by overlapping. M stands for 100 bp ladder. (New England Biolabs, New England, USA). The arrows indicate the product of the PCR with the extension of the chain by overlapping.

10 is a flowchart showing the steps for creating a library of expressed related antibodies from which polyclonal or monoclonal antibodies can be expressed.

11 schematically depicts the E. coli JSK301 vector used to create a library of expression vectors for Fab fragments by introducing overlapping chain extension fragments into the vector containing related sequences encoding variable regions at the indicated NotI / XhoI restriction sites. The specified vector contains the following elements: Amp and Amp pro = ampicillin resistance gene and its promoter. pUC19 Ori = origin of replication. Human CH1 = sequence encoding the human immunoglobulin gamma 1 heavy chain domain 1. Insert = insert an unrelated sequence that is cut out by introducing fragments of chain extension by overlapping. tac P and lac Z = bacterial promoters that can be excised at the NheI and AscI restriction sites.

12 is a diagram illustrating the creation of a library of expression vectors of related Fab fragments. Stage 1 illustrates the insertion of related pairs of sequences encoding the variable regions (VH ₁ -VL ₁ - VH _X -VL _X ) in the E. coli JSK301 vector by hydrolysis of XhoI-NotI. Stage II illustrates the insertion of a bacterial promoter cluster and a leader sequence (pelB leader sequence and P tac promoter stimulating VHx expression, P lac promoter and pelB leader sequence stimulating VLx expression) by AscI-NheI hydrolysis.

13 shows the binding of the α-, β- and γ-subunits forming the G protein using a single-step multiple RT-PCR with chain extension by overlapping and further amplification using PCR. The images show the sizes of individual coding regions, as well as the size of the associated product. For the final product, restriction sites introduced by the end segments of the primer during amplification are indicated.

On Fig shows a dot diagram of staining when performing FACS analysis (A) of peripheral blood mononuclear cells (PBMC), isolated from the blood of the donor; (B) fractions of unlabeled CD19-negative cells obtained by magnetic cell sorting, and (C) fractions of CD19 + cells obtained by magnetic cell sorting. For each fraction, a scatter chart, a CD19 / CD38 chart, and a CD38 / CD45 chart are shown.

On Fig shows the fraction of CD19 + cells depicted in figs, which were previously stored in liquid nitrogen, thawed and stained with anti-CD19, CD38 and CD45 antibody. Scatter plots corresponding to those shown in FIG. 9C are shown.

Fig. 16 shows coincidence diagrams used to sort the CD19 + cell fraction. A scatter plot and a fluorescence plot based on CD38 and CD45 were used to isolate high producing CD38 cells (CD38hi) and intermediate CD45 cells (CD45in).

17 shows the gel after electrophoresis, which shows the successful completion of multiple RT-PCR with chain extension by overlapping using a blood sample obtained from a TT03 donor (row A, wells 1-12 from eight 96-well plates). Samples were applied to agarose gel in two rows (A and B), 48 samples each. The expected fragment size of the chain extension by overlapping was approximately 1070 bp Alleged fragments of chain elongation by overlapping are indicated by arrows.

On Fig shows the ELISA analysis of periplasmic extracts from the tablet G060. The ELISA plate was sensitized with a goat anti-human kappa chain antibody, and trapped Fab fragments were detected using a HRP-conjugated goat anti-human Fab antibody.

On Fig shows the ELISA analysis of periplasmic extracts from the tablet G060. The ELISA plate was sensitized with 10 μg / ml ovalbumin (Sigma A-5503), while the captured Fab fragments were detected using a HRP-conjugated goat antibody against the human Fab fragment.

On Fig shows the ELISA analysis of periplasmic extracts from the tablet G060. The ELISA plate was sensitized with a tetanus toxin, and the captured Fab fragments were detected using a HRP-conjugated goat antibody against human Fab fragment.

On Fig shows a one-stage competitive ELISA analysis of periplasmic extracts from the tablet G060. The ELISA plate was sensitized with tetanus toxin (TT) and soluble TT in an amount of 10 ^-7 M was added to each well to competitively bind Fab fragments of bacterial supernatants with immobilized TT. Trapped Fab fragments were detected using an HRP-conjugated goat antibody against a human Fab fragment.

On Fig shows a comparative analysis of the protein sequences of the variable region of the heavy chain obtained from clones that bind TT antigen, from the tablet G060. The degree of sequence homology is expressed in different shades; 100%, 80% and 60% homology is depicted in black, gray and light gray, respectively. CDR1 is in comparable positions 34-41. CDR2 is in comparable positions 55-73. CDR3 is in comparable positions 107-127. Immature termination codons are indicated by an asterisk. The results of the comparative analysis are shown in eight separate figures (a-h) arranged in two rows from left to right, with FIGS. 22a-d in the upper row and FIGS. 22e-h in the lower row.

On Fig shows a comparative analysis of protein sequences of the variable region of the light chain obtained from clones that bind TT antigen, with the tablet G060. The degree of sequence homology is expressed in different shades; 100%, 80% and 60% homology is depicted in black, gray and light gray, respectively. CDR1 is in comparable positions 26-42. CDR2 is in comparable positions 58-64. CDR3 is in comparable positions 97-106. Immature termination codons are indicated by an asterisk. The results of the comparative analysis are shown in eight separate figures (a-h) arranged in two rows from left to right, with FIGS. 23a-d in the upper row and FIGS. 23e-h in the lower row.

On Fig shows a competitive ELISA analysis performed to determine the apparent affinity of the selected clones from the tablet G060. Soluble TT diluted in concentrations from 100 nM to 25 pM (four-fold dilutions) was added to the Fab fragments, causing competitive binding of the Fab fragment to the immobilized TT. The degrees of interaction are expressed as the ratio of the observed binding at a given concentration of soluble TT to the binding detected without adding soluble TT to the reaction mixtures.

On Fig presents a double phylogenetic histogram showing the intragenetic and intergenetic relationship between the sequences of the variable domain of the heavy and light chains of the antibodies. Phylogenetic groups of three V _H and V _L sequences are paired on a histogram to indicate the actual pairing of specific V genes. A) Clones linking the TT antigen obtained from the combinatorial library by the method of display on the phage. C) Clones that bind TT antigen obtained from a library of related pairs by the method of the present invention.

Description of the invention

The present invention relates to a method for amplification and binding of two or more interesting non-contiguous nucleotide sequences, which provides highly efficient cloning of such sequences. This result is achieved mainly by reducing the number of stages required for amplification and binding of cloned sequences.

One of the objects of the present invention is a method for linking several non-contiguous nucleotide sequences, which involves multiple molecular amplification of the nucleotide sequences of interest using a matrix derived from a single cell, a population of isogenic cells or a population of genetically different cells, and subsequent binding of the amplified sequences. If an isolated single cell or a population of isogenic cells is used as a matrix, then a nucleic acid segment containing related related nucleotide sequences of interest is formed as a result of binding. If a population of genetically different cells is used as a matrix, then as a result of binding a library of segments is formed in which each segment contains randomly linked nucleic acid sequences of interest; such a library is also called a combinatorial library.

In one embodiment of the present invention, the above multiple molecular amplification is a multiple PCR amplification, which is preferably preceded by a reverse transcription step. In a preferred embodiment, reverse transcription, amplification and binding are performed in a single step using multiple RT-PCRs with chain extension by overlapping or, alternatively, in two steps using multiple RT-PCRs and subsequent binding by ligation or recombination.

Another embodiment of the present invention relates to the creation of libraries of related pairs, including linked sequences encoding the variable regions, in particular sequences encoding the variable regions of the heavy and light chains, or sequences encoding the alpha chain and beta chain of the T cell receptor (TcR) . This method involves obtaining a lymphocyte-containing fraction of cells from at least one acceptable donor and, optionally, enriching a specific population of lymphocytes in the specified fraction, for example B-lymphocytes or T-lymphocytes, depending on which sequences encoding the variable regions, it is desirable to obtain from immunoglobulins or TcR. The lymphocyte-containing cell fraction or enriched cell fraction is distributed into several vessels, obtaining one cell in each vessel. Several individual cells are subjected to reverse transcription (RT) or an alternative procedure for producing cDNA using nucleic acids isolated from a population of individual cells as a template. After the reverse transcription step, multiple molecular amplification and binding of pairs of sequences encoding variable regions obtained from each cell is performed using one of the methods of the present invention.

The cloning methods described in the present invention avoid time-consuming and inefficient cloning and, in addition, reduce the risk of contamination and loss of diversity during the numerous stages of cloning.

Another object of the present invention are libraries of related pairs resulting from multiple molecular amplification and binding. The source library of related pairs (primary library) obtained by the method of the present invention can be screened to create a sub-library of related pairs encoding the variable domains of target specific binding proteins or unprocessed binding proteins.

In another embodiment of the invention, the libraries and sub-libraries of the present invention can be used to express recombinant monoclonal or polyclonal proteins that retain the original donor's inherent affinity and binding specificity.

Definitions of terms

The term “related pair” refers to the original pair of non-contiguous nucleic acids of interest that are inside a single cell or isolated from a single cell. In preferred embodiments of the invention, the related pair contains two sequences encoding variable regions that together encode the variable domain of the binding protein and have gene sequences isolated from the same cell. Thus, when expressed as a complete binding protein or a stable fragment thereof, they retain the affinity and specificity of binding of the binding protein originally expressed from a given cell. A related pair, for example, may consist of a sequence encoding a variable region of a heavy chain of an antibody linked to a sequence encoding a variable region of a light chain from the same cell, or a sequence encoding an α-chain of a T cell receptor linked to a sequence encoding β -chain from the same cell. The library of couples is a collection of such couples.

By the term “heat activated polymerase” is meant polymerases that are inactive or have very low activity at temperatures used for reverse transcription. To activate such polymerases, high temperatures (90-95 ° C) are needed. This is an advantage of performing one-step RT-PCR, as this does not include the inclusion of polymerase interference in the reaction involving reverse transcriptase.

The term “isogenic population of cells” means a population of genetically identical cells. In particular, of particular interest in the practice of the present invention is an isogenic population of cells resulting from the clonal expansion of one isolated cell.

The term “isolated single cell” means a cell that is physically separated from the cell population and corresponds to the definition of “one cell in one vessel”. A population of isolated individual cells is obtained by distributing a population of cells into several vessels. As indicated in the section entitled “Sources of the matrix”, the number of vessels with one cell does not have to be proportional to 100% so that such a population can be called a population of individual cells.

The terms “bind” or “binding” as applied to amplification mean connecting the amplified nucleic acid sequences of interest in one segment. For related pairs, a segment contains nucleic acid sequences encoding a variable domain, for example, an antibody heavy chain variable region, linked to a sequence encoding an antibody light chain variable region derived from the same cell. Linking can occur simultaneously with amplification or in the form of a stage, performed immediately after amplification. No requirements are imposed on the shape or functionality of a segment; it can be linear, ring, single-chain or double-chain. Said binding does not have to be constant, one of the nucleic acid sequences of interest can be isolated from a segment, if desired, for example, one of the sequences encoding the variable region can be isolated from a segment of a related pair. However, until the original variable regions forming a related pair are replaced by other variable regions, they are still considered a related pair, without even being tied together in one segment. Said binding is preferably nucleotide binding by a phosphodiester bond. However, binding can be accomplished by other chemical cross-linking methods.

The term “multiple molecular amplification" means the simultaneous amplification of two or more given sequences in a single reaction. Suitable amplification methods include polymerase chain reaction (PCR) (US Pat. No. 4,683,202), ligase chain reaction (LCR) (Wu and Wallace, 1989, Genomics 4, 560-9), chain change amplification (SDA) (Walker et al. 1992, Nucl. Acids Res. 20, 1691-6), self-sustained sequence replication (Guatelli et al., 1990, Proc. Nat. Acad. Sci USA, 87, 1874-8) and nucleic acid sequence amplification (NASBA ) (Compton J., 1991, Nature 350, 91-2). The last two amplification methods involve the implementation of isothermal reactions based on isothermal transcription with the formation of both single-stranded RNA (ssRNA) and double-stranded DNA (dsDNA).

The term “multiple PCR” means a variant of PCR in which two or more given sequences are amplified simultaneously by introducing several sets of primers into the reaction mixture, of which, for example, one set of primers is designed to amplify the variable region of the heavy chain and the other set of primers is intended for amplification of the variable region of the kappa chain in a single PCR reaction. In addition, a set of primers designed to amplify the variable region of the lambda chain can be combined with the above primer sets.

The term "multiple RT-PCR" means a multiple PCR, which is preceded by a stage of reverse transcription (RT). Multiple RT-PCR can be performed as a two-stage process with a separate RT stage, performed before the multiple PCR, or as a single-stage process, in which all the components necessary for RT and multiple PCR are combined in one tube.

The term “multiple overlap extended PCR” and “overlap extended RT-PCR” means that multiple PCR or multiple RT-PCR is performed using a mixture of multiple overlapping extended chain primers designed to amplify predetermined sequences, due to which there is a simultaneous amplification and binding of given sequences.

The term “multiple vessels” means any object (or set of objects) that provide a physical separation of one cell from a population of cells. Such vessels may include tubes, multi-well plates (e.g., 96-well plates, 384-well plates, microtiter plates or other multi-well plates), arrays, microarrays, microarrays, gels, or gel matrices. The specified object is preferably used for amplification by PCR.

The term “polyclonal protein” or “polyclonality” as used herein means a protein that contains different but homologous protein molecules, preferably selected from the superfamily of immunoglobulins. Thus, each protein molecule is homologous to the other molecules in the composition, but contains one or more fragments of the variable region of the polypeptide sequence, which differ in amino acid sequence from other members of the polyclonal protein. Known examples of such polyclonal proteins include antibody or immunoglobulin molecules, T-cell receptors, and B-cell receptors. A polyclonal protein may consist of a specific subpopulation of protein molecules that have a common characteristic, such as the total binding activity of the desired target, for example, such a protein may be a polyclonal antibody characterized by specificity of binding of the desired target antigen.

The term “population of genetically different cells” as used herein means a population of cells in which individual cells differ from one another at the genome level. A population of genetically different cells is, for example, a population of cells obtained from a donor, or a fraction of such cells, in particular a fraction of cells containing B-lymphocytes or T-lymphocytes.

The term “primer set”, or the interchangeable term “primer pair”, refers to two or more primers that together are capable of initiating amplification of a nucleotide sequence of interest (that is, one of a member of a cognate pair). The primer set of the present invention can be designed to initiate a family of nucleotide sequences containing sequences encoding variable regions. Examples of different families are antibody light kappa chains, lambda light chains, variable regions of the heavy chain, and variable regions of the α, β, γ, or δ chain of the T cell receptor. A set of primers for amplifying a family of nucleotide sequences containing sequences encoding variable regions often consists of several primers, some of which may be degenerate primers.

The term "sequence identity" means the identity, expressed as a percentage, which determines the degree of sequence identity of nucleic acids over the entire length of the shortest of the two sequences. Identity can be calculated as (N _ref - N _dif ) x100 / N _ref , where N _ref denotes the number of residues in a shorter sequence, N _dif denotes the total number of non-identical residues in the optimally combined number of residues N _{ref of} two sequences. Therefore, the AGTCAGTC DNA sequence will be 75% identical to the TAATCAATC GG sequence (N _dif = 2 and N _ref = 8) (optimally aligned residues are underlined and two non-identical residues of 8 are highlighted in bold).

The terms “arbitrary” or “arbitrary” as applied to binding mean the binding of nucleotide sequences isolated from different cells but transversely linked in a population of genetically different cells. If the nucleotide sequences of interest are sequences encoding variable regions, then a combinatorial library of linked sequences will be created. If, on the other hand, the nucleotide sequences of interest encode an identical heteromeric protein, then the randomly linked sequences are likely to be similar to the sequences linked in a single cell.

The term “matrix derived from an isolated single cell” as applied to reverse transcription refers to the nucleic acids of such an isolated cell. Nucleic acids can be, for example, RNA, mRNA, DNA or genomic DNA. Nucleic acids may be isolated from a cell or located in a cell, which may be intact or lysed.

Amplification and Binding Method

One of the distinguishing features of the present invention is the reduction in the number of tubes required for amplification of nucleotide sequences of interest, due to the implementation of the PCR variant, in which two or more predetermined sequences are amplified simultaneously in the same tube by introducing several sets of primers, for example, all primers necessary for amplification of sequences, coding for variable regions in a single reaction mixture. A similar technique is known as multiple polymerase chain reaction (multiple PCR).

Multiple PCR or multiple PCR with previous reverse transcription (multiple RT-PCR) are well-known diagnostic methods used, for example, in analysis of mutations, deletions and polymorphisms of DNA, quantitative analysis of mRNA content and identification of viruses, bacteria and parasites ( see Markoulatos, P. et al., 2002, J. Clin. Lab. Anal. 16, 47-51). However, there are very few examples of amplification of sequences encoding the variable regions of the light chain in one vessel, as well as sequences encoding the variable regions of the heavy chain of immunoglobulins, using a mixture of multiple primers consisting of more than four primers and including a set of primers for V _to and / or V _λ together with a set of primers for V _H (Chapal, N. et al., 1997, BioTechniques 23, 518-524; Liu, AH et al., 1992, Proc. Natl. Acad. Sci. USA 89, 7610- 7614; Embleton, MJ et al., 1992, Nucleic Acids Res. 20, 3831-3837). The reason for this may be the fact that sets of primers that can be used to amplify sequences encoding the variable domains of antigen binding proteins typically include several degenerate primers to match the variety of sequences encoding the variable regions. Thus, the complexity of the PCR reaction increases significantly when amplifying sequences encoding variable regions using multiple PCRs.

Another distinguishing feature of the present invention is the binding of two several predetermined sequences amplified using multiple PCR immediately after amplification. In particular, related pairs of sequences encoding variable regions are linked in this manner.

One of the embodiments of the present invention relates to the creation of a mixture of multiple primers designed to perform PCR with extension of the chain by overlapping, resulting in simultaneous amplification and binding of the nucleotide sequences of interest. The specified multiple PCR with chain extension by overlapping allows to reduce the number of reactions necessary for the isolation and binding of nucleotide sequences of interest, in particular, related pairs of linked variable regions.

Other embodiments of the present invention relate to ligation binding or recombination as an alternative to overlapping multiple extension PCR. In these methods, binding is performed separately from amplification using multiple PCR, but immediately after amplification. However, binding can be performed in the same tube as the multiple PCR.

To perform multiple PCR with chain extension by overlapping, two or more sets of primers (a mixture of multiple primers) are required in which at least one primer in each set has an end segment of chain extension by overlapping. The end segments of chain elongation by overlapping allow the products formed by each set of primers to be coupled during amplification. Such a primer mixture is referred to as a multiple primer mixture to extend the chain by overlapping. Multiple overlapping chain extension PCRs are different from regular overlapping chain extension PCRs in that the sequences to be linked are formed simultaneously in a single tube, thereby immediately binding the desired sequences during amplification without any intermediate purification. In addition, with a conventional PCR with chain extension by overlapping, a separate PCR binding reaction is required using an external primer set or a nested set of primers to produce a bound product (Horton, R. M. et al., 1989, Gene 77, 61-68). Such an additional amplification step is optional when performing multiple chain extension PCR by overlapping of the present invention.

Another feature of the present invention is the reverse transcription (RT) step, prior to amplification of multiple PCR or multiple PCR with chain extension by overlapping, using a matrix derived from an isolated single cell or a population of isogenic cells.

Another hallmark of the present invention is the use of nucleotide sequences obtained from an isolated single cell or a population of isogenic cells as a matrix for amplification by multiple PCR. RNA from a single cell is preferably reverse transcribed to form cDNA before performing multiple PCR. Genomic DNA can be used as an alternative to mRNA to amplify some nucleic acid sequences of interest. Using isolated individual cells or a population of isogenic cells obtained as a result of clonal expansion of an isolated individual cell as a matrix source, one can avoid replacing the nucleotide sequences encoding the heteromeric protein of interest with nucleotide sequences obtained from other cells in the cell population. This is important if it is desired to obtain the initial composition of the sequences of interest. To form a related pair of sequences encoding variable regions, it is important to use an isolated single cell or a population of isogenic cells as a matrix source.

Multiple overlap extension PCR is a rarely used method. WO 99/16904 describes the binding of exons from a genomic sequence in a single reaction, resulting in cDNA formation without reverse transcription. In the described method, one set of primers (consisting of two primers) per exon to be bound is used, in which a mixture of multiple primers is formed to extend the chain by overlapping. With each individual set of primers, the chain can be extended by overlapping with an adjacent set of primers using complementary end segments of chain extension by overlapping. The cDNA is generated from the genomic DNA template by performing PCR with chain extension by overlapping using a mixture of multiple primers to extend the chain by overlapping and subsequent nested PCR, which, as described, is a necessary step.

The formation of cDNA from exons of genomic DNA described in WO 99/16904 is not related to the cloning of sequences encoding heteromeric proteins. First of all, heteromeric proteins are usually obtained from different genes, while exon binding as described in WO 99/16904 refers to exon binding from a single gene. In addition, the present invention facilitates the creation of libraries of interesting linked nucleic acid sequences, in particular combinatorial libraries and libraries of related pairs of variable regions, which is completely different from linking a series of exons from a single gene, resulting in a single non-variable cDNA. The present invention uses nucleic acids isolated from individual cells, preferably in the form of RNA, which does not require separation from the rest of the cell before using it as a template.

Several publications describe multiple overlap-extended RT-PCRs used to bind sequences encoding variable regions.

The simplest form of overlapping extension of RT-PCR with overlapping chain is described to isolate a sequence encoding an scFv fragment from a hybridoma cell line (Thirion, S. et al. 1996, Eur. J. Cancer Prev. 5, 507-511 and Mullinax , RL et al. 1992, BioTechniques 12, 864-869). The methods described in the publication of Thirion and Mullinax involve reverse transcribing mRNA using oligo-dT primers for total RNA extracted from the hybridoma cell line, followed by a separate binding step. The binding step is performed using a total of four primers, including two pairs of primers for amplifying sequences coding for the variable region of the heavy chain and the variable region of the light chain, respectively. The main primer for V _L and the reverse primer for V _H or C _H contain complementary end segments of chain extension by overlapping, which allows amplification and binding of sequences encoding the variable region of the heavy chain and the variable region of the light chain. In these methods, nested PCR is not used to increase the sensitivity of the binding method.

Another example of an overlapping extension of RT-PCRs with overlapping extension related to the binding of sequences encoding variable regions is described in the above publication WO 93/03151, which describes a method for cloning sequences encoding a variable region of a heavy chain and a variable region of a light chain that were obtained from a single cell without isolation of individual cells before cloning. The method described in WO 93/03151 requires flushing between the RT step and the multiple overlap chain extension PCR step. In addition, one of the specific goals of WO 93/03151 is to solve the problem of isolating individual cells to obtain related pairs of sequences encoding variable regions.

None of the known methods of multiple RT-PCR with chain extension by overlapping is not designed to be implemented on a matrix obtained from an isolated single cell. In addition, none of the known methods can be performed in the form of single-stage RT-PCR reactions.

One embodiment of the present invention relates to the binding of several non-contiguous nucleotide sequences of interest. Such a method involves amplification using multiple PCR or multiple RT-PCR of nucleotide sequences of interest using a matrix derived from an isolated single cell or a population of isogenic cells, and linking the amplified nucleotide sequences of interest. In addition, the method provides an optional step for performing additional amplification of the bound products.

Another embodiment of the present invention relates to a method for creating a library of cognate pairs comprising linked sequences encoding variable regions. This method involves obtaining from the donor a lymphocyte-containing fraction of cells, which, optionally, is enriched with a specific population of lymphocytes from the specified fraction of cells. Then, a population of isolated individual cells is obtained by distributing cells from the lymphocyte-containing fraction of cells or the enriched fraction of cells into several vessels. Then, multiple molecular amplification (amplification by the multiple RT-PCR method) of sequences encoding variable regions that are in a population of isolated individual cells is performed, and pairing of pairs of sequences encoding variable regions is performed, and a single pair is obtained from one cell in a population of isolated individual cells. In addition, this method involves two optional steps: in the first step, a single cell is isolated that is isolated from a population of individual cells, until a population of isogenic cells is formed before amplification by the multiple RT-PCR method. Thus, several vessels with a different population of isogenic cells are obtained (one population of isogenic cells in one vessel). The second optional step involves performing additional amplification of the linked sequences encoding the variable regions.

In preferred embodiments of the present invention, one of the members of said library of related pairs is a sequence encoding an immunoglobulin light chain variable region associated with a sequence encoding an immunoglobulin heavy chain variable region that are derived from a single cell, or sequences encoding a T-cell binding domain receptor, consisting of the variable region of the alpha chain associated with the variable region of the beta chain, or variable about Asti gamma chain variable region linked with delta chain, wherein the associated variable regions are obtained from a single cell.

Multiple RT-PCR amplification of the present invention can be performed as a two-step method in which reverse transcription (RT) is performed separately from amplification by multiple PCR (or alternative multiple molecular amplification), or as a one-step method in which the stages of RT and PCR amplifications are performed using the same primers in a single tube.

Reverse transcription (RT) is performed using an enzyme with reverse transcriptase activity, thereby obtaining cDNA from total RNA, mRNA, or a given specific RNA in an isolated single cell. Primers that can be used for reverse transcription are, for example, oligo-dT primers, random hexamers, arbitrary decamers, other arbitrary primers or primers specific for the nucleotide sequences of interest.

The two-stage amplification method using multiple RT-PCR allows you to distribute the cDNA obtained in stage RT, in several vessels for storing the matrix fraction until amplification. In addition, the distribution of cDNA in several tubes makes it possible to perform multiple amplifications by the multiple PCR method of nucleic acid obtained from the same matrix. Although this method is characterized by a large number of individual reactions, it allows, if desired, to simplify the mixture of multiple primers. The specified two-stage method, for example, can be used to amplify and bind sequences encoding the variable region of the heavy chain and the variable region of the light Kappa chain in one tube and sequences encoding the variable region of the heavy chain and the variable region of the light lambda chain, in another tube using the same matrix. A single cell usually expresses only one of the light chains. However, it is often much easier to carry out the reactions simultaneously, without waiting for the result of one of the reactions, before starting to carry out the other reaction. In addition, the amplification of the kappa chain and lambda chain serves as an internal negative control, since it is expected that only a kappa chain or lambda chain can be amplified from a single cell.

