RU2252786C2 - Antibody and chemokine constructs and uses thereof in immunological disorders - Google Patents

Abstract

FIELD: immunology, pharmaceutical compositions.

SUBSTANCE: invention relates to application of antibody and/or chemokine construct which bonds to chemokine receptor to produce pharmaceutical composition for elimination of cells, being latently infected with primate immunodeficiency virus. Also are disclosed pharmaceutical compositions for treatment, prevention and/or alleviation of kidney and intestine inflammation, multiple sclerosis, skin diseases, diabetes, or transplant abruption. Antibody construct includes binding site to chemokine 5 receptor and binding site to CD3 receptor; chemokine construct includes RANTES and toxin. Polynucleotides encoding said antibody and/or chemokine constructs, vectors and hosts, containing nuclear acid molecules also are disclosed.

EFFECT: new agents for genetic treatment of immunological disorders.

77 cl, 12 ex, 4 tbl, 23 dwg

Description

This invention relates to the use of an antibody and / or chemokine construct that binds to a chemokine receptor for the manufacture of a pharmaceutical composition for the elimination of cells that are latently infected with a primate immunodeficiency virus. In addition, this invention relates to the use of an antibody and / or chemokine construct that binds to a chemokine receptor for the manufacture of a pharmaceutical composition for the treatment, prevention and / or alleviation of inflammatory kidney diseases, inflammatory bowel diseases, multiple sclerosis, skin diseases, diabetes or transplant rejection. The invention further relates to antibody and / or chemokine constructs, in particular to constructs in which said antibody construct comprises a chemokine receptor 5 binding site and a CD3 binding site, and wherein said chemokine construct includes RANTES and a toxin. The invention also describes polynucleotides encoding the aforementioned antibody and / or chemokine constructs, and vectors and hosts containing said nucleic acid molecules. Additionally, this invention relates to compositions comprising said antibody constructs, chemokine constructs, polynucleotides, vectors and / or hosts. Preferably, said composition is a pharmaceutical composition. The use of antibody constructs, chemokine constructs, polynucleotides, hosts and / or vectors for the manufacture of a pharmaceutical composition for the treatment, prophylaxis and / or alleviation of immunological disorders, or for the elimination of latently infected cells, wherein said cells are infected with a primates immunodeficiency virus such as HIV-1, is also described. . This invention also relates to a method for treating, preventing and / or alleviating immunological disorders or eliminating cells that are latently infected with primates immunodeficiency virus. In addition, the invention relates to a kit containing compounds of the invention.

Some documents are cited in the text of this description. Thus, each of the documents cited here (including any manufacturers specifications, instructions, etc.) is hereby incorporated by reference.

The incidence of immunological disorders / diseases, such as autoimmune diseases, inflammatory diseases, as well as infectious diseases, not only increases, but poses a serious danger to the health of all mankind.

For example, in Germany, about 1% of the population suffers from an autoimmune disease such as rheumatoid arthritis. In addition, there are a number of other rheumatoid diseases that also lead to arthritis. Currently, three groups of drugs are used to treat inflammatory joint diseases - non-steroidal antirheumatic drugs, cortisone drugs and second-line drugs, as well as TNFα-blocking agents. Until today, treatment has focused on local injections of cortisone drugs in combination with systemic use of anti-inflammatory drugs or second-line drugs.

Nonsteroidal antirheumatic drugs that have a mild analgesic and anti-inflammatory effect, however, have many side effects with regular use (for example, with gastrointestinal ulcers, nephrosis). High doses of cortisone preparations at high doses give a strong decongestant and analgesic effect, but lead to a rapid relapse after treatment is discontinued. Moreover, cortisone preparations cannot stop the destructive process in diseases of the joints. Long-term cortisone therapy usually entails serious side effects (infections, Cushing's syndrome, osteoporosis, parchment skin, metabolic disorders and hormonal disorders). A significant drawback of local cortisone injections is that the activity of migrated white blood cells only decreases. Since the infiltrating cells are not destroyed, a rapid relapse occurs after discontinuation of therapy. As mentioned above, the same applies to systemic use. Sometimes inflammation develops due to the irritating effect of cortisone crystals, intensifying after cortisone injection. The duration of the injection of cortisone is very uneven and can range from complete inefficiency to a lasting effect for several weeks.

Second-line drugs in rheumatology are used to achieve long-term suppression of inflammation and to reduce the use of cortisone preparations. Due to the significant toxicity (allergies, infections, malignant diseases, renal failure, blood pressure crises, pulmonary diseases), very close monitoring by doctors of patients is necessary. After the start of treatment, the therapeutic effect may not appear for the first three months. Currently, 4 or 5 of these second-line drugs are used, which are first used individually or combined if the treatment is ineffective. Almost nothing is known about the mechanism of action of second-line drugs. It is still not completely clear whether the use of second-line drugs can slow the destruction of joints. In recent years, a new group of substances has begun to be used in the treatment of rheumatoid arthritis, the effect of which is based on the blocking of cellular signal substances (in particular, TNFα) through monoclonal antibodies or soluble receptor constructs.

In addition, some patients do not respond to current treatments. In other cases, conventional therapy is discontinued due to intolerable side effects.

A similar situation where modern treatments have many limitations is also observed for many other inflammatory and autoimmune diseases, such as renal inflammatory diseases, intestinal inflammatory diseases, multiple sclerosis, and transplant rejection. For example, agents used to treat inflammatory and autoimmune diseases include anti-inflammatory and immunosuppressive agents, such as azathioprine, cyclophosphamide, glucocorticoids, for example, prednisone and corticosteroids; immunosuppressants such as cyclosporin A, tacrolimus (FK506), sirolimus (rapamycin); and protein agents, such as calcinurin, β-interferon, anti-TMPα-monoclonal antibodies (remicade). These drugs show general immunomodulating effects and therefore their performance indicators and side effects may impose severe restrictions on the selected treatment options (Harrison's Principles of Internal Medicine, eds. Fauci et al., 14 ^{th edition, McGraw-Hill publisher)} .

For the treatment of intestinal inflammatory diseases (examples of which are Crohn’s disease, ulcerative colitis), anti-inflammatory drugs such as sulfasalazine (azulfidine) and glucocorticoids such as prednisone and, in some cases, TNFα-blocking drugs are usually used. With ulcerative colitis, immunosuppressive therapy with drugs such as azathioprine is traditionally used, and patients with severe forms of the disease are prescribed the powerful immunosuppressive drug cyclosporin (Harrison's Principles of Internal Medicine, eds. Fauci et al., 14 ^th edition, McGraw-Hill publisher).

In many cases, when using the available medicines, a sufficient decrease in the activity of the disease is not achieved, so sometimes even surgical intervention becomes necessary.

Renal inflammatory diseases (nephritis) are usually treated, for example, with glucocorticoids, alkylating agents and / or plasmapheresis. Similar treatment options are also used for systemic lupus erythematosus (SLE), Sjogren's syndrome, polymyositis, dermatomyositis, mixed connective tissue disease, antiphospholipid syndrome.

To treat some of these diseases, only a limited number of therapeutic options exist today. All of these diseases include an inflammatory component. However, with currently available drugs, the inflammatory component cannot be sufficiently suppressed. For some drugs, such as alkylating agents, the patient’s maximum lifetime dose should not be exceeded.

Graft rejection is usually treated with immunosuppressive drugs, including azathioprine, mycophenolate mofetil, glucocorticoids, cyclosporine, tacrolimus (FK506), sirolimus (rapamycin). The combination of steroids and a low dose of mouse monoclonal antibody OCTZ binding to T cells is used to induce anergy and depletion of T cells, and then therapy is continued using immunosuppressants, for example, cyclosporin. Human anti-mouse antibodies I (HAMAs) have common side effects and limit the use of OKTZ (Fauci et al. Sic. 2374-2381).

Methods for treating multiple sclerosis include those that affect the immune system as a whole, such as anti-inflammatory drugs such as azathioprine, cyclophosphamide, prednisone, corticosteroids, cyclosporin A, calcinurin, rapamycin, β-interferon (Fauci et al. Sic.2415- 2419; Wang (2000) J. Immunol 165, 548-57). In addition, a number of non-specific agents are used that can improve the quality of life, including physiotherapy and psychopharmaceuticals. None of the treatment options mentioned above have a healing effect. Even the most promising drug, β-interferon, only slows down the development of the disease and at the same time causes significant side effects.

Furthermore, more than 50 million people (including those who have died) are already infected with type 1 human immunodeficiency virus (HIV-1), which is the most common cause of AIDS, and the rate of new infection is estimated at about 6 million people per year (AIDS epidemic data for December 1999 (UNAIDS, Geneva, 1999), www.unaids.org). Uncertainty about the possibility of an epidemic is also worrying. Although central Africa is the global epicenter, infection rates have recently increased in the countries of the former USSR and parts of south and southeast Asia, including India and China, where literally hundreds of millions of people are at potential risk. In the United States, a new wave of infection has been detected in women, sexual minorities, and younger generations of gay men. Combination antiretroviral therapy brings clinical relief to many patients, but is costly and toxic, and AIDS remains a deadly disease. In addition, these drugs are not available to the vast majority of infected people in the world. Thus, although the demography (and in some cases the natural course of development) of AIDS has changed, the epidemic is by no means prevented; on the contrary, the disease develops, expands and poses an even greater danger.

The human immunodeficiency virus (HIV) cannot enter a human cell without first contacting two key molecules on the cell surface, CD4 and coreceptor. The coreceptor that is recognized first is CCR5, and later in the life cycle of the virus, another chemokine receptor, CXCR4, becomes the coreceptor for HIV-1 (D'SouZa, Nature Med. 2, 1293 (1996); Premack, Nature Med. 2 1174; Fauci, Nature 384, 529 (1996)). HIV-1 strains, which are mostly sexually transmitted, are called M-tropic viruses. These HIV-1 strains (also known as NSI primary viruses) can replicate in primary CD4 + T cells and macrophages and use the chemokine receptor CCR5 (less commonly CCR3) as a coreceptor. T-tropic viruses (sometimes called Sl-primary) can also replicate in primary CD4 + T cells, but they can also infect established CD4 + T cell lines in vitro via the CXCR4 chemokine receptor (fusin). Many of these T-tropic strains can use CCR5 in addition to CXCR4, and some through CCR5 can enter macrophages, at least under certain in vitro conditions (D'SouZa, Nature Med. 2, 1293 (1996); Premack, Nature Med. 2, 1174; Fauci, Nature 384, 529 (1996)). It is not clear whether other coreceptors are involved in the pathogenesis of HIV-1, but from in vitro studies it can be concluded that another coreceptor exists for some T-tropic strains. Since M-tropic strains are approximately 90% linked to sexual transmission of HIV, CCR5 is the dominant coreceptor for the virus in patients; transmission (or systemic binding) of CXCR4-using (T-tropic) strains is rare (D'SouZa, Nature Med. 2, 1293 (1996); Premack, Nature Med. 2, 1174; Fauci, Nature 384, 529 (1996) , Paxton, Nature Med. 2, 412 (1996); Liu, Cell 86, 367 (1996); Samson, Nature 382, 722 (1996); Dean, Science 273, 1856 (1996); Huang, Nature Med. 2, 1240 (1996)). However, when SI viruses develop in vivo (or transmission has occurred), they are especially virulent and cause accelerated disease progression (D'SouZa, Nature Med. 2, 1293 (1996); Premack, Nature Med. 2, 1174; Fauci, Nature 384 , 529 (1996), Schuitemaker, J. Virol. 66, 1354 (1992); Connor, J. Virol. 67, 1772 (1993); Richman, J. Infect. Dis. 169, 968 (1994); RI Connor et al., J. Exp. Med. 185, 621 (1997); Trkola, Nature 384, 184 (1996)).

The number and nature of coreceptor molecules on the target cells, as well as the estimated ability of HIV-1 strains to enter the cells through various coreceptors, are represented by factors that determine the progression of the disease. These factors have a huge impact on the mechanisms of HIV-1 infection from both the host and the virus. For example, a homozygous defect (delta 32) in CCR5 is strongly correlated with resistance to HIV-1 infection in vivo and in vitro. Individuals that are heterozygous for the defective CCR5 allele are poorly protected from infection at best and show only moderately slow disease progression (Paxton, Nature Med. 2, 412 (1996); Liu, Cell 86, 367 (1996); Samson, Nature 382 722 (1996); Dean, Science 273, 1856 (1996); Huang, Nature Med. 2, 1240 (1996)). However, other factors may influence the level of CCR5 expression on activated CD4 + T cells, which in turn affects the effectiveness of HIV-1 infection in vitro (Trkola, Nature 384, 184 (1996); BleuI, Proc. Natl. Acad Sci. USA 94, 1925 (1997)). For reasons that are not yet clear, the amount of CCR5 expression on the cell surface (as measured by MIP-1 binding) of CD4 + T cells from individuals with two wild-type CCR5 alleles changes 20 times (Trkola, Nature 384, 184 (1996)) (see FIG.). Staining with CCRS-specific monoclonal antibody shows equally strong variation (Wu, J. Exp. Med. 186: 1373-81 (1997)). Such a change can be much stronger than the effect of one defective CCR5 allele. The reasons for this change should be carefully studied, as they open the way to controlled factors that can increase disease resistance.

Clinical isolates of primates immunodeficiency viruses are mainly used to enter the chemokine receptor CCR5 (Feng, Science 272, 872 (1996); Choe, Cell 85, 1135 (1996); Deng, Nature 381, 661 (1996); Dragic et al., Nature 381, p. 667; Doranz, Cell 85, 1149 (1996); Alkhatib, Science 272, 1955 (1996)). For the majority of HIV-1 isolates that have become fixed after transmission and dominate during the first years of infection, CCR5 is an essential coreceptor, and rare individuals that are genetically deficient in CCR5 expression are relatively resistant to HIV-1 infection (Connor, J. Exp. Med 185, 621 (1997); Zhang, Nature 383, 768 (1996); Björndal, J. Virol. 71, 7478 (1997); Dean, Science 273.1856 (1996); Liu, Cell 86, 367 (1996) ; Paxton, Nature Med. 2, 412 (1996); Samson, Nature 382, 722 (1996)). HIV-1 isolates that appear later during infection often use other chemokine receptors in addition to CCR5, most often CXCR4. A study of chimeric enveloped glycoproteins showed that the third variable (V3) gp120 loop is the main determinant of the use of the chemokine receptor (see references cited above, as well as Cocchi, Nature Med. 2, 1244 (1996); Bieniasz, EMBO J. 16, 2599 (1997); Speck, J. Virol. 71, 7136 (1997)). V3-deleted gp120 versions do not bind to CCR5, although binding to CD-4 occurs at wild-type levels. Antibodies to the V3 loop interfere with gp-120-CCR5 binding (Trkola, Nature 384, 184 (1996); Wu, Nature 384, 179 (1996); Lapham, Science 274, 602 (1996); Bandres, J. Virol. 72 2500 (1998); Hill, Science 71, 6296 (1997)). These results indicate the involvement of the V3 loop in chemokine receptor binding.

The latent state of HIV is established in the very early stages of infection, when M-tropic strains dominate. Infection with M-tropic strains depends on the presence of CCR5 on the target cell. The importance of CCR5 as an indispensable coreceptor for M-tropic HIV-1 is confirmed by the fact that individuals without CCR5 due to a homozygous deletion of 32 base pairs (Delta 32) are highly resistant to HIV-1 infection. Unlike other markers, such as CD4, CD25 or CD45RO, CCR5 is present only in a specific subgroup of lymphocytes and other cells susceptible to HIV infection (Rottmann (1997) Am J Pathol 151, 1341-1351; Naif (1998) J Virol 72 830-836; Lee (1999) Proc. Natl. Acad Sci. 96, 5315-5220).

Some treatment approaches rely on the removal of latently infected cells. One strategy is to bring latently infected cells to virus production and subsequent cell death. In this context, one way is to administer IL-2 (TNFα, IL-6) in the presence of HAART until the viral source is exhausted (Chun (1999) Nat. Med. 5, 651-655; Stellbrink (1999) Abstracts of the 6 ^th Conference on Retroviruses and Opportunistic Infections (Foundations for Retrovirology and Human Health, Alexandria, VA), abstr. 358, p. 135). These cells are thought to die after activation. The question of whether the entire pool of latently infected cells can be completely destroyed remains an open question.

Another strategy was to attempt to specifically kill latently infected cells based on expression of gp120 on the cell surface. Immunotoxins that recognize gp120 have been proposed, but they have been unsuccessful for two reasons. One human-tested construct was a protein consisting of soluble CD4 linked to Pseudomonas aeroginosa exotoxin A (PE). Clinical results were disappointing due to dose-limiting hepatotoxicity in the absence of any signs of efficacy, and the program was closed (Ashorn (1990) Proc. Natl. Acad. Sci. 87, 8889-8893; Berger (1998) Proc. Natl. Acad. Sci. 95, 11511-11513). The second reason for the failure was that latently infected cells do not express viral surface glycoproteins, i.e. gp-120 and gp-41. Thus, methods based on recognition of gp-120 or gp-41 to eliminate latently infected cells are ineffective.

Other methods for eliminating latently infected cells are based on the elimination of a whole department of CD4 + T cells (Berger (1998) Proc. Natl. Acad. Sci. 95, 11511-11513), or CD25-positive department (Bell (1993) Proc. Natl. Acad . Sci. 90, 1411-1415), Division of T-lymphocytes CD45RO (McCoig (1999) Proc. Natl. Acad. Sci. 96, 11482-11485). However, these markers do not sufficiently include all potentially infected cells. Such cells include, in addition to CD4-positive cells, or T-lymphocytes, also macrophages and non-hematopoietic cells.

