RU2168544C2 - Molecule of isolated double-stranded dna, molecule of recombinant double-stranded dna and method of genetically transformed plants preparing - Google Patents

Abstract

FIELD: molecular biology, genetic engineering, agriculture. SUBSTANCE: transformation of plants with genes destructing herbicide glyphosate ensures to obtain plants exhibiting resistance to this herbicide used for control of weeds and others. Invention can be used in agriculture. EFFECT: improved method of plants transformation. 9 cl, 13 dwg, 16 tbl, 6 ex

Description

 This application is a partial continuation of the pending application N 07/543236, filed June 25, 1990

 Recent advances in genetic engineering have provided specialists with the necessary tool for plant transformation with the introduction of foreign genes into them. Currently, you can create plants with unique indicators in terms of agronomy. Undoubtedly, among the advantages achieved with this: a more cost-effective, environmentally compatible weed control by creating tolerance to herbicides. Herbicide-tolerant plants can reduce the need for tillage while effectively reducing soil erosion.

 One of the herbicides that has undergone rigorous research in this regard is N-phosphonomethylglycine, commonly called glyphosate. Glyphosate inhibits the participation of shikimic acid in the biosynthesis of aromatic compounds, including amino acids and vitamins. More specifically, glyphosate inhibits the conversion of phosphoenolpyruvic acid and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvyl-3-phosphoshikimic acid synthetase (EPPSh synthetase or EPPSh).

 It has been shown that glyphosate-tolerant plants can be created by introducing into the plant genome the ability to produce high-level EPPSh synthetase, while it is recommended that the enzyme be tolerant to glyphosate. (Shah et al. 1986). The introduction of glyphosate degradation gene (s) into plants could serve as a way to give plants glyphosate tolerance and / or increase the tolerance of a transgenic plant already expressing glyphosate tolerant EPPSh synthetase, depending on the physiological effect of the degradation products.

 Metabolism (destruction) has been studied on a wide variety of plants, and most of these studies have established a small degree of such destruction. In cases where disruption occurs, the starting product of disruption is aminomethylphosphonate (AMPK) (Coupland, 1985; Marshall et al., 1987). And in such cases it is not clear whether glyphosate is metabolized by the plant or by foreign bacteria on the surface of the leaves to which glyphosate is applied. AMPK has been reported to be less phytotoxic for most plant species than glyphosate (Franz, 1985), but not for all plant species (Maier, 1983; Tanaka et al., 1988). In soil, glyphosate destruction occurs more intensively and quickly (Torstensson, 1985). The main identified destruction product is AMPK (Rueppel et al., 1977; Nomura and Hilton, 1977), a phosphonate that can be metabolized by a wide variety of microorganisms (Zeleznick et al., 1963; Masfalerz et al., 1965; Cook et al., 1978; Daughton et al., 1979a, 1979b; Wackett et al., 1987a). A number of pure bacterial cultures have been identified that destroy glyphosate in one of two known ways (Moore et al., 1983; Talbot et al., 1984; Shinabarger and Braymer, 1986; Ballthazor and Hallas, 1986; Kishore and Jacob, 1987; Wackett and et al., 1987a; Pipke et al., 1987a; Pipke et al., 1987; Hallas et al., 1988; Jacob et al., 1985 and 1988; Pipke and Amrhein, 1988; Quinn et al., 1988 and 1989; Lerbs et al., 1990; Schowanek and Verstraete, 1990; Weidhase et al., 1990; Liu et al., 1991). A pathway involving a “C-P lyase” that destroys glyphosate to sarcosine and inorganic phosphate (Pi) is indicated for the species Pseudomonas (Shinabarger and Braymer, 1986; Kishore and Jacob, 1987) and the species Arthrobacler (Pipke et al., 1987b). Pure cultures capable of degrading glyphosate to AMPA are indicated for the Flavobacterium species (Balthazor and Hallas, 1986), for the Pseudomonas species (Jacob et al., 1988) and for Arthrobacter atrocyaneus (Pipke and Amrhein, 1988). In addition, a large number of isolates that convert glyphosate to AMPA have been identified in industrial activated sludge that processes glyphosate production waste (Hallas et al., 1988). However, the number and nature of the bacterial genes responsible for these lesions have not yet been determined, just as the gene (s) have not been isolated.

 Accordingly, in one of its aspects, the aim of the invention is to create new genes encoding a glyphosate metabolism enzyme that converts glyphosate to aminomethylphosphonate and glyoxylate.

 Another objective of the invention is to increase the activity of the glyphosate metabolism enzyme in relation to glyphosate by replacing specific amino acid residues.

 Another objective of the present invention is to provide genetically modified plants expressing a gene encoding a glyphosate metabolism enzyme and characterized by increased tolerance to herbicidal glyphosate.

 And another objective of the invention is to show that the metabolism enzyme can be directed using a chloroplast transit peptide to plastids and that the enzyme directed to plastids gives them high glyphosate tolerance.

 Finally, the aim of the invention is to provide a method for selecting transformed plant tissue using the glyphosate metabolism enzyme as a selectable marker in the presence of inhibitory concentrations of glyphosate.

 These and other objectives, aspects, and features of the present invention will become apparent to those skilled in the art from the following description and working examples.

 The present invention provides structural DNA constructs encoding the glyphosate oxidoreductase enzyme and is useful in creating the ability to destroy glyphosate in heterologous microorganisms (e.g. bacteria and plants), as well as in creating glyphosate tolerant plants.