In a one-step multiple RT-PCR method, reverse transcription and amplification using multiple PCR are performed in a single vessel. All components necessary for performing both reverse transcription and multiple PCR in one stage are introduced into the vessels, and then this reaction is carried out. As a rule, it is not necessary to introduce additional components after the start of the reaction. An advantage of the one-step amplification method using multiple RT-PCR is the reduction in the number of steps required to obtain the linked nucleotide sequences of the present invention. This method is particularly effective for performing multiple RT-PCR using a number of separate cells, when the same reaction must be performed in several vessels. The one-step multiple RT-PCR method is performed using reverse primers present in the multiple primer mixture necessary for amplification by multiple PCR, also as reverse transcription primers. The composition required for the one-step multiple RT-PCR method comprises a nucleic acid matrix, an enzyme having reverse transcriptase activity, an enzyme having DNA polymerase activity, a mixture of deoxynucleoside triphosphates (dNTP mixture containing dATP, dCTP, dGTP and dTTP) and a mixture of multiple primers . The nucleic acid matrix is preferably total RNA or mRNA obtained from an isolated single cell in purified form, contained in a cell lysate, or within an intact cell. The exact composition of the reaction mixture usually requires some optimization of each mixture of multiple primers of the present invention. This applies to both the two-stage and one-stage multiple RT-PCR methods.

In alternative embodiments of the present invention, it may be desirable to use genomic DNA instead of RNA as a template. In such cases, the reverse transcription step is skipped and the remaining steps of the present invention are performed as described.

When performing some one-step multiple RT-PCR during the reaction, it may be desirable to introduce additional components. For example, after performing the RT step, polymerase can be added. Other components may include, for example, a mixture of dNTP or a mixture of multiple primers, possibly with a different composition of primers. This method can be considered as multiple RT-PCR performed in a single tube, which has the same advantages as the single-stage method of multiple RT-PCR, as it also limits the number of tubes required to obtain the required related products.

The nucleotide sequences of interest amplified by multiple RT-PCR can be linked to each other in different ways, such as multiple RT-PCR with chain extension by overlapping, ligation or recombination using different mixtures of multiple primers. Multiple RT-PCR amplification and binding are performed in a one-step or two-step manner. However, binding can also be accomplished by a multi-step process using, for example, a filling moiety that serves to bind nucleic acid sequences of interest by PCR, ligation, or recombination. Such a filling fragment may contain cis elements, promoter elements, a corresponding coding sequence or recognition sequence. In a preferred embodiment of the invention, the binding is performed in the same vessel as the amplification by multiple RT-PCR.

In one embodiment of the invention, the binding of several non-contiguous nucleotide sequences of interest is carried out together with amplification by the multiple PCR method using a mixture of multiple primers to extend the chain by overlapping. This method allows you to combine the amplification and binding of given sequences. The composition required to perform multiple overlapping chain extension PCRs typically comprises a nucleic acid matrix, an enzyme having DNA polymerase activity, a mixture of deoxynucleoside triphosphates (a mixture of dNTPs containing dATP, dCTP, dGTP and dTTP) and a mixture of multiple primers for chain extension by overlapping.

In a specific embodiment of the present invention, several non-contiguous nucleotide sequences of interest are linked using multiple RT-PCR with chain extension by overlapping using a matrix derived from an isolated single cell or population of isogenic cells. In addition, this method provides an optional step for performing additional molecular amplification of the coupled products. Multiple overlap extended RT-PCRs are preferably performed as a one-step reaction in a single tube.

A mixture of multiple primers to extend the chain by overlapping the present invention includes at least two sets of primers capable of initiating amplification and binding of at least two variable region coding sequences, for example, amplification and binding of sequences from the immunoglobulin heavy chain variable region families to variable region families light kappa or lambda chains or amplification and binding of sequences from the families of α-, β-, γ- or δ-chains of T- letochnyh receptors.

In another embodiment of the present invention, several nucleotide sequences of interest amplified by multiple RT-PCR are linked by ligation. For this, the multiple primer mixture used for the multiple RT-PCR is designed so that amplified target sequences can be cleaved with the appropriate restriction enzymes and covalently linked by DNA ligation (the creation of primers is described in the section “Primer mixtures and their creation”). After amplification by multiple RT-PCR using such a mixture of multiple primers, the restriction enzymes necessary for the formation of compatible ends of the desired sequences are added to the reaction mixture together with the ligase. PCR products may not be cleaned prior to this step, although such purification may be performed. The reaction temperature for combined restriction cleavage and ligation is in the range of about 0 to 40 ° C. However, if the polymerase used in the multiple PCR is still present in the mixture, an incubation temperature below room temperature is preferred, temperatures from 4 to 16 ° C are most preferred.

In another embodiment of the invention, several RT-PCR amplified nucleotide sequences of interest are coupled by recombination. In this case, amplified target sequences can be linked using identical recombination sites. Binding is performed by adding recombinases that facilitate recombination. Some suitable recombinase systems include Flp recombinase with multiple FRT sites, Cre recombinase with multiple lox sites, ΦC31 integrase that recombines between the attP site and attB site, a system of six β-recombinases, and the Gin-gix system. Recombination binding was shown by the example of two nucleotide sequences (V _H binding to V _L ) (published by Chapal, N. et al. 1997, Bio Techniques 23, 518-524, incorporated herein by reference).

In a preferred embodiment of the present invention, the nucleotide sequences of interest include sequences encoding the variable regions, resulting in the binding of a related pair of sequences encoding the variable regions. Such a related pair may contain one or more sequences encoding constant regions in addition to variable regions.

In an even more preferred embodiment of the present invention, the nucleotide sequences of interest include sequences encoding the immunoglobulin variable regions, and as a result of binding, a related pair of sequences encoding the variable region of the light chain and the variable region of the heavy chain is formed. Such a related pair may contain one or more sequences encoding constant regions in addition to variable regions. In addition, such a related pair can be isolated from a matrix obtained from cells of the B-lymphocyte line enriched from a lymphocyte-containing fraction of cells, such as whole blood, mononuclear cells or leukocytes.

In the same preferred embodiment of the present invention, the nucleotide sequences of interest include sequences encoding the variable regions of TcR, and as a result of binding, a related pair of sequences encoding the variable region of the α chain and variable region of the β chain, or sequences encoding the variable region of γ- chains and the variable region of the δ-chain. Such a related pair may contain one or more sequences encoding constant regions in addition to variable regions. In addition, such a related pair can be isolated from a matrix obtained from cells of the T-lymphocyte line enriched from a lymphocyte-containing fraction of cells, such as whole blood, mononuclear cells or leukocytes.

Another object of the present invention is the use of multiple RT-PCR using genetically different cells as a matrix source. Most sequences encoding heteromeric proteins are the same in different cells, unlike sequences encoding variable regions in binding proteins. Thus, when applying the present invention to clone such sequences encoding the non-variable regions of heteromeric proteins, it is not necessary to initially isolate individual cells.

In this embodiment of the present invention, several non-contiguous nucleotide sequences of interest are randomly linked in a manner involving amplification by multiple RT-PCR methods of the nucleotide sequences of interest using a matrix derived from a population of genetically different cells and binding of the amplified nucleotide sequences of interest. In addition, this method provides an optional step for performing additional amplification of the coupled products. As in the case of the method based on a single cell, binding can be performed using a mixture of multiple primers to extend the chain by overlapping used for amplification, or, alternatively, ligation or recombination. The matrix obtained from the cell population is preferably located within the cells. A cell population, for example, may be lysed.

The application of the method of arbitrary binding to a population of cells expressing the variable regions of binding proteins allows us to simplify the creation of combinatorial libraries of sequences encoding variable regions. The cell population preferably contains cells expressing variable regions of binding proteins, such as B-lymphocytes, T-lymphocytes, hybridoma cells, plasma cells, or a mixture of these cells.

A population of cells in the above embodiment, for example, can be made permeable or lysed without further purification, or matrix nucleic acids can be isolated from cells by standard methods. A one-step multiple RT-PCR method is preferred. However, in this embodiment, a two-step process can also be used.

The present invention also relates to a combinatorial library comprising linked pairs of sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin.

An effective way to increase the specificity, sensitivity and yield of a product when performing multiple RT-PCR and binding is to perform additional molecular amplification of the linked nucleotide sequences resulting from multiple RT-PCR followed by ligation or recombination, or using multiple RT-PCR with chain extension by overlapping. Additional amplification is preferably performed using PCR using a mixture of primers to amplify the linked nucleic acid sequences of interest. The primer mixture may include external primers from a mixture of multiple primers or a mixture of multiple primers to extend the chain by overlapping, in particular, primers hybridizing to the 5'-end and 3'-end of the sense strand of linked sequences encoding variable regions, which allows amplification of the entire linked product. External primers can also be defined as primers from a mixture of multiple primers for chain extension by overlapping, not containing end segments of chain extension by overlapping. Alternatively, for further amplification of the linked nucleotide sequences, a primer set for nested or half-nested PCR can be used. Such nested PCR is especially effective for increasing the specificity of the method, as well as for increasing the amount of bound product. In accordance with the objectives of the present invention, a semi-nested PCR (described in the section entitled “Mixtures of primers and their creation”) is considered as effective as nested PCR. Thus, a desirable, although optional, condition for the present invention is to perform additional PCR amplification of coupled products resulting from multiple RT-PCRs with overlapping chain extension, or products associated by ligation or recombination, by nested PCR or semi-nested PCR

Additional amplification can be performed directly using the fraction or the entire product resulting from multiple RT-PCR with chain extension by overlapping, the product obtained by ligation or recombination, a fraction of any of these products or partially purified related products obtained from any of these reactions , for example, by agarose gel electrophoresis and cutting out a fragment corresponding to the estimated size of the linked sequences encoding variable domain. For products linked by multiple RT-PCRs with overlapping chain extension, additional amplification is preferably performed directly in the fraction resulting from multiple RT-PCRs with chain extension by overlapping, as this facilitates the binding of individual predetermined sequences that have not been linked during the first reaction.

Sequences of Interest

The nucleotide sequences of interest of the present invention can be selected from sequences encoding different subunits or domains, the expression of which produces a protein or part of a protein. Such proteins, consisting of at least two non-identical subunits, are known as heteromeric proteins. Heteromeric proteins are present in all species. Some classes to which such proteins belong are, for example, enzymes, inhibitors, structural proteins, toxins, channel-forming proteins, G-proteins, receptor proteins, immunoglobulin superfamily proteins, transporting proteins, etc. The nucleotide sequences encoding such heteromeric proteins are non-contiguous, which implies, for example, that they are formed by different genes or different mRNA molecules. However, the term “non-contiguous” as used in the present invention may also refer to nucleotide sequences encoding the domains of one protein in which these domains are separated by uninteresting nucleotide sequences.

In one embodiment of the present invention, nucleotide sequences of interest include variable region coding sequences from a superfamily of immunoglobulins such as immunoglobulins (antibodies), B-cell receptors, and T-cell receptors (TcRs). Of particular interest are sequences encoding the variable regions of immunoglobulins. Such variable region coding sequences include unprocessed antibodies, as well as Fab, Fv, scFv fragments, and combinations of variable region coding sequences, for example, hypervariable regions (CDRs), J genes, or V genes, or combinations thereof . Typically, the present invention relates to any combination of sequences encoding variable regions, and combinations of their fragments. This application discusses the binding of the entire light chain to the variable domain of the heavy chain. However, the present invention also relates to the binding of only the variable domains of the heavy and light chains forming Fv or scFv coding sequences, or to the binding of the entire light chain to the variable region of the heavy chain, the domain of the constant region With _H1 and the parts of the hinge region forming Fab, Fab 'or F (ab) ₂ . In addition, any domain region of the constant region of the heavy chain can be added to the variable region of the heavy chain, as a result of which processed antibody coding sequences or unprocessed antibody coding sequences will be obtained.

In another embodiment of the present invention, sequences encoding the variable regions include a sequence encoding the immunoglobulin light chain (kappa or lambda) of the same type and one sequence encoding the variable region of the immunoglobulin heavy chain.

In addition, the sequences encoding the variable regions that were derived from T cell receptors (TcR) are of interest. Such TcR coding sequences include coding sequences for unprocessed alpha and beta chains or gamma and delta chains, as well as soluble TcRs, or only the variable domains of these chains, or their single chain fusion proteins (e.g., single αβ chain or single γδ-chain).

Matrix sources

One of the distinguishing features of the present invention is the ability to bind nucleotide sequences obtained from an isolated single cell, a population of isogenic cells, or a genetically different population of cells that have not been distributed across individual vessels. The cells used in the present invention can be, for example, bacterial cells, yeast cells, fungal cells, insect cells, plant cells, mammalian cells, or fractions of such cells. Mammalian blood cells are one example of a fraction of cells that can be used in the present invention.

A preferred feature of the present invention is the use of isolated single cells or a population of isogenic cells as a matrix source, since in this way replacement of nucleic acid sequences of interest, in particular sequences encoding variable regions, can be avoided. This is especially important if it is desired to obtain an initial pair of sequences encoding variable regions.

Another preferred feature of the present invention is the preparation of a single cell or a population of individual cells from a lymphocyte-containing fraction of cells, such as B-lymphocytes, T-lymphocytes, plasma cells and / or lines of these cells at different stages of development. Other cell populations expressing binding proteins from the immunoglobulin superfamily can also be used to produce single cells. Cell lines such as hybridoma cells, B-lymphocyte or T-lymphocyte cell lines, immobilized virus cell lines or cells obtained from a donor that are involved in initiating an immune response can also be used in the present invention. Fractions of lymphocyte-containing cells obtained from a donor can be isolated from natural tissues or fluids with a high content of such cells, for example, from blood, bone marrow, lymph nodes, spleen tissue, tonsil tissue, from infiltrates in and around tumors or from inflammatory tissue infiltrates. Acceptable cell donors of the present invention may be vertebrates with an acquired immune system. Donors can be individuals who have not previously been exposed to any effect or hyperimmunized against the desired target. Hyperimmunized donors are preferred for isolating antigen binding proteins having binding specificity for a particular target. Such hyperimmunized donors may be donors immunized with a target antigen or fragments thereof, recovering or sick individuals that have a natural immune response to a target antigen, for example, individuals suffering from autoimmune diseases, cancer or infectious diseases, such as HIV-infected individuals, individuals suffering from hepatitis A, B or C, severe acute respiratory syndrome (SARS) and the like, or individuals suffering from chronic diseases.

When using recombinant proteins for therapeutic purposes, it is desirable that they be isolated from sequences characterized by species identity with the individual to be treated (for example, human sequences should be used to treat people). First of all, because recombinant proteins isolated from a foreign sequence (that is, different from human ones) will be recognized by the immune system, resulting in an immune reaction involving polyclonal anti-protein antibodies. These anti-protein antibodies can block the action of the drug by occupying the active site, accelerate drug elimination and cause harmful reactions, in particular allergic reactions when repeated exposure.

Immunogenicity, however, can also be observed in cases where a recombinant protein is isolated from a sequence characterized by species identity. Such immunogenicity, for example, can be induced by post-translational modifications, which may differ from those observed in vivo. Combinatorial libraries of sequences encoding variable regions can also cause immunogenicity, since they consist of arbitrary pairs of sequences encoding variable regions created in vitro. The rules governing the formation of in vivo pairs of sequences encoding the heavy and light chains of antibodies (or T-cell receptors) have not yet been fully studied. It follows from the foregoing that some pairs formed in vitro can be recognized by the immune system as foreign, even if both sequences forming a pair belong to a person. Binding proteins obtained from libraries of related pairs, on the other hand, do not form such abnormal combinations and therefore are potentially less immunogenic than binding proteins obtained from combinatorial libraries. This does not mean that products obtained from combinatorial libraries are not suitable for treatment, they simply require more careful monitoring in order to identify the above side effects.

In accordance with the present invention, the cell donors should preferably be of the same species as the individuals to be treated with products derived from the linked nucleotide sequences of the present invention. The cell donor is preferably a pet, companion animal, human or transgenic animal. Transgenic animals carrying human immunoglobulin loci are described in US Pat. No. 6,111,166 and in Kuroiwa, Y. et al. Nature Biotechnology; 2002; 20: 889-893. Such transgenic animals can produce human immunoglobulins. Thus, fully human antibodies against a specific target can be obtained by conventional methods of immunization of such transgenic animals. This allows the creation of libraries encoding binding proteins that are specific for more difficult targets, such as human antigens, for which a person has no or has a limited natural humoral immune response. Similarly, transgenic animals producing human T-cell receptors can be created.

In another embodiment of the present invention, the lymphocyte-containing fraction of the cells consists of whole blood, bone marrow, mononuclear cells or leukocytes obtained from a donor. Mononuclear cells can be isolated from blood, bone marrow, lymph nodes, spleen, infiltrates around cancer cells and inflammatory infiltrates. Mononuclear cells can be isolated by density gradient centrifugation, such as ficoll gradients. When mononuclear cells are isolated from tissue samples, the tissue used is destroyed prior to density gradient centrifugation. The tissue can be destroyed by mechanical methods, such as, for example, grinding, electroporation and / or chemical methods, such as treatment with enzymes. White blood cells can be isolated directly from donors using leukopheresis. Untreated bone marrow preparations or tissues containing lymphocytes can also be used in the present invention. Such preparations must be destroyed, for example, by the methods described above to facilitate the distribution of individual cells.

Another hallmark of the present invention is the enrichment of a lymphocyte-containing fraction of cells, for example, whole blood, mononuclear cells, white blood cells or bone marrow, in relation to a specific population of lymphocytes, such as cells from lines of B-lymphocytes or T-lymphocytes. Enrichment of B-lymphocytes can be done, for example, by sorting cells using magnetic beads or sorting cells with fluorescence stimulation (FACS), using cell surface-specific marker proteins of the cell surface, such as CD19 or other markers specific to the B-cell line. Enrichment of T-lymphocytes can be performed, for example, using a cell surface marker, such as CD3, or other markers specific to the T-cell line.

A preferred feature of the present invention is the additional sorting of enriched B lymphocytes to produce plasma cells prior to the distribution of individual cells into several vessels. Plasma cells are usually isolated by FACS sorting using surface markers such as CD38, possibly in combination with CD45. In addition, you can use other surface markers specific to plasma cells, or combinations thereof, for example CD138, CD20, CD21, CD40, CD9, HLA-DR or CD62L, and the choice of marker depends on the source of plasma cells, such as tonsils, blood or Bone marrow. Plasma cells can also be isolated from an unenriched lymphocyte-containing population of cells obtained from any of the above sources. Plasma cells isolated from the blood are sometimes called early plasma cells or lymphoblasts. In the present invention, these cells are also referred to as plasma cells, although they are CD19-positive cells in contrast to plasma cells located in the bone marrow. To isolate related pairs of sequences encoding immunoglobulins, it is desirable to use plasma cells, since at a higher frequency of occurrence, these cells produce antigen-specific antibodies that reflect acquired immunity to the desired antigen, while most of these cells underwent somatic overmutation and therefore encode high affinity antibodies. In addition, plasma cells have increased mRNA levels compared to the rest of the B-lymphocyte population, which makes reverse transcription more effective when using individual plasma cells. As an alternative to isolating plasma cells from a lymphocyte-containing fraction of cells, memory B cells can be isolated using a cell surface marker such as CD22.

An alternative distinguishing feature of the present invention is the selection of enriched B lymphocytes for antigenic specificity before the distribution of cells into several vessels. Antigen-specific B-lymphocytes are selected by contacting the enriched B-lymphocytes with the desired antigen or antigens, which results in the binding of the antigen to surface immunoglobulin and the subsequent isolation of bound cells. The above selection can be made by applying the desired antigen or antigens to the magnetic granules and sorting the cells by magnetic granule method, FACS, introducing the antigens into the column and performing affinity chromatography, filter screening or other methods known in the art. If desired, plasma cells as well as B-lymphocytes, unenriched mononuclear cells, white blood cells, whole blood, bone marrow or tissue preparations can be selected for antigenic specificity.

Another hallmark of the present invention is the sorting of enriched T-lymphocytes (eg, CD3-positive cells) using surface markers CD45R0 and / or CD27 to obtain a fraction of memory T cells. T lymphocytes can also be selected taking into account MHC antigenicity using MHC-peptide complexes (see, for example, Callan, MF et al. 1998, J. Exp. Med. 187, 1395-1402; Novak, EJ et al . 1999, J. Clin. Invest. 104, R63-R67).

Another hallmark of the present invention is the immortalization of any of the isolated cell fractions described above (e.g., B-lymphocytes, plasma cells, memory cells or T-lymphocytes). Immortalization can, for example, be performed using the Epstein-Barr virus (Traggiai, E. et al., 2004, Nat. Med. 10, 871-875) before cell distribution to the tubes. Alternatively, isolated individual cells may be immortalized and propagated before reverse transcription is performed. (Traggiai et al., Nat. Med. 2004, Aug .; 10 (8): 871-5).

Another hallmark of the present invention is the distribution of the population of desired cells (e.g., hybridoma cells, B-lymphocyte or T-lymphocyte cell lines, whole blood cells, bone marrow cells, mononuclear cells, white blood cells, B-lymphocytes, plasma cells, antigen-specific B-lymphocytes , Memory B cells, T lymphocytes, antigen / MHC-specific T lymphocytes or memory T cells) in several vessels to obtain a population of isolated individual cells. Isolation of individual cells means the physical separation of cells from a population of cells so that there is one cell in one vessel, or the deposition of cells on a microarray, chip or gel matrix with the possibility of obtaining individual cells. Cells can be distributed directly into several adjacent vessels by limited dilution. The vessels used in the present invention are preferably similar to the vessels used to perform PCR (e.g., PCR tubes, 96-well or 384-well PCR plates, or larger arrays of vessels). However, other vessels may also be used. When individual cells are distributed into a large number of individual vessels (for example, 384-well plates), a population of individual cells is obtained. Distribution can be made by dosing a certain volume into a separate vessel, in which the average concentration of cells is one, 0.5 or 0.3 cells, resulting in vessels that, on average, contain one cell or less. Since the distribution of cells by the limited dilution method is a statistical method, part of the vessels will be empty, the main part of the vessels will contain one cell and a small part of the vessels will contain two or more cells. When two or more cells are in the vessel, some rearrangement of the sequences encoding the variable regions from the cells present in the vessel may occur. However, since such a result is not significant, it will not affect the general applicability of the present invention. In addition, combinations of sequences encoding variable regions that do not have the required affinity and binding specificity are not likely to be selected and therefore will be excluded during the screening process. Therefore, minor cases of sequence rearrangement will not significantly affect the final library of the present invention.

There are alternatives to the distribution of cells by the limited dilution method, for example, cell sorters, such as FACS or robots, which can be programmed to accurately distribute individual cells into separate vessels. Such alternative methods are more preferable, as they are less time consuming and more effective to achieve a uniform distribution of individual cells in separate vessels.

The above methods of enrichment, sorting and selection of cells are performed in such a way that most of the cells remain intact. Destruction of cells during enrichment or sorting may result in permutation of sequences encoding variable regions. However, this problem should not have serious consequences, since it is assumed that the frequency of cell destruction will be low. Thanks to the washing and possible treatment of the cells with RNase, any RNA released from the cells will be removed before they are distributed into separate vessels.

In addition, when reviewing the above description of the distribution of cells to obtain a population of individual cells in several separate vessels, this requirement cannot be interpreted as an absolutely necessary distinguishing feature, according to which one cell must be in each vessel. The above symptom rather suggests that in most vessels there should be separate cells, for example, the number of vessels with two or more cells is less than 25% of the total number of distributed cells, or even less than 10%.

Another hallmark of the present invention is the implementation of reverse transcription using a matrix obtained from cells distributed one at a time in several vessels.

For the purposes of the reverse transcription (RT) of the present invention, nucleic acids in a single cell, which should serve as the source of the matrix for RT, must be obtained from a single cell, although they need not be separated from the rest of the content of this single cell.

After the final distribution of individual cells to individual vessels, individual cells can be propagated to obtain a population of isogenic cells before reverse transcription is performed. Thus, the yield of mRNA used as a template increases, which may be important in the amplification and binding of a rare target. However, the cells must remain genetically identical with respect to the target gene during propagation. Isolated cells or a population of isogenic cells can be intact or lysed if the matrix for reverse transcription does not degenerate. Cells are preferably lysed to facilitate subsequent reverse transcription and PCR amplification.

In another embodiment of the present invention, the described method of multiple RT-PCR with chain extension by overlapping or multiple RT-PCR followed by ligation or recombination can also be performed on a matrix obtained from a genetically different population of cells that were not distributed in separate vessels and stay together as a pool of cells. The specified method can be used to create combinatorial libraries. This method does not require the distribution of individual cells. However, the cells that can be used in the implementation of this method should be similar to the cells used in the method using individual cells, and represent, for example, a population (pool) of sorted B-lymphocytes or T-lymphocytes. When performing one-step multiple RT-PCR with chain extension by overlapping or one-step multiple RT-PCR followed by ligation or recombination in such a population of cells, it is desirable to lyse the cells before the reaction, and total RNA or mRNA can be isolated from the lysate if desired.

The sensitivity of the one-step multiple RT-PCR with chain extension by overlapping of the present invention allows the use of a very small amount of matrix. As shown in examples 2 and 3, one-step multiple RT-PCR with chain extension by overlapping can be performed on a matrix, the amount of which corresponds to the lysate of a single cell.

Mixtures of primers and their creation

The primer mixtures of the present invention include at least four primers forming primer sets containing two primers in each, which are capable of amplifying at least two different desired sequences of interest. Mixtures of two or more of these sets of primers form a mixture of multiple primers. The mixture of multiple primers preferably contains at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 sets of primers (pairs of primers). In particular, for amplification of sequences encoding variable regions, individual sets of primers in a mixture of multiple primers contain more than two primers. A separate set of primers preferably contains at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, or 300 primers. The total number of primers in the multiple primer mixture is preferably at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200 and at most 225, 250, 275, 300, 325, 350, 375 or 400 primers.

All primers of the present invention contain a gene-specific region, and preferably all primers additionally have an end segment at the 5'-end of the primer, i.e. 5'-end non-coding sequences that are fused to the 3'-end of the gene-specific part of the primer. This end segment of the primer contains from about 6 to 50 nucleotides, but may be longer if desired. In the amplification process, the end segments of the primer are attached to predetermined sequences.

The end segments of the primer of the present invention are, for example, cloning and binding end segments, end segments adapted for ligation binding, end segments adapted for recombination binding, or end chain extension segments by overlapping.

Cloning end segments may contain 6-20 or more nucleotides and contain restriction sites and / or recombination sites that can be used to insert the bound product into the corresponding vector.