WO 98/18826 describes an antibody directed against a mammalian chemokine receptor 5 (e.g., human), said antibody being provided in a method of inhibiting the interaction of a cell carrying CCR5 with a potential ligand such as HIV. The said method is proposed as inhibiting HIV infection. In addition, treatment options for inflammatory diseases, autoimmune diseases, and transplant rejection have been proposed. All of these treatment options are based on the assumption that specific antibodies, such as immunoglobulin molecules or their functional parts, interfere with receptor-ligand interactions. However, it is not clear whether these antibodies are capable of destroying the corresponding cells. Furthermore, WO 98/18826 only suggested that the interaction of HIV and the CCR5 receptor would be prevented and therefore HIV infection would be prevented.

White blood cells, in particular T cells, are thought to be key regulators of the immune response to infectious factors and are major components for initiating and maintaining inflammatory processes, such as intestinal inflammatory diseases and renal inflammatory diseases, inflammatory joint diseases, autoimmune disorders such as multiple sclerosis and arthritis, skin diseases such as psoriasis, diabetes and transplant rejection.

Therefore, the technical task of the invention is to create new tools and methods that can lead to the suppression of activated leukocytes involved in immunological pathologies, such as autoimmune diseases, inflammatory processes and / or viral infections of immune cells.

Accordingly, this invention relates to the use of an antibody and / or chemokine construct that binds to a chemokine receptor for the manufacture of a pharmaceutical composition for the elimination of cells that are latently infected with primates immunodeficiency virus, preferably human immunodeficiency virus, most preferably HIV-1.

In the context of this invention, the binding of the aforementioned antibody and / or chemokine construct, which binds to the chemokine receptor, leads to the destruction and / or destruction of the target cell, namely the cell latently infected with the above-mentioned primate immunodeficiency virus.

This invention revealed the unexpected fact that highly specific antibodies directed against the chemokine receptor were unable to destroy, cause lysis and / or deplete cells that express the chemokine receptor. However, the antibody or chemokine constructs described in this invention have been able to specifically interact with said chemokine receptor-positive cells and capable of killing said cells. Said killing / destruction can be achieved, for example, by attracting specific effector cells such as monocytes, macrophages, T cells (cytotoxic T cells are particularly preferred) or dendritic cells. Although monoclonal antibodies have been successful in the destruction / destruction of malignant cells (see, for example, Maloney (1999), Sem. Oncol. 26, 76-78), they do not show efficacy against certain subtypes of leukocytes (including lymphocytes, polynuclear leukocytes and monocytes) , especially CCR5-positive monocytes, T cells and dendritic cells, which is confirmed in this description and in the accompanying examples.

In the present invention, the expression “antibody and / or chemokine construct” (ie, antibody construct and / or chemokine construct) includes not only the molecules and multifunctional constructs and compounds described herein, but also their functional fragments. Functional fragments of these constructs are fragments that are capable of binding or interacting with a chemokine receptor on a target cell and provide means for killing, lysing and / or destroying said target cell.

Specific chemokine receptors of this invention include, but are not limited to, CXCR3, CXCR4, CXCR5, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, XCR1, CCR10 and CX3CR1. Chemokines and / or chemokine ligands binding to said chemokine receptors are well known in the art and are shown, inter alia, in Table 4. In addition, chemokines and corresponding receptors are described in Murphy (2000), Pharm. Reviews 52, 145-176. Chemokines, chemokine ligands and / or primate receptors are preferred, most preferably human chemokines / ligands / receptors.

The invention also relates to the use of an antibody and / or chemokine construct that binds to a chemokine receptor for the manufacture of a pharmaceutical composition for treating, preventing and / or alleviating inflammatory kidney diseases, inflammatory bowel diseases, multiple sclerosis, skin diseases, allergic reactions, diabetes, or graft rejection.

Mentioned skin diseases include, but are not limited to, psoriatic disorders, atopic dermatitis, or chronic inflammation of the skin. In PBMCs obtained from patients with psoriasis, CCR6 expression is upregulated. In addition, the ligand CCR6 (CCL20 = MIP3 alpha) and CCR6 are upregulated in psoriatic skin. In addition, CCL20-expressing keratinocytes are co-localized with skin infiltrating T cells (Homey (2000) J. Immunol. 164, 6621-6632). In addition, CCR10 was found on melanocytes, dermal fibroblasts, dermal endothelial cells, Langerhans T cells and skin cells, but not keratinocytes. The ligand CCR10 (CCL27) has a skin-associated expression (Homey (2000) J. Immunol. 164, 3465-3470; Cnarbonnier (1999) J. Exp. Med. 190, 1755-1768). Further, CCR4 and its ligand (TARC, MDC) are upregulated in chronically inflamed skin. In addition, CCR4 is a homing receptor for T cells entering the skin. CCR4 + T cells represent only a small subpopulation of all T cells, and therefore the destruction of CCR4 + T cells has been shown for various inflammatory skin diseases (Campbell (1999) Nature 400, 776-780). The expression of CCR3 and endotoxin is enhanced in atopic dermatitis and may be involved in the initiation and maintenance of inflammation (Yawalkar (1999) J. Invest. Dermatol. 113, 43-48).

In fact, all T cells in the tissues of rheumatoid arthritis, synovial fluid, and in various inflamed tissues, for example, with ulcerative colitis, chronic vaginitis, and sarcoidosis, express CXCR3, while in normal lymph nodes fewer T cells are CXCR3-positive.

For multiple sclerosis, CCR5 and CXCR3 have been shown to be expressed in large numbers on T cells that infiltrate demyelinating brain lesions, as well as in the peripheral blood of disease-affected patients. Corresponding ligands M1P-1α and IP-10 were also found in platelets (Balashov (1999) Proc. Natl. Acad Sci. 96, 6873-6878). Removing T cells would block the T cell activator of this autoimmune disease.

An immunochemical analysis of the expression of beta-chemokine receptors in the post-mortem CNS tissues of patients with multiple sclerosis (MS) showed that CCR2, CCR3 and CCR5 expression was associated with foamy macrophages and activated microglia in chronically affected MS sites, while microglial expression in control CNS tissue cells expressed low levels of these chemokine receptors. CCR2 and CCR5 were also present on large numbers of infiltrating lymphocytes, and in 5 out of 14 cases, MS CCR3 and CCR5 were also expressed on astrocytes. Increased expression of CCR2, CCR3, and CCR5 in the central nervous system in MS suggests that these beta-chemokine receptors and their ligands play a role in the pathogenesis of MS (Simpson, J. Neuroimmunol., 2000, 108, 192-200).

High expression of CCR3 and CCR5 has also been observed in lymph nodes from patients with Hodgkin's disease. While CCR3 was equally distributed in CD4 + and CD8 + cells, CCR5 was mainly associated with CD4 + cells. These data show that chemokines are involved in the formation of non-neoplastic leukocyte infiltrates in Hodgkin's disease (Buri, Blood, 2001, 97, 1543-8).

Periodontal disease is a peripheral infection involving gram-negative microorganisms. In patients with moderate and progressive disease, inflammatory cytokine receptor CCR5 receptors were found in inflammatory infiltrates (Gamonal, J. Periopdontal. Res., 2001, 36, 194-203 and Taubman, Crit. Rev. Oral. Biol. Med. 2001, 12, 125-35).

Type I diabetes is considered a T-cell-mediated autoimmune disease. Pancreatic CCR5 receptor expression has been associated with the progression of type I diabetes in appropriate animal models (Cameron (2000) J. Immunol. 165, 1102-1110). In particular, CCR5 expression has been associated with the development of insulinitis and spontaneous type I diabetes.

In the corresponding animal models of type I diabetes, specific chemokines are associated with T-cell migration: RANTES, MCP-1, MCP-5, IP-10. These chemokines lead to an th1 immune response (Bradley (1999) J. Immunol. 162: 2511-2520).

The intestinal inflammatory disease mentioned above may include Crohn's disease and ulcerative colitis.

CCR9 is expressed on T cells migrating into the intestine and may be involved in Crohn's disease and ulcerative colitis. All intestinal lymphocytes of the lamina propria and intraepithelial lymphocytes express CCR9 (Zabel (1999) J. Exp. Med. 190, 1241-1256).

In addition, the design of the antibody and / or chemokine described in this invention is also useful for preventing complications during and / or after transplantation, i.e. prevent graft rejection and graft versus host disease.

CCR7 is expressed on naive T cells and dendritic cells and mediates cell migration to the lymphatic organs. Therefore, elimination of CCR7 + cells will prevent an immune response to new antigens, for example, after transplantation. Such treatment will not be immunosuppressive in general, but selective for new antigens and will be limited by the time of administration of medicaments of the invention that deplete CCR7 + cells (Forster (1999) Cell 99, 23-33). CXCR5 is expressed on naive B cells in peripheral blood and tonsils, as well as in T lymphocytes. Elimination of CXCR5 + B cells will prevent the formation of a humoral response. In addition, elimination of T-lymphocytes will decrease the cellular component of the immune response (Murphy (2000), Pharmacological Reviews 52, 145-176).

Antibody and / or chemokine constructs described herein can be used to create pharmaceutical compositions for treating allergies and / or allergic reactions. It has been shown that CCR3, which binds to endotoxin and RANTES, is expressed on eosinophils, Th2 cells, mast cells, basophils that are involved in allergic reactions (Romangnani (1999) Am. J. Pathol. 155, 1195-1204).

For the aforementioned renal diseases, it has been shown that CCR5-positive T cells can play a role in interstitial processes leading to fibrosis. CCR5-positive cells were identified in interstitial infiltrate of various glomerular and interstitial diseases, as well as transplant rejection. Mentioned diseases include acute and chronic nephritis, IgA nephropathy, etc. (Segerer (1999), Kidney Int. 56, 52-64).

In the transient immune complex glomerulonephritis (IC-GN) model, CCR1, CCR2, and CCR5 were expressed early and were already downregulated at the peak of proteinuria and leukocyte infiltration. CCR5 expression was localized in the glomeruli by in situ hybridization and quantitative reverse transcriptional (RT) PCR of isolated glomeruli (Anders, J. Am. Soc. Nephrol., 2001, 12, 919-31). In the kidneys of 38 patients with several renal diseases, CCR1- and CCR5-positive macrophages and T cells were detected in both glomeruli and interstitium, as shown by immunohistochemical analysis. The number of renal CCR5-positive cells sharply decreased during recovery due to glucocorticoids (Furuichi, Am. J. Nephrol., 2000, 20, 291-9).

In a preferred embodiment, the invention relates to the use of an antibody and / or chemokine construct that binds to a chemokine receptor to produce the pharmaceutical composition described above, wherein said chemokine receptor is chemokine receptor 5 (CCR5). Preferably, said CCR5 is human CCR5.

The chemokine receptor CCR5 is a member of a large family of G-protein-linked receptors with seven transmembrane domains that bind to the pro-inflammatory chemokines RANTES, MIP1-α, MIP1-β and MCP-2. Chemokines act in concert with adhesive molecules, inducing the release of white blood cells and directing their migration to areas of tissue damage.

CCR5 is expressed on a small portion of T cells and monocytes and is the main coreceptor for M-tropic strains of HIV-1, which predominate in the early stages of HIV infection.

Thus, the pharmaceutical composition described above is especially useful for killing CCR5 ⁺ white blood cells and could be useful for removing cells latently infected with HIV-1. Therefore, the destruction of CCR5 ⁺ cells should reduce the number of cells latently infected with HIV, and should be especially useful in combination with active antiviral, preferably antiretroviral, therapy.

In a particularly preferred embodiment of the invention, said antibody construct that binds to a chemokine receptor, preferably CCR5, as a first antigen, and to a CD3 antigen of an effector cell as a second antigen. Preferably, said CD3 antigen is on the surface of a T cell, preferably a cytotoxic T cell. Therefore, said CD3 denotes an antigen that is expressed on the aforementioned cells and may be part of a multimolecular (T-) cell receptor complex.

Bispecific antibodies can be constructed by hybrid hybrid technology, by covalent binding of specific antibodies, or by other methods, for example, on the basis of a diatel (Kipriyanow, Int. J. Cancer 77 (1998), 763-773).

Preferably, said bispecific antibody is a single chain antibody construct.

It is well known that Fv, the smallest fragment of an antibody that contains a complete antigen recognition and binding site, consists of a dimer of one heavy chain variable domain and one light chain variable domain (V _H and V _L ) in a non-covalent bond. In this configuration, which corresponds to the configuration found in native antibodies, the three complementarity determining regions (CDRs) of each variable domain interact with each other to determine the antigen binding site on the surface of the V _H -V _L dimer. These six CDRs together give the antibody specificity for binding to the antigen. Frame regions (FRs) flanking CDRs have a tertiary structure that is essentially conserved in native immunoglobulins of such distinct species as humans and mice. These FRs serve to maintain CDRs in their proper orientation. Constant domains are not required for the binding function, but may help to stabilize the interaction of V _H -V _L. Even one variable domain (or half of an Fv containing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although usually with a lower affinity than the whole binding site (Painter, Biochem. 11 (1972), 1327-1337 ) Thus, the aforementioned domain of the antibody construction binding site defined and described in this invention may be a pair of V _H —V _L , V _H —V _H , or V _L —V _L domains. various immunoglobulins. The order of the V _H and V _L domains within the polypeptide chain is not critical in the present invention, and the domain order described above can usually be changed without loss of function. However, it is important that the V _H and V _L domains are located so that the antigen binding site can bend as desired.

The various parts of the antibodies / immunoglobulins can be combined using conventional methods or constructed as adjacent proteins by recombinant DNA technologies, for example, so that a nucleic acid molecule encoding a chimeric or humanized antibody chain is expressed to construct an adjacent protein (cf., for example, Mack et al. (1995) Proc. Natl. Acad. Sci. USA, Vol. 92, pp. 7021-7025).

A single chain antibody with the following Fv fragments is preferred: an sc-Fv fragment of an anti-chemokine receptor monoclonal antibody, preferably anti-CCR5, and an sc-Fv fragment of an anti-CD3 monoclonal antibody. In this case, both Fv fragments are directed against the chemokine receptor, and the Fv fragment against CD3 can be located at the N-terminal position. The order of the V _L and V _H antibody domains can be variable in both constructs, the order of the Fv fragment against CCR5 V _L -V _{H is} preferred, and the order of the Fv fragment against CD3 is V _H -V _L. Linkers between variable domains, as well as between two Fv fragments, may consist of peptide linkers, preferably a hydrophilic, flexible glycine and serine-containing linker containing 1-25 amino acids. An additional histidine chain, for example from 6 × His, at the C- or N-terminal position, can be used to simplify cleaning and detection of the construct.

Compared to conventional bispecific antibodies, bispecific single chain antibodies have the advantage that they consist of only one protein chain and, thus, their composition is precisely defined. They have a low molecular weight, usually <60 kDa, and can be easily produced on an industrial scale in suitable cell lines, for example, in CHO cells, using recombinant technologies. However, the most significant advantage is that they do not have constant domains of the antibody and, thus, only activate the lysis of T-lymphocytes when they bind to the corresponding target cells, i.e. with cells expressing a chemokine receptor. Therefore, single chain antibodies are often preferable over conventional bispecific antibodies, since their clinical use entails fewer or less severe side effects.

It was found that MS-1 specifically binds to the first part of the second extracellular loop of human CCR5 and does not cross-interact with CCR5 taken from rhesus macaque, as shown in the accompanying examples. Therefore, it is preferable that the design of said single chain antibody include V _L and V _H domains of a chemokine receptor specific antibody, preferably human CCR5, and V _L and V _H domains of an antibody specific for CD3 antigen. Mentioned antibody specific for human CCR5 is a mouse antibody to human CCR5 MC-1, described, inter alia, by Mack (1998), J. Exp. Med. 187, 1215-1224 and in the accompanying examples. However, it is also understood that other α-CCR5 antibodies, such as MC-5 (described in the accompanying examples and Segerer (1999), loc. Cit), can be used in this invention. An antibody specific for the CD3 antigen may be selected from the group consisting of antibodies recognizing gamma, delta, epsilon, zeta chains, where antibodies recognizing the epsilon chain and CD3 zeta chain are particularly preferred (Jakobs (1997 ) Cancer Immunol Immunother. 44, 257-264; Mezzanzanica (1991) Cancer Res 51, 5716-5721). Examples of anti-epsilon chain antibodies include OCT-3 (WO 91/09968, Kung et al., Science 206, 347-349 (1979); Van Wauwe, J. Immunol. 124, 2708-2713 (1980); Transy, Eur . J. Immunol. 19, 947-950 (1989); Woodle, J. Immunol. 148, 2756-2763 (1992); Ada, Human. Antibod. Hybridomas, 41-47 (1994)) and TR66 (Traunecker (1991) ) EMBO J. 10, 3655-3659). Examples of monoclonal antibodies against the CD3 zeta chain include H2D9, TIA2 (both from Becton Dickinson), G3 (Seroteck Ltd.).

In a most preferred embodiment of the invention, the V _L and V _H domains of the single chain antibody described above are arranged in the order of V _L (MC-1) -V _H (MS-1) -V _H (CD3) -V _L (CD3), where most preferably v _H (MC-1) includes the amino acid sequence shown in SEQ ID NO: 12, where said V _H (MS-1) includes the amino acid sequence shown in SEQ ID NO: 16, where said V _H (CD3) includes the amino acid sequence shown in SEQ ID NO: 26 and / or where the said V _L (CD3) includes the amino acid sequence shown in SEQ ID N O: 28. Specific CDR portions of the MS-1 antibody are shown in SEQ ID NO: 29-34, where SEQ ID NO: 29 shows CDR1 v _l MC-1, SEQ ID NO: 30 shows CDR2 v _l MC-1, SEQ ID NO: 31 shows CDR3 v _l MC-1, SEQ ID NO: 32 shows CDR1 v _h MC-1, SEQ ID NO: 33 shows CDR2 v _h MC-1 and SEQ ID NO: 34 shows CDR3 v _h MC-1.

