RU2349586C2 - Quinolone analogues - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: present invention pertains to new compounds with formula (1):

and to their pharmaceutical salts, where B, X, A or V are not present, if Z¹, Z², Z³ or Z⁴ respectively represent N, and independently H, halogen atom, azido, R², CH₂R², SR², OR² or NR¹R², when Z¹, Z², Z³ or Z⁴ represent C. In each NR¹R², R¹ and R² together with N there can be formation of an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring. Z¹ represents N and Z², Z³ and Z⁴ represent C, or Z¹ and Z³ represent N and Z² and Z⁴ represent C. W together with N and Z form an optionally substituted thiazole, imidazole or pyrimidine ring, which is condensed with an optionally substituted ring, chosen from a group consisting of:

or

. U represents NR¹R², NR¹-(CR¹ ₂)_n-NR³R⁴, where in NR³R⁴, R³ and R⁴ together with N there can be formation of an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring. R¹ and R³ independently represent H or C_1-6alkyl. Each R² represents H or C_1-10alkyl, each optionally substituted with a halogen atom, or C_3-6cycloalkyl, aryl, heteroaryl or pyridine, pyrrolidine, piperazine or morpholine ring, where each ring is optionally substituted; or R² is optionally substituted with piperidine, pyrrolidine, pyridine, piperazine, pyrazine, morpholine or benzimidazole. R² represents H or C_1-10alkyl. Each R⁵ represents a substitute in any position in ring W, and is H, OR², amino, alkoxy, amido, halogen atom or cyano; or R⁵ represents C_1-6alkyl, -CONHR¹-, each optionally substituted with a halogen atom; or two adjacent R⁵ are linked with formation of a 5-6-member ring, an optionally substituted heterocyclic ring, chosen piperidine, pyrrolidine, piperazine or morpholine ring. n equals 1-6, and each optionally substituted part can be substituted with one or more halogens, OR², NR¹R² , carbamate, C_1-10alkyl, each optionally substituted with a halogen atom, C=O, cyano, nitro, COR², NR²COR², sulphonyl amides, NR²SOOR²; SR², SOR², COOR², CONR² ₂, OCOR², OCOOR² or OCONR² ₂. The invention also relates to pharmaceutical compositions, to the method of suppressing proliferation of cells and/or weakening cell proliferative breakdown, to the method of reducing microbe titre and/or weakening microbe infection, to the method of inducing death of cells and/or inducing apoptosis, to compounds, chosen from a group, to pharmaceutical compositions, as well as to the method of producing compounds with formula (1).

EFFECT: obtaining new biologically active compounds, which can suppress proliferation of cells and/or induce apoptosis.

41 cl, 113 ex, 12 tbl

Description

This application claims priority for provisional patent application US No. 11/149007, filed June 9, 2005, and provisional applications No. 60/611030, filed September 17, 2004; 60/688986, filed June 9, 2005; 60/638603, filed December 22, 2004 and 60/688796, filed June 9, 2005, each of which is incorporated into this description by reference in its entirety.

The invention relates to quinolone analogues and their uses. The invention also relates to methods for producing quinolone analogues.

Based on the available data, it can be assumed that quadruplex structures can exist in vivo in certain regions of the genome, including telomere ends of the chromosomes and regulatory regions of oncogenes (Han et al., Trends Pharm. Sci. (2000) 21: 136-142). Quadruplex structures can form purine-rich nucleic acid chains. In duplex nucleic acids, some purine-enriched chains are able to participate in creating a slow equilibrium between the usual duplex helical structure and the untwisted regions that are not related to the B-form. These untwisted and non-B-forms can be attributed to “paranaemic structures”. Some forms are associated with sensitivity to cleavage by nuclease S1, which can be attributed to "elements with hypersensitivity to nuclease" or "NHE". A quadruplex is one type of paranaemic structure, and some NHEs may adopt a quadruplex structure.

The present invention relates to quinolone analogues that can inhibit cell proliferation and / or induce cell apoptosis. The present invention also relates to methods for producing quinolone analogues and methods for their use.

In one aspect, the present invention relates to compounds of the general formula:

and their pharmaceutically acceptable salts, esters and prodrugs;

where B, X, A or V are absent if Z ² , Z ³ or Z ⁴ respectively represent N and independently H, a halogen atom, azido, R ² , CH ₂ R ² , SR ² , OR ² or NR ¹ R ² , if Z ² , Z ³ or Z ⁴ is independently C; or

A and V, A and X or X and B may form a carbocyclic ring, a heterocyclic ring, an aryl or heteroaryl, each of which may optionally be substituted and / or fused to the cyclic ring;

Z represents O, S, NR ¹ , CH ₂ or C = O;

Z ¹ , Z ² , Z ³ or Z ⁴ represent O or N, provided that the two N are not adjacent;

W together with N and Z forms an optionally substituted 5- or 6-membered ring which is fused to an optionally substituted saturated or unsaturated ring; said saturated or unsaturated ring may contain a heteroatom and is monocyclic or fused with one or more carbocyclic or heterocyclic rings;

U represents R ² , OR ² , NR ¹ R ² , NR ¹ - (CR ¹ ₂ ) _n -NR ³ R ⁴ or N = CR ¹ R ² , where in N = CR ¹ R ² groups R ¹ and R ² together C can form a ring;

provided that U is not H, and when U is OH, OR ² or NH ₂ , then at least one of Z ¹ -Z ⁴ is N;

in each NR ¹ R ^{2 the} groups R ¹ and R ² together with N may form an optionally substituted ring;

in NR ^3, R ⁴ R ³ and R ⁴ together with N may form an optionally substituted ring;

R ¹ and R ³ independently represent H or C _1-6 alkyl;

each R ² represents H or C _1-10 alkyl, or C _2-10 alkenyl, each optionally substituted with a halogen atom, one or more non-adjacent heteroatoms, a carbocyclic ring, a heterocyclic ring, aryl or heteroaryl, where each ring is optionally substituted; or R ^{2 is} optionally substituted with a carbocyclic ring, a heterocyclic ring, aryl or heteroaryl;

R ⁴ represents H, C _1-10 alkyl or C _2-10 alkenyl, optionally containing one or more non-adjacent heteroatoms selected from N, O and S, and optionally substituted with a carbocyclic or heterocyclic ring; or R ³ and R ⁴ together with N may form an optionally substituted ring;

each R ⁵ represents a substituent at any position in the ring W; and is H, OR ² , amino, alkoxy, amido, a halogen atom, cyano, or an inorganic substituent; or R ⁵ is C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, —CONHR ¹ each optionally substituted with a halogen atom, carbonyl, or one or more non-adjacent heteroatoms; or two adjacent R ⁵ are linked to form a 5-6 membered, optionally substituted carbocyclic or heterocyclic ring, which may be fused to an additional, optionally substituted carbocyclic or heterocyclic ring; and

n is 1-6.

In the above formula (1), B may be absent when Z ¹ represents N, or is H or a halogen atom when Z ¹ represents C.

In the above formula (1), W together with N and Z form an optionally substituted 5-6 membered ring which is fused to an optionally substituted aryl or heteroaryl selected from the group consisting of:

where each Q, Q ¹ , Q ² and Q ³ independently represents CH or N;

Y independently represents O, CH, C = O or NR ¹ ;

n and R ⁵ are as defined above.

In other embodiments, the implementation of W together with N and Z form a group having a formula selected from the group consisting of:

where Z represents O, S, CR ¹ , NR ¹ or C = O;

each Z ⁵ represents CR ⁶ , NR ¹ or C = O, provided that Z and Z ⁵ , if adjacent, are both not NR ¹ ;

each R ¹ represents H, C _1-6 alkyl, COR ² or S (O) _p R ² , where p is 1-2;

R ⁶ represents H or a substituent known in the art, including, but not limited to, hydroxyl, alkyl, alkoxy, halogen atom, amino or amido; and

ring S or ring T may be saturated or unsaturated.

In some embodiments, W together with N and Z form a 5-6 membered ring that is fused to phenyl. In other embodiments, W together with N and Z form a 5-6 membered ring that is optionally fused to another ring when U is NR ¹ R ² , provided that U is not NH ₂ . In some embodiments, W together with N and Z form a 5-6 membered ring that is not fused to another ring when U is NR ¹ R ² (e.g., NH ₂ ).

In yet another embodiment, the compounds of the present invention have the general formula (2A) or (2B):

where A, B, V, X, U, Z, Z ¹ , Z ² , Z ³ , Z ⁴ and n are as defined above;

Z ⁵ represents O, NR ¹ , CR ⁶ or C = O;

R ⁶ represents H, C _1-6 alkyl, hydroxyl, alkoxy, a halogen atom, amino or amido; and

Z and Z ⁵ may optionally form a double bond.

In the above formulas (1), (2A) and (2B), U may be NR ¹ R ² , where R ¹ is H and R ² is C _1-10 alkyl optionally substituted with a heteroatom, C _3-6 cycloalkyl, aryl or A 5-14 membered heterocyclic ring containing one or more N, O and S atoms. For example, R ² may be C _1-10 alkyl substituted with optionally substituted morpholine, thiomorpholine, imidazole, aminodithiadazole, pyrrolidine, piperazine, pyridine or piperidine. In other examples, R ¹ and R ^2, together with N, form optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or aminodithiazole.

In other embodiments, U is NR ¹ - (CR ¹ ₂ ) _n —NR ³ R ⁴ ; n is 1-4; and R ³ and R ⁴ in NR ³ R ⁴ together form optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or aminodithiazole. In some examples, U is NH- (CH ₂ ) _n —NR ³ R ⁴ ; where R ³ and R ⁴ together with N form an optionally substituted pyrrolidine, which may be associated with (CH ₂ ) _n at any position in the pyrrolidine ring. In one embodiment, R ³ and R ^4, together with N, form an N-methyl substituted pyrrolidine. In other embodiments, U is 2- (1-methylpyrrolidin-2-yl) ethylamino or (2-pyrrolidin-1-yl) ethanamino.

In the above formulas (1), (2A) and (2B), Z may represent S or NR ¹ . In some embodiments, at least one of B, X, or A represents a halogen atom, and Z ¹ , Z ^2, and Z ³ represent C. In other embodiments, each X and A is not H when Z ² and Z ³ represent C. In the above formulas (1), (2A) and (2B), V may represent H. In specific embodiments, U is not OH.

In one embodiment, each of Z ¹ , Z ² , Z ³ and Z ⁴ represents C. In another embodiment, three of Z ¹ , Z ² , Z ³ and Z ⁴ represent C, and the other is N. For example, Z ¹ , Z ² and Z ³ are C, and Z ⁴ is N. Alternatively, Z ¹ , Z ² and Z ⁴ are C, and Z ³ is N. In other examples, Z ¹ , Z ³ and Z ⁴ are C, and Z ² represents N. In yet other examples, Z ² , Z ³ and Z ⁴ are C, and Z ¹ is N.

In another embodiment, two of Z ¹ , Z ² , Z ³ and Z ⁴ are C, and the other two are non-adjacent nitrogen atoms. For example, Z ¹ and Z ³ may be C, and Z ² and Z ^{4 may} represent N. Alternatively, Z ¹ and Z ³ may be N, and Z ² and Z ⁴ may represent C. In other examples, Z ¹ and Z ⁴ represent N, and Z ² and Z ³ are C. In specific examples, W together with N and Z form a 5-6 membered ring that is fused to phenyl.

In some embodiments, each of B, X, A, and V represents H, and Z ¹ -Z ⁴ are C. In many embodiments, at least one of B, X, A, and V is H, and a corresponding adjacent atom Z ¹ -Z ⁴ represents C. For example, two of B, X, A and V can be H. In one example, V and M can both represent H. In other examples, any three of B, X, A and V represent H, and the corresponding adjacent atom Z ¹ -Z ⁴ is C.

In some embodiments, one of B, X, A, and V is a halogen atom (e.g., fluorine), and the corresponding adjacent Z ¹ -Z ⁴ atom is C. In other embodiments, two of X, A, and V are a halogen atom or SR ² , where R ² is C _0-10 alkyl or C _2-10 alkenyl, optionally substituted with a heteroatom, carbocyclic ring, heterocyclic ring, aryl or heteroaryl; and the corresponding adjacent atom Z ² -Z ⁴ represents C. For example, each X and A may represent a halogen atom. In other examples, each X and A, if present, may be SR ² , where R ² is C _0-10 alkyl substituted with phenyl or pyrazine. In still further examples, V, A and X may be alkynyls, fluorinated alkyls such as CF ₃ , CH ₂ CF ₃ , perfluorinated alkyls, etc .; cyano, nitro, amides, sulfonylamides or carbonyl derivatives such as COR ² .

In each of the above formulas, U and X, V and A, if present, can independently represent NR ¹ R ² where R ¹ is H and R ² is C _1-10 alkyl optionally substituted with a heteroatom, C _3-6 cycloalkyl , an aryl or a 5-14 membered heterocyclic ring containing one or more N, O or S. If more than one NR ¹ R ² group is present in the compound of the invention, for example, when both A and U represent NR ¹ R ² in compound of any of the above formulas, then each R ¹ and each R ² are independently selected. In one example, R ² is C _1-10 alkyl substituted with an optionally substituted 5-14 membered heterocyclic ring. For example, R ² may be C _1-10 alkyl substituted with morpholine, thiomorpholine, imidazole, aminodithiadazole, pyrrolidine, piperazine, pyridine or piperidine. Alternatively, R ¹ and R ² together with N can form an optionally substituted heterocyclic ring containing one or more N, O or S. atoms. For example, R ¹ and R ² together with N can form piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or aminodithiadazole.

Illustrative examples of optionally substituted heterocyclic rings include, but are not limited to, tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran, tetrahydropiran, benzofuran, isobenzofuran, 1,3-dihydroisobenzofuran, isoxazole, 4,5-dihydroisoxazole, piperidine , pyrrolidin-2-one, pyrrole, pyridine, pyrimidine, octahydropyrrolo [3,4-b] pyridine, piperazine, pyrazine, morpholine, thiomorpholine, imidazole, aminodithiadazole, imidazolidine-2,4-dione, benzimidazole, 1,3-dihydrobenzene -2-one, indole, thiazole, benzothiazole, thiadiazole, thiophene, tetrahydro iofen 1,1-dioxide, diazepine, triazole, diazabicyclo [2.2.1] heptane, 2,5-diazabicyclo [2.2.1] heptane, 2,3,4,4a, 9,9a-hexahydro-1H-carboline.

In one embodiment, the present invention relates to compounds of general formulas (1), (2A) or (2B), where:

each of A, V and B, if present, independently represents H or a halogen atom (for example, a chlorine or fluorine atom);

X represents - (R ⁵ ) R ¹ R ² where R ⁵ is C or N, and where in each (R ⁵ ) R ¹ R ^{2 the} groups R ¹ and R ² together may form an optionally substituted aryl or heteroaryl ring;

Z represents NH or N-alkyl (for example, N-CH ₃ );

W together with N and Z form an optionally substituted 5- or 6-membered ring that is fused to an optionally substituted aryl or heteroaryl ring; and

U represents —R ⁵ R ⁶ - (CH ₂ ) _n —CHR ² —NR ³ R ⁴ , where R ⁶ is H or C _1-10 alkyl, and where in the group —CHR ² —NR ³ R ⁴ each R ³ and R ⁴ together with C can form an optionally substituted heterocyclic or heteroaryl ring, or where in the —CHR ² —NR ³ R ⁴ group each R ³ and R ⁴ together with N can form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.

In yet another embodiment, the present invention relates to compounds of general formulas (1), (2A) or (2B), in which:

And, if present, represents H or a halogen atom (for example, a chlorine or fluorine atom);

X, if present, represents - (R ⁵ ) R ¹ R ² where R ⁵ represents C or N, and where in each - (R ⁵ ) R ¹ R ^{2 the} groups R ¹ and R ² together may form an optionally substituted aryl or heteroaryl ring;

Z represents NH or N-alkyl (for example, N-CH ₃ );

W together with N and Z form an optionally substituted 5- or 6-membered ring that is fused to an optionally substituted aryl or heteroaryl ring; and

U represents —R ⁵ R ⁶ - (CH ₂ ) _n —CHR ² —NR ³ R ⁴ , where R ⁶ is H or alkyl, and where in the group —CHR ² —NR ³ R ⁴ each R ³ and R ⁴ together with C can form an optionally substituted heterocyclic or heteroaryl ring, or where in the —CHR ² —NR ³ R ⁴ group each R ³ and R ⁴ together with N can form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.

In each of the above formulas, each optionally substituted group can be substituted with one or more halogen atoms, OR ² , NR ¹ R ² , carbamate, C _1-10 alkyl, C _2-10 alkenyl, each optionally substituted with a halogen atom, C = O, aryl or one or more heteroatoms; inorganic substituents, aryl, carbocyclic or heterocyclic ring. Other substituents include, but are not limited to, alkynyl, cycloalkyl, fluorinated alkyls such as CF ₃ , OCH ₂ CF ₃ ; perfluorinated alkyls, etc .; oxidized fluorinated alkyls such as OCF ₃ or OCH ₂ CF ₃ , etc .; cyano, nitro, COR ² , NR ² COR ² , sulfonylamides; NR ² SOOR ² ; SR ² , SOR ² , COOR ² , CONR ² ₂ , OCOR ² , OCOOR ² ₂ , OCONR ² , NRCOOR ² , NRCONR ² ₂ , NRC (NR) (NR ² ₂ ), NR (CO) NR ² ₂ and SOONR ² ₂ , where each R ² has the meanings as defined for formula 1.

The present invention also relates to pharmaceutical compositions comprising a compound of any of the above formulas and a pharmaceutically acceptable excipient. In one example, the composition comprises a compound of any of the above formulas, polyethylene glycol and propylene glycol in a buffer solution.

In addition, the present invention relates to methods for inhibiting cell proliferation and / or inducing cell death, comprising contacting the system with an effective amount of a compound of any of the above formulas or a pharmaceutical composition thereof and optionally in combination with a chemotherapeutic agent, thereby inhibiting cell proliferation and / or inducing cell death, such as apoptosis or apoptotic cell death, in the specified system. The system may be a cell or tissue. In one embodiment, the system includes a pancreatic cell, such as a cell from a subject or a cultured cell (e.g., in vitro and ex vivo). In specific embodiments, the system includes a pancreatic cancer cell. In one embodiment, the system is a cell line such as PC3, HCT116, HT29, MIA Paca-2, HPAC, Hs700T, Panc 10.05, Panc 02.13, PL45, SW 190, Hs766T, CFPAC-1 and PANC-1.

The present invention also relates to methods for attenuating a cell proliferative disorder, comprising administering to a subject in need thereof an effective amount of a compound of any of the above formulas or a pharmaceutical composition thereof and optionally in combination with a chemotherapeutic agent, thereby attenuating said cell proliferative disorder. For example, cell proliferation can be reduced and / or cell death, such as apoptosis or apoptotic cell death, can be induced. A cell proliferative disorder may be a tumor or a malignant tumor in a human or animal. In a specific embodiment, the malignant tumor is a malignant disease of the pancreas, including non-endocrine and endocrine tumors. Illustrative examples of non-endocrine tumors include, but are not limited to, adenocarcinomas, exocrine carcinomas, glandular squamous cell carcinomas, giant cell tumors, intra-ductal papillary mucinous neoplasms, mucinous cystadenocarcinomas, pancreatoblastomas, pseudomonas cystic fibrosis, and serosomal celoid cystic The endocrine tumor may be a tumor of the islets of Langengharnes.

The above methods of inhibiting cell proliferation and / or inducing cell death can be used in practice in combination with a procedure and / or chemotherapeutic agent. Examples of procedures that can be used in combination with the methods of the present invention include, but are not limited to, radiation therapy or surgery. In some embodiments, the compounds of the present invention are administered in combination with gemcitabine and are used to inhibit cell proliferation, induce cell death and / or attenuate cell proliferative disorder.

In addition, the present invention relates to methods for reducing microbial titers, comprising contacting the system with an effective amount of a compound of any of the above formulas or a pharmaceutical composition thereof and optionally in combination with an antimicrobial agent, thereby reducing microbial titers. The system may be a cell or tissue. The present invention also relates to methods for attenuating a cell proliferative disorder, comprising administering to a subject in need thereof an effective amount of a compound of any of the above formulas or a pharmaceutical composition thereof and optionally in combination with an antimicrobial agent, thereby attenuating said microbial infection. The subject can be a person or an animal. Microbial titers can be titers of viruses, bacteria or fungi.

The present invention also relates to methods for determining the selectivity of the interaction between a compound of any of the above formulas and nucleic acids capable of forming a quadruplex structure, including: a) contacting the compound in the absence of a competitive molecule with three or more nucleic acids capable of forming a quadruplex structure, where each the nucleic acid is not a telomeric nucleic acid; b) determining the direct interaction between the compound and said three or more nucleic acids; and c) determining the selectivity of the interaction by comparing the data for determining the interaction. In one example, three or more nucleic acids comprise a nucleotide sequence located at the 5 ′ end of the nucleotide sequence of an oncogen. The oncogen can be MYC, HIF, VEGF, ABL, TGF, PDGFα, MYB, SPARC, HER, VAV, RET, H-RAS, EGF, SRC, BCL-1, BCL-2, DHFR or HMGA. When determining the selectivity of the interaction, the compound can be subjected to separate contact with each of these three or more nucleic acids in different containers. In addition, the selectivity of the interaction can be determined by comparing the values of the IC ₅₀ .

The compounds of the present invention may or may not interact with regions of DNA that can form quadruplexes. In some embodiments, the compounds of the present invention can bind and / or stabilize a “propeller” quadruplex. Examples of propeller quadruplexes include, but are not limited to, H-RAS, RET, BCL-1, DHFR, TGF-β, HIF-1α, VEGF, c-Myc or PDGFα. In another embodiment, the compound may bind and / or stabilize a “basket” quadruplex. For example, the compound may bind and / or stabilize BCL-2.

The present invention also relates to methods for inducing cell death, such as apoptotic cell death (apoptosis), comprising administering to a system or subject in need thereof an effective amount of a compound of any of the above formulas or its pharmaceutical composition and optionally in combination with a chemotherapeutic agent. The present invention also relates to methods of treating or alleviating a disorder mediated by overexpression of an oncogen, such as overexpression of c-Myc, comprising administering to the system or subject in need thereof an effective amount of a compound of any of the above formulas or its pharmaceutical composition, and optionally in combination with chemotherapeutic agent. The subject may be a human or animal, and the system may be a cell or tissue.

In another aspect, the present invention relates to methods for producing compounds of formula (3):

or formula (4),

comprising contacting an ester, NHR ¹ R ² and a Lewis acid, wherein said ester has the formula (5)

or formula (6)

where A, B, V, X, R ¹ , R ² , R ⁵ , Z, Z ¹ , Z ² , Z ³ , Z ⁴ and n have the meanings defined above for formula (1);

W together with N and Z form an optionally substituted 5- or 6-membered ring which is fused to an optionally substituted aryl or heteroaryl, wherein said aryl or heteroaryl may be monocyclic or fused with one or more rings and wherein said ring optionally contains a heteroatom;

W ¹ represents optionally substituted aryl or heteroaryl, which may be monocyclic or fused with one or more rings, and optionally contain a heteroatom;

Z ⁵ represents C or N, provided that Z ⁵ is C if Z represents O, S or NR ¹ , and an additional condition that Z and Z ⁶ are not N if Z ⁵ represents N; and

Z ⁶ , Z ⁷ and Z ⁸ independently represent C or N, provided that the two N are non-adjacent.

The present processes for preparing compounds of formula (3) include an amide combination of an ester with an amine in the presence of a Lewis acid such as aluminum chloride. Suitable Lewis acids may be selected by conducting control reactions and determining the amount of reaction product formed, as described below. For the present methods, hydrolysis of the ester into a carboxylic acid is not required before the amide coupling. Thus, the present methods are simpler. As shown in example 29, the present methods also provide higher yield and purity compared with the methods of the previous level, which require hydrolysis of the ester to acid (example 30).

In another embodiment, the Lewis acid has the formula ML _n , where L represents a halogen atom or an organic radical, n is 3-5, and M is an atom of an element of group III, an atom of an element of group IV, As, Sb, V, and Fe.

In the above methods, the contacting step can be carried out at room temperature. Alternatively, the ester, amine and Lewis acid can be reacted at a lower or higher temperature than room temperature, which can be determined by a person skilled in the art.

In one example, the contacting step involves reacting an ether and an amine in an organic solvent to form a solution, and reacting the solution with a Lewis acid. In one example, the organic solvent is methylene chloride. The reaction can also be carried out using other suitable solvents known in the art.

In one embodiment, an excess of amine with respect to the ether can be used. For example, the ratio of ether to amine may be 1: 2, 1: 1.5, or 1: 1.25.

In another embodiment, an equimolar amount of Lewis acid to amine can be used. Alternatively, more or less Lewis acid with respect to the amine can be used.

The above methods further include isolating a compound of any of the formulas above. The isolated compounds can be further purified using any methods known in the art. For example, the isolated compounds can be purified by column chromatography, recrystallization, or both.

In the above methods, the purity of the isolated compounds may range from 90 to 99%. For example, the isolated compounds may have a purity of 90 to 95%.

In the above methods, the ester can be reacted with NHR ¹ R ² ,

where R ¹ represents a group (CR ³ ₂ ) _n ;

R ² represents NR ³ R ⁴ ;

R ³ is H or C _1-6 alkyl;

n is 1-6; and

R ⁴ represents H or C _1-10 alkyl, or C _2-10 alkenyl, optionally containing one or more non-adjacent heteroatoms selected from N, O and S, and optionally substituted with a carbocyclic or heterocyclic ring; and

where in NR ³ R ⁴ groups R ³ and R ⁴ may form an optionally substituted ring, such as described above.

Figure 1-10 shows the activity of examples of the compounds of the present invention on the model of a transplant of a malignant tumor of the colon HCT-116.

Definitions

As used herein, the term “alkyl” refers to a carbon-containing compound and includes compounds containing one or more heteroatoms. The term “alkyl” also includes alkyls substituted with one or more substituents, including, but not limited to, OR ¹ , amino, amido, halogen atom, = O, aryl, heterocyclic groups or inorganic substituents.

As used herein, the term “carbocycle” refers to a cyclic compound containing only carbon atoms in the ring, while “heterocycle” refers to a cyclic compound containing a heteroatom. Carbocyclic and heterocyclic structures include compounds having monocyclic, bicyclic and multiple ring systems.

As used herein, the term “aryl” refers to a polyunsaturated, typically aromatic hydrocarbon substituent, while the terms “heteroaryl” or “heteroaromatic” refer to an aromatic ring containing a heteroatom. Aryl and heteroaryl structures include compounds having monocyclic, bicyclic and multiple ring systems.

As used herein, the term “heteroatom” refers to any atom that is not carbon or hydrogen, such as a nitrogen, oxygen, or sulfur atom.

Illustrative examples include, but are not limited to, 1,3-dioxolane, 2,3-dihydrofuran, pyran, tetrahydropiran, benzofuran, isobenzofuran, 1,3-dihydroisobenzofuran, isoxazole, 4,5-dihydroisoxazole, piperidine, pyrrolidine, pyrrolidine-2 -one, pyrrole, pyridine, pyrimidine, octahydropyrrolo [3,4-b] pyridine, piperazine, pyrazine, morpholine, thiomorpholine, imidazole, imidazolidin-2,4-dione, 1,3-dihydrobenzimidazole-2-one, indole, thiazole , benzothiazole, thiadiazole, thiophene, tetrahydrothiophene 1,1-dioxide, diazepine, triazole, guanidine, diazabicyclo [2.2.1] heptane, 2,5-diazabicyclo [2.2.1] hept en, 2,3,4,4a, 9,9a-hexahydro-1H-carboline, oxirane, oxetane, tetrahydropyran, dioxane, lactones, aziridine, azetidine, piperidine, lactams, and they may also include heteroaryls. Other illustrative examples include, but are not limited to, furan, pyrrole, pyridine, pyrimidine, imidazole, bezimidazole and triazole.

As used herein, the term “inorganic substituent” refers to substituents that do not contain carbon or contain carbon bound to elements other than hydrogen (for example, elemental carbon, carbon monoxide, carbon dioxide and carbonate). Examples of inorganic substituents include, but are not limited to, nitro, a halogen atom, sulfonyls, sulfinyls, phosphates, etc.

The terms “treat,” “treatment,” and “therapeutic effect,” as used herein, refer to suppressing or stopping cell proliferation (e.g., slowing or stopping tumor growth) or reducing the number of proliferating malignant cells (e.g., removing part or all of tumors). These terms also apply to reducing the titer of microorganisms in a system (i.e., in a cell, tissue, or in a subject) infected with a microorganism, reducing the rate of multiplication of microorganisms, stopping the number of symptoms or manifestation of a symptom associated with a microbial infection and / or the release of detectable amounts of microbes from the system. Examples of the microorganism include, but are not limited to, a virus, bacterium, or fungus.

As used herein, the term “chemotherapeutic agent” refers to a therapeutic agent that can be used to treat or ameliorate a cell proliferative disorder, such as a tumor or malignant disease. Examples of chemotherapeutic agents include, but are not limited to, an anti-neoplastic agent, an alkylating agent, a plant alkaloid, an antimicrobial agent, sulfonamide, an antiviral agent, a platinum-based agent, and antitumor agents known in the art. Specific examples of chemotherapeutic agents include, but are not limited to, cisplatin, carboplatin, busulfan, methotrexate, daunorubicin, doxorubicin, cyclophosphamide, mefalan, vincristine, vinblastine, chlorambucil, paclitaxel, gemcitabine, and others, e.g. , The Pharmacological Basis of Therapeutics (9 ^th Ed) (Goodman et al., Eds.) (McGraw-Hill) (1996) and 1999 Physician's Desk Reference (1998)).