In accordance with the foregoing, in accordance with one aspect of the present invention, there is provided a method for creating genetically transformed plants tolerant to the glyphosate herbicide, comprising the steps of:
(a) introducing into the genome of a plant cell a recombinant double-stranded DNA molecule consisting of:
(I) a promoter whose action in plant cells causes the production of an RNA sequence,
(II) a structural DNA sequence that causes the production of an RNA sequence encoding the glyphosate oxidoreductase enzyme,
(III) a 3'-non-translational DNA sequence whose action in plant cells causes the polyadenylated nucleotides to attach to the 3'-end of the RNA sequence;
moreover, the promoter is heterologous with respect to the coding sequence and is capable of causing sufficient expression of the indicated enzyme in plant tissues, including the meristematic tissue, with an increase in the resistance of plant cells transformed by the indicated gene to glyphosate;
(b) obtaining a transformed plant cell; and
(c) regenerating from the transformed plant cell a genetically transformed plant with increased glyphosate herbicide tolerance.

According to another aspect of the present invention, there is provided a recombinant double-stranded DNA molecule consisting sequentially of:
(a) a promoter whose action in plant cells causes the production of an RNA sequence;
(b) a structural DNA sequence that causes the production of an RNA sequence encoding the glyphosate oxidoreductase enzyme; and
(c) a 3'-non-translational region, the action of which in a plant causes the polyadenylated nucleotides to attach to the 3'-end of the RNA sequence.

 According to another aspect of the invention, bacterial and transformed plant cells are provided containing, respectively, DNA consisting of the aforementioned elements (a), (b) and (c).

 According to another aspect of the present invention, differentiated plants are provided, including transformed plant cells described above and characterized by glyphosate herbicide tolerance.

In accordance with another aspect of the present invention, a method for selectively controlling weeds in fields with cultivated plants on which seeds or seedlings of cultivated plants are planted is provided, the method comprising the steps of:
(a) planting seeds of cultivated plants or the plants themselves, which are characterized by glyphosate tolerance as a result of introducing into the seeds or plants a recombinant double-stranded DNA molecule consisting of:
(I) a promoter sequence whose action in plants causes the production of an RNA sequence,
(II) a structural DNA sequence that causes the production of RNA encoding the glyphosate oxidoreductase enzyme,
(III) the 3'-non-translational region encoding the polyadenylation signal, the action of which in plants causes the polyadenylated nucleotides to attach to the 3'-end of the RNA sequence. Moreover, the promoter is heterologous with respect to the coding sequence and is capable of causing sufficient expression of the indicated enzyme in the plant tissue, including the meristematic tissue, with an increase in the tolerance of the plant cell transformed by the indicated gene; and
(b) applying to the plants and seeds in the fields a sufficient amount to control the weed glyphosate herbicide without significant effect on the crop.

 In a particularly recommended embodiment of the invention, the double-stranded DNA molecule includes a gene for expression in a plant, which is a structural DNA encoding a fusion polypeptide containing an amino terminal chloroplast transit peptide capable of importing the carboxy terminal enzyme glyphosate oxidoreductase into the chloroplast of a plant cell expressing the gene.

 Another embodiment of the present invention is the use of the glyphosate oxidoreductase gene as a selectable marker for the selection and identification of transformed plant tissue.

 In FIG. Figure 1 shows the DNA sequence for the full length promoter of the mosaic Norica virus (FMV).

 In FIG. Figure 2 shows the structural DNA sequence for the glyphosate oxidoreductase gene from the bacterial isolate LBAA.

 In FIG. Figure 3 shows a comparison of a processed glyphosate oxidoreductase structural gene with a modified glyphosate oxidoreductase gene for increased expression in plants. The processed glyphosate oxidoreductase gene is shown as the top DNA sequence. The only changes made to the modified gene are shown in the downstream strand of sequences.

 In FIG. Figure 4 shows a comparison of the processed glyphosate oxidoreductase structural gene with the synthetic glyphosate oxidoreductase gene for increased expression in plants. The processed glyphosate oxidoreductase gene is shown as the top DNA sequence.

 In FIG. Figure 5 shows the structure of the pMON17032 - pMON1886 vector containing the modified glyphosate oxidoreductase gene inserted as En-CaMV35S-modified glyphosate oxidoreductase-NOS-3'-cassette into the NotI site of the vector. A description of the vector pMON886 can be found in the text.

 In FIG. Figure 6 shows the nucleotide sequence of the CTP1 of a chloroplast transit peptide derived from the A.thaliana SSUIA gene.

 In FIG. Figure 7 shows the genetic / structural map of plasmid pMON17066, a pMON979 type vector, containing a CTP / synthetic glyphosate oxidoreductase fusion polypeptide. Derivatives related to the pMON979 type are pMON17065 and pMON17073.

 In FIG. Figure 8 shows the genetic / structural map of plasmid pMON17138, which is an example of a pMON981 type vector containing a gene encoding a CTP fusion polypeptide / synthetic glyphosate oxidoreductase. In this example, the gene of the CTP1 synthetic glyphosate oxidoreductase is cloned into pMON979 as an XbaI-BamHI fragment.

 In FIG. Figure 9 shows the nucleotide sequence of the CTP2 of a chloroplast transit peptide derived from the A. thaliana EPSPS gene.

 In FIG. 10 shows a structural map of plasmid pMON17159.

 In FIG. 11 shows a structural map of plasmid pMON17226.

 In FIG. 12 shows a structural map of plasmid pMON17164.

 The expression of a plant gene that exists in the form of double-stranded DNA involves the synthesis of messenger RNA (mRNA) from one of the DNA strands with the participation of the RNA polymerase enzyme and subsequent processing inside the nucleus of the primary mRNA transcript. Such processing involves the participation of the 3'-signal region, facilitating the attachment of polyadenylated nucleotides to the 3'-end of RNA.

 Transcription of DNA into mRNA is regulated by a region of DNA, commonly referred to as the "promoter". The promoter region contains a sequence of bases supplying RNA polymerase signals to bind to DNA and initiate transcription into mRNA using one of the DNA strands as a template to form the corresponding complementary RNA strand.