Said bispecific antibody may, inter alia, include the amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 17 or include the amino acid sequence shown in SEQ ID NO: 18.

In another embodiment of the invention, the antibody construct is a bispecific antibody that binds to said chemokine receptor as a first antigen and toxin as a second antigen. This antibody may be covalently linked to said toxin, and said antibody toxin construct may be constructed by chemical coupling, generating a fusion protein or mosaic protein from said antibody and from a modified or unmodified prokaryotic or eukaryotic toxin. Furthermore, said antibody can be coupled to said toxin via additional multimerization domains.

In a further embodiment of the invention, said antibody construct can be linked via a multimerization domain in vitro and / or in vivo to a second antibody construct that binds to the CD3 antigen and / or toxin. Said multimerization domain can be obtained, for example, by hetero (di )merization. For example, a hetero (di) merization region of constant immunoglobulin domains can be used. Other multi- and / or hetero (di) merization domains are also known in the art and are based on leucine zippers, α and β chains of T cell receptors, or MHC class II molecules. In addition, jun and fos domains can be used (de Kuif (1996) J. Biol Chem. 271, 7630-7634; Kostelny (1992), J. Immunol 148, 1547-1553). Additional examples of multimerization domains include the p53 and MNT domains described in Sakamoto (1994) Proc. Natl. Acad Sci. USA 91, 8974-8978; Lee (1994) Nat. Struct. Biol. 1, 877-890; Jeffrey (1995) Science 267, 1498-5102 or Nooren (1999) Nat. Struct. Biol. 6, 755-759).

In a further embodiment of the invention, the aforementioned chemokine construct is a fusion construct of a modified or unmodified chemokine with a modified or unmodified toxin. Said construct may be coupled through an in vitro and / or in vivo multimerization domain to an antibody construct that binds to the CD3 antigen and / or toxin. Suitable multimerization domains are described in the literature and mentioned above. Chemokine toxin constructs can be obtained, for example, by chemical addition, by recombinant technology (as shown in the attached examples), or can be obtained as a fusion protein from chemokine and a modified or unmodified prokaryotic or eukaryotic toxin. Most preferably, said chemokine binds to the human chemokine receptor CCR5 and includes, among others, RANTES, MIP1-α, MIP1-β, MCP-2, MCP-3, or fragments thereof capable of binding to said receptor. A preferred toxin may be a truncated version of Pseudomonas exotoxin, such as PE38, PE40, or PE37. Most preferred in this invention is PE38.

Furthermore, in the present invention, said chemokine construct may comprise a chemokine covalently linked to an antibody construct that binds to an antibody construct capable of binding to the CD3 antigen and / or which is covalently linked to a toxin.

In a most preferred embodiment of the invention, the antibody and / or chemokine construct is a hetero-antibody construct containing at least an antibody and / or chemokine that binds to a chemokine receptor, preferably a CCR5 receptor, most preferably a human CCR5 receptor. Said heterominibody construct may comprise at least one toxin, and it is most preferred that said heterominibody construct binds to a chemokine receptor as defined above and / or to an CD3 antigen of an effector cell. Preferred chemokines include the chemokines mentioned above, and preferred toxins include the toxins described above, which may be modified or unmodified. Chemokines are well known and described in the art, for example, Murphy (1999), loc. cit. Therefore, it is preferred that the chemokine is selected from the group consisting of RANTES, MIP1-α, MIP1-β, MCP-2, and MCP-3, or functional fragments thereof. The most preferred chemokine in this invention is RANTES. Functional fragments of said chemokines are those fragments that are capable of binding or interacting with said chemokine receptor, preferably human CCR5. Heterominibodies are known in the art and their preparation is described, for example, in WO 00/06605. Said hetero-antibody may be a multifunctional compound containing at least one antibody and / or chemokine that binds or interacts with a chemokine receptor, preferably human CCR5, and (optionally) may contain a toxin, as described below, and / or a CD3 antigen binding site .

In a preferred embodiment, the antibody or chemokine construct for use in the invention is a fusion (poly) peptide or a mosaic (poly) peptide. Mentioned fused (poly) peptide may include only the domains of the above structures, as well as their functional fragments. However, it is also understood that said fusion (poly) peptide may include additional domains and / or functional segments. Therefore, said fusion (poly) peptide may include at least one additional domain, wherein said domain is joined by covalent or non-covalent bonds. Linking and constructing such constructs can be based on genetic fusion in accordance with methods known in the art (Sambrook et al., Loc. Cit, Ausubel, "Current Protocols in Molecular Biology", Green Publishing Assosiates and Wiley Interscience, NY ( 1989)) or can be performed, for example, by chemical crosslinking, as described in WO 94/04686. The additional domain present in the construct can preferably be joined by a flexible linker, preferably a (poly) peptide linker, wherein said (poly) peptide linker preferably includes hydrophilic amino acid chains with peptide bonds having a length sufficient to cover the distance between the C-terminus of said additional domain and N-terminus of the peptide, (poly) peptide or antibody, or vice versa. Said linker may be, for example, glycine, serine and / or glycine / serine linker. Additional linkers include oligomerization domains. Oligomerization domains facilitate the combination of two or more autoantigens or their fragments in one functional molecule. Non-limiting examples of oligomerization domains include leucine zippers (such as jun-fos, GCN4, E / EBP; Kostelny, J. Immunol 148 (1992), 1547-1553; Zeng, Proc. Natl. Acad. Sci. USA 94 (1997), 3673-3678, Williams, Genes Dev. 5 (1991), 1553-1563; Suter, "Phage Display of Peptides and Proteins", Chapter 11, (1996), Academic Press), oligomerization domains from antibodies, such as constant domains of CH1 and CL (Mueller, FEBS Letters 422 (1998), 259-264) and / or tetramerisation domains, e.g. GCN4-LI (Zerangue, Proc. Natl. Acad. Sd. USA 97 (2000), 3591-3595).

In addition, the design of an antibody or chemokine for use in this invention may contain at least one additional domain, for example, domains providing cleaning agents, in particular histidine segments. Mentioned additional domain (s) may be joined by covalent or non-covalent bonds.

The accession may be based on genetic fusion in accordance with methods known in the art and described herein, or may be performed, for example, by chemical crosslinking, as described, in particular, in WO 94/04686. The additional domain present in the construction of the invention can preferably be joined by a flexible linker, preferably a polypeptide linker, to one of the binding site domains, said polypeptide linker comprising hydrophilic amino acid chains with peptide bonds having a length sufficient to cover the distance between With the termination of one of the aforementioned domains and the N-termination of the other of the aforementioned domains, wherein said polypeptide in a water solution takes on a conform uw convenient for binding. Preferably, said polypeptide linker is a polypeptide linker as defined in the above embodiments. The polypeptide of the invention may further comprise a cleavable linker or cleavage site for proteinases, such as enterokinase.

It is also understood that the constructions for use cases, compositions and methods of this invention include additional domain (s) that can function as an immunomodulator. Said immunomodulators include, but are not limited to, cytokines, lymphokines, T-cell costimulatory ligands, etc.

Adequate activation leading to the priming of naive T cells is critical for primary immune responses and depends on two signals received from professional APCs (antigen presenting cells), such as dendritic cells. The first signal is antigen-specific and is usually mediated by stimulation of the clonotypic T-cell antigen receptor, which is induced by the treated antigen present in the environment of MHC class I or MHC class II molecules. However, this primary stimulus is not sufficient to induce primitive responses of naive T cells, and a second signal is required, which is provided by the interaction of specific T cell surface molecules that bind to co-stimulatory ligand molecules on antigen-presenting cells that additionally support proliferation of primed T cells . Therefore, the expression "T-cell co-stimulatory ligands" in the light of this invention means molecules that are able to support the priming of naive T cells in combination with the primary stimulus and which include, but are not limited to, members of the B7 protein family, including B7-1 (CD80 ) and B7-2 (CD86).

The design of an antibody and / or chemokine, as defined above or described below, may include additional function (s) of the receptor or ligand and may include an immunomodulatory effector molecule or a fragment thereof. An immunomodulating effector molecule positively and / or negatively affects the humoral and / or cellular immune system, especially its cellular and / or non-cellular components, its functions and / or its interactions with other physiological systems. Said immunomodulatory effector molecule may be selected from the group consisting of cytokines, chemokines, inhibitory macrophage migration factor (MIF; described, among others, in Bernhagen (1998), Mol Med 76 (3-4); 151-61 or Metz (1997) , Adv Immunol 66, 197-223), T-cell receptors and soluble MHC molecules. Such immunomodulatory effector molecules are well known in the art and are described, among others, by Paul "Fundamental immunology", Raven Press, New York (1989). In particular, known cytokines and chemokines are described by Meager, "The Molecular Biology of Cytokines" (1998), John Wiley & Sons, Ltd., Chichester, West Sussex, England; (Bacon (1998). Cytokine Growth Factor Rev 9 (2): 167-73; Oppenheim (1997). Clin Cancer Res 12, 2682-6; Taub, (1994) Ther. Immunol. 1 (4), 229-46 or Michel, (1992). Semin Cancer Biol 3 (1), 3-15).

The antibody and / or chemokine constructs described herein and containing additional functional domain (s) may, for example, be multifunctional compounds, such as hetero-antibodies, described below.

Designs intended for use in the present invention or described herein may be constructs that include domains from one species, preferably from mammals, more preferably from a human. However, chimeric and / or humanized constructs are also intended to be within the scope of this invention.

In a most preferred embodiment, the composition of the invention includes constructs for use in the invention or described herein, which are a crosslinked (poly) peptide construct. As indicated above, said crosslinking can be carried out by methods known in the art, which include recombinant and biochemical methods.

In a further embodiment of the invention, the antibody construct or chemokine construct comprises at least one toxin. Said toxin may be Pseudomonas exotoxin A, diphtheria toxin and the like toxins. The use of truncated toxins, such as the PE38 or PE40 of the Pseudomonas toxin described in the accompanying examples, is also intended.

Said toxin may be coupled to said antibody or chemokine by the methods described above. It is also contemplated that said toxin may be coupled to an antibody / chemokine via a short peptide linker. The linker preferably consists of a flexible and hydrophilic amino acid sequence, in particular glycines and serines. Preferably, said linker has a length of from 1 to 20 amino acids.

To date, several fusion proteins with exotoxin A Pseudomonas have been constructed. Most of them are used to recognize and destroy malignant cells. This toxin is activated after proteolytic cleavage. A truncated version of the toxin (PE38) can be used for the constructs of this invention, since the complete protein binds to its first domain of the ubiquitous α2-macroglobulin receptor and is therefore toxic to most eukaryotic cells. This problem can still be solved by replacing the first Pseudomonas exotoxin A domain with a specific sequence that changes the specificity of toxin binding.

The invention further relates to the use of a chemokine construct that binds to a chemokine receptor to produce a pharmaceutical composition for eliminating cells that are latently infected with a primates immunodeficiency virus, said chemokine construct comprising the amino acid sequence shown in SEQ ID NO: 24 or encoded the nucleotide sequence shown in SEQ ID NO: 23.

As indicated above, in a preferred embodiment, antibody and / or chemokine constructs for use in the context of the invention bind or interact with the CD3 antigen. Preferably, said CD3 antigen is located on the surface of an effector cell, namely a T cell, preferably a cytotoxic T cell.

Most preferably, the use of an antibody construct in which said construct comprises a CCR5 binding site and a CD3 binding site and the use of a chemokine construct in which said construct comprises RANTES and said toxin is truncated Pseudomonas exotoxin A (PE38).

Thus, the present invention also relates to antibody constructs comprising a CCR5 binding site and a CD3 binding site, as well as chemokine constructs containing RANTES and truncated Pseudomonas exotoxin A (PE38).

The invention also relates to a polynucleotide encoding an antibody construct as defined above, or to a polynucleotide encoding a chemokine construct as defined above, wherein said polynucleotide is a polynucleotide comprising a nucleic acid molecule, in particular encoding a polynucleotide shown in SEQ ID NO: 18 or SEQ ID NO: 24; a polynucleotide comprising a nucleic acid molecule shown in SEQ ID NO: 17 or SEQ ID NO: 23; or (c) a polynucleotide hybridizing under stringent conditions with a complementary strand of polynucleotide (a) or (b).

For polynucleotide / nucleotide sequences as defined in (c), the expression “hybridizing” in this context should be referred to normal hybridization conditions, preferably such as hybridization in 50% formamide / 6 × SSC (sodium chloride / sodium citrate) / 0.1 % SDS (sodium dodecyl sulfate) and 100 μg / ml ssDNA, at hybridization temperatures above 37 ° C and washing temperatures of 0.1 × SSC / 0.1% SDS above 55 ° C. Most preferably, the term “hybridizing” refers to stringent hybridization conditions, such as those described in Sambrook, “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor Laboratory Press (1989), Cold Spring Harbor, NY, 1989. It is understood that polynucleotides as defined by (c) are highly homologous to polynucleotides as defined by (a) and / or (b), with at least 95% homology, more preferably at least 97%, and most preferably 99% homology with (a) polynucleotides and / or (b).

Thus, the polynucleotides defined in paragraph (c) can encode polypeptides highly homologous to the polypeptides defined in paragraph (a) and / or (b). An experienced person skilled in the art can easily test the ability of such homologous polypeptides to bind to chemokine receptors, in particular to the human CCR5 receptor and / or to remove, deplete and / or destroy cells, for example cells infected with primates immunodeficiency virus such as HIV-1, or remove, deplete and / or destroy the target cells involved in immunological disorders or described here. An experienced person skilled in the art can easily master the in vitro, in vivo and ex vivo experiments described in the accompanying examples to check the binding and / or depleting properties of such structures.

Furthermore, said polynucleotide / nucleic acid molecule may contain, for example, thioether bonds and / or nucleotide analogs. Such modifications may be useful for stabilizing the nucleic acid molecule against endo- and exonucleases in the cell. Said nucleic acid molecules can be transcribed with a corresponding vector containing a chimeric gene that enables the transcription of said nucleic acid molecule in a cell. The polynucleotide / nucleic acid molecule of the composition of this invention may be a chimeric nucleic acid molecule obtained by recombinant technology and containing any of the aforementioned nucleic acid molecules, individually or in combination.

Said polynucleotide may be, for example, DNA, cDNA, RNA, or synthetic DNA or RNA, or a recombinant chimeric nucleic acid molecule containing any of these polynucleotides, individual or in combination. Preferably, said polynucleotide is part of a vector. Such vectors may contain additional genes, such as marker genes, enabling selection of said vector in a suitable host cell under appropriate conditions. Preferably, the polynucleotide of the invention is operably linked to expression control sequences that allow expression in prokaryotic or eukaryotic cells. Expression of said polynucleotide involves transcription of the polynucleotide into the translated mRNA. Regulatory elements that provide expression in eukaryotic cells, preferably mammalian cells, are well known in the art. Typically, they include regulatory sequences that initiate transcription and, possibly, poly-A signals that terminate transcription and stabilize the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers and / or naturally associated or heterologous promoter regions. Possible regulatory elements that allow expression in prokaryotic host cells include, for example, the PL, lac, trp or tac promoter in E. coli, and examples of regulatory elements that allow expression in eukaryotic host cells include the AOX1 or GAL1 promoter in yeast or CMV, SV40, RSV promoter (Rous sarcoma virus), CMV enhancer, SV40 enhancer or globin intron in mammalian or other animal cells. In addition to the elements responsible for initiating transcription, such regulatory elements may also include transcription termination signals, such as the SV40-poly-A site or tk-poly-A site, below the polynucleotide. In addition, depending on the expression system used, leader sequences capable of directing or secreting a polypeptide into a specific cell division or secreting it into the medium and well known in the art may be added to the coding sequence of the polynucleotide of the invention; see also the attached examples. The leader sequence (s) are assembled in the appropriate phase together with the translational, initiating and terminating sequences, and preferably a leader sequence, capable of directing the secretion of the translated protein, or part thereof, into the periplasmic space or extracellular medium. Alternatively, the heterologous sequence may encode a fusion protein comprising an N-terminal identification peptide that confers desired characteristics, for example, stabilization or simplified purification of an expressed recombinant product; see above. Suitable expression vectors in this regard are known in the art and include, for example, the Okayama-Berg cDNA expression vector, pcDV1 (Pharmacia), pCDM8, pRc / CMV, pcDNAI, pcDNAS (Invitrogene) or pSPORT1 (GIBCO BRL) vector.

Preferably, the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts can also be used. After the vector has been inserted into the appropriate host, the host is maintained under conditions suitable for a high level of expression of the nucleotide sequences, and then, if desired, the polypeptide of the invention can be collected and purified; see attached examples.

As indicated above, the polynucleotide of the invention can be used individually or as part of a vector for expression of an antibody and / or chemokine construct for use in the invention or in cells, for example, for the treatment of immunological disorders or in antiviral therapy. Polynucleotides or vectors containing a DNA sequence (s) encoding any of the polypeptides described above are introduced into cells, which in turn produce a polypeptide of interest. Therefore, said polynucleotides and vectors can be used for gene therapy. Gene therapy, which is based on the introduction of therapeutic genes into cells by ex-vivo or in-vivo technology, is one of the most important applications of gene transfer. Suitable vectors, gene delivery methods for in-vitro or in-vivo gene therapy are described in the literature and are known to those skilled in the art; see, for example, Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813, Verma, Nature 389 (1994), 239; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Onodera, Blood 91 (1998), 30-36; Verma, Gene Ther. 5 (1998), 692-699; Nabel, Ann. N.Y. Acad. Sci. 811 (1997), 289-292; Verzeletti, Hum. Gene Ther. 9 (1998), 2243-51; Wang, Nature Medicine 2 (1996), 714-716; WO 94/29469; WO 97/00957; US 5,580,859; US 5,589,466 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640, and references cited therein. Polynucleotides and vectors of the invention can be designed for direct administration into a cell or for administration through liposomes or viral vectors (e.g., adenovirus, retroviral). Preferably, said cell is a germ-line cell, an embryonic cell or an egg cell or derivatives thereof; most preferably said cell is a stem cell. An example of an embryonic stem cell is the stem cell described by Nagy, Proc. Natl. Acad. Sci. USA 90 (1993), 8424-8428.