For ligation binding, primer sets in a multiple primer mixture are designed so that one part (primary or reverse primer) of the first set of primers has a binding end segment containing a restriction site, which, when cleaved, must be compatible with the restriction site located in the binding end segment one part of the second set of primers. To bind more than two given sequences, the second part of the second set of primers contains a restriction site, which upon cleavage must be compatible with the restriction site located in one part of the third set of primers. The second restriction site located in the second set of primers must not be compatible with the above restriction site of the first set of primers. Due to the similar creation of primer sets, a significant number of given sequences can be linked. In predetermined sequences, rare or non-existent restriction sites should be selected. In addition, it is desirable that the compatible restriction sites are not identical, that the ligation site is resistant to cleavage by the specific restriction enzymes used. Due to this, the reaction should be aimed at linking the first given sequence with the second given sequence, since the connection between identical given sequences will be cleaved by restriction enzymes. Suitable pairs of restriction sites are, for example, SpeI and XbaI (alternatively, NheI or AvrII can replace one or both of these enzymes), NcoI and BspHI, EcoRI and MfeI, or PstI and NsiI. For binding, SpeI may be, for example, in the first predetermined sequence, XbaI may be in the second predetermined sequence, NcoI may be at the other end of the second predetermined sequence, BspHI may be in the third predetermined sequence, and so on. To further facilitate the process, it is desirable to use these restriction enzymes in one buffer.

For recombination binding, primer sets in a mixture of multiple primers can, for example, be designed as described in Chapal (1997, Bio Techniques 23, 518-524), which is incorporated herein by reference.

To link the nucleotide sequences of interest in one step with multiple PCR amplification, end segments adapted for PCR with chain extension by overlapping are added to at least one primer in each set of primers, resulting in a mixture of multiple primers for chain extension by overlapping.

The overlapping end segments of the chain extension are usually longer, including from 8 to 75 nucleotides, and may contain restriction sites or recombination sites that allow subsequent insertion of regulatory elements, such as promoters, ribosome binding sites, termination sequences or linker sequences, such as for example in scFv. The end segment of chain extension by overlapping may also optionally comprise a termination codon. Typically, there are three types of end segments of chain extension by overlapping, as shown in FIG. The end segments of the chain extension by overlapping type I in two sets of primers overlap only each other. All nucleotides of the two terminal segments of chain extension by overlapping are not necessarily complementary to each other. In accordance with one aspect of the present invention, complementary nucleotides comprise 60-85% of the end segment of chain extension by overlapping. In the terminal segments of chain extension by overlapping type II, the 4-6 5'-terminal nucleotides are complementary to the gene-specific region of an adjacent predetermined sequence. In the terminal segments of chain extension by type III overlay, all overlapping nucleotides are complementary to an adjacent predetermined sequence. End segments of chain extension by overlapping type I and II are preferable in the subsequent introduction of regulatory and similar elements between related predetermined sequences. End segments of chain extension by type II overlapping are preferred if the desired sequences are to be linked by a specific linker, as is the case with scFv. End segments of chain extension by type III overlapping are preferred if predetermined sequences are to be linked together in a reading frame.

The creation of end segments of chain elongation by overlapping depends on the distinguishing features of the sequence, such as length, relative GC content (GC%), the presence of restriction sites, palindromes, the melting point, the gene-specific part with which they are associated, etc. The length of the end segments of chain extension by overlapping should be 8-75 nucleotides, preferably 15-40 nucleotides. The length of such segments is even more preferably 22-28 nucleotides. The use of very long end segments of chain extension by overlapping (50-75 nucleotides) can facilitate the binding of products produced by each set of primers. However, when using very long end segments of chain extension by overlapping, it is necessary to adjust the ratio between the length of the end segment of chain extension by overlapping and the genespecific region. The choice of GC% depends on the length of the end segment of the chain extension by overlapping. Since shorter end segments have a smaller area, in those cases when they are complementary, a higher GC% value is needed to enhance the interaction than when using longer end segments. Other principles for creating primers must be observed, for example, dimerization of primers and the formation of hairpins should be minimized. Primers should not cause false initiation. In addition, it is known that Taq DNA polymerase often adds adenosine (A) to the 3'-end of a newly synthesized DNA strand, and this should be taken into account when creating the end segment of chain extension by overlapping by adapting the end segments of chain extension by overlapping to non-matrix adding adenosine to the 3'-end.

The choice of primers carrying a binding end segment, for example, an end segment of chain extension by overlapping, an end segment adapted for ligation binding, or an end segment adapted for recombination binding determines the order and direction of binding of the desired sequences. For the present invention, it is unimportant whether the primers having the connecting end segment are the main or reverse primers in the primer set, or possibly both the upper and lower primers. However, attention needs to be paid to this issue, since the order and direction of the given sequences in the final product may have a certain value, for example, for inserting regulatory elements, such as promoters and termination sequences, or for linking individual given sequences within the reading frame.

To bind the two nucleotide sequences of interest, a binding end segment can be added to the reverse or main primers in each set of primers used for PCR amplification of each given sequence. The present invention describes the addition of end segments of chain extension by overlapping and end segments adapted for ligation binding to the main primers for V _H and V _L in each set (see, respectively, FIG. 1 and Example 9). In this case, the binding of products occurs in the direction from the 5'-end to the 5'-end (the head segment with the head segment and bidirectional binding). However, the binding end segments can also be added to the reverse primers in each set (for example, primers for C _to and / or C _λ in the first set and primers for C _H or J _H in the second set). In this case, the binding of products occurs in the direction from the 3'-end to the 3'-end (end segment with end segment and bidirectional binding). A third option is to add the binding end segments to the reverse primers in the first set of primers (e.g., primers for C _to and / or C _λ ) and to the main primers in the second set of primers (e.g., primers for V _H ) or vice versa. In this way, an orientation is obtained in the direction from the 3'-end to the 5'-end (head segment with end segment and unidirectional binding). Figure 3 shows the possible directions that can be obtained depending on which primers in each set of primers have a connecting end segment.

When more than two nucleotide sequences of interest are linked in some primer sets, the binding end segments must be on both the primary and reverse primers, with one end segment being complementary to the end segment of the previous set of primers and the other end segment being complementary to one of the primers in the subsequent set primers. This principle must be observed for all sets of primers used to amplify given sequences, designed to bind between two other given sequences.

When creating a gene-specific part of a primer, it is usually necessary to follow known rules for creating primers, such as minimizing dimerization of primers, formation of hairpins, and nonspecific hybridization. In addition, if possible, several nucleotides G and C should be avoided as the basis of the 3'-end. The melting temperature (Tm) of the gene-specific regions in the primer set should preferably be the same plus / minus 5 ° C. In the present invention, Tm values in the range of 45 ° C to 75 ° C are desirable, with Tm values of about 60 ° C being optimal for most applications. The primer can be initially created using computer programs designed to perform this task. However, primers created usually require laboratory testing and optimization. Such a check can be performed by analyzing the size and length polymorphism of restriction fragments (RFLP) and sequencing amplification products obtained using the created sets of primers. It is possible to successfully use degenerate positions in primers to amplify sequences with variable regions or to search for new family members belonging to an established class of proteins. The number of degenerate positions may also require optimization.

The present invention relates to improved sets of primers that can be used together in a very complex mixture. The primer set used was the one described in de Haard (de Haard, HJ et al., 1999, J. Biol. Chem. 274, 18218-18230), which was modified by trimming the 3 ′ ends of the primers to reduce non-specific interactions and adding end segments of chain extension by overlapping or end segments adapted for ligation binding.

One of the distinguishing features of the present invention are primer mixtures consisting of at least two sets of primers capable of initiating amplification and stimulating the binding of at least two nucleotide sequences of interest. The primer mixtures of the present invention can initiate the amplification of at least two subunits or domains in heteromeric proteins, for example, belonging to the class of enzymes, inhibitors, structural proteins, toxins, channel-forming proteins, G-proteins, receptor proteins, immunoglobulin superfamily proteins, transporting proteins and etc.

Another feature of the present invention is a mixture of multiple primers for elongation of the chain by overlapping, comprising sets of primers in which at least one primer in each set of primers has an end segment of chain extension by overlapping capable of hybridizing with the end segment of chain extension by overlapping one primer in another set of primers.

The end segments of chain extension by overlapping make it possible to immediately bind nucleotides of interest during amplification by the multiple PCR method with chain extension by overlapping, because an end segment complementary to the attached product is added to each product formed using primer sets. However, it does not follow from the foregoing that binding will necessarily occur during the first PCR amplification. Depending on the nature of the reaction, most of the actual binding can occur during additional amplification using external primers used in the first PCR amplification (multiple PCR amplification).

Another hallmark of the present invention is a set of primers designed to amplify a family of nucleotide sequences containing sequences encoding variable regions. Examples of such families are light kappa chains (e.g., VKI-VI in humans), light lambda chains (e.g., VL1-10 in humans) and variable regions of heavy chains (e.g., VH1-7 in humans and VH1-15 in mice ) immunoglobulins, as well as the variable regions of the α-, β-, γ- or δ-chains of TcR. A set of primers for amplifying a family of nucleotide sequences containing sequences encoding variable regions often includes several primers, some of which may be degenerate primers. Amplification of sequences encoding the variable regions of the light chain of immunoglobulin families, for example, is performed using a set of primers containing several primers complementary to the 5 ′ end of the variable region of the kappa chain (primer for V _Lc ) or the leader sequence of the kappa chain (primer for V _LкL ) and / or lambda chains (primer for V _Lλ ), or the leader sequence of a lambda chain (primer for V _LλL ) (main primers), together with several primers for the constant region of the kappa chain (primer for C _to ) and / or lambda-ts epi (primer for C _λ ) (reverse primers). Alternative primers for the connecting region of the light chain (primers for J _LK and / or J _Lλ ) can be used as reverse primers instead of primers for the constant region. Alternatively, the main primers hybridize to the UTR region preceding the leader sequence of the light chain variable region. The sequences encoding the variable region of the heavy chain of the families of immunoglobulins can also be amplified using one set of primers using different combinations of primers. For example, several primers complementary to the 5'-end of the variable region of the heavy chain (primer for V _H ) or the leader sequence of this region (primer for V _HL ) (main primers) can be used together with several primers for the connecting region of the heavy chain (primer for J _H ) or primers for the constant region of the heavy chain (reverse primers). The primer for C _H can be isotype-specific, and in principle, any primer for C _H (for example, C _H1 , C _H2 , C _H3 or C _H4 ), as well as a primer that allows an unprocessed heavy chain, can be used. Alternatively, the main primers hybridize to the UTR region preceding the leader sequence of the heavy chain variable region.

The use of basic primers hybridizing with a leader sequence instead of the 5'-end of the variable region is especially useful in detecting cross hybridization of primers for the variable region, since mutations resulting from cross hybridization will be removed from the final protein due to cleavage of the leader sequences during protein processing inside the cell. Example 9 describes the creation of primers for leader sequences of the variable region of the heavy chain and light Kappa chain of the antibody. The fact that the initiation site is located at the 3'-end of the sequence encoding the leader sequence (C-terminal) is an advantage compared to previously known primers for the leader sequence of antibodies, as this allows you to transfer amplified sequences between bacterial and eukaryotic expression vectors to obtain functional leader sequences in both systems. The system described in Example 9 can be easily applied to the light lambda chains of an antibody, as well as to the TcR α, β, γ, or δ chains.

One of the distinguishing features of the present invention are primers hybridizing to the 3'-end of a sequence encoding a leader sequence that precedes a sequence encoding a variable region, and their use for amplifying sequences encoding variable regions.

A preferred feature of the present invention is the use of primers characterized by at least 90% sequence identity (preferably at least 95% identity) with a gene-specific region of SEQ ID NOS: 86-92, which correspond to primers hybridizing to the C-terminus of leader coding sequences heavy chain sequence (primer for V _HL ). The gene-specific sequence of these SEQ ID NOs corresponds to the 18th base in the direction of the 3'-end of these sequences (see also table 11).

Another preferred feature of the present invention is the use of primers characterized by at least 90% sequence identity (preferably at least 95% identity) with a gene-specific region of SEQ ID NOS: 93-98, which correspond to primers hybridizing to the C-terminus of coding sequences leader sequences of the light Kappa chain (primer for V _LkL ). The gene-specific sequence of these SEQ ID NOs corresponds to the 25th base in the direction of the 3'-end of these sequences (see also table 11).

In one embodiment of the present invention, a mixture of multiple primers for overlapping strand extension used to perform multiple strand overlapping PCRs and possibly for the reverse transcription step also includes a) at least one primer for C _L or J _L complementary to the sense strand of a sequence encoding an immunoglobulin light chain region; b) at least one 5'-terminal primer for V _L or a primer for the leader sequence V _L , complementary to the antisense strand of the sequence encoding the variable region of the immunoglobulin light chain, and capable of forming a set of primers with primers according to paragraph a); c) at least one primer for C _H or J _H complementary to the sense strand of the sequence encoding the constant domain of an immunoglobulin heavy chain or heavy chain connecting region; and d) at least one 5'-terminal primer for V _H or a primer for the V _H leader sequence complementary to the antisense strand of a sequence encoding the variable region of an immunoglobulin heavy chain and capable of forming a primer set with primers according to c).

The primer sets of the present invention, for example, can be V _Lk + C _k , V _Lλ + C _λ , V _Lk + J _Lk , V _Lλ + J _Lλ , V _LkL + C _k, V _LλL + C _λ , V _LkL + J _Lк , V _LλL + J _Lλ , V _H + J _H , V _H + C _H , V _HL + J _H , V _HL + C _H, or combinations thereof capable of amplifying a given sequence encoding a variable region.

In another embodiment, primers for C _L (J _L ) and primers for V _L (V _LL ) are used, adapted to amplify sequences comprising variable regions of the light Kappa chain or variable regions of the light lambda chain.

In a preferred embodiment of the present invention, primers for C _L (J _L ) and primers for V _L (V _LL ) are used, adapted to amplify sequences encoding the variable regions of both light kappa chains and light lambda chains.

In an even more preferred embodiment of the present invention, primary primers for amplification of V _LL light chains are used, characterized by at least 90% sequence identity (preferably at least 95% identity) with the gene-specific region of SEQ ID NOS: 93-98, and basic primers for amplification of the heavy chains of V _HL , characterized by at least 90% identity (preferably at least 95% identity) with the gene-specific region of SEQ ID NO: 86-92.

In another embodiment of the present invention, the primers for V _L / V _LL and V _H / V _{HL of} immunoglobulin have binding end segments, preferably in the form of complementary overlapping end segments of the chain. The indicated primers make it possible to obtain sequences coding for variable regions that are linked in the direction “head segment - head segment”. To bind sequences encoding the variable regions in the “head segment - end segment” direction, the primers for C _L / J _L and V _H / V _HL contain binding end segments or the primers for V _L / V _LL and C _H / J _H contain binding end segments are preferably in the form of complementary end segments of chain extension by overlapping. To bind sequences encoding the variable regions in the “end segment - end segment” direction, the primers for C _L / J _L and C _H / J _H have binding end segments, preferably in the form of complementary end extension segments by overlapping (FIG. 3).

Mixtures of multiple primers, including mixtures of multiple primers for chain extension by overlapping of the present invention, include two sets of primers. Thus, a mixture of multiple primers includes at least four different primers. According to another aspect of the present invention, a multiple primer mixture comprises more than four different primers. A mixture of multiple primers of the present invention is used to amplify desired sequences in a single vessel. For example, in one vessel, all the variable regions of the kappa, lambda chains and heavy chains can be amplified. One mixture of multiple primers of the present invention contained 16 different degenerate primers, distributed as follows: eight primers for V _H , one primer for C _H1 , six primers for V _{L k} and one primer for C _k (FIG. 2). Another set of primers included 19 degenerate primers, distributed as follows: eight primers for V _H , four primers for J _H , six primers for V _{L k} and one primer for C _k . The third set of primers included 22 degenerate primers, distributed as follows: eight primers for V _H , one primer for C _H1 , eleven primers for V _Lλ and two primers for C _λ . The fourth set of primers included 27 degenerate primers distributed as follows: eight primers for V _H , one primer for C _H1 , six primers for V _Lк , one primer for C _k , eleven primers for V _Lλ and two primers for C _λ .

The present invention also relates to primers for further amplification by the PCR method of coupled products obtained using multiple RT-PCR followed by ligation or recombination, or using multiple RT-PCR with chain extension by overlapping. Additional amplification by PCR can be performed using a mixture of primers adapted to amplify related given sequences. Such a primer mixture may contain external primers of a multiple primer mixture or a mixture of multiple primers to extend the chain by overlapping, which are primers that hybridize to the extreme 5 ′ end and 3 ′ end of the sense strand of the linked nucleotide sequences, making it possible to amplify the entire bound product. One example of primers that can be used as external primers in the present invention are primers for C _to / J _to and / or C _λ / J _λ , forming a set of primers with primers for J _H or C _H. Additional amplification typically serves to increase the amount of bound product resulting from multiple RT-PCR followed by ligation or recombination, or from multiple RT-PCR with chain extension by overlapping.

Alternatively, for further amplification of the linked nucleotide sequences, a primer set can be used that is nested compared to the external primers used to perform the primary reaction of multiple RT-PCR or multiple RT-PCR with overlapping chain extension. In the present invention, such a set of primers is referred to as a nested set of primers. Nested primers are usually created in accordance with the same rules as the previously described gene-specific primers, except that they initiate the 3'-end in the hybridization position of the outer primers used in multiple RT-PCR or multiple RT-PCR with chain extension by overlapping. Therefore, the product resulting from the execution of the nested PCR is shorter than the bound product obtained from the multiple RT-PCR followed by ligation or recombination, or as a result of multiple RT-PCR with chain extension by overlapping. In addition to increasing the amount of bound product, nested PCR also serves to increase overall specificity, especially the overlap extended RT-PCR method. However, it should be noted that not all of the multiple primer / multiple primer blends described above for extending the chain by overlapping are suitable for use in combination with a nested primer kit when performing additional amplification. In such cases, for further amplification, external primers of the multiple primer mixture / multiple primer mixture can be used to extend the chain by overlapping, or a semi-nested PCR will be performed, which will be described later.

In one embodiment of the present invention, primers for J _L and J _H are used as nested primers for further amplification of the linked sequences encoding the variable regions of the immunoglobulin.

Socket primer sets of the present invention may also include reverse (or main) external primers from the first multiple primer / multiple primer mixture to extend the chain by overlapping and the second female primer mixture that initiate the 3'-end in the hybridization position of the main (or reverse) external primers of the first mixture of multiple primers / mixture of multiple primers to increase the chain by overlapping. The use of such a set of primers for additional PCR amplification is known as semi-nested PCR. Semi-nested PCR can be performed, for example, if it is difficult to create a nested primer in one specific region, for example, for sequences encoding variable regions (primers for V and J), since such a primer must hybridize with hypervariable regions (CDR ) In addition, semi-nested PCR can be used in cases where it is desirable to keep one end of the linked sequences intact, for example, for cloning.

In accordance with one of the distinguishing features of the present invention, the sequence encoding the constant region of the light chain remains intact in the process of additional amplification. The (reverse) primers for C _L used for additional amplification are only slightly modified compared to the external primers used for the primary reaction (multiple RT-PCR or multiple RT-PCR with chain extension by overlapping). Modification involves the addition of several bases to the 3'-end of the primers for C _L used for primary amplification. In addition, another cloning end segment can be added to the nested primers for C _L. The main primers used for additional amplification are completely nested compared to external primers specific for the constant region of the heavy chain used in the primary reaction. The combined use of external primers in the primary reaction and slightly modified nested primers for C _L together with fully nested primary primers in the additional amplification reaction causes an increase in specificity comparable to that achieved when performing nested PCR using a fully nested primer set.

In a preferred embodiment of the present invention, nested PCRs are performed using primers for J _H and modified primers for C _L , to the 2 ′ end of which 2 to 10 gene-specific base pairs are added compared to the first primers for C _L in a multiple primer / mixture multiple primers to extend the chain by overlapping.

Overlapping Multiple PCR Optimization with Overlap

The parameters of multiple PCR with chain extension by overlapping in both the two-stage method and the one-stage method can be optimized in several respects (see, for example, publications Henegariu, O. et al. 1997, BioTechniques 23, 504-511; Markoulatos, P . et al. 2002, J. Clin. Lab. Anal. 16, 47-51). Typically, multiple RT-PCRs use equally optimized parameters, although the ratio between the external and internal primers is less important for such a reaction.

but. Primer Concentration

The concentration of primers having an end segment of chain extension by overlapping (e.g., primers for V _H and V _L ) is preferably lower than the concentration of external primers having no end segment of chain extension by overlapping (e.g., primers for J _H and kappa chain).

If one of the given sequences amplifies less efficiently than the other sequences, for example, as a result of a higher GC% value, the amplification efficiency can be balanced. This result can be obtained by increasing the concentration of the set of primers, which is less effective in mediating amplification, or by reducing the concentration of another set of primers. For example, sequences encoding the variable regions of the heavy chain are characterized by a higher GC% value and, therefore, lower amplification efficiency compared to the variable regions of the light chain. From the above it follows that the primer for V _L should be used in a lower concentration than the primer for V _H.

In addition, when using a large number of primers, there may be a problem with determining the total concentration of primers. The upper limit is determined experimentally by titration. For the Applied Biosystems AmpliTaq Gold PCR system, the upper concentration limit of all oligonucleotides is set to 1.1 μM, although for other systems the upper limit can reach 2.4 μM. Such an upper limit on the concentration of all oligonucleotides affects the maximum concentration of individual primers. Too low an individual primer concentration causes poor PCR sensitivity.

It was also found that the quality of oligonucleotide primers is important for multiple overlap-extended PCR. The best results were obtained using oligonucleotides purified by HPLC.

b. PCR cyclization conditions

The cyclization conditions are preferably the following values:

Denaturation 10-30 sec 94 ° C Hybridization 30-60 sec 50-70 ° C About 5 ° C below Tm primers Chain extension 1 min x EPL 65-72 ° C EPL stands for expected product length in kb. Number of cycles 30-80 Final chain extension 10 min 65-72 ° C

For one-step multiple RT-PCR with chain extension by overlapping, the following steps were introduced into the cyclization program prior to the above amplification cyclization:

Reverse transcription 30 minutes 42-60 ° C These conditions are also used when performing separate reverse transcription Polymerase activation 10-15 minutes 95 ° C Heat activated polymerases are preferred in single-step RT-PCR. Activation is carried out in accordance with the manufacturer's instructions.

All the above parameters can be optimized. Of particular importance is the temperature of hybridization. Thus, all individual sets of primers that should form the final primer mixture must be tested separately to establish the optimum temperature and hybridization time, as well as elongation and denaturation times. This will determine the range within which these parameters can be optimized for a mixture of multiple primers to extend the chain by overlapping.

Problems associated with poor PCR sensitivity, for example, due to the low concentration of primers or template can be overcome using a large number of thermal cycles. A large number of thermal cycles include 35-80 cycles, preferably about 40 cycles.

In addition, longer chain extension times can increase the efficiency of multiple overlapping PCRs with chain extension. The long chain elongation time is 1.5-4 minutes x EPL compared to a normal chain elongation time of 1 minute.

from. The use of adjuvants

The effectiveness of the multiple PCR reaction can be significantly improved by using an additive for PCR, such as DMSO, glycerin, formamide or betaine, which relax the DNA, thereby facilitating matrix denaturation.

d. dNTP and MgCl ₂

The quality and concentration of deoxynucleoside triphosphate (dNTP) are important for multiple overlapping PCRs. The best concentration of dNTP is from 200 to 400 μM of each dNTP (dATP, dCTP, dGTP and dTTP), above which there is a rapid inhibition of amplification. Lower dNTP concentrations (100 μM of each dNTP) are sufficient for amplification by the PCR method. DNTP stocks are sensitive to thawing / freezing cycles. After three to five such cycles, multiple PCR is often ineffective. To avoid such problems, small aliquots of dNTP can be obtained and kept frozen at -20 ° C.

Optimization of the concentration of Mg ²⁺ is important, since most of the DNA polymerases are magnesium-dependent enzymes. In addition to Mg ²⁺ DNA polymerase, primers for template DNA and dNTP are linked. Therefore, the optimal concentration of Mg ²⁺ will depend on the concentration of dNTP, template DNA and the composition of the sample buffer. If primers and / or matrix DNA buffers contain chelators, such as EDTA or EGTA, the optimal concentration of Mg ²⁺ can be changed. Excess concentration of Mg ²⁺ stabilizes the double strand of DNA and prevents the complete denaturation of DNA, resulting in a decrease in product yield. Excess concentration of Mg ²⁺ can also stabilize false hybridization of the primer with irregular matrix sites, which reduces specificity. On the other hand, an insufficient concentration of Mg ²⁺ reduces the amount of product.

A good balance between dNTP and MgCl ₂ is approximately 200-400 μM dNTP (each) per 1.5-3 mM MgCl ₂ .

e. Concentration of buffer for PCR

KCl-based buffers typically satisfy the requirements of multiple overlap-extended PCRs; however, buffers based on other components, such as (NH ₄ ) ₂ SO ₄ , MgSO ₄ , Tris-HCl, or combinations thereof can also be optimized for use in multiple overlap extended PCRs. Primer pairs involved in the amplification of longer products perform better at lower salt concentrations (e.g. 20-50 mM KCl), while primer pairs involved in the amplification of short products perform better at higher salt concentrations (e.g. 80-100 mM KCl). A double increase in buffer concentration instead of a single increase can increase the efficiency of the multiple reaction.

f. DNA polymerase

The present invention is described using Taq polymerase as an example. Alternatively, other types of heat-resistant DNA polymerases can be used, including, for example, Pfu, Phusion, Pwo, Tgo, Tth, Vent, Deep-vent. Polymerases lacking or possessing the activity of a 3'-5'-terminal exonuclease can be used alone or in combination with each other.

Vectors and libraries

As a result of the binding of the nucleotide sequences of interest of the present invention, a nucleotide segment is formed comprising the linked nucleotide sequences of interest. In addition, by the methods of the present invention, libraries of such related linked nucleic acid sequences of interest are obtained, in particular libraries of sequences encoding variable regions.

One of the hallmarks of the present invention is the introduction into acceptable vectors of a segment containing the linked nucleotide sequences of interest, or libraries of the linked nucleotide sequences of interest obtained by the method of the present invention. These libraries may be combinatorial libraries or libraries of related pairs of sequences encoding variable regions. The restriction sites formed by external primers, nested primers or semi-nested primers should preferably be compatible with the corresponding restriction sites of the selected vector. Interesting linked nucleic acid sequences can also be introduced into vectors by recombination if one of the half-nested, nested or external primers has an acceptable recombination site and the selected vector contains the same site.