As used in this description, the term "apoptosis" refers to the intrinsic cell self-destruction or suicidal program. In response to the “triggering” stimulus, the cells undergo a cascade of events, including wrinkling of cells, the formation of vesicles from cell membranes and the condensation and fragmentation of chromatin. These events lead to the transformation of cells into “clusters” of particles associated with membranes (apoptotic bodies), which are then absorbed by macrophages.

The present invention relates to quinolone derivatives of the general formulas (1), (2A) and (2B) and their pharmaceutically acceptable salts, esters and prodrugs. The present invention also relates to methods of using the compounds described herein, for example, for screening and treatment. The compounds of the present invention may or may not interact with regions of DNA that can form quadruplexes.

The compounds of the present invention having formulas (1), (2A) and (2B) are presented below:

where A, B, V, X, Z, Z ¹ , Z ² , Z ³ , Z ⁴ , X ² and n are as defined above.

Synthetic methods for preparing the compounds of the present invention are shown in Reaction Scheme 1 and in the Examples. Other synthetic methods known to those skilled in the art can also be used to prepare the compounds of the present invention. For example, various protecting groups can be used in the preparation of intermediates illustrated in side chain 1 (see, in particular, Example 31).

Reaction Scheme 1

The compounds of the present invention may be chiral. As used herein, the term, a chiral compound is a compound that differs from its mirror image and has an enantiomer. In addition, the compounds may be a racemate, or an isolated enantiomer, or a stereoisomer. Methods for synthesizing chiral compounds and methods for resolving a racemic mixture of enantiomers are well known to those skilled in the art. See, for example, March, Advanced Organic Chemistry, John Wiley and Sons, Inc., New York, (1985), incorporated herein by reference.

The compounds of the present invention were tested using screening tests, such as those described herein. Figure 1-10 presents data on the activity of an exemplary compound of the present invention in a xenograft model of a colon cancer of the colon NST-116. Some compounds did not show activity at this dose.

Illustrative examples of compounds having the above formulas are presented in table 1 (A-C) and in the examples. The present invention also includes other compounds of any of formulas (1), (2A) and (2B) containing the substituents U, A, X, V and B, independently selected from the substituents shown in table 1 (A-C) and in the examples . For example, the isopropyl substituent in the last two compounds in Table 1A can be replaced with an acetyl substituent or N-CH ₃ in the fused ring can be replaced with an NH-group. In addition, the fluorine atom can be replaced with H. Thus, the present invention is not limited to the specific combination of substituents described in the various embodiments presented below.

Table 1A

Table 1B

The compounds described herein can interact with nucleic acid regions that can form quadruplexes. Since the regions of DNA that can form quadruplexes are regulators of biological processes, such as transcription of an oncogen, modulators of the biological activity of quadruplexes can be used as drugs for the treatment of malignant diseases. Molecules that interact with regions of DNA that can form quadruplexes can exert a therapeutic effect on certain cellular proliferative disorders and related conditions. In particular, abnormally high oncogen expression can lead to the development of cell proliferative disorders, and, as a rule, quadruplex structures lead to a decrease in oncogen expression. Examples of oncogenes include, but are not limited to, MYC, HIF, VEGF, ABL, TGF, PDGFA, MYB, SPARC, HUMTEL, HER, VAV, RET, H-RAS, EGF, SRC, BCL1, BCL2, DHFR, HMGA and others oncogenes known to specialists in this field. In addition, the compounds described herein can induce cell death (eg, apoptosis) and may not interact with DNA regions that can form quadruplexes.

Molecules that bind to regions of DNA that can form quadruplexes are capable of exhibiting biological activity through various mechanisms, which include, for example, stabilization of the natural quadruplex structure, inhibiting the conversion of the natural quadruplex to DNA duplex by blocking chain cleavage and stabilization of the natural quadruplex structure having a nucleotide substitution leading to destabilization of the quadruplex, and other specific interactions of sequences. Thus, compounds that bind to regions of DNA that can form the quadruplexes described herein can be introduced into cells, tissues or organisms in order to reduce the transcription of the oncogen and thereby treat cell proliferative disorders.

Determining how the biological activity of natural DNA, which can form quadruplexes, is modulated in a cell, tissue, or organism, can be done by monitoring the biological activity of the quadruplex. The quadruplex-forming regions of DNA biological activity can be traced in cells, tissues or organisms, for example, when determining a decrease or enhancement of gene transcription in response to the interaction of the quadruplex-forming DNA with the molecule. Transcription can be detected by direct determination of RNA transcripts or by the determination of polypeptides translated by transcripts, and these methods are well known to those skilled in the art.

Molecules that interact with quadruplex DNA or quadruplex nucleic acids can be used to treat many cellular proliferative disorders. Cell proliferative disorders include, for example, colon cancer and malignant diseases of the hematopoietic system (i.e., diseases including hyperplastic / neoplastic cells of hematopoietic origin, such as those originating from myeloid, lymphoid or erythroid cells or their progenitor cells). As a result of poorly differentiated acute leukemia, for example, erythroblastic leukemia and acute megakaryoblastic leukemia can develop. Additional myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myeloid leukemia (AML), and chronic acute myeloid leukemia (CML) (Vaickus, Crit. Rev. in Oncol./Hemotol. 11: 267-297 ( 1991) Lymphoid malignancies include, but are not limited to, acute lymphoblastic leukemia (ALL), which includes B-cell ALL and T-cell ALL, chronic lymphocytic leukemia (CLL), multilymphocytic leukemia (PLL), leukemic reticulosis (HLL) and Waldenstrom macroglobulinemia (WM) .Additional forms of maladies Essential lymphomas include, but are not limited to, non-Hodgkin lymphoma and its variants, T-cell peripheral lymphomas, T-cell leukemia / adult lymphoma (ATL), T-cell skin lymphoma (CTCL), large-cell granular lymphocytic leukemia (LGF) , Hodgkin's disease and Reed-Sternberg disease Cell proliferative disorders also include malignant tumors of the colon, breast, lung, pancreas, lymph nodes, colon, prostate, brain, head and neck, skin, liver, kidney and heart. Compounds that interact with regions of DNA that can form quadruplexes can also be used to specifically target processes and conditions associated with malignant tumors, such as enhanced angiogenesis, suppression of angiogenesis in a subject.

The present invention relates to a method for inhibiting cell proliferation or treating or attenuating cell proliferative disorders, comprising contacting a system containing natural DNA capable of forming a quadruplex region with a compound of any of the above formulas. The system may be a group of cells or one or more tissues. In one embodiment, the system is a subject in need of treatment for a cell proliferative disorder (eg, a mammal, such as a mouse, rat, monkey, or human). The present invention also relates to a method for treating a colon cancer, administering a compound that interacts with the quadruplex-forming region of c-MYC, a subject in need thereof, thereby inhibiting cell proliferation of the colon cancer. In addition, the present invention relates to a method for suppressing angiogenesis and optionally treating a malignant tumor associated with angiogenesis, comprising administering a compound that interacts with the quadruplex region of vascular endothelial growth factor (VEGF) to a subject in need thereof, thereby inhibiting angiogenesis, and optional treatment of a malignant tumor associated with angiogenesis.

Compounds that interact with quadruplex-forming regions of DNA can also be used to suppress microbial infections, such as viral infections. Retroviruses are potential targets for drugs with targeted effects on the G-quadruplex. G-quadruplex structures are present as functional elements in at least two secondary structures formed by viral RNA or DNA in HIV, a dimeric linker structure (DLS), and a central DNA fragment (CDF). Additionally, DNA aptamers that are capable of accepting inter- or intramolecular quadruplex structures are capable of inhibiting viral replication. In one example, DNA aptamers are capable of inhibiting viral replication by targetedly acting on a glycoprotein envelope (presumably). In another example, DNA aptamers suppress virus replication by targeted action on integrase-HIV, respectively, on the basis of which we can assume the participation of natural quadruplex structures in interaction with the integrase enzyme.

Dimeric linker structures that are common to all retroviruses serve to bind two copies of the viral genome through non-covalent interaction between the two 5'-ends of two viral RNA sequences. The genomic dimer is stably bound to a gag protein in a mature viral particle. In the case of HIV, this non-covalent binding is provided by a sequence of 98 base pairs containing several residues of at least two consecutive guanines (for example, at the 3'-end for the formation of RNA dimers in vitro). As a result of the observed dependence on the cation (potassium ions) for the formation and stability of the dimer in vitro, in addition to the lack of the ability of the antisense sequence to efficiently dimerize, it was established that the intermolecular G-quadruplex is the most likely structure for binding.

Before integration into the host genome, the reverse transcribed viral DNA forms a pre-integration complex (PIC) with at least two major viral proteins, integrase and reverse transcriptase, which is then transferred to the nucleus. The central DNA fragment (CDF) refers to a single-stranded tail + chain of 99 bases near the center of the viral duplex-DNA, which is known to play a role in entry into the PIC nucleus. It was shown that oligonucleotide mimetics form intermolecular G-quadruplex structures in cell-free systems.

Thus, compounds that recognize quadruplex-forming regions can be used to stabilize the dimeric linker structure and thus prevent the separation of the two RNA chains. Also, when binding to a quadruplex structure formed by CDF, recognition and / or protein binding for PIC transport to the nucleus may be impaired. In any case, there may be a significant advantage over other antiviral drugs. Modern highly active antiviral therapeutic regimens (HAART) are based on the use of combinations of drugs in their action aimed at HIV protease and HIV integrase. The need for multi-drug regimens is to minimize the risk of developing resistance, which usually develops rapidly when drugs are used alone. The reason for this rapid development of resistance is the variability of the reverse transcriptase enzyme, which undergoes mutations at a frequency of about one for every 10,000 base pairs. The advantage of targeted action on viral quadruplex structures compared with target proteins is that the development of resistance is slower or even impossible. The point mutation of the target quadruplex can disrupt the integrity of the quadruplex structure and lead to the appearance of a non-functional copy of the virus. A single drug based on such a mechanism of action can replace a regimen using many currently used drugs, with the ensuing advantages of lower cost of treatment and the elimination of the negative effects of drug-drug interactions.

The present invention relates to a method for reducing a microbial titer in a system, comprising contacting a system having a naturally occurring quadruplex forming DNA region with a compound of any of the above formulas. A system may represent one or more cells or tissues. Examples of microbial titers include, but are not limited to, titers of viruses, bacteria, or fungi. In a particular embodiment, the system is a subject in need of treatment for a viral infection (eg, a mammal, such as a mouse, rat, monkey, or human). Examples of viral infections include infections caused by hepatitis B virus (e.g., hepatitis B or C), human immunodeficiency virus (HIV), rhinovirus zoster virus (VZV), herpes simplex virus (e.g. HSV-1 or HSV-2), cytomegalovirus (CMV), vaccine virus, influenza virus, encephalitis virus, gantavirus, arbovirus, West Nile fever virus, human papilloma virus (HPV), Epstein-Barr virus and respiratory syncytial virus. The present invention also relates to a method for treating HIV infection by administering a compound of any of the above formulas to a subject in need thereof, thereby suppressing HIV infection.

Identification of compounds that can bind to quadruplex forming DNA regions.

The compounds described herein can bind to quadruplex forming regions of DNA, where the biological activity of a given region, often expressed as a “signal”, reproduced in a system containing a compound, is different from a signal produced in a system containing no compound. Although background signals can be determined each time a new molecule is evaluated in a test, background signal detection is not required every time a new molecule is analyzed.

Examples of quadruplex-forming nucleotide sequences are presented in the following table 2.

table 2

In addition to determining how much the test molecule or test nucleic acid induces a different signal, the affinity of the interaction between the nucleic acid and the compound can be quantified. A comparative analysis of the threshold values of IC ₅₀ , Kd and Ki and the established values of IC ₅₀ or Kd for each interaction can be performed, and thus the test molecule can be identified as a molecule interacting with a quadruplex or the test nucleic acid as a quadruplex nucleic acid. For example, IC ₅₀ or Kd thresholds of 10 μM or lower, 1 μM or lower, and 100 nM or lower are often used. In one example, thresholds of 10 nM or lower, 1 nM or lower, 100 pM or lower and 10 pM or lower can be used to identify molecules interacting with the quadruplex and forming the quadruplex of nucleic acids.

Many tests exist to identify compounds that have affinity for quadruplex forming DNA regions. In some of these tests, the biological activity is the binding of a quadruplex nucleic acid to the compound, and the binding is determined as a signal. In other tests, biological activity is blocking the quadruplex polymerase function, and the degree of blocking is determined as a signal. In some tests, the biological activity is transcription, and transcription levels can be quantified as a signal. In another test, biological activity is cell death, in which case the number of cells that underwent death is quantified. In other tests, the proliferation rate of malignant cells is determined. Examples of tests are fluorescence binding tests, gel mobility change analysis (see, for example, Jin & Pike, Mol. Endocrinol. (1996) 10: 196-205), polymerase blocking tests, reporter transcription tests, cancer cell proliferation tests, and evaluation tests apoptosis (see, for example, Amersham Biosciences (Piscataway, New Jersey), and embodiments of such tests are described below. To determine how interacting with the quadruplex molecules have topoisomerase activity, tests based on ac ivnosti topoisomerase (see., e.g., TopoGEN, Inc. (Columbus, Ohio)).

Gel Electrophoretic Mobility Change Test (EMSA)

The EMSA test is suitable for determining how much a nucleic acid forms a quadruplex and how much a nucleotide sequence is a destabilizing quadruplex. EMSA is carried out as previously described (Jin & Pike, Mol. Endocrinol. 10: 196-205 (1996)), with minor modifications. In general, synthetic single-stranded oligonucleotides are labeled at the 5'-end with T-kinase in the presence of [ ³² P] ATP (1000 mCi / mol, Amersham Life Science) and purified on a Sephadex column. Then ³² P-labeled oligonucleotides (≈30000 cpm) are incubated with and / or without the test compound in various concentrations in 20 μl of buffer containing 10 mM Tris pH 7.5, 100 mM KCl, 5 mM dithiothreitol, 0.1 mM EDTA, 5 mM MgCl ₂ , 10% glycerol, 0.05% Nonedit P-40 and 0.1 mg / ml poly (dI-dC) (Pharmacia). After incubation for 20 minutes at room temperature, the binding reaction mixtures were applied to a 5% polyacrylamide gel in 0.25 × borate-EDTA buffer (0.25 × TBE, 1 × TBE equal to 89 mM Tris-borate, pH 8.0, 1 mM EDTA). The gel is dried and each lane is quantified using a phosphate imager.

DMS methylation protection test

Chemical footprinting tests are useful for determining quadruplex structure. The quadruplex structure is evaluated when determining which nucleotides in a nucleic acid are protected or unprotected from chemical modification, as inaccessible or available, for a modifying reagent. The DMS methylation test is an example of a chemical footprint test. In this test, EMSA bands were isolated and subjected to DMS-induced band cleavage. Each strip of interest is cut out of the gel to determine the change in electrophoretic mobility and immersed in a 100 mM KCl solution (300 μl) for 6 hours at 4 ° C. The solutions were filtered (microcentrifuged) and 30,000 cpm (per reaction mixture) of the DNA solution was diluted with an additional 100 mM KCl in 0.1 × TE to a total volume of 70 μl (per reaction mixture). After adding 1 μl of salmon sperm DNA (0.1 μg / μl), the reaction mixture was incubated with 1 μl of a DMS solution (DMS: ethanol; 4: 1, v / v) for a period of time. Each reaction mixture was quenched with 18 μl stop buffer (b-mercaptoethanol: water: NaOAc (3M); 1: 6: 7; v / v / v). After ethanol precipitation (twice) and piperidine cleavage, the reaction mixtures were separated on a preparative gel (16%) and visualized on a phosphate imager.

Polymerase Blocking Test

The blocking test includes a nucleic acid matrix that may contain a quadruplex forming sequence, a nucleic acid primer that hybridizes to the 5'end of the nucleic acid matrix forming a quadruplex sequence. The primer is extended using a polymerase (e.g., Taq polymerase), which advances from the primer along the nucleic acid template. In this test, the quadruplex structure can block or stop the progress of the enzyme, leading to the formation of shorter transcriptional fragments. Also, a blocking test can be performed at various temperatures, including 45 ° C and 60 ° C, and at various ion concentrations.

An example of a Taq polymerase stop test is described by Han et al., In Nucl. Acids Res. (1999) 27: 537-542, this method is a modification of the method used by Weitzmann et al., J. Biol. Chem. (1996) 271: 20958-20964. Briefly, a reaction mixture of a DNA template (50 nM), Tris · HCl (50 mM), MgCl ₂ (10 mM), DTT (0.5 mM), EDTA (0.1 mM), BSA (60 ng) and labeled at the 5'-end of the quadruplex nucleic acid (≈18 nM), it is heated to 90 ° C in 5 minutes and cooled to room temperature in 30 minutes. Taq polymerase (1 μl) was added to the reaction mixture and the reaction mixture was kept at a constant temperature for 30 minutes. After making 10 μl of a stop buffer (formamide (20 ml), 1 M NaOH (200 μl), 0.5 M EDTA (400 μl) and 10 mg bromophenol blue), the reaction mixtures were separated in a preparative gel (12%) and visualized on a phosphophore analyzer. Adenine sequencing (indicated by “A” in the upper part of the gel) was carried out using a double-stranded DNA sequencing system manufactured by Life Technologies. The general sequence of the template chains is TCCAACTATGTATAC-insert-TTAGCGACACGCAATTGCTATTAGTGAGTCGTATTA, where “insert” refers to a nucleic acid sequence containing a quadruplex sequence (see, for example, Table 2). Stripes on the gel, showing less mobility, indicate the formation of a quadruplex.

High Throughput Polymerase Blocking Test

A high throughput polymerase blocking test has been developed. The test involves the interaction of a matrix nucleic acid, usually DNA, with a primer, which is also often DNA; the interaction of the primer / matrix complex with the compound described herein (also applies to the “test compound”); contacting the primer / matrix complex with polymerase; and separating the reaction products. The test often includes the step of denaturing the primer / matrix complex mixture and then the complex renaturation, which is usually carried out before the test molecule is introduced into the system. Typically, many tests are conducted using various concentrations of the test compound so that, for example, an IC ₅₀ value can be set. Often, reaction products include extended primers of various lengths. In those cases where the test compound does not significantly interact with the quadruplex structure in the matrix, the primer usually extends at the end of the matrix.

In cases where the test compound substantially interacts with the quadruplex structure in the matrix, the primer usually grows only in the quadruplex structure in the matrix and not further. Thus, typically a reaction mixture comprises at least two reaction products when the test compound interacts with a quadruplex structure in the matrix, one with a fully extended primer and one with a not fully extended primer, and the two reaction products are separated. Products can be separated using any suitable separation method, such as mass spectrometry and, in one embodiment, capillary electrophoresis.

Typically, reaction products are identified by detecting a detectable label bound to the primer. The detectable label may be non-covalently linked to the 5'-end of the primer (for example, a biotin molecule covalently linked to the 5'-end of the primer that is non-covalently linked to the avidin molecule associated with the detected label). The detectable label can be linked to the primer at any stage of the test, sometimes before introducing the primer into the system, after extending the primer, or after separating the products. Typically, a detectable label is covalently coupled to a primer using a technique based on the nature of the chemical groups in the detectable label.

There are many methods for covalently linking detectable labels to nucleic acids, such as chemically combining an allylamine derivatized nucleotide with a derivative of a detectable label and then primer using a labeled nucleotide (see, for example, Nature Biotech. (2000) 18: 345- 348 and at http://info.med.yale.edu/genetics/ward/tavi/n_coupling.html). In some cases, a spacer (typically 5-16 carbon atoms) is included between the detectable label and the nucleotide. You can use any suitable detectable label, including, but not limited to, a radioactive isotope (for example, ¹²⁵ I, ¹³¹ I, ³⁵ S, ³² P, ¹⁴ C and ³ N); a light scattering label (for example, spherical gold or silver; Genicon Sciences Corporation, San Diego, CA and US Patent No. 6214560); an enzyme or protein tag (e.g., GFP or peroxidase) or, in some cases, use another chromogenic tag or paint. Often a fluorescent label (e.g. aminomethylcoumarin (AMCA); diethylaminomethylcoumarin (DEAC); cascade blue (CB); fluorescein isothiocyanate (FITC); oregon green (OG); Alexa 488 (A488); rhodamine green (RGr) antioxidant; , europium), carboxyrodamine 6G (R6G); tetramethylrodamine (TAMRA); Texas Red (TxR); Cy3; Cy3.5; Cy5; Cy5.5; and carboxyneftofluorescein (CNF), digoxygenin (DIG) and 2,4-dinitrophenyl ( DNP)). Other fluorophores and corresponding excitation and emission wavelengths are described by Anantha et al., Biochemistry (1998) 37: 2709-2714 and Qu & Chaires, Methods Enzymol., (2000) 321: 353-369).

In one embodiment, an oligonucleotide primer covalently linked to a fluorescent label is contacted with template DNA. The resulting complex is contacted with a test molecule and then with a polymerase capable of extending the primer. Then the reaction products are separated and detected by capillary electrophoresis. A primer with a longer sequence was used to practice this embodiment compared to embodiments in which the primer comprises a covalently linked fluorophore or when capillary electrophoresis is not used for separation. Deoxynucleotides are added at any stage of the test prior to separation, usually when the primer is in contact with the DNA template. Typically, the DNA matrix / primer complex is denatured (for example, when the temperature of the system is increased) and then renaturated (for example, when the system is cooled) before the test compound is added).

Quadruplex binding test

Typically, a 5'-fluorescently labeled (FAM) primer (P45, 15 nM) was mixed with a DNA template (15 nM) in Tris-HCl buffer (15 mM Tris, pH 7.5) containing 10 mM MgCl ₂ , 0.1 mm EDTA and 0.1 mm mixture of deoxynucleotide phosphates (dNTP). In one example, FAM-synthesized primer P45 (5'-6FAM-AGTCTGACTGACTGTACGTAGCTAATACGACTCACTATAGCAATT-3 ') (SEQ ID NO 17) and template DNA c-Myc (5'-TCCAACTATGTATACTGGGGAGGGTGGGGAGGGTGGGGAAGGTTAGCGACACGCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT-3') (SEQ ID NO 18) and purified by HPLC chromatograph manufactured by Applied Biosystems. The mixture was denatured at 95 ° C for 5 min and, after cooling to room temperature, incubated at 37 ° C for 15 min.

After cooling to room temperature, 1 mM KCl and the test compound (at various concentrations) were added and the mixture was incubated for 15 min at room temperature. Primer extension was performed by adding 10 mM KCl and Taq DNA polymerase (2.5 U / reaction, Promega) and incubating at 70 ° C for 30 min. The reaction was stopped by adding 1 μl of the reaction mixture to 10 μl of Hi-Di formamide and 0.25 μl of LIZ120 size standard. Hi-Di formamide and LIZ120 size standard were obtained from Applied Biosystems. The partially elongated quadruplex blocking product measured between 61-62 bases, and the full-sized elongated product was 99 bases in length. The products were separated and analyzed by capillary electrophoresis. Capillary electrophoresis was performed using an ABI PRISM 3100-Avant Genetic Analyzer. The test was carried out using the compounds described above, and its results are shown in table 1. The concentration values in μM shown in table 1 are the concentrations at which 50% DNA blocking in the test takes place (i.e., the ratio of the shorter partially extended DNA (blocked DNA) to full-sized DNA is 1: 1).

Reporter transcription test

In the transcription determination reporter test, the test quadruplex of DNA is combined with the reporter system in such a way that the formation or stabilization of the quadruplex structure can modulate the reporter signal. An example of such a system is a reporter expression system in which a polypeptide, such as luciferase or green fluorescent protein (GFP), is expressed by a gene operably linked to a potential quadruplex forming nucleic acid, and expression of the polypeptide can be detected. As used herein, the term “operably linked” refers to a nucleotide sequence that is under the control of a sequence containing a potential quadruplex forming nucleic acid. A sequence can be operably linked when it is in the same nucleic acid as the quadruplex of DNA, or in a different nucleic acid. In this case, an exemplary luciferase reporter system is described.

The luciferase promoter test described by He et al., Science (1998) 281: 1509-1512 is often used to study quadruplex formation. In particular, the vector used for the test is presented in reference 11 of He et al. In this test, HeLa cells are transfected using the Lipofectamine 2000-based system (Invitrogen) according to the manufacturer's protocol using 0.1 μg pRL-TK (Renilla luciferase reporter plasmid) and 0.9 μg quadruplex forming plasmid. Firefly and Renilla luciferase activity was determined using a double luciferase reporter (Promega) test in a 96-well plate format according to the manufacturer's protocol.

Circular Dichroism Test

Circular dichroism (CD) is used to determine how much another molecule interacts with a quadruplex nucleic acid. The CD is particularly suitable for determining whether a PNA or PNA peptide conjugate hybridizes with a quadruplex nucleic acid in vitro. PNA probes are added to the quadruplex of DNA (each 5 μM each) in a buffer containing 10 mM potassium phosphate (pH 7.2) and 10 or 25 mM KCl at 37 ° C and then incubated for 5 min at the same temperature before removal spectrum. CD spectra are recorded on a Jasco J-715 spectropolarimeter equipped with a thermoelectrically controlled single-cell holder. Typically, CD intensity is determined at wavelengths ranging from 220 nm to 320 nm and comparative spectra are obtained for one DNA quadruplex, one PNA and DNA quadruplex with PNA to determine the presence or absence of interaction (see, for example, Datta et al., JACS ( 2001) 123: 9612-9619). Spectra are arranged to obtain an average of eight scans recorded at a speed of 100 nm / min.

Fluorescence binding test

An example of a fluorescence binding test is a system that includes a quadruplex nucleic acid, a signal molecule, and a test molecule. The signal molecule generates a fluorescence signal upon binding to a quadruplex nucleic acid (e.g., N-methylmesoporphyrin IX (NMM)), and the signal changes when the test compound competes with the signal molecule for binding to a quadruplex nucleic acid. A change in signal when a test molecule is present compared to when there is no test compound is an indication that the test compound interacts with the quadruplex.

50 μl of a quadruplex nucleic acid or a nucleic acid that is not capable of forming a quadruplex is added to a 96-well plate. Test compound is also added in various concentrations. A typical test is carried out in 100 μl of 20 mM HEPES buffer, pH 7.0, 140 mM NaCl and 100 mM KCl. Then add 50 ml of the signal molecule of NMM to a final concentration of 3 mm. NMM is obtained from Frontier Scientific Inc., Logan, Utah. Fluorescence intensity is measured at an excitation wavelength of 420 nm and an emission wavelength of 660 nm using a FluroStar 2000 fluorimeter (BMG Labtechnologies, Durham, NC). Typically, a plot is plotted as a function of the concentration of the test compound or quadruplex nucleic acid of the target and the maximum fluorescence signals for NMM in the absence of these molecules.

Cell Proliferation Test

In the test for determining the proliferation of malignant cells, the level of cell proliferation is evaluated as a function of various concentrations of test compounds added to the cell culture medium. In this test, any type of cancer cell can be used. In one embodiment, colon cancer cells are cultured in vitro and test compounds are introduced into the culture medium at various concentrations. A suitable colon cancer cell line is colo320, which is a colon adenocarcinoma cell line deposited at the National Institute of Health under accession number JCRBO225. Parameters for using such cells are available at http://cellbank.nihs.go.jp/cell/data/jcrb0225.htm.

Formulation of compounds

As used herein, the term “pharmaceutically acceptable salts, esters and amides” includes, but is not limited to, carboxylates, amino acid addition salts, esters and amides of the compounds, as well as their zwitterionic forms, which are known to those skilled in the art as suitable for human and animal applications (see, for example, Gerge SM et al., "Pharmaceuticals Salts", J. Pharm. Sci. (1977) 66: 1-19, this source is incorporated herein by reference).

Any suitable composition of the compounds described herein can be prepared. In cases where the compounds sufficiently possess basic or acidic properties to form non-toxic acidic or basic salts, it may be appropriate to administer the compounds in the form of salts. Examples of pharmaceutically acceptable salts are organic acid addition salts formed by acids that form a physiologically acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, α-ketoglutarate and α-glycerophosphate. Suitable inorganic salts can also be prepared including hydrochloride, sulfate, nitrate, bicarbonate and carbonate. Pharmaceutically acceptable salts are prepared using standard methods well known in the art. For example, pharmaceutically acceptable salts can be prepared by reacting a sufficiently basic compound, such as an amine, with a suitable acid to give a physiologically acceptable anion. You can also get salts of an alkali metal (e.g. sodium, potassium or lithium) or an alkaline earth metal (e.g. calcium) and a carboxylic acid.

The compound can be formulated as a pharmaceutical composition and administered to a mammalian host in need of such treatment. In one embodiment, the mammalian host is a human. You can use any suitable route of administration, including, but not limited to, oral, parenteral, intravenous, intramuscular, local or subcutaneous.

In one embodiment, the compound is administered systemically (eg, orally) in combination with a pharmaceutically acceptable excipient, such as an inert diluent or a cleavable food carrier. They can be incorporated into hard or soft gelatin capsules, compressed into tablets, or directly incorporated into a food product included in the patient's diet. For oral therapeutic management, the active compound can be combined with one or more excipients and used in the form of tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like. Such compositions and preparations will contain at least 0.1% of the active compound. The percentage of compositions and preparations may vary and may accordingly range from about 2 to 60% by weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dose will be provided.