 The literature describes a number of promoters that are active in plant cells, including; nopalin synthetase (NOS) and octopine syntheses (OCS) promoters (located on tumor inducing plasmids from Agrobacterium tumefaciens), caulmovirus promoters such as the 19S-35S promoters of cauliflower mosaic virus (CaMV) and the 35S promoter of mosaic virus (nori FMV), a photosensitive promoter from the small subunit of ribulosabisphosphate carboxylase (SSRUBISCO, a very common plant polypeptide). All of these promoters were used to create different types of DNA constructs expressed in plants (see, for example, PCT publication WO 84/02913 (Pogers et al., Monsanto)).

 Promoters for which the ability to induce transcription in plant cells is known or found can be used in the present invention. Such promoters can be obtained from various sources, such as: plants and plant DNA viruses, including, but not limited to: CaMV 35S and FMV35S promoters and promoters isolated from plant genes, such as: SSRUBISCO genes or proteins a / b chlorophyll binding. As shown below, it is recommended that the particular promoter selected be able to induce sufficient expression, resulting in glyphosate oxidoreductase production in an amount effective to impart noticeable tolerance to glyphosate herbicides to plants. The amount of glyphosate oxidoreductase required to create the target tolerance may vary depending on the type of plant.

 It is recommended that the promoter used be characterized by relatively high expression in all meristematic tissues, in addition to other tissues, since it is now known that glyphosate travels and accumulates in plant tissue of this type. Alternatively, a combination of chimeric genes can be used to cumulatively create the required overall expression level of the glyphosate oxidoreductase enzyme, resulting in a glyphosate tolerant genotype.

 The mRNA produced by the DNA construct of the present invention also contains a 5'-non-translational leader sequence. Such a sequence may originate from a promoter selected for gene expression, and may be specifically modified in order to increase translation of mRNA. 5'-non-translational regions can also be obtained from viral RNA, from acceptable eukaryotic genes, or from synthetic gene sequences. The present invention is not limited to the constructs presented in the following examples, in which the non-translational region originates both from the 5'-non-translational sequence concomitant with the promoter sequence and from the 5'-non-translational region of the virus envelope protein gene. Preferably, the non-translational leader sequence could be derived from an unrelated promoter or coding sequence, as discussed above.

 The promoter recommended for use in the present invention is the full-length transcriptional (35S) mosaic noric warp virus (FMV) promoter, acting as a strong and uniform promoter for chimeric genes introduced into plants, in particular dicotyledonous plants. In general, the resulting transgenic plants express a protein encoded by the introduced gene at a higher and more uniform level in all tissues and cells than the same gene driven by the amplified CaCV 35S promoter. The DNA sequence of the promoter (see Fig. 1) is located between nucleotides 6368 and 6930 (SEQ. N 1) of the FMV genome. It is recommended that a 5'-non-translational leader sequence is combined with the promoter, and an example of the leader sequence is shown in FIG. 1 (LAST N 2). The leader sequence may originate from the same FMV genome, or may originate from a source other than FMV.

 The 3'-non-translational region of the chimeric plant gene contains a polyadenylation signal, the action of which in plants causes polyadenylated nucleotides to attach to the 3'-end of RNA. Examples of acceptable 3'-regions include: (1) 3'-transcribed, non-translational regions containing a polyadenylation signal from Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthetase (NOS) gene, and (2) plant genes, such as soybean storage protein genes and the ribulose-1,5-bisphosphate carboxylase small subunit gene (ssRUBISCO). An example of a recommended 3 ′ region is represented by a region from the ssRUBISCO pea gene (E9), described in more detail in the following examples.

 The DNA constructs of the present invention further comprise a double-stranded DNA structural coding sequence encoding a glyphosate oxidoreductase enzyme that converts glyphosate to aminomethylphosphonate and glyoxylate.

Summary of glyphosate oxidoreductase reactions
The glyphosate oxidoreductase enzyme catalyzes the cleavage of the CN bond of glyphosate to form aminomethylphosphonate (AMPA) and glyoxylate as reaction products. Under aerobic conditions, oxygen participates in the reaction as a sub-substrate. Other electron donors, such as phenazine methosulfate and ubiquinone under aerobic conditions stimulate the reaction. In the absence of oxygen, these compounds act as electron acceptors.

 An enzymatic reaction assay can be performed by absorbing oxygen using an oxygen electrode. Glyphosate oxidoreductase from LBAA does not form hydrogen peroxide as an oxygen reduction product. This enzyme requires stoichiometrically two moles of oxidized glyphosate per mole of oxygen consumed to form two moles of each AMPA and glyoxylate as reaction products.

 An alternative method for the analysis of glyphosate oxidoreductase involves the reaction of a sample with 2,4-dinitrophenylhydrazine and determination of the amount of glyoxylate-2,4-dinitrophenylhydrazone by HPLC analysis, described in more detail in the following section.

The third method of analysis of glyphosate oxidoreductase consists in the use of / 3- ¹⁴ C / -glifozata as a substrate, wherein the radioactive AMPA enzyme formed is separated from the substrate by HPLC on anion exchange column as described below. AMPK-related radioactivity is a measure of the depth of the glyphosate oxidoreductase reaction.

 Glyphosate oxidoreductase from LBAA refers to flavoproteins involving FAD as a cofactor. One of the mechanisms we proposed for the reaction catalyzed by this enzyme involves the restoration of FAD from the active site of the enzyme by glyphosate. This leads to the formation of reduced FAD and Schiff base of aminomethylphosphonate with glyoxylate. The Schiff base is hydrated with water and hydrolyzed to its components: AMPA and glyoxylate. The reduced flavin is again oxidized by molecular oxygen. We believe that oxidized flavin is formed as an intermediate in the process of reoxidation of reduced FAD. An intermediate flavin can catalyze the oxidation of glyphosate to form AMPA and glyoxylate. This hypothesis is consistent with the observed stoichiometry and the inability to detect hydrogen peroxide in the reaction mixture.