In accordance with the foregoing, this invention relates to vectors, in particular plasmids, cosmids, viruses and bacteriophages traditionally used in genetic engineering, which include a polynucleotide encoding a polypeptide of the invention. Preferably, said vector is an expression vector and / or gene transfer vector or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated viruses, herpes virus, or bovine papilloma virus can be used to deliver polynucleotides or a vector of the invention to target cell populations. Methods well known to those skilled in the art can be used to construct recombinant vectors; see, for example, the technologies described in Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Assosiates and Wiley Interscience, N.Y. (1989). In an alternative, the polynucleotides and vectors of the invention can be reconstructed into liposomes for delivery to target cells. Vectors containing the polynucleotides of the invention can be transferred to a host cell by well-known methods that are selected depending on the type of cell host. For example, calcium chloride transfection is usually used for prokaryotic cells, and calcium phosphate treatment or electroporation can be used for other cell hosts; see Sambrook, above. After expression, the polypeptides of this invention can be purified in accordance with standard techniques, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis, and the like; see Scopes, "Protein Purification", Springer-Verlag, N.Y. (1982). For pharmaceutical use, substantially pure polypeptides with homogeneity of at least 90-95% are preferred, most preferably 98-99% or more homogeneity. After purification, partial or to the required homogeneity, the polypeptides can be used for medicinal purposes (including extracorporeal use) or for the development and implementation of analytical methods.

In a further embodiment, the invention relates to a cell comprising a polynucleotide or vector described above, or to a host transformed with a vector of the invention. Preferably, said host / cell is a eukaryotic cell, most preferably a mammalian cell, if therapeutic use of the polypeptide is provided. Of course, yeast and less preferred prokaryotic, for example, bacterial cells can also be used, in particular if the produced polypeptide is used as a diagnostic tool.

The polynucleotide or vector of the invention, which is present in the host cell, may be integrated into the genome of the host cell or may be maintained extrachromosomally.

The expression "prokaryotic" includes all bacteria that can be transformed or transfected with DNA or RNA molecules to express the polypeptide of the invention. Prokaryotic hosts may include gram-negative and gram-positive bacteria such as E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. The expression "eukaryotic" includes cells of yeast, higher plants, insects, and preferably mammals. Depending on the host used in the recombinant production, the polypeptides of this invention may be glycosylated or non-glycosylated. The polypeptides of this invention may also include parent methionine amino acid residues. A polynucleotide encoding a polypeptide of the invention can be used to transform or transfect a host using any of the technologies well known to those skilled in the art. Particularly preferred is the use of a plasmid or virus containing the coding sequence of a polypeptide of the invention and a N-terminal Flag tag and / or C-terminal His tag genetically fused to it. Preferably, said Flag tag is 4-8 amino acids in length, most preferably 8 amino acids. Methods for producing fusion of operably linked genes and expressing them, for example, in mammalian and bacterial cells, are well known (Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989). The genetic constructs and methods described therein can be used to express the polypeptide of the invention in eukaryotic or prokaryotic hosts. Typically, expression vectors containing promoter sequences that increase the transcription efficiency of the inserted polynucleotide are used in combination with the host. The expression vector usually contains a replication source, promoter and terminator, as well as specific genes capable of providing phenotypic selection of transformed cells. In addition, transgenic animals, preferably mammals, containing cells of the invention can be used for large-scale production of antibody and / or chemokine constructs of the invention. Most preferably, said transgenic animals produce an antibody construct of the invention.

Thus, in a further embodiment, the invention relates to a method for producing a polypeptide described above, comprising culturing a cell (host) of the invention under conditions suitable for expressing an antibody and / or chemokine construct, and isolating the polypeptide from the cell or culture medium.

Transformed hosts can be grown in fermenters and cultured by methods known in the art to achieve optimal cell growth. The produced constructs of the invention can then be isolated from growth media, cell lysates, or cell membrane fractions. Isolation and purification of the polypeptides of the invention, for example, produced by microbes, can be accomplished by any conventional methods, such as preparative chromatography and immunological separation, for example, using monoclonal or polyclonal antibodies, for example, to a tag or polypeptide of the invention, or by the methods described in attached examples.

Depending on the host cell, renaturation techniques may be required to obtain the corresponding conformation. If necessary, point substitutions in the DNA can be made in order to search for optimization of binding using conventional cassette mutagenesis or other protein engineering techniques, such as those described herein. The preparation of the polypeptides of the invention may also depend on knowledge of the amino acid sequence (or the corresponding DNA or RNA sequence) of bioactive proteins, such as enzymes, toxins, growth factors, cell differentiation factors, receptors, antimetabolites, hormones, or various cytokines or lymphokines. Such sequences are described in the literature and are contained in computerized data banks.

The invention also relates to an antibody construct or chemokine construct encoded by the polynucleotide described above or produced by the method described above.

In addition, the constructs of the invention can be used to treat immunological disorders, in particular autoimmune diseases, allergic diseases, inflammatory diseases and AIDS (HIV infection), as described in the accompanying examples.

In addition to this, the invention relates to compositions comprising a polynucleotide, vector, host, antibody construct and / or chemokine construct of the invention.

The expression "composition" in the context of this invention includes at least one polynucleotide, vector, host, antibody construct and / or chemokine construct described herein. The composition may also (optionally) include other molecules, individual or in combination, such as molecules capable of modulating and / or interfering with the functioning of the immune system. The composition may be solid, liquid or gaseous and may take the form of, for example, powder (s), tablets (tablets), solution (s) or aerosol (s). In a preferred embodiment, said composition comprises at least two, preferably three, more preferably four components described in the invention.

Preferably, said composition is a pharmaceutical composition also comprising (optionally) a pharmaceutically acceptable carrier, diluent and / or excipient.

Examples of suitable pharmaceutical carriers are well known in the art and include buffered saline solutions, water, emulsions such as oil-water emulsions, various types of wetting agents, sterile solutions, etc. Compositions containing such carriers can be prepared by known conventional methods. These pharmaceutical compositions may be administered to a subject in acceptable doses. The introduction of the respective compositions can be carried out in various ways, for example, intravenously, intraperitoneally, subcutaneously, intramuscularly or by local or intradermal application. Dosages will be determined by the attending physician depending on clinical factors. As is known in medicine, the dosages for each patient depend on many factors, such as the patient’s weight, body surface area, age, the particular compound used, gender, duration and method of application, general health status, as well as other drugs used simultaneously. A typical dosage for regular administration of the pharmaceutical composition should be in the range of 1 μg to 10 mg units per day. If continuous infusion is used, the dosage should also be in the range of 1 μg to 10 mg units per kg of body weight per minute, respectively. However, a more preferred dosage for continuous infusion may be in the range of 0.01 μg to 10 mg units per kg body weight per hour. The most preferred doses are listed below. Progress can be observed by periodically evaluating. Doses will vary, but the preferred dosage for intravenous use of DNA is between ~ 10 ⁶ and 10 ¹² copies of the DNA molecule. The use of the compositions of the invention may be topical or systemic. Basically, the application will be parenteral, i.e. intravenous, but external use is also provided. DNA can also be used directly at the target site, for example, by biolistic delivery to an internal or external target site or by catheter to a specific part of the artery. Preparations for parenteral use include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic esters suitable for injection, such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffering media. Parenteral carriers include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or fatty oils. Intravenous vehicles include liquid and nutritional supplements, electrolyte supplements (e.g., based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, inert gases, etc. In addition, the pharmaceutical composition of this invention may contain protein carriers, for example, serum albumin or immunoglobulin, preferably of human origin. In addition, it is understood that the pharmaceutical composition of this invention may contain additional biologically active substances, depending on the purpose of the pharmaceutical composition. Such substances can be drugs that affect the immune system, drugs used in the treatment of viral infections, in particular the treatment of HIV (e.g., HAART) and AIDS and / or anti-inflammatory drugs. For example, it is understood that patients in the earliest stages undergo HAART treatment until the viral load drops below detectable levels for a period of several weeks to several months. Early treatment of infected HAART patients prevents the passage of viral strains from using CCR5 to other chemokine receptors, such as CXCR4 (Connor (1997) J. Exp. Med. 185, 621-628). The constructs described in this invention, such as the CCR5xCD3 construct, are prescribed in addition to HAART to eliminate latently infected cells, as well as cells prone to HIV-1 reinfection. The destruction of CCR5 + cells is repeated from 1 to 10 times. Doses of CCR5xCD3 are in the range from 0.5 to 10 μg / m ² , preferably from 10 to 100 μg / m ² . Doses may be administered intravenously, subcutaneously and / or into the cerebrospinal fluid. After several cycles of bispecific antibody treatment, HAART is interrupted and the viral load is carefully monitored. If the viral load rises above a detectable level, a new cycle of treatment with HAART and a bispecific antibody is carried out as described above.

The present invention provides that the various polynucleotides and vectors of the invention are used individually or in any combination using standard delivery systems of vectors and / or genes and, optionally, together with a pharmaceutically acceptable carrier or excipient. After administration, said polynucleotides or vectors can stably integrate into the subject's genome. Preferably, said subject is a human.

Alternatively, viral vectors specific to specific cells or tissues and resistant to said cells can be used. Suitable pharmaceutical carriers and excipients are well known in the art. The pharmaceutical compositions made according to the invention can be used to prevent or treat or slow down various types of immunological diseases that may be associated with inflammation, in particular intestinal inflammatory diseases, renal inflammatory diseases, inflammatory joint diseases such as (chronic) arthritis. In addition, the pharmaceutical composition of this invention can be used to eliminate cells latently infected with a virus, preferably a primates immunodeficiency virus, more preferably HIV (-1).

In addition, it is possible to use a pharmaceutical composition according to the invention, which contains a polynucleotide or vector according to the invention, in gene therapy. Suitable gene delivery systems include, but are not limited to, liposomes, receptor-mediated delivery systems, naked DNA and viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses. The delivery of nucleic acids to specific areas of the body for gene therapy can also be accomplished using a biologic delivery system, such as that described by Williams (Proc. Natl. Acad. Sci. USA 88 (1991), 2726-2729). Other nucleic acid delivery methods include particle-mediated gene transfer, for example as described by Verma, Gene Ther. 15 (1998), 692-699.

It should be understood that the introduced polynucleotides and vectors express the gene product after being introduced into said cell, and preferably remain in this state throughout the life of said cell. For example, cell lines that stably express a polynucleotide under the control of appropriate regulatory sequences can be constructed by methods well known to those skilled in the art. Instead of using expression vectors that contain viral sources of replication, host cells can be transformed with the polynucleotide of the invention and a selectable marker in the same or in different plasmids. After the introduction of foreign DNA, the engineered cells can be left to grow for 1-2 days in an enriched medium, and then transferred to a selective medium. The selectable marker contained in the recombinant plasmid confers resistance to selection and allows the selection of cells having a plasmid stably integrated in the chromosomes and growing with the formation of foci, which, in turn, can be cloned and expanded into cell lines.

A number of selection systems can be used, including, but not limited to, the herpes simplex virus thymidine kinase (Wigler, Cell 11 (1977), 223), hypoxanthine-guanine-phosphoribosyltransferase (Szybalska, Proc. Natl. Acad. Sci. USA 48- (1962 ), 2026) and adenine phosphoribosyltransferase (Lowy, cell 22 (1980), 817) in the cells tk ^-, hgprt ^- or aprt ^- respectively. In addition, resistance to antimetabolites can be used as a basis for dhfr selection, which confers resistance to methotrexate (Wigler, Proc. Natl. Acad. Sci. USA 77 (1980), 3567; O'Hare, Proc. Natl. Acad. Sci. USA 78 (1981), 1527), gpt, which confers resistance to mycophenolic acid (Mulligan, Proc. Natl. Acad. Sci. USA 78 (1981), 2072); neo, which confers resistance to aminoglycoside G-418 (Colberre-Garapin, J. Mol. Biol. 150 (1981), 1); hygro, which confers resistance to hydromycin (Santerre, Gene 30 (1984), 147); or puromycin (pat, puromycin-N-acetyltransferase). Other breeding genes are also described, for example trpB, which allows cells to use indole instead of tryptophan; hisD, which enables cells to use histinol instead of histidine (Hartman, Proc. Natl. Acad. Sci. USA 85 (1988), 8047); ODC (ornithine decarboxylase), which confers resistance to an ornithine decarboxylase inhibitor, 2- (difluoromethyl) -DL-ornithine, DFMO (McConlogue, 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).

In a further embodiment, the invention provides a composition, preferably a pharmaceutical composition, as described above, which further comprises a medicament for treating an immunological disorder or a medicament for treating HIV infection.

Said treatment for HIV infection may be HAART. HAART therapy includes a cocktail of three classes of antiviral drugs. These classes include nucleoside reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI), and protease inhibitors (PI). Usually, 2 to 4 preparations are combined, preferably from more than one class, to reduce the viral load to almost undetectable levels. Products, dosage regimens, and common side effects are given in the attached Tables I-III.

Said treatment for an immunological disorder may include anti-inflammatory agents and immunosuppressive agents.

Anti-inflammatory drugs can be selected from the group consisting of azathioprine, cyclophosphamide, glucocorticoids, for example, prednisone and corticosteroids. Immunosuppressants may include cyclosporin A, tacrolimus (FK506), sirolimus (rapamycin). Protein preparations may include calcinurin, β-interferon, anti-TMPα-monoclonal antibodies (remicade). Dosages and use of anti-inflammatory drugs and immunosuppressants are described, among others, by Fauci et al., Sic. Additional treatment options are known to those skilled in the art and, among others, are described above.

In a most preferred embodiment, the present invention relates to a method for treating, preventing and / or alleviating an immunological disorder or eliminating cells that are latently infected with a primates immunodeficiency virus, comprising administering to a subject in need of such treatment, prophylaxis and / or relief, an effective amount of the compounds and / or compositions, preferably pharmaceutical compositions of this invention.

The constructs described herein are particularly useful for the specific destruction of chemokines of receptor-positive cells. For example, a bispecific antibody that binds simultaneously with CCR5 on target cells and CD3 on T cells redirects cytotoxic T cells to CCR5 positive target cells. As shown in the accompanying examples, the antibody construct specifically destroys CCP5 positive T cells and monocytes, but is inactive against cells not expressing CCR5, such as CCR5-deficient Δ32 / Δ32 PBMCs. In addition, in an in vitro / ex vivo experiment, the design of a bispecific antibody eliminated more than 95% of CCP5 positive monocytes and T cells from the synovial fluid of patients with arthritis. Other constructs, such as chemokine constructs, for example, the RANTES chemokine fusion protein and the truncated version of Pseudomonas exotoxin A (PE38), are able to bind to CCR5 and downmodulate the receptor from the cell surface, as shown in the accompanying examples. Within 48 hours, RANTES-PE38 completely destroyed CCR5-positive CHO cells at a concentration of 2 nM. A cytotoxic effect against CCR5 negative CHO cells was not detected.

Based on the predominance of CCR5-positive T cells and monocytes in the infiltrate of chronically inflamed tissue, the specific killing of CCR5-positive cells represents a new concept in the treatment of immunological disorders.

As indicated above, due to the fact that specific chemokine receptors are present in HIV-infected cells, namely CCR5, the compounds and compositions of the invention are particularly useful for killing / eliminating cells latently infected with primate immunodeficiency virus.

The present invention also relates to the use of a polynucleotide, vector, host, antibody construct and / or chemokine construct of the present invention for the preparation of a pharmaceutical composition for treating, preventing and / or alleviating an immunological disorder, or for the preparation of a pharmaceutical composition for eliminating latently infected cells, wherein said cells infected with primates immunodeficiency virus, such as human immunodeficiency virus, in particular HIV-1.

Said immunological disorders can be autoimmune diseases, skin diseases, allergic diseases, inflammatory diseases, diabetes, and transplant rejection, wherein said autoimmune disease is selected from the group consisting of multiple sclerosis, type I diabetes, rheumatoid arthritis. Mentioned skin diseases may include psoriatic lesions, psoriasis, atrophic dermatitis, and the like. The inflammatory diseases mentioned here are selected from the group comprising inflammatory joint diseases, renal inflammatory diseases, intestinal inflammatory diseases. In particular, said intestinal inflammatory disease may be Crohn’s disease, sarcoidosis, systemic sclerosis, collagenosis, myositis, neuritis. Renal inflammatory diseases may include nephritis, glomerulonephritis, lupus nephritis, or IgA nephropathy.