Tablets, lozenges, pills, capsules and the like may also contain the following: binders such as tragacanth gum, gum arabic, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrant such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and you can also add a sweetener, such as sucrose, fructose, lactose or aspartame, or a flavoring substance, such as peppermint, wintergreen oil or a flavoring substance with a taste and smell of cherries. In the event that the unit dosage form is a capsule, it may contain, in addition to the substances of the above type, a liquid carrier such as vegetable oil or polyethylene glycol. Various other substances may be present as shells or for other modifications of the physical form of a solid unit dosage form. For example, tablets, pills or capsules can be coated with gelatin, wax, shellac or sugar and the like. The syrup or elixir may contain the active compound, sucrose or fructose as a sweetener, methyl or propyl parabens as preservatives, a colorant and a flavoring substance, such as a flavoring substance with a taste and smell of cherry or orange. Any substance used in the preparation of any unit dosage form is pharmaceutically acceptable and substantially non-toxic in the amounts used. In addition, the active compound can be incorporated into sustained release preparations and devices.

The active compound can also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in a buffered solution, usually phosphate buffered saline, optionally mixed with a non-toxic surfactant. It is also possible to prepare dispersions in glycerol, liquid polyethylene glycols, triacetin and their mixtures and in oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In some cases, the compound is formulated as a polymatrix composition for such administration (e.g., liposomes or microsomes). For example, liposomes are described in US Pat. No. 5,703,055 (Felgner et al.) And (Gregoriadis, Liposome Technology vols. I-III (2 ^nd ed. 1993).

Pharmaceutical dosage forms suitable for injection or infusion may include sterile aqueous solutions or dispersions, or sterile powders containing the active ingredient, which are adapted for the preparation of extempo sterile injectable or infusion solutions or dispersions, optionally encapsulated in liposomes. In all cases, the final dosage form must be sterile, liquid and stable under the conditions of manufacture and storage. The liquid carrier or solvent may be a solvent or a liquid dispersion medium containing, for example, water, ethanol, a polyol (e.g. glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, non-toxic glyceryl ethers, and suitable mixtures thereof. You can maintain the necessary fluidity, for example, obtaining liposomes, maintaining particle size in the case of dispersions or using surfactants. The action of microorganisms can be prevented using various antibacterial and antifungal agents, for example parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic substances, for example sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be achieved using absorption inhibiting agents such as aluminum monostearate and gelatin in the compositions.

Sterile injectable solutions are prepared by incorporating the active compound in the required amount in an appropriate solvent with various other ingredients indicated above, as required, followed by sterilization by filtration. In the case of sterile powders for the preparation of sterile injectable solutions, vacuum drying and lyophilization are the preferred methods of obtaining the active ingredient powder plus any additional desired ingredient present in solutions previously sterilized by filtration.

For topical use, the present compounds can be used in liquid form. The compounds are often administered in the form of compositions or preparations in combination with a dermatologically acceptable carrier, which may be solid or liquid. Examples of suitable dermatological compositions are known for applying the compounds to the skin (see, for example, Jacquet et al. (US Pat. No. 4,608,392), Geria (US Pat. No. 4,992,478), Smith et al. (US Pat. No. 4,559,157) and Wortzman ( U.S. Patent No. 4,820,508).

The compounds can be formulated with a solid carrier that contains fine solid particles such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Suitable liquid carriers include water, alcohols or glycols, or water-alcohol / glycol mixtures in which the present compounds can be dissolved or dispersed in effective amounts, optionally with non-toxic surfactants. Adjuvants, such as perfumes and additional antimicrobial agents, can be added to optimize properties for a given application. The resulting liquid compositions can be used from absorbent vapors used to impregnate bandages or other dressings, or sprayed onto the affected area using pump-type sprayers or aerosol sprayers. Also, thickeners such as synthetic polymers, fatty acids, salts and esters of fatty acids, fatty alcohols, modified celluloses or modified minerals can be used with liquid carriers for the preparation of dispensable pastes, gels, ointments, soaps and the like, for direct use on user skin.

Typically, the concentration of the compound in the liquid composition is in the range of from about 0.1 wt.% To about 25 wt.%, In some cases, from about 0.5 wt.% To about 10 wt.%. The concentration in a semi-solid or solid composition, such as a gel or powder, is usually from about 0.1 wt.% To about 5 wt.%, In some cases from about 0.5 wt.% To about 2.5 wt.%. The composition of the compound can be obtained in the form of a unit dosage form, which is prepared by conventional methods known in the pharmaceutical industry. Typically, such methods include mixing the compound with the pharmaceutical carrier (s) and / or excipient (s) in liquid form, or finely divided solid form, or both, and then shaping the product, if necessary.

Table 3 presents examples of compositions for use with the compounds described in this description. For example, a compound can be formulated in concentrations from 10 mg / ml to 20 mg / ml of a solution using these compositions. In table 3, the designation "D5W" refers to deionized water with 5% dextrose. The content of each component in each composition may vary without adversely affecting the activity of the compound. In one example, the compound is formulated in a solution containing polyethylene glycol and propylene glycol in a buffer solution, such as a phosphate buffer.

Table 3 Songs %
(w / w) Compound (ml) + solvent (ml) solvent pH pH of the resulting solution
(10 ml / ml) one. Mannitol four 35 ml + 35 ml 6.1 6.1 Sucrose 0.5 Deionized water with 5% dextrose 95.5 2. Mannitol four 35 ml + 35 ml 6 5.8 50 mM citrate buffer, pH 6.0 96 3. Mannitol four 35 ml + 35 ml 5 5 50 mM citrate buffer, pH 5.0 96 four. Mannitol four 35 ml + 35 ml 6 6 Deionized water with 5% dextrose 96 5. Test compound (20 mg / ml) one 35 ml + 35 ml 6.4 6.1 Deionized water with 5% dextrose 99 6. PEG-300 7 5 ml + 5 ml N / a 5.80 Propylene glycol 9 Deionized water with 5% dextrose 84 7. PEG-300 7 5 ml + 5 ml N / a 5.8 Propylene glycol 9 50 mM citrate buffer, pH 6.0 84 8. Mannitol four 5 ml + 5 ml N / a 5.7 PEG-300 twenty 50 mM citrate buffer, pH 6.0 76 9. Mannitol four 5 ml + 5 ml N / a 5.8 Propylene glycol 10 50 mM citrate buffer, pH 6.0 86

The composition of the compound can be presented in any dosage form, such as tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories and enemas. Also, the composition can be presented in the form of suspensions in an aqueous, non-aqueous or mixed medium. Aqueous suspensions may additionally contain substances that increase viscosity, including, for example, the sodium salt of carboxymethyl cellulose, sorbitol and / or dextran. Suspensions may also contain one or more stabilizers. The amount of the compound or its active salt or derivative thereof necessary for use in the treatment will vary not only depending on the particular salt selected, but also on the route of administration, the origin of the disease being treated, the age and condition of the patient, and ultimately from the decision of the attending physician or clinician.

Dosage

A suitable dose of a compound is usually determined by evaluating its activity in vitro in a cellular or tissue system and / or its activity in vivo in animals. For example, methods for extrapolating an effective dose from mice and other animals to humans are known in the art (see, for example, US Pat. No. 4,938,949). Such systems can be used to determine the LD ₅₀ (dose causing the death of 50% of the population) and ED ₅₀ (therapeutically effective dose in 50% of the population) of the compound. The ratio of toxic and therapeutic doses is a therapeutic index, and it can be expressed as the ratio of ED ₅₀ / LD ₅₀ . Dosages of the compound are often in the range of blood concentrations at which the ED _{50 has} little or no toxicity. Dosages may vary within this limit depending on the dosage form used and the route of administration used. For any compounds used in the methods described herein, a therapeutically effective dose can be initially set in cell culture assays. In some cases, the dose is set to reach plasma concentrations that include IC ₅₀ (i.e., the concentration of the test compound that provides half the maximum suppression of symptoms) according to in vitro tests, and this information is usually used to more accurately determining suitable doses for humans. Plasma concentrations can be determined, for example, by high performance liquid chromatography.

Another example of determining the effective dose for a subject is the ability to directly analyze the concentration of “free” and “bound” compounds in the blood serum of a test subject. When setting up such analyzes, antibody mimetics and / or "biosensors" obtained by molecular "imprinting" methods can be used. The compound is used as a matrix or “imprinting” molecule for the spatial organization of polymerizable monomers before their polymerization with catalytic reagents. Subsequent removal of the “imprinted” molecule leaves a polymer matrix that contains a repeated “negative reflection” of the compound and which is capable of selectively reproducing the molecule under biological test conditions (see, for example, Ansell et al., Current Opinion in Biotechnology (1996) 7: 89- 94 and Shea, Trends in Polymer Science (1994) 2: 166-173).

Such “imprinted” affinity matrices are suitable for ligand binding assays in which the immobilized component of monoclonal antibodies is replaced with an appropriately “imprinted” matrix (see, for example, Vlatakis et al., Nature (1993) 361: 645-647). By using an isotopic label, the “free” concentration of the compound can be easily determined and used for calculations of IC ₅₀ . It is also possible to construct such “printed” affinity matrices with the inclusion of fluorescent groups, the property of which emit photons in a definite way changes with local and selective binding of the compound. These changes can be easily analyzed in real time using the appropriate fiber-optic devices, which, in turn, allows you to quickly optimize the dose of the test subject based on its individual IC ₅₀ values. An example of such a “biosensor” is discussed by Kriz et al., Analytical Chemistry (1995) 67: 2142-2144.

Exemplary doses include milligram or microgram amounts of the compound per kg of subject or sample weight, for example, from about 1 μg per kg to about 500 mg per kg, from about 100 μg per kg to about 5 mg per kg, or from about 1 μg per kg to approximately 50 mg per kg. It is understood that suitable doses of a small molecule depend on the effectiveness of the small molecule with respect to expression or activity that undergo modulation. When one or more of these small molecules are administered to an animal (eg, a human) to modulate the expression or activity of a polypeptide or nucleic acid described herein, the physician, veterinarian or researcher may, for example, first prescribe a relatively low dose, followed by increasing the dose to obtaining an adequate response. In addition, it is clear that the specific dose for any particular animal will depend on various factors, including the activity of the particular compound used, age, body weight, general health, gender and diet of the subject, time of administration, route of administration, rate of excretion, any combination of drugs and degrees of expression or activity that undergo modulation.

The following examples are provided to illustrate, but not limit the invention.

Example 1

To a solution of magnesium chloride (6.74 g, 70.8 mmol) and potassium ethyl malonate (6.78 g, 39.8 mmol) in dry acetonitrile (100 ml) at 0 ° C was added dropwise 2,4-dichloro-5-fluorobenzoyl chloride (5.0 g, 22.1 mmol), maintaining the temperature of the mixture below 5 ° C. The mixture was stirred for another 30 minutes and triethylamine (6.1 ml, 44.25 mmol) was added dropwise, again maintaining the temperature of the mixture below 5 ° C, and the reaction mixture was stirred overnight. The mixture was concentrated in vacuo, diluted with toluene (250 ml) and 1N was added. HCl solution (100 ml) and the mixture was stirred for 30 minutes. The layers were separated, the organic layer was washed once more with 1N. HCl solution (100 ml) and brine (200 ml) and dried over sodium sulfate. Then the organic layer was filtered, concentrated in vacuo and purified on silica gel (ethyl acetate / hexane 1:10 mixture) to give the ketoester as an oil that solidified upon standing (5.02 g, 81% yield).

To a solution of ketoester (5.0 g, 18 mmol) in diglyme (50 ml) was added 2-chlorobenzotriazole (3.66 g, 21.6 mmol), followed by sodium hydride (1.52 g, 39.6 mmol), added in portions. 60% dispersion in oil) for 10 minutes The reaction mixture was heated to 160 ° C for 24 hours and allowed to cool to room temperature. The reaction was quenched with careful addition of water (250 ml), the resulting brown precipitate was removed by filtration and washed with water. The product was then dissolved in methylene chloride (300 ml), washed with brine and filtered through celite. The resulting organic layer was dried over sodium sulfate, filtered and concentrated in vacuo. The product was purified on silica gel (7% ethyl acetate in hexane) to give a cyclic compound (1.76 g, 26% yield) as a solid.

Example 2

To a solution of chloroester (250 mg, 0.66 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-pyrazine ethanethiol (81 μl, 0.66 mmol) and potassium carbonate (182 mg, 1.32 mmol) and the mixture was heated to 100 ° C over 2 hours. The mixture was allowed to cool to room temperature, water (50 ml) was added and stirring was continued overnight. The crude product was separated by filtration and purified by preparative TLC (2% methanol in methylene chloride) to give the crude product as a tan fine crystalline solid (122 mg, 38% yield).

Example 3

To a solution of ketoester (2.0 g, 7.2 mmol) in diglyme (20 ml) was added 2-dichlorobenzothiazole (1.76 g, 8.63 mmol), followed by sodium hydride (0.63 g, 15.8). mmol, 60% dispersion in oil) for 10 minutes The reaction mixture was heated to 160 ° C for 24 hours and allowed to cool to room temperature. The reaction was quenched with careful addition of water (200 ml), the resulting brown precipitate was removed by filtration and washed with water. The product was then dissolved in methylene chloride (30 ml), washed with brine and filtered through celite. The resulting organic layer was dried over sodium sulfate, filtered and concentrated in vacuo. The product was purified on silica gel (5% ethyl acetate in hexane) to give a cyclic compound (0.55 g, 18.8% yield) as a solid.

Example 4

To a solution of chloroester (250 mg, 0.61 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-pyrazine ethanethiol (75 μl, 0.61 mmol) and potassium carbonate (170 mg, 1.2 mmol) to 100 ° C over 2 hours. The mixture was allowed to cool to room temperature and water (50 ml) was added and stirring was continued overnight. The crude product was separated by filtration and purified by preparative TLC (2% methanol in methylene chloride) to give the pure product as a tan microcrystalline solid (125 mg, 40% yield).

Example 5

To a solution of ketoester (2.0 g, 7.2 mmol) in diglyme (20 ml) was added 2-chloro-6-methoxybenzotriazole (1.73 g, 8.63 mmol), followed by sodium hydride (0.63 g) , 15.8 mmol, 60% dispersion in oil) for 10 minutes The reaction mixture was heated to 160 ° C for 24 hours and allowed to cool to room temperature. The reaction was quenched with careful addition of water (200 ml), the resulting brown precipitate was removed by filtration and washed with water. The product was then dissolved in methylene chloride (30 ml), washed with brine and filtered through celite. The resulting organic layer was dried over sodium sulfate, filtered and concentrated in vacuo. The product was purified on silica gel (5% ethyl acetate in hexane) to give a cyclic compound (0.23 g, 7.6% yield) as a solid.

Example 6

To a solution of chloroester (220 mg, 0.54 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-pyrazine ethanethiol (66 μl, 0.54 mmol) and potassium carbonate (150 mg, 1.1 mmol) to 100 ° C over 2 hours. The mixture was allowed to cool to room temperature, water (50 ml) was added and stirring was continued overnight. The crude product was separated by filtration and purified by preparative TLC (2% methanol in methylene chloride) to give the crude product as a tan microcrystalline solid (75 mg, 28% yield).

Example 7

Ammonium formate (0.6 g, 4.0 mmol) was added to a suspension of chloro ether (0.25 g, 0.67 mmol) in glacial acetic acid (5 ml) and the mixture was degassed by passing argon for 2 min. Then palladium on charcoal (10% Degass type, 0.6 g) was added and the mixture was heated to 60 ° C for 1 h. More ammonium formate (0.1 g) and catalyst (0.1 g) were added and heating continued overnight . Finally, more ammonium formate and a catalyst (150 mg each) were added and heating was continued for 1.5 hours. The mixture was allowed to cool to room temperature, filtered through celite, the solvent was removed in vacuo and replaced with methylene chloride (100 ml). The organic fractions were washed with water (100 ml) and brine (100 ml) and dried over sodium sulfate. The solvent was removed in vacuo to give benzothiazole as a tan solid (153 mg, 67% yield).

Example 8

To a solution of fluoroether (50 mg, 0.15 mmol) in N-methylpyrrolidinone (NMP, 0.5 ml) was added 2-pyrazine ethanethiol (126 μl, 1.0 mmol) and potassium carbonate (40 mg, 0.3 mmol) and the mixture was heated to 100 ° C for 2 hours. The mixture was allowed to cool to room temperature, water (50 ml) was added and stirring was continued overnight. The crude product was separated by filtration and purified by preparative TLC (2% methanol in methylene chloride) to give the crude product as a tan microcrystalline solid (17 mg, 25% yield).

Example 9

Compound 1 (1.0 equiv, 399 mg, 1.06 mmol) and 1-isopropylpiperazine 2 (5.0 equiv, 0.76 ml, 5.31 mmol) were dissolved in N-methylpyrrolidinone (NMP, 5 ml). The resulting mixture was stirred at 120 ° C for 3 days. LC control indicated the formation of two main products 3 and 4 in equal amounts. The solution was poured into water and the resulting precipitate was separated by filtration. The two compounds were separated by flash chromatography on SiO ₂ (MeOH gradient 0.5 to 7% in CH ₂ Cl ₂ ) to give compound 3 (135 mg, 27% yield) and compound 4 (135 mg, 26% yield).

Compound 3: Rf = 0.40 (SiO ₂ , 5% MeOH in CH ₂ Cl ₂ ), LCMS (ES): 95% pure, m / z 468 [M + H] ⁺ .

Compound 4: Rf = 0.26 (SiO ₂ , 5% MeOH in CH ₂ Cl ₂ ), LCMS (ES): 95% pure, m / z 484 [M] ⁺ , 486 [M + 2] ⁺ .

Example 10

This example presents data for two specific compounds:

Quadruplex binding affinity Km = 5.5 μM

The average survival time of tumor cells (IC50) (staining with alamar blue)

Hela 2.8 μM PC3 2.7 μm HCT-116 1.1 μM

Quadruplex binding affinity Km = 4.5 μM

The average survival time of tumor cells (IC50) (staining with alamar blue)

Hela 2.7 μm PC3 0.52 μM HCT-116 0.57 μM

Example 11

In a three-necked flask equipped with a nitrogen inlet, potassium ethyl malonate (1.5 eq, 32.8 g, 0.192 mol) and MgCl ₂ (1.5 eq, 18.4 g, 0.193 mol) were suspended in acetonitrile (120 ml) with mechanical stirring. The suspension was cooled in an ice bath. A solution of 2,4,5-trifluorobenzoyl chloride (1.0 eq, 25 g, 0.128 mol) in acetonitrile (60 ml) was added dropwise. A solution of triethylamine (2.0 eq, 36 ml, 0.258 mol) in acetonitrile (50 ml) was added over 30 min, keeping the temperature of the mixture below 10 ° C with external cooling with an ice-salt mixture. The resulting very thick suspension was allowed to warm to room temperature. More acetonitrile (150 ml) was added to facilitate mixing of the suspension. The reaction mixture was stirred for 2 days and the volatiles removed in vacuo. A 10% aqueous solution of HCl and EtOAc was added and the mixture was stirred for 3 hours. The substance was extracted with EtOAc (3 ×). The combined extracts were washed with brine and dried over Na ₂ SO ₄ . After the solvent was evaporated in vacuo, the substance was recrystallized from 10% water / EtOH to give compound 1 as a white crystalline substance (17.8 g, 56% yield). LCMS (ES): 95% pure, m / z 269 [M + 23] ⁺ . A mixture of two tautomers.

Compound 1 (1.0 equiv, 3.27 g, 13.29 mmol) was dissolved in anhydrous DMF (30 ml). The solution was cooled on ice, K ₂ CO ₃ (3.0 eq, 5.51 g, 39.87 mmol) was added and the solution was stirred for 15 minutes. Carbon disulfide (1.5 eq, 1.20 ml, 19.86 mmol) was quickly added to the resulting white suspension, and the mixture was stirred at 0 ° C for 5 min. Methyl iodide (3.0 equiv, 2.5 ml, 40.2 mmol) was added dropwise via syringe and the reaction mixture was stirred at 0 ° C for 2 hours. After adding ice water, the compound was extracted with EtOAc (3 ×). The combined extracts were washed with water (1 ×) and brine (2 ×), dried over Na ₂ SO ₄ and the volatiles were removed in vacuo. With the addition of hexane and a small amount of EtOAc, the substance began to crystallize. The crude material was separated by filtration and recrystallized from hexane to give a white crystalline solid (3.27 g, 70% yield). LCMS (ES): 95% pure, m / z 373 [M + 23] ⁺ , 351 [M + 1] ⁺ .

Ethyl 3-oxo-3- (2,3,4,5-tetrafluorophenyl) propanoate (1.0 eq, 5.77 g, 21.84 mmol) was dissolved in a mixture of DMSO (55 ml) and water (12 ml). A solution of KOH (2.3 equiv, 2.82 g, 50.26 mmol) in water (25 ml) was added dropwise, keeping the temperature of the mixture below 15 ° C using an ice bath. After stirring for 15 minutes, a mixture of carbon disulfide (3.2 eq, 4.2 ml, 69.50 mmol) and iodomethane (3.8 eq, 5.2 ml, 83.35 mmol) was quickly added and the resulting mixture was stirred at room temperature during the night. After adding water, the substance was extracted with EtOAc (2 ×). The combined extracts were washed with water, dried over Na ₂ SO ₄ and the solvent was removed in vacuo. The compound was purified by flash chromatography on silica gel (5-15% EtOAc gradient in hexane) to give a yellow oil (1.69 g, 21% yield). LCMS (ES): 95% pure, m / z 323 [M + 1-EtO] ⁺ . ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.15 (t, J = 7.0, 3H), 2.40 (br s, 6H), 4.18 (q, J = 7.2, 2H), 7.54-7.60 (m, 1H) ppm.

Compound 2 (1.0 eq, 933 mg, 2.84 mmol), 2-aminothiophenol (5.0 eq, 1.52 g, 14.2 mmol) and NEt ₃ (4.0 eq, 1.59 g, 11.0 mmol) was mixed in anhydrous toluene (10 ml). The mixture was stirred at reflux for several hours. After removing the solvent in vacuo, the material was purified by sonication in EtOAc / hexane to give a solid (724 mg, 53% yield). LCMS (ES): 95% pure, m / z 485 [M + 1] ⁺ .

Compound 4 (1.0 equiv, 70 mg, 0.144 mmol) was mixed with DBU (4.0 equiv, 65 μl, 0.43 mmol) in toluene (1.5 ml). The solution was stirred at reflux for 45 minutes. The compound was purified by flash chromatography on silica gel (1% MeOH in CH ₂ Cl ₂ ). LCMS (ES): 95% pure, m / z 465 [M + 1] ⁺ .

Example 12

Compound 3 (1.0 equiv, 347 mg, 0.942 mmol) and 2-aminothiophenol (1.0 equiv, 0.10 ml, 0.943 mmol) were mixed in toluene (1 ml) and stirred at 130 ° C for 14 hours. After cooling some solid impurities were removed by filtration. The toluene solution was applied to a silica gel column. Toluene was first removed eluting with hexane. The column was then eluted with a 10-30% EtOAc gradient in hexane to give the intended compound. After evaporation of the volatiles, the solid was further purified by recrystallization from EtOAc / hexane. Compound 6 was isolated as a gray substance (62 mg, 18% yield). LCMS (ES): 90% pure, m / z 378 [M + 1] ⁺ .

Example 13

Compound 2 (1.0 equiv, 3.15 g, 8.99 mmol) and 2-aminothiophenol (1.1 equiv, 1.06 ml, 9.91 mmol) were mixed in toluene (150 ml). Nitrogen gas was passed into the solution for 10 minutes. The reaction mixture was stirred at reflux (in an oil bath T = 140 ° C) for 30 hours. Volatiles were removed in vacuo and CH ₂ Cl _{2 was} added. Solids were removed by filtration. The material was purified by flash chromatography on silica gel (10-50% EtOAc gradient in hexane) to give compound 7 as an off-white powder (576 mg, 18% yield). LCMS (ES): purity 90%, m / z 360 [M + 1] ⁺ .

Example 14

Compound 2 (1.0 equiv, 2.52 g, 7.20 mmol) was mixed with N-methylbenzene-1,2-diamine (1.2 equiv, 0.98 ml) and DIEA (1.2 equiv, 1, 5 ml) in toluene (10 ml) and the reaction mixture was stirred at 120 ° C for 1 day. Compound 8 was separated by filtration after cooling the reaction mixture (679 mg, 26% yield). LCMS (ES): 95% pure, m / z 358 [M + 1] ⁺ .

Example 15

Compound 7 (1.0 equiv, 392 mg, 1.09 mmol) and racemic tert-butyl 3- (pyrazin-2-yl) pyrrolidin-1-carboxylate (1.6 equiv, 436 mg, 1.74 mmol) were suspended in 1 ml of NMP. The mixture was heated with microwaves at 150 ° C for 20 minutes. Water was added and the resulting solid was separated by filtration. Purification by flash chromatography afforded compound 9 (265 mg, 50% yield) as a solid. LCMS (ES): 95% pure, m / z 489 [M + 1] ⁺ .

Example 16

Compound 6 (1.0 eq, 66 mg, 0.175 mmol) and racemic tert-butyl 3- (pyrazin-2-yl) pyrrolidin-1-carboxylate (3.8 eq, 165 mg, 0.661 mmol) were mixed in NMP (0 5 ml). The mixture was stirred at 200 ° C for 23 hours. After adding water, the resulting solid was removed by filtration. Purification by flash chromatography on silica gel (1-4% MeOH gradient in CH ₂ Cl ₂ ) gave compound 10 as a brown solid (70 mg, 79% yield). LCMS (ES): purity 90%, m / z 507 [M + 1] ⁺ .

Example 17

Compound 11 was prepared according to the procedure used for compound 10. The compound was purified by flash chromatography on silica gel (1-10% gradient of MeOH in CH ₂ Cl ₂ ) to give a solid (220 mg, 47%). LCMS (ES): 95% pure, m / z 486 [M + 1] ⁺ .

Example 18

Compound 8 (1.0 equiv, 202 mg, 0.56 mmol) was mixed with 2- (pyrazin-2-yl) ethanethiol (1.05 equiv, 76 μl) and K ₂ CO ₃ (1.2 equiv, 94 mg ) in NMP. The mixture was stirred for 3 hours at 80 ° C. After adding water, the solid was filtered and dried to give compound 12 (202 mg, 85% yield). LCMS (ES): 95% pure, m / z 477 [M + 1] ⁺ .

Example 19

Compound 8 (313 mg) was mixed with N-isopropylpiperazine (1.5 equiv, 188 μl) in NMP and the mixture was stirred at 90 ° C. for several hours. The compound was separated by filtration after adding water. Purification by flash chromatography on silica gel (MeOH / CH ₂ Cl ₂ mixture) afforded pure compound 13 (222 mg, 54% yield). LCMS (ES): 95% pure, m / z 465 [M + 1] ⁺ .

Example 20

Compound 9 (1.0 equiv, 181 mg, 0.370 mmol) and racemic 2- (1-methylpyrrolidin-2-yl) ethanamine (4.0 equiv, 0.21 ml, 1.499 mmol) were mixed in CH ₂ Cl ₂ (1 5 ml). AlCl ₃ (2.9 equiv, 142 mg, 1.06 mmol) was added and the solution was stirred for 22 hours. After removal of CH ₂ Cl ₂ in vacuo, the resulting suspension was treated with a saturated aqueous solution of tartaric acid (about 1 ml) and stirred until complete the disappearance of solids (approximately 1 h to complete hydrolysis). Water was added and the pH was adjusted to 14 by the addition of NaOH. The material was extracted with CH ₂ Cl ₂ (3 ×) and the combined extracts were washed with water (2 ×). After drying over Na ₂ SO _4, volatiles were removed in vacuo. The material was purified by flash chromatography (0.1-1% MeOH gradient in CH ₂ Cl ₂ ). The solution in CH ₂ Cl ₂ / MeOH was concentrated in vacuo. Addition of EtOAc precipitated Compound 14 as a yellow solid (93 mg, 44% yield). LCMS (ES): 95% pure, m / z 571 [M + 1] ⁺ .

The following compounds were prepared in a similar manner using the corresponding amines and quinolone ethyl esters.

Example 21

To a solution of quinolone ester (60 mg, 0.13 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (30 μl, 0.19 mmol) in methylene chloride (1.0 ml) was added aluminum chloride (25 mg, 0 , 19 mmol) and the reaction mixture was stirred for 30 minutes. The solvent was removed in vacuo and a saturated solution of L-tartaric acid (1.0 ml) was added, stirring for 45 minutes until the solid was completely dissolved. The aqueous solution was washed with methylene chloride (1.0 ml), made basic with 1N. NaOH solution and extracted with methylene chloride. The resulting extract was washed with brine, dried over sodium sulfate, filtered and the solvent was removed in vacuo. The resulting yellow substance was purified by preparative TLC (alumina, 2% methanol in CH ₂ Cl ₂ ) to give the product as a yellowish solid (30 mg, 43% yield).

Example 22

To a solution of quinol ester (60 mg, 0.13 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (25 μl, 0.17 mmol) in methylene chloride (1.0 ml) was added aluminum chloride (23 mg, 0 , 17 mmol) and the reaction mixture was stirred for 30 minutes. The solvent was removed in vacuo and a saturated solution of L-tartaric acid (1.0 ml) was added, stirring for 45 minutes until the solid was completely dissolved. The aqueous solution was washed with methylene chloride (1.0 ml), made basic with 1N. NaOH solution and extracted with methylene chloride. The resulting extract was washed with brine, dried over sodium sulfate, filtered and the solvent was removed in vacuo. The resulting yellow material was purified by preparative TLC (alumina, 2% methanol in CH ₂ Cl ₂ ) to give the product as a yellowish solid (30 mg, 46% yield).