 In addition to glyphosate, glyphosate oxidoreductase from LBAA oxidizes iminodiacetic acid (IMU) to glycine and glyoxylate. The reaction rate with IMU is much faster than with glyphosate.

Isolation of bacteria that effectively decompose glyphosate to AMPK
Bacteria capable of degrading glyphosate are known (Hallas et al., 1988; Malik et al., 1988). A number of such bacteria were selected for the rapid destruction of glyphosate in the following way. Twenty-three bacterial isolates were transferred from TSA plates (Triptase soy agar, BBL) to medium A, consisting of a medium with Dvorkin-Foster salts containing glucose, gluconate and citrate (each at a concentration of 0.1%) as a carbon source and containing glyphosate as a source of phosphorus (glyphosate concentration 0.1 mM).

 The minimum Dvorkin-Foster medium is prepared by mixing in 1 liter of autoclaved water 1 ml of each of components A, B and C and 10 ml of component D, thiamine • HCl (5 mg), C sources to a final concentration of 0.1% each and P-source (glyphosate or other phosphonate, or Pi) to the required concentration.

A. D-F salts (1000X lot, per 100 ml, autoclaved):
H ₃ BO ₃ - 1 mg
MnSO ₄ • 7H ₂ O - 1 mg
ZnSO ₄ • 7H ₂ O - 12.5 mg
CuSO ₄ • 5H ₂ O - 8 mg
NaMoO ₃ • 3H ₂ O - 1.7 mg
B. FeSO ₄ • 7H ₂ O (1000X batch, per 100 ml, autoclaved) 0.1 g;
C. MgSO ₄ • 7H ₂ O (1000X batch, per 100 ml, autoclaved) 0.1 g;
D. (NH ₄ ) ₂ SO ₄ (1000X batch, per 100 ml, autoclaved) 20 g.

 Yeast extract (UE, Difco) is added to a final concentration of 0.01-0.001%.

Furthermore, each 1 ml of culture medium containing approximately 200,000 cpm / 3- ¹⁴ C / -glifozata (Amerskham, CFA-745). The cultures were incubated with shaking at 30 ^° C. LBAA isolates showed significant growth on the first day, while other test cultures showed slight growth until the third day. The determination of radioactivity (scintillation counter) in the culture, cell debris and culture supernatant (on the fourth day) showed a general decrease in ¹⁴ C-radioactivity and a 1: 1 distribution of residual radioactivity in the supernatant and debris, indicating a significant glyphosate metabolism occurred with its absorption (see table. I).

On the fifth day, 75 μl of the supernatant of all test cultures was analyzed by HPLC as follows. A SYNCHROPACK ^R AX100 (PJCobert) anion exchange column is used, the mobile phase consists of 65 mM KH ₂ PO ₄ (pH 5.5 by addition of NaOH, depending on the experimental requirements, the phosphate buffer concentration is varied within the range of 50-75 mM), Isocrate and eluted product mode is recorded continuously using a radioactivity detector. This analysis revealed, especially in one of the isolates (LBAA), the complete absence of a glyphosate peak (Retention Time / VU / = 7 min in this analysis) and the appearance of a new radioactivity peak with the same retention time as that of methylamine or N-acetylmethylamine (VU = 3.5 min). A collection of bacteria, which also includes the LBAA strain, has been characterized as destroying glyphosate prior to AMPK (Hallas et al., 1988), the detection of methylamine or N-acetylmethylamine suggests that AMPK or N-acetyl AMPK were metabolized due to the activity of LBAA "CP-lyase "with the release of phosphate required in this experiment for culture growth. The LBAA strain has been investigated in more detail.

The conversion of glyphosate to AMPA in microbial isolates
For clarity and brevity, the following procedure has been described for isolating genes encoding the glyphosate oxidoreductase enzyme and is provided for isolating a similar gene from a bacterial isolate (LBAA). It will be apparent to one skilled in the art that the same or similar strategy can be used to isolate such genes from other microbial isolates.

The glyphosate destruction pathway was characterized on resting cells grown in the presence of glyphosate of the LBAA strain as follows. Cells from the LBAA culture (100 ml) are grown in DF medium with glucose, gluconate and citrate as carbon sources, with thiamine and yeast extract (0.01%) for trace additions (= DF3S medium) and with 0.2 mM glyphosate as a phosphorus source, was collected at a value Klett = 200, washed twice with 20 ml of DF3S medium and the equivalent of 20 ml cells resuspended in 100 ul of the same medium containing / 3- ¹⁴ C / -glifozat (2,5 ul radioactivity 52 mCi / mmol). The cell mixture was incubated with shaking at 30 ^° C. and samples (20 ml) were taken at intervals. Samples are centrifuged and both the supernatant and the cell debris are analyzed by HPLC (debris is resuspended in 100 ul acidic DF3S medium / = DF3S, 0.65 N HCl /, boiled for 5 minutes, centrifuged briefly and the supernatant analyzed; acidified control with glyphosate also analyzed). Over 2 hours, the amount of radioactivity at the peak of glyphosate (VU = 7.8 min) from the supernatant decreased to -33% from the initial level, approximately 3% of glyphosate was found in the cells. The product, eluting with methylamine as a standard, amounted to -5% of the initial meter reading for the supernatant and -1.5% for debris. A new peak, which amounted to -1.5% of the initial radioactivity at VU = 7.7 min (VU of glyphosate = 8.9 min during acidification in this experiment), was identified in the cell contents. A large decrease in total radioactivity also suggests that glyphosate undergoes extensive metabolism in this experiment. This pathway has received additional light in the experiment in which the metabolism / ¹⁴ C / -AMFK compared with the metabolism / 3- ¹⁴ C / -glifozata (cm. Above) in resting cells harvested at Klett = value of 165 and resuspended at the equivalent to 15 ml cells per 100 ul DF3S medium. Samples analyzed by HPLC consist of complete cultures, acidified and treated as described above. In the first 2 hours of the experiment with glyphosate, 25% of the radioactivity is found at the peak of methylamine / N-acetylmethylamine (BU = 4.8 min), 12.5% in the form of a peak AMPK (BU = 6.4 min), 30% in the form of a peak, the above (VU = 9.4 min) and 30% in the form of a glyphosate peak (VU = 11.8 min). In the experiment with AMPK, 15% of the radioactivity was detected as N-acetylmethylamine / methylamine, 59% as AMPK and 18% as a peak with VU = 9.4 min. The modified form of AMPA is identified as N-acetyl-AMPK. The conclusion about a similar acetylation step was made on the basis of products identified in E. coli grown in aminomethylphosphonates as the sole source of P (Avita et al., 1987). The data obtained indicate the following pathway for glyphosate decomposition in LBAA: glyphosate ---> AMPK (---> methylamine) ---> N-acetyl AMPK ---> N-acetylmethylamine.