In a variety of chronic inflammatory diseases, an impressive accumulation of CCR5-positive T cells and macrophages at the site of inflammation has been found. The accumulation of CCR5 ⁺ cells has been demonstrated in several types of inflammatory diseases, such as arthritis, renal inflammatory diseases, transplant rejection, autoimmune diseases such as multiple sclerosis, and intestinal inflammatory diseases. In contrast, only a small number of T cells and monocytes express CCR5 in the peripheral blood of these patients. Thus, CCR5 seems to be an excellent marker for the identification of white blood cells involved in chronic inflammation. The presence of a 32-bp deletion in the CCR5 gene, which prevents the expression of CCR5, allows us to study the pathophysiological role of CCR5 in chronic inflammatory diseases. Among patients with rheumatoid arthritis, CCR5-deficient (Δ32 / Δ32) individuals are much less common. In addition, the average viability of renal transplants is significantly longer in CCR5-Δ32 / Δ32 patients. These results indicate that the target for therapeutic intervention should be CCR5. In addition, the predominance of CCR5-positive white blood cells in the affected tissue, as opposed to the rare expression of CCR5 in peripheral blood leukocytes, means that specific elimination of CCR5-positive white blood cells can be therapeutically useful by reducing the number of infiltrating cells in chronic inflammation, graft rejection and autoimmune diseases, such as multiple sclerosis, without significant depletion of peripheral blood leukocytes. Elimination of CCR5-positive white blood cells from inflammatory infiltrate will bring greater therapeutic benefits than simply blocking the chemokine receptors of these cells, since they have already infiltrated the tissue.

As indicated in the accompanying examples, antibody and / or chemokine constructs are particularly useful for treating, preventing and / or alleviating inflammatory joint diseases. Therefore, the compositions of this invention are particularly useful for the treatment of inflammatory joint diseases such as arthritis, in particular chronic arthritis.

In addition, this invention relates to medical methods and uses in which the composition, preferably the pharmaceutical composition, is to be used in combination with antiviral agents and / or in combination with drugs used in the treatment of AIDS.

As stated above, the main problem in the treatment of AIDS is the presence of latently HIV-infected cells. Concurrent treatment options are based on antiviral drugs that interfere with the two enzymes of the HIV virus, its protease and reverse transcriptase. Protease is indispensable for the cleavage of inactive viral preproteins to form active products, and reverse transcriptase is required for the production of intermediate DNA of the viral RNA genome. Then the intermediate DNA can integrate into the host genome and remain there in a latent - latent form. The most effective treatment option includes highly active antiretroviral therapy (HAART), a treatment regimen consisting of a combination of at least three antiretroviral drugs and usually including at least one protease inhibitor drug. The advent of highly active antiretroviral therapy (HAART) has had a significant effect on HIV-1-infected patients, reducing the circulation of the virus to undetectable levels (Oxenius (2000) Proc. Natl. Acad. Sci. 97, 3383-3387; Perelson (1997) Nature (London) ) 387, 188-191; Hammer (1997) N. Engl. J. Med. 337, 725-733; Gulick (1997) N. Engl. J. Med. 337, 734-739). Despite this, latently infected cells can remain in these patients for significant periods of time (Chun (1997) Nature (London) 387, 183-188; Chun (1998) Proc. Natl. Acad. Sci. USA 95, 8869-8873 ; Zhang (1999) N. Engl. J. Med. 340, 1605-1613); if HAART is discontinued, these cells can produce the virus (Harrigan (1999) AIDS 13, F59-F62). A pool of latently infected cells is produced only during primary HIV-1 infection (Chun (1998) Proc. Natl. Acad. Sci. USA 95, 8869-8873). Due to the alleged long half-life of viral reservoirs (Zhang (1999) N. Engl. J. Med. 340, 1605-1613, Finzi (1999) Nat. Med 5, 512-517) and side effects, as well as the high cost of chronic HAART therapy (Flexner (1998) N. Engl. J. Med. 338, 1281-1292; Carr (1998) Lancet 351, 1881-1883) it is necessary to develop new strategies for eliminating the latent reservoir. While HAART treatment has been very successful in suppressing plasma viremia in HIV-infected patients, there are still persistent reservoirs of HIV, including latently infected CD4 + T cells and other cells in the brain, in intestinal associated lymphoid tissue and genital pathways (Chun (1999) Proc. Natl. Acad. Sci. USA 96, 10958-10961). The reappearance of plasma viremia in HIV-infected patients after HAART interruption is due to these latent viral reservoirs, and HAART cannot eliminate these reservoirs (Chun (2000) Nature Med. 6, 757-761). Therefore, even HAART only inhibits viral replication and reduces viral load, but does not prevent the appearance of latently infected cells and does not eliminate such cells. HIV-1 transmission is dependent on the presence of CCR5, as individuals with a homozygous deletion of A32 CCR5 alleles are highly resistant to HIV-1 infection. Although highly active antiretroviral therapy can effectively suppress HIV-1 replication, complete eradication of HIV has not yet been achieved. The main obstacle is the inactivity of antiretroviral therapy against latently infected cells that can survive for several years and function as an endogenous source of HIV-1. Many of these cells do not express viral proteins and may evade an immune response. However, most latently infected cells can still express CCR5, as this receptor is essential for primary infection. The compounds of this invention are particularly useful for killing CCR5 ⁺ cells and should significantly reduce the number of latently infected HIV ⁺ cells. Other strategies for eliminating HIV-1-infected cells, which are based on specific recognition of viral proteins, for example expressed on the surface of gp120, will be less effective against latently infected cells, since the virus in these cells is hidden.

Therefore, the compositions of this invention are particularly useful in co-therapy methods that result in the killing of HIV-infected cells, preferably CCR5 positive cells. Preferably, the composition of this invention is used in combination with HAART. Therefore, the construct of the invention can be used in HIV therapy in combination with HAART, as shown in the accompanying examples. Products, dosage regimens, and common side effects are given in the attached Tables I, II, and III.

The combination may include co-administration as well as use before or after treatment with another antiviral, preferably antiretroviral, most preferably anti-HIV drug.

This invention also relates to a kit comprising a polynucleotide, vector, host, antibody construct and / or chemokine construct of the invention.

Preferably, the kit of this invention additionally (optionally) includes storage solution (s) and / or other reagents or materials required for research or therapeutic activities. The kit may include, inter alia, drugs used in the treatment of the immunological disorders described herein and / or used in the treatment of AIDS. In addition, parts of the kit can be packaged separately in ampoules or vials, or combined together in containers or multi-container units.

The figures show:

Figure 1.

Expression of various chemokine receptors (indicated on the x axis) on T cells (first and second panel), monocytes (third panel) and neutrophils (fourth panel) in the peripheral blood (white columns) and synovial fluid (gray columns) of patients with arthritis, different from gout. Each point represents one patient, and the average values are shown in stripes. The expression of CXCR1 and CXCR2 on neutrophils is shown as the fluorescence intensity on the y axis, and in all other cases the percentage of receptor-positive cells is shown.

Figure 2.

Scatter plots of FACS analysis showing the expression of CCR5, CCR2 and CXCR4 on white blood cells in the peripheral blood (left) and synovial fluid (right) of one patient with rheumatoid arthritis. Borders were set according to isotype controls and are shown as vertical lines. In synovial fluid, most T cells and monocytes show a high level of CCR5 expression, and in the peripheral blood only a small number of these cells express low CCR5 levels.

Figure 3.

Scheme bispecific single chain antibodies. The αCCR5 single chain fragment (CCR5 VL / CCR5 VH) obtained from the MC-1 hybridoma is fused to the N-terminus of the single chain fragment directed against CD3 (CD3 VL / CD3VH). Binding of a bispecific antibody to CD3 + T cells and CCR5 positive target cells results in crosslinking of CD3, activation of effector T cells and lysis of CCR5 positive target cells.

Figure 4.

SDS-PAGE of purified bispecific single chain antibody αCCR5-αCD3. A single band of about 60 kDa is visible under reducing (left) and non-reducing (right) conditions. No degradation or proteolysis of the bispecific antibody was detected.

Figure 5.

Chemokine-toxin RANTES-PE38 design. RANTES chemokine is fused to the M-terminus of a truncated version of exotoxin A Pseudomonas. While the truncated toxin is unable to bind to eukaryotic cells, through the RANTES component, the fusion protein binds to CCR5 and is internalized in the cell. Due to this, the toxin inhibits protein synthesis and induces cell death.

Figure 6.

SDS-PAGE (left) and Western blot (right) of purified RANTES-PE38 protein. A distinct band of the expected size of about 46 kDa is visible in SDS-PAGE and Western blotting with Coomassie staining.

Figure 7.

Binding of the bispecific antibody αCCR5-αCD3 to αCD3 on CCR5-deficient lymphocytes. Co-staining of CD4 and CD8 showed that the bispecific antibody binds to a subpopulation of CD4 + / CD8 + T cells. Multicolor analysis showed that binding to other cell populations did not occur.

Figure 8.

Binding of the bCC-specific antibody aCCR5-aCD3 to CCR5 on transfected CHO cells. CHO cells transfected with CCR5 are shown in black, and CXCR4-positive CHO cells serving as a negative control are shown in white.

Figure 9.

The binding of the bispecific antibody fCCR5-αCD3 to CCR5 on cultured monocytes. Monocytes from a CCR5-positive donor are shown in black, and monocytes from a CCR5-deficient (Δ32 / Δ32) donor, which served as a negative control experiment, are shown in white.

Figure 10.

CCR5-specific monoclonal antibodies were compared for their ability to induce downmodulation of CCR5 using FACS analysis. Mab MC-1 (squares) and parent antibody of the bispecific antibody αCCR5-αCD3 showed significant internalization, while MS-4 (triangles) did not show induction of internalization of CCR5. CHO-CCR5 cells were incubated at various concentrations for 30 minutes at 37 ° C.

Figure 11.

Downmodulation of CCR5 from the PBMC surface using RANTES-PE38 (white characters) and RANTES (black characters). Surface expression of CCR5 was determined on lymphocytes (squares) and monocytes (circles) and presented on the graph as% of medium as a control experiment. The RANTES-PE38 fusion protein is capable of downmodulating CCR5 from the cell surface with slightly lower potency than unmodified RANTES.

Figure 12.

Destruction of CCR5-positive monocytes with a bispecific antibody. CCR5-deficient PBMCs (Δ32 / Δ32) or wild-type PBMCs (WT-PBMC) were cultured overnight and incubated with a bispecific antibody (100 ng / ml) or medium as a control experiment for 20 hours. The remaining monocytes (Mo) and lymphocytes (Ly) were identified by their light scattering properties in FACS. CCR5 positive wild-type monocytes were completely destroyed by the bispecific antibody, while CCR5-deficient monocytes survived.

Figure 13.

Destruction of CCR5-positive monocytes with a bispecific antibody. Dose response showing the destruction of cultured monocytes at various concentrations of the αCCR5-αCD3 bispecific antibody. More than 90% of monocytes were destroyed at a concentration of 33 ng / ml.

Figure 14.

The αCCR5-αCD3 bispecific antibody kills lymphocytes and monocytes in the synovial fluid of a patient with chronic arthritis. Freshly picked synovial fluid was incubated with various concentrations of a bispecific antibody or medium as a control experiment for 20 hours and analyzed by FACS. More than 95% of both cell types were destroyed at a concentration of 31 ng / ml.

Figure 15.

The αCCR5-αCD3 bispecific antibody kills lymphocytes and monocytes in the synovial fluid of a patient with chronic arthritis. Freshly collected synovial fluid was incubated with a bispecific antibody (500 ng / ml) or medium as a control experiment for 20 hours and analyzed by FACS (direct and side light scattering analysis). The bispecific antibody completely eliminated CCR5 positive monocytes and lymphocytes, while CCR5 negative granulocytes (PMN) survived. According to our previous data, all monocytes and lymphocytes in this synovial fluid expressed CCR5, and no CCR5 expression was found on granulocytes (PMN).

Figure 16.

The efficacy of the bispecific single chain antibody αCCR5-αCD3 in killing CCR5 positive monocytes was compared with the efficacy of two unmodified monoclonal antibodies MC-1 and MC-5. PBMCs from two different donors (F and N) were cultured overnight and then incubated for 24 hours in the medium in the presence or absence of an antibody and monoclonal antibody construct. Concentrations are indicated on the diagram. Cells were fully recovered and analyzed by FACS counting surviving monocytes and lymphocytes. The results of two experiments for each donor of PBMC are shown. It was unexpected that only a bispecific antibody was able to significantly destroy CCR5-positive monocytes, while unmodified monoclonal antibodies were practically ineffective.

Figure 17.

An example of an analysis of direct and lateral light scattering in the representative experiment shown in Fig. 16, demonstrating that only the bispecific single chain antibody αCCR5-αCD3 is able to destroy monocytes in the lower left quarter. To compare the localization of different types of cells, see also Fig. 12, left panel.

Figure 18.

Destruction of CCR5-positive CHO cells by RANTES-PE38 chemokine-toxin construct. CCR5-positive CHO cells and CXCR4-positive CHO cells were incubated for 40 hours with a chemokine-toxin construct (10 nM) and analyzed by FACS. Dead cells are located in the upper left of the graph of direct and side light scattering. The RANTES-PE38 construct completely destroyed CCR5-positive CHO cells, while it did not have an effect on CXCR4-positive CHO cells.

Figure 19.

Examples of antibody and / or chemokine constructs that bind to a chemokine receptor (CCR) expressing cells and are constructed by peptide linkage or multimerization domains: (A) shows various examples of antibody and chemokine constructs that interact with an effector cell by binding to an effector surface antigen cells, (B) shows examples of constructs of antibodies and / or chemokines associated with a toxin, (C) shows examples of constructs of antibodies and / or chemokines that contain ca t toxin antibody binding.

Figure 20.

4 × 10 ⁵ CCR5 + CHO cells were incubated with 19.5 ng / ml scFv CCR5 × CD3 for 30 minutes at 4 ° C. After washing, cells were incubated for 45 minutes at 4 ° C with 20 μg / ml anti-His-Tag monoclonal antibody. The scFv binding of CCR5 × CD3 was determined using a monoclonal goat anti-mouse IgG F (ab ') ₂ -PE conjugated antibody and analyzed in a flow cytometer using CellQuest software. Nonlinear regression analysis was performed using GraphPad Prizm.

Figure 21.

The cytotoxic activity of scFv CCR5 × CD3 was tested by FACS analysis with CCR5 + CHO cells as target and CD3 + T lymphocytes as effector cells. CD3 + T cells were isolated from peripheral blood. In the CCR5 + CHO cells, a label of 12 μM PKH26 was introduced. Cells in a ratio of 5: 1 effector to target were incubated at various dilutions of scFv CCR5 × CD3 from 320 ng / ml to 0.3 pg / ml for 16 hours at 37 ° C and 5% CO ₂ . After staining with 1 μg / ml propidium iodide (PI), the cells were analyzed by flow cytometry. To verify the specificity of scFv CCR5 × CD3-mediated lysis, stably CXCR4 transfected CHO cells were used as negative control target cells. Analysis for cytotoxicity was performed under conditions identical to those described for CCR5 + CHO cells. Specific lysis of CCR5 + CHO cells was calculated using CellQuest software (Becton Dickinson), and non-linear regression analysis was performed using GraphPad Prizm. The sigmoidal dose response curve showed an EC50 value of 912 pg / ml. The cytotoxic effect of scFv CCR5 × CD3 when using CXCR4 + CHO cells as the target was not detected.

Figure 22.

The cytotoxic activity of scFv CCR5 × CD3 was also tested using the CD3 positive CB15 T cell line as effector cells by FACS analysis. CCR5 + CHO target cells labeled with 10 μM PKH26 were used in a ratio of 10: 1 effector to target and incubated with 100 μl scFv CCR5 × CD3 at various dilutions (from 40 μg / ml to 0.15 ng / ml) for 6 hours 37 ° C and 5% CO ₂ . Cells were stained with 1 μg / ml propidium iodide (PI) and analyzed in two parallel experiments in a flow cytometer.

Specific lysis of CCR5 + CHO cells was calculated using CellQuest software (Becton Dickinson), and non-linear regression analysis was performed using GraphPad Prizm. The sigmoidal dose response curve showed an EC50 value of 12.8 ng / ml.

Figure 23.

Reactivity MS-1 with A) human RVMS and R) RVMS rhesus. PBMC (solid line), PBMC with PE-conjugated goat anti-mouse antibody (dotted line) and PBMC with MS-1 and PE-conjugated goat anti-mouse antibody (solid solid line). The binding of MS-1 to human PBMCs (A) but not to Rhesus PBMCs (B) is indicated by the M1 marker line.

The invention will now be described with reference to the following biological examples, which are for illustration only and do not limit the scope of the invention.

Example 1: Cell lines, preparation of PBMC, synovial fluid

1.1 Production of a CHO cell line expressing the human CCR5 cDNA sequence The CCR5 was amplified from the genomic DNA of human PBMC by PCR with Pfu polymerase (Stratagene), with oligonucleotide primers

SEQ ID NO. 1: 5 ’GGA ACA AGA TGG ATT ATC AAG TGT C 3’

SEQ ID NO. 2: 5 ’CTG TGT ATG AAA ACT AAG CCA TGT G 3’

The amplified fragment was purified on a gel, ligated into the PCR-Script Amp Sk (+) script vector (Stratagene) and sequenced. After subcloning into the PEF-DHFR vector, DHFR-deficient CHO cells were transfected by electroporation and selected for stable expression in non-nucleotide MEM medium with 10% dialyzed FCS, as described below. FACS analysis showed homogeneity of CHO / CCR5 transfected cells.

1.2 Cleaning PBMC

PBMCs were isolated from the light layer of blood clots from healthy donors by Ficoll gradient centrifugation. Specially used PBMC from donors with a homozygous deletion of 32 base pairs in the CCR5 allele (Δ32 / Δ32), preventing the surface expression of CCR5. In particular, the light layers of blood clots were diluted 1: 2 in 0.9% NaCI and 35 ml were placed on top of 15 ml of Ficoll Paque and centrifuged for 25 minutes at 400 g. Transparent interphase was collected and platelets were removed by three successive washes and centrifugation steps at 100 g for 6 minutes in RPMI with FCS. Freshly isolated monocytes expressed very low CCR5, but expression was strongly induced after culturing PBMC in RPMI with 10% FCS for 24-48 hours at 37 ° C. The amount of FCS did not affect this induction. The expression of CCR5 on lymphocytes during cultivation did not change.