Example 23

To a solution of quinolone ester (75 mg, 0.15 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (32 μl, 0.22 mmol) in methylene chloride (1.0 ml) was added aluminum chloride (29 mg, 0 , 22 mmol) and the reaction mixture was stirred for 30 minutes. The solvent was removed in vacuo and a saturated solution of L-tartaric acid (1.0 ml) was added, stirring for 45 minutes until the solid was completely dissolved. The aqueous solution was washed with methylene chloride (1.0 ml), made basic with 1N. NaOH solution and extracted with methylene chloride. The resulting extract was washed with brine, dried over sodium sulfate, filtered and the solvent was removed in vacuo. The resulting yellow substance was purified by preparative TLC (alumina, 2% methanol in CH ₂ Cl ₂ ) to give the product as a yellowish solid (30 mg, 34% yield).

Example 24

To a solution of quinolone ester (34 mg, 0.7 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (15 μl, 0.11 mmol) in methylene chloride (1.0 ml) was added aluminum chloride (15 mg, 0 , 11 mmol) and the reaction mixture was stirred for 30 minutes. The solvent was removed in vacuo and a saturated solution of L-tartaric acid (1.0 ml) was added, stirring for 45 minutes until the solid was completely dissolved. The aqueous solution was washed with methylene chloride (1.0 ml), made basic with 1N. NaOH solution and extracted with methylene chloride. The resulting extract was washed with brine, dried over sodium sulfate, filtered and the solvent was removed in vacuo. The resulting yellow substance was purified by preparative TLC (alumina, 2% methanol in CH ₂ Cl ₂ ) to give the product as a yellowish solid (28 mg, 73% yield).

Example 25

To a solution of quinolone ester (146 mg, 0.65 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (1 mmol) in methylene chloride (1.0 ml) was added aluminum chloride (1 mmol) and the reaction mixture was stirred for 30 minutes. The solvent was removed in vacuo and a saturated solution of L-tartaric acid (1.0 ml) was added, stirring for 45 minutes until the solid was completely dissolved. The aqueous solution was washed with methylene chloride (1.0 ml), made basic with 1N. NaOH solution and extracted with methylene chloride. The resulting extract was washed with brine, dried over sodium sulfate, filtered and the solvent was removed in vacuo. The resulting yellow material was purified by preparative TLC (alumina, 2% methanol in CH ₂ Cl ₂ ) to give the product as a yellowish solid (1.7 mg, 5% yield).

Example 26

Compound 3 (1.0 eq, 126 mg, 0.27 mmol) and amine 5 (2.0 eq, 68 μl, 0.54 mmol) were dissolved in anhydrous CH ₂ Cl ₂ (1 ml). AlCl ₃ (2.0 eq, 72 mg, 0.54 mmol) was added and the mixture was stirred at room temperature for 3 hours. Volatiles were removed in vacuo. The resulting suspension was treated with a saturated aqueous solution of tartaric acid (10 ml) and stirred until the solid disappeared completely (about 1 hour to complete hydrolysis). The solution was neutralized with 1N. NaOH solution (to adjust pH to 14) and the compound was extracted with CH ₂ Cl ₂ (4 ×). The organic phase was washed with a concentrated aqueous solution of sodium potassium tartrate, water (2 ×) and dried over Na ₂ SO ₄ . A solution of CH ₂ Cl _{2 was} concentrated. Addition of AcOEt caused crystallization of the intended compound. After filtration, Compound 6 was obtained as a yellow microcrystalline solid (76 mg, 53% yield). LCMS (ES): 95% pure, m / z 536 [M + 1] ⁺ . ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.12 (d, J = 6.6, 6H), 1.80 (br s, 4H), 2.62 (br s, 4H), 2, 79 (m, 7H), 3.36 (m, 4H), 3.67 (q, J = 6.0, 2H), 7.45 (t, J = 7.2, 1H), 7.53 (td, J = 7.3, J = 1.3, 1H), 7.84 (dd, J = 7.8, J = 1.2, 1H), 7.89 (d, J = 6.9 , 1H), 8.16 (d, J = 13.1, 1H), 8.23 (d, J = 8.5, 1H), 10.46 (br t, 1H) ppm.

Example 27

The compound was prepared according to the procedure used in Example 26, starting from compound 4 (101 mg, 0.21 mmol) and compound 7, to give compound 8 as a white microcrystalline solid (37 mg, 31% yield). LCMS (ES): 95% pure, m / z 566 [M] ⁺ , 568, [M + 2] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.13 (d, J = 6.5, 6H), 1.57 (m overlapping with the water signal, 2H), 1.71 (m, 1H), 1, 81 (m, 1H), 2.04-2.18 (m, 4H), 2.34 (s, 3H), 2.78 (m, 5H), 3.06 (broad t, J = 8, 6, 1H), 3.27 (br s, 4H), 3.52-3.59 (m, 2H), 7.47 (t, J = 7.3, 1H), 7.57 (td, J = 8.4, J = 1.1, 1H), 7.84 (d, J = 7.8, 1H), 8.19 (s, 1H), 8.27 (d, J = 8.4 , 1H), 8.57 (s, 1H), 10.38 (broad t, J = 5.6, 1H) ppm.

Example 28

Example 28 describes a method for producing a substituted benzoxazine analog by reacting the corresponding ester with an amine and aluminum chloride.

To a solution of 2,3,4,5-tetrafluorobenzoic acid (100 g, 510 mmol) in methylene chloride (0.5 ml) was added oxalyl chloride (68 g, 540 mmol) and DMF (about 3 drops) and the reaction mixture was stirred at room temperature to remove the resulting gases. The solvent was removed in vacuo, the vessel was placed in a deep vacuum (approximately 0.5 mm Hg) for 2 hours to obtain the acid chloride as a viscous oil (105 g) and was used in the subsequent reaction without further purification.

To a suspension of potassium ethyl malonate (97 g, 570 mmol) and magnesium chloride (55 g, 570 mmol) in acetonitrile, and the suspension was cooled to 0 ° C. Crude 2,3,4,5-benzoyl chloride (105 g, 520 mmol) was added to this suspension over 5 minutes. Triethylamine was slowly added at a rate sufficient to maintain the temperature below 10 ° C, the mixture was allowed to warm to room temperature and was stirred overnight. The solvent was removed in vacuo, replaced with toluene (300 ml), 1N was added. HCl solution (500 ml) and the mixture was stirred for 1 h. The organic layer was separated, washed with 1N. HCl solution (100 ml) and brine (100 ml) and dried over sodium sulfate, filtered through a pad of silica gel (50 × 100 mm), eluting with ethyl acetate. The solvent was removed in vacuo and the resulting oil was dissolved in ethanol / water (9: 1) and allowed to crystallize overnight. The obtained crystals were separated by filtration, washed with a mixture of ethanol / water (8: 2) to obtain a ketoester (43.75 g, 166 mmol) as a white crystalline solid.

To a 250 ml round bottom flask were added tetrafluorocetoester (10.0 g, 37.9 mmol), triethyl orthoformate (8.6 ml, 56.8 mmol) and acetic anhydride (7.15 ml, 75.8 mmol) and the reaction mixture was heated to 145 ° C for 2 hours. The reaction mixture was cooled to room temperature and placed in high vacuum (about 0.5 mmHg) for 1 hour. The resulting oil was dissolved in ethanol (100 ml), 2-amino-1- was added naphthol (6.02 g, 37.9 mmol) at room temperature, the solution quickly became transparent, and then the product began to precipitate. The reaction mixture was stirred for 2 hours, then filtered and washed with ethanol (100 ml) to give enamine as a yellow solid (12.5 g, 28.9 mmol).

To a solution of enamine (12.13 g, 27.95 mmol) in dry DMF (50 ml) was added potassium carbonate (4.24 g, 1.1 mmol) and the mixture was heated to 90 ° C with constant stirring for 2 hours. The mixture was given cool to room temperature without stirring and kept at room temperature for another 1 hour. The crystalline solid was separated by filtration, washing with water. Recrystallization from THF afforded difluoroether as a white crystalline solid (9.3 g, 23.6 mmol).

To a solution of difluoroether (1.0 g, 2.5 mmol) in NMP (10 ml) was added N-Boc-3- (2-pyrazino) pyrrolidine (870 mg, 3.5 mmol) and the mixture was heated under reflux for 3 hours. The reaction mixture was allowed to cool to room temperature and the product was separated by filtration. Crystallization from THF afforded the pyrazine ester as a yellow solid (910 mg, 1.74 mmol).

To a solution of pyrazine ester (250 mg, 0.48 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (80 mg, 0.63 mmol) in methylene chloride, aluminum chloride (83 mg, 0.63) was added at room temperature mmol) and the reaction mixture was stirred for 2 hours. The solvent was removed in vacuo, saturated L-tartaric acid solution (5 ml) was added, and the mixture was stirred for 1 hour. Methylene chloride (10 ml) was then added and the mixture was made basic with 1N. NaOH solution. The organic layer was separated and washed with saturated Rochelle salt solution, brine and dried over sodium sulfate. The solvent was removed in vacuo and the resulting solid was dissolved in THF, filtered and the solvent was removed again. The crude solid was recrystallized from ethyl acetate to give the amide as a yellowish solid (225 mg, 0.37 mmol, 98.5% purity).

Example 29

As shown in Example 29, the amide combination of the corresponding ester led to a weak reaction or its absence when zinc chloride was used as the Lewis acid.

To a solution of ether (100 mg, 0.19 mmol) and 2- (2-aminoethyl) -1-methylpyrrolidine (80 mg, 0.63 mmol) in methylene chloride, zinc chloride (86 mg, 0.63 mmol) was added at room temperature and the reaction mixture was stirred overnight. LCMS data indicated no reaction and the reaction was terminated.

Example 30

Example 30 describes a method for producing a substituted benzoxazine analog by reacting the corresponding carboxylic acid with an amine.

Pyrazinoester (2.0 g, 3.8 mmol) was dissolved in ethanol (100 ml) and concentrated HCl (20 ml) was added and the mixture was refluxed overnight. The mixture was allowed to cool to room temperature and the solid was separated by filtration in vacuo, washing with ethanol to give pyrazine acid as a light tan powder (1.6 g, 3.2 mmol).

To a mixture of fluoroamino acid (1.6 g, 3.2 mmol) and HBTU (2.0 g, 5.3 mmol) in NMP (20 ml) was added N, N-diisopropyl-N-ethylamine (1.0 ml, 6 mmol) and the mixture was stirred at room temperature under argon for 1 h (the solution became transparent). (S) -2- (2-aminoethyl) -1-methylpyrrolidine (Mizuno A., Hamada Y., Shioiri T., Synthesis 1980, 12: 1007) (1.0 ml, 6.9 mmol) was added and the mixture was stirred within 30 minutes Water (200 ml) was added, the resulting solid was collected by vacuum filtration, washing with water, and dried to give pyrazine as a yellow solid. The yellow solid was purified on silica gel (10% MeOH / CH ₂ Cl ₂ mixture, first eluting with impurities, followed by elution with 5% NH ₄ OH / 15% MeOH / CH ₂ Cl ₂ mixture. The combined fractions were evaporated to give the compound as a yellow solid substances (1.2 g, 2.0 mmol, 85% purity).

Example 31

Example 30 describes the preparation of a Boc-protected pyrrolidine reagent as an intermediate in the preparation of benzoxazine and benzothiazole derivatives.

A mixture of benzylamine (90 g, 841 mmol) and chloromethyltrimethylsilane (30 g, 246 mmol) was heated at 200 ° C for 2.5 hours. Generally, the trimethylsilyl group can be replaced by a —SiR ¹ R ² R ³ group, where R ¹ , R ² and R ³ independently represents alkyl or substituted alkyl. Benzyl groups can also be replaced with other suitable protecting groups.

The mixture was allowed to cool to room temperature and was treated with 1N. sodium hydroxide solution (250 ml) and diethyl ether (200 ml) with stirring. The aqueous layer was extracted with ether (3 × 100 ml) and the combined organic extracts were washed with brine, dried over magnesium sulfate and filtered through a loose layer of silica gel (70 × 50 mm), eluting with diethyl ether. The solvent was removed in vacuo and the resulting oil was distilled in vacuo (b.p. = 70 ° C. at about 1 mmHg) to give the amine as a colorless oil (60.8 g), which contained a large amount of benzylamine. The resulting oil was then chromatographed on a single Biotage column (90 g, silica gel, ANALOGIX), eluting with ethyl acetate. The solvent was removed in vacuo to give the pure amine as a colorless oil (43.55 g, 225 mmol). Then, the resulting amine was added to 37% formalin (25 ml) and the mixture was stirred at room temperature for 10 min, followed by the addition of methanol (25 ml) and potassium carbonate (20 g). The resulting mixture was stirred overnight, then was extracted with methylene chloride (3 × 100 ml) and the combined organic extracts were dried over sodium sulfate. The solvent was removed in vacuo and the resulting oil was distilled in vacuo (bp = 80 ° C at about 1 mmHg) to give the amine as a colorless liquid (39.9 g, 168 mmol).

To a solution of vinylpyrazine (10 g, 94.3 mmol) in methylene chloride (200 ml) and trifluoroacetic acid (2 ml) was added dropwise a solution of silylated amine ester (24.33 g, 102.7 mmol) dissolved in methylene chloride (100 ml ), for 4 hours. Then the volume was reduced to 100 ml and extracted with 1N. HCl solution (3 × 75 ml). The aqueous layer was made basic with NaOH, extracted with methylene chloride (3 × 100 ml), dried over magnesium sulfate and filtered through a loose layer of silica gel (30 × 150 mm), eluting with ethyl acetate. The solvent was evaporated to give benzylated pyrazinopyrrolidine (26.19 g) as a brownish clear liquid. Typically, a pyrazine heterocycle can be replaced with other suitable heterocyclic groups.

To a solution of benzylpyrrolidine (7.0 g, 29.3 mmol) and di-tert-butyl dicarbonate (44.7 g, 205 mmol) in methanol (35 ml) was added 10% Pd / C (degass type, wet) and the container was saturated hydrogen (50 psi) with shaking. The container was purged three times to normal pressure. After 5 hours, the reaction was completed, the mixture was filtered and the solvent was evaporated in vacuo. The resulting material was chromatographed on silica gel (1: 1 hexane / ethyl acetate) to give a Boc-protected pyrrolidine as a pale yellow oil (2.3 g, 9.2 mmol).

Enantiomer ratios can be determined by preparing TPC (N-trifluoromethylacetyl-L-prolyl chloride, Regis # 440001) and using HCMS (HP 6890N / 5973 MSD) on a Phenomenex Zebron capillary column (ZB-50, 50% phenyl, 50% diethyl polysiloxane, 30 M × 0.25 mm, film thickness 0.25 μM). Chromatographic conditions: 1 μl injection at 50: 1 separation. Constant speed Not = 1.0 ml / min. The thermostat is 100ºС for 5 minutes, the temperature rises at a rate of 5ºС / min to 300ºС and is kept for 8 minutes. The compound leaves at 39.08 and 39.31 min, but the separation is very good.

Example 32

Example 32 describes the preparation of a chiral amine reagent used in an amide combination.

To a solution of hydroxymethylpyrrolidine (50 g, 434 mmol) in methylene chloride (1 L) was added triphenylphosphine (148 g, 564 mmol) followed by careful addition of carbon tetrabromide (187 g, 564 mmol) at room temperature. The reaction mixture was stirred for 1 h at room temperature. Water was added and the organic layer was washed with brine, dried over sodium sulfate and the solvent was removed in vacuo. The resulting oil was purified by silica gel chromatography (1: 1 hexane / ethyl acetate mixture) to give bromide as a clear oil (35 g, 197 mmol).

To a solution of bromide (23.0 g, 129 mmol) in a mixture of acetonitrile and water (75:15, 200 ml) was added potassium cyanide (12.6 g, 194 mmol) and 18-crown ether-6 (340 mg, 1.3 mmol) and the reaction mixture was stirred overnight at room temperature. The volume was then reduced to 50 ml in vacuo and extracted twice with methylene chloride (2 × 200 ml). The extracts were combined and washed with brine, dried over sodium sulfate and the solvent was carefully removed in vacuo to give cyanide as a clear oil (17 g).

Raney nickel (2.0 g, aqueous solution) was added to a solution of cyanide (17 g, 137 mmol) in methanol (90 ml) and the mixture was purged under hydrogen pressure (60 psi) with shaking for 24 hours. Solution filtered and the solvent was removed in vacuo. Pure amine was isolated by distillation (bp = 50 ° C at about 10 mmHg) as a clear oil (7.54 g, 58.9 mmol).

Enantiomer ratios can be determined by preparing TPC (N-trifluoromethylacetyl-L-prolyl chloride, Regis # 440001) and using HCMS (HP 6890N / 5973 MSD) on a Phenomenex Zebron capillary column (ZB-50, 50% phenyl, 50% diemthylpolysiloxane, 30 M × 0.25 mm, film thickness 0.25 μM). Chromatographic conditions: 1 μl injection at 50: 1 separation. Constant speed Not = 1.0 ml / min. The thermostat is 100ºС for 5 minutes, the temperature rises at a rate of 5ºС / min to 300ºС and is kept for 8 minutes. The compound exudes at 28.51 and 28.68 min, but the separation is very good.

It is understood that the following detailed description and accompanying examples are illustrative only and are not intended to limit the scope of the invention. Various changes and modifications of the disclosed embodiments will become apparent to those skilled in the art. Such changes and modifications, including without limitation related to chemical formulas, substituents, derivatives, intermediates, syntheses, compositions and / or methods of using the invention, can be carried out without departing from its essence and scope. US patents and publications cited herein are incorporated by reference.

Example 33

To a solution of 2,6-dichloronicotinic acid (1.0 eq, 31.24 g, 162.7 mmol) in methylene chloride (500 ml) was added oxalyl chloride (1.2 eq, 23.7 g, 187.5 mmol), followed by by adding 3 drops of DMF and the mixture was stirred overnight at room temperature. Then, the solvent was removed in vacuo to give the crude acid chloride as an oil. Potassium ethyl malonate (1.5 equiv, 41.5 g, 244 mmol) in acetonitrile (500 ml) was dissolved in a separate flask, and the mixture was cooled to 5 ° C. Then magnesium chloride (1.5 eq, 23.4 g, 245.8 mmol) was added over 5 min, keeping the temperature of the mixture below 25 ° C. The crude acid chloride was then dissolved in acetonitrile (50 ml) and added via a dropping funnel, keeping the temperature below 5 ° C for 30 minutes. Then triethylamine (2.0 eq, 42.8 g, 325 mmol) was added as quickly as possible, while still maintaining the temperature of the mixture below 10 ° C. After complete addition, the reaction mixture was allowed to warm to room temperature overnight with constant stirring. The solvent was removed in vacuo and replaced with ethyl acetate. 1N was added. HCl solution (500 ml) and the mixture was stirred for another 30 minutes. The organic layer was separated, washed with brine, dried over sodium sulfate, and the solvent was removed in vacuo to give the ketoester as an orange oil (35.04 g). The product was purified by recrystallization from 10% water / methanol to give pure ketoester 1 as a white crystalline solid (31.21 g, 74%). LCMS (ES): 95% pure, eluting as 2 peaks, m / z 216, 262.

Example 34

Ketoester 1 (1.0 equiv, 11.45 g, 43.87 mmol) was dissolved in DMF (60 ml) and the mixture was cooled to 0 ° C in an ice bath. Then methyl iodide (3.0 eq, 8.2 ml, 132.0 mmol) was added and the mixture was cooled to -5 ° C. Then carbon disulfide (1.5 eq, 4.0 g, 65.8 mmol) was added followed by potassium carbonate (2.0 eq, 12.1 g, 88 mmol), keeping the temperature below 5 ° C. The mixture was allowed to warm to room temperature with stirring for 2 hours, then was extracted with ethyl acetate (5 × 100 ml) and dried over sodium sulfate. The solvent was removed in vacuo and the resulting oil was purified by silica gel chromatography (10% ethyl acetate / hexane mixture) to give bistioether 2 as a yellow oil (70% yield). LCMS (ES): purity 90%, m / z 388 [M + 22] ⁺ , 320 [M + 1-OEt] ⁺ .

Example 35

Ethyl 2,6-dichloro-5-fluoro-3-pyridin-β-ketopropionate (1.0 eq, 31.79 g, 0.113 mmol) was dissolved in DMF (180 ml). The solution was cooled using an ice-salt mixture. Iodomethane (3.0 equiv, 21 ml, 0.887 mmol) and carbon disulfide (1.5 equiv, 10.3 ml, 0.170 mol) were added and the mixture was stirred until the temperature of the mixture reached T = -2 ° C. Very quickly (within 2-3 minutes) K ₂ CO ₃ (2.0 eq, 31.4 g, 0.227 mmol) was added, which caused an increase in the temperature of the mixture to T = 12 ° C. The mixture was stirred in an ice bath for 5 hours. After adding water and brine, the compound was extracted with EtOAc (3 ×). The combined extracts were washed with brine (2 ×), dried over Na ₂ SO ₄ and the volatiles removed in vacuo. Purification by flash chromatography on silica gel (5-30% EtOAc gradient in hexanes) gave compound 3 as a thick yellow oil (22.86 g, 52% yield). Rf = 0.14 (10% EtOAc in hexane); LCMS (ES): 95% pure, m / z 384 [M] ⁺ , 338 [M-EtOH] ⁺ , 340 [M + 2-EtOH] ⁺ , 342 [M + 4-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.16 (t, J = 7.4, 3H), 2.43 (s, 6H), 4.18 (q, J = 7.4, 2H) 7.86 (dd, J = 0.6, J = 7.4, 1H) ppm.

Example 36

Compound 3 (1.0 equiv, 18.93 g, 49.18 mmol) was dissolved in toluene (400 ml). The solution was carefully degassed by sparging nitrogen for 10 minutes. After addition of 2-aminothiophenol (0.9 eq, 4.7 ml, 43.92 mmol), the mixture was stirred at 130-140 ° C (oil bath temperature) for 6 hours with a constant flow of nitrogen into the reaction mixture. DIEA (1.0 eq, 8.6 ml, 49.37 mmol) was added and the mixture was stirred at 140 ° C overnight. After cooling, compound 4 began to precipitate. The solid was filtered off and washed with a small amount of toluene. The substance was suspended in MeOH and sonicated for several minutes. After filtration and drying, compound 4 was isolated as a tan solid (9.19 g, 56% yield). LCMS (ES): 95% pure, m / z 377 [M + 1] ⁺ , 379 [M + 3] ⁺ , 331 [M + 1-EtOH] ⁺ , 333 [M + 3-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.50 (t, J = 7.0, 3H), 4.53 (d, J = 7.0, 2H), 7.52 (td, J = 0 9, J = 7.1, 1H), 7.63 (td, J = 1.4, J = 6.0, 1H), 7.84 (dd, J = 1.2, J = 7.9 , 1H), 8.62 (d, J = 7.4, 1H), 9.49 (d, J = 8.6, 1H) ppm.

Example 37

In a vessel, compound 3 (1.0 equiv, 202 mg, 0.526 mmol) and N-methylbenzene-1,2-diamine (1.0 equiv, 60 μl, 0.528 mmol) was stirred at 130 ° C in anhydrous toluene (5 ml) for 16 hours. After removal of the volatiles in vacuo, the crude mixture was purified by flash chromatography on silica gel (0.5-3% gradient of MeOH in CH ₂ Cl ₂ ). After adding MeOH to the resulting oil, pure compound 5 precipitated. The substance was filtered and dried to give compound 5 as a yellow solid (29 mg, 15% yield). Rf = 0.26 (5% MeOH in CH ₂ Cl ₂ ); LCMS (ES): 95% pure, m / z 374 [M + 1] ⁺ , 376 [M + 3] ⁺ , 328 [M + 1-EtOH] ⁺ , 330 [M + 3-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.47 (t, J = 7.0, 3H), 3.70 (s, 3H), 4.50 (q, J = 7.0, 2H) 7.37 (dd, J = 8.1, J = 1.0, 1H), 7.44-7.51 (m, 2H), 8.55 (d, J = 7.6, 1H), 8.94 (dd, J = 1.1, J = 8.1, 1H) ppm.

Example 38

In a vessel, compound 3 (1.0 equiv, 221 mg, 0.575 mmol) and 2-aminophenol (1.1 equiv, 70 mg, 0.641 mmol) were stirred at 130 ° C. in anhydrous toluene (5 ml) for 6 hours. After cooling the mixture, the resulting brown precipitate was filtered off. This substance was dissolved in CH ₂ Cl ₂ and the solution was filtered through a loose layer of cellite. Recrystallization from toluene afforded compound 6 as a beige solid (48 mg, 24% yield). LCMS (ES): 95% pure, m / z 361 [M + 1] ⁺ , 363 [M + 3] ⁺ , 315 [M + 1-EtOH] ⁺ , 317 [M + 3-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) showed a purity of about 80%, δ 1.46 (t, J = 7.0, 3H), 4.50 (q, J = 7.3, 2H), 7, 48-7.54 (m, 2H), 7.65 (dd, J = 1.4, J = 7.9, 1H), 8.57 (d, J = 7.4, 1H), 8.68 (dd, J = 1.4, J = 7.9, 1H) ppm.

Example 39

In a vessel, compound 3 (1.0 equiv, 266 mg, 0.692 mmol) and 3-amino-4- (methylamino) benzonitrile (1.0 equiv, 100 mg, 0.689 mmol) were stirred at 130 ° C in anhydrous toluene (5 ml) in within 2 days. After evaporation of the solvents, the crude material was passed through a silica gel column (0.5-3% gradient of MeOH in CH ₂ Cl ₂ ). Purification by preparative TLC on silica gel, two 1 mm thick plates, 4% MeOH in CH ₂ Cl ₂ ) gave compound 7 as a yellow solid (32 mg, 12% yield). LCMS (ES): 95% pure, m / z 399 [M + 1] ⁺ , 401 [M + 3] ⁺ , 353 [M + 1-EtOH] ⁺ , 355 [M + 3-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.47 (t, J = 7.1, 3H), 3.72 (s, 3H), 4.51 (q, J = 7.3, 2H) 7.42 (d, J = 8.4, 1H), 7.79 (dd, J = 1.5, J = 8.4, 1H), 8.55 (d, J = 7.3, 1H ), 9.22 (d, J = 1.4, 1H) ppm.

Example 40

In a vessel, compound 3 (1.0 equiv, 228 mg, 0.749 mmol) and 2-amino-4-chlorobenzenethiol (1.0 equiv, 120 mg, 0.752 mmol) were stirred at 130 ° C. in anhydrous toluene (5 ml) for 2 days The solid formed during the reaction was filtered off and dissolved in a mixture of MeOH and CH ₂ Cl ₂ (200 ml). The resulting turbid solution was filtered through a loose layer of celite. After evaporation of the volatiles, the compound was purified by flash chromatography on silica gel (CH ₂ Cl ₂ , then 0.5% MeOH in CH ₂ Cl ₂ ). Compound 8 was isolated as a yellow solid (20 mg, 6% yield). LCMS (ES): purity> 85%, m / z 411 [M] ⁺ , 413 [M + 2] ⁺ , 415 [M + 4] ⁺ , 365 [M-EtOH] ⁺ , 367 [M + 2-EtOH ] ⁺ , 368 [M + 4-EtOH] ⁺ .

Example 41

In a vessel, compound 3 (1.0 equiv, 255 mg, 0.664 mmol) and benzene-1,2-diamine (1.0 equiv, 72 mg, 0.666 mmol) were stirred at 130 ° C. in anhydrous toluene (5 ml) for 5 h. Volatiles were removed in vacuo and the substance was dissolved in diglyme (2 ml). A 60% suspension of NaH in oil (1.0 eq, 26 mg, 0.63 mmol) was added and the mixture was stirred at 130 ° C for 3 hours. The resulting precipitate was filtered off and washed with water. After trituration with MeOH and filtration, Compound 9 was isolated as a brown solid (91 mg, 38% yield). LCMS (ES): 95% pure, m / z 360 [M + 1] ⁺ , 362 [M + 3] ⁺ ; ¹ H NMR (CDCl ₃ , 500 MHz) δ 1.44 (t, J = 7.1, 3H), 4.44 (q, J = 7.1, 2H), 7.40-7.46 ( m, 2H), 7.49 (m, 1H), 8.50 (d, J = 7.7, 1H), 8.81 (d, J = 6.8, 1H) ppm.

Example 42

To a solution of bistioether 2 (1.0 equiv, 10.14 g, 27.7 mmol) in toluene (300 ml) was added 2-aminothiophenol (1.1 equiv, 3.81 g, 30.5 mmol) and the mixture was boiled with reflux overnight with constant degassing, sparging nitrogen. Then the mixture was allowed to cool to room temperature and diisopropylethylamine (1.5 eq, 7.0 ml, 41.55 mmol) was added and the mixture was heated to boiling for 3 hours. The mixture was allowed to cool to room temperature, the product was separated by filtration to obtain cyclic ether 10 as a tan solid (6.6 g, 66% yield). LCMS (ES): 95% pure, m / z 359 [M + 1] ⁺ .

Example 43

To a solution of bistioether 2 (1.0 equiv, 5.0 g, 13.66 mmol) in toluene (150 ml) was added N-methyl-1,2-phenylenediamine (1.2 equiv, 2.0 g, 16.4 mmol) and the mixture was refluxed overnight with constant degassing, sparging nitrogen. The mixture was then allowed to cool to room temperature and diisopropylethylamine (1.5 eq, 3.5 ml, 20.75 mmol) was added and the mixture was heated at reflux for 3 hours. The mixture was allowed to cool to room temperature and methanol was added. The volume was reduced to about 100 ml by evaporation on a rotary evaporator and kept for 2 days. The product was separated by filtration and recrystallized to give cyclic ether 11 as a tan solid (2.6 g, 53% yield). LCMS (ES): 95% pure, m / z 356 [M + 1] ⁺ .