Basically, there are no restrictions on the vectors that can be used as carriers of products obtained by one of the methods for performing multiple RT-PCR and binding of the present invention. Selected vectors can be used for amplification and expression in cells, including, for example, bacterial cells, yeast cells, cells of other fungi, insect cells, plant cells or mammalian cells. Such vectors can be used to facilitate the subsequent stages of cloning, transfer between vector systems, display of the product introduced into the vector, expression of the introduced product and / or incorporation into the genome of the host cell.

Cloning vectors and shuttle vectors are preferably bacterial vectors. However, other types of vectors can also be used in the process of cloning and transfer.

Vector displays can be, for example, phage vectors or phagemid vectors derived from filamentous bacteriophages of class fd, M13 or f1. Such vectors are able to facilitate the display of proteins, including, for example, a binding protein or fragment thereof, on the surface of a filiform bacteriophage. Vector displays are also known in the art that can be used to display on ribosomes, DNA, yeast or mammalian cells. These vectors include, for example, viral vectors or vectors encoding chimeric proteins.

Expression vectors exist for all of these species, and the choice of vector depends entirely on the expressed protein. Some expression vectors are additionally able to integrate into the genome of the host cell as a result of arbitrary integration or site-specific integration using appropriate recombination sites. Expression vectors may have additional coding sequences that, when a bound product is introduced into the indicated sequences in the reading frame, can express a longer protein, for example, an unprocessed monoclonal antibody, in the corresponding host cell. Such an introduction in the reading frame can also facilitate the expression of chimeric proteins, which in turn facilitates the display of a filamentous bacteriophage or cell on the surface. In a bacteriophage-based display system, the associated nucleotide sequences of interest can be introduced into the reading frame into a sequence encoding a coat protein, such as pIII or pVIII (Barbas, CF et al. 1991, Proc. Natl. Acad. Sci. USA 88, 7978- 7982; Kang, AS et al. 1991, Proc. Natl. Acad. Sci. USA 88, 4363-4366).

In one embodiment of the present invention, individual segments of the linked nucleotide sequences of interest include a sequence encoding an immunoglobulin heavy chain variable region that is linked to a sequence encoding a light chain variable region. These linked sequences are preferably introduced into a vector containing sequences encoding one or more constant domains of immunoglobulin. The insertion is carried out so that the linked sequences encoding the variable region of the heavy chain and / or the variable region of the light chain are in the reading frame of sequences encoding constant regions. As a result of such an insertion, for example, an expression vector of a Fab fragment, an expression vector of an unprocessed antibody or an expression vector encoding a fragment of an unprocessed antibody can be created. Such a vector is preferably an expression vector suitable for screening (e.g., vectors based on E. coli, phagomide or a mammalian vector), wherein sequences encoding the constant region of the heavy chain are selected from human immunoglobulin of classes IgG1, IgG2, IgG3, IgG4, IgM , IgA1, IgA2, IgD or IgE, resulting in the expression of a Fab fragment or an unprocessed recombinant antibody. In addition to sequences encoding the constant region of the heavy chain, this vector may also contain a sequence encoding the constant region of the light chain, which is selected from lambda or kappa chains of a person. This approach is justified in cases where the linked nucleotide sequences encode only sequences encoding the variable region of the immunoglobulin (Fv fragments).

In another embodiment of the present invention, individual segments of the linked nucleotide sequences include a sequence encoding a variable region of a TcR α chain that is linked to a sequence encoding a variable region of a β chain, or a sequence encoding a variable region of a γ chain that is linked to a sequence encoding variable region of the δ-chain. These linked sequences are preferably introduced into a vector that contains sequences encoding one or more constant TcR domains. The insertion is carried out so that the introduced linked sequences encoding the variable regions are in the reading frame of the corresponding sequences encoding the constant regions of TcR. In another embodiment of the invention, such a vector is a chimeric expression vector comprising sequences encoding a leucine zipper in the reading frame of TcR constant regions. It has been found that such constructs increase the stability of soluble TcRs (Willcox, B.E. et al. 1999, Protein Sci. 8, 2418-2423).

The pairing libraries of the present invention can be introduced into vectors in two different ways. According to the first method, separate related pairs are introduced into an acceptable vector. Such a library of vectors can be in a disparate or combined form. According to the second method, all related pairs are combined before being introduced into the vector and then all together are introduced into acceptable vectors to form a combined library of vectors (illustration in FIG. 12). Such a vector library contains a wide variety of pairs of sequences encoding variable regions.

One object of the present invention is a library of related pairs of linked sequences encoding variable regions. Individual related library pairs preferably include a sequence encoding an immunoglobulin light chain variable region associated with a sequence encoding a heavy chain variable region.

Another preferred library of related pairs contains linked sequences encoding TcR regions in which each individual sequence encoding a TcR region includes a sequence encoding a variable region of an alpha chain associated with a sequence encoding a variable region of a beta chain and / or a sequence encoding the variable region of the gamma chain TcR associated with the sequence encoding the variable region of the delta chain.

One embodiment of the present invention relates to a sub-library of related pairs of linked sequences encoding variable regions that determine the desired binding specificity for a particular target. These related pairs preferably include linked sequences encoding the variable region of the light chain and the variable region of the heavy chain of the immunoglobulin, sequences encoding the variable region of the alpha chain and the variable region of the beta chain TcR, and / or sequences encoding the variable region of the gamma chain and variable region delta chain TcR.

Another embodiment of the invention relates to a sub-library selected from a source library of related pairs of sequences encoding variable regions of the present invention.

A preferred embodiment of the present invention relates to a library or sub-library encoding related pairs of unprocessed immunoglobulins selected from human immunoglobulin of classes IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM.

Another preferred feature of the present invention is a library or sub-library encoding soluble and stable TcR related pairs.

A distinctive feature of the present invention is the variety of these libraries, which include at least 5, 10, 20, 50, 100, 1000, 10 ⁴ , 10 ⁵ or 10 ⁶ different related pairs.

In another embodiment of the present invention, said libraries of related pairs of linked sequences encoding variable regions are prepared by a method comprising the steps described above. Such a library is also referred to as the source library.

Screening and screening

It can be assumed that the original library of pairs of linked sequences encoding variable regions that were obtained from a donor by one of the methods of the present invention should be a variety of binding proteins, some of which will be unsuitable, that is, they will not bind to the desired target, which is especially true for combinatorial libraries. Therefore, enrichment and screening is included in the scope of the present invention to obtain a sub-library encoding a subset of binding specificities directed against a specific target.

As regards the libraries of related pairs, the diversity of the library presumably corresponds to the diversity of the material of the donor in the presence of a small number of arbitrarily connected variable regions. Thus, in a library consisting of related pairs, an enrichment step may not be necessary prior to screening for target specific binding affinity.

In another embodiment of the present invention, a method of creating a library of pairs of linked sequences encoding variable regions further comprises creating a sub-library by selecting a subset of pairs of linked sequences of variable regions that encode binding proteins with the desired specificity for the target. Such a selection of linked sequences encoding variable regions is also referred to as a library of target-specific related pairs.

A preferred embodiment of the present invention relates to a library of target-specific related pairs of sequences encoding variable regions that are introduced into a mammalian expression vector.

The selection of sequences encoding the variable regions of target-specific immunoglobulins is usually carried out using immunological assays. Such assays are well known in the art and include, for example, ELISPOTS, ELISA, membrane assays (e.g. western blotting), filter matrices, or FACS. These analyzes can be performed directly using polypeptides derived from sequences encoding the variable regions of immunoglobulin. Alternatively, immunoassays can be performed in combination or after enrichment with methods such as imaging on phages, ribosomes, the bacterial surface, yeast, eukaryotic viruses and RNA or covalent imaging (see FitzGerald, K., 2000, Drug Discov. Today 5, 253- 258). As shown in FIG. 10, both libraries of expressed related Fab fragments and libraries of expressed related unprocessed antibodies can be screened, resulting in a sub-library of positive clones. Such screening and enrichment methods are also suitable for Fv or scFv fragments or combinatorial libraries of related variable regions.

In a preferred embodiment of the present invention, the selection of a sub-library of target-specific related pairs or combinatorial pairs of sequences encoding variable regions is performed by a highly efficient screening method. Highly effective screening methods include, but are not limited to, ELISA assays performed using semi-automatic and automatic equipment. Membrane assays can also be used, in which bacteria are automatically collected and placed on an appropriate membrane over agar plates to form colonies that express antigen binding molecules. These molecules penetrate through the membrane onto the second antigen sensitized membrane below, which can be developed and used to identify clones secreting antigen-binding molecules to the desired target (de Wildt, RM, et al. 2000, Nat. Biotechnol. 18, 989-994 )

After selection by a suitable method of a sub-library of related pairs or combinatorial pairs of antigen-binding clones, additional analyzes can be performed by DNA sequencing of linked sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin. First, such DNA sequencing provides information on library diversity, such as the origin of the germ line, family distribution, and maturation in hypervariable regions. This analysis allows you to select clones, characterized by a wide variety, and remove duplicate clones. Secondly, DNA sequencing allows you to identify mutations that have arisen in the process of isolation.

When analyzing sequences encoding variable regions, three types of mutations must be considered before deciding on the acceptability of the mutation: i) the most common type of mutation results from cross-linking within the family when the primers for the V gene bind to the wrong subset in one particular family of V genes. The introduced changes are mainly replacements of natural codons in one specific position. Due to the high degree of sequence homology in the V gene family, such substitutions can be considered as conservative and acceptable substitutions; ii) less frequent mutations result from cross-linking between families (for example, a primer for the VH3 family initiates a sequence encoding the VH1 family) and cause more significant structural changes, sometimes without a natural variant. Such changes can potentially affect the immunogenicity of the variable region as a result of the creation of new epitopes. Such changes can be easily identified and then eliminated by standard molecular biology methods or excluded detected clones from the library; iii) Errors caused by Taq DNA polymerase are most easily identified in sequences encoding constant regions, after which they can be easily eliminated. However, Taq polymerase-induced mutations will undoubtedly also be present in sequences coding for variable regions, where they cannot be distinguished from natural somatic mutations, which are also the result of random mutations in sequences coding for variable regions. Considering that these mutations are not systemic and only affect certain pairs in different ways, it seems reasonable not to take such changes into account.

In addition, sequence analysis can be used to identify the degree of sequence permutation in the library of related pairs, as shown in table 20 for the VH group H4.

As described in Example 9, the mutations discussed in i) and ii) can be eliminated in the library of expressed sequences by using primers hybridizing to the leader peptide of sequences encoding the variable regions instead of primers hybridizing to the 5 ′ end of the variable regions.

In another embodiment of the present invention, a sub-library of target-specific and possibly analyzed pairs of linked sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin is transferred to the mammalian expression vector. Such transfer can be made to any vectors described in the previous section, which allow the expression of an unprocessed recombinant antibody. If screening is performed for a library of related pairs of expressed unprocessed antibodies, such transfer may not be necessary.

In another embodiment of the present invention, the source library is created from a lymphocyte-containing fraction of cells enriched in T-lymphocytes. Pairs of linked sequences encoding the variable regions that form the source library can be selected taking into account the coding of a subset of pairs of linked sequences of variable regions consisting of alpha and beta chains and / or gamma and delta chains encoding binding proteins with the required specificity for targets, as a result of which a sub-library of related pairs or combinatorial pairs will be created. Antigen-specific T cell receptors can then be identified in a pool of transfected cells by standard methods, such as staining with MHC peptide tetrameric complexes (see, for example, Callan, MF et al. 1998, J. Ex. Med. 187, 1395-1402 ; Novak, EJ et al. 1999, J. Clin. Invest. 104, R63-R67), measuring cellular reactions in the form of IL-2 release, or by more sophisticated methods, such as yeast or retrovirus imaging methods.

Host Cells and Expression

The libraries of the present invention can be transferred to vectors suitable for the expression and production of proteins encoded by interest nucleic acid linked sequences, in particular binding proteins containing variable regions, or fragments thereof. Such vectors are described in the “Vectors and Libraries” section and are used to express, for example, unprocessed antibodies, Fab fragments, Fv fragments, scFv fragments, membrane-bound or soluble TcRs, or TcR fragments of a selected species.

One of the hallmarks of the present invention is the introduction into the host cell of a library or sub-library of vectors containing related pairs of linked sequences encoding variable regions, or a single clone comprising a related pair of linked sequences encoding variable regions for amplification and / or expression. Host cells can be selected from bacterial cells, yeast cells, cells of other fungi, insect cells, plant cells, or mammalian cells. For expression, mammalian cells such as Chinese hamster ovary (CHO) cells, COS cells, BHK cells, myeloma cells (e.g. Sp2 / 0, NS0 cells), NIH 3T3, fibroblasts or immortal human cells such as HeLa cells are preferred. HEK 293 or PERC6 cells.

The vectors are introduced into the host cells using a variety of transformation or transfection methods known to those skilled in the art, which include calcium phosphate precipitation, electroporation, microinjection, fusion with liposomes, fusion with homolized red blood cells, fusion with protoplasts, viral infection and the like. . Well-known methods for producing monoclonal unprocessed antibodies, Fab fragments, Fv fragments and scFv fragments.

The production of recombinant polyclonal antibodies intended for therapeutic use is a new area. A method for producing recombinant polyclonal antibodies is described in PCT application WO 2004/061104. The specified method includes creating a collection of cells suitable for use as a line of producing cells. The following description of this method relates to a library of related pairs, although it is also applicable to a combinatorial library. Individual cells in a cell collection can express one member of a recombinant polyclonal binding protein, for example, from a library of related pairs. To guarantee the expression by individual cells of one related pair, rather than several related pairs of the polyclonal binding protein, nucleic acid sequences encoding the related pairs are introduced into one specific site of the genome of each individual cell. This is an important feature of the cell collection, since it prevents the rearrangement of the heavy and light chains expressed by each cell, and also allows you to get cells essentially identical to each other, with the exception of small differences in the variable regions of individual related pairs. This feature allows unbiased growth of the cell collection over the period of time necessary for production. To guarantee a single site-specific integration, it is necessary to use a commercially available line of host cells having only one integration site, for example Invitrogen CHO Flp-In cells containing one FRT site. Vectors suitable for a given cell line contain the corresponding FRT site and are inserted into the genome using Flp recombinase. There are several other known recombinases, for example, Cre, beta recombinase, Gin, Pin, PinB, PinD, R / RS, lambda integrase or phage integrase FS31, which can be used in combination with the corresponding recombination sites. In addition, acceptable vectors contain a selectable marker that allows the selection of site-specific integrants.

The creation of a polyclonal producing cell line and the production of a recombinant polyclonal protein with such a cell line can be accomplished by several different transfection and production methods.

One method is to use a library of vectors mixed to form one composition, designed to transfect a line of host cells that have one integration site in one cell. This method is called mass transfection. The previously described structure of the vector and the host cell ensures that, as a result of appropriate selection, a line of polyclonal cells characterized by unbiased growth should be obtained. It is necessary to create a frozen supply of the polyclonal cell line before starting production of the recombinant polyclonal protein.

Another method is to use for transfection of a library of vectors, divided into parts, containing about 5-50 individual library vectors in the composition. One part of the library preferably contains 10-20 individual vectors. Each composition is then transfected into one aliquot of the host cells. This method is called half-mass transfection. The number of transfected aliquots depends on the size of the library and the number of individual vectors in each part. If the library includes, for example, 100 separate related pairs, divided into parts containing 20 separate members in the composition, it is necessary to transfect 5 aliquots of the host cells with the composition of the library, which is a separate part of the original library. Aliquots of host cells are selected based on site-specific integration. Different aliquots are preferably selected separately. However, they can also be combined before breeding. These aliquots can be analyzed for their clonal diversity, and only aliquots of sufficient diversity are used to stock the library of polyclonal related pairs. To obtain the desired polyclonal cell line, aliquots can be mixed until a frozen stock is created immediately after they are obtained from the stock or after a short period of proliferation and adaptation. Aliquots of the cells are separately in the production process, and a polyclonal protein is obtained by combining the products of all aliquots, rather than aliquots of the cells prior to production.

The third method is a highly efficient method in which host cells are transfected separately using separate vectors that make up the library of related pairs. This method is called individual transfection. Individually transfected host cells are preferably selected separately for site-specific integration. Individual cell clones obtained by selection can be analyzed to determine the proliferation time, and cells with the same growth rates are preferably used to stock the library of polyclonal related pairs. Individual cell clones can be mixed to produce the desired polyclonal cell line before stockpiling immediately after being obtained from stock or after short proliferation and adaptation. This approach eliminates any possible shift in residual sequences during transfection, integration, and selection. Alternatively, individually transfected host cells are mixed prior to selection, which allows control of sequence displacement due to transfection.

A common hallmark of the above methods is that all individual related pairs forming a recombinant polyclonal protein can be obtained in one or a limited number of bioreactors. The only difference is the stage at which a collection of cells is selected that forms a line of polyclonal producing cells.

One embodiment of the present invention relates to a population of host cells forming a library of related pairs or a sub-library of linked pairs of sequences encoding variable regions.

Another embodiment of the present invention relates to a population of host cells forming a library obtained from a population of isolated single cells including lymphocytes using the multiple RT-PCR method to bind related pairs, followed by ligation or recombination or multiple RT-PCR extension chains by overlapping of the present invention.

Another embodiment of the present invention relates to a population of host cells forming a combinatorial library or a sub-library of linked pairs of sequences encoding variable regions.

The host cell population of the present invention includes a population of different cells corresponding to the variety of the library used to transform and transfect cells. Each cell in the cell population preferably forms only one related pair from the entire library of related pairs, and not a single member of the library of related pairs exceeds 50%, more preferably 25% or most preferably 10% of the total number of individual members expressed from the cell population - the hosts.

In a preferred embodiment of the present invention, the host cell population includes mammalian cells.

The above population of host cells can be used to express a recombinant polyclonal binding protein, as individual cells in a population form different sequences encoding variable regions.

One embodiment of the present invention relates to a recombinant polyclonal protein expressed by a population of host cells comprising a library of vectors containing different related pairs of linked sequences encoding variable regions that was created by the method of the present invention. The recombinant polyclonal protein of the present invention typically includes 2, 5, 10, 20, 50, 100, 1000, 10 ⁴ , 10 ⁵ or 10 ⁶ proteins consisting of different related pairs.

A preferred embodiment of the present invention relates to a recombinant polyclonal immunoglobulin expressed by a population of host cells comprising a library of vectors containing different related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain.

Another preferred embodiment of the present invention relates to a recombinant polyclonal TcR expressed by a population of host cells comprising a library of vectors containing different related pairs of sequences encoding the variable region of the TcR alpha chain linked to the variable region of the beta chain and / or sequences encoding the variable region of the gamma chain associated with the variable region of the delta chain.

Another embodiment of the present invention relates to a host cell suitable for producing a monoclonal protein. In particular, a monoclonal antibody containing a cognate pair of the variable region of the light chain and a variable region of the heavy chain, or a monoclonal TcR containing a cognate pair of the variable region of the alpha chain and the variable region of the beta chain or the variable region of the delta chain and the variable region of the gamma chain. Such a monoclonal protein producing cell line is preferably not a hybridoma cell line.

Such a monoclonal antibody or TcR can be obtained by adding the following steps to a method for linking several interesting non-contiguous nucleotide sequences: a) introducing into the vector of said linked nucleic acid sequences; b) introducing the specified vector into the host cell; c) culturing said host cells under conditions suitable for expression; and d) preparing a protein product expressed by a vector introduced into said host cell. The vector introduced into the host cell preferably contains a separate related pair of sequences encoding variable regions.

Application of the invention

The main application of the present invention is the binding of related pairs of sequences encoding the variable regions, in particular sequences encoding the variable regions of the immunoglobulin heavy and light chains, or sequences encoding the variable regions of the alpha and beta chain or the gamma and delta chains of TcR, using a highly efficient way to create related pair libraries. In addition to creating libraries of related pairs, multiple RT-PCR followed by ligation or recombination binding or multiple RT-PCR overlapping chain extension of the present invention can be used to create combinatorial libraries for a population of different genetic cells, a cell lyser from such a population of cells or RNA isolated from such a population of cells. Libraries, sub-libraries, or single clones from one of these libraries facilitate the expression of polyclonal or monoclonal proteins. From the libraries of the present invention, in particular, monoclonal or polyclonal antibodies can be obtained.

The use of recombinant monoclonal antibodies for the diagnosis, treatment and prevention of diseases is well known. Recombinant monoclonal and polyclonal antibodies obtained by the method of the present invention have the same use as antibodies obtained by existing methods. In particular, a pharmaceutical composition comprising, as an active ingredient, a polyclonal recombinant immunoglobulin combined with at least one pharmaceutically acceptable excipient can be prepared by the method of the present invention. Pharmaceutical compositions in which the polyclonal recombinant immunoglobulin contains related pairs of sequences encoding variable regions are more preferred. Pharmaceutical compositions based on polyclonal recombinant immunoglobulins can be used as medicines. The polyclonal recombinant immunoglobulin included in the composition may be specific for a predetermined disease, therefore, such a composition can be used to treat, reduce the intensity or prevention of diseases such as cancer, infectious diseases, inflammatory diseases, allergies, asthma and other respiratory diseases, autoimmune diseases, dysfunctions of the immune system, cardiovascular diseases, diseases of the central nervous system, metabolic diseases in and endocrine diseases, transplant rejection, or undesired pregnancy in mammals, such as humans, domestic or pet animals.

Further application of the present invention has no analogues among modern methods based on monoclonal chimeric antibodies. When protective antigens are poorly studied or completely unknown, as is the case with the emergence of new infectious diseases, it is impossible to find a monoclonal antibody that protects against this disease.

However, the present invention allows to obtain antibody-expressing cells directly from donors with a developed humoral immune response, for example, in recovering individuals, and to use the starting material obtained from these individuals to create a library of related pairs of sequences encoding the variable regions of the heavy and light chains of immunoglobulin.

In those cases when, for example, the virus is known, but the protective antigens are unknown, it is possible to create a sub-library of related pairs of antibody genes with broad reactivity with respect to the antigenic structures of the virus. The recombinant polyclonal antibody obtained from such a sub-library is likely to contain protective antibodies.

In cases where the antigens are completely unknown, the recombinant polyclonal antibody obtained from the library of related pairs, created on the basis of the starting material of recovering individuals, can be used in the same way as hyperimmune immunoglobulins are currently used. The basis for this application is related mating, which guarantees close correspondence of the obtained recombinant polyclonal antibody to the humoral immune response of a recovering individual.

Methods of binding related pairs of variable regions described in the present invention are used in diagnostic and analytical methods. When a drug is administered to an individual, there is always the possibility of an immune response against such a drug. Immunogenicity can be determined by existing methods, such as drug-specific serum or plasma binding assays obtained from an individual taking the drug. Alternatively, the methods of the present invention can be used to display the immune response of individuals immediately after drug administration by isolating related pairs of sequences encoding the variable regions of the heavy and light chains. Antibodies expressed from such a library can be tested for reactivity with a given drug or its components. This method is particularly useful in cases where the presence of a drug in plasma or serum prevents the use of the existing method. Such drugs are, for example, antibodies. An immune response against a drug (e.g., an anti-idiotypic immune response, an immune response to a reading frame, or an Fc fragment) caused by administration of an antibody cannot be identified by known methods until the antibody used for treatment has been completely removed from the blood. In accordance with the present invention, sequences coding for such antibodies against a given drug can be isolated from the subject being treated and examined for two weeks. Thus, the present invention is an alternative method for studying the immunogenicity of drugs in general and antibody-based drugs in particular.

Another application of the present invention is the testing and comparison of vaccines and vaccination programs. This is especially useful in the process of creating a vaccine, as it allows you to evaluate and compare the variety of sequences involved in humoral immune responses that occur in response to the effects of new candidate vaccines, in addition to ongoing comparisons of antibody binding affinity and serum titer. In addition, the present invention can be used to analyze, control and compare humoral immune responses in monitoring the effectiveness of a vaccine in a population.

The present invention also finds use outside the field of binding proteins containing variable regions. One of skill in the art can easily adapt the method described in the present invention to bind two or more transcribed nucleotide sequences encoding a heteromeric non-binding protein. Such linking of sequences encoding domains or subunits of a heteromeric protein can be very useful for isolating protein coding sequences, since it will significantly reduce the number of stages. In addition, it is possible to isolate, for example, spliced variants, mutations or new members of the family of such proteins, using only one mixture of multiple primers / mixture of multiple primers to extend the chain by overlapping.

In addition, it is possible to bind sequences encoding the remote domains of a single protein. This method should facilitate the study of the significance of certain domains in a multidomain protein, since it simplifies the deletion of intermediate domains.

The creation of chimeric or bound proteins is also an area in which the present invention can be used. Even if the proteins to be bound are of different origin, for example, they are a chimeric protein made from human and mouse proteins, the present invention can be used by mixing cells before reverse transcription is performed. Such a mixture of cells may include a population of cells from each species or a single cell from each species.

Examples

Example 1. Two-stage multiple RT-PCR with chain extension by overlapping

This example describes the implementation of reverse transcription (RT) using a matrix obtained from an isolated single cell, and the produced cDNA is used as a matrix to perform multiple multiple PCRs with chain extension by overlapping.

but. Cells

The Chinese Hamster Ovary (CHO) cell line expressing the kappa chain of IgG1 was obtained by Flp-In (Invitrogen, Carlsbad, CA, USA).

The plasmid vector pLL113 expressing the kappa chain of IgG (FIG. 4) was created based on the Flp-In expression vector, pcDNA5 / FRT. CHO-Flp-In cells were cotransfected with the pLL113 vector containing the antibody and pOG44 genes causing transient expression of Flp recombinase using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. Transformants were selected and tested for IgG kappa chain production by immunoassays. A selected cell line, dubbed CHO Flp-In pLL113, was placed in Ham F-12 medium containing 2 mM L-glutamine, 10% FCS and 900 hygromycin B (support medium).

CHO Flp-In pLL113 cells were harvested with trypsin and washed three times in a support medium. After the last wash, the cells were re-suspended in the initial volume of the support medium. Cell concentration was determined using the Casy-1 system (Scharfe System GmbH, Reutlingen, Germany) and diluted in a support medium to a concentration of 1 cell / 5 μl.

b. Reverse transcription

A suspension of CHO Flp-In pLL113 cells containing on average one cell was distributed into individual wells of a 96-well PCR plate (Thermo-Fast 96, skirted AB-0800, ABgene, Epsom, Surrey, UK).

cDNA was synthesized from distributed cells at the reverse transcription stage using reverse transcriptase (RT) in accordance with the Qiagen RT-PCR one-step method (Qiagen one-step RT-PCR kit, catalog number 210210 Hilden, Germany).