1.3 Synovial fluid

The synovial fluid of patients with arthritis was obtained from a diagnostic or therapeutic puncture of the joint and was used for experiments without further preparation. Consent was obtained from all patients. Synovial fluid and blood samples were obtained simultaneously from 23 patients with gonitis from a diagnostic or therapeutic puncture. Diagnoses included rheumatoid arthritis (7), reactive arthritis (3), undifferentiated gonitis (4), psoriatic arthritis (3), osteoarthritis (2), ankylosing spondylitis (1) and gout (3) according to ACR criteria, where they were are applicable. Written consent was obtained from all patients. The synovial fluid was analyzed by optical microscopy. For statistical analysis, Student t-test and paired t-test were used.

1.4 Analysis of expression of the chemokine receptor in samples of whole blood and synovial fluid

Right after puncture of the SJ (synovial fluid), white blood cells were isolated by two steps of washing with 5% PBS in 0.9% NaCI. Synovial fluid cells and whole blood (containing 1 mM EDTA) were incubated on ice with monoclonal antibodies to chemokine receptors and the corresponding isotype controls at a concentration of 10 μg / ml. The following antibodies were used: to CCR5 - MC-1 (Mack (1998), J. Exp. Med. 187, 1215-1224), to CCR2 - DOC-3, which specifically binds to CCR2 (9), to CCR1 - Clone 53504 (R & D-Systems), to CXCR1 - 5А12 (Pharmingen), to CXCR2 - 6С6 (Pharmingen) and to CXCR4 - 12G5 (Pharmingen), controls of isotype lgG1, lgG2a and lgG2b (Sigma). After two washing steps, cells were incubated for 30 minutes on ice with a F (ab) 2 fragment of a PE conjugated rabbit anti-mouse antibody (R439, DAKO). Cells were washed twice and incubated with 10% mouse serum, followed by a combination of CD4-FITC, CD8-PECy5 and CD14-APC (Immunotech). After lysis of red blood cells, cells were immediately analyzed by flow cytometry (Becton-Dockinson). Calculations were performed using CellQuest software. Helper T cells, cytotoxic T cells, monocytes and neutrophils were identified by their light scattering properties and expression or lack of CD4, CD8 and CD14. The expression of the chemokine receptor was calculated after determining the boundaries in accordance with the controls of isotypes.

In both acute and chronic joint effusions, we found an ever-increasing percentage of CD4 + and CD8 + T cells that expressed the CCR5 chemokine receptor compared to peripheral blood. These data are in good agreement with previous reports (Mack (1999) Arthritis Rheum. 42, 981-988; Qin (1998) J. Clin. Invest 101, 746-754).

Expression of the chemokine receptor on T cells in non-crystalline induced arthritis: about 88% of CD4 + T cells and 93% of CD8 + T cells from synovial fluid were positively stained for CCR5 chemokine receptor. Similarly, most of the CD4 + and CD8 + T cells in the SG expressed CCR2 (66% and 48%) (Figure 1). In contrast, only a small fraction of T cells expressed peripheral blood chemokine receptor CCR5 or CCR2. Synovial fluid was most enriched in CCR5 + helper T cells (ratio in blood / synovial fluid = 1: 4). Most T cells were positively stained for CXCR4 in both departments. CXCR1, CXCR2 and CCR1 were expressed only by an insignificant and variable part of T cells (Figure 1). A typical example of one patient is presented in FIG. 2, which shows the expression of CCR5, CCR2 and CXCR4 on white blood cells in peripheral blood and synovial fluid.

Expression of chemokine receptors on monocytes in non-crystalline-induced arthritis: according to previous data, most monocytes in the SG expressed CCR5. In addition, reduced expression of CXCR1, CXCR2, CXCR4 and CCR1 was observed on monocytes in synovial fluid compared with peripheral blood (Fig.1, 2). Not only a reduced frequency of receptor-positive cells was detected, but also a lower density of chemokine receptors on the cell surface (data not shown). No difference was found in relation to the diagnoses, the duration of the effusion from the joints, or the previous treatment. CCR2 was expressed equally by all monocytes in both departments (Fig.1, 2).

Expression of chemokine receptors on neutrophils in non-crystalline induced arthritis: acute arthritis is characterized by a rapid influx of neutrophils into the inflamed joint. Therefore, the expression of chemokine receptors on neutrophils from effusion of inflamed joints was analyzed. High expression of CXCR4 was described for the first time on a large neutrophil fraction (60%) from the synovial fluid of patients with acute and chronic arthritis, while much lower expression was found in peripheral blood (24%) (Figs. 1, 2). In arthritis other than gout, on neutrophils from synovial fluid, expression of CXCR1 and CXCR2 was reduced by about 50% compared to peripheral blood. CCR1 was expressed by only a small fraction of neutrophils in both departments.

1.5 Determination of the genotype CCR5

Genomic DNA was obtained from frozen blood samples by affinity chromatography (Roche Diagnostics). Then, a CCR5 gene fragment containing a potential deletion of 32 base pairs was amplified using 40 Taq polymerase PCR cycles. The primers were

SEQ ID NO. 3: 5 ’TTT ACCAAGA TCT CAA AAA GAA G 3’

SEQ ID NO. 4: 5 ’GGA GAA GGA CAA TGT TGT AGG 3’

Differences in the length of PCR fragments (274 or 242 bp) allowed the identification of wild-type CCR5 and CCR5-Δ32 alleles.

Example 2: Design bispecific antibodies

2.1 Production of monoclonal antibodies against human CCR5

To produce monoclonal antibodies against human CCR5, five BALB / c mice were immunized intraperitoneally (i.p.) at four-week intervals, first with 1 × 10 ⁷ PBMCs, cultured for 10 days in IL-2 (100 units / ml), and then with six consecutive injections of 1 × 10 ⁷ CHO cells expressing high levels of CCR5. To this end, CCR5 transfected CHO cells were grown in the presence of 20 nM methotrexate to amplify CCR5 expression, and one clone expressing high levels of CCR5 was selected. 4 days after the last injection of CHO / CCR5 cells, the spleen was removed and the cells were fused to the P3X63-Ag8 cell line. Supernatants from ~ 6000 hybridomas were screened by flow cytometry fusion for stable CHO / CCR5 cells and monoclonal antibodies against CCR5 (MC-1, MC-4, MC-5) were detected after the third fusion. Specificity MS-1 (logG1), MS-4, MS-5 were tested for CHO cells stably transfected with CCR1-3 and CXCR4. In all cases, no binding was detected. In addition, antibodies do not react with freshly isolated PBMCs and cultured PBMCs from a donor homozygous for A32 deletion in the CCR5 gene.

2.2 Cloning of the variable domains Mab MS-1 to CCR5

The light (VL) and heavy (VH) variable domains from the αCCR5 hybridoma MC-1 were cloned using PCR amplification (Orandi (1989) Proc. Natl. Acad. Sci. 86, 3833).

Reverse transcription (RT) was performed with random hexamer nucleotides and Super-Script reverse transcriptase (Gibco). The variable domains were amplified by PCR with Pfu polymerase, subcloned into the PCR-Script Amp Sk (+) vector (Stratagene) and sequenced.

The following primers were used for PCR amplification of VL (1):

SEQ ID NO. 5: 5 ’GACATTCAGC TGACCCAGTC TCCA 3’

SEQ ID NO. 6: 5 ’GTTTTATTTC CAGCTTGGTC CC 3’

The following primers were used for PCR amplification of VH (1):

SEQ ID NO. 7: 5 ’ACCATGGGAT GGAGCTGTGT CATGCTCTT

SEQ ID NO. 8: 5 ’TGAGGAGACG GTGACCGTGG TCCCTTGGCC CCAG

The nucleotide sequence of VL (1) obtained by RT PCR - SEQ ID NO. 9:

2.3 Design and expression of bispecific single chain antibody CCR5 × CD3

A schematic representation of the structure and mechanism of action of the bispecific single chain antibody CCR5 × CD3 is shown in FIG. 3. As described above, the light and heavy variable domains were joined into a single chain fragment using the (Gly ₄ Ser ₁ ) ₃ linker and expressed in the periplasmic space of E. coli to check the binding of the recombinant protein to CCR5.

Then, the DNA sequence of the single-chain fragment αCCR5 was subcloned using BsrG1 and BspE1 into a eukaryotic expression vector (pEF-DHFR), which already contained a single-chain fragment directed against CD3, with a tail of 6 histidine residues attached at the C-terminus (Mack (1995) Proc. Natl. Acad. Sci. 92, 7021). Single chain fragments of αCR5 and αCD3 were linked by a linker encoding Gly4Seri (see Figure 3).

The following domain order was selected: VL (1) -VH (1) -VH (2) -VL (2), where (1) means specificity for CCR5, and (2) means specificity for CD3. The bispecific CCR5xCD3 antibody has the following nucleotide sequence, SEQ ID NO. 17:

A bispecific CCR5 × CD3 antibody has the following protein sequence, SEQ ID NO. 18:

The bispecific antibody was expressed in DHFR-deficient CHO cells and purified from culture supernatant by affinity chromatography on immobilized Ni ^{2+ ions} (Hochuli (1988) Biotechnology 6. 1321-1325; Ni-NTA, Qlagen).

Thus, for the construction of bispecific antibodies, for example, single chain technology can be used (Mack et al. (1995) Proc. Natl. Acad. Sci. USA, 92: 7021-7025; Mack et al. (1997) J. Immunol. 158: 3965-3970). In this case, as shown schematically in FIG. 3 (top), the variable domains of the light (VL) and heavy (VH) immunoglobulin chains of two different antibodies are fused in a specific order and, possibly, a 6 × His histidine chain is added. The fusion is performed on the basis of DNA, so that after expression a protein chain is formed with four different domains (compare Figures 3 (top)). The attached histidine chain enables simple and efficient purification by immobilized Ni ions in one step. Fig. 3 (above) shows a preferred embodiment of a bispecific antibody that binds to the CD3 antigen on the surface of the effector cell and human CCR5 on the surface of leukocytes as target cells.

Then, a single chain antibody with a specific specificity is generated by fusion-PCR by insertion of the linker from (Gly ₄ Ser ₁ ) ₃ between the two variable domains of the antibody. In a subsequent PCR fusion, the anti-CCR5 antibody fragment is fused to the already known (published) anti-CD3 fragment with insertion of a linker consisting of Gly ₄ Ser ₁ (cf. Mack et al., Supra).

To express a bispecific antibody, the corresponding DNA sequence is subcloned into a eukaryotic expression vector (e.g., PEF-DHFR, Mack et al. (1995) PNAS, supra) and transfected into DHFR-deficient CHO cells by electroporation. The bispecific antibody is purified from the supernatant of stably transfected CHO cells by affinity chromatography on Ni-NTA, where elution is performed by lowering the pH. Then adjust the pH and bring the protein to the desired concentration. The total yield after purification was about 900 μg / L of culture supernatant. SDS-PAGE showed a single band of about 60 kDa in reducing and non-reducing conditions and the absence of detectable proteolysis or protein degradation (Figure 4).

Example 3: Expression and Purification of a Chemokine-Toxin Fusion Protein

A schematic representation of the structure and mechanism of action of the RANTES-PE38 fusion chemokine toxin protein is shown in FIG. 5. The RANTES PCR fragment generated with primers P1 and P2 was subcloned using StuI and Sall into a vector for periplasmic expression in E. coli (Mack (1995) Proc. Natl. Acad. Sci. 92, 7021). The StuI restriction site was previously introduced at the 3’-end of the OrmA signal sequence. DNA of a truncated version of Pseudomonas exotoxin A (PE38; Theuer (1993) Cancer Res. 53, 340) was amplified by PCR with Pfu polymerase using P3 and P4 primers and subcloned using BspE1 and Hind III into a vector that already contained “DNA” RANTES. Primer P4 also added a tail of 6 histidine residues at the 3 ′ end of PE38. During periplasmic expression, the OpmA signal sequence was cleaved, so that the recombinant protein began with the first amino acid RANTES. A tail of 6 histidine residues attached at the C-terminus made it possible to purify by Ni-NTA affinity chromatography (Qiagen).

Primer List:

SEQ ID NO. 19: 5 ’AAAGGCCTCCCCATATTCCTCGGA

SEQ ID NO. 20: 5 ’AAAGTCGACTCCGGACATCTCCAAAGAGTTGATGTAC

SEQ ID NO. 21: 5 ’AATCCGGAGGCGGCAGCCTGGCCGC

SEQ ID NO. 22: 5 ’GGGAAGCTTAGTGATGGTGATGGTGATGCTTCAGGTCCTCGCGCGG

As described above, the RANTES DNA sequence was fused to the sequence of a truncated version of Pseudomonas exotoxin A (PE38) (Theuer (1993) Cancer Res. 53, 340). In the first version of the structure, a Gly-Ser linker was placed between RANTES and PE38. However, this led to significant proteolytic degradation of the fusion protein during expression in E. coli (data not shown). In an attempt to stabilize the construct, the linker and the first three amino acids of PE38 were removed. The new fusion protein did not show proteolysis during expression in E. coli, as demonstrated by SDS-PAGE (Figure 6, left panel) and Western blotting (Figure 6, right panel). Corresponding constructs are shown in SEQ ID NOs. 22 and 24, respectively.

Example 4: Binding of a bispecific antibody to target antigens CCR5 and CD3

The binding of the bispecific single chain antibody to CHO cells or PBMCs was determined by FACS analysis (Figs. 7-9). Cells were incubated with a bispecific antibody for 60 minutes on ice, and then with a 6 × His antibody (Dianova, Hamburg, Germany) and a F (ab) 2 fragment of a PE conjugated rabbit anti-mouse antibody (R439, DAKO, Hamburg, Germany). Since the bispecific antibody also binds to CCR5, we performed an analysis with PBMCs that do not express CCR5 due to a homozygous deletion of 32 base pairs in the CCP5 alleles. The antibody showed good binding to a subpopulation of lymphocytes. Co-staining with anti-CD4 and CD8 antibodies identified this subpopulation as CD4 and CO6 positive T lymphocytes (Figure 7). In addition, the bispecific antibody bound to T cells complete with the OCT-3 monoclonal anti-CD3 antibody (data not shown).

Binding of the bispecific anti-CCR5 antibody was demonstrated on CHO cells overexpressing CCR5 and human monocytes (Figs. 8 and 9). The antibody showed excellent binding to CCR5 transfected CHO cells (FIG. 8) and cultured monocytes (FIG. 9), while binding to CHO cells transfected with CXCR4 or cultured monocytes from a donor with a CCR5-Δ32 homozygous deletion / Δ32 was not detected. Culturing monocytes overnight induced CCR5 expression on wild-type monocytes, while monocytes from donors with a homozygous CCR5-Δ32 / Δ32 deletion did not express CCR5. In addition, we showed that the CCR5 signal detected by a bispecific antibody on cultured monocytes can be reduced to less than 15% by preincubation of monocytes for 30 minutes at 37 ° C with AOP-RANTES (data not shown), which, as It is known to effectively induce the internalization of CCR5 and reduce the binding of CCR5 antibodies (25).

Example 5: Downmodulation of chemokine receptors

5.1 Downmodulation of CCR5 with MS-1 Monoclonal Antibody to CCR5

The effect of MC-1 alone on the surface expression of human CCR5 was measured. For comparison, another monoclonal anti-CCR5 antibody MS-4 was used. CHO-CCR5 cells were incubated with various concentrations of antibodies MS-1 and MS-4 for 30 minutes at 37 ° C. Cells were placed on ice and stained with MS-1 and MS-4, respectively, at a concentration of 15 μg / L for one hour on ice, followed by detection with a secondary antibody (rabbit anti-mouse-PTS, F313 from DAKO). The analysis was performed on FACSCalibur. Incubation with MS-1 at 37 ° C for 30 minutes led to downmodulation of human CCR5 by 40% at a concentration of 10 μg / ml (Figure 10).

5.2 Downmodulation of CCR5 with the chemokine-toxin construct

The fusion of RANTES with an N-terminus with a truncated version of Pseudomonas exotoxin A was supposed to result in specific binding of the construct to cells expressing RANTES receptors such as CCR5, CCR1 and CCR3. The internalization of chemokine receptors after binding of the modified toxin should enhance cell uptake and cytotoxic activity of the construct (Figure 5, bottom panel). Therefore, we analyzed the ability of RANTES-PE38 to internalize CCR5 from the surface of primary monocytes and T cells (Figure 11, white characters). Internalization of CCR5 would mean that the construct is capable of binding to CCR5, and that RANTES remains functionally active after fusion with PE38. As shown in FIG. 11, the construct is capable of internalizing CCR5 from the surface of monocytes and lymphocytes. Unmodified RANTES served as a positive control experiment and was slightly more effective than RANTES-PE38 (Figure 11, black characters).

PBMCs were incubated for 30 minutes at 37 ° C with various concentrations of RANTES or RANTES-PE38 diluted in RPMI with 10% FCS in a volume of 100 μl. The medium was used as a control experiment. Cells were stained on ice to determine the surface expression of CCR5 using MS-1 monoclonal antibody or medium as a negative control, followed by the administration of a PE-conjugated anti-mouse R439 antibody. FACS analysis was performed on FACSCalibur (Becton-Dickinson) and using CellQuest software. Lymphocytes and monocytes were determined by their direct and lateral light scattering and expression of CD14, CD4 and CD8. The relative surface expression of CCR5 was calculated as [mean channel (experiment) fluorescence — average channel fluorescence (negative control)] / [channel (medium) fluorescence — average channel fluorescence (negative control)].