Example 44

To a solution of bistioether 2 (1.0 equiv, 10.14 g, 27.7 mmol) in toluene (300 ml) was added 1,2-phenylenediamine (1.1 equiv, 3.3 g, 30.5 mmol) and the mixture boiled under reflux overnight with constant degassing, sparging nitrogen. The mixture was then allowed to cool to room temperature, diisopropylethylamine (1.5 eq, 7.0 ml, 41.55 mmol) was added and the mixture was heated at reflux for 3 hours. The mixture was allowed to cool to room temperature and the product was filtered by filtration. obtaining cyclic acid 12a as a tan solid (3.5 g, 11.2 mmol, 40% yield). LCMS (ES): 95% pure, m / z 314 [M + 1] ⁺ . The resulting filtrate was concentrated in vacuo and triturated with diethyl ether (100 ml). The product was separated by filtration to obtain cyclic ether 12 as a tan solid (3.5 g, 10.3 mmol, 37% yield). LCMS (ES): 95% pure, m / z 342 [M + 1] ⁺ .

Example 45

Compound 4 (1.0 equiv, 1.57 g, 4.17 mmol) was suspended in acetic acid (15 ml). The suspension was degassed by sparging nitrogen for 10 minutes. Ammonium formate (10 eq, 2.63 g, 41.6 mmol) and Pd / C (10% wet, Degass type, 2.5 g) were added and the mixture was vigorously stirred at 60 ° C for 3 hours. The mixture was filtered through loose layer of celite. Coal was treated several times with a hot mixture of CH ₂ Cl ₂ , MeOH and acetic acid to completely recover the intended substance. The combined filtrates were evaporated and CH ₂ Cl _{2 was} added. The organic phase was washed with water (2 ×), dried over Na ₂ SO ₄ and the solvents were removed in vacuo. The resulting solid was sonicated in a mixture of EtOAc and hexane, filtered and dried to give pure compound 13 as an off-white solid (1.11 g, 78% yield). LCMS (ES): 95% pure, m / z 343 [M + 1] ⁺ .

Example 46

Compound 14 was prepared in accordance with the procedure used for product 13 at a higher temperature (80 ° C) and a longer reaction time. A larger excess of reagents was added several times for complete conversion. The compound was isolated as an off-white solid (41 mg, 15% yield). LCMS (ES): 95% pure, m / z 325 [M + 1] ⁺ .

Example 47

In a vessel, compound 6 (1.0 eq, 13 mg, 0.0360 mmol) and N-isopropylpiperazine (4.0 eq, 21 μl, 0.147 mmol) was stirred in DMF (0.1 ml) at 90 ° C for 4.5 h. After adding water, the precipitate was filtered off and dried. Product 15 was purified by precipitation with AcOEt / hexane to give a beige solid (7 mg, 43% yield). LCMS (ES): purity> 90%, m / z 453 [M + 1] ⁺ .

The following analogs were obtained in a similar manner using the corresponding amines and chloroazabenzofluorenones.

Example 48

In the vessel, compound 4 (1.0 equiv, 14 mg, 0.0372 mmol) and racemic tert-butyl-3- (pyrazin-2-yl) pyrrolidine-1-carboxylate (4.0 equiv, 50 mg, 0.160 mmol) stirred in anhydrous NMP (0.2 ml) at 200 ° C for 1 h. After adding water, the precipitate was filtered off and dried. This substance was purified by preparative TLC on silica gel (1 mm thick plate, eluting with 4% MeOH in CH ₂ Cl ₂ twice). Compound 28 was isolated as a brown solid (9 mg, 50% yield). LCMS (ES): 90% pure, m / z 490 [M + 1] ⁺ .

Example 49

In a vessel, compound 5 (1.0 eq, 21 mg, 0.0562 mmol) and racemic tert-butyl 3- (pyrazin-2-yl) pyrrolidine-1-carboxylate (4.0 eq, 56 mg, 0.225 mmol) were mixed in anhydrous NMP (0.2 ml) at 200 ° C for 3 hours. After adding water, the precipitate was filtered off and dried. This material was purified by preparative TLC on silica gel (1 mm thick plate, eluting twice with 5% MeOH in CH ₂ Cl ₂ ) and precipitation using a mixture of CH ₂ Cl ₂ / hexane. Compound 29 was isolated as a beige solid (15 mg, 55% yield). LCMS (ES): 95% pure, m / z 487 [M + 1] ⁺ .

Example 50

In the vessel, compound 5 (1.0 equiv, 21 mg, 0.0562 mmol), 2- (pyrazin-2-yl) ethanethiol (1.1 equiv, 8 μl, 0.0652 mmol) and K ₂ CO ₃ (1 , 2 eq., 9 mg, 0.0651 mmol) were mixed in anhydrous DMF (0.2 ml). The mixture was stirred at 90 ° C. for 3 hours. After adding water, the precipitate was filtered off and dried. This material was triturated with MeOH and filtered. Compound 30 was isolated as a yellow solid (19 mg, 71% yield). LCMS (ES): 95% pure, m / z 478 [M + 1] ⁺ .

The following analogues were obtained in a similar manner using the corresponding chloroabenzofluorenones.

Example 51

Compound 13 (1.0 equiv, 266 mg, 0.777 mmol) was suspended in anhydrous NMP (3 ml). Nitrogen was bubbled into the mixture for several minutes. 2- (Pyrazin-2-yl) ethanethiol (5.0 eq, 0.48 ml, 3.91 mmol) and K ₂ CO ₃ (10.0 eq, 1.0 g, 7.23 mmol) and the reaction were added the mixture was vigorously stirred at 100 ° C for 1 h. Water was added to dissolve all substances. The pH was adjusted to 1-2 by adding a 3N aqueous HCl solution. The resulting orange precipitate was filtered off, suspended in a small amount of MeOH and filtered a second time. The crude compound 34 was isolated as an orange-brown solid and used in the next step without any further purification (188 mg, 68% yield). LCMS (ES): purity 80-90%, m / z 357 [M + 1] ⁺ .

Example 52

Compound 34 (1.0 equiv, 188 mg, 0.527 mmol) was suspended in CH ₂ Cl ₂ (4 ml). Triethylamine (2.2 equiv, 0.16 ml, 1.148 mmol) and 2- (bromomethyl) pyridinium bromide (1.2 equiv, 160 mg, 0.6325 mmol) were added and the mixture was stirred at room temperature for 15 minutes. After adding a saturated aqueous solution of NaHCO _{3, the} substance was extracted with CH ₂ Cl ₂ (3 ×). The combined extracts were dried over Na ₂ SO ₄ and the solvents were removed in vacuo. The compound was purified by preparative HPLC. The resulting solution was concentrated and the pH was adjusted to 10 by the addition of an aqueous NaOH solution. Compound 35 was filtered off, triturated with CH ₂ Cl ₂ / hexane and filtered to give a pale brown solid (59 mg, 25% yield). LCMS (ES): 95% pure, m / z 448 [M + 1] ⁺ .

Example 53

In a round bottom flask, compound 4 (1.0 eq, 1.28 g, 3.397 mmol) and 2- (pyrrolidin-1-yl) ethanamine (2.0 eq, 0.86 ml, 6.786 mmol) in CH ₂ Cl _{2 were} mixed (50 ml). AlCl ₃ (1.5 equiv, 680 mg, 5.10 mmol) was added and the mixture was vigorously stirred at room temperature for 1 h. After removal of CH ₂ Cl ₂ in vacuo, the resulting suspension was treated with a saturated aqueous solution of tartaric acid (about 20 ml) and stirred until the solid disappeared completely (about 1 hour to complete hydrolysis). Water was added and the pH was adjusted to 14 by the addition of NaOH. The yellow precipitate was filtered off and washed with water. The solid was dissolved in a large amount of CH ₂ Cl ₂ / MeOH and the cloudy solution was filtered through a loose pad of celite. Volatiles were removed in vacuo and the solid was triturated with hot methanol. Filtration and drying gave compound 36 (1.09 g, 72% yield) as a yellow solid. LCMS (ES): 95% pure, m / z 445 [M + 1] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.84 (m, 4H), 2.65 (m, 4H), 2.80 (t, J = 7.2, 2H), 3.68 (t, J = 7.2, 2H), 7.52 (td, J = 1.2, J = 7.2 1H), 7.62 (td, J = 1.2, J = 8.4 1H), 7 81 (dd, J = 0.8, J = 8.0 1H), 8.62 (d, J = 7.2, 1H), 9.49 (d, J = 8.8, 1H), m .d.

The following compounds were prepared in a similar manner using the corresponding amines and azabenzofluorenone ethyl esters. Some compounds were alternatively isolated by extraction of CH ₂ Cl ₂ from an alkaline aqueous solution. Some compounds were purified by preparative TLC on alumina (eluted with 1-5% MeOH in CH ₂ Cl ₂ ), preparative HPLC, or trituration with EtOAc or CH ₂ Cl ₂ / hexane mixtures.

Example 54

Compound 64 protected by the Boc group was prepared according to the procedure used for product 36. The crude Boc amine was treated with undiluted trifluoroacetic acid (0.5 ml) for 45 minutes. After evaporation of the acid, water was added and the pH was adjusted to 14 by the addition of 1N. NaOH solution. After extraction with CH ₂ Cl ₂ (4 ×), the extracts were washed with water (1 ×) and dried over Na ₂ SO ₄ . Racemic compound 64 was purified by preparative TLC on alumina (1.5 mm thick plate, eluted 3 times with 4% MeOH in CH ₂ Cl ₂ ) to give a yellow solid compound (6 mg, 37% yield). LCMS (ES): 95% pure, m / z 509 [M + 1] ⁺ .

Example 55

Compound 65 was prepared according to the procedure used for product 64. Compound 65 was purified by preparative TLC on alumina (1.5 mm thick plate, eluting with 4% MeOH in CH ₂ Cl ₂ twice and four times with 5% MeOH in CH ₂ Cl ₂ ) and precipitation with a mixture of CH ₂ Cl ₂ / hexane to obtain a yellow solid (2.7 g, yield 12%). LCMS (ES): purity> 85%, m / z 506 [M + 1] ⁺ .

Example 56

Compound 63 (300 mg, 0.523 mmol) was suspended in undiluted trifluoroacetic acid (2 ml). The mixture was stirred at about 50 ° C for several minutes and the volatiles were removed in vacuo. MeCN (5 ml) was added and the substance was precipitated with Et ₂ O (200 ml). Compound 66 was purified by preparative HPLC and isolated after evaporation as a TFA double salt (215 mg, 59% yield). LCMS (ES): purity> 95%, m / z 474 [M + 1] ⁺ .

Example 57

Compound 57 (20 mg) was suspended in NMP (0.2 ml) and racemic piperidin-3-ylmethanol (0.2 ml). The mixture was heated with microwaves at 200 ° C for 15 minutes. After purification by preparative HPLC, a solution of compound 67 in a H ₂ O / MeCN mixture was concentrated in vacuo, the pH was adjusted to 9 with saturated NaHCO _3, and the compound was extracted with CH ₂ Cl ₂ (4 ×). The combined extracts were dried over Na ₂ SO ₄ and the solvents were removed in vacuo. The resulting solid was triturated with EtOAc / hexane to give racemic compound 67 as a tan solid (13 mg, 54% yield). LCMS (ES): purity> 95%, m / z 506 [M + 1] ⁺ .

The following compounds were prepared in a similar manner using the corresponding amines and fluoroazabenzofluorenones. In the case of using less reactive amines, the reaction was carried out at 220 ° C for 20 min.

The following compounds were prepared in a similar manner using the corresponding amines and chlorazabenzofluorenones. The reaction was carried out using microwave heating at 100 ° C for 5 minutes or 150 ° C for 3 minutes.

Example 58

To a solution of chloroester (1.0 g, 2.81 mmol) and 1- (2-aminoethyl) pyrrolidine (0.50 g, 4.4 mmol) in methylene chloride (20 ml) was added aluminum chloride (585 mg, 4.4 mmol) and the reaction mixture was stirred for 4 hours at room temperature. Then the reaction was quenched with a saturated solution of Rochelle salt, alkalinized with 1N. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuo. The resulting crude solid was triturated with ethyl acetate to give chloramide as a tan solid (0.5 g, 1.1 mmol); LCMS (ES): 95% pure, m / z 437 [M + 1] ⁺ .

Example 59

To a solution of chloroester (1.0 g, 2.81 mmol) in N-methylpyrrolidinone (10 ml) was added N-acetylpiperazine (540 mg, 4.2 mmol) and the mixture was heated at 110 ° C for 4 hours. Water and the crude product were added. separated by filtration. The resulting solid was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuo. The resulting solid was triturated with ethyl acetate to give the amino ester as a tan solid (0.70 g, 1.62 mmol); LCMS (ES): 95% pure, m / z 434 [M + 1] ⁺ .

Example 60

To a solution of chloroester (1.0 g, 2.81 mmol) in N-methylpyrrolidinone (10 ml) was added N-acetylpiperazine (540 mg, 4.2 mmol) and the mixture was heated at 110 ° C for 4 hours. Water and the crude product were added. separated by filtration. The resulting solid was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuo. The resulting solid was triturated with ethyl acetate to give the amino ester as a tan solid (0.75 g, 1.67 mmol); LCMS (ES): 95% pure, m / z 451 [M + 1] ⁺ .

Example 61

The following procedure was used to obtain a library of analogues.

To a solution of amino ester (200 mg, 0.46 mmol) and 1- (2-aminoethyl) pyrrolidine (80 mg, 1.5 equiv) in methylene chloride (3 ml) was added aluminum chloride (100 mg, 1.5 equiv) and the reaction the mixture was stirred for 4 hours at room temperature. Then the reaction was quenched with a saturated solution of Rochelle salt, alkalinized with 1N. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuo. The resulting crude solid was purified by mass selective LCMS to afford the amide as a white solid (71 mg, 0.14 mmol); LCMS (ES): 95% pure, m / z 502 [M + 1] ⁺ .

Example 62

The following procedure was used to obtain a library of analogues.

To a solution of amino ester (200 mg, 0.46 mmol) and 1- (2-aminoethyl) pyrrolidine (80 mg, 1.5 equiv) in methylene chloride (3 ml) was added aluminum chloride (100 mg, 1.5 equiv) and the reaction the mixture was stirred for 4 hours at room temperature. Then the reaction was quenched with a saturated solution of Rochelle salt, alkalinized with 1N. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuo. The resulting crude solid was purified by mass selective LCMS to afford the amide as a white solid (200 mg, 0.38 mmol); LCMS (ES): 95% pure, m / z 519 [M + 1] ⁺ .

Example 63

The following procedure was used to obtain a library of analogues.

To a solution of chloramide (350 mg, 0.83 mmol) in N-methylpyrrolidinone (2 ml) was added N-acetylpiperazine (160 mg, 1.24 mmol) and the mixture was heated at 110 ° C. for 4 hours. Water and crude product were added. separated by filtration. The resulting solid was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuo. The resulting crude solid was triturated with ethyl acetate to give the amide as a white solid (200 mg, 0.4 mmol); LCMS (ES): 98% pure, m / z 516 [M + 1] ⁺ .

Example 64

4-Methoxy-2- (methylthio) pyrimidine-5-carboxylic acid. Solid sodium methylate (11.40 g, 211.0 mmol) was added to a solution of ethyl 4-chloro-2- (methylthio) pyrimidine-5-carboxylate (24.40 g, 104.9 mmol) in MeOH (125 ml) at room temperature. The reaction mixture was stirred at room temperature for 5 hours and then treated with NaOH (17.70 g, 315.5 mmol) in H ₂ O (100 ml). Then it was stirred at the same temperature for another 1 hour. The reaction mixture was concentrated to half the volume and then acidified with HCl to pH 4 (6N solution). The reaction mixture was extracted with EtOAc (5 × 200 ml) and the organic layer was washed with brine (200 ml), dried over Na ₂ SO ₄ and concentrated to obtain the desired product as a white solid (19.28 g, 92%); MS m / z: 201 [MH ⁺ ]. ¹ H NMR (DMSO-d ₆ ) δ: 8.72 (s, 1H), 3.98 (s, 3H), 2.54 (s, 3H).

Example 65

Ethyl 3- (4-methoxy-2- (methylthio) pyrimidin-5-yl) -3-oxopropanoate. A solution of 4-methoxy-2- (methylthio) pyrimidine-5-carboxylic acid (10.92 g, 54.6 mmol) and oxalyl chloride (19.0 ml, 217.8 mmol) in toluene (100 ml) was heated at 100 ° C in within 1 h. The solvent was removed under reduced pressure and the crude acid chloride was used without purification in the next step. To a solution of MgCl ₂ (7.80 g, 81.9 mmol) and ethyl magnesium malonate (14.10 g, 82.6 mmol) in THF (100 ml) was added the above acid chloride in THF (100 ml) at 0 ° C followed by the addition of TEM (15.0 ml, 107.6 mmol). The reaction mixture was stirred at 0 ° C for 30 minutes and at room temperature for 2 hours. EtOAc (200 ml) and H ₂ O (100 ml) were added and stirred for another 30 minutes. The layers were separated and the organic layer was washed with brine (100 ml), dried over Na ₂ SO ₄ and concentrated. The crude material was purified by flash chromatography (15% EtOAc / hexane) to give the desired compound as a white solid (7.73 g, 52%). MS m / z: 271 [MH ⁺ ]. ¹ H NMR (CDCl ₃ ) δ 12.65 (s, 1H × 2/3), 8.85 (s, 1H × l / 3), 8.84 (s, 1H × 2/3), 6.03 (s, 1H × 2/3), 4.26 (q, 2H × 2/3), 4.19 (q, 2H × 1/3), 4.10 (s, 3H × 2/3) , 4.09 (s, 3H × 1/3), 3.92 (s, 2H × 1/3), 2.60 (s, 3H × 1H), 2.59 (s, 3H × 2/3) 1.34 (t, 3H × 2/3); 1.26 (3H × 1/3).

Example 66

Ethyl 2- (4-methoxy-2- (methylthio) pyrimidine-5-carbonyl) -3,3-bis (methylthioacrylate). To a solution of ethyl 3- (4-methoxy-2- (methylthio) pyrimidin-5-yl) -3-oxopropanoate in DMF (85 ml) was added methyl iodide (5.3 ml, 85.1 mmol), carbon disulfide (2.6 ml, 43.0 mmol) at -5ºС. Solid K ₂ CO _{3 was} slowly added, keeping the temperature of the mixture below -3 ° C. The reaction mixture was stirred at -5 ° C for 1 h and at room temperature for 1 h. Diluted with EtOAc (300 ml), washed with H ₂ O (2 × 200 ml) and dried over Na ₂ SO ₄ . The solvent was removed under reduced pressure and the crude material was purified by flash chromatography (20% EtOAc / hexane) to give the desired product as a yellow oil (7.60 g, 71% yield). MS m / z: 375 [MH ⁺ ]. ¹ H NMR (CDCl ₃ ) δ 8.82 (s, 1H), 4.16 (q, 2H), 4.03 (s, 3H), 2.61 (s, 3H), 2.51 (broad s, 3H), 2.28 (br s, 3H), 1.15 (t, 3H).

Example 67

2-Methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-triazabenzo [c] fluorene-6-carboxylic acid ethyl ester. Solution of ethyl 2- (4-methoxy-2- (methylthio) pyrimidine-5-carbonyl) -3,3-bis (methylthio) acrylate (475 mg, 1.27 mmol) and 2-aminobenzenethiol (200 mg, 1.60 mmol) in toluene (5 ml) was heated to dryness and continued heating without dilution at 140 ° C for 1 h. Toluene (30 ml) and K ₂ CO ₃ (350 mg, 2.53 mmol) were added to the reaction mixture and heated for another 1 h. The reaction mixture was cooled to room temperature and EtOAc (100 ml) and H ₂ O (50 ml) were added. The layers were separated and the organic layer was washed with brine (100 ml), dried over Na ₂ SO ₄ and concentrated. The crude solid was triturated with Et ₂ O to give the desired product as a yellow solid (260 mg, 55% yield). MS m / z: 372 [MH ⁺ ]. ¹ H NMR (DMSO-d ⁶ ) δ: 9.37 (d, 1H), 9.30 (s, 1H), 8.06 (m, 1H), 7.65 (m, 1H), 7.54 (m, 1H), 4.35 (q, 2H), 2.78 (s, 3H), l, 34 (t, 3H).

Example 68

(2-Cyclopentylethyl) amide 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-triazabenzo [c] fluorene-6-carboxylic acid. To a solution of ethyl 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-triazabenzo [c] fluorene-6-carboxylic acid (230 mg, 0.619 mmol) and 2- (pyrrolidin-1-yl) ) ethanamine (0.24 ml, 1.854 mmol) in DCM (15 ml) solid AlCl ₃ (250 mg, 1.875 mmol) was added at room temperature. The reaction mixture was stirred for 1 h at room temperature and diluted with DCM (100 ml), concentrated potassium sodium tartrate solution (30 ml) and NaOH (6N solution, 10 ml). The mixture was stirred for 15 minutes and the layers were separated. The aqueous layer was extracted with DCM (50 ml) and the combined organic layer was washed with brine (50 ml). The crude reaction mixture was dried over Na ₂ SO ₄ and concentrated to give the desired product as a yellow solid (250 mg, 92% yield). MS m / z: 440 [MH ⁺ ]. ¹ H NMR (CDCl ₃ ) δ 10.26 (broad, 1H), 9.61 (s, 1H), 9.55 (m, 1H), 7.77 (m, 1H), 7.57 (m , 1H), 7.50 (m, 1H), 3.67 (q, 2H), 2.81 (s, 3H), 2.77 (t, 2H), 2.63 (m, 4H), 1.82 (m, 4H).

Example 69

(2-Pyrrolidin-1-yl-ethyl) amide 2- (4-acetylpiperazin-1-yl) -5-oxo-5H-7-thia-1,3,11b-triazabenzo [c] fluorene-6-carboxylic acid. Solution of (2-cyclopentylethyl) amide 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-triazabenzo [c] fluorene-6-carboxylic acid (25 mg, 0.057 mmol) and 1- (piperazine- 1-yl) ethanone (75 mg, 0.585 mmol) in NMP (1.0 ml) was heated for 20 min at 200 ° C in a microwave oven. The crude reaction mixture was purified by reverse phase HPLC. MS m / z: 520 [MH ⁺ ].

Example 70

7-methyl-2-methylsulfanyl-5.8-dioxo-7.8-dihydro-5H-1,3,7,12b-tetraazabenzo [c] phenanthrene-6-carboxylic acid ethyl ester. Solution of ethyl 2- (4-methoxy-2- (methylthio) pyrimidine-5-carbonyl) -3,3-bis (methylthio) acrylate (775 mg, 2.069 mmol) and 2-amino-N-methylbenzamide (475 mg, 3.163 mmol) in toluene (5 ml) was heated in a stream of nitrogen, allowing toluene to evaporate, and heating was continued without dilution at 140 ° C overnight. It was cooled to room temperature and the precipitate formed from DCM (10 ml) was filtered. The mother liquor solvent was removed under reduced pressure and the deposition process was repeated with Et ₂ O (10 ml). Trituration with methanol (10 ml) gave the desired product as a yellow solid (30 mg, 4% yield). MS m / z: 397 [MH ⁺ ]. ¹ H NMR (CDCl ₃ ) δ 9.37 (s, 1H), 8.37 (d, 1H), 8.26 (dd, 1H), 7.70 (m, 1H), 7.49 (m, 1H), 4.46 (q, 2H), 3.61 (s, 3H), 2.60 (s, 3H), 1.43 (t, 3H).

Example 71

2-Methylsulfanyl-5.8-dioxo-7.8-dihydro-5H-1,3,7,12b-tetraazabenzo [c] phenanthrene-6-carboxylic acid ethyl ester. A solution of ethyl 2- (4-methoxy-2- (methylthio) pyrimidine-5-carbonyl) -3,3-bis (methylthio) acrylate (250 mg, 0.668 mmol) and 2-aminobenzamide (118 mg, 0.867 mmol) in DCM (5 ml) was heated under a stream of nitrogen, allowing DCM to evaporate, and heating was continued without dilution at 140 ° C. overnight. The residue was dissolved in DMF (7 ml) after cooling to room temperature and treated with NaH (60 mg, 1500 mmol). The reaction mixture was stirred at room temperature for 1 h and diluted with DCM (20 ml) and H ₂ O (20 ml). The layers were separated and DCM was removed under reduced pressure. Trituration of the crude with Et ₂ O (10 ml) afforded the desired product as a yellow solid (50 mg, 20%). MS m / z: 383 [MH ⁺ ]. ¹ H NMR (CDCl ₃ ) δ 13.58 (br s, 1H), 9.43 (s, 1H), 8.60 (d, 1H), 8.33 (dd, 1H), 7.79 ( m, 1H), 7.59 (m, 1H), 4.48 (q, 2H), 2.62 (s, 3H), 1.46 (t, 3H).

Example 72

The substance was obtained according to a published procedure, which was slightly modified (J. Med. Chem., 2003, 46, 1661-1669). Under nitrogen atmosphere, 2-aminobenzylamine (2.0 eq, 2.45 g, 20.05 mmol) was dissolved in THF (25 ml). A solution of di-tert-butyl dicarbonate (1.0 eq, 2.19 g, 10.03 mmol) in THF (25 ml) was slowly added using a syringe pump over 30 minutes. After a few minutes, more THF (25 ml) was added to ensure effective mixing of the thick suspension. After stirring at room temperature overnight, the resulting white solid was filtered off. The filtrate was concentrated in vacuo, poured onto the top of a silica gel column, and purified by chromatography (10-20% EtOAc gradient in hexane). The resulting solid was recrystallized from EtOAc / hexane to give a white crystalline solid (1.95 g, 87% yield based on Boc ₂ O). LCMS (ES): 95% pure, m / z 224 [M + H] ⁺ , 224 [M + Na] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.44 (s, 9H), 4.23 (d, J = 6.0, 2H), 4.2 (br s, 2H), 4.80 ( broad s, 1H), 6.68 (t, J = 7.6, 2H), 7.02 (d, J = 6.8, 1H), 7.10 (dt, J = 8.0, J = 1.6, 1H) ppm.

Example 73

A mixture of compound 1 (1.22 g, 5.49 mmol) and compound 2 (2.01 g, 5.49 mmol) in DMF (10 ml) was stirred at 80 ° C for 5 h, while nitrogen was bubbled into the solution. K ₂ CO ₃ (1.2 equiv, 910 mg, 6.58 mmol) was added and the mixture was stirred at 80 ° C for 40 minutes. Water was added and the resulting adhesive was extracted with CH ₂ Cl ₂ (3 ×). The combined extracts were washed with water (1 ×), dried over Na ₂ SO ₄ and the volatiles were removed in vacuo to give a thick oil (3.2 g of solvent-containing substance, yield> 100%). The resulting substance had a purity of more than 85% and was used in the next step without further purification. A small portion of it was purified by preparative HPLC for characterization. LCMS (ES): 95% pure, m / z 504 [M] ⁺ , 506 [M + 2] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.38 (s, 9H), 1.40 (m, 3H), 2.32 (s, 3H), 3.93 (dd, J = 15.2, J = 5.5, 1H), 4.24 (dd, J = 14.8, J = 4.2, 1H), 4.43 (m, 2H), 4.84 (broad t, 1H), 7.15 (m, 1H), 7.29 (m, 1H), 7.45 (m, 1H), 7.57 (m, 2H), 8.61 (d, J = 8.8, 1H) ppm

Example 74

Compound 3 (1.5 g, 2.98 mmol) was dissolved in 5 ml of trifluoroacetic acid. The mixture was stirred at room temperature for 2 hours. Volatiles were removed in vacuo and the resulting thick oil was heated using a heat “gun” in vacuo. This operation was continued until the formation of compound 4 by cyclization (control according to LCMS). The compound was purified by flash chromatography on silica gel (30-80% EtOAc gradient in hexane). The solid that precipitated upon evaporation of the solvents was filtered and dried to give compound 4 as a white microcrystalline solid (434 mg, 41% yield). LCMS (ES): 95% pure, m / z 356 [M + H] ⁺ , 378 [M + Na] ⁺ , 310 [M + 1-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.43 (t, J = 6.8, 3H), 4.40 (q, J = 7.2, 2H), 4.46 (d, J = 2.4, 2H), 7.24-7.40 (m, 4H), 7.69 (d, J = 8.4, 1H), 8.62 (d, J = 8.0, 1H), 10.74 (br s, 1H) ppm.

Example 75

Compound 4 (1.0 equiv, 198 mg, 0.556 mmol) and K ₂ CO ₃ (2.0 equiv, 154 mg, 1.11 mmol) were suspended in DMF (1.5 ml). Iodomethane (1.4 equiv, 0.05 ml, 0.80 mmol) was added and the mixture was stirred at 70 ° C for 40 minutes. Water was added and the substance was extracted with CH ₂ Cl ₂ (3 ×). The combined extracts were washed with water, dried over Na ₂ SO ₄ and the volatiles were removed in vacuo. After purification by flash chromatography on silica gel (40-80% EtOAc gradient in hexane), compound 5 was isolated as an off-white solid (181 mg, 88% yield). LCMS (ES): 95% pure, m / z 370 [M + H] ⁺ , 324 [M + 1-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.41 (t, J = 7.2, 3H), 3.17 (s, 3H), 4.29 (s, 2H), 4.41 (q. , J = 7.2, 2H), 7.27 (d, J = 7.2, 1H), 7.33 (t, J = 7.6, 1H), 7.36 (d, J = 8, 4, 1H), 7.39 (td, J = 7.2, J = 1.2, 1H), 7.57 (d, J = 8.4, 1H), 8.61 (d, J = 8 4, 1H) ppm.