Cloning of the glyphosate oxidoreductase gene (s) in E. coli
After the conversion of glyphosate to AMPA in the LBAA strain was established, the general approach for cloning the gene (s) involved in such a conversion into E. coli was studied. Cloning and gene technology, unless otherwise indicated, are generally consistent with previously published ones (Maniatis et al., 1982). The cloning strategy was as follows. The introduction of the cosmid bank of the LBAA strain into E. coli and selection for gene (s) conversion of glyphosate to AMPK were determined by growth on glyphosate as a source of phosphorus (P). The selection was based on the use of AMPK, formed by the glyphosate metabolism enzyme, as a source of P, followed by the isolation of inorganic phosphates (Pi) from AMPK by E. coli "CP-lyase". Most E. coli strains are unable to absorb phosphonates as the source of P in the initial state, however, such strains quickly adapt (independently of RecA) and absorb phosphonates (become Mpu ⁺ ) (Wackett et al. 1987b). E. coli Mpu ^{+ was} isolated from E. coli SR200 (Leu ^- , Pro ^- , recA, hsdR, supE, Sm ^r , tonA) as follows. Aliquots of the fresh E. coli SR200 culture in 1-broth are applied to MOPS (Neidhardt et al., 1974) full agar (i.e. it contains L-leucine and L-proline at a concentration of 25 ug / ml and vitamin B1 / thiamine / b concentration of 10 ug / ml; agar - DIFCO "Purified") containing aminomethylphosphonate as a source of P (AMPK, 0.2 mM, Sigma),
MOPS environment includes:
10 ml 10X MOPS salts
2 ml 0.5 mg / ml Thiamine • HCl
1 ml of 20% glucose
10X MOPS salt includes:
per 100 ml
40 ml 1M MOPS pH 7.4
4 ml 1M Tricin, pH 7.4
1 ml 0.01 M FeSO ₄ • 7H ₂ O
5 ml 1.9M NH ₄ Cl
1 ml 0.276 M K ₂ SO ₄
1 ml 0.5 mM CaCl ₂
1 ml 0.528 M MgCl ₂
10 ml 5 M NaCl
1 ml 0.5% L-Methionine
1 ml of nutritious microadditives
Microadditives include:
3 • 10 ^-9 M (NH ₄ ) ₆ Mn ₇ O ₂₄
4 • 10 ^-7 M H ₃ BO ₄
3 • 10 ^-8 M CoCl ₂
1.6 • 10 ^-8 M CuSO ₄
8 • 10 ^-8 M MnCl ₂
1 • 10 ^-8 M ZnSO ₄
Six individual colonies were collected from the agar plate after three days of incubation at 37 ^° C and the complete agar containing as source P either AMPK or methylphosphonate (Alpha) was applied as streaks to the MOPS. One colony, designated as E. coli SR200 Mpu ⁺ , was selected from those colonies that grew equally and uniformly on both phosphonate media.

Chromosomal DNA is obtained from the LBAA strain in the following way. Debris from 100 ml of the late log phase of the LBAA culture in L-broth (Miller, 1972) was resuspended in 10 ml of Solution 1 (Birnboim and Doly, 1979). VAT is added to a final concentration of 1% and the suspension is subjected to three freeze-thaw cycles, each of which is immersed for 15 minutes in dry ice and water for 10 minutes at 70 ^o C. The lysate is then extracted four times with equal volumes of phenol-mixture chloroform (1: 1, phenol saturated with TE) (TE = 10 mM Tris with pH 8; 1 mM EDTA) and the phases are separated by centrifugation (15000 G, 10 min). Ethanol precipitated product is obtained from the supernatant in the form of debris by short centrifugation (8000 G, 5 min) after adding two volumes of ethanol. The debris was resuspended in 5 ml of TE and dialyzed for 16 hours at 4 ^° C. in 2 L of TE. The result is 6 ml of a DNA solution at a concentration of 150 μg / ml.

Partially restricted DNA is prepared as follows. Three aliquots of 100 μg of LBAA DNA were treated for 1 h at 37 ^° C with a HindIII restriction endonuclease in an amount of 4.2 and 1 enzyme units / μg of DNA, respectively. DNA samples are combined, add EDTA to a concentration of 0.25 mm and extracted with an equal volume of phenol-chloroform. After the addition of NaAcetate and ethanol, DNA was precipitated with two volumes of ethanol and separated as debris by centrifugation (12000 G, 10 min). The dried DNA debris was resuspended in 500 μl TE and stratified by 10–40% sucrose gradients (5% increment of 5.5 each time) in 0.5 M NaCl, 50 mM Tris with pH 8, 0.5 mM EDTA. After centrifugation for 20 h at a speed of 2600 rpm in a SW28 rotor, the tubes are punctured and 1 ml fractions are taken. Fifteen μl of a sample from every third fraction was passed on a 0.8% agarose gel and the DNA size was determined by comparison with linear lambda DNA and HindIII-hydrolyzed lambda DNA as standards. Fractions containing DNA in the form of fragments of 25-35 kb are pooled, desalted on AMICON 10 columns (7000 rpm, 20 ^° C, 45 min) and concentrated by precipitation. Using this technique, 50 ug LBAA DNA of the required size was obtained.