Example 6: Destruction of Cells with CCR5 × CD3 and RANTES-PE38 Antibody

6.1 CCR5-specific killing of monocytes in cultured PBMCs

PBMCs from donors with wild-type CCR5 (WT) or CCR5-deficient (Δ32 / Δ32) donors were incubated overnight to induce CCR5 expression on monocytes. Cultured PBMCs were incubated with various concentrations of purified bispecific αCCR5-αCD3 antibodies or medium as a control experiment for 20 hours. Surviving cells were analyzed on FACSCalibur and counted.

To test the ability of the bispecific single chain antibody αCCR5-αCD3 to kill CCR5-positive primary cells, we incubated human PBMCs with the antibody (Figure 12). Before incubation, PBMCs were cultured overnight to upregulate the expression of CCR5 on monocytes. By redirecting cytotoxic T cells, the bispecific antibody destroys most monocytes within 20 hours depending on the concentration (Fig. 13) with the almost complete elimination of CCR5-positive cells at a concentration of 10 ng / ml. To make sure that the destruction of monocytes is due to the induced expression of CCR5 on them, the same experiment was performed with PBMC from a donor with a homozygous 32 bp deletion in the CCR5 allele, which prevents the surface expression of CCR5. After 20 hours of killing, CCR5-deficient monocytes were not detected, which indicates that the killing of cells with a bispecific antibody is limited to monocytes that express CCR5 (Fig. 12), compare the lower right panel with the upper right panel; left panels show negative control experiments. Monocytes (Mo) and lymphocytes (Ly) were identified by their direct and lateral light scattering. Monocytes are visible in the lower left quarter, see arrows.

6.2 Destruction of monocytes and T-lymphocytes from synovial fluid of patients with arthritis

Freshly collected synovial fluid of patients with arthritis was incubated with various concentrations of purified bispecific antibodies αCCR5-αCD3 or medium as a control experiment for 20 hours. Surviving cells were analyzed on FACSCalibur and counted.

A bispecific single chain antibody can potentially be used to kill CCR5-positive T cells and monocytes from the inflamed joints of patients with arthritis. Therefore, the destruction of CCR5-positive cells in the synovial fluid of patients with various types of arthritis was determined. It has been shown previously that most T cells and monocytes in the synovial fluid of inflamed joints express CCR5 (Mack (1999) loc. Cit.). In synovial samples obtained prior to killing experiments, FACS analysis confirmed that most lymphocytes and monocytes express CCR5, while no CCR5 expression was detected on granulocytes (data not shown). For extermination experiments, synovial fluid was incubated ex vivo with various concentrations of a bispecific antibody for 20 hours (Figure 14). The synovial fluid was incubated immediately after the puncture without any preparation, so that the in vitro conditions were as similar as possible to the in vivo conditions when the antibody was present inside the inflamed joints. As shown in FIG. 14, the bispecific antibody induced the destruction of most of the lymphocytes and monocytes in the synovial fluid, while granulocytes that do not express CCR5 remained unaffected. Exemplary FACS analysis of the destruction of monocytes and lymphocytes in synovial fluid at a concentration of 0.5 μg / ml αCCR5-αCD3 is shown in Fig. 15. Only CCR5 negative neutrophils (PMN, polymorphonuclear cells) are not affected by the bispecific antibody.

Antibodies were incubated with synovial fluid for one to several days. After 24 hours, CCR5-positive lymphocytes and monocytes almost disappeared. When the medium was checked after a longer incubation, monocytes differentiated into macrophages visible at the bottom of the culture flask. After appropriate incubation with the bispecific antibody, macrophages were no longer visible.

A corresponding result can be obtained by incubating cultured PBMCs with a bispecific antibody, as described above. In this case, almost complete destruction of CCR5-positive monocytes and almost complete destruction of CCR5-positive T-lymphocytes are observed. Destruction of CCR5-positive T cells and monocytes is shown graphically.

These results indicate that the construct of this invention is capable of destroying CCR5 positive monocytes. This applies to both monocytes from articular fluid and blood monocytes that express CCR5 upon differentiation into macrophages. The destruction of monocytes / macrophages occurs within a few hours (<24 hours). In particular, the destruction of monocytes / macrophages in the joints has a great advantage in therapy, since it is these cells that are mainly responsible for the destruction of the joints. Moreover, the activation of T-lymphocytes also requires interaction with macrophages, so that the function of T-lymphocytes is simultaneously suppressed.

In addition to killing monocytes / macrophages, a significant decrease in the number of CCR5-positive T lymphocytes is observed.

6.3 Comparison of the efficacy of the bispecific antibody α * CCR5-αCD3 and monoclonal antibodies

The effectiveness of the bispecific single chain antibody αCCR5-αCD3 in killing CCR5 positive monocytes was compared with the efficiency of two unmodified monoclonal antibodies. PBMCs from two different donors (F and N) were cultured overnight and then incubated for 24 hours with medium, with a bispecific single chain antibody (125 ng / ml), MS-1 (5 μg / ml) and MS-5 (5 μg / ml). The MS-1 monoclonal antibody, the parent antibody for the bispecific single chain antibody, has the mouse IgG1 isotype, and the MS-5 antibody has the IgG-2a isotype. Cells were fully recovered and analyzed by FACS counting surviving monocytes and lymphocytes.

Fig. 16 shows the unexpected fact that only a bispecific antibody was able to significantly kill CCR5-positive monocytes, while unmodified monoclonal antibodies were practically ineffective even at a concentration 40 times higher compared to the αCCR5-αCD3 bispecific antibody. FACS analysis using direct and lateral light scattering properties of lymphocytes and monocytes shows that only the bispecific antibody αCCR5-αCD3, but not monoclonal antibodies, can destroy cultured monocytes (Fig. 17; compare the upper right panel with the lower panels).

6.4 Killing cells expressing a chemokine receptor, RANTES-PE38 construct

CHO cells expressing CCR5 or CXCR4 were grown before sub-fusion in a 24-well culture plate and incubated with various concentrations of purified RANTES-PE38 or medium as a control experiment. After 40 hours, adherent and nonadherent cells were removed and analyzed by FACS to measure the percentage of dead cells. It was previously found that dead (propidium iodide-positive) CHO cells can be identified by their light-scattering properties.

Next, the cytotoxic activity of RANTES-PE38 was analyzed. To this end, we incubated CHO cells expressing human CCR5, murine CCR5 and human CXCR4 with different concentrations of chemokine toxin or medium. Surviving (attached) human or mouse CCR5-positive CHO cells were not detected by an optical microscope after 40 hours of incubation with just 10 nm RANTES-PE38. In contrast, regular growth and survival were observed upon incubation of CCR5 positive cells with the medium or upon incubation of CXCR4 positive CHO cells with equal concentrations of chemokine toxin (data not shown). To quantify dead cells, adherent and nonadherent cells were analyzed by FACS. It was previously found that living and dead CHO cells can be identified by their light-scattering properties; the position of dead and living cells is shown by arrows (Fig. 18). As shown in FIG. 18, the cytotoxic effect of RANTES-PE38 on CHO cells expressing CXCR4 was not detected, while CHO cells expressing human CCR5 were completely killed by a concentration of 10 nM RANTES-PE38.

These experiments show that RANTES-PE38 is able to internalize CCR5 from the cell surface and induce the destruction of cells expressing RANTES hCCR5 or mCCR5 receptors. The inactivity of the construct against CXCR4-positive CHO cells indicates that the cytotoxic activity of the construct is limited to cells that express specific chemokine receptors.

Example 7: Analysis of viral infection on stably transfected cells

GHOST 34 CCR5 cells were derived from HOS / CD4 cells stably expressing CCR5 and provided by Dan Littman (Skirball Institute, New York). 2.5 × 10 ⁴ cells in 48-well plates were exposed to 100 μl of chemokine with appropriate dilution for 30 minutes at 37 ° C. Added 100 μl of NSI, CCR5-dependent strain of HIV-1, SF 162 at a concentration of 1000 focus-forming units / ml (FFU / ml) and the cells were incubated for another 3 hours. The cells were then washed and incubated in medium containing the appropriate chemokine for 4 days before fixation, in situ staining for p24 production and evaluation of the foci of infection as described above.

Example 8: Concentration-dependent binding of CCR5 × CD3 to CCR5-expressing CHO cells.

Chinese hamster ovary cells stably transfected with CCR5 (CCR5 ⁺ CHO) were used as target cells for bispecific scFv binding CCR5 × CD3 binding studies (as described in Example 2 and shown in FIG. 3). These cells were negative for CD3 and in more than 95% of cases positive for CCR5, which was shown by the assay for binding to the parent antibody MC-1 (as described in Example 5 and shown in FIG. 10). Binding was evaluated by flow cytometry based on a binding assay. 4 × 10 ⁵ CCR5 ⁺ CHO cells were resuspended in 50 μl FACS buffer (PBS with 1% heat-inactivated fetal calf serum (FCS) and 0.05% Na ₃ N) containing scFv CCR5 × CD3 at different dilutions from 20 μg / ml to 19.5 ng / ml. Cells were incubated in a 96-well microtiter plate for 30 minutes at 4 ° C. Cells were washed twice with FACS buffer and incubated for 45 minutes at 4 ° C with 20 μg / ml anti-His-Tag monoclonal antibody (Dianova). Specifically bound scFv CCR5 × CD3 was detected using goat anti-mouse IgG F (ab ') ₂ -PE conjugated antibody (Dianova). After washing, cells were analyzed in a FACSCalibur flow cytometer (Becton-Dickinson) using CellQuest software (Becton-Dickinson) to calculate the fluorescence intensity medians for samples with different concentrations. Nonlinear regression analysis was performed using GraphPad Prizm (Version 3.02). The concentration-dependent binding of scFv CCR5 × CD3 to CCR5-expressing CHO cells was recorded with a K _D value of 0.86 μg / ml (Figure 20).

Example 9: Cytotoxic activity of CCR5 × CD3 with primary T lymphocytes as effector cells

The ability of scFv CCR5 × CD3 (described in Example 2 and shown in FIG. 3) to mediate cytotoxicity to CCR5 positive cells was studied using stably transfected CCRS ⁺ CHO as target cells and CD3 positive T lymphocytes obtained from peripheral blood in as effector cells. Cytotoxicity was determined using an analysis based on FACS.

CD3 positive T cells (including CD4 + and CD8 + cells) were isolated from peripheral blood by negative selection using a human T cell enrichment column (R&D Systems). For this purpose, PBMCs were prepared by standard Ficoll-Hypaque gradient separation and added to the column. B cells and monocytes bound to the column matrix, and T cells eluted. Enriched T cells were washed with medium and used as effector cells.

To distinguish between target cells and effector cells in flow cytometry, CCR5 + CHO cells were labeled with PKH26 aliphatic membrane dye (Sigma) at a final concentration of 12 μM. 0.5 × 10 ⁵ labeled CCR5 + CHO cells and 2.5 × 10 ⁵ CD3 + T cells were seeded in a 96-well microtiter plate at a 5: 1 ratio of effector and target cells. A 100 μl portion of scFv CCR5 × CD3 with various dilutions from 320 ng / ml to 0.3 pg / ml was incubated with cells for 16 hours at 37 ° C in a humid atmosphere at 5% CO ₂ . Cells were then centrifuged for 3 minutes at 600 g and cell beads were resuspended in 200 μl FACS buffer (PBS, 1% FCS and 0.05% Na ₃ N). After staining with 1 μg / ml propidium iodide (PI), the cells were analyzed in pairwise experiments using a flow cytometer (FACSCalibur, Becton-Dickinson).

To confirm the specificity of scFv CCR5 × CD3-mediated lysis, stably CXCR4 transfected CHO cells were used as negative control target cells. Analysis for cytotoxicity was performed under conditions identical to those described for CCR5 + CHO cells.

Specific lysis of CCR5 + CHO cells was calculated using CellQuest software (Becton-Dickinson), and non-linear regression analysis was performed using GraphPad Prizm. The sigmoidal dose response curve (FIG. 21) showed an EC50 value of 912 pg / ml. The cytotoxic effect of scFv CCR5 × CD3 when using CXCR4 + CHO cells as the target was not detected.

Example 10: Cytotoxic activity of CCR5 × CD3 with CB15 T cell clone as effector cells

The cytotoxic activity of scFv CCR5 × CD3 (described in Example 2 and shown in FIG. 3) against CCR5 positive cells was also examined using a CO3 positive CB15 cell line (CD4 +) as effector cells. To determine cytotoxicity, FACS analysis was performed with CCR5 transfected CHO cells (CCR5 + CHO) as target cells.

Labeled cells with CCR5 + CHO with an aliphatic membrane dye PKH26 (Sigma) at a final concentration of 10 μM. Effector and target cells were incubated in a microtiter plate at a ratio of 10: 1 with 100 μl scFv CCR5 × CD3 at various dilutions from 40 μg / ml to 0.15 ng / ml for 6 hours at 37 ° C in a humid atmosphere at 5% CO ₂ . The cells were then centrifuged for 3 minutes at 600 g, and the cell beads were resuspended in 200 μl FACS buffer (PBS, 1% FCS and 0.05% Na ₃ N). After staining with 1 μg / ml propidium iodide (PI), the cells were analyzed in pairwise experiments using a flow cytometer (FACSCalibur, Becton-Dickinson).

Specific lysis of CCR5 + CHO cells was calculated using CellQuest software (Becton-Dickinson), and non-linear regression analysis was performed using GraphPad Prizm. The sigmoidal dose response curve (FIG. 22) showed an EC50 value of 12.8 ng / ml.

The results obtained using the CB15 T cell clone as effector cells in the bioactivity analysis showed that the specific lysis mediated by scFv CCR5 × CD3 is not limited to the cytotoxic activity of CD8 + CTL, since CD4 + T cells are also involved in this process.

Example 11: Mapping of the epitope of the parent CCR5-specific monoclonal antibody MS-1. used for the construction of scFv CCR5 × CD3

The epitope of the parent CCR5-specific monoclonal antibody MS-1 used to construct scFv CCR5 × CD3 (described in Example 2 and shown in FIG. 3) was mapped by flow cytometry using a panel of -70 CHO-K1 cell lines stably expressing chimeric and point mutant receptors (Samson, J. Biol. Chem., 1997, 272, 24934-24941; Lee, J. Biol. Chem., 1999, 274, 9617-9626; Blanpain, Blood, 2000, 96, 1638-1645 ) Cells were incubated for 30 minutes on ice with mab MC-1, washed and stained with a PE-conjugated anti-mouse Ig antibody (Sigma). CHO-K1 cells expressing CCR2b were used as a negative control. As it turned out, MS-1 recognizes the first part of the second extracellular loop (ECL2) of the CCR5 molecule (data not shown). ECL2 occupies the range aa 168-199 (RSQ KEGLHYTCSS HFPYSQYQFW KNFQTLKIV) and is located between transmembrane regions 4 and 5 of CCR5, as described by Chen, J. Virol., 1997, 71, 2705-2714.

The amino acid sequences of human CCR5 and rhesus macaque differ in eight amino acids, with two amino acid changes in ECL2 at positions aa 171 (K → R) and aa 198 (I → M) (Chen, J. Virol., 1997, 71, 2705 -2714). In connection with these amino acid changes, the potential cross-reactivity of MC-1 with ECL2 CCR5 rhesus macaque was studied using human PBMCs and rhesus in the FACS analysis. PBMCs of both species were isolated by standard Ficoll gradient centrifugation. 5 × 10 ⁵ cells were suspended in 50 μl of FACS buffer and 50 μg / ml MS-1 was added. After 30 minutes of incubation at 4 ° C, the cells were washed and stained with goat anti-mouse IgG F (ab ') ₂ -PE conjugated monoclonal antibody (Dianova) for 30 minutes at 4 ° C in the dark. Cells were washed and examined in a flow cytometer (FACSCalibur Becton-Dickinson).

As shown in FIG. 23, MC-1 binds exclusively to human CCR5 and does not react with CCR5 from rhesus monkey. These data indicate that the epitope recognized by MC-1 is specific for human CCR5 and that lysine at position 171 and isoleucine at position 198 in the human CCR5 sequence are necessary for this specificity. The main part in the specific recognition of the human CCR5 epitope by the monoclonal antibody MC-1 is played by lysine at position aa 171, located in the first part of ECL2.

Example 12: scFv CCR5 × CD3-mediated reduction in virus production in HIV-1 infected monocytes

PBMCs were prepared from fresh, light layers of a healthy donor blood clot by standard Ficoll gradient centrifugation and monocytes were isolated by coupling to culture flasks overnight. The remaining PBLs were separated and cultured separately at 37 ° C in a humid atmosphere at 5% CO ₂ .

Monocytes were seeded in a 48-well microtiter plate with a density of 5 × 10 ⁴ cells / well and infected with the M-tropic strain HIV-1 Bal (moi = 1) overnight at 37 ° C in a humid atmosphere at 5% CO ₂ . The virus was removed by washing, and monocytes continued to be cultured with unstimulated PBL (15 × 10 ⁴ per well) + scFv CCR5 × CD3 (1 μg / ml) + AZT (75 μM) or only with unstimulated PBL (15 × 10 ⁴ per well) as a negative control experience. 5 days after infection (pi), the monocytes were washed and cultured in the absence of AZT or antibody. Supernatant was collected on day 15 pi and HIV-1 replication was evaluated by measuring p24 by ELISA. This experimental approach showed a 75% reduction in viral replication in samples containing scFv CCR5 × CD3 (75 ng / ml p24) compared to controls without scFv CCR5 × CD3 (300 ng / ml p24).