Example 76

Compound 4 (1.0 equiv, 104 mg, 0.29 mmol) was suspended in THF. A solution of DDQ (1.1 eq, 73 mg, 0.32 mmol) in THF (1 ml) was added dropwise, and the resulting mixture was stirred at 70 ° C. for 24 hours. 1N was added. aqueous NaOH and the solution was extracted with CH ₂ Cl ₂ (4 ×). The combined extracts were washed with saturated aqueous NaHCO ₃ and the solvents were removed in vacuo. The compound was purified by preparative HPLC (MeCN / water mixture). MeCN was evaporated, NaHCO _{3 was} added and the compound was extracted with CH ₂ Cl ₂ . The combined extracts were dried over Na ₂ SO ₄ and the solvent was removed in vacuo to give compound 6 as an off-white solid (18 mg, 17% yield). LCMS (ES): 95% pure, m / z 372 [M + H] ⁺ , 326 [M + 1-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.44 (t, J = 6.8, 3H), 4.42 (q, J = 7.2, 2H), 6.01 (d, J = 4.4, 1H), 7.4-7.55 (m, 4H), 7.98 (d, J = 8.8, 1H), 8.64 (d, J = 8.4, 1H), 11.53 (br s, 1H) ppm.

Example 77

Compound 6 (8 mg, 0.021 mmol) was suspended in dioxane (0.5 ml). One drop of concentrated aqueous HCl was added and the resulting yellow solution was stirred at room temperature. After 2 hours, another drop of concentrated HCl was added and some air was bubbled into the solution. The solution was stirred at room temperature for 24 hours. The solvent was removed in vacuo, NMP was added, and the compound was purified by preparative HPLC (MeCN / water mixture). Acetonitrile was evaporated, the product was extracted with CH ₂ Cl ₂ (3 ×) and the combined extracts were dried over Na ₂ SO ₄ . Solvents were removed to give compound 7 as a solid (5 mg, 62% yield). LCMS (ES): 95% pure, m / z 370 [M + H] ⁺ , 392 [M + 23] ⁺ , 324 [M + 1-EtOH] ⁺ ; ¹ H NMR (CDCl ₃ , 400 MHz) δ 1.46 (t, J = 7.2, 3H), 4.48 (q, J = 7.2, 2H), 7.52 (d, J = 8.0, 1H), 7.58 (t, J = 6.8, 1H), 7.81 (dt, J = 6.8, J = 1.6, 1H), 8.33 (dd, J = 7.6, J = 1.2, 1H), 8.56 (d, J = 8.8, 1H), 8.70 (d, J = 8.0, 1H), 13.58 (broad. s, 1H) ppm

Example 78

Compound 4 (1.0 equiv, 218 mg, 0.613 mmol) and K ₂ CO ₃ (2.0 equiv, 169 mg, 1.22 mmol) were suspended in DMF (1.5 ml). Iodomethane (1.2 equiv, 0.059 ml, 0.74 mmol) was added and the mixture was stirred at 70 ° C for 35 minutes. Water was added and the substance was extracted with CH ₂ Cl ₂ (4 ×). The combined extracts were dried over Na ₂ SO ₄ and the volatiles were removed in vacuo. After purification by preparative HPLC, the pH of the resulting solution in MeCN / water was adjusted by adding NaHCO ₃ and the MeCN was evaporated. The material was extracted with CH ₂ Cl ₂ and the combined extracts were dried over Na ₂ SO ₄ . Precipitation with CH ₂ Cl ₂ / hexane gave compound 8 as an off-white solid (77 mg, 33% yield). LCMS (ES): 95% pure, m / z 384 [M + H] ⁺ , 406 [M + Na] ⁺ , 338 [M + 1-EtOH] ⁺ .

Example 79

Compound 4 (1.0 equiv, 110 mg, 0.309 mmol) and N-acetylpiperazine (4.0 equiv, 158 mg, 1.233 mmol) were mixed in NMP (0.3 ml) and the resulting solution was heated with microwaves at 100 ° C for 5 min . A mixture of EtOAc and hexane was added and the resulting solid was filtered and dried. Compound 9 was isolated as an off-white solid (145 mg, 100% yield). LCMS (ES): 95% pure, m / z 448 [M + H] ⁺ .

Example 80

Compound 10 was prepared according to the procedure used to prepare compound 9. Compound 10 was isolated as an off-white solid (147 mg, 70% yield). LCMS (ES): 95% pure, m / z 462 [M + H] ⁺ , 416 [M + H-EtOH] ⁺ .

Example 81

Compound 9 (1.0 eq, 131 mg, 0.293 mmol) and 1- (2-aminoethyl) pyrrolidine (1.5 eq, 0.05 ml, 0.394 mmol) were mixed in CH ₂ Cl ₂ (5 ml). AlCl ₃ (2.0 eq, 80 mg, 0.60 mmol) was added and the resulting solution was vigorously stirred at room temperature. After 3 hours, another 0.1 ml of 1- (2-amino-ethyl) pyrrolidine and 2 ml of CH ₂ Cl ₂ were added and the reaction mixture was stirred overnight. After removing CH ₂ Cl ₂ in vacuo, the resulting suspension was treated with a saturated aqueous solution of tartaric acid and stirred until all solid disappeared (about 1 h to complete hydrolysis). Water was added and the pH was adjusted to 14 by the addition of NaOH. The product was extracted with CH ₂ Cl ₂ (4 ×). The combined extracts were washed with brine (1 ×) and dried over Na ₂ SO ₄ . After removing the solvent, the crude material was dissolved in a mixture of NMP and trifluoroacetic acid and purified by preparative HPLC (MeCN, water). After adjusting the pH with NaOH and evaporating MeCN, the material was extracted with CH ₂ Cl ₂ . After drying over Na ₂ SO ₄ and evaporation of the volatiles, compound 11 was precipitated with EtOAc / hexane, filtered and dried to give a white solid (60 mg, 40% yield). LCMS (ES): 95% pure, m / z 516 [M + H] ⁺ .

Example 82

Compound 12 was prepared according to the procedure used to prepare compound 11. Compound 12 was isolated as an off-white solid (28 mg, 17% yield). LCMS (ES): 95% pure, m / z 530 [M + H] ⁺ .

Example 83

Compound 8 (1.0 equiv, 77 mg, 0.21 mmol) and N-acetylpiperazine (4.0 equiv, 103 mg, 0.803 mmol) were mixed in NMP (0.5 ml) and heated with microwaves at 100 ° C for 10 min. Water was added and brine, and the sticky material was filtered. This crude material was dissolved in CH ₂ Cl ₂ , the solution was dried over Na ₂ SO ₄ and the volatiles were removed in vacuo. Then, the final reaction step was carried out with the crude ether in accordance with the procedure used to prepare compound 11. Compound 13 was isolated as an off-white solid (7 mg, 6% yield). LCMS (ES): 95% pure, m / z 544 [M + H] ⁺ .

Example 84

Compound 14 was prepared according to the procedure used to prepare compound 13 as described in Example 83. Compound 14 was isolated as an off-white solid. LCMS (ES): purity 91%, m / z 530 [M + H] ⁺ .

Example 85

Ethyl 2- (4-chlorobenzothiazol-2-yl) acetate was prepared by the method of Abbotto, Bradamante et al. (J. Org. Chem., 2002, 16, 5753). An undiluted mixture of 4-chloro-2-aminothiophenol (6.36 g, 40 mmol) and ethyl cyanoacetate (6.8 g, 60 mmol) was heated at 125 ° C for 2 hours, at which time the TLC analysis indicated that the reaction was complete, what was judged by the disappearance of the starting compound. The mixture was triturated with a mixture of diethyl ether and hexane to give 7.91 g of yellow crystals in the first batch and 0.75 g of crystals in the second batch, which in total was 8.66 g (85%). LCMS: 256.2 [M + H] ⁺ .

2,6-Dichloropicolinic acid (1.80 g, 9.5 mmol) was suspended in dichloromethane (10 ml) and treated with oxalyl chloride (1.53 g, 12.0 mmol). The mixture was cooled in an ice bath and two drops of dimethylformamide were added. After the initial vigorous evolution of gas, the ice bath was removed and the solution was stirred for 18 hours at room temperature. An aliquot of the reaction mixture was quenched with methanol and analyzed by LCMS, the data of which indicated that all the acid had turned into the acid chloride. The solution was concentrated on a rotary evaporator to give the acid chloride as a light brown crystalline solid, which was used in the next step without further purification. LCMS: 206.2 (methyl ester M + H) ⁺ .

Tetrahydrofuran (25 ml) was added to a mixture of ethyl 2- (4-chlorobenzothiazol-2-yl) acetate (2.2 g, 8.6 mmol), magnesium chloride (1.19 g, 12.9 mmol) and 2.6 -dichloropicolinyl chloride obtained in the previous step. The resulting suspension was cooled in an ice bath and triethylamine (2.4 g, 17.2 mmol) was added dropwise at such a rate that the temperature of the mixture did not rise above 10 ° C, which was determined using a temperature sensor. After the addition was complete, the ice bath was removed and the mixture was stirred until the temperature rose to room temperature for 2 hours. The reaction mixture was diluted with dimethylformamide, potassium carbonate (1.19 g, 8.6 mmol) was added and heated to 80 ° C for 1 h, in during this time, LCMS data indicated that the reaction was over. The reaction mixture was diluted with water and filtered. The solid was dissolved in a mixture of dichloromethane and chloroform, washed with water and the organic phase was dried over sodium sulfate. After concentrating on a rotary evaporator, the product was purified by trituration with diethyl ether to give 2.5 g (yield 74%) of dichloroester as a beige solid. LCMS: 393.2 (M + H) ⁺ .

Example 86

A solution of 2- (1-methylpyrrolidin-2-yl) ethylamine (295 mg, 2.3 mmol) in dichloromethane (5 ml) was treated with trimethylaluminum (0.99 ml, 25% solution in hexane, 2.37 mmol). This solution was added to a solution containing dichloroester A (600 mg, 1.53 mmol) and dichloromethane (10 ml) at such a rate that the temperature of the mixture did not exceed 10 ° C. The solution was stirred for 18 hours, at which time LCMS data indicated that the reaction was complete. The reaction mixture was treated with Rochelle salt and extracted three times with dichloromethane. The organic extracts were dried over sodium sulfate to give a residue, which was purified by trituration with dichloromethane and diethyl ether to give 450 mg (yield 62%) of dichloramide B as a beige solid. LCMS: 475.5 (M + H) ⁺ .

Example 87

A mixture of Vos-amine (250 mg, 1.0 mmol) was deprotected by treatment with trifluoroacetic acid (1 ml) and dichloromethane (1 ml) at 50 ° C for 2 hours. The resulting residue was concentrated on a rotary evaporator, followed by connection to a deep vacuum. Dichloramide B (200 mg, 0.42 mmol) and N-methylpyrrolidinone (0.8 ml) and diisopropylethylamine (0.5 ml) were added to this residue. The mixture was stirred at 80 ° C for 72 hours, at which time LCMS data indicated that the reaction was complete. The mixture was diluted with water (containing 10% trifluoroacetic acid) and purified by preparative HPLC to give 286 mg (97% yield) of compound C as the corresponding trifluoroacetate. LCMS: 588.3 (M + H) ⁺ .

Example 88

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 242.9 mm ³ Test compound: 251.0 mm ³

Animals were given iv bolus injection into the lateral caudal vein for five consecutive days. Measurements with a caliper were performed on days 1, 4 and 6. Figure 3 shows data on the activity of the test compound at a dose of 25 mg / kg without the manifestation of the observed side effects.

Example 89

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Simonsen Labs Nursery, Gilroy, CA. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 101.9 mm ³ Test compound: 152.8 mm ³

Animals were given iv bolus injection into the lateral caudal vein for fourteen consecutive days. Caliper measurements were performed on days 1, 3, 5, 7, 10, 12, 14, and 18. Figure 4 shows data on the activity of the test compound at a dose of 12.5 mg / kg without the manifestation of the observed side effects.

Example 90

In this example, the activity of the test compound of Example 89 was evaluated, which was administered intravenously in various doses.

Methodology

6 week old nu / nu female mice were obtained from Simonsen Labs Nursery, Gilroy, CA. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 114.6 mm ³ Test compound: 106.1 mm ³ Test compound: 84.1 mm ³

Animals were given iv bolus injection into the lateral caudal vein for fourteen consecutive days. Caliper measurements were performed on days 1, 4, 6, 8, 12, and 15. Figure 5 shows data on dose-dependent activity without the manifestation of the observed side effects.

Example 91

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 242.9 mm ³ Test compound: 252.1 mm ³

Animals were given iv bolus injection into the lateral caudal lateral vein for five consecutive days. Measurements with a caliper were performed on days 1, 4 and 6. Figure 6 shows data on the activity of the test compound at a dose of 25 mg / kg without the manifestation of the observed side effects.

Example 92

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 242.9 mm ³ Test compound: 236.1 mm ³

Animals were given iv bolus injection into the lateral caudal vein for five consecutive days. Measurements with a caliper were performed on days 1, 4 and 6. 7 shows data on the activity of the test compound at a dose of 25 mg / kg without the manifestation of the observed side effects.

Example 93

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 242.9 mm ³ Test compound: 254.7 mm ³

Animals were given iv bolus injection into the lateral caudal vein for five consecutive days. Measurements with a caliper were performed on days 1, 4 and 6. On Fig shows data on the activity of the test compounds at a dose of 25 mg / kg without the manifestation of the observed side effects.

Example 94

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 112.7 mm ³ Test compound: 113.1 mm ³ 25 mg / kg Test compound: 110.1 mm ³ 12.5 mg / kg CPT11: 109.4 mm ³

Animals were given iv bolus injection into the lateral caudal vein for nine consecutive days. Caliper measurements were performed on days 1, 3, 5, and 7. Figure 9 shows data indicating the limited activity of the compound at the highest dose and the lack of activity in the average dose without the manifestation of the observed side effects.

Example 95

In this example, the activity of the test compound shown below, which was administered intravenously, was evaluated.

Methodology

6 week old nu / nu female mice were obtained from Taconic Farms Nursery, Germantown NY. They were inoculated with 5 × 10 ⁶ HCT116 cells subcutaneously in the right flank. When the tumors reached sufficient size for the formulation of the study, the animals were randomly divided into groups.

Solvent: 112.7 mm ³ Test compound: 107.1 mm ³ 25 mg / kg Test compound: 108.9 mm ³ 12.5 mg / kg CPT11: 109.4 mm ³

Animals were given iv bolus injection into the lateral caudal vein for nine consecutive days. Caliper measurements were performed on days 1, 3, 5, and 7. Figure 10 shows data on high activity in a minimum dose. No side effects were observed.

Example 96

Test for evaluating cell proliferation and / or cytotoxicity

The antiproliferative effects of the present compounds can be tested using a cell proliferation and / or cytotoxicity test, following the protocols described below.

Cell culture. Epithelial cells of a human cervical cancer (HeLa cells) are obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in Eagle’s minimal essential medium (MEM, Hyclone, Utah) supplemented with 2 mM glutamine, 0.1 mM essential amino acids, 1 mM Na pyruvate, 1.5 g / L NaHCO ₃ , 50 mg / L gentamicin and 10% fetal calf serum (Hyclone, USA) in a humid atmosphere of 5% CO ₂ at 37 ° C.

MTS tests. The antiproliferative effects of anticancer drugs are evaluated by the CellTiter 96 AQueous test (Promega, WI), which is a colorimetric test to determine the number of viable cells. (See, for example, Wang L., et al., Methods Cell Sci. (1996) 18: 249-255). Typically, cells (2000-5000 cells / well) are seeded in a 96-well flat-bottom plate (Corning, NY) in 100 μl of culture medium without an antitumor preparation on day 0 and the culture medium on day 1 is replaced containing antitumor preparations in various concentrations . After incubation for 3 days under normal culture conditions (on day 4), the monolayers are washed once with PBS and the medium is replaced with 100 μl of PBS in each well of a 96-well plate. After mixing MTS and PBS in a 20: 1 ratio, 20 μl of a MTS / PBS solution was added to each well of a 96-well plate and incubated for 4 hours in a humid atmosphere of 5% CO ₂ at 37 ° C. Absorbance was determined at 490 nm using a reader for 96-well FLUOstar Galaxy plates (BMG Labtechnologies, Germany).

Example 97

Test for determining mRNA concentrations in a cell

To detect changes in the c-mus target and endogenous copies of the GAPDH standard gene in a single tube, you can use the method of quantitative real-time PCR (qPCR). Typically, cells (15,000 cells / well) are seeded in 96-well flat bottom plates (Corning, NY) and incubated under normal culture conditions overnight. The next day, the culture medium is replaced containing antitumor drugs in various concentrations and incubated for 4 hours in a humid atmosphere of 5% CO ₂ at 37 ° C. The total RNA fraction (oRNA) was extracted using the RNeasy 96 kit (QIAGEN, CA). The concentration of oRNA is determined using RiboGreen RNA quantitative reagent (Molecular Probes, OR).

The reverse transcription (RT) reaction can be carried out using 50 ng of oRNA from each well in 25 μl of the reaction mixture containing 1 × TaqMan RT buffer, 2.5 μM random hexamer mixture, 5.5 mM MgCl ₂ , 0.5 mM each deoxynucleoside triphosphate (dNTP), 30 U MultiScribe reverse transcriptase and 10 U RNase inhibitor. RT formulation reaction mixtures are incubated for 10 min at 25 ° C, a reverse transcription reaction is performed for 30 min at 48 ° C, inactivated for 5 min at 95 ° C and placed at 4 ° C. All RT reagents can be obtained from Applied Biosystems, CA.

Real-time quantitative PCR can be carried out in 50 μl of the reaction mixture containing 5 μl of cDNA, a universal 1 × PCR mixture, pre-prepared primers with c-mus and a set of probes 1 × and pre-prepared primers GAPDH and a set of probes 0.8 × . Due to the relative redundancy of the GAPDH gene in HeLa cells, the concentrations of primers and GAPDH probes are adjusted to the exact value for the (C _T ) cycles for both genes in one tube. The threshold cycle (C _T ) indicates the number of fractional cycles at which the amount of the amplified target reaches a fixed threshold. In this embodiment, the amplification of GAPDH is stopped before the limit of conventional reagents available for c-mus amplification is reached. The ΔR _n value represents the normalized reporter signal minus the background signal. The ΔR _n value increases during PCR as the number of copies of the amplicon increases, until the reaction reaches a plateau.

The c-mus probe is marked with MGB 6FAM ^™ paint and the GAPDH probe is marked with MGB VIM ^™ paint. A preliminary incubation is carried out for 2 min at 50 ° C to activate the AmpErase UNG enzyme and then for 10 min at 95 ° C to activate the AmpliTaq DNA polymerase enzyme. DNA is amplified in 40 cycles of 15 sec at 95 ° C and 1 min at 60 ° C. Human c-DNA and GAPDH cDNAs are amplified, detected and quantified in real time using the ABI Prism 7000 sequence determination system (Applied Biosystems, CA), which is installed for the simultaneous detection of 6FAM and VIM reporter colors.

Data can be analyzed using the ABI Prism sequencing system and Microsoft Excel. Relative quantification is carried out using a standard curve and a comparative method _{T T} at the same time, and both methods provide the same results. It is known that the cycle in which the amplification graph crosses C _T accurately reflects the relative amounts of mRNA. (See Heid et al., Genome Res. (1996) 6: 986-994; Gibson et al., Genome Res. (1996) 6: 995-1001). Real-time quantitative PCR reactions are carried out in three parallels with each cDNA sample and the average C _T value is calculated from three values. All reagents, including pre-prepared primers and probe sets, are available from Applied Biosystems, CA.

Example 98

In vitro characterization

Various methods can be used to characterize the compounds of the present invention, including but not limited to i) stop tests; ii) quadruplex / duplex competition methods; iii) the quadrom footprint method; and iv) the direct method in the absence of a competitive molecule.

Stop tests. Stop tests are primary high-throughput screening methods designed to detect drugs that bind and stabilize the G-quadruplex target. Typically, an DNA template oligonucleotide is prepared that contains the nucleotide sequence of the target quadruplex for the drug that is being screened. The fluorescence-labeled DNA primer is then annealed at the 3 ′ end of the DNA template. DNA polymerase, such as Taq polymerase, is then introduced to synthesize a complementary strand of DNA by extension from a fluorescently labeled primer. In the event that the effect of Taq polymerase is not difficult, it synthesizes a full-sized copy of the matrix. The introduction of a test drug that only binds to DNA duplex, but does not selectively bind to the quadruplex region, leads to a decrease in the synthesis of a full-sized product and a concomitant increase in the synthesis of DNA copies of various lengths. However, if the test drug selectively binds to and stabilizes the quadruplex, then the polymerase is blocked only on the quadruplex, and a specific “stop product” is synthesized.

Compounds were initially screened at a single concentration, and “hits” were re-analyzed at a number of concentrations in order to establish an IC ₅₀ value (ie, the concentration of the drug needed to obtain a 1: 1 blocking product / full-size product ratio). These products are determined by capillary electrophoresis.

The quadruplex / duplex competition method . The selectivity of compounds with respect to the target quadruplex sequence compared to DNA duplex can be determined using a competitive method (ie, “screening for selectivity”). In this screening for selectivity, a stop test is used as a reporter system to determine the relative ability of an externally inserted DNA sequence to compete with a quadruplex target structure in the DNA matrix for binding to a drug. For example, competitors are the c-mus quadruplex sequence, which is identical to the quadruplex sequence present in the DNA matrix; or a DNA plasmid, which is a mimetic of the genomic complex of a DNA duplex. The degree to which each competitor successfully “flushes out” a drug in solution is a reflection of a quantitative decrease in stop product synthesis. Thus, the relative binding affinity of the drug is determined with respect to both target quadruplex and DNA duplex.

Quadrom footprint method. Compounds can also be evaluated for their ability to bind to other naturally occurring quadruplex structures of biological importance, including quadruplex regulatory elements that regulate a number of different oncogenes. The data obtained is used to create quadrom footprints.

Direct interaction test. Compounds can be evaluated for their ability to directly interact with nucleic acids capable of forming quadruplex structures, where the nucleic acid is not a telomeric nucleic acid. The test can be carried out in one or different containers. For example, a compound can be reacted with each nucleic acid in a single container. Alternatively, the compound may individually interact with each nucleic acid in different containers. The term telomeric nucleic acid, as used herein, represents the region of the highly repeating nucleic acid at the end of the chromosome. As used herein, direct interaction is determined without the presence of competitive nucleic acid.

The interaction between the compound and the nucleic acid can be evaluated, for example, by determining IC ₅₀ values that indicate binding and / or stabilization of the quadruplex. You can determine the selectivity of interactions, for example, by comparing the set values of IC ₅₀ For example, the lowest IC ₅₀ values can be used, indicating a strong interaction between the compound and the nucleic acid, while the highest IC ₅₀ values are indicative of weak interaction and thus an indicator of the selectivity of the interaction. The reaction products can be determined by capillary electrophoresis.

Example 99

Direct interaction test

Typically, a 5'-fluorescently labeled (FAM) primer (P45, 15 nM) is mixed with a DNA template (15 nM) in Tris-HCl buffer (15 mM Tris, pH 7.5) containing 10 mM MgCl ₂ , 0, 1 mM EDTA and 0.1 mM deoxynucleotide triphosphate (dNTP) mixtures. The mixture was denatured at 95 ° C for 5 minutes and, after cooling to room temperature, incubated at 37 ° C for 15 minutes. After cooling to room temperature, 1 mM KCl and the test compound (at various concentrations) were added and the mixture was incubated for 15 minutes at room temperature.

Primer extension is carried out by adding 13 mM KCl and Taq DNA polymerase (2.5 U / reaction, Promega) and incubation at 70 ° C for 20 minutes. The reaction is stopped by adding 1 μl of the reaction mixture to 10 μl of Hi-Di formamide and 0.25 μl of LIZ120 size standard. The method is repeated with the addition of competitive nucleic acids in various concentrations in the first stage, together with a primer and template sequences. A ligand binding to the G-quadruplex is added at a previously established concentration, as it leads to the formation of the ratio of the stop product and the full-sized product equal to 1: 1. The CC50 for each competitive nucleic acid is determined as the competitor concentration necessary to change the ratio of the blocking product to the full-sized product in the range from 1: 1 to 1: 2. The nucleic acid sequences of the quadruplexes that can be used for this test are shown in table 4.

Example 100

Cytochrome P450 Inhibition Test (CYP450)

The compounds of the present invention can be evaluated for potential inhibitory activity against cytochrome P450 isoenzymes. Typically, six test tubes are prepared with reaction mixtures from 100 μl of a solution containing 50 mM potassium phosphate, pH 7.4, 2.6 mM NADP +, 6.6 mM glucose-6-phosphate, 0.8 U glucose-6-phosphate dehydrogenase / ml and serial dilutions of 1: 6 of the test compound together with 6 tubes with serial dilutions of 1: 6 of the corresponding positive control inhibitor. The reaction begins with the addition of a pre-warmed enzyme / substrate solution to the reaction tubes. A control reaction corresponding to zero time is prepared by adding 50 μl of acetonitrile to 100 μl of cofactor inactivation enzyme solution, then adding 100 μl of enzyme / substrate solution. You can also prepare a control reaction mixture without introducing an inhibitor. After appropriate incubation at 37 ° C, the reaction is stopped by adding 50 μl of acetonitrile. The reaction mixtures are analyzed for the content of the metabolites of the substrate probe using LC / MS / MS.

Example 101

Evaluation of the effectiveness of compounds in suppressing tumor growth

A representative experiment can be planned to evaluate the effectiveness of the compounds of the present invention in a model of human carcinoma in nude mice, as described below. Male or female mice (mice, Sim) (NCR, nu / nu) are used at the age of 5-6 weeks and weighing more than 20 g. Animals are intentionally raised, and at the beginning of the experiment they are intact. Tumors reproduce as a result of cell grafting or passage of tumor fragments. Cell lines for use include, but are not limited to Paca-2, HPAC, Hs700T, Panc 10.05, Panc 02.13, PL45, SW 190, Hs 766T, CFPAC-1, and PANC-1.

Cell implantation. Into the right flank of 60 animals, 1-10 million cells were suspended subcutaneously suspended in 0.1 ml of culture medium, with or without matrigel (Collaborative Biomedical Products, Inc, Bedford, MA). Only one injection per animal is needed. Within 7-14 days after vaccination, tumors develop with a size suitable for the study, approximately 1.0 cm ³ . A small subgroup (<10/60) of animals is envisioned. Donors and tumors grow within 10-28 days and to a size of 1.5 cm ³ for use in serial transplantation.

Fragment transplantation. Donor animals are euthanized and tumors are surgically removed and cut into 2 mm ³ fragments using an aseptic method. Animals intended for implantation are lightly anesthetized with isoflurane. The implantation site is treated with 70% alcohol and betadine. Then one fragment is implanted subcutaneously using a trocar.

Experience in evaluating effectiveness. 50-60 animals with tumors are randomly divided into groups. For example, in a specific experiment, animals can be randomly divided into 3-8 groups of 7 animals each, as shown in table 5.

Table 5 Group number The number of males and
females Dose Dose Volume (μl) The concentration of the solution for administration (mg / ml) The number of animals euthanized per
day 28-42 one N = 7 Negative the control* 250 All 2 N = 7 Positive. the control** 10-40 V / B 2-5 V / B All 10-250 V / V 2.5-5 V / V 125-500 software ≤10 software Groups 3-8 N = 7 / group overall <56 Test compound All 1-25 V / B 10-40 V / B 2-5 V / B 1-50 V / V 10-250 V / V 2.5-5 V / V 125-200 software 125-500 software ≤10 software * solvent / diluent
** industrially available antitumor drugs, including, but not limited to, taxol, CPT11, and gemcitabine, are used as positive controls.

Route of administration. Compounds are administered every day, every 2 days, every 3 days, or once a week intraperitoneally, intravenously (into the lateral caudal vein), or orally. Introduction to animals is carried out in a systematic manner, which allows you to evenly distribute the time of administration in all groups. When iv or oral administration of animals is fixed manually. With the on / in the introduction in the form of a bolus or a short intravenous infusion (within 1 min), the animals are fixed mechanically, but not euthanized. Disposable sterile syringes are used for each animal / dose. The test compound is also tested in combination with a chemotherapeutic agent at a dose of 10-100 mg / kg (e.g., 40 mg / kg), such as gemcitabine, usually with intraperitoneal administration once a week.

Example 102

Determination of maximum tolerated doses

A representative experiment can be planned to determine the maximum tolerated dose (MTD) of the compounds of the present invention, as presented below. The selection of animals in the experiment is carried out as described in example 101.

Experiments to determine acute toxicity. In a representative experiment on the determination of MTD after a single administration, for example, 60 intact animals are randomly assigned to groups of 10 animals (5 males and 5 females) and one compound is administered in two ways or two compounds in one way. It was found that a single IV dose of 50 mg / kg was tolerated and was used as a preliminary lower dose. The lower dose for experiments with oral administration is based on the expected tolerance, and if necessary it is adjusted. A typical scheme of doses, volumes of administration and concentration of the injected solution are given in table 6.