Plasmid pHC79 (Hohn and Collins, 1980) DNA and a vector treated with HindIII-phosphatase are prepared according to the literature (Maniatis et al., 1982). Ligation was carried out under the following conditions:
Vector DNA (treated with HindIII and calf alkaline phosphatase) - 1.6 mcg
LBAA HindIII Fractionated by Size 3.75 μg
10X ligation buffer - 2.2 μl
250 mM Tris-HCl, pH 8
100 mM MgCl ₂
100 mM dithiothreitol
2 mm spermidine
T4 DNA ligase (Boehringer-Mannheim) (400 units / ul) - 1 μl
H ₂ O - Up to 22 ul
18 h at 16 ^o C.

 The ligated DNA (4 μl) was packaged in lambda phage particles (Stratagen, Gigpak Gould) using the manufacturer's procedure.

E. coli SR200 Mpu ⁺ , grown for about a day in L-broth (with 0.2% maltose), is infected with 50 μl of packaged DNA. Transformants were selected on MOPS complete agar plus ampicillin and with glyphosate (0.2 mM) as source P.

For titration of packaged cosmids, aliquots are also applied to MOPS (Neidhardt et al., 1974) complete agar plus ampicillin containing Pi (1 mM). Cosmid transformants are isolated after 2 days at 37 ^o C on the same medium with a ratio of -10 ^-5 per μg / LBAA HindIII DNA. Colonies occur on glyphosate agar in the range from day 3 to day 10 with a final ratio of 1 per 200-300 cosmids. Plasmid DNA is obtained from twenty-one cosmid transformants selected from glyphosate plates. Cosmid data, based on the nature of HindIII plasmid DNA restriction, can be divided into at least two classes. Common for class I cosmids are cloned HindIII restriction fragments of 6.4 kb and 4.2 kb, for class II a 23 kb fragment is common. about. Ten cosmids representing deviations from the cloned fragments were again transformed with E. coli SR200 Mpu ⁺ and the ability to assimilate glyphosate was tested by selection by growing on agar plates with MOPS complete agar plus ampicillin plus glyphosate. In addition, the final cell density achieved by culturing in the presence of glyphosate (0.2 mM in MOPS medium) as a source of P was determined, while only small differences were found between the various transformants. MOPS complete broth with AMPA at a concentration of 0.1 mM was also inoculated with transformants as a source of P (to confirm the presence of CP-lyase activity) and after incubation for 24 hours at 37 ^° C, dilute 100-fold MOPS with complete medium with glyphosate at a concentration of 0, and 1 mM / 3- ¹⁴ C / -glifozatom (40000 cpm / ml). All the cosmid-containing cells are disrupted to form a glyphosate N-atsetilAMFK and N-atsetilmetilamin no noticeable difference in speed. in these trials, N-atsetilAMFK detected in the culture supernatant One cosmid of class I, identified as pMON7468, is selected for I am investigating further.The second glyphosate oxidoreductase gene has been identified in the cosmid clone of class II.

Cell-free lysates of E. coli SR200 Mpu ⁺ / pMON17468 were obtained from cells grown on MOPS complete medium with glyphosate at a concentration of 1 mM (and with the addition of L-phenylalanine, L-tyrosine and L-tryptophan, each concentration of 100 μg / ml, and p-aminobenzoic acid, p-hydroxybenzoic acid and 2,3-dihydroxybenzoic acid, each concentration of 5 μg / ml to minimize the inhibitory effect of E. coli EPPP synthetase). Debris (weighing approximately 0.5 g in the wet state) was resuspended in 1 ml of lysis buffer (40 mM MOPS pH 7.4, 4 mM tricin pH 7.4, 10% glycerol, 1 mM DTT) and passed through French twice press. Cell debris is removed by centrifugation for 10 minutes at 15,000 rpm. The supernatant after adding MgCl ₂ to a concentration of 10 mM was analyzed for destruction of radiolabeled glyphosate. Glyphosate as the substrate comes in the form of / 3- ¹⁴ C / -glifozata (final concentration = 17 uM). The identified products are predominantly AMPA and a certain amount of N-acetylAMPA; the formation of AMPA indicates the cloning of enzymatic activity from the LBAA strain, however, the formation of N-acetyl AMPA can be caused by endogenous E. coli activity (Avila et al., 1987). The specific activity for the formation of AMPA under these conditions is 13.3 pmol of AMPA / min • mg of protein.

Characterization of the gene for the conversion of glyphosate to AMPK
The cloned region responsible for the enzymatic activity of glyphosate oxidoreductase is then localized in cosmid. PMON7468 deletions were isolated predominantly within the cloned region using restriction enzymes that cut randomly inside the insert using the following procedure. Samples of plasmid DNA of 0.5-2 μg are completely hydrolyzed by the following restriction endonucleases; NotI, SacI, BglII or BamHI, extracted with phenol-chloroform, precipitated with ethanol, resuspended in TE buffer and ligated for 2-4 hours at room temperature (or 18 hours at 16 ^° C) in a final volume of 50 μl with ligation buffer and T4 DNA ligase. Transformants were selected in E. coli SR200 Mpu ⁺ and these deletions were examined for the loss or maintenance of the glyphosate uptake phenotype. These data, combined with restriction mapping of clones, were used to localize the active region, which turned out to be near the central part of the insert in pMON7468, including two common HindIII fragments (6.4 and 4.2 kb). HindIII restriction fragments from this region are then subcloned into pBIueScript (Stratagen) and their glyphosate phenotype is determined in E. coli JMIOI Mpu ⁺ (Mpu ⁺ derivative JM101 was isolated by SR200 Mpu ⁺ isolation). Clones containing a 6.4 kb HindIII fragment in any orientation produce glyphosate uptake. After restriction mapping of this HindIII fragment from two HindIII clones of 6.4 kb Using enzymes that cut the insert, as well as the polylinker region at random, a number of deletion clones were isolated. In addition, several restriction fragments internal to the HindIII fragment are subcloned. PstI (3.5 kb) and BglII (2.5 kb) fragments in any orientation were found to be positive for glyphosate uptake. These data, combined with deletion data, were used to localize the active region, which turned out to be a BglII-Xhol fragment of approximately 1.8 kb. In addition, deletions isolated from the 6.4 kb HindIII fragment indicate a minimum coding region of about 0.7 kb, with E.coRI and SacI sites probably located within the coding sequences.