Each well contained the following reagents in a total volume of 20 μl:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 1 mM of each reagent,

5 pmol of poly-dT oligonucleotide (18),

26 units RNase inhibitor (RNasin, Promega, Madison USA, catalog number N2111),

2 μl enzyme mixture for one-step RT-PCR,

5 μl suspension of CHO cells Flp-In pLL113.

The reverse transcription reaction using RT was performed by incubating the reaction mixtures at 55 ° C for 30 minutes. Then reverse transcriptase was inactivated by incubating the reaction mixture at 94 ° C for 10 minutes.

from. Multiple overlap extended PCR

A portion of the cDNA products obtained in step b) was used as a template for multiple overlap extended PCR. The reaction was performed on 96-well plates.

Each well contained the following reagents in a total volume of 40 μl:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 500 μM of each reagent,

a mixture of multiple primers for lengthening the chain by overlapping at the concentrations indicated in table 1,

26 units RNase inhibitor (RNasin, Promega, Madison USA, catalog number N2111),

2 μl enzyme mixture for one-step RT-PCR,

1 μl cDNA template (isolated from a single cell (step b)).

The mixture of multiple primers used to extend the chain by overlapping contained the primers shown in Table 1.

Table 1 Primer Name Concentration SEQ ID NO The primer sequence in the direction from the 5'-end to 3'-end V _h 20 nM each one

2

3

four

5

6

7

8

C _h 100 nM 9

V _l 20 nM each 10

eleven

12

13

fourteen

fifteen

C _Lк 100 nM 16

W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

Reactions were performed in a 96-well Primus HT MWG thermoblock (MWG Biotech AG, Ebersberg, Germany) under the following cyclization conditions:

Denaturation 30 sec 95 ° C 50 cycles Hybridization 30 sec 50 ° C Chain extension 5 minutes 72 ° C Final chain extension 10 min 72 ° C

d. Socket PCR

Nested PCR was performed using multiple chain extension products by overlapping as the template. Reactions were performed on 96-well plates.

Each well contained the following reagents in a total volume of 50 μl:

one-time buffer for Bio Taq,

dNTP at a final concentration of 400 μM of each reagent,

2 mm MgCl ₂ ,

PCR primer mix

1.25 units BIOTAQ DNA Polymerase (BIO-21040, Bioline, UK),

1 μl product of overlapping multiple PCR with chain elongation (step c).

The primers used are shown in table 2.

table 2 Primer Name Concentration SEQ ID NO The primer sequence in the direction from the 5'-end to 3'-end J _h 100 nM each 17

eighteen

19

twenty

C _Lк 100 nM 21

The sequences indicated in capital letters correspond to the genespecific region.

The reactions were performed in a 96-well Primus HT MWG thermoblock (MWG Biotech AG, Ebersberg, Germany) under the following cyclization conditions:

Denaturation 30 sec 95 ° C  25 cycles Hybridization 30 sec 50 ° C Chain extension 90 sec 72 ° C Final chain extension 10 min 72 ° C

Nesting PCR products were analyzed by 1% agarose gel electrophoresis using ethidium bromide to detect (Figure 5). The expected size of the product obtained by chain elongation by overlapping was 1076 bp. Such a product is shown in bands 1, 5, 6, 7, 8, and 12, marked by arrows (FIG. 5A). In the experiment under consideration, the negative control sample is contaminated, and similar contamination is also characteristic of the test samples. On figv shows the fragments depicted in figa, which relate to the present experiment.

This experiment illustrates one way of performing two-stage multiple PCR with chain extension by overlapping using a matrix isolated from a single cell. In addition, it has been shown that approximately twenty multiple PCRs can be performed with chain extension by overlapping using cDNA obtained from an isolated single cell.

Example 2. One-stage multiple RT-PCR with chain extension by overlapping

In this example, the implementation of reverse transcription and multiple PCR with chain extension by overlapping in a single stage using a matrix obtained from lysed cells in concentrations corresponding to 100, 10 or 1 cell.

but. Cells

The HB-8501 human hybridoma cell line producing an anti-tetanus antibody with IgG1 kappa chain, which was obtained from the American Type Culture Collection, was cultured in Dulbekko medium modified according to the Claims method (Vitacell, Kiev, Ukrain, catalog number 30-2005), containing 10% fetal calf serum. Prior to performing multiple chain extension RT-PCR by overlapping, cells were harvested, counted and frozen at -80 ° C in culture medium at a concentration of 200 cells / μl.

b. Single-Stage Multiple Overlap RT-PCR with Overlap

To perform multiple RT-PCRs with chain extension by overlapping, the Qiagen Single-Stage RT-PCR Kit (Qiagen, Catalog No. 210212, Hilden, Germany) was used in accordance with the manufacturer's recommendations. Before being added to PCR tubes, cell lysates were thawed and diluted in H ₂ O to a lysate concentration corresponding to 100, 10 and 1 cell per 5 μl.

Each PCR tube contained the following reagents in a total volume of 50 μl:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 400 μM of each reagent,

a mixture of multiple primers for lengthening the chain by overlapping at the concentrations indicated in table 3,

2 μl enzyme mixture for one-step RT-PCR,

50 units RNase inhibitor (RNasin, Promega, Madison USA, catalog number N2515),

5 μl of diluted cell lysate.

The mixture of multiple primers used to extend the chain by overlapping contained the primers shown in Table 3.

Table 3 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end V _h 40 nM each 22

23

24

25

26

27

28

29th

thirty

J _h 200 nM each 31

32

33

34

V _l 40 nM each 35

36

37

38

39

40

C _Lк 200 nM 16

W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

The reactions were carried out under the following cyclization conditions:

Reverse transcription 30 minutes 55 ° C Polymerase activation 15 minutes 95 ° C reverse transcriptase inactivation and Taq polymerase activation

PCR reaction:

Denaturation 30 sec 94 ° C  50 cycles Hybridization 30 sec 44 ° C Chain extension 3 min 72 ° C Final chain extension 10 min 72 ° C

Ten microliters of reaction products were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (FIG. 6A).

The expected size of the fragments (the exact size depends on the length of the variable regions):

V _H : 410 bp

LC: 680 bp

Fragment of chain extension by overlapping: 1070 bp

Individual DNA fragments with mobility corresponding to the length of the variable region of the heavy chain (V _H ) and the length of the variable and constant regions of the light chain (LC) are present at all dilutions of the cell lysate. A less intense fragment with motility corresponding to the putative fragment of chain extension by overlapping is present in lysates from 100 to 10 cells. A fragment of chain extension by overlapping a single cell lysate in the sample was hardly detected, although it was present in the original gel (see the arrow in the photo shown in FIG. 6A and the image shown in FIG. 6B).

from. Overlapping fragment identification

As a result of the above experiment, the presence of a strip corresponding to a fragment of chain extension by overlapping was confirmed. Areas of agarose gel at 1070 bp bands corresponding to 1 cell and bands corresponding to 100 cells were excised, DNA was purified using a Qiaex II kit (Qiagen, catalog No. 20051, Hilden, Germany) and diluted in 20 μl of water.

One microliter of eluate was subjected to PCR (Biotaq kit, Bioline, UK catalog number BIO-21040) in accordance with the manufacturer's instructions using primers flanking the proposed fragment of the chain extension by overlapping (primers for J _H corresponding to SEQ ID NO: 32-35, and a primer for C _Lk corresponding to SEQ ID NO: 17, using each primer at a concentration of 0.5 μM). The reactions were carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C 30 cycles Hybridization 30 sec 55 ° C Chain extension 1 min 72 ° C

Ten microliters of each reaction product were analyzed by electrophoresis on a 1% agarose gel using ethidium bromide for detection. Several fragments were found, including those with the mobility of the expected fragment of chain extension by overlapping from 1 to 100 cells in the samples (arrow in Fig. 6C). Fragment 1 kbp long excised from the gel strip corresponding to one cell and purified using the Qiaex II kit described above. The purified fragment was hydrolyzed with restriction enzymes NheI and NcoI (separately) and the reaction products were analyzed by electrophoresis on a 1% agarose gel using ethidium bromide for detection (Fig. 6D). These restriction sites are present at the overlapping site of VH and LC, and the expected chain sizes after hydrolysis are approximately 410 and 680 bp (figure 2). The hydrolysis of NheI was incomplete, since the large fraction still has its original size.

Example 3. Combined reactions of one-stage multiple RT-PCR with chain extension by overlapping and nested PCR

In this example, reverse transcription and multiple PCR overlap-extended PCR reactions are performed as a single step, followed by amplification using semi-nested PCR using a matrix of lysed cells at concentrations corresponding to 100, 10, or 1 cell.

but. Single-Stage Multiple Overlap RT-PCR with Overlap

Multiple overlap extension RT-PCRs were performed using the HB-8501 cell lysate, as described in Example 2, using a mixture of multiple overlap extension primers comprising the primers shown in Table 4.

Table 4 Primer Name Concentration SEQ ID NO The primer sequence in the direction from the 5'-end to 3'-end V _h 40 nM each 41

42

43

44

45

46

47

48

C _H1-5 200 nM of one of these primers 49

fifty

51

52

53

V _l 20 nM each 54

55

56

57

58

59

C _Lк 200 nM 60

W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

However, it should be noted that for each mixture of multiple primers for chain extension by overlapping, only one of the primers for C _{H1-5 was used} , resulting in five different mixtures of multiple primers for chain extension by overlapping.

The remaining parameters were similar to those shown in example 2 for multiple RT-PCR with chain extension by overlapping with the exception of a change in hybridization temperature, which was equal to 50 ° C. The reaction was performed using each reverse primer for the constant region of the heavy chain (C _H1 , C _H2 , C _H3 , C _H4 , C _H5 , corresponding to SEQ ID NOS: 49-53) and lysates corresponding to 100, 10, 1 and 0 cells.

b. Semi-slot PCR

One microliter of the reaction product of the multiple RT-PCR reaction with chain extension by overlapping was subjected to a semi-nested PCR (Biotaq kit, Bioline, UK, catalog number BIO-21040) in accordance with the manufacturer's recommendations. The total volume of the reaction mixtures was 50 μl. The primers used are shown in table 5.

Table 5 Primer Name Concentration SEQ ID NO The primer sequence in the direction from the 5'-end to 3'-end J _h 200 nM each 61

62

63

64

C _Lк 200 nM 21

The sequences indicated in capital letters correspond to the genespecific region.

The reaction was carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C  25 cycles Hybridization 30 sec 50 ° C Chain extension 1.5 min 72 ° C Final chain extension 5 minutes 72 ° C

Ten microliters of each reaction mixture were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (Fig. 7).

The putative overlapping chain extension fragment obtained by performing a semi-nested PCR using a primer for C _H4 in the first reaction and corresponding to a single cell lysate (see arrow in Fig. 7) was excised from agarose gel, purified using Qiaex II kit (Qiagen Catalog No. 20051, Hilden, Germany) and introduced into pCR2.1-TOPO using the Invitrogen TOPO TA cloning kit (Invitrogen, Catalog No. 45-0641, Carlsbad, CA, USA). Inserts of eight clones were sequenced, and it was found that seven of these inserts consisted of the variable region of the heavy chain associated with the variable and constant region of the light chain in the proposed region of overlap.

It can be noted that the sensitivity of the combined reaction of multiple RT-PCR with chain extension by overlapping and half-nested PCR was very satisfactory, while 4 out of 5 constant region primers amplified significant amounts of chain extension products by overlapping from a lysate corresponding to a single cell.

Example 4. Combined reactions of one-step multiple RT-PCR with chain extension by overlapping and nested PCR using enriched human B-lymphocytes as a matrix source

In this example, reverse transcription and multiple PCR reactions with chain extension by overlapping, performed in a single stage, followed by amplification using semi-nested PCR using isolated individual human B lymphocytes as a matrix source, are considered.

but. B cell isolation

The male donor was immunized with tetanus toxin. 6 days after immunization, a blood sample of 120 ml was taken from the donor and peripheral blood mononuclear cells (PBMC) were isolated in a Lymphoprep device (Axis-Shield, Oslo, Norway, production No. 1001967) in accordance with the manufacturer's instructions. The population of CD19-positive cells was enriched by cell sorting using magnetic beads. PBMCs were stained with a FITC-conjugated anti-CD19-year-old antibody (Becton Dickinson, NJ, USA, catalog number 345776). Magnetic sorting of cells using magnetic microbeads conjugated to an anti-FITC antibody and purification in a column was performed in accordance with the manufacturers instructions (Miltenyi Biotec, Gladbach, Germany, catalog number 130-042-401). Cells were diluted to a concentration of 200 cells per 1 ml in PBS containing 2 nM EDTA and 0.5% BSA. Five microliters of diluted cells were distributed in PCR tubes containing approximately one cell in one tube. The tubes were stored until use at -80 ° C.

b. Multiple overlap extended RT-PCR and semi-nested PCR

The conditions for performing multiple overlapping extension RT-PCRs with overlapping strands and half-nested PCRs were similar to those described in Example 3. However, these reactions were performed only using a mixture of multiple overlapping extending primers comprising a primer for C _H3 corresponding to SEQ ID NO: 51. Sixteen samples obtained by performing the combined multiple extension RT-PCR chain extension reactions by overlapping and half-nested PCR were analyzed by electrophoresis on a 1% agarose gel using 10 μl of the reaction product of each semi-nested PCR and detecting ethidium bromide (Fig. 8).

As shown in FIG. 8, 2 of the 16 bands (bands 5 and 6) contained fragments with the expected mobility (approximately 1 kb). In addition, lane 2 contained a less intense fragment with the expected mobility. Fragments of 1 kbp present in bands 5 and 6 were excised from agarose gel, purified using a Qiaex II kit (Qiagen, Catalog No. 20051) and introduced into pCR2.1-TOPO using the TOPO cloning kit Invitrogen TA (Invitrogen, Catalog No. 45-0641 Carlsbad, CA, USA). Two clones from each selected fragment had inserts of the correct size. As a result of restriction enzyme hydrolysis (separately NcoI and NheI), fragments of the expected sizes (410 and 680 bp) were detected, which indicates the correct binding of sequences encoding the variable region of the heavy chain and the variable and constant regions of the light chain.

Two clones obtained from the fragment present in lane 5 were sequenced, revealing their identity, indicating that the bound V _H and LC were related pairs.

Example 5. Combined reactions of one-stage multiple RT-PCR with chain extension by overlapping and nested PCR using V _λ -specific primers

In this example, the reactions of reverse transcription and multiple PCR with extension of the chain, performed in a single stage, using V _λ- specific primers with the subsequent implementation of semi-nested PCR. As matrices, total RNA isolated from two different cell lines expressing the lambda chain gene families 1b and 1e in combination with the same variable region of the heavy chain was used.

but. Cells

Two Chinese Hamster Ovary (CHO) cell lines expressing the IgG1 lambda chain were obtained by Flp-In (Invitrogen, Carlsbad, CA, USA).

The vectors pEm465 / 01P581 and pEm465 / 01P582 expressing the mammalian IgG1 lambda chain (Fig. 9A) and representing two families of IgG lambda chain genes were created based on the pcDNA5 / FRT expression vector obtained by Flp-In. CHO-Flp-In cells were cotransfected with the above plasmids containing the antibody and pOG44 genes, causing the temporary expression of Flp recombinase using fugen 6 (Roche, Mannheim, Germany), in accordance with the manufacturer's instructions. Then made the selection of transformants in relation to the inserts. Selected cell lines, called CHO Flp-In / Em464 / 01P581 and CHO Flp-In / Em464 / 01P582, were placed in Ham F-12 medium containing 2 mM L-glutamine, 10% FCS and 900 μg / ml hygromycin B ( supporting environment).

Cell lines were harvested using trypsin and washed three times in a support medium. About 10 ⁷ cells were used to purify total RNA using the Nucleo Spin L kit (Macherey-Nagel, Duren, Germany) in accordance with the manufacturer's instructions. Final RNA concentrations were determined by optical density measurement methods OD ₂₆₀ .

b. Single-Stage Multiple Overlap RT-PCR with Overlap

Multiple overlapping extension RT-PCRs were performed as in Example 3, using 50 pg, 5 pg, or 0.5 pg of total RNA as template and a mixture of multiple overlapping extension primers containing the primers shown in Table 6 in the indicated lower cyclization conditions.

Reverse transcription 30 minutes 55 ° C Polymerase activation 15 minutes 95 ° C reverse transcriptase inactivation and Taq polymerase activation

PCR reaction:

Denaturation 30 sec 95 ° C 35 cycles Hybridization 30 sec 50 ° C Chain extension 5 minutes 72 ° C Final chain extension 10 min 72 ° C

Table 6 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end V _h 40 nM each one

2

3

four

5

6

7

8

C _h 100 nM 9

V _λ 100 nM each 65

66

67

68

69

70

71

72

73

74

75

C _λ2 / _Cλ7 100 nM 76

77

Y = C / T, W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

from. Semi-slot PCR

One microliter of the product of the reaction of the multiple RT-PCR chain extension by overlapping was subjected to a semi-nested PCR (set Biotaq, Bioline, UK, catalog number BIO-21040) in accordance with the manufacturer's instructions. The total volumes of the reaction mixtures were 20 μl. The primers used are shown in table 7.

Table 7 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end J _h 200 nM each 61

62

63

64

C _lλ 200 nM 78

79

The sequences indicated in capital letters correspond to the genespecific region.

The reaction was carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C  25 cycles Hybridization 30 sec 50 ° C Chain extension 1.5 min 72 ° C Final chain extension 5 minutes 72 ° C

Ten microliters of the nested PCR reaction products were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (Figs. 9B and 9C). The arrows show the products of chain extension by overlapping with the expected migration properties of approximately 1 kb in length.

This experiment shows that the multiple primer mixture for lambda chain extension by overlapping, shown in Table 6, can be used in a single-stage multiple RT-PCR with chain extension by overlapping, regardless of the template used. In addition, specific overlapping extension PCR reaction products were obtained using 0.5 pg of total RNA. The detected sensitivity suggests that related related sequences encoding the variable region of the heavy chain and the variable region of the light chain can be amplified from a single cell.

Example 6. Creating a sub-library of related pairs of sequences encoding anti-tetanus antibody

The present example describes the steps depicted in the flowchart of FIG. 10 using tetanus toxin (TT) as the target antigen.

but. Donors

Donors previously immunized with the tetanus vaccine were boosted with the tetanus vaccine (Statens Serum Institut, Denmark). Six days after booster immunization with an anti-tetanus vaccine, a blood sample of approximately 200 ml was taken from a donor and introduced into an anticoagulant tube.

Donors should be healthy and not have dormant or chronic infections. They should not suffer from autoimmune diseases or take any immunosuppressive drugs and should not be subjected to any vaccinations in the last 3 months. In addition, donors should not have any serious infections during the last month during booster immunization with the TT vaccine.

b. Getting peripheral blood mononuclear cells (PBMC)

PBMCs were isolated from blood samples using a Lymphoprep device (Axis-Shield PoC AS, Norway, production No. 1001967) in accordance with the recommendations of the manufacturers. Blood was diluted in a 1: 1 ratio in PBS and the resulting suspension was introduced into Lymphoprep in a 2: 1 ratio. The tubes are centrifuged with an acceleration of 800 g for 20 minutes at 25 ° C and a strip corresponding to the lymphocyte interphase is collected. Cells were washed in PBS containing 2 mM EDTA.

from. B cell enrichment

The B cell line (CD19 + cells) in the PBMC is enriched by magnetic bead sorting of cells as described below.

The isolated PBMCs are stained with anti-CD19-FITC (fluorescein isothiocyanate) (Becton Dickenson, NJ, USA, catalog number 345776). All stages are performed in a dark room at 4 ° C. Staining is performed with 10 μl of anti-CD19-FITC per 1x10 ⁶ cells in a volume equal to 100 μl per 1x10 ⁶ cells using M-buffer (PBS, pH 7.2, 0.5% BSA, 2 mm EDTA). Under the above conditions, staining of the PBMC B-cell line occurs. Cells are incubated for 20 minutes and then washed twice with M-buffer. Cells stained with anti-CD19-FITC are magnetically labeled with microbeads conjugated to an anti-FITC antibody using 10 μl of magnetic beads sensitized with anti-FITC antibody (Miltenyi Biotec, Gladbach, Germany, Cat. No. 130-042 -401), per 1x10 ⁶ cells in a volume equal to 100 μl of M-buffer per 1x10 ⁶ cells. Cells are incubated for 15 minutes and then washed once with M-buffer. Cells are resuspended in a degassed M-buffer.

The MACS LS column (Miltenyi Biotec, Gladbach, Germany, catalog number 130-042-401) is pretreated with a degassed M-buffer in accordance with the manufacturers instructions. A suspension of cells stained with anti-CD19-FITC and labeled with magnetic beads sensitized with anti-FITC antibody is introduced into the column with the possibility of passing through it. Stained and labeled cells (CD19 +) remain in the magnetic field surrounding the column, while unpainted cells (CD19-) pass through the column. The column is washed with degassed M-ufer. The magnetic field is turned off and CD19 + cells are collected.

d. Plasma cell sorting

The eluate from the MACS column is centrifuged and resuspended in FACS buffer (PBS, pH 7.2, 2% BSA) at a concentration of 1x10 ⁶ cells / 60 μl of FACS buffer. Add anti-CD19-FITC (Becton Dickenson, NJ, USA, 345776 No.) (10 μl / 10 ⁶ cells), anti-CD38-PE (Becton Dickenson, NJ, USA, 555460 No.) (10 μl / 10 ⁶ cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, catalog number 345809) (20 μl / 10 ⁶ cells). Cells were incubated in a dark room at 4 ° C for 20 minutes, then washed twice and resuspended in FACS buffer.

Cells are sorted by Fluorescence Excited Cell Sort (FACS) using the following sorting options:

1. Direct and lateral scattering to preserve lymphocytes and monocytes, including plasma blasts and plasma cells, and the removal of dead cells and cells with very high lateral scattering, which may be aggregates or granulocytes.

2. Cells that are CD19-positive and express elevated levels of CD38 (CD38 ^hi ). Similarly, mainly CD38 cells are captured, since PBMCs were enriched in the MACS column of CD19 cells, but this method allows any contamination to be detected.

3. CD45-positive cells. All lymphocytes express CD45. However, plasma cells are characterized by lower expression of CD45 compared to the earlier stages of lymphocyte differentiation. Therefore, by capturing CD45, a discrete cell population corresponding to plasma cells can be obtained.

Cells sorted by FACS are collected as single cells and immediately placed in separate wells of 96-well plates containing 5 μl of PBS buffer with 5 units. RNase inhibitor (RNasin, Promega, Madison USA, catalog number N2515) in one well. At this stage, the cells can be frozen for subsequent RT-PCR or immediately used for RT-PCR.

e. Linking related pairs of sequences encoding the variable regions of immunoglobulin

The overlap extension RT-PCR method with overlapping chain is applicable to individual cells, providing for the related binding of transcribed sequences encoding the variable region of the heavy chain and the variable region of the light chain of an anti-tetanus toxin antibody.

e-1. Single-Stage Multiple Overlap RT-PCR with Overlap

Qiagen's one-stage RT-PCR kit (Qiagen, 210212, Hilden, Germany) is used to perform multiple RT-PCRs with chain extension by overlapping according to the manufacturer's recommendations. Frozen 96-well plates containing one cell in one well are removed from the refrigerator and, when there are no ice crystals left in the wells, 15 μl of RT-PCR reaction mixture is immediately added to each sample (single cell).

The reaction mixture for RT-PCR contains in a total volume equal to 20 μl, the following reagents:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 400 μM of each reagent,

a mixture of multiple primers for lengthening the chain by overlapping at the concentrations indicated in table 8,

0.8 μl of enzyme mixture for one-step RT-PCR,

20 units an RNase inhibitor (RNasin, Promega, Madison, USA, catalog number N2515).

The composition of the mixture of multiple primers to extend the chain by overlapping is shown in table 8.

Table 8 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end V _h 40 nM each 41

42

43

44

45

46

47

48

C _{H (IgG)} 200nM 9

V _l 40 nM each 54

55

56

57

58

59

C _Lк 200 nM 60

W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

The reaction is carried out under the following cyclization conditions:

Reverse transcription 30 minutes 55 ° C Polymerase activation 15 minutes 95 ° C reverse transcriptase inactivation and Taq polymerase activation

PCR reaction:

Denaturation 30 sec 94 ° C  35 cycles Hybridization 30 sec 52 ° C Chain extension 5 minutes 72 ° C Final chain extension 10 min 72 ° C

e-2. Additional amplification

One microliter of the reaction product of the multiple RT-PCR chain extension by overlapping from each sample is subjected to a semi-nested PCR (Biotaq kit, Bioline, UK, BIO-1040 No.) according to the kit manufacturer's recommendations using 96-well plates. Each reaction mixture has a total volume of 50 μl and contains a single Buiotaq buffer, 200 μM dNTP (each reagent), 2 mm MgCl ₂ , 1.25 units. Bio Taq polymerase at final concentration and primers are shown in table 9.

The reaction is carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C  30 cycles Hybridization 30 sec 55 ° C Chain extension 1.5 min 72 ° C Final chain extension 5 minutes 72 ° C

Table 9 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end J _h 200 nM each 61

62

63

64

C _Lк 200 nM 21

The sequences indicated in capital letters correspond to the genespecific region.

Ten microliters of a limited series of samples were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for visualization to verify the success of multiple RT-PCR with chain extension by overlapping.