Table I
Nucleoside reverse transcriptase inhibitors (nucleoside analogues, NRTI) Substance Tradename Dosage Common side effects and general notes Zidovudine (AZT) Retrovir 300 mg, 2 p. in a day Primary gastrointestinal (GI) side effects, anemia, neutropenia, myopathy Lamivudine (ZTS) Epivir 150 mg, 2 p. in a day It is generally well tolerated. Effective against hepatitis Zidovudine, Lamiduvine (AZT + ZTS) Combivir 1 tablet 2 p. in a day Combination tablet containing 300 mg of AZT and 150 mg of ZTS Didanosine (ddl) Videx 200 mg, 2 p. in a day
or
400 mg, 1 p. in a day
on an empty stomach (weighing> 60 kg) 15% peripheral nephropathy, pancreatitis; Avoid drinking alcohol.
Contains alcohol; can be used simultaneously with all NRTIs, Adefovir, Nevirapine and Efavirence; Delavirdine and
Indinavir should be taken at least 1 hour before ddl; Nelfinavir should be taken 1 hour after ddl. Zaicitabine (ddC) Hivid 0.375-0.75 mg, 3 p. in a day 17-31% peripheral nephropathy in various stages; aphthous ulceration Stavudine (d4T) Zerit 20-40 mg, 2 p. in a day Peripheral nephropathy (1-4% in the early stages; 24% in patients with "extensive introduction" with CD4> 50) Abacavir (ABA) Ziagen 300 mg, 2 p. in a day About 3% of the reaction in the form of hypersensitivity: fever, malaise, a short-term rash, gastrointestinal side effects are possible.

Table II
Protease inhibitors Substance Tradename Dosage Common side effects and general notes Saquinavir (Hard Gelatin Capsule, SQV-H) Invirase 600 mg, 3 p. per day, taken with fatty foods Well tolerated. Limited efficacy due to poor resorption. Saquinavir (soft gelatin capsule, SQV-S) Fortovase 1200 mg, 3 p. per day, take with fatty foods (> 28 g fat) Improved resorption compared to Invirase. Ritonavir (RTV) Norvir 600 mg, (6 caps. / 7.5 ml) 2 p. in a day. Start with 300 mg, 2 p. per day, then increase over 10 days to 600 mg, 2 p. in a day; Nausea and numbness of the lips for up to 5 weeks. Occasionally hepatitis. Intolerable for ~ 50% of patients. Indinavir (IDV) Crixivan 800 mg every 8 hours on an empty stomach or with a light meal (<2 g of fat) Neural calculus with 6-8%; requires a large absorption of fluid. Occasionally, nausea and gastrointestinal side effects. Nelfinavir (NFV) Viracept 750 mg, 3 p. per day, or 1250 mg, 2 p. per day with meals Often diarrhea, occasionally nausea.

Table III
Non-nucleoside reverse transcriptase inhibitors (NNRTI) Substance Tradename Dosage Common side effects and general notes Nevirapine (NVP) Viramune 200 mg, 1 p. in a day Transient skin, hepatitis, induces liver enzymes P450 3A4 Delavirdine (DLV) Rescriptor 400 mg, 3 p. in a day Transient skin, suppresses P450 ZA4 Efavirence (EFV) Sustainiva 600 mg, 1 p. in a day
in the evening Initially - dizziness, insomnia, short-term transient skin; induces P450 3A4; avoid concomitant use of Claritithromycin.

Table IV
Chemokine receptors and chemokine ligands Chemokine Chemokine ligands Cxcr3 I-TAC (CXCL11), IP-10 (CXCL-10), Mig (CXCL9) Cxcr4 SDF-1 (CXCL12) Cxcr5 BCA1 (CXCL13) CCR1 MIP1α (CCL3), RANTES (CCL5), MCP-3 (CCL7), MCP-4 (CCL13), HCC1 (CCL14), LKN1 (CCL15) CCR2 MIP1α (CCL3), RANTES (CCL5), MCP-1 (CCL2), MCP-2 (CCL8), MCP-3 (CCL7), MCP-4 (CCL13) CCR3 RANTES (CCL5), MCP-2 (CCL8), MCP-3 (CCL7), MCP-4 (CCL13), eotaxin (CCL11), LKN1 (CCL15), MPIF-2 (CCL24), eotaxin-3 (CCL26) CCR4 TARC (CCL17), MDC (CCL22) CCR5 MIP1α (CCL3), MIP1β (CCL4), RANTES (CCL5), MCP-2 (CCL8), MCP-3 (CCL7), MCP-4 (CCL13), eotaxin (CCL11) CCR6 LARC (CCL20) CCR7 ELC (CCL19), SLC (CCL21) CCR8 I-309 (CCL1), MIP1β (CCL4), TARC (CCL17) CCR9 TESK (CCL25) XCR1 XCL1, XCL2 CCR10 CCL27, CCL28 (Wang (2000) J. Bioi. Chem. 275. 22313-22323) CX3CR1: fractalkin (CXC3CL1)

Claims (77)

1 A pharmaceutical composition for eliminating cells that are latently infected with a primates immunodeficiency virus, comprising an active ingredient and a pharmaceutically acceptable carrier, diluent or solvent, characterized in that it contains an antibody or chemokine construct that binds to a chemokine receptor as an active ingredient. 2. The pharmaceutical composition according to claim 1, characterized in that said primate immunodeficiency virus is a human immunodeficiency virus. 3. The pharmaceutical composition according to claim 2, characterized in that the said human immunodeficiency virus is HIV-1. 4. A pharmaceutical composition for treating, preventing or alleviating inflammatory kidney diseases, allergic reactions, inflammatory bowel diseases, multiple sclerosis, skin diseases, diabetes or transplant rejection, containing the active ingredient and a pharmaceutically acceptable carrier, diluent or solvent, characterized in that as of the active ingredient, it contains an antibody or chemokine construct that binds to the chemokine receptor. 5. The pharmaceutical composition according to any one of claims 1 to 4, characterized in that said chemokine receptor is chemokine receptor 5 (CCR5). 6. The pharmaceutical composition according to claim 5, characterized in that the said chemokine receptor 5 is a human CCR5. 7. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said antibody construction is a bispecific antibody that binds to a chemokine receptor as a first antigen and to a CD3 antigen of an effector cell as a second antigen. 8. The pharmaceutical composition according to claim 7, characterized in that said bispecific antibody is a single chain antibody construct. 9. The pharmaceutical composition of claim 8, wherein said single-chain antibody construction comprises V _L and V _H domains of a chemokine receptor specific antibody and V _L and V _H domains of an antibody specific for CD3 antigen. 10. The pharmaceutical composition according to claim 9, characterized in that said chemokine receptor specific antibody is a mouse antibody to human CCR5 MC-1. 11. The pharmaceutical composition according to claim 9 or 10, characterized in that the said domains V _L and V _H are arranged in the order of V _L (MS-1) -V _H (MS-1) -V _H (CD3) -V _L ( CD3). 12. The pharmaceutical composition according to claim 11, characterized in that the said V _L (MC-1) includes the amino acid sequence shown in SEQ ID NO: 12, in which the said V _H (MS-1) includes the amino acid sequence shown in SEQ ID NO: 16, wherein said V _H (CD3) comprises the amino acid sequence shown in SEQ ID NO: 26 or in which said V _L (CD3) includes the amino acid sequence shown in SEQ ID NO: 28. 13. The pharmaceutical composition according to any one of claims 5-12, wherein said bispecific antibody comprises an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 17, or includes the amino acid sequence shown in SEQ ID NO: 18. 14. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said antibody construction is a bispecific antibody that binds to said chemokine receptor as a first antigen and with a toxin as a second antigen. 15. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said antibody construction is covalently linked to a toxin. 16. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said antibody construct can be coupled via an in vitro or in vivo multimerization domain to a second antibody construct that binds to a CD3 antigen or toxin. 17. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said chemokine construct is a fusion construct of a modified or unmodified chemokine with a modified or unmodified toxin. 18. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that the chemokine construct can be linked via an in vitro or in vivo multimerization domain to an antibody construct that binds to the CD3 antigen or toxin. 19. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said chemokine construct comprises a chemokine covalently linked to an antibody construct that binds to an antibody construct that binds to a CD3 antigen or which is covalently linked to a toxin. 20. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that said antibody or chemokine construct is a hetero-antibody construct containing at least an antibody or chemokine that binds to a chemokine receptor. 21. The pharmaceutical composition according to claim 20, characterized in that the said hetero-antibody construct may include at least one toxin. 22. The pharmaceutical composition according to claim 20 or 21, characterized in that said hetero-antibody construct binds to a chemokine receptor or to CD3 antigen of an effector cell. 23. The pharmaceutical composition according to any one of claims 17 to 22, wherein said chemokine is selected from the group consisting of RANTES, M1P1-β, MIP1-α, MCP-2 and MCP-3. 24. The pharmaceutical composition according to any one of paragraphs.15-19, 21 and 22, characterized in that said toxin is a truncated Pseudomonas exotoxin A. 25. The pharmaceutical composition according to any one of claims 17-24, wherein said chemokine construct comprises the amino acid sequence shown in SEQ ID NO: 24 or encoded by the nucleotide sequence shown in SEQ ID NO: 23. 26. The pharmaceutical composition according to any one of claims 7 to 13, 16, 18, 19 and 22, characterized in that said CD3 antigen is located on the surface of an effector cell, which is a T cell. 27. An antibody construct capable of binding to the CCR5 chemokine receptor, which comprises a CCR5 binding site and a CD3 binding site. 28. The antibody construct of claim 27, wherein it is a bispecific antibody that binds to a chemokine receptor as a first antigen and to an CD3 antigen of an effector cell as a second antigen. 29. The antibody construct of claim 28, wherein said bispecific antibody is a single chain antibody construct. 30. The antibody construct of claim 29, wherein said single-chain antibody construct comprises V _L and V _H domains of a chemokine receptor specific antibody and V _L and V _H domains of an antibody specific for CD3 antigen. 31. The antibody design of claim 30, wherein said chemokine receptor specific antibody is a mouse antibody to human CCR5 MC-1. 32. The antibody design of claim 29 or 30, wherein said V _L and V _H domains are arranged in the order of V _L (MC-1) -V _H (MS-1) -V _H (CD3) -V _L ( CD3). 33. The antibody construct of claim 32, wherein said V _L (MC-1) comprises the amino acid sequence shown in SEQ ID NO: 12, wherein said V _H (MC-1) includes the amino acid sequence shown in SEQ ID NO: 16, wherein said V _H (CD3) includes the amino acid sequence shown in SEQ ID NO: 26, or in which said V _L (CD3) includes the amino acid sequence shown in SEQ ID NO: 28. 34. The antibody construct according to one of claims 28-33, wherein said bispecific antibody comprises an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 17 or includes the amino acid sequence shown in SEQ ID NO: 18. 35. The antibody construct of claim 27, wherein it is a bispecific antibody that binds to said chemokine receptor as a first antigen and toxin as a second antigen. 36. The antibody design of claim 27, wherein it is covalently linked to a toxin. 37. The antibody construct of claim 27, wherein it can be coupled via an in vitro or in vivo multimerization domain to a second antibody construct that binds to a CD3 antigen or toxin. 38. The antibody construct of claim 27, wherein said antibody construct is a heterominibody construct comprising at least an antibody or chemokine that binds to a chemokine receptor. 39. The antibody construct of claim 38, wherein said heterominibody construct may include at least one toxin. 40. The antibody construct of claim 38 or 39, wherein said heterominibody construct binds to a chemokine receptor or CD3 antigen of an effector cell. 41. A chemokine construct capable of binding to the CCR5 chemokine receptor, which is a fusion construct of a modified or unmodified chemokine with a modified or unmodified toxin. 42. The chemokine construct of claim 41, wherein RANTES is included, and said toxin is truncated Pseudomonas exotoxin A (PE38). 43. The chemokine construct of claim 41, wherein the chemokine construct can be linked through an in vitro or in vivo multimerization domain to an antibody construct that binds to the CD3 antigen or toxin. 44. The chemokine construct of claim 41, wherein the chemokine is covalently linked to an antibody construct that binds to an antibody construct that binds to the CD3 antigen or which is covalently linked to a toxin. 45. The chemokine construct according to claim 41, characterized in that it is a heterominibody construct containing a chemokine that binds to a chemokine receptor. 46. The chemokine construct of claim 45, wherein said heterominibody construct may include at least one toxin. 47. The chemokine construct of claim 45 or 46, wherein said heterominibody construct binds to the chemokine receptor or to the CD3 antigen of the effector cell. 48. A polynucleotide encoding an antibody construct or a chemokine construct capable of binding to the CCR5 chemokine receptor, wherein said polynucleotide is (a) a polynucleotide comprising a nucleic acid molecule, in particular, encoding a polypeptide shown in SEQ ID NO: 18 or SEQ ID NO: 24; (b) a polynucleotide comprising a nucleic acid molecule shown in SEQ ID NO: 17 or SEQ ID NO: 23; or (c) a polynucleotide hybridizing under stringent conditions with a complementary strand of polynucleotide according to (a) or (b). 49. The polynucleotide of claim 48, wherein the polynucleotide is DNA or RNA. 50. A vector comprising the polynucleotide of claim 48 or 49. 51. The vector according to p. 50, characterized in that it is an expression vector or gene transfer vector. 52. A host cell containing an integrated vector according to claim 50 or 51. 53. A method of obtaining an antibody construct or chemokine construct capable of binding to the CCR5 chemokine receptor, comprising culturing a host cell according to paragraph 52 and isolating the generated antibody construct or chemokine construct. 54. The antibody construct or chemokine construct encoded by the polynucleotide according to claim 48 or 49 or generated by the method according to claim 53. 55. A composition comprising a polynucleotide according to claim 48 or 49, a vector according to claim 50 or 51, a host cell according to claim 52, an antibody construct according to claims 27-40 or 54, or a chemokine construct according to claims 41-47 or 54 . 56. The composition according to p. 55, characterized in that it is a pharmaceutical composition also containing a pharmaceutically acceptable carrier, diluent or excipient. 57. The composition according to p. 55 or 56, characterized in that it further comprises a drug for the treatment of immunological disorders or a drug for the treatment of HIV infection. 58. A method of treating, preventing or alleviating an immunological disorder or eliminating cells that are latently infected with a primates immunodeficiency virus, comprising administering to a subject in need of such treatment, prophylaxis or relief, an effective amount of a composition according to any one of claims 55-57. 59. A pharmaceutical composition for treating, preventing or alleviating an immunological disorder, comprising an active ingredient and a pharmaceutically acceptable carrier, diluent or diluent, characterized in that it contains the polynucleotide according to claim 48 or 49, the vector according to claim 50 or 51 , a host cell according to claim 52, an antibody construct according to claims 27-40 or 54, or a chemokine construct according to claims 41-47 or 54. 60. A pharmaceutical composition for eliminating latently infected cells infected with a primates immunodeficiency virus, comprising an active ingredient and a pharmaceutically acceptable carrier, diluent or solvent, characterized in that it contains the polynucleotide of claim 48 or 49 as the active ingredient, the vector of claim 50 or 51, the host cell of claim 52, the antibody construct of claims 27-40 or 54, or the chemokine construct of claims 41-47 or 54. 61. The method of claim 58, wherein said immunological disorder is selected from the group consisting of autoimmune diseases, allergic diseases, skin diseases, inflammatory diseases, diabetes, graft versus host disease and graft rejection. 62. The method of Claim 61, wherein said autoimmune disease is selected from the group consisting of multiple sclerosis, type I diabetes, and rheumatoid arthritis. 63. The method according to p, characterized in that said skin disease is selected from the group including skin inflammation, atopic dermatitis and psoriasis. 64. The method according to p, characterized in that the said inflammatory disease is selected from the group including inflammatory joint diseases, renal inflammatory diseases, intestinal inflammatory diseases. 65. The method of claim 64, wherein said inflammatory joint disease is (chronic) arthritis. 66. The method of claim 58, wherein said primate immunodeficiency virus infection is HIV-1 infection. 67. The method according to p, characterized in that the said composition should be used in combination with antiviral drugs or in combination with drugs used in the treatment of AIDS. 68. The method according to p, characterized in that the said drugs used in the treatment of AIDS, include drugs used in HAART. 69. The pharmaceutical composition according to § 59, wherein said immunological disorder is selected from the group comprising autoimmune diseases, allergic diseases, skin diseases, inflammatory diseases, diabetes, graft versus host disease and graft rejection. 70. The pharmaceutical composition according to p, characterized in that the said autoimmune disease is selected from the group comprising multiple sclerosis, type 1 diabetes and rheumatoid arthritis. 71. The pharmaceutical composition according to p, characterized in that the said skin disease is selected from the group including skin inflammation, atopic dermatitis and psoriasis. 72. The pharmaceutical composition according to p, characterized in that the said inflammatory disease is selected from the group including inflammatory joint diseases, renal inflammatory diseases, intestinal inflammatory diseases. 73. The pharmaceutical composition according p, characterized in that the said inflammatory joint disease is (chronic) arthritis. 74. The pharmaceutical composition of claim 60, wherein said primate immunodeficiency virus infection is HIV-1 infection. 75. The pharmaceutical composition according p, characterized in that the said composition should be used in combination with antiviral drugs or in combination with drugs used in the treatment of AIDS. 76. The pharmaceutical composition according p, characterized in that the said drugs used in the treatment of AIDS include drugs used in HAART. 77. A kit comprising the polynucleotide of claim 48 or 49, encoding an antibody construct or a chemokine construct capable of binding to the CCR5 chemokine receptor, a vector of claim 50 or 51, comprising this polynucleotide, a host cell of claim 52, the antibody construct of one of claims 27-40 or 54, capable of binding to the CCR5 chemokine receptor, which comprises a CCR5 binding site and a CD3 binding site, or a chemokine construct according to one of claims 41 to 47 or 54, capable of binding to the CCR5 chemokine receptor.

Images