Table 6 Group number The number of females and males Dose
(mg / kg) Dose Volume (μl) The concentration of the solution for administration (mg / ml) The number of animals euthanized on day 7 one N = 5 males
N = 5 females Test compound 1
50 V / V
100 software 250 V / V
500 software 5 V / V
5 software All 2 N = 5 males
N = 5 females Test compound 1
75 V / V
200 software 250 V / V
500 software 8.25 V / V
10 software All 3 N = 5 males
N = 5 females Test compound 1
100 V / V
300 software 250 V / V
500 software 10 V / V
15 software All four N = 5 males
N = 5 females Test compound 2
50 V / V
100 software 250 V / V
500 software 5 V / V
5 software All 5 N = 5 males
N = 5 females Test compound 2
75 V / V
200 software 250 V / V
500 software 8.25 V / V
10 software All 6 N = 5 males
N = 5 females Test compound 2
50 V / V
100 software 250 V / V
500 software 10 V / V
15 software All

Experiments on the study of subchronic toxicity. In a representative experiment, to evaluate the dose-response relationship after repeated administrations, for example, 25 intact animals are randomly assigned to groups of 5 animals each, as shown in Table 7. Every two weeks, only one compound is tested with one route of administration at the optimal dose. established on the basis of acute toxicity data.

Table 7 Group number Number of females or males Dose
(mg / kg) Dose Volume (μl) The concentration of the solution for administration (mg / ml) The number of animals subjected to euthanasia on day 14 one N = 5 Negative control 250 V / V
500 software Dose dependent All 2
QD N = 5 Test compound according to maximum tolerated dose determination (MTD) 250 V / V
500 software Dose dependent All 3
QOD N = 5 Test compound according to maximum tolerated dose determination (MTD) 250 V / V
500 software Dose dependent All four
Q3D N = 5 Test compound according to maximum tolerated dose determination (MTD) 250 V / V
500 software Dose dependent All 5
Q7D N = 5 Test compound according to maximum tolerated dose determination (MTD) 250 V / V
500 software Dose dependent All

Route of administration. Compounds are administered every day, every 2 days, every 3 days, or once a week intravenously (in the lateral caudal vein) or orally. Introduction to animals is carried out in a systematic manner, which allows you to evenly distribute the time of administration in all groups. When administered orally, animals are fixed manually. With the on / in the introduction in the form of a bolus or a short intravenous infusion (within 1 min), the animals are fixed mechanically, but not euthanized. Disposable sterile syringes are used for each animal / dose.

Example 103

Assessment of pharmacokinetic properties

An indicative pharmacokinetic study can be planned to evaluate the pharmacokinetic properties of the present compounds, as presented below. Male animals (Balb / c mice or rats, SD) at the age of 5-6 weeks are used. In the experiment on rats, animals with a body weight of more than 200 g are used. In a typical experiment, for example, 20 animals are randomly divided into 4 groups, as shown in Table 8. Animals of one group are not processed and the selected samples are used as background control. There are animals of three other groups, and they are given a single dose of the compounds by intravenous injection.

Table 8 Group number Number of animals Time after injection (hour) one 2 Intact 2 6 0.25, 2, 8 3 6 0.5, 4, 12 four 6 1, 6, 24

Route of administration. Compounds are administered iv (in the lateral tail vein), iv or orally. Introduction to animals is carried out in a systematic manner, which allows you to evenly distribute the time of administration in all groups. With iv or oral administration, the animals are fixed manually. With the on / in the introduction in the form of a bolus or a short intravenous infusion (within 1 min), the animals are fixed mechanically, but not euthanized. Disposable sterile syringes are used for each animal / dose.

About 0.5 ml of blood was collected from intact animals by heart puncture before the first dose. Final blood samples (0.5 ml) were taken by heart puncture from two animals per group at each time point according to the above scheme. All samples are placed in tubes containing the lithium salt of heparin as an anticoagulant, and immediately stirred by rotating the tubes. Samples are centrifuged, blood plasma is frozen in liquid nitrogen, stored at -70 ° C or lower, and drug concentrations are determined.

Example 104

Determination of metabolic stability in hepatocytes in vitro

An indicative protocol can be designed to determine the stability of a new chemical compound in the presence of hepatocytes (humans, rats, dogs, monkeys) during incubation in vitro, as described below. The test compound is incubated with hepatocytes and a suitable medium for various periods of time at 37 ° C. The reaction mixtures were extracted and analyzed by LC / MS / MS for the content of the starting compound and putative metabolites. If applicable, the half-life of the test compound is determined. A study of metabolic controls is carried out in order to compare the half-life values with those obtained for the test compound. Controls in the study of metabolism can be tolbutamide, desipramine and naloxone, which have established pharmacokinetic parameters corresponding to low, medium and high clearance values in vivo.

The study of metabolic stability. Typically, solutions of the test compounds are prepared along with a mixed solution of metabolic controls, which are intended to be used as a standard for enzymatic activity. Reactions begin by mixing these pre-heated solutions with hepatocyte suspensions and with the control solution medium. Immediately after the start, control samples corresponding to zero time were taken from these reaction mixtures. Additional samples can be taken at appropriate time points. Each sample was immediately placed in a solution to stop the reaction (acidified MeCN containing IS). Prepare control suspensions of hepatocytes and standard solutions of the tested compounds.

Samples and standards of the test compound, as well as the corresponding controls, are prepared by the usual sample preparation procedure and analyzed for the content of the starting compound and / or metabolites of the test compound using HPLC in combination with mass spectrometry. Samples and standards for metabolic controls can be studied by the analytical method described in this description. In cases where the Krebs-Henseleit buffer is added, 5% CO ₂ is passed into the buffer in air at room temperature for 5-10 minutes before adding BSA to a final concentration of 0.2 wt% / vol. The volume of the solution to stop the reaction and the method of sample preparation are determined for the test object during the development of the method.

A solution of the test compound of the medium. A test compound solution is prepared by adding an appropriate volume of the mother liquor to a 0.2% BSA solution in Krebs-Henseleit buffer, balanced with 5% CO ₂ in air. The final concentration ranges from 5 μM to 20 μM, and the final concentration when setting the test at the beginning of the reaction is from 1 μM to 10 μM.

Control solution for metabolic / environmental studies. Solutions of tolbutamide, desipramide and naloxone are prepared by adding an appropriate volume of a 10 mM mother liquor of each compound to a 0.2% BSA solution in Krebs-Henseleit buffer balanced with 5% CO ₂ in air. The final concentration is 20 μM for each metabolic control and the final concentration when setting the test is 10 μM at the beginning of the reaction.

A suspension of hepatocytes. Hepatocytes are thawed and isolated according to the manufacturer's instructions (Invitrotech, Inc.). At the final stage of the test, cell viability is determined using trypan blue displacement. Hepatocytes are then resuspended in 0.2% BSA in Krebs-Henseleit buffer balanced with 5% CO ₂ in air to a final concentration of 0.5 million viable cells / ml. The concentration at the beginning of the reaction is 0.25 million viable cells / ml.

Initiating test compound incubation. Equal volumes of the test compound solution prepared in step 2.1.3 are poured into 4 polypropylene scintillation vials. The bottles are preheated for 5-10 minutes at 37 ° C at 95% humidity and 5% CO ₂ . Two vials add 0.2% BSA in Krebs-Henseleit buffer equilibrated with 5% CO ₂ in air and mix thoroughly. Immediately after the start of the reaction, a timer is started and a sample of 100 μl is taken from each vial and placed in 1.7 ml centrifuge tubes containing the appropriate volume of solution to stop. These samples serve as controls on the medium to determine non-enzymatic degradation and nonspecific binding to the vessel.

Equal volumes of hepatocyte suspension prepared as described above are added to two bottles and mixed thoroughly. Immediately after the start of the reaction, a timer is started and a sample of 100 μl is taken from each vial and placed in 1.7 ml centrifuge tubes containing the appropriate volume of solution to stop the reaction. All bottles are placed in a thermostat at 37 ° C, 95% humidity and 5% CO ₂ .

Initiating metabolic controls incubation. Equal volumes of the control solution for studying metabolism are poured into 2 polypropylene scintillation vials. The bottles are preheated for 5-10 minutes at 37 ° C at 95% humidity and 5% CO ₂ . Equal volumes of hepatocyte suspension are added to each of the two vials and mixed thoroughly. Immediately after the start of the reaction, a timer is started and a sample of 100 μl is taken from each vial and placed in 1.7 ml centrifuge tubes containing an equal volume of solution to stop. All bottles are placed in a thermostat at 37 ° C, 95% humidity and 5% CO ₂ .

Sample selection. The vials are gently shaken and samples (100 μl) are taken and placed in 1.7 ml centrifuge tubes containing the appropriate volume of solution to stop the reaction according to the following scheme: samples with the test drug are taken after 5, 10, 15, 30, 60, 90 and 120 minutes; samples with controls for studying metabolism are taken after 30, 60, 90 and 120 minutes. Immediately after sampling, the vials are placed back into the thermostat until the last sample is taken.

Preparation of control samples. A sample (100 μl) of hepatocyte suspension is added to an equal volume of 0.2% BSA in Krebs-Henseleit buffer and mixed thoroughly. A sample of this solution with a volume of 100 μl was taken and placed in 1.7 ml centrifuge tubes containing the same volume of solution to stop the reaction used for the reaction with the test compound. A sample of the incubation medium (0.2% BSA in Krebs-Henseleit buffer) was placed in 1.7 ml centrifuge tubes containing the same volume of stopping solution used for the reaction with the test compound.

Sample preparation and analysis. All vials are centrifuged at 16,000 g for 3 minutes. Supernatants are placed in polypropylene autosampler tanks and stored at 4 ° C (≤1 days) or -70 ° C (≥1 days) until analysis. Test compound solutions were analyzed using HPLC / MS / MS according to standard methods. In one example, the following HPLC conditions may be used: column (Phenomenex Synergi Hydro-RP, 100.0 x 2.0 mM, 5 μm); pre-column (Phenomenex C18, 4.0 × 2.0, 5 μm); flow rate (0.3 ml / min); column temperature 45ºС; the volume of injection of 10 μl and room temperature autosampler.

Example 105

Determination of metabolic stability in in vitro microsomes

An indicative protocol can be designed to study the stability of a new chemical compound in the presence of a microsomal fraction of the liver (human, rat, dog, monkey) during in vitro incubation, which is presented below. The test compound is incubated with microsomes and a suitable medium for various periods of time at 37 ° C. The reaction mixtures were extracted and analyzed by LC / MS / MS for the content of the starting compound and putative metabolites. If applicable, the half-life of the test compound is determined. A study of metabolic controls is carried out in order to compare the half-life values with those obtained for the test compound. Controls in the study of metabolism can be tolbutamide, desipramine and naloxone, which have certain pharmacokinetic parameters corresponding to low, medium and high clearance values in vivo.

The study of metabolic stability. Typically, 6 vials are prepared with a pre-heated reaction mixture with 100 μl of a solution containing 50 mM potassium phosphate, pH 7.4, 2.6 mM NADP ⁺ , 6.6 mM glucose-6-phosphate, 0.8 U / ml glucose 6-phosphate dehydrogenase and 1, 10 and 50 μM of the test compound. At the same time, similar reactions are set with metabolic controls, which are compounds with low (tolbutamide), medium (desipramine) and high (testosterone) clearance with a solution of the same enzyme. Reactions begin by adding 100 μl of a preheated enzyme solution and incubate at 37 ° C. A reaction corresponding to a zero time point is prepared by adding 50 μl of acetonitrile (containing an internal standard) to a solution of the test compound / cofactor before introducing the enzyme solution. After 15, 30, 60, 90, and 120 minutes, the test tube with the reaction mixture was removed from the water bath and the reaction was stopped by adding 50 μl of acetonitrile containing an internal standard. The reaction mixtures were extracted and the samples were analyzed for the initial form of the test compound and one metabolite using a C18 column with MS / MS detection. Each analysis is carried out in two parallels.

Concentrations of cofactor / test compound solution. A mother solution of 10 mM NCE in 10% DMSO (v / v) is prepared. For all analyzes, a 2, 20 or 100 μM solution of the test compound in 50 mM potassium phosphate, pH 7.4, 2.6 mM NADP ⁺ , 6.6 mM glucose-6-phosphate, 0.8 U / ml glucose-6 is prepared -phosphate dehydrogenase (cofactor solution).

Concentrations of cofactor solution / metabolic controls. Stock solutions of metabolic controls (tolbutamide, desipramine and testosterone) are used to prepare a 6 μM metabolic control solution in the cofactor solution described in the previous step.

The concentration of the enzyme solution. Enzyme solutions are prepared by adding a microsomal fraction of the liver to 50 mM potassium phosphate, pH 7.4, to a final concentration of 1 mg / ml. All microsomal fractions are obtained from Xeno Tech or InvitroTech, Inc.

Beginning of reactions. All tubes with reaction mixtures are preheated at 37 ° C in a water bath for about 3-5 minutes. A control reaction mixture corresponding to a zero time point is prepared for each parallel by adding 50 μl of acetonitrile containing 15.9 μM nebularine (internal standard) to 100 μl of cofactor solution to inactivate the enzymes and then vortex it. Reactions begin by adding 100 μl of the enzyme solution to each tube and mix on a vortex. All tubes, including the control corresponding to the zero time point, are incubated in a water bath at 37 ° C. The final concentrations of all components in the tubes after the start of the reactions are 50 mM potassium phosphate, pH 7.4, 1.3 mM NADP ⁺ , 3.3 mM glucose-6-phosphate, 0.4 U / ml glucose-6-phosphate dehydrogenase, 0 5 mg / ml of the microsomal fraction of the liver and 1, 10 or 50 μm of the test compound.

Stopping the reaction and extraction of the reaction mixtures. After 15, 30, 60, 90, and 120 minutes at 37 ° C, all reactions were stopped by adding 150 μl of acetonitrile containing 15.9 μM nebularine (internal standard). The control corresponding to the zero time point is removed from the water bath after 120 minutes. All vials are centrifuged at 16,000 g for 3 minutes. Supernatants are placed in autosampler polypropylene tanks and stored at 4 ° C (<1 day) or -70 ° C (> 1 day) until analysis.

Analysis of solutions of the test compound. Solutions of the test compound are analyzed using HPLC / MS / MS according to standard procedures as described in Example 39.

Example 106

Test for assessing mutagenic properties on bacteria

Using this test, the assessment of mutagenic properties (Ames test) assesses the potential ability of extracts of the test compounds to induce histidine (his) reversion in S. typhimurium (his-in his +) or tryptophan (trp) reversal in E. coli (trp-in trp +), caused by base changes or mutations with a shift in the reading frame in the genome of test microorganisms. Typically, a plate inclusion test is performed on 5 Salmonella typhimurium strains (TA97a, TA98, TA100, TA102 and TA1535) and one Escherichia coli strain (WP2-uvrA ^- ) in the presence and absence of an exogenous mammalian activating system (S9). The test compound is dissolved in a 5% dextrose solution. Then prepare a series of dilutions in saline before testing. For this test, research is also conducted on the limits of the search to establish the appropriate doses for the final assessment of certain mutagenic properties.

Preparation of test compound

Prepare a stock solution of the test compound with a concentration of 20.0 mg / ml as follows: 1.0 g of the test compound is added to 15.0 ml of 0.1N. HCl solution for 1 min. The test compound is stirred for 15 minutes at room temperature. Then add 33.0 ml of deionized water and mix for 30 minutes. Then the pH was adjusted to 3.53. Lower concentrations are prepared by diluting this stock solution with 5% dextrose immediately before use. To minimize any change resulting from degradation, the solutions of the test compound are stored on ice after preparation and immediately before use. The test compound is used in vitro in a solvent that is compatible with the test system.

Genotypic characteristics of test strains

Working uterine cultures of the strains used in the test are examined for genotypic markers and acceptable levels of spontaneous reversion. All working uterine cultures show a need for histidine or tryptophan (only E. coli). In addition, for each test additional relevant confirmations are carried out: sensitivity to violet crystalline paint due to rfa wall mutation; sensitivity to ultraviolet light due to deletion of the uvr B gene (uvr A in E. coli); ampicillin resistance due to the presence of plasmid pKM101 and tetracycline resistance due to the presence of plasmid pAQ1. Spontaneous reversion levels are determined using negative controls.

Test compounds that are water soluble are dissolved in isotonic saline or other suitable solvent. Test compounds that are not water soluble are dissolved in dimethyl sulfoxide (DMSO) or another suitable solvent. If DMSO is not acceptable due to adverse reactions with the test compound, the test compound is suspended in carboxymethyl cellulose. To facilitate dissolution, heating, vortex vortexing or alternative solvents can be used.

System for testing

This test is carried out according to the cup incorporation methodology originally described by Ames (Ames et al., Mutation Research (1975) 31: 347-364) and updated by Maron and Ames (Maron et al., Mutation Research (1983) 113: 173-215 ) Historically, this test was used to detect mutations in the gene of a strain for which histidine is required, in order to obtain a strain independent of histidine and, accordingly, to detect mutations in the gene of a strain for which tryptophan is required, to obtain a strain independent of tryptophan. In addition, it has been shown to be suitable for testing various groups of chemical mutagens that induce inherited DNA mutations of a type that is associated with side effects.

The Salmonella typhimurium strains that can be used in this assay, TA97a, TA98, TA100 and TA102, are described by Maron and Ames, supra; Green et al., Mutation Research (1976) 38: 33-42; and Brusick et al., Mutation Research (1980) 76: 169-190)). S. typhimurium strain TA1535 strain and E. coli Wp2-uvrA ^- can be obtained from the American Type Culture Collection, Manassas, VA (ATCC Nos: 29629 and 49979, respectively). In all working uterine cultures of strains, genotypic markers and acceptable reversion levels are determined for testing. Working uterine cultures should show a need for histidine or tryptophan (E. coli only).

Experimental methods

Prepare cups of test strains from frozen working uterine cultures. To obtain working cultures for each strain of bacteria used in the test, a single colony is transferred from a cup to Oxoid nutrient broth and incubated with shaking at 37 ± 2 ° C until an optical density (at 650 nm) of 0.6-1.6 is obtained. This nocturnal culture is used to test the assessment of mutagenic properties and for genotypic control. Genotype tests are performed as described in the protocol.

To determine the concentration limits and to establish a mutagenic test, the top agar layer, consisting of 0.6% Difco agar in 0.5% NaCl, is melted and 0.5 mM L-histidine / 0.5 mM biotin or 0 is added to the molten top agar layer , 5 mm L-tryptophan in the ratio of 10 ml per 100 ml of agar. Enriched agar is poured at the rate of 2 ml per tube and kept at 45-47 ° C. To prepare the top layer of agar for processing, 0.1 ml of the test compound or control, 0.1 ml of bacteria culture and 0.5 ml of phosphate buffered saline are added to the molten agar. The mixture is vortexed quickly and poured at room temperature onto an agar plate with a minimum glucose content (1.5% Difco agar, 2% glucose in Vogel-Bonner E medium). Metabolic activation is carried out by adding 0.5 ml of a mixture of S9 instead of PBS. The agar on the plates is allowed to harden and then incubated for 48-72 hours at 37 ± 2 ° C. All plates are counted using an automatic analytical imaging system. Negative control plates and plates treated with the test compound are also examined for the presence of a bacterial lawn.

Exogenous metabolic activation

The in vitro metabolic activation system used in this test consists of Sprague-Dauli rat liver enzymes and a mixture of cofactors. Enzymes are part of the preparation of liver microsomes (fraction S9) from rats treated with Arochlore, in order to induce the production of enzymes that can transform chemical compounds into more active forms. Immediately prior to use, the S9 fraction is thawed and mixed with a mixture of cofactors containing 5% S9, 5 mM glucose-6-phosphate, 4 mM β-nicotin adenine dinucleotide phosphate, 8 mM MgCl ₂ and 33 mM KCl in 200 mM phosphate buffer at pH 7.4.

Concentrations and Parallel Samples

The test compound is tested in triplicate at 5 concentrations (20.0, 10.0, 5.0, 2.5, and 1.25 mg / ml) together with an appropriate solvent (5% dextrose solution) and positive controls within concentrations for test. Which is equivalent to 2.0, 1.0, 0.5, 0.25 and 0.125 mg / cup.

Three concentrations are selected for the final test (20.0, 10.0 and 5.0 mg / ml), which is equivalent to 2.0, 1.0 and 0.5 mg / cup. All treatments, including negative and positive controls, plated in triplicate with the test strains TA97a, TA98, TA100, TA102, TA1535 and WP2-uvrA ^- in the presence and absence of metabolic activation. These concentrations are selected based on the induction of the toxicity limit of the test compound and the maximum response of the dose used.

Control compounds

You can prepare and use control compounds for the test for mutagenicity, as shown in table 9.

Table 9 The control Strain Concentration Acridine ICR-191 TA97a 1.0 mcg / cup 2-nitrofluorene A98 10.0 mcg / cup Sodium azide TA100 and TA1535 1.5 mcg / cup 1-methyl-3-nitro-1-nitrosoguanidine WP2-uvrA ^- 4.0 mcg / cup 2-aminoanthracene All strains (except TA1 535) 10.0 mcg / cup 2-aminoanthracene TA1535 1.6 mcg / cup

Negative control (solvent)

Test strains are seeded with untreated dextrose solution at the appropriate maximum concentration (0.1 ml) with and without S9. These cups serve as negative controls and obtain information regarding the background lawn and the formation of reverse colonies.

Concentration limits for the test

Initial concentration limits for the test start with a maximum concentration of 2.0 mg / cup. 4 lower concentrations used for testing are obtained by 1: 2 serial dilution.

Reverse mutation test

Each individual bacterial strain with and without S9 addition is considered as a separate experiment with its own concomitant positive control and solvent control. Growth on all plates is scored using an automatic colony counter and photographs taken. Positive controls consist of direct mutagens and mutagens that require metabolic transformation. For all strains representing a positive control, one can observe a twofold or more increase in the levels of reversion. The reversion rates for the negative control for each strain should be at or slightly below the expected limits for laboratory historical data. An indicator of the induced positive result for any strain will be at least a twofold increase in the number of revertant colonies per cup compared with the values for the negative control.

Example 107

In vitro chromosome aberration test on CHO cells

The chromosome aberration test may be one of several in vitro tests that can be used to screen compounds for their potential genetic toxicity. Chromosome aberrations are mutations that are associated with carcinogenesis. Therefore, the chromosome aberration test refers to testing potential mutagens and carcinogens (Galloway et al., Environ. Mut. (1985) 7: 1-51; Galloway et al., Environ. Mut. (1987) 10: 1-175). Using this chromosome aberration test, the potential ability of extracts of the test compounds to induce damage in Chinese hamster ovary cells (CHO) is assessed. This test is performed in the presence and absence of an exogenous mammalian activating system (S9) in three treatment periods. All cultures treated with a negative control should have normal levels of spontaneous aberration, while cultures treated with a positive control should have a significant, dose-dependent increase in the number of aberrant chromosomes.

You can plan an indicative test to determine how far the test compound is clastogenic, i.e. how much it has the ability to lead to chromosome breakdown, as presented below. Clastogenicity is an important endpoint because, through chromosome damage and inappropriate mating, some oncogenes (e.g., mus) can be activated and some tumor suppressor genes (e.g., inhibiting retinoblastoma) can be activated. In this test, mammalian cells, Chinese hamster ovary (CHO) cells, are exposed to the test compound and are blocked in metaphase using mitotic spindle venom. Visualization of chromosomes is carried out microscopically after swelling under hypotonic conditions, fixation and staining of the treated CHO cells. Agents with an established ability to induce chromosome rupture are highly likely to be carcinogens and also have the potential to induce the occurrence of inherited chromosome defects.

The CHO-K ₁ cell line (ATCC number: CCL-61) is an auxotroph in relation to proline with a modal number of chromosomes equal to 20 and a population doubling time of 10-14 hours. It was shown that this system is sensitive to clastogenic the activity of various chemical compounds (Preston et al., Mutation Research (1981) 87: 143-188). CHO cells were cultured in McCow 5A medium supplemented with 10% fetal bovine serum, 1% L-glutamine (2 mM), penicillin (100 U / ml) and streptomycin (μg / ml). The cultures are incubated in an atmosphere of 5-7% CO ₂ with loose cups in a humid thermostat at 37 ± 2ºС.

Test setting

Prepare a stock solution with a concentration of 5 mg / ml. Lower concentrations are prepared by diluting this stock solution with 5% dextrose solution and immediately before use. To minimize any possibility of degradation, the solutions of the test compound after preparation are stored on ice and immediately before application. Cells are seeded at a rate of about 1-1.5 × 10 ⁶ cells per tissue culture flask with a capacity of 75 cm ² in 10 ml of fresh medium the day before the test. For processing, the medium used is replaced with fresh culture medium and the test compound extract, negative or positive control, is added to each flask. Positive controls are added in a volume of 0.1 ml to minimize solvent toxicity. Dilutions of the test compound and negative control were added in a volume of 1 ml. Fresh medium is added to bring the total volume of the mixture to 10 ml. For part of the metabolic activation test, a mixture for S9 activation is added to serum-free medium at a final concentration of 1.5% (v / v). All treatments are carried out in two parallels. Cells are incubated at 37 ± 2 ° C in the presence of an extract of the test compound, the reaction mixture S9 (only in the part of the experiment with metabolic activation) and culture medium. The test is divided into three treatment periods: 3 hours, 3 hours with activation of S9 and 20 hours.

After a treatment period, the contents of all flasks are examined microscopically for significant manifestations of toxicity, i.e. the presence of morphological changes in the cells or a significant detachment of cells. All flasks were washed twice with phosphate buffered saline (PBS). A normal culture medium containing 10% fetal bovine serum (FBS) was added to the freshly washed cells, and the flasks were placed back into the thermostat for another 14.5-15.5 hours. Microscopic evaluation was performed immediately before collecting the cells. 2 h before cell collection, 1 μg of colcemid (final concentration of 0.1 μg / ml) was added to all flasks to stop cell division.

The extracts of the test compound are tested in two parallels in 6 concentrations (final concentration in the culture of 0.5, 0.16, 0.05, 0.016, 0.005 and 0.0016 mg / ml) together with an appropriate solvent and positive controls.

Metabolic activation system

The use of a metabolic activation system is an important aspect in the evaluation of a test compound, as some compounds are only in promagenic form. Those. they become mutagens only after exposure to an external metabolic source. In vitro systems lack this ability to metabolize compounds unless an external system such as S9 is added.

An in vitro metabolic activation system for use in this assay may include Sprague-Dauli rat liver enzymes and an energy producing system (NADP and isolimonic acid; the backbone of the reaction mixture) for their functioning. Enzymes are part of the liver microsomes (fraction S9) from rats treated with Arochlor 1254 in order to induce enzymes capable of converting chemical compounds into more active forms. S9 fraction can be obtained from Moltox (Boone, NC) and stored frozen at temperatures below -70 ° C until use. This fraction S9 is thawed immediately before use and is added to the reaction mixture.

Cell fixation, staining and evaluation

Metaphase cells were selected with a mitotic “shock”, swelled using 75 mM KCl, fixed in a mixture of methanol: glacial acetic acid (3: 1 v / v). Then the cells are pipetted onto a glass slide after resuspension in a fresh portion of the fixative and dried in air. Glasses are marked with “blind” codes. Three glasses are prepared for each flask. Glasses are stained with Giemsa paint and constant preparations are prepared. All glasses are denoted by “blind” codes, with the exception of positive controls in high concentration, which are examined first to ensure that the frequency of aberrations was adequate. For each concentration, 200 cells were examined per concentration (100 for each of two parallel flasks). 100 cells are examined from each positive control in high concentration, following the following definitions and evaluation criteria.

Chromatid type of aberration

TG (chromatid space): “Tid space”. Achromatic (unpainted) region in one chromatid, the size of which is equal to or less than the width of the chromatid. They are noted, but, as a rule, are not included in the final total number of aberrations, since they may not be real gaps.

IG (isochromatide gap): “chromosomal gap”. Gaps at the same locus in both sister chromatids. They are noted, but, as a rule, are not included in the final total number of aberrations, since they may not be real gaps.

TB (chromatid rupture): achromatic region in one chromatid, larger than the width of the chromatid. The associated fragment may be partially or completely displaced or lost.

ID (chromatid deletion): the length of the chromatid is “cut off” from the center of the chromatid, which leads to the formation of a small fragment or ring lying behind the shortened chromatid or a gap in the chromatid.

TR (triradial): an exchange between two chromosomes, resulting in a three-arm configuration. An acentric fragment may be present.

QR (quadradial): the same as triradial, but leads to the formation of a four-arm configuration.

CR (complex rearrangement): an exchange between more than two chromosomes, which leads to the formation of several breaks and exchanges.

TI (chromatid exchange): an exchange within the chromosome in which one or both arms are involved.

Chromosomal type of aberration

SB (chromosome break): terminal deletion. The chromosome has a clear gap, forming an abnormal (deletion) chromosome with an acentric fragment, which can be displaced and can remain connected, or it can be found anywhere in the cell.

DM (double short fragment): intermediate deletion of the chromosome. They appear in the form of small double “points” or can represent paired rings. In some cases, they cannot be distinguished from acentric fragments that result from exchanges or terminal deletions.

D (dicentric): an exchange between two chromosomes, which leads to the formation of chromosomes with two centromeres. It is often associated with an acentric fragment when it is classified as dicentric with a fragment (DF).

MS (multicentric chromosome): an exchange between chromosomes, which leads to the formation of a chromosome with more than two centromeres.

R (ring): a chromosome that forms a ring containing a centromere. It is often associated with an acentric fragment, in which case this type is classified as a ring with a fragment (RF). Accentric rings also fall into this category.

Ab (abnormal monocentric chromosome): This is a chromosome whose morphology is abnormal for the karyotype and often leads to things like translocation or pericentric inversion. If the anomaly cannot be attributed, then it is classified as reciprocal translocation.

T (translocation): the apparent transfer of matter between two chromosomes, leading to the formation of two abnormal chromosomes. When identified, evaluated as "T", not "2 Ab".

Other

SD (severely damaged cell): a cell with 10 or more aberrations of any type. A badly damaged cell should be analyzed to identify the type of aberration and may not have 10 or more, for example, as a result of multiple fragments, as is the case with the formation of tricentromeres.