The expected size of the fragments (the exact size depends on the length of the variable regions):

V _H : ~ 410 bp

LC: ~ 680 bp

Fragment of chain elongation by overlapping: ~ 1070 bp

Two microlitres of all samples obtained from one donor, which were cultured on 96-well plates, are combined in one tube. Collected samples hydrolyze XhoI and NotI. Hydrolyzed chain extension fragments by overlapping are purified by preparative electrophoresis on a 1% agarose gel; chain elongation fragments are cut out from the agarose gel and purified using a Qiaex II kit (Qiagen, Catalog No. 20051, Hilden, Germany). At this stage, you do not need to combine related pairs if this is not required. In this case, each individual reaction mixture is digested with restriction enzymes and the resulting products are cloned separately in the vector described below.

f. Library of expressed related Fab fragments

A library of expression vectors for Fab fragments is created by introducing a pool of chain extension fragments by overlapping, XhoI / NotI hydrolyzed, into the E. coli JSK301 vector (FIG. 11) by ligation. E. coli (TOP 10) is transformed by electroporation with a library of expression vectors of Fab fragments and transformants are selected on 2xYT agar containing 100 μg / ml carbenicillin. Plasmid DNA is obtained from colonies immediately after removal from agar plates. To preserve diversity, the plasmid preparation is obtained from the minimum number of colonies of one donor, corresponding to three times the total number of initially sorted individual plasma cells. A library of expressed related Fab fragments is created by introducing a prokaryotic promoter cluster and leader sequence isolated from phh3 (Den, W. et al. 1999, J. Immunol. Methods 222, 45-57) into the resulting plasmid preparation by AscI and NheI hydrolysis and subsequent ligation. The library creation process is shown in FIG. E. coli (TG1) was transformed by electroporation with a library of expressed related Fab fragments and transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Donors do not contact during the execution of the procedures described in Den et al., J. Immunol. Methods, 1999, Jan. one; 222 (1-2): 45-57. However, if desired, they can be together at any stage.

g. Clone Screening

Fab-expressing clones were examined for binding of TT antigen by antigen-specific ELISA.

g-1. Creation of base plates and expression of Fab fragments

Selected TG1 cell colonies, each of which contains an expression vector of related Fab fragments from the library created in step (f), are placed in separate wells of 96-well plates containing 2xYT / 100 μg / ml Amp / 1% glucose. Colonies are grown by shaking gently overnight at 37 ° C. These tablets, referred to as base plates, are stored at -80 ° C after glycerol is added to a final concentration of 15%.

Prior to transferring the base plates for storage, they are used to inoculate one or more 384-well plates containing 2xYT / 100 μg / ml Amp / 0.1% glucose using a 96-channel replicator. The tablets are sealed and shaken for 2-3 hours at 37 ° C.

Expression of Fab fragments was induced by adding an equal amount of 2xYT / 100 μg / ml Amp / 0.2 mM IPTG to achieve a final IPTG concentration of 0.1 mM. The plates are sealed and shaken overnight at 30 ° C. The next day, Fab-containing supernatants were analyzed for binding specificity for TT antigen by ELISA.

g-2. ELISA analysis

384-well ELISA plates (Nunc, Roskilde, Denmark, 265196 No.) are sensitized overnight at 4 ° C. with tetanus toxin (TT) antigen diluted to a final concentration of 0.1 μg / ml in PBS in a volume of 25 μl per well. Excess binding sites in the wells are blocked for 1 hour at room temperature by adding 2% M-PBS-T (2% skimmed milk powder in PBS, 0.05% Tween-20). Wells are washed twice with PBS-T (PBS, 0.05% Tween-20).

Fab-containing bacterial supernatants obtained in g-1 are diluted 1: 2 in 2% M-PBS-T and transferred in duplicate to the wells of an ELISA plate. The culture is incubated for 1 hour at room temperature. Wells are washed four times with PBS-T. Goat antibody is added to the wells to the human Fab / HRP complex (Sigma, St. Louis, MO, USA, Catalog No. A0293), diluted 1: 10000 in 2% M-PBS-T. The culture is incubated for 1 hour at room temperature. Wells are washed four times with PBS-T. Add TMB Plus substrate (KemEnTec, Copenhagen, Denmark, catalog number 4390L) and incubate for 5-15 minutes. The reaction is stopped by adding an equal volume of a 1M solution of H ₂ SO ₄ . The degree of reaction is determined in a spectrophotometer for reading ELISA plates at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA).

Then, original bacterial clones corresponding to the TT antigen binding clones are removed from the base plates. Plasmid DNA is obtained from the isolated antigen-positive clones of Fab fragments and a sub-library of expressed related Fab fragments of clones that bind TT antigen is created.

These clones can also be subjected to ELISA using antibodies against light chains to establish a correlation between the number of antigen-binding clones and the number of Fab-expressing clones. In addition, such an analysis provides information on the light kappa and lambda chains in these clones.

h. Expressed Related Antibody Library

To facilitate the expression of unprocessed human antibodies, related variable regions from the bacterial expression vector of Fab fragments should be transferred to a mammalian expression vector containing constant regions of a human immunoglobulin of one of the isotypes. Such transfer can be accomplished by sequential or mass transfer of clones. The mass transfer method is described below.

Mass transfer is performed in two stages. First, plasmid preparations of separately isolated antigen binding clones of Fab fragments are collected. The cluster containing the prokaryotic promoter and leader sequence is replaced by a mammalian promoter and leader sequence cluster consisting of a human alkaline phosphatase leader sequence (AP leader sequence), a human 1-alpha elongation factor (EFP) promoter, an adenovirus late late promoter (AdMLP), a leader IgK sequences by hydrolysis of a sub-library of assembled expressed Fab fragments using AscI and NheI followed by the introduction of a promoter cluster and leader sequence ligation of a mammal. E. coli (TOP 10) was transformed by electroporation with the resulting library of expressed Fab fragments with a replaced promoter and transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Plasmid DNA is obtained from colonies immediately after removal from agar plates. To preserve diversity, the plasmid preparation is obtained from the minimum number of colonies of one donor, corresponding to approximately three times the total number of clones in the source library.

Then, carrying out the hydrolysis of the plasmid preparation using XhoI and NotI, related variable sequences are isolated from the expression vector of Fab fragments with a replaced promoter. The isolated fragment is introduced by ligation into the mammalian expression vector, thereby obtaining a library of expressed related antibodies. The vector used is similar to that shown in FIG. 9A, except that the IgL in this case corresponds to the sequence encoding the kappa light chain. The above mammalian expression vector was obtained based on the site-specific Flp-In system (Invitrogen Corporation, Carlsbad, CA, USA, catalog number K6010-01). E. coli (TOP10) was transformed by electroporation with the resulting library of expressed related antibodies and transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Plasmid DNA is obtained from colonies immediately after removal from agar plates. To preserve diversity, the plasmid preparation is again obtained from the minimum number of colonies of one donor, corresponding to approximately three times the total number of clones in the source library. The obtained plasmid preparation from the library of expressed related antibodies can be used to transfect a mammalian host cell, for example, CHO cells from the Invitrogen Flp-In system (Invitrogen Corporation, Carlsbad, CA, USA, catalog number K6010-01), in order to create resistant expressing mammalian cell lines by integration mediated by Flp recombinase. Such a cell line can be used to produce recombinant polyclonal antibodies.

Example 7. Screening using high density membrane analysis

The Fab-expressing clones of Example 6f were examined by high density membrane analysis.

but. Creating basic tablets

Base plates are made as described in step (g-1) of Example 6.

b. Obtaining PVDF membranes

PVDF (polyvinylidene fluoride) membranes (Amersham, Uppsala, Sweden, catalog number RPN2020F) were sensitized with TT antigen diluted to a final concentration of 1 μg / ml in PBS overnight at 4 ° C according to the manufacturer's instructions. Excess membrane binding sites are blocked for 1 hour in 2% M-PBS (2% skimmed milk powder in PBS). Membranes are washed three times in PBS. Membranes are soaked in 2xYT for several minutes.

from. Clone Consolidation

Clone consolidation on 384-well plates is accomplished by transferring the clones from the base plates to one or more 384-well plates containing 20 μl of 2xYT / well using a 96-channel replicator.

Using a 384-channel replicator, bacteria are transferred in duplicate onto one or more nylon membranes (Amersham, Uppsala, Sweden, RPN2020B catalog number) located on agar plates containing 2xYT / Carb / 1% glucose. The plates are incubated for 4-6 hours at 37 ° C.

d. Induction of expression of Fab fragments

PVDF membranes obtained in step b are placed on agar plates containing 2xYT / Carb / 0.1 mM IPTG. Nylon membranes with growing bacterial colonies are placed on top of the PVDF membranes (one nylon membrane per PVDF membrane) on an IPTG-containing agar plate. The IPTG-containing agar plate was incubated at 30 ° C. overnight to facilitate IPTG-induced expression of Fab fragments from the colonies. Molecules of Fab fragments penetrate through the nylon membrane onto the PVDF membrane, which retains Fab fragments that bind the TT antigen.

e. Detection

The nylon membranes are removed and the PVDF membranes are washed with PBS-T (PBS, 0.05% Tween-20) 2 times for 5 minutes. Membranes are incubated for 30 minutes with 2% M-PBS. PVDF membranes were washed with PBS-T 2 times for 5 minutes and incubated for 1 hour with goat antibody to human IgG / HRP complex (Sigma, St. Louis, MO, USA, Catalog No. A0293) when diluted in 2% M-PBS in the ratio of 1: 10000. PVDF membranes were washed with PBS-T 3 times for 5 minutes. Finally, PVDF membranes are incubated for 5 minutes with a SuperSignal West Femto chemiluminescent substrate (Pierce, Rockford, Il, USA, catalog number 34095) according to the manufacturers instructions. Excess substrate is removed and PVDF membranes are placed under a charge-coupled device (CCD) video camera to detect the chemiluminescent signal arising at those positions of the PVDF membrane where the Fab fragment binds the TT antigen.

Positive clones that bind the TT antigen appear in the image as dots. The original bacterial clone is then removed from the base plates. Plasmid DNA is obtained from the isolated antigen-positive clones of Fab fragments, thus creating a sub-library of expressed related Fab fragments of clones that bind TT antigen.

f. Correlation between antigen-binding clones and Fab-expressing clones

The nylon membranes removed in step e. Are placed on a second series of PVDF membranes sensitized with an anti-light chain antibody or anti-Fab antibody, according to the method described in step b. Then repeat stage d. and e.

Fab-positive clones appear as dots on the image, and a correlation can be established between the number of clones that bind the TT antigen and the number of Fab-expressing clones.

Example 8. An example illustrating the selection of sequences encoding a heteromeric protein

This example illustrates the possibility of a one-step isolation of a trimeric guanine nucleotide binding protein (G protein) using multiple chain extension RT-PCR by overlapping of the present invention. The family of G protein subunits is extensive, only in humans there are approximately 16 different alpha subunits, 5 beta subunits and 12 gamma subunits. For the present example, the GαS subunit (access number in the GenBank gene bank X04408), the Gβ1 subunit (access number in the GenBank gene bank AF501822) and the Gγ1 subunit (access number in the GenBank gene bank BC029367) were selected. The binding method is shown in FIG. 13, where stage 1 is the stage of multiple RT-PCR with chain extension by overlapping and stage 2 is the stage of additional amplification of the bound product.

but. Cells

A population of human liver cells is obtained from samples destroyed after performing surgical operations. Liver cells are destroyed and lysed, total RNA is isolated from the lysate using the RNA L kit (Macherey - Nagel, Duren, Germany, catalog number 740962.20) in accordance with the manufacturers instructions.

b. Multiple overlap extended RT-PCR

To perform multiple overlap extended RT-PCR with overlapping chain, use the Qiagen one-step RT-PCR kit (Qiagen, 210212, Hilden, Germany) according to the manufacturer's recommendations.

Each PCR tube contains, in a total volume of 50 μl, the following reagents:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 400 μM of each reagent,

a mixture of multiple primers to extend the chain by overlapping at the concentrations indicated in table 10,

2 μl enzyme mixture for one-step RT-PCR,

1 unit / μl of an RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2515),

50 ng of total RNA.

The used mixture of multiple primers to extend the chain by overlapping contains the primers shown in table 10.

Table 10 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end α1 400 nM 80

α2 80 nM 81

β1 80 nM 82

β2 80 nM 83

γ1 80 nM 84

γ2 400 nM 85

The sequences indicated in capital letters correspond to the genespecific region.

The reaction is carried out under the following cyclization conditions:

Reverse transcription 30 minutes 42 ° C Polymerase activation 15 minutes 95 ° C reverse transcriptase inactivation and Taq polymerase activation

PCR reaction:

Denaturation 30 sec 94 ° C  45 cycles Hybridization 30 sec 49 ° C Chain extension 3 min 72 ° C Final chain extension 10 min 72 ° C

from. PCR amplification

One microliter of the product of the reaction of multiple RT-PCR chain extension by overlapping is subjected to additional amplification by PCR method (set Biotaq, Bioline, UK, catalog number BIO-21040) in accordance with the manufacturer's recommendations. Use primers α1 and γ2 shown in table 10, which correspond to SEQ ID NO: 80 and 85. The total volume of the reaction mixture is 50 μl.

The reaction is carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C  25 cycles Hybridization 30 sec 53 ° C Chain extension 3 min 72 ° C Final chain extension 10 min 72 ° C

Five microliters of the reaction product was analyzed by electrophoresis on a 1% agarose gel using ethidium bromide for detection. The expected size of the product is 2215 bp However, additional unbound fragments of these subunits may be present. The expected sizes of these fragments are equal: Gα - 1228 bp, Gβ - 1064 bp and Gγ - 262 bp

d. Cloning

The remaining reaction product is subjected to electrophoresis on a 1% agarose gel, using ethidium bromide to detect a chain extension fragment by overlapping 2215 bp in length. excised from the agarose gel, purified using a Qiaex II kit (Qiagen, Hilden, Germany, catalog No. 20051) and introduced into pCR2.1-TOPO using Invitrogen TOPO TA cloning kit (Invitrogen, catalog number 45-0641, Carlsbad, CA, USA).

In addition, promoter sequences or ribosome binding sites can be inserted at the top of the sequence encoding each subunit to facilitate their expression from the vector. For such an insertion, restriction sites present in the sequences for chain extension by overlapping can be used.

e. General considerations

The above linking of sequences encoding subunits forming a heteromeric protein can be performed for most heteromeric proteins in which the sequence of individual subunits is known. In addition, when using a mixture of multiple primers to extend the chain by overlapping, capable of amplifying several members of a particular family, for example, all the α, β, and γ subunits of the G protein, any combination of subunits from any cell can be identified and linked without prior analysis, which allows to determine what type of cells express which family members. For example, the method of the above example can be performed using a matrix obtained from isolated individual liver cells using a mixture of multiple primers to extend the chain by overlapping, able to amplify and bind all 16 Gα subunits to 5 Gβ subunits and 12 Gγ subunits, so that determine which combination of subunits is expressed in each cell, and simultaneously isolate the coding sequences that define this combination of subunits. In addition, degenerate primers can even serve to identify new members of a particular family.

When linking subunits of a heteromeric protein using multiple RT-PCR with chain extension by overlapping of the present invention, it is necessary to take into account the total size of the bound product, since there are limits to the number of base pairs amplified by DNA polymerase. New Vent Biolabs, MA, USA, Deep Vent Polymerase, is a single DNA polymerase capable of forming very long primer extensions containing up to 14,000 bp. Theoretically, 14,000 bp can encode a protein with an average weight of 510 kDa. Thus, by the method of the present invention, coding sequences for very large heteromeric proteins can be isolated. Chain elongation can be further increased by using a mixture of DNA polymerases.

Example 9. Creating primers for leader sequences

In this example, the creation of a multiple set of primers in which the initiation site is in the sequence encoding the leader region of the heavy chain and light kappa chains of a human antibody is considered.

When using primers hybridizing with the N-terminal coding sequences of the variable region family, some degree of cross hybridization may be observed. Primers for the sequence of one particular gene family can hybridize with cDNA of another gene family, which in many cases causes the formation of new sequences. Proteins formed from such sequences are potentially immunogenic when used for therapeutic purposes. These new sequences can usually be corrected using PCR or removed from the library.

An alternative solution is to introduce the initiation site into a sequence encoding a leader peptide of an antibody variable region. Hybrid sequences resulting from cross-hybridization will be removed during intracellular processing of the antibody, as a result of which the leader peptide containing potential immunogenic sequences will be cleaved and therefore will not be present in the secreted antibody. Known leader peptide primer kits for antibody cloning were located at the 5 ′ end of the leader peptide coding sequence, allowing direct expression by a eukaryotic cell (Campbell M.J. et al. 1992, Mol. Immunol. 29, 193-203). Unfortunately, leader peptides of a eukaryotic cell are poorly suited for processing in a prokaryotic cell.

The ease of manipulation of nucleic acid sequences in bacteria makes it attractive to create cloning systems in which sequence transfer between bacterial vectors and vectors is possible for other host organisms. Therefore, in the present example, a multiple set of primers was created in which the initiation site is in the position of the sequence encoding the region of the leader peptide, which makes possible the functional expression of antibodies or antibody fragments in both eukaryotic and prokaryotic expression systems.

The requirements for cleavage of sequences by signal peptidase in the C-terminal region of any leader peptide appear to be very similar for prokaryotic and eukaryotic systems (Nielsen H et al., 1997, Protein Eng. 10, 1-6). In addition, it follows from the foregoing that mutations in the C-terminal region of the leader peptide are likely to have little effect on the conformation of the N-terminal region and vice versa. Thus, it can be expected that C-terminal sequences can be transferred from one species to another without loss of functional activity.

The main principle of creating primers in this example was the placement of the initiation site in the last six codons of the C-terminal region of the leader peptide. The remainder of the leader peptide coding sequence upstream of the initiation site (approximately 50 nucleotides) should be introduced with an acceptable expression vector corresponding to the host species. For example, vectors suitable for expression in gram-negative bacteria can be created using a processed or unprocessed PelB leader sequence. For expression of antibodies in eukaryotes, a vector with a processed sequence encoding a leader peptide of a heavy chain of a native antibody and a processed sequence encoding a leader peptide of a kappa chain variable region is suitable. Regardless of the expression system, the last six amino acids of the leader peptide are formed from the sequence encoding the leader peptide of the endogenous antibody, which is located in the nucleic acid segment inserted into the vector.

The following primers have been developed for use in multiple RT-PCR with chain extension by overlapping (table 11). However, the end segments of the chain extension by overlapping (lowercase letters) can be easily changed for use in binding by ligation or recombination.

Table 11 Primer Name SEQ ID NO Primer sequence in direction from 5'-end to 3'-end V _hl 86

87

88

89

90

91

92

C _{H (IgG)} 9

V _LKL 93

94

95

96

97

98

C _Lк 99

M = A / T, R = A / G, Y = C / T, S = G / C. The sequences indicated in capital letters correspond to the genespecific region.

It should be noted that the restriction sites in this conformation of the primers were slightly modified in comparison with the primers described in the previous examples. Thus, the overlapping sequence located between the sequences encoding the variable regions of the heavy and light chains contains the NotI and NheI restriction site, and in the seed for the constant region of the kappa chain (C _Lc ), the previously existing NotI site was replaced by the AscI site. The last modification must be made when creating primers for additional amplification by PCR. In addition, the NotI site in the cloning vector shown in FIG. 11 should be replaced by the AscI site, and the AscI site in the promoter should be replaced by the NotI site.

Functional properties related to cleavage of the leader peptide were tested in silico using the SignalP software provided by CBS of the Danish Technical University.

Chimeric leader peptides tested for the presence of the variable region of the heavy chain were encoded by nucleic acid sequences consisting of a processed PelB sequence, NotI C-terminal site (SEQ ID NO 100: ATG AAA TAT CTT CTA CCA ACA GCG GCA GCT GGA TTA TTG GCG GCC GCC), and are associated with the NotI site of the gene-specific part of one of SEQ ID NOS 86-92, encoding six C-terminal amino acids from native members of the V _HL family. Using the SignalP program, it was found that all seven sequences are characterized by cleavage of the signal peptide in gram-negative bacteria.

Chimeric leader peptides tested for the presence of a variable region of the light chain were encoded by nucleic acid sequences consisting of a processed PelB sequence, NheI C-terminal site (SEQ ID NO 101: ATG AAA TAT TTG CTA CCA ACA GCG GCA GCT GGA TTA TTG TTA CTA GCG), and are associated with the NheI site of the gene-specific part of one of SEQ ID NOS 93-98, encoding six C-terminal amino acids from native members of the V _LkL family. Using the SignalP program, it was found that all six sequences are characterized by cleavage of the signal peptide in gram-negative bacteria.

The sequences of SEQ ID NO 100 and 101 are suitable for creating a bacterial expression vector similar to that shown in FIG. 11, since the AscI site shown in FIG. 11 is replaced by SEQ ID NO 100 and the NheI site is replaced by SEQ ID NO 101. In addition, the site The NotI shown in FIG. 11 should be replaced by an AscI site.

The mammalian expression vector (Fig. 9) can likewise be modified to be expressed in mammalian cells after transferring segments encoding the variable regions from the bacterial vector just described.

Example 10. Performing multiple RT-PCR and ligation binding in a single tube

The present example describes a method for producing a related pair, including linked sequences encoding the variable region of the heavy chain and the variable region of the light chain, in one tube when performing ligation binding instead of PCR with chain extension by overlapping.

but. Multiple RT-PCR

The cell line obtained in our own laboratory expressing molecules of Fab fragments with specificity for tetanus toxin was distributed by limited dilution to obtain one cell in one PCR tube.

In addition to one cell, each PCR tube contains the following reagents in a total volume of 20 μl:

one-time buffer Phusion HF,

dNTP at a final concentration of 200 μM of each reagent,

a mixture of multiple primers in the concentrations indicated in table 12,

0.8 units Phusion polymerase (FinnZymes, catalog number F-530-L),

1 μl Sensiscript reverse transcriptase (Qiagen, Catalog No. 205213),

20 units RNase inhibitor.

Table 12 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end Vh 200 nM each 102

103

104

105

106

107

108

109

Jh 200 nM each 61

62

63

64

Vl 200 nM each 110

111

112

113

114

115

C _Lк 200 nM 16

W = A / T, R = A / G, S = G / C. The sequences indicated in capital letters correspond to the genespecific region.

The reaction is carried out under the following cyclization conditions:

Reverse transcription 30 minutes 37 ° C Denaturation 30 sec 98 ° C  40 cycles Denaturation 10 sec 98 ° C Hybridization 30 sec 55 ° C Chain extension 30 sec 72 ° C Final chain extension 5 minutes 72 ° C

b. Ligation binding

To perform ligation binding, restriction enzymes and a ligase are added directly to the products of the multiple RT-PCR reaction. Alternatively, the multiple RT-PCR reaction product may be purified prior to the above addition to maximize the release of the mixture from polymerase.

The following reagents are added to each tube in a total volume of 40 μl:

NEBII single buffer

1 mm ATR

50 units XbaI (New England Biolabs, Catalog No. R0145L),

25 units SpeI (New England Biolabs, Cat. No. R0133S),

100 μg / ml BSA,

400 units T4 DNA Ligases (New England Biolabs, Catalog No. M0202S).

The reaction mixture was incubated at 16 ° C. overnight.

The linked sequences encoding the variable regions of the heavy and light chains are purified from the reaction mixture by gel electrophoresis and a strip of about 1000 bp is cut out.

In an alternative embodiment of this method, multiple RT-PCRs are performed using a primer for C _H instead of primers for J _H in a multiple set of primers. The specified primer may have a cloning end segment, which makes it possible to introduce in the reading frame the variable region of the heavy chain into the expression vector, or semi-nested PCR can be performed using the primers shown in table 5.

Example 11. The creation of recombinant polyclonal immunoglobulin with specificity for tetanus toxin

In this example, the results of immunization of a single donor (TT03) with tetanus toxin (TT) are described with a description of the stages shown in the flowchart shown in FIG.

but. Donors

Eight donors previously immunized with the tetanus vaccine were boosted with the tetanus vaccine (Statens Serum Institut, Denmark). Donors were assigned numbers TT01 - TT08. Six days after booster immunization with an anti-tetanus vaccine, a blood sample of approximately 200 ml was taken from a donor and introduced into an anticoagulant tube.

The donors were healthy, had no chronic infections and autoimmune diseases, did not take immunosuppressive drugs, and did not receive any vaccinations in the last 3 months.

a-1. Quality control of blood samples obtained from donors

Preliminary blood samples were taken from donors during immunization. Fourteen days later, additional blood samples were taken from donors to determine serum titer. All donors showed an increase in titer of tetanus toxin (TT). In addition, an ELISPOT assay was performed to measure the incidence of TT-specific plasma cells. For ELISPOT analysis, different cell fractions can be used, for example, whole blood obtained on day 6, a PBMC fraction, a fraction obtained by magnetic sorting, or a fraction obtained by FACS sorting. ELISPOT analysis can be used to evaluate donor material and identify the best responder cells, which can then be used in the sorting step and multiple RT-PCR with chain extension by overlapping. An ELISPOT assay was performed for a TT03 donor using a CD19 + cell fraction (see section c). An ELISPOT assay was performed as described in Lakew, M. et al., 1997, J. Immunol. Methods 203, 193-198, with minor changes. The frequency of TT-specific plasma cells in the PBMC fraction was calculated to be 0.021%.

b. Getting peripheral blood mononuclear cells (PBMC)

PBMC cells were isolated from a blood sample in a Lymphoprep device (Axis-Shield PoC AS, Norway, production No. 1001967) in accordance with the recommendations of the manufacturers. Blood was diluted in PBS at a ratio of 1: 1 and the resulting suspension was introduced into the Lymphoprep device at a ratio of 2: 1. The tubes were centrifuged with an acceleration of 800 g for 20 minutes at 25 ° C and a leukocyte interphase band was collected. Cells were washed in PBS containing 2 mM EDTA.

From 200 ml of whole blood taken from a TT03 donor, approximately 2 × 10 ⁸ PBMCs were obtained.

from. B cell enrichment

The B cell line (CD19 + cells) from PBMC was enriched by sorting the cells using magnetic beads in the following manner.

Isolated PBMC cells were stained with anti-CD19-FITC (Becton Dickenson, NJ, USA, catalog number 345776). All stages were performed in a dark room at 4 ° C. Staining was performed with 10 μl of anti-CD19-FITC per 1x10 ⁶ cells in a volume of 100 μl per 1x10 ⁶ cells using M-buffer (PBS, pH 7.2, 0.5% BSA, 2 mm EDTA). The specified dye stains the line of b-cells RVMS. Cells were incubated for 20 minutes and then washed twice with M-buffer. Cells stained with anti-CD19-FITC were magnetically labeled with microbeads conjugated to anti-FITC antibody using 10 μl of magnetic beads sensitized with anti-FITC antibody (Miltenyi Biotec, Gladbach, Germany, Cat. No. 130-042 -401), per 1x10 ⁶ cells in a volume of 100 μl of M-buffer per 1x10 ⁶ cells. Cells were incubated for 15 minutes and then washed once with M-buffer. Cells were resuspended in a degassed M-buffer.

The MACS LS column (Miltenyi Biotec, Gladbach, Germany, catalog number 130-042-401) was pretreated with a degassed M-buffer in accordance with the manufacturers instructions. A suspension of cells stained with anti-CD19-FITC and labeled with magnetic beads sensitized with anti-FITC antibody was introduced into the column with the possibility of passing through it. Stained and labeled cells (CD19 +) remained in the magnetic field surrounding the column, while unpainted cells (CD19 +) passed through the column. The column was washed with degassed M-buffer. The magnetic field was turned off and CD19 + cells were harvested.