The direction of transcription / expression of the locus responsible for the enzymatic activity of the conversion of glyphosate to AMPK is determined as follows. E. coli JMIOI Mpu ⁺ transformants from pMON7469 # 1 and # 4 (clones of 2.5 kb BglII fragment in the BamHI site of pUC118 with the opposite orientation) are grown in M9-glucose-thiamine-ampicillin broth in the presence and absence of Plac inducer IPTG , collected in the late log phase (Klett = 109-220), according to the above procedure, cell-free lysates of four cultures are obtained and analyzed for the activity of conversion of glyphosate to AMPA at a glyphosate concentration of 1.7 μM. The highest enzymatic activity was obtained for pMON7468 # 1 plus IPTG, where the XhoI site was delivered relative to Plac, which suggests the expression of the gene (s) in the direction from BglII to XhoI (see Table II).

 The only product detected was AMPK, which suggests inducing in E. coli transformants grown on glyphosate as a source of P, the previously described AMPK acetylation activity.

In a later experiment, cell lysates from pMON7468 # 1 and pMON7470 (BglII-XhoI 1.8 kb in pUC118, formed from pMON7469 # 1 by deletion of ~ 700 bp of the XhoI-SaII fragment) on glyphosate to AMPK conversion activity at a concentration of glyphosate of 2 mm / beats. Act. / 3- ¹⁴ C / -glifozata = 3.7 mCi / mmol, 0.2 .mu.Ci / reaction, cultures were grown in the presence of IPTG in the medium, and the registered higher enzymatic activity, reflecting the improved assay conditions (see. Table. III )

Proteins encoded by the BglII fragment are determined in vivo using the T7 expression system (Tabor and Richardson, 1985) after cloning the indicated fragment into the BamHI site of the pBlue Script (+) vector (pMON7471 # 1, # 2, orientations are opposite). The test and control plasmids were transformed into E. coli K38 containing pGPI-2 (Tabor and Richardson, 1985) and grown at 30 ^° C in L-broth (2 ml) in the presence of ampicillin and kanamicide (100 and 50 μg / ml, respectively) to a value of Klett ~ 50. An aliquot was taken, the cells were separated by centrifugation, washed with M9 salts (Miller, 1972) and resuspended in M9 medium (1 ml) containing 0.2% glucose, 20 μg / ml thiamine and 18 amino acids at a concentration of 0.01% (minus cysteine and methionine). After incubation for 90 minutes at 30 ^° C, the cultures are transferred to a water bath heated to 42 ^° C and incubated for 15 minutes. Rifampicin (Sigma) was added to a concentration of 200 mg / ml, the cultures were incubated for another 10 min at 42 ^o C and then 20 min at 30 ^o C. Pulse samples were treated for 5 min at 30 ^o C ³⁵ S-methionine (10 μ Ci), cells separated by centrifugation and suspended in 60-120 μl of cracking buffer (60 mm Tris-HCl with pH 6.8 / 1% VAT / 1% 2-mercaptoethanol / 10% glycerol / 0.01% blue bromophenol). Aliquots of the samples are subjected to electrophoresis for 12.5% VAT-PAGE and after soaking for 60 minutes in 10 volumes of a mixture of acetic acid-methanol-water (10: 30: 60), the gel is soaked in ENLIGHTNING ^R (DUPONT) according to the manufacturer's instructions, dried and exposed to x-ray film at -70 ^o C. Proteins labeled with ³⁵ S-methionine are detected only for the direction from BglII to XhoI, and the largest of them has a size of about 45 kD. When the BglII-XhoI fragment is examined after cloning into the BamHI-XhoI sites of pBIue Script (with the formation of pMON7472), then in this case such a protein of ~ 45 kDa is also expressed.

The effect of expression of glyphosate to AMPA conversion activity on E. coli glyphosate tolerance is first determined by studying the growth of recombinants in a medium containing inhibitory glyphosate concentrations. The test compares the growth of E. coli
JM101 containing the control vector (pUC118; Viera, and Nessing, 1987) or pUC118 clones of the BglII fragment of 2.5 kb (pMON7469 # 1, # 4). There is a very clear correlation between the ability to assimilate glyphosate and glyphosate tolerance. This tolerance genotype (resistance to 1.5 mM glyphosate) is then used as a sieve to quickly determine the phenotype of deletion clones, such as pMON7470 (BglII-XhoI 1.8 kb in pUC118, formed from pMON7469 # 1 deletion ~ 700 n XoI-SaII fragment) and subsequent clones.