PU (Atomized Chromosome): A despiralized or fragmented chromosome. This can simply be set at different stages of chromosome condensation.

P (+ atomized chromosome): more than one chromosome, up to the whole nucleus, is “atomized”.

PP (polyploid cell): a cell containing multiple copies of the haploid number of chromosomes. Sometimes polyploid cells are found in normal bone marrow or cell cultures. They are recorded, but not included in the final total number of aberrations.

Control compounds

In this test, control compounds are prepared and used as described in published reports. Positive controls that can be used are: cyclophosphamide - in a high concentration of 15 μg / ml; cyclophosphamide - in a low concentration of 5 μg / ml; mitomycin C - in a high concentration of 1.0 μg / ml; and cytomycin C - in a low concentration of 0.25 μg / ml. For a negative control (solvent), CHO cells are treated with a negative control with a 5% dextrose solution with and without S9 activation. Processing data provide information on the background number of aberrant cells.

Validation and statistical analysis of test data

The total number of aberrations (% CA) in the control culture (x) with the solvent should be in the range of 1-14%. Positive controls in high concentration should give a statistically significant increase in the number of aberrations at a probability level of 95% (p <0.05) according to statistical analysis. Analysis of variation (ANOVA) can be used to establish statistically significant differences between the groups of positive and negative controls or groups of the test compound and negative control. The difference is considered statistically significant when the obtained p value is less than 0.05.

Example 108

Dog Safety and Tolerance Assessment

You can plan a representative experiment in assessing the safety and tolerability of compounds in doses administered intravenously once a day for 5 consecutive days, for example, beagle dogs, as presented below. Safety indicators are monitored by observation, clinical pathology and histopathological findings.

Experience protocol

Table 10 presents the representative experience. For example, an experiment is conducted with three groups (3) of a test compound and one (1) control group. The control is a solution (5% dextrose in water) used to dilute the test compound before administration and is administered in the same volume as when administering a high dose. Doses of the test compound for this experiment will be approximately 12, 3.8 and 1.2 mg / kg. The test compound and control are administered once by intravenous (iv) infusion for approximately one hour for 5 consecutive days.

Blood samples for analysis of the concentration of the test compound in the blood are collected as follows (i.e. sampling for pk / tk (pharmacokinetic / toxicokinetic studies)).

About 1.0 ml of blood is taken from three cables and three bitches in the low-dose group approximately 20 minutes and 40 minutes after the start of the infusion and then at the end of the infusion (0 time) and after 5, 10, 15 and 30 minutes and 1, 2, 4, 8, 12, and 24 hours after the end of the infusion after the introduction of the first and fifth doses. Also, before and immediately after the introduction of dose 1 and dose 5 in all animals and animals in the recovery period before euthanasia, an ECG is removed for approximately 5-10 seconds in lead II. Animals are euthanized on day (1) and day 15 after the last dose. Blood for clinical and biochemical analysis is taken before administration and before euthanasia at the end of the experiment. After euthanasia, an autopsy is performed, which includes the selection of the main organs for microscopic examination.

Table 10 Group number Experience option ^but Dose (mg / kg) The main number of animals (males / females) The number of animals in the recovery period (males / females) one The control 0,0 3/3 1/1 2 Test compound 12.0 3/3 1/1 3 Test compound 3.8 3/3 1/1 four Test compound 1,2 3/3 1/1 ^and infusion for about 1 hour

Test methods

In a representative experiment, animals are divided into groups as follows: the dog with the largest body mass for each sex is distributed in group 1, the next most mass dog for each sex is distributed in group 2, the next most mass dog in group 3, and the next most mass dog in group 4, then continue according to this sample from groups 2, 3, 4 and 1, then from groups 3, 4, 1 and 2, continuing until each group is fully equipped with animals. The test compound and control are administered at each dose as an intravenous infusion into the lateral saphenous vein of the anterior limb or the saphenous vein of the hind limb for approximately 1 hour.

Animals are weighed daily before administration and before euthanasia. All animals are observed for signs of pharmacological activity, changes in behavior and toxicity immediately after administration and 1 hour after administration. Restorative animals are also monitored once a day during the recovery period. Before and immediately after the administration of doses 1 and 5 in all animals and in animals after a recovery period before euthanasia, an ECG is taken for about 5 seconds in lead II. These electrocardiograms are used to interpret changes in the rhythm and amplitude of the QRS peak and T wave and to determine QT intervals by the number of segments per electrocardiogram (approximately 5-10).

Blood sampling

RK / TC. Blood samples were taken to analyze the concentration of the test compound in the blood. Approximately 1 ml of blood is taken from three males and three females in the low-dose group approximately 20 minutes and 40 minutes after the start of the infusion and then at the end of the infusion (0 time) and after 5, 10, 15 and 30 minutes and 1, 2, 4, 8, 12 and 24 hours after the end of the infusion after the introduction of the first and fifth doses. Blood plasma is prepared for analysis (lithium salt of heparin as an anticoagulant).

Clinical pathology. After fasting overnight and before the first dose (background; all animals) and then before euthanasia, blood samples are taken to determine hematological and biochemical parameters. When setting up a hematological analysis in blood samples taken as a background and before euthanasia (on an empty stomach), the content of red blood cells, the level of hematocrit, MCH, the number of leukocytes, differential WC, MCHC, the concentration of hemoglobin, MCV, the number of platelets, PT and ARTT are determined. During biochemical analysis in blood samples taken as a background and before euthanasia (on an empty stomach), aspartate aminotransferase (AST) activity, globulin & A / G ratio, alanine aminotransferase (ALT) activity, sodium concentration, alkaline phosphatase activity, potassium level, activity are determined gamma-glutamyl transferase (GGT), the concentration of chlorides, glucose, calcium, blood urea nitrogen (BUN), total bilirubin, creatinine, inorganic phosphorus, total protein, cholesterol, albumin and triglycerides.

Autopsy

After sampling the blood of animals after the main treatment and recovery period, they are euthanized at appropriate time periods and opened. The main organs are selected, weighed and preserved for microscopic examination. An autopsy study includes examination of the cranial, thoracic, abdominal and pelvic cavities, their insides, tissues, organs and carcasses.

Statistical Processing Methods

Statistical processing of data on biochemical and hematological indicators and data on the mass of organs and body weight is carried out by comparing the groups with the processing of the test compound and the control group. The choice of the statistical methods used is carried out as it corresponds: parametric data are analyzed using one-way variational analysis, non-parametric data are analyzed using the Kurskai-Wallis method. A paired t-test is also used to compare baseline data and biochemical and hematological parameters after treatment for each animal. Probability values (p) of 0.05 or lower are accepted as statistically significant for all statistical tests.

Example 109

Rat and Safety Assessment

You can plan a representative experiment to assess the safety and tolerability of the test compound in three doses, administered intravenously once a day for 5 consecutive days, for example, to rats, as presented below. Safety indicators are monitored by observation, clinical pathology and histopathological findings. Blood samples were also taken from the selected animals for pharmacokinetic / toxicokinetic studies.

Experience protocol

Table 11 presents the representative experience. The experiment is carried out in three groups (3) with the test compound and one (1) control group. Groups with the introduction of the test compounds in high and low doses and the control group consists of 28 animals each, and they are used to assess tolerance. The group with the introduction of the test drug in an average dose includes 64 animals, of which 28 are used to assess tolerance and 36 animals are used to determine the concentration of the test compound in the blood at different time periods after the first and fifth doses in part of the PK / TC experiment. The control is a solution (5% dextrose in water) used to dilute the test compound before administration, and it is administered in the same volume as the test compound in high dose. Doses of the test compound for this experiment will be approximately 24, 7.6 and 2.4 mg / kg. The test compound and control are administered once by intravenous (iv) injection into the tail vein for one minute for 5 consecutive days.

Blood samples for analysis of the concentration of the test compound in the blood are taken as follows. Approximately 0.3-0.5 ml of blood is taken from three males and three female rats under anesthesia at each time point before administration and at the end of the injection (0 time) and after about 0.08, 0.25, 0.5, 1 , 2, 4, 8, 12 and 24 hours after the end of the injection after the first and fifth doses. Animals used to assess tolerance are euthanized on day (1) (main group) and day 15 (recovery group) after the last dose. At the end of the experiment to assess the tolerance of the test compound, blood is taken for clinical and biochemical analysis before and after euthanasia. At autopsy, the main organs are selected for microscopic examination. Animals used only for blood sampling for rk / tk, to determine the concentration of the test compound, are euthanized after the final blood sampling without any additional selection or observation.

Table 11 Group number Experience option ^but Dose (mg / kg) The main number of animals (males / females) The number of animals in the recovery period (males / females) one The control 0,0 3/3 1/1 2 Test compound 12.0 3/3 1/1 3 Test compound 3.8 3/3 1/1 four Test compound 1,2 3/3 1/1 ^and infusion for about 1 hour

Test methods

The test compound and control are administered at each dose as an intravenous infusion into the tail vein for about 1 minute. Animals are weighed daily before administration and before euthanasia. All animals are observed for signs of pharmacological activity, changes in behavior and toxicity immediately after administration and 1 hour after administration. Animals are also monitored once a day during the recovery period. Control animals were injected with D5W at a rate of about 6 ml / kg. Animals intended for administration of the test compound in high, medium and low doses are given doses corresponding to about 24 mg / kg, 7.6 mg / kg and 2.4 mg / kg, respectively.

Blood sampling

RK / TC. Blood samples were taken to analyze the concentration of the test compound in the blood. Approximately 0.3-0.5 ml of blood was taken from 18 males and 3 female rats under anesthesia for each time point before and at the end of the injection (0 time) and after approximately 18 males and 18 females who were injected with an average dose of the drug. 0.08, 0.25, 0.5, 1, 2, 4, 8, 12, and 24 hours after the end of the injection after the first and fifth doses. Blood is taken by puncture of the retrobulbar plexus or heart to take final samples. Blood plasma is prepared for analysis (lithium salt of heparin as an anticoagulant). Conduct common methods for determining biochemical parameters, autopsy and histopathology, as well as statistical data processing, as already described above.

Example 110

Protocol for the determination of phosphorylated and total p53

A protocol for the determination of phosphorylated and total p53 can be planned as follows. On day 1, cells are seeded at the rate of 2 × 10 ⁶ cells / cup with a diameter of 10 cm / 10 ml of medium. On day 2, cells are treated as follows: control = 0.05% DMSO (5 μl of DMSO stock solution / 10 ml of medium); 1 μM test compound (1 μl of the mother liquor (10 mm) / 10 ml of medium); 2 μM test compound (2 μl stock solution (10 mm) / 10 ml of medium); 3 μM test compound (3 μl stock solution (10 mm) / 10 ml of medium); 4 μM test compound (4 μl mother liquor (10 mM) / 10 ml medium) and 5 μM test compound (5 μl mother liquor (10 mm) / 10 ml medium).

On day 3, cells are harvested and attached and floating cells are selected. Cells are washed twice with PBS, their number is counted and 4 × 10 ⁶ cells / sample are taken. The pellet after centrifugation of the cells is frozen at -80 ° C until use. On the same day or day 4, cells are extracted using cell extraction buffer (3 ml of cell extraction buffer, 300 μl of protease inhibitor and 10 μl of 0.3M PMSF). 200 μl of buffer is added to each sample and the solution is vortexed, placed on ice for 30 minutes and then vortexed every 10 minutes. Then the solution is centrifuged at 13000 rpm for 10 minutes and an aliquot of 100 μl of the supernatant is taken from each tube and stored at -80 ° C.

Test setting (5 days). An anti-rabbit IgG horseradish peroxidase labeled with horseradish is prepared by diluting 10 μl of a solution of a concentrate of 100 × 1 ml of horseradish peroxidase diluent for each strip of 8 holes. Prepare a buffer solution for washing by diluting the contents of the original ampoule (× 25) using distilled water to obtain a solution × 1. Dilutions of a standard p53 solution or a general p53 solution can be prepared as described in the representative data of Table 12. To ensure complete recovery, Standard 1 is gently mixed and allowed to stand for 10 minutes at room temperature.

Table 12 Concentration Standard solution Breeding buffer Standard 1 100 U / ml Recover contents of ampoule 1 0.7 ml of standard dilution buffer Standard 2 50 U / ml 250 μl of standard 1 250 μl Standard 3 25 U / ml 250 μl of standard 2 250 μl Standard 4 12.5 U / ml 250 μl of standard 3 250 μl Standard 5 6.25 U / ml 250 μl of standard 4 250 μl Standard 6 3.12 U / ml 250 μl of standard 5 250 μl Standard 7 1.6 U / ml 250 μl of standard 6 250 μl Standard 8 0 250 μl

Protocol of experience. All solutions were allowed to reach room temperature and mixed gently before use. Prepare and season 8-well strips. Pipette 100 μl of standard dilution buffer per well for standard 8 (0 ng / ml / well or 0 U / well). Nothing is added to the chromogenic control well. 100 μl of a standard or diluted sample is added to the appropriate microtiter wells. Typically, a sample is diluted with a standard dilution buffer in a ratio of at least 1:10 or higher. Each sample is placed in two parallels. Gently pat the edge of the tablet for thorough mixing. The tablet is covered with a lid for tablets and incubated for 2 hours at room temperature or at 4 ° C. Wells are washed four times with 400 μl wash buffer. Stand for 15-30 seconds and then the liquid is aspirated. After washing, the plate is turned upside down and dried with tissue absorption. With the exception of the chromogenic control, 100 μl of anti-p53 antibodies [pS15] or anti-p53 antibodies (total) (detection antibodies) were added to each well. Gently pat for stirring; the plate is coated and incubated for 1 h at room temperature. Carefully aspirate the solution from the wells.

Wells are washed four times with 400 μl wash buffer. Stand for 15-30 seconds and then the liquid is aspirated. After washing, the plate is turned upside down and dried with tissue absorption. With the exception of the chromogenic control, 100 μl of rabbit anti-rabbit labeled with peroxidase from horseradish IgG are added to each well. The tablet is coated and incubated for 30 minutes at room temperature. Wells are washed four times with 400 μl wash buffer. Stand for 15-30 seconds and then the liquid is aspirated. After washing, the plate is turned upside down and dried with tissue absorption. 100 μl of TMB (stabilized chromogenic substrate) was added to each well and incubated for 30 minutes at room temperature in the dark. The color changes to blue. Pipette 100 μl of stop solution. The tablet is gently patted to mix. The color should change to yellow. The color intensity is determined on a reader at a wavelength of A450 nm against the chromogenic control (= 100 μl TMB + 100 μl stop solution) as a control. Absorption is determined within 2 hours after the end of the analysis.

Example 111

Protocol for the determination of caspase-3/7 activity

An indicative protocol for determining caspase-3/7 activity can be planned as follows. On day 1, HCT-116 cells were seeded at the rate of 0.015 × 10 ⁶ cells / 50 μl / well. Incubated at 37 ° C in a CO ₂ thermostat. On day 2, 25 μl of medium is removed from the wells. HCT-116 cells are treated with 1, 3 and 5 μM test compound. A positive control is treated with 0.01, 0.1, 1 μM staurosporine. Six negative control wells are treated only with medium (add 25 μl of the diluted sample to the corresponding wells). Incubated for 24 hours at 37 ° C in a CO ₂ thermostat. On day 3, a homogeneous reagent is prepared for the test of determining the activity of caspase-3/7 Apo-ONE (Promega) at the rate of 10 μl of reagent / 1 ml of buffer. Pipette 50 μl of the diluted reagent. Incubated for 1 h at room temperature. Determine fluorescence at wavelengths 485/520.

Example 112

V-Alexa 488 Annexin Staining Protocol

An annexin V-Alexa 488 staining protocol can be planned as follows. On day 1, HCT-116 cells were seeded at the rate of 1.5-2.0 × 10 ⁶ cells / plate with a diameter of 10 cm / 10 ml of medium. Incubated for 24 hours at 37 ° C in a CO ₂ thermostat. The next day, cells are treated with 1, 2, 3, 4, and 5 μM of the test compound. One or two tablets are left untreated (medium only) as control plates. The following controls are used: untreated samples (without Alexa or propidium iodide), controls treated only with propidium iodide or Alexa 488, and controls treated with both Alexa 488 and propidium iodide. Collect cells (collect attached as well as floating cells). Cells were washed twice with cold PBS. Cells are resuspended in 1 × annexin binding buffer.

The number of cells is counted and diluted in 1 × annexin binding buffer to a titer of ≈1 × 10 ⁶ cells / 0.1 ml with sufficient volume to provide 100 μl for analysis. 5 μl of annexin V conjugate is added per 100 μl of cell suspension. Add 4 μl propidium iodide solution (mother liquor = 1 mg / ml) to each 100 μl cell suspension. The sample is incubated at room temperature for 15 minutes. Add 400 μl of annexin binding buffer, mix gently and store the samples on ice. Stained cells are immediately analyzed by flow cytometry.

Example 113

DNA cell cycle analysis protocol

An indicative DNA cell cycle analysis protocol can be designed as follows. Cells are seeded at the rate of 1.5-2.0 × 10 ⁶ cells / cup with a diameter of 10 cm (cells are seeded on an additional cup for unpainted cells). Cells are incubated at 37 ° C in a humid atmosphere of a 5% CO ₂ thermostat for 24 hours. To synchronize cells in a state of weak growth in order to obtain cells at rest, the medium is removed and washed once with serum-free medium, 10 ml of serum-free medium is added to each plate. Cells are incubated for 24 hours at 37 ° C in a humid atmosphere of a 5% CO ₂ thermostat. The medium is removed and the treatment is repeated (diluted in medium containing serum, 10 ml): 1-5 μM test compound plus control. Cells are incubated for 24 hours at 37 ° C in a humid atmosphere of a 5% CO ₂ thermostat.

Processing is carried out for trypsinization / isolation of cells. Make 3 ml of trypsin / EDTA solution. Floating cells are stored and combined with attached cells. Incubated for 24 hours at 37 ° C in a humid atmosphere of a 5% CO ₂ thermostat. Add 3 ml of medium (containing FBS) to the wells and pipet into centrifuge tubes. Centrifuged at 1000 rpm for 5 minutes The supernatant was separated and the pellet was resuspended in 2-3 ml of PBS. The number of cells is counted and the cells are washed once by transferring 2 × 10 ⁶ cells / tube, adding 2 ml of PBS and centrifuging at 1000 rpm for 5 minutes. The pellet after centrifugation of the cells is resuspended in 0.3 ml of cold PBS.

To fix the cells, 0.7 ml of ice-cold 70% ethanol is carefully added dropwise into a test tube with 0.3 ml of cell suspension in PBS, while vortexing. The mixture is kept on ice for 1 h (or up to several days at 4 ° C). Centrifuge at 1000 g for 5 minutes. Wash once with cold PBS (1-2 ml). Centrifuge at 1000 g for 5 minutes. The pellet after centrifugation of the cells was resuspended in 0.25 ml of cold PBS, 5 μl of a 10 mg / ml RNAse A solution (final concentration 0.2-0.5 mg / ml) was added. They are incubated at 37 ° C for 1 h. 10 μl of a solution of propidium iodide with a concentration of 1 mg / ml in deionized water (final concentration of 10 μl / ml) is added and stored in the dark at 4 ° C until analysis. Samples are analyzed using FACS according to the cytometer at a wavelength of 488 nm. Cells can be stained with propidium iodide on the day of analysis.

It is understood that the foregoing detailed description and accompanying examples are illustrative only and should not be construed as limiting the scope of the invention. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including without limitation, related to chemical formulas, substituents, derivatives, intermediates, syntheses, compositions and / or methods of using the invention, can be carried out without departing from its essence and scope. The cited US patents and publications are incorporated herein by reference.

Claims (41)

1. The compound of formula (1)

and pharmaceutically acceptable salts thereof;
where B, X, A or V are absent if Z ¹ , Z ² , Z ³ or Z ⁴ respectively represent N, and independently H, a halogen atom, azido, R ² , CH ₂ R ² , SR ² , OR ² or NR ¹ R ² when Z ¹ , Z ² , Z ³ or Z ⁴ represent C;
where in each NR ¹ R ² , R ¹ and R ² together with N can form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring;
Z ¹ represents N and Z ² , Z ³ and Z ⁴ represent C, or
Z ¹ and Z ³ represent N and Z ² and Z ⁴ represent C;
W together with N and Z form an optionally substituted thiazole, imidazole or pyrimidine ring, which is fused to an optionally substituted ring selected from the group consisting of:

or

U represents NR ¹ R ² , NR ¹ - (CR ¹ ₂ ) _n -NR ³ R ⁴ ,
where in NR ³ R ⁴ , R ³ and R ⁴ together with N can form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring;
R ¹ and R ³ independently represent H or C _1-6 alkyl;
each R ² represents H or C _1-10 alkyl, each optionally substituted with a halogen atom, or a C _3-6 cycloalkyl, aryl, heteroaryl or pyridine, pyrrolidine, piperazine or morpholine ring,
where each ring is optionally substituted; or
R ^{2 is} optionally substituted with piperidine, pyrrolidine, pyridine, piperazine, pyrazine, morpholine or benzimidazole;
R ⁴ represents H or C _1-10 alkyl;
each R ⁵ represents a substituent at any position in the ring W; and is H, OR ² , amino, alkoxy, amido, a halogen atom or cyano;
or R ⁵ is C _1-6 alkyl, —CONHR ¹ -, each optionally substituted with a halogen atom;
or two adjacent R ⁵ are linked to form a 5-6 membered ring, an optionally substituted heterocyclic ring selected from a piperidine, pyrrolidine, piperazine or morpholine ring;
n is 1-6; and
each optionally substituted portion may be substituted with one or more halogens, OR ² , NR ¹ R ² , carbamate, C _1-10 alkyl, each optionally substituted with a halogen atom, C = O, cyano, nitro, COR ² , NR ² COR ² , sulfonylamides; NR ² SOOR ² ; SR ² , SOR ² , COOR ² , CONR ² ₂ , OCOR ² , OCOOR ² or OCONR ² ₂ . 2. The compound according to claim 1, where W together with N and Z form a ring that is fused to phenyl. 3. The compound according to claim 1, where U is NR ¹ R ² where R ¹ is H and R ² is C _1-10 alkyl optionally substituted with a heteroatom, C _3-6 cycloalkyl, aryl or piperidine, pyrrolidine, piperazine or morpholine. 4. The compound according to claim 3, where U is NR ¹ R ² , where R ² is C _1-10 alkyl substituted with morpholine, pyrrolidine, piperazine, pyridine or piperidine. 5. The compound according to claim 1, where U represents NR ¹ (CR ¹ ₂ ) _n -NR ³ R ⁴ ; n is 1-4; and R ³ and R ⁴ in NR ³ R ⁴ together form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine. 6. The compound according to claim 1, where U is NH- (CH ₂ ) _n —NR ³ R ⁴ ; where R ³ and R ⁴ together with N form an optionally substituted pyrrolidine. 7. The compound according to claim 1, where U is 2- (N-methylpyrrolidin-2-yl) ethylamino or (2-pyrrolidin-1-yl) ethanamino. 8. The compound according to claim 1, where A and X independently represent a halogen atom or SR ² , where R ² is C _0-10 alkyl optionally substituted with C _3-6 cycloalkyl, aryl, heteroaryl or piperidine, pyrrolidine, piperazine or morpholine. 9. The compound of claim 8, wherein R ² is C _0-10 alkyl substituted with phenyl or pyrazine. 10. The compound according to claim 1, where each of Z ² , Z ³ and Z ⁴ represent C, and Z ¹ is N. 11. The compound according to claim 1, where two of Z ¹ and Z ³ each represents N, and Z and Z ⁴ each represent C. 12. The compound according to claim 1, where Z represents NR ¹ and R ¹ is C _1-6 alkyl. 13. The compound of claim 12, wherein R ¹ is methyl. 14. The compound according to claim 1, where at least one of B, A, X or V is a halogen atom, and the corresponding adjacent Z ¹ -Z ⁴ represents C. 15. The compound according to claim 1, where V represents N. 16. A pharmaceutical composition that can inhibit cell proliferation and / or induce cell apoptosis, comprising the compound of claim 1 and a pharmaceutically acceptable carrier. 17. A method of inhibiting cell proliferation and / or attenuating a cell proliferative disorder, comprising administering to a system or subject in need thereof an effective amount of a compound according to claim 1 or a pharmaceutical composition thereof, and optionally with a procedure and / or chemotherapeutic agent, thereby suppressing cell proliferation and / or attenuating said cell proliferative disorder. 18. The method of claim 17, wherein said cell proliferative disorder is a tumor or cancer. 19. The method of claim 18, wherein said system is a cell or tissue, and said subject is a human or animal. 20. A method of reducing microbial titers and / or attenuating a microbial infection, comprising contacting a system or subject in need thereof with an effective amount of a compound according to claim 1 or a pharmaceutical composition thereof, and optionally with an antimicrobial agent, thereby reducing microbial titers and / or weakening the indicated microbial infection. 21. The method of claim 20, wherein said system is a cell or tissue, and said subject is a human or animal. 22. The method according to claim 20, in which the titers of microbes and / or microbial infection are titers of viruses, bacteria or fungi. 23. A method for inducing cell death and / or inducing apoptosis, comprising administering to a system or subject in need thereof an effective amount of a composition containing the compound of claim 1, or a pharmaceutical composition thereof, and optionally with a procedure and / or chemotherapeutic agent, thereby inducing cell death and / or inducing apoptosis. 24. The method of claim 23, wherein said system is a cell or tissue, and said subject is a human or animal. 25. The method according to item 23, in which the specified chemotherapeutic agent is gemcitabine. 26. The method according to paragraph 24, wherein said procedure is radiation therapy or surgery. 27. The compound of the formula

or

28. A pharmaceutical composition that can inhibit cell proliferation and / or induce cell apoptosis, comprising the compound of claim 27 and a pharmaceutically acceptable carrier. 29. A method of obtaining compounds of the formula (1)

comprising contacting an ester of formula 3, an amine of formula NHR ¹ R ² and a Lewis acid of formula ML _n , where L represents a halogen atom or organic radical, n is 3-5, and M represents an atom of an element of group III, an atom of an element of group IV, As, Sb, V or Fe,

where B, X, A or V are absent if Z ¹ , Z ² , Z ³ or Z ⁴ respectively represent N, and independently H, a halogen atom, azido, R ² , CH ₂ R ² , SR ² , OR ² or NR ¹ R ² when Z ¹ , Z ² , Z ³ or Z ⁴ represent C;
where in each NR ¹ R ² , R ¹ and R ² together with N can form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring;
Z ¹ represents N and Z ² , Z ³ and Z ⁴ represent C, or
Z ¹ and Z ³ represent N and Z ² and Z ⁴ represent C;
W together with N and Z form an optionally substituted thiazole, imidazole or pyrimidine ring, which is fused to an optionally substituted ring selected from the group consisting of:

or

U represents NR ¹ R ² , NR ¹ - (CR ¹ ₂ ) _n -NR ³ R ⁴ ,
where in NR ³ R ⁴ , R ³ and R ⁴ together with N can form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring;
R ¹ and R ³ independently represent H or C _1-6 alkyl;
each R ² represents H or C _1-10 alkyl, each optionally substituted with a halogen atom, or a C _3-6 cycloalkyl, aryl, heteroaryl or pyridine, pyrrolidine, piperazine or morpholine ring,
where each ring is optionally substituted; or
R ^{2 is} optionally substituted with piperidine, pyrrolidine, pyridine, piperazine, pyrazine, morpholine or benzimidazole;
R ⁴ represents H or C _1-10 alkyl;
each R ⁵ represents a substituent at any position in the ring W; and is H, OR ² , amino, alkoxy, amido, a halogen atom or cyano;
or R ⁵ is C _1-10 alkyl, —CONHR ¹ -, each optionally substituted with a halogen atom;
or two adjacent R ⁵ are linked to form a 5-6 membered ring, an optionally substituted heterocyclic ring selected from a piperidine, pyrrolidine, piperazine or morpholine ring;
n is 1-6; and
each optionally substituted portion may be substituted with one or more halogens, OR ² , NR ¹ R ² , carbamate, C _1-10 alkyl, each optionally substituted with a halogen atom, C = O, cyano, nitro, COR ² , NR ² COR ² , sulfonylamides; NR ² SOOR ² ; SR ² , SOR ² , COOR ² , CONR ² ₂ , OCOR ² , OCOOR ² or OCONR ² ₂ . 30. The method according to clause 29, in which the specified ether, amine and Lewis acid is subjected to interaction at room temperature. 31. The method according to clause 29, comprising the interaction of the specified ether and amine in an organic solvent to form a solution and the interaction of the specified solution with Lewis acid. 32. The method according to p, in which the specified organic solvent is methylene chloride. 33. The method according to clause 29, which uses an excess of amine with respect to ether. 34. The method according to p, in which the ratio of ether to amine is 1: 2, 1: 1.5 or 1: 1.25. 35. The method according to clause 29, which uses an equimolar amount of Lewis acid with respect to the amine. 36. The method according to clause 29, further comprising isolating a compound of formula 1, and optionally purifying the isolated compound of formula 1. 37. The method of claim 36, wherein said isolated compound is purified by column chromatography, recrystallization, or both. 38. The method according to clause 37, in which the purity of the selected compounds is in the range from 90 to 99% or in the range from 90 to 95%. 39. The method according to clause 29, wherein said Lewis acid is BL ₃ , AlL ₃ , FeL ₃ , GaL ₃ , SbL ₅ , InL ₃ , ZrL ₄ , SnL ₄ , TiL ₄ , TiL ₃ , AsL ₃ or SbL ₃ where L represents a halogen atom or alkyl. 40. The method according to § 39, wherein said Lewis acid is aluminum chloride. 41. The method according to clause 29 to obtain a compound selected from the group consisting of:

and

Images