Analytical staining of the starting material (PBMC), unlabeled fraction and CD19 of the labeled TT03 donor fraction was performed using anti-CD19-FITC, anti-CD38-PE and anti-CD45-PerCP (Fig. 14). The data obtained show that, as a result of magnetic sorting of the cells, two different fractions are formed in comparison with the PBMC fraction. CD19-negative cells shown in block B and CD19-positive cells shown in block C. The PBMC fraction contained 11% of CD19 + cells, and the degree of purification of CD19-positive cells was 99.5% R1 (scatter plot shown in FIG. .14C) for TT03.

As shown in FIG. 14C, an anti-CD38 / CD45 scatter plot revealed a single population of CD38hi, CD45in cells (R2) corresponding to 1.1% R1. This population contained plasma cells and was collected at a subsequent sorting stage. From the foregoing, it follows that in the PBMC fraction, 0.12% of the cells corresponded to plasma cells.

The fraction of CD19-positive cells was frozen in FCS (Invitrogen, catalog number 16000-044) containing 10% DMSO (Sigma, catalog number D2650), for subsequent sorting. An analysis similar to that shown in FIG. 14 was performed on cells purified in a MACS column that were frozen to ensure cell integrity (FIG. 15). The staining patterns shown in FIG. 15 were similar to those shown in FIG. 14C, although a slightly higher staining intensity was observed. Cells collected by sorting are a subpopulation of R1 and R2. This subpopulation corresponds to approximately 1.1% of the cells purified on a MACS column.

d. Plasma cell sorting

The frozen eluate obtained from the MACS column was thawed, centrifuged and resuspended in FACS buffer (PBS, pH 7.2, 2% BSA) at a concentration of 1x10 ⁶ cells / 60 μl FACS buffer. Anti-CD19-FITC (Becton Dickenson, NJ, USA, catalog number 345776) (10 μl / 10 ⁶ cells), anti-CD38-PE (Becton Dickenson, NJ, USA, catalog number 555460) (10 μl / 10 ⁶ cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, catalog number 345809) (20 μl / 10 ⁶ cells), the mixture was incubated in a dark room at 4 ° C for 20 minutes, then washed twice and resuspended in FACS buffer.

Cells were sorted by Fluorescence Excited Cell Sort (FACS) using the following sorting options:

1. Direct and lateral scattering to preserve lymphocytes and monocytes, including plasma blasts and plasma cells, and the removal of dead cells and cells with very high lateral scattering, which may be aggregates or granulocytes.

2. Cells that are CD19-positive and express elevated levels of CD38 (CD38hi). Similarly, mainly CD38 cells are captured, since PBMCs were enriched in the MACS column of CD19 cells, but this method allows any contamination to be detected.

3. CD45-intermediate positive cells. All lymphocytes express CD45. However, plasma cells are characterized by lower expression of CD45 compared to the earlier stages of lymphocyte differentiation. Therefore, by capturing CD45, a discrete cell population corresponding to plasma cells can be obtained.

FACS-sorted cells obtained from a TT03 donor were collected as a subpopulation obtained from two sorts P2 and P1 (FIGS. 16A and 16B). These cells were CD38hi (FL2-A), CD45in (FL3-A) and CD19 +, the latter cells being obtained by purification in a MACS column. Cells were harvested in total, counted and bred in RPMI (Invitrogen, catalog number 21875-034) containing 10% FCS (Invitrogen, catalog number 16000-044), 100 units / ml penicillin-streptomycin (Invitrogen, catalog number 15140-122), 2 mM L-Glutamine (catalog number 25030-024). Cells were then dispensed into fifty 96-well PCR plates (ABgene, AB-0800 catalog number) in the amount of one cell per well in 5 μl of medium. The plates were sealed, immediately frozen and stored for subsequent RT-PCR analysis.

e. Linking related pairs of sequences encoding the variable regions of immunoglobulin

Multiple overlapping extension RT-PCRs were performed on individual cells obtained from a TT03 donor, resulting in a kinship between the transcribed sequences encoding the variable region of the heavy chain and the variable region of the light chain of the anti-tetanus toxin antibody.

e-1. Single-Stage Multiple Overlap RT-PCR with Overlap

Qiagen's one-step RT-PCR kit (Qiagen, Catalog No. 210212, Hilden, Germany) was used to perform multiple RT-PCRs with chain extension by overlapping according to the manufacturer's recommendations. Fifty frozen 96-well PCR plates containing approximately one cell in one well were removed from the refrigerator and, when there were no ice crystals left in the wells, 15 μl of RT-PCR reaction mixture was immediately added to each well.

The reaction mixture for RT-PCR contained in a total volume of 20 μl of the following reagents:

single buffer for single-stage RT-PCR,

dNTP at a final concentration of 400 μM of each reagent,

a mixture of multiple primers to extend the chain by overlapping at the concentrations indicated in table 13,

0.8 μl of enzyme mixture for one-step RT-PCR,

20 units an RNase inhibitor (RNasin, Promega, Madison, USA, catalog number N2515).

The composition of the mixture of multiple primers to extend the chain by overlapping is shown in table 13.

Table 13 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end V _h 40 nM each 116

117

118

119

120

121

122

123

C _{H (IgG)} 200 nM 9

V _l 40 nM each 124

125

126

127

128

129

C _Lк 200 nM 130

W = A / T, S = G / C, R = A / G. The sequences indicated in capital letters correspond to the genespecific region.

The reaction was carried out under the following cyclization conditions:

Reverse transcription 30 minutes 55 ° C Polymerase activation 15 minutes 95 ° C reverse transcriptase inactivation and Taq polymerase activation

PCR reaction:

Denaturation 30 sec 94 ° C  35 cycles Hybridization 30 sec 52 ° C Chain extension 5 minutes 72 ° C Final chain extension 10 min 72 ° C

e-2. Additional amplification

One microliter of the product of the multiple extension RT-PCR chain extension reaction by overlapping from each sample was subjected to semi-nested PCR (Biotaq kit, Bioline, BIO-21040 catalog number) according to the manufacturer's recommendations, using 96-well PCR plates (ABgene, Nos. catalog AB-0800). Each reaction mixture, the volume of which was equal to 50 μl, contained a single Biotaq buffer, 200 μM dNTP (each reagent), 2 mm MgCl ₂ , 1.25 units. Bio Taq polymerase and primers are shown in table 14.

Table 14 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end J _h 200 nM each 61

62

63

64

C _Lк 200 nM 21

The sequences indicated in capital letters correspond to the genespecific region.

The reaction was carried out under the following cyclization conditions:

Denaturation 30 sec 95 ° C 30 cycles Hybridization 30 sec 55 ° C Chain extension 1.5 min 72 ° C Final chain extension 5 minutes 72 ° C

Ten microliters of samples from row A, wells 1-12 of each plate, were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide to visualize, in order to verify the success of the multiple RT-PCR chain extension by overlapping. The expected length of the chain elongation fragment by overlapping was approximately 1070 bp (the exact size depends on the length of the variable regions). 17 shows samples taken from eight 96-well plates. As a result of the successful completion of RT-PCR with chain extension by overlapping with fifty-96 well plates, an average of eight fragments were obtained from one plate. Thus, the total number of fragments resulting from the successful completion of RT-PCR with chain extension by overlapping was approximately 400.

Ten microliters of all reaction products on 96-well plates belonging to one donor were combined in one tube. An aliquot of 200 μl of the combined PCR products was purified using a QIAquick PCR product cleaning kit in accordance with the manufacturer's recommendations (Qiagen, Catalog No. 28106, Hilden, Germany) using 60 microliters of EB elution buffer. The purified pool of PCR reaction products with chain extension by overlapping was hydrolyzed by XhoI and NotI and then purified by preparative electrophoresis on a 1% agarose gel; overlapping chain elongation fragments were excised from the agarose gel and purified using a Qiaex II kit (Qiagen, Catalog No. 20051, Hilden, Germany).

f. Library of expressed related Fab fragments

The library of expressed Fab fragments was created by two-stage ligation. The pool of the above hydrolyzed chain extension fragments by overlapping was ligated with the E. coli JSK301 vector hydrolyzed by XhoI / NotI (FIG. 11). The ligation product was then transferred to E. coli electrocompetent cells (electroporation competent XL1-Blue, Stratagen, catalog No. 200228, La Jolla, USA) in accordance with the manufacturer's instructions. Transformed E. coli cells were cultured on 2xYT agar containing 100 μg / ml carbenicillin. Biomass corresponding to approximately 10 ¹⁰ -10 ¹¹ cells obtained from independent colonies, the number of which is at least 5 times higher than the total number of PCR products with chain extension by overlapping, was used as starting material for the preparation of a plasmid preparation using the plasmid preparation kit Maxi by Qiagen (Qiagen, Cat. No. 12163, Hilden, Germany). To express Fab fragments of the cloned related and associated VH and VL coding sequences at the second stage of ligation, a cluster of prokaryotic promoter and leader sequence was introduced into the vector. The bi-directional promoter fragment used (SEQ ID NO: 321) was extracted from the original JSK301 vector by AscI / NheI hydrolysis. The purified pool of plasmids was likewise hydrolyzed with AseI / NheI restriction endonucleases and purified from the gel as described above. The purified fragments were then ligated and transferred to E. coli electrocompetent cells (TG1, Stratagene, catalog No. 200123, La Jolla, USA) and cultured on 2 × YT agar containing 100 μg / ml carbenicillin and 1% glucose. The process of creating a library of expressed Fab fragments is shown in FIG.

g. Clone Screening

Fab-expressing clones were examined for TT antigen binding using antigen-specific ELISA assays.

g-1. Creation of base plates and expression of Fab fragments

Selected TG1 cell colonies, each of which contained an expression vector of related Fab fragments from the library created in section (f), were introduced into separate wells of 96-well plates containing 2xYT / 100 μg / ml Carb / 1% glucose. The plates were incubated by gently shaking overnight at 37 ° C. Four 96-well plates were pooled in the wells of one 384-well plate containing 2xYT / 100 μg / ml Carb / 1% glucose using 96-channel replicators. 384-well plates were incubated during the day at 37 ° C. These tablets, called base plates, were stored at -80 ° C after the addition of glycerol to a final concentration of 15%.

Base plates were used to incubate deep 384-well plates containing 2xYT / 100 μg / ml Carb / 0.1% glucose using a 96-channel replicator. The tablets were sealed and incubated, shaking, for 2-3 hours at 37 ° C.

Expression of Fab fragments was induced by adding an equal volume of 2xYT / 100 μg / ml Carb / 0.2 mM IPTG to achieve a final IPTG concentration of 0.1 mM. The tablets were sealed and incubated, shaking, overnight at 30 ° C. The next day, supernatants containing Fab fragments were analyzed by ELISA for binding specificity of TT antigens.

g-2. ELISA Analysis

384-well ELISA plates (Corning Inc., Corning, NY, USA, 3700 catalog No.) were sensitized overnight at 4 ° C. with tetanus toxin (TT) antigen diluted to a final concentration of 1 μg / ml in PBS in volume, equal to 25 μl per well. Excess binding sites in the wells were blocked for 1 hour at room temperature (RT) by adding 2% M-PBS-T (2% skimmed milk powder in PBS, 0.05% Tween-20). Wells were washed twice with PBS-T (PBS, 0.05% Tween-20).

Fab-containing bacterial supernatants obtained in g-1 were diluted 1: 2 in 2% M-PBS-T and transferred in duplicate to the wells of an ELISA plate. The culture was incubated for 1 hour at room temperature. The wells were washed four times with PBS-T. Goat antibody was added to the wells to the human Fab / HRP complex (Sigma, St. Louis, MO, USA, Catalog No. A0293), diluted in a ratio of 1: 10000 in 2% M-PBS-T. The culture was incubated for 1 hour at room temperature. The wells were washed four times with PBS-T. TMB Plus substrate was added (KemEnTec, Copenhagen, Denmark, catalog number 4390L) and incubated for 5-15 minutes. The reactions were terminated by adding an equal volume of a 1M solution of H ₂ SO ₄ , and the reaction product was analyzed in a spectrophotometer at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA).

Primary bacterial clones corresponding to TT antigen binding clones can then be removed from the base plates. Plasmid DNA can be obtained from the isolated antigen-positive clones of Fab fragments with the creation of a sub-library of expressed related Fab fragments of clones that bind TT antigen.

The clone subpopulation was further analyzed by ELISA using an anti-kappa chain antibody to establish a correlation between the number of antigen-binding clones and the number of Fab-expressing clones. Antibody Kappa antibody assays were typically performed as TT antigen assays unless the wells were sensitized with a goat anti-human Kappa antibody diluted 1: 1000 (Caltag, California, USA, Catalog No. H16000) using carbonate buffer, pH 9.6.

g-3. Screening Results

Clones from four 384-well plates were tested for reactivity with Kappa chain antibodies and TT antigen using ELISA assays as described in section g-2. The results obtained are summarized in tables 15-19. The results of ELISA analysis using antibodies against the kappa chain indicate the expression of Fab fragments in this clone, and the results of ELISA analysis using TT antigen indicate the functional activity of Fab fragments.

Table 15 ELISA screening with anti-kappa antibody sensitization (total 1440 clones) Tablet number 2x background reactivity 3x background reactivity 4x background reactivity G050 105 79 73 G051 93 79 68 G052 120 96 73 G053 164 141 125 Amount 482 395 339 % Fab-positive clones 34% 27% 24%

Of the 1,440 individual clones that were analyzed, 482 clones, or 34%, had an anti-kappa chain reactivity greater than 2-fold background reactivity. 395 clones or 27% had a reactivity in excess of 3-fold background reactivity, etc.

The same clones were analyzed by reactivity ELISA for TT antigen; the results are shown in the following table 16.

Table 16 ELISA screening with TT antigen sensitization (total 1440 clones) Tablet number 2x background reactivity 3x background reactivity 4x background reactivity G050 26 19 17 G051 24 eighteen fifteen G052 34 31 24 G053 46 36 thirty Amount 130 104 86 % TT-positive clones 9.0% 7.2% 6.1%

From the above table it is seen that 9.0% of the clones are reactive with respect to the TT antigen at the level of 2-fold background reactivity (defined as a signal obtained based on the reactivity of the Fab fragment with irrelevant specificity). 104 clones interacted at the level of 3-fold background reactivity (7.2%), etc.

Of Fab-positive clones (a total of 482 clones), approximately 27% of the clones (130/482) were reactive with TT antigen at the level of 2-fold background reactivity. The indicated level does not change significantly at other levels of background reactivity.

Six 384-well plates were examined to detect clones with reactivity against TT antigen. The number of clones having reactivity for this antigen is shown in Table 17. For these plates, ELISA analysis using an anti-kappa chain antibody was not performed.

Table 17 ELISA screening with TT antigen sensitization (2160 total clones) Tablet number 2x background reactivity 3x background reactivity 4x background reactivity G054 82 65 52 G0555 thirty 24 21 G056 25 23 21 G057 thirty 28 26 G058 24 21 19 G059 eighteen fourteen 13 Amount 209 175 151 % TT-positive clones 9.7% 8.1% 7.0%

The percentage of TT-positive clones on the G054-G059 plates was comparable to the same value found for the G050-G053 tablets (Table 16).

The results obtained for all clones studied in relation to the TT antigen (tables 16 and 17) are summarized in table 18.

Table 18 All investigated clones, TT reactive clones Tablets 2x background reactivity 3x background reactivity 4x background reactivity G050-G053 130 104 86 G054-G059 209 175 151 Amount 339 279 237 % of the total number of clones (3600) 9.4% 7.8% 6.6%

A total of 339 clones were reactive with respect to the TT antigen at least at the level of 2-fold background reactivity (Table 18). The result obtained corresponds to 9.4% of all investigated clones.

All positive clones having a TT antigen reactivity of 2x background reactivity were inoculated from the base plate onto the 96-well plates described above. The next day, the bacteria were collected by centrifugation at 4000 rpm for 15 minutes, the pellet was resuspended in 0.8 mM EDTA, 0.4 x PBS, 0.8 M NaCl and incubated on ice for 15 minutes. The periplasmic extract was collected by centrifugation and clone reactivity was analyzed. Below are the results of the reactivity for one such tablet (G060) in relation to an antibody against the kappa chain (Fig. 18), ovalbumin (unrelated antigen) (Fig. 19), TT antigen (Fig. 20) and the results of a one-stage competitive analysis using TT-antigen at a concentration of 10 ^-7 M in solution (Fig.21). The above ELISA assays were performed on the same periplasmic extract with the same dilution.

Most of these clones expressed Fab fragments (90/96) (FIG. 13), with none of the clones interacting with ovalbumin (FIG. 19). The immobilized TT antigen reactivity was lower or completely suppressed by the TT antigen in solution (FIG. 21), indicating that clones specifically interact with the TT antigen. Clone reactivity indices on the G060 tablet are summarized in table 19.

Table 19 Summary of results for the G060 tablet (96 total clones) Background level Clones with positive reactivity to the antibody against Kappa chain TT positive clones 2x 94% (90/96) 74% (71/96) 3x 91% (87/96) 72% (69/96) 4x 84% (81/96) 69% (66/96)

h. Diversity analysis and confirmation of clones

A plasmid isolated from 47 clones (from G060 plate) of a sub-library of expressed related Fab fragments that bind TT antigen was subjected to sequence analysis. The sequences encoding the variable region of the heavy chain were sequenced using primer LSH-HCP: AGGAAACAGGAGATATACAT (SEQ ID NO: 131) and hybridized with the P tac promoter; light chain coding sequences were sequenced using primer LSN-LCP: TCGCCAAGGAGACAGTCATA (SEQ ID NO: 132) and hybridized to the P lac promoter. Sequencing data was analyzed using Vector NTI software (Informax, Frederick, MD, USA). The data obtained for the heavy chain sequence were cut to one base pair at the 5'end at the top of the AscI restriction site and at the 3'end at the bottom of the XhoI restriction site. The data obtained for the light chain sequence were cut off to the second base pair at the 5'end at the top of the NheI restriction site and at the 3'end of the last AAA codon encoding the C-terminal variable chain lysine. Clipping was performed to facilitate further analysis, such as the translation of each DNA sequence.

The sequences encoding the variable regions of the heavy and light chains were analyzed for the use of the germline gene by comparing these sequences with a database of sequences encoding the variable region of the germline based on the V gene (MRC Center for Protein Engineering, Cambridge, UK). Thus, the closest related germline allele was determined for each sequence containing a set of V genes from 12 different germline alleles of the heavy chain variable region belonging to the VH1-VH5 family and from 8 different germline alleles of the variable kappa chains related to VK1, VKIII and VKIV (table 20).

In addition, the variable region sequences of the gene were translated into protein sequences, which were subjected to comparative analysis using AlignX software (Informax, Frederick, MD, USA), as shown in figures 22 and 23. Based on the comparative analysis of the protein sequences of the variable region sequences of the chain, was divided into groups in accordance with the rearrangement V (D) J indicated by the letter H for the sequence of the variable region of the heavy chain and the letter L for the sequence of variab flaxen region of the kappa chain followed by an identification number. In each rearrangement group, the sequences were distributed according to the maturation genotype (M-type in Table 20) among the hypervariable sections of CDR1, 2, and 3, indicated in lower case in alphabetical order. Seven clones contained immature termination codons, of which 6 clones had an amber mutation (TAG) (clone identification numbers g060: b12, d08, f06, c12, f03, c04) and 1 clone had an opal mutation (TGA) (clone identification number g060: h12). These codons were most likely suppressed by E. coli to form functional Fab fragments. Four of these clones were members of groups containing similar clones, which made them redundant. It was necessary to analyze additional clones in order to replace the remaining 3 clones with immature termination codons, since they were the only members of their groups. Alternatively, these sequences could be corrected by standard molecular biology methods such as PCR, replacing the termination codon with an acceptable codon.

The 47 analyzed V-region sequences could be divided into 20 groups with a unique rearrangement of V (D) J (designated “groups” in Table 20) depending on the gene for the variable region of the heavy chain and the variable region of the kappa chain. Four of these rearrangement groups could be further divided into 1-4 types of maturation (a-d), resulting in 27 unambiguous antibody-coding sequences (table 12). Specific heavy chain rearrangement groups are usually combined with specific light chain rearrangement groups (e.g., H1 with L1, H12 with L24, and so on). In addition, the type of maturation is consistent in pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain (for example, H4c is consistent with L13c). Such stringency of pairing in rearrangement groups and types of maturation indicates a related pairing of sequences encoding variable regions.

However, the H4 heavy chain rearrangement group is an exception. H4 mates with two different light chains L28 and L13. L13 was the only chain for H4, including maturation types a, b and c, which are consistent with the types of maturation L13. On the other hand, it was also found that L28 mates with one of the members in the H2 heavy chain group. Two of the seven H4a heavy chain sequences mate with the L13a heavy chain, and five of the seven H4a heavy chain sequences mate with L28a. These observations suggest that when performing multiple RT-PCR with chain extension by overlapping in one well there were two plasma cells producing a TT-specific antibody, with combinations of the H2-L28 and H4a-L13a genotypes. Rare sequence shifts during pairing of the light and heavy chain genes, such as H2 and H4a with L28, were expected, since the experiment was performed by the method of limited dilution of plasma cells.

The identity of the sequences in separate related pairs of sequences encoding the variable region of the heavy and the variable region of the light chain belonging to the same group and type of maturation is at least 90% and preferably at least 95%. When considering, for example, g060g03 and g060a01 from group H1 with the type of maturation a, it turns out that clone g060g03 corresponds to a pair of nucleotide sequences of SEQ ID NO 168: 215, where the sequence encoding the variable region of the heavy chain corresponds to SEQ ID NO 168 and the sequence encoding the variable the light chain region corresponds to SEQ ID NO 215. Clone g060a01 corresponds to the nucleotide sequence pair of SEQ ID NO 133: 180. When comparing SEQ ID NO 168 with SEQ ID NO 133 (variable regions of heavy chains) 4 of 369 bases are not identical and variable regions of light chains (SEQ ID NO 215 and 180) 8 of 327 bases are not identical, which corresponds to 98.3 % sequence identity in two related pairs (g060g03 and g060a01). However, when considering sequence identity in different groups, one cannot expect high sequence identity, since this library is a polyclonal sub-library in which diversity is desired. In this example, the lowest identity in related pairs is approximately 40% (for example, g060b11 and g060h11 are characterized by sequence identity of 39.5%).

One embodiment of the present invention relates to a sub-library of related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain of immunoglobulin, and immunoglobulins obtained from the library can interact or bind with a tetanus toxin.

Another embodiment of the present invention relates to such a sub-library of related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain of immunoglobulin, which contains individual related pairs with sequence identity of at least 90% selected from the group consisting of pairs SEQ ID NO 135: 182, 168: 215, 146: 193, 151: 198, 173: 220, 152: 199, 164: 211, 148: 195, 137: 184, 169: 216, 138: 185, 143: 190, 161: 208, 166: 213, 157: 204, 139: 186, 134: 181, 150: 197, 156: 203, 158: 205, 170: 217, 178: 225, 141: 188 or 144: 191.

Table 20

An asterisk denotes sequences encoding variable regions that undergo permutation. The “protein sequence” column (Seq.prot.) Shows the SEQ ID numbers from the sequence list corresponding to the protein sequences, and the “nucleotide sequence” column (Seq nucl.) Shows the SEQ ID numbers corresponding to the nucleic acid sequences in the sequence list.

i. Apparent affinity

Competitive analysis was performed to determine the apparent affinity or IC _{50 of the} selected clones from the G060 tablet.

Fab fragments were expressed in 50 ml of cultures as follows: 0.5 ml of an overnight culture was added to 50 ml of 2xYT / 100 μg / ml Carb / 0.1% glucose and shaken for 2 hours at 37 ° C. Then IPTG was added to a final concentration of 0.1 mM and continued to shake overnight at 30 ° C. The next day, bacteria were collected by centrifugation at 4000 rpm for 15 minutes, the pellet was resuspended in 1 ml of 0.8 mM EDTA, 0.4 x PBS, 0.8 M NaCl and incubated on ice for 15 minutes. The periplasmic extract was collected by centrifugation and stored at -20 ° C.

Competitive analysis was performed as follows: periplasmic extracts with the appropriate dilution determined by titration were introduced into several tubes. The mp584 Fag fragment obtained by imaging on a phage that was isolated from the HB8501 human hybridoma cell line expressing an anti-TT antigen antibody was used as a positive control sample. Soluble TT was added to the first tube at a concentration of 100 nM and diluted sequentially in other tubes over four stages, resulting in a total of seven dilutions of TT (from 100 nM to 25 pM). The reaction mixtures were incubated for approximately 45 minutes at room temperature. Samples were transferred onto ELISA plates, sensitized with TT in an amount of 1 μg / ml and blocked as described above. The plates were incubated for 1 hour at room temperature, then washed four times with PBS-T, a goat antibody was added to the human Fab / HRP complex in a ratio of 1: 10000 and incubated for 1 hour. TMB Plus substrate was added (KemEnTech, Denmark, catalog number 4390A), the culture was incubated for about 10 minutes and the reaction was stopped by adding a 1 M solution of H ₂ SO ₄ . Plates were read at 450 nm. A data graph is shown in FIG.

The apparent affinity values of the analyzed clones are shown in table 21.

Table 21 Clone Apparent affinity g060a10 0.50 nM g060b06 0.60 nM g060b12 1.2 nM g060c04 0.55 nM g060d04 1.1 nM g060f01 1.2 nM g060g04 0.9 nM g060g07 0.35 nM g060h11 3.0 nM mp584 (positive control) 6.0 nM

As shown in table 21, Fab fragments have an apparent affinity in the lower nanomolecular or higher picomolecular range. In addition, all related paired Fab fragments are characterized by a higher apparent affinity compared to the Fab fragment obtained by imaging on the phage.

j. Short review

The frequency of TT-specific plasma cells in the peripheral blood monocyte fraction from the TT03 donor was calculated to be 0.022%. About 400 related pairs were created from the blood of the TT03 donor. 3600 clones from cells transformed with the library of related pairs were examined by ELISA, and it was found that 339 of these clones were characterized by TT reactivity when screened by ELISA. 47 of these clones were analyzed to determine their clonal diversity. Of the 47 indicated clones, 27 clones were similar to single-valued, not transposed, sequences encoding variable regions. Three of these clones contained an immature termination codon, which requires correction before being transferred to the mammalian expression vector. Transfer to mammalian expression vectors is described in Example 1, section h. The apparent affinity measured in the selected clones ranged from a lower nanomolecular to a higher picomolecular range.

k. Prospects

Tetanus toxin is one of the most famous toxic substances, the lethal dose of which is several nanograms. The specified toxin is produced by Clostridium tetani, soil bacteria also present in the digestive tract in 25% of people. The tetanus vaccination program has made it possible to effectively overcome this disease in the Western world, although 100-200 cases of the disease are still detected annually in leading Western countries, and the ratio between morbidity and mortality is 50%. In developing countries, the incidence of tetanus is significantly higher. The growth of bacteria in contaminated penetrating wounds causes the release of toxin, which ultimately leads to stiffness, cramping, respiratory failure and death.