The nucleotide sequence of the structural gene of glyphosate oxidoreductase
The nucleotide sequence of the BqlII-XhoI fragment (SEQ ID NO: 3) is determined using single-stranded DNA templates (created using phagemid clones and the M13 helper of phage R408) and the SEKENENAZ ^R sales kit (International Biotechnology Inc.). Computer sequence analysis (SEQ ID NO: 3) revealed the only large open reading frame (OPC) in the direction from BglII to XhoI (see FIG. 2), including the location of the individual corresponding restriction sites. Estimated Stop Codon (UAA) is 2 bp 5 'from a ScaI restriction circumcision site. Data confirming that the UAA codon is a ~ 45 kD ODP termination colony was obtained based on the following. Previously, based on the glyphosate assimilation phenotype, it was determined that the 3'-boundaries are located between the SacI site (95 bp in the upstream direction from the ScaI site) and the XhoI site. When cloning a BglII-ScaI fragment into BamHI-SmaI, pBlue Script sites and expressing proteins in vivo still produce a ~ 45 kD protein. The BgIII-ScaI fragment is then re-cloned from such a pBlue Script clone in the form of XbaI-HindIII into the pUC118 XbaI-HindIII vector, which is found to confer resistance to 15 mM glyphosate transformants of E. coli JM101. Based on these data, the location of the C-terminus of a ~ 45 kD protein is located between the Sacl and Scal sites. The only stop codon in any reading frame that is located between these sites can be a codon located directly in the upstream direction from the ScaI site.

 There are two methionine codons (AUG, located at positions 120 and 186), which, when used as fMet, should have resulted in proteins of sizes 46, 140, and 44.002 kD, respectively, but none of them was preceded by a clearly recognizable Shine-Delgarno sequence.

The onset of protein is more accurately outlined as follows. The sequences recognizing the BgIII restriction site are introduced in positions upstream of potential start codons, by site-directed mutagenesis of pMON7470 by replacing AGATCT with AGACTG ("Bg120") and GTATCG ("Bg186) sequences at 21 and 9 bp. upstream from AUG ₁₂₀ and AUG ₁₈₆ respectively, unless otherwise noted, oligonucleotide examples for mutagenesis are sequences subject to flanked changes of 8-10 homologous bases on each side. the introduction of the BglII site upstream from AUG ₁₂₀ did not affect glyphosate tolerance, but was eliminated by mutagenesis with the introduction of the BglII site upstream from AUG _186. The effect of both cases of mutagenesis on a ~ 45 kD protein was determined by subcloning of the mutated the sequences in T7 expression vectors using the polylinker of the plasmid pMON7470 of the KpnI site located immediately in the upstream direction from the original BglII site and the downstream HindIII site. This complete fragment was recloned into p18UT3T7 (PHARMACY) KpnI-HindIII and tested in vivo using the above procedure. And in this case, a ~ 45 kD protein was also expressed in comparable amounts from both “BglII” mutagenized sequences. When using new BglII sites in the form of 5'-ends (and a descending HindIII site) for cloning into pBIue Script BamHI-HindIII sites, a ~ 45 kD protein was expressed if the new BglII site in the upstream direction from AUG ₁₂₀ served as the 5'-end , but not in the case when the same site was located in the upstream direction from AUG ₁₈₆ and was the 5'-end. These data serve as very strong evidence that AUG ₁₂₀ (or some codon located very close to it) is the N-terminus of the glyphosate oxidoreductase protein. The BglII site, introduced upstream from AUG ₁₈₆ , does not lead to prematurely terminated or unstable protein, which suggests that the predictions resulting from such mutagenesis are in the coding sequence (Val ₁₈ -Cys ₁₉ ---> Arg ₁₈ -Ala ₁₉ ) had severe consequences on the activity of the enzyme.

Additional data confirming the location of the N-terminus was obtained by individually introducing the recognition sequence of the NcoI restriction site (CCATGG to CTATGT; substitution of serine for alanine in the second codon) or the NdeI sequence (CATATG to GCTATG) at AUC ₁₂₀ and expressing this OPC using efficient E .coli expression vectors. Expression of the NdeI variant is described in more detail below. The NdeI-HindIII fragment starting at the putative AUG codon is cloned into pMON2123 (NdeI-HindIII) with the ompF-IGF-I fusion fragment replaced (Wong et al., 1988). The resulting clone was introduced into E. coli JM101 and cells were induced for 2 hours with nalidixic acid according to the described procedure (Wong et al., 1988). The obtained one is not distinguishable by DS-PAGE in size from a protein of ~ 45 kD in size, and the cell lysate from the induced culture has a specific glyphosate oxidoreductase activity of 12.8 mmol AMPK / min • mg. When comparing in a separate experiment, no difference in glyphosate-oxidoreductase activity was observed if the second codon was alanine, and not serine. The structural DNA sequence for the glyphosate oxidoreductase enzyme (SEQ. N 4) starts at nucleotide 120 and ends at the nucleotide 1415 of the BglII-XhoI fragment (see FIG. 2) and the glyphosate oxidoreductase enzyme consists of 431 amino acids (SEQ. N 5).

Construction of transformation vectors of the plant glyphosate oxidoreductase gene
To facilitate manipulation of the glyphosate oxidoreductase structural gene, the internal EcoRI and NcoI site recognition sequences are deleted by site-directed mutagenesis, with the GAATTT sequence replaced by GAATTC and CCACGG by CCATGG, respectively. The coding sequence of glyphosate oxidoreductase suitable for introduction and expression in plant transformation vectors is constructed as follows. NcoI ("Met-Ala") N-terminus is linked to NcoI- and EcoRI-deleted coding sequences and C-terminations are deleted to the ScaI site in a series of cloning steps using internal SpnI and EcoRV restriction sites. At these stages, BglII is located immediately behind the NotI site in the upstream direction, and EcoRI and HindIII sites are located in the downstream direction immediately after the stop codon. The sequence of the glyphosate oxidoreductase gene thus treated (SEQ ID NO: 6) is shown in FIG. 3. The processed glyphosate oxidoreductase gene nonetheless encodes a wild-type glyphosate oxidoreductase protein. The performed manipulations do not change the amino acid