Products of hyperimmune immunoglobulins isolated from donated blood of people with a high titer of humoral immune response against tetanus toxin can be used to prevent or treat tetanus at an early stage, as well as in combination with active vaccination. However, due to a lack of human product in developing countries, a horse’s hyperimmune anti-tetanus toxin antibody is used. Recombinant monoclonal or polyclonal antibodies against tetanus toxin can replace the products of hyperimmune globulins for therapeutic and / or prophylactic purposes. The scientific literature has described the successful use of anti-TT recombinant monoclonal antibodies obtained by a known method based on hybridoma cells (Chim, J. et al. 2003, Biologicals 31, 45-53). It is interesting to note the presence of a synergistic effect when mixing two monoclonal antibodies. Thus, a recombinant polyclonal anti-tetanus toxin antibody capable of interacting with or binding to tetanus toxin can potentially be very effective in treating or preventing individuals with an increased risk of tetanus disease.

One embodiment of the present invention relates to recombinant polyclonal immunoglobulin or fragments thereof capable of interacting with or binding to a tetanus toxin.

A preferred embodiment of the present invention relates to a recombinant polyclonal immunoglobulin capable of interacting with or binding to a tetanus toxin, which consists of related pairs of the heavy chain variable region and the immunoglobulin light chain variable region.

Another embodiment of the present invention relates to a recombinant polyclonal immunoglobulin capable of interacting or binding to a tetanus toxin, which is obtained by the method of the present invention.

Another embodiment of the present invention relates to a recombinant polyclonal immunoglobulin capable of interacting or binding to a tetanus toxin, which contains separate related pairs of the variable region of the heavy chain and the variable region of the light chain of immunoglobulin having at least 90% sequence identity with one separate pair of SEQ ID, selected from the pairs SEQ ID 229: 276, 262: 309, 240: 287, 245: 292, 267: 314, 246: 293, 258: 305, 242: 289, 231: 278, 263: 310, 232: 279, 237 : 284, 255: 302, 260: 307, 251: 298, 233: 280, 228: 275, 244: 291, 250: 297, 252: 299, 264: 311, 272: 319, 2 35: 282 or 238: 285.

Another embodiment of the invention relates to a pharmaceutical composition comprising, as an active ingredient, a recombinant polyclonal antibody capable of interacting with or binding to a tetanus toxin, which is intended to treat or prevent tetanus. The recombinant polyclonal antibody is preferably combined with a pharmaceutically acceptable excipient.

Another embodiment of the present invention relates to the use of a recombinant polyclonal immunoglobulin capable of interacting with or binding to a tetanus toxin as a medicament for the treatment or prophylactic protection of an individual with an increased risk of tetanus disease.

An additional embodiment of the invention relates to a method for preventing or treating an individual with an increased risk of tetanus disease by administering to a needy individual a composition comprising a recombinant polyclonal antibody capable of interacting or binding to a tetanus toxin.

Example 12. Comparison of the results obtained from two donors

In the following example, the results obtained from the TT08 donor are compared with the results obtained from the TT03 donor in example 11. The results are summarized in table 22.

Table 22 TT03 TT08 TT-specific plasma cells in the PBMC fraction (ELISPOT) 0.021% 0.011% CD19 + cells in the PBMC fraction (FACS) eleven% 5% Plasma cells in PBMC fraction (FACS CD38gi, CD45in) 0.12% 0.08% The established number of related V _H - and V _L -sequences 400 400 The number of clones examined in relation to the expression of Fab fragments 1400 2000 The number of Fab-positive clones (2x background level) 482 558 The number of clones tested for TT specificity 3600 3400 The number of TT-specific clones (2x background level) 339 188 The number of sequences analyzed from TT-specific clones 47 102 Germ line alleles VH 12 (VH1-5) NA Germ line alleles VL 8 (VKI, III, IV) NA The number of single-parental couples 27 40 Apparent affinity range 0.35-3.0 nM NA NA = no analysis

This example clearly shows that libraries of the same quality can be obtained from two different donors immunized with TT.

The presence of a larger number of unambiguous related pairs in the library obtained from the TT08 donor is most likely due to the large number of analyzed sequences.

Example 13. Comparison of the library of related pairs in example 11 with displayed on the phage combinatorial library obtained from the same donor

In the present example, the combinatorial library displayed in the phage was obtained from a donor whose blood had previously been used to obtain a library of related pairs, in order to compare the diversity, affinity and specificity of the libraries of related pairs and combinatorial libraries.

but. Creating a combinatorial library in phage

The library displayed on the phage was created from the fraction of CD19 ⁺ cells obtained from the TT03 donor (identical to the cell fraction obtained in Example 11c).

Total RNA was obtained from approximately 5 × 10 ⁶ CD19 ⁺ cells using the NucleoSpin RNA L kit (Machery-Nagel, Catalog No. 740962.20). Then cDNA was synthesized by performing an oligo (dT) seed-initiated reaction using ThermoScript reverse transcriptase (Invitrogen, catalog number 11146-016).

V _H and kappa chains were PCR amplified using HotMaster Taq DNA polymerase (Eppendorf, 0032002.692) and primers substantially similar to those described by de Haard et al., J. Biol. Chem. 274, 18218-18230; 1999), in which only recognition sequences of restriction enzymes at the 5'-end have been modified.

Displayed on phage combinatorial library was created by sequentially introduction of PCR products kappa and V _H -chain in displaying phage vector Em351 (modified vector of phh3, described in the publication Den, W. et al. 1999, J. Immunol. Methods 222 45-57).

The final library was electroporated into E. coli TG1 strain (Stratagene). The combinatorial library contained 3x10 ⁶ independent clones with a high insertion frequency.

b. Panning Combinatorial Library

Phage particles displaying Fab fragments were obtained by standard methods (e.g., Antibody Engineering, A Practical Approach, 1996, ed. McCafferty, Hoogenboom and Chiswell).

Panning was performed for tetanus toxin (TT; SSI, lot No. 89-2), diluted to 1 μg / ml in PBS and immobilized in MaxiSorp immunoassay tubes (Nunc, catalog number 444202). The culture was incubated for one hour and washed several times, bound phage particles were eluted using 100 mM TEA (triethylamine).

The phage particle eluate was neutralized and used to infect exponentially growing TG1 cells, from which phage particles displaying Fab fragments with increased specificity for TT antigen were obtained. The second panning cycle using eluted phages was performed as described above in a standard manner.

In parallel, three panning cycles were performed with respect to the C-fragment of the tetanus toxin molecule (Sigma, catalog No. T3694) after the implementation of the above method.

Separate colonies were examined for binding to tetanus toxin and C-fragment from an unselected library and after each panning cycle in both series of the above panning.

from. Comparison of the specificity and affinity of combinatorial clones on phage particles and clones of related pairs

Separate colonies were obtained from an unselected library and after each panning cycle (for intact tetanus toxin (TT) and tetanus toxin C-fragment). Phage particles displaying Fab fragments were analyzed for reactivity using ELISA assays. The number of Fab-positive clones with a reactivity to TT and / or C-fragment equal to at least 2-fold background reactivity and at least 4-fold background reactivity are shown in tables 23-25 below. All results are expressed as the ratio of the number of specific clones to the number of Fab-positive clones.

Table 23 Clones selected for TT and subjected to TT-specific ELISA Enrichment 2x background reactivity 4x background reactivity Unselected Clones - 13 / about 5000 After 1 panning cycle 61/99 59/93 After 2 panning cycles 165/169 163/166

Table 24 Clones selected for TT and subjected to C-fragment specific ELISA Enrichment 2x background reactivity 4x background reactivity Unselected Clones 0/13 0/13 After 1 panning cycle 0/85 0/85 After 2 panning cycles 0/85 0/85

Table 25 Clones selected for the C fragment and subjected to ELISA specific to the C fragment Enrichment 2x background reactivity 4x background reactivity After 1 panning cycle 1/35 0/35 After 2 panning cycles 12/47 9/47 After 3 panning cycles 64/126 26/126

The panning of the anti-TT library displayed on the phage revealed an increasing number of TT-specific clones with an increase in the number of panning cycles, while only a few clones were identified in the unselected library. No clones with reactivity to the C-fragment of tetanus toxin were found in the unselected library or after two cycles of panning against the TT library. In order to obtain Fab fragments with specificity for the C fragment from the combinatorial library displayed on the phage, this library had to be specifically panned against the C fragment.

For comparison, thirteen TT-specific clones of seven clones with reactivity above 2-fold background reactivity of Example 11 were subjected to C-fragment specific ELISA. Thus, Fab fragments with specificity for the tetanus toxin C fragment could be expressed from a library of cognate pairs obtained from the blood of a TT immunized individual.

This example clearly shows the disadvantage of using panning to identify clones with specificity for a particular antigen. Unknown important fragments or epitopes of the antigen may be skipped during panning, resulting in a less effective product.

In addition, the apparent affinity of combinatorial clones was measured by the method described in the analysis of Example 11i. Ten combinatorial clones obtained after two panning cycles for TT were analyzed, with apparent binding affinities ranging from 1 to 15 nM obtained.

When comparing four of the nine clones that were analyzed from a library of related pairs (table 21), affinity values in the picomolecular range were obtained.

The results show that the pairing of the variable regions originally selected by the donor’s immune system, combined with the somatic hypermutations to which the pairs were subjected, potentially increases the apparent binding affinity compared to arbitrary combinations of such variable regions.

d. Comparison of the sequences of TT-specific combinatorial clones on phage particles and clones of related pairs

The large volume of sequence data obtained from two libraries prevents direct comparisons of the crude sequences. For visualization of differences between pairs of V _H - and V _L -sequences displayed on a phage library and the library of related pairs were reconstituted phylogenetic tree for the V _H - and V _L-sequences, and pairs were illustrated in a dot matrix. A pairwise comparison of phylogenetic information in a point matrix (Fig. 25) revealed very different distribution profiles of pairs of V _H and V _L sequences in two libraries. The scattered image of pairs of V _H and V _L sequences in the library displayed on the phage (Fig. 25A) indicated a small phylogenetic relationship between the V _H and V _L genes, which is consistent with the random pairing of V genes in this library. In contrast, pairs of V _H and V _L sequences from the library of related pairs (FIG. 25B) are characterized by a cluster image indicative of the co-evolution of V genes expected for related pairs. In addition, genetic diversity is much greater for V genes in a library of related pairs compared to V genes from a combinatorial library, indicating that the method of isolating related paired V genes is less erroneous.

Example 14. The combined reactions of one-stage multiple RT-PCR with chain extension by overlapping and nested PCR using T cells as a matrix source

This example describes the implementation of a one-stage multiple RT-PCR with chain extension by overlapping using human T-lymphocytes.

but. Obtaining a lymphocyte-containing fraction of cells

A blood sample is obtained from donors exposed to the desired antigen, for example, as a result of immunization, natural infection, neoplasia, autoimmune reaction or other diseases. Peripheral blood mononuclear cells (PBMCs) are isolated in a Lymphoprep device (Axis-Shield, Oslo, Norway, production No. 1001967) in accordance with the manufacturer's instructions.

In the present example, antigen-specific T cells were obtained by further stimulation of the PBMC fraction. However, overlapping multiple RT-PCRs with overlapping chain extension can also be performed using single cells from a PBMC fraction or a cell fraction enriched in T cells (for example, by FACS sorting for CD3-positive cells).

b. The creation of antigen-specific T cells

The PBMC cell fraction is resuspended in an appropriate culture medium containing the necessary cytokites, such as IL2. Then, the desired antigen is added to the culture, where the antigen-presenting cells (APC) present in the PBMC fraction represent its T-lymphocytes. Alternatively, APC-feeding cells pretreated to present the desired antigen can be added to the PBMC fraction. Such APC-feeding cells can be APC exposed to the desired antigen, for example, in the form of a peptide, protein or other molecules, APC infected with microbes, cells transfected to express and present the antigen, or APC co-cultivated with other antigenic cells, for example cancer cells in the form of primary tissue or cell lines. The scientific literature describes numerous different types of APC-feeding cells, including transformed cell lines, B-cell lines, dendritic cells, etc.

The PBMC fraction is cultured for about 3-5 weeks, during which fresh antigen-presenting cells are added along with cytokines, for example, once a week. As a result of this, proliferation, activation and maturation of T-lymphocytes occurs. At the end of cultivation, antigen-specific T cells predominate in the cell culture. Whether these cells are CD4 + or CD8 + cells depends on the disease, antigen, APC cells and mixtures of cytokines used during stimulation.

Antigenic specificity can be checked, for example, by CTL analysis, proliferation assays and MHC tetramers sensitized with the desired antigen (Altman, J.D. et al., 1996, Science 274, 94-96).

Antigen-specific T cells are distributed in tubes for PCR by the method of limited dilution or FACS, while receiving one cell in one vessel. The vessel can be stored at -80 ° C until use.

b. Single-Stage Multiple Overlap RT-PCR with Overlap

To perform multiple overlap extended RT-PCR with overlapping chain, use the Qiagen one-step RT-PCR kit (Qiagen, 210212, Hilden, Germany) according to the manufacturer's recommendations. Before the PCR reaction mixture is added to the PCR tubes, the cells are thawed.

PCR reaction mixtures and cyclization conditions are initially determined as described in Example 11 e-1. However, when using a new set of primers, some optimization of the conditions may be required.

The mixture of multiple primers used to extend the chain by overlapping includes the primers shown in table 26.

Table 26 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end Vα 10 nM each 322

323

324

325

326

327

328

329

330

331

332

333

334

335

336

337

338

339

340

341

342

343

344

345

346

347

348

349

350

Cα 200 nM 351

Vβ 10 nM each 352

353

354

355

356

357

358

359

360

361

362

363

364

365

366

367

368

369

370

371

372

373 374

Cβ 200 nM 375

from. Semi-slot PCR

A semi-nested PCR may be performed as described in Example 11 e-2, and some optimization of the conditions may be required.

Table 27 Primer Name Concentration SEQ ID NO Primer sequence in direction from 5'-end to 3'-end Cα 200 nM 376

Cβ 200 nM 377

The sequences indicated in capital letters correspond to the genespecific region.

To verify the success of the multiple chain extension RT-PCR by overlapping part of the samples from the reaction mixtures, the semi-nested PCR was analyzed by subjecting 10 μl of each reaction mixture to semi-nested PCR electrophoresis in 1% agarose gel using ethidium bromide to detect it. The expected fragment size of the chain elongation by overlapping is approximately 850 bp. (the exact size depends on the length of the variable regions).

About ten microliters of all reaction mixtures obtained from one donor are combined in one tube. An aliquot of the combined PCR products is then purified using the QIAquick PCR Cleaning Kit according to the manufacturers instructions (Qiagen, Catalog No. 28106, Hilden, Germany). The purified overlap-extended PCR product pool can be hydrolyzed with the appropriate restriction enzymes, purified and introduced into an acceptable vector.

In the present experiment, constant region primers (SEQ ID NO 376 and 377) used in the performance of the semi-nested PCR are designed to subclone the product of the semi-nested PCR in an acceptable vector. When creating a primer for the β-chain, the SER residue is replaced by the Met residue at position 21 of the peptide of the constant region of the β-chain, so that the NsiI site can be introduced into the indicated nucleic acid sequence:

Such a transition should be relatively safe, since SER 21 is located in the constant region of the β-chain in the loop at the proximal end of the membrane domain. Therefore, the above relatively conservative substitution does not appear to violate the general structure of the domain.

When creating a primer for the α-chain, nucleotides corresponding to positions 15-17 in the peptide of the constant region of the α-chain are replaced, so that the SacI site can be introduced into the nucleic acid sequence:

Therefore, acceptable vectors contain the remaining parts of the constant regions of the α and β chains of TcR and include the corresponding modification of restriction sites. These replacements can be made using standard PCR and subcloning methods.

e. Additional considerations

Many variable region primers can potentially interact with each other to exert an inhibitory effect during amplification by multiple PCR with chain extension by overlapping. To avoid this, primers for variable regions can be divided into subsets and used separately in appropriate combinations.

Other embodiments of the invention

All publications and patent applications cited in this specification are incorporated herein by reference, as if all individual publications or patent applications were incorporated by reference in their entirety. Although the present invention has been described in detail by way of separate illustrative embodiments for ease of understanding, it will be understood by those skilled in the art in light of the above description that certain changes and modifications may be made to the invention without departing from the scope and spirit of the appended claims .

Claims (51)

1. A method of binding a plurality of non-contiguous nucleotide sequences of interest, which comprises:
a) amplification of nucleotide sequences of interest using multiple molecular amplification using a matrix derived from an isolated single cell; and
b) binding of the nucleotide sequences of interest amplified in step a);
in which the nucleotide sequences of interest contain sequences encoding a variable region, and as a result of binding, a related pair of sequences encoding variable regions is formed. 2. The method according to claim 1, in which the nucleotide sequences of interest contain sequences encoding the variable regions of the immunoglobulin, and as a result of binding, a related pair is formed, consisting of a sequence encoding the variable region of the light chain and an associated sequence encoding the variable region of the heavy chain . 3. The method according to claim 1, in which the nucleotide sequences of interest contain sequences encoding the variable regions of the T-cell receptor, and as a result of binding, a related pair is formed, consisting of a sequence encoding the variable region of the alpha chain, and a sequence coding for it the variable region of the beta chain, or a sequence encoding the variable region of the gamma chain, and its associated sequence encoding the variable region of the delta chain. 4. The method according to claim 1, in which the family of nucleotide sequences containing sequences encoding variable regions is amplified using a variety of primers. 5. The method according to claim 1, wherein said multiple molecular amplification is amplification by multiple RT-PCR. 6. The method according to claim 5, in which the specified amplification by multiple RT-PCR is a two-stage process, comprising a separate stage of reverse transcription (RT), performed before amplification by multiple PCR. 7. The method according to claim 5, in which the specified amplification by the method of multiple RT-PCR is performed in a single stage, providing for the initial introduction into a single vessel of all the components necessary to perform both reverse transcription (RT) and amplification by multiple PCR. 8. The method according to claim 1, in which a single cell or population of genetically different cells is obtained from a fraction of cells containing lymphocytes. 9. The method of claim 8, in which the fraction of cells containing lymphocytes is part of whole blood, bone marrow, mononuclear cells or white blood cells. 10. The method according to claim 9, in which the fraction of cells containing lymphocytes is enriched in B-lymphocyte cells. 11. The method according to claim 10, in which the fraction of cells containing lymphocytes, or a line of B-lymphocytes enriched in plasma cells. 12. The method of claim 8, in which cells from a fraction of cells containing lymphocytes, a line of B-lymphocytes or plasma cells have increased antigenic specificity. 13. The method of claim 8, in which the fraction of cells containing lymphocytes is enriched in T-lymphocyte cells. 14. The method of claim 8, in which antigen-specific T cells are obtained by stimulating a fraction of cells containing lymphocytes. 15. The method of claim 8, which further comprises introducing into the vector the linked nucleotide sequences or a related pair from the library. 16. The method of claim 8, wherein before performing the reverse transcription and multiple molecular amplification steps, a population of isogenic cells is obtained by intensively dividing each isolated individual cell. 17. The method according to claim 1, wherein said binding of the nucleotide sequences of interest is performed in the same vessel as the multiple molecular amplification. 18. The method according to any one of claims 5-17, wherein said binding of the nucleotide sequences of interest is performed together with amplification by the multiple PCR method using a mixture of multiple primers to extend the chain by overlapping. 19. The method according to any one of claims 5-17, wherein said binding of nucleotide sequences of interest is performed by ligation. 20. The method according to claim 1, in which additional molecular amplification is performed using a mixture of primers adapted to amplify the linked nucleic acid sequences of interest. 21. The method according to p. 18, in which the mixture of multiple primers for lengthening the chain by overlapping contains sets of primers in which at least one of the primers of the set contains an end sequence for lengthening the chain by overlapping, capable of hybridizing with the end sequence to extend the chain beyond by overlapping the primer of the second set of primers. 22. The method according to p, in which the mixture of multiple primers to extend the chain by overlapping includes:
a) at least one primer for C _L or J _L complementary to a sense sequence encoding an immunoglobulin light chain variable region;
b) at least one 5'-terminal primer for V _L or a primer for V _LL complementary to the antisense sequence encoding the variable region of the light chain of the immunoglobulin or leader sequence of the variable region of the light chain, and capable of forming a set of primers with primer (s) at paragraph a);
c) at least one primer for C _H or J _H complementary to a sense sequence encoding an immunoglobulin heavy chain constant domain, or a sequence encoding a connecting region of a heavy chain; and
d) at least one 5'-terminal primer for V _H or a primer for V _HL complementary to the antisense chain of the sequence encoding the variable region of the heavy chain of the immunoglobulin or leader sequence of the variable region of the heavy chain, and capable of forming a set of primers with a primer (s) under item c). 23. The method according to item 22, in which the primers according to paragraph b) are primers for V _LL , characterized in that their sequence is at least 90% identical to the sequence of the gene-specific region selected from SEQ ID NO: 93-98, and the primers under item d) are primers for V _HL , characterized in that their sequence is at least 90% identical to the sequence of the gene-specific region selected from SEQ ID NO: 86-92. 24. A method of creating a library of related pairs containing linked sequences encoding variable regions, said sequences encoding variable regions being sequences of the immunoglobulin superfamily, the method comprising:
a) receiving from the donor a fraction of cells containing lymphocytes;
b) optional enrichment of a particular population of lymphocytes of a specified fraction of cells;
c) obtaining a population of isolated individual cells, comprising distributing one cell from the specified fraction of cells into several vessels; and
d) amplification and binding of sequences encoding the variable regions located in the specified population of isolated individual cells, by the method according to any one of claims 1 to 24. 25. The method according to paragraph 24, in which before performing the amplification and binding (stage d) due to the intensive division of each isolated individual cells, a population of isogenic cells is obtained. 26. The method according to paragraph 24, in which the fraction of cells containing lymphocytes, is part of whole blood, bone marrow, mononuclear cells or white blood cells. 27. The method according to p, in which the fraction of cells containing lymphocytes enriched in cells of B-lymphocytes. 28. The method according to item 27, in which the fraction of cells containing lymphocytes, or a line of b-lymphocytes enriched in plasma cells. 29. The method according to paragraph 24, in which cells from a fraction of cells containing lymphocytes, a line of B-lymphocytes or plasma cells have increased antigenic specificity. 30. The method according to paragraph 24, in which the fraction of cells containing lymphocytes is enriched in T-lymphocyte cells. 31. The method according to paragraph 24, in which antigen-specific T cells are obtained by stimulating a fraction of cells containing lymphocytes. 32. The method according to paragraph 24, which further comprises introducing into the vector the linked nucleotide sequences or a related pair from the library. 33. The method of claim 32, wherein said vector is selected from cloning vectors, shuttle vectors, vector displays, or expression vectors. 34. The method according to p, in which the associated nucleotide sequences or individual representatives of the library of related pairs are sequences encoding the variable region of the heavy chain of the immunoglobulin associated with sequences encoding the variable region of the light chain, and these sequences are entered with the preservation of the reading frame into the vector, already containing sequences encoding one or more constant domains of immunoglobulin or fragments thereof. 35. The method according to p, in which the associated nucleotide sequences or individual representatives of the library of related pairs are sequences encoding the variable region of the α-chain of the T-cell receptor, associated with sequences encoding the variable region of the β-chain, and these sequences are entered with the preservation reading frames into a vector already containing sequences encoding one or more constant domains of the T-cell receptor or fragments thereof. 36. The method according to paragraph 24, which further provides for the creation of a sub-library by selecting a subset of related pairs of linked sequences of variable regions encoding binding proteins with specificity for the desired target, with the formation of a library of target-specific related pairs of sequences encoding variable regions. 37. The method according to any one of claims 34-36, which further comprises transferring said related pair or library of target-specific related pairs of sequences encoding variable regions to a mammalian expression vector. 38. The method according to clause 37, in which the expression vector of the mammal encodes one or more domains of a constant region selected from human immunoglobulin classes IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4, IgM, light Kappa chain or light lambda chains from either the alpha, beta, delta and / or gamma chains of the human T cell receptor. 39. The method according to p, which further comprises the steps of:
a) introducing a vector encoding a segment of linked nucleotide sequences into a host cell;
b) culturing said host cells under conditions adapted for expression; and
c) obtaining a protein product expressed by a vector introduced into the specified host cell. 40. The method according to § 39, wherein said protein product is a monoclonal antibody containing a related pair of the variable region of the light chain and the variable region of the heavy chain. 41. The method according to § 39, wherein said polypeptide product is a monoclonal T-cell receptor containing a related pair of the variable region of the alpha chain and the variable region of the beta chain. 42. A library of related pairs, consisting of linked sequences encoding the variable regions, in which these sequences encoding the variable regions are sequences of the immunoglobulin superfamily, where each related pair is inserted into a vector capable of expressing the specified related pair. 43. The library according to § 42, wherein said related pairs of sequences encoding variable regions are obtained by the method according to paragraph 24. 44. The library according to paragraph 42 or 43, in which a separate representative of these related pairs contains a sequence encoding the variable region of the light chain of immunoglobulin, and its associated sequence encoding the variable region of the heavy chain. 45. The library according to item 44, in which the specified individual representative encodes a full-sized antibody selected from human immunoglobulins of class IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM. 46. The library of related pairs according to paragraph 42 or 43, in which a separate representative of these related pairs contains a sequence encoding the variable region of the alpha chain TcR, and its associated sequence encoding the variable region of the beta chain, or a sequence encoding the variable region of gamma -chain, and its associated sequence encoding the variable region of the delta chain. 47. The library of claim 46, wherein said individual representative encodes a full-sized TcR. 48. A library of related pairs of linked sequences encoding variable regions, according to any one of paragraphs 42-47, in which each individual representative is selected based on its ability to encode a protein having the desired binding specificity for a particular target. 49. The library of related pairs according to item 44, in which antibodies expressed from the specified library are able to interact or bind to tetanus toxin. 50. A population of host cells containing a library or sub-library according to any one of paragraphs 42-49, where the population of host cells is intended for expression of a recombinant polyclonal binding protein. 51. The host cell population of claim 50, wherein the cells are mammalian cells.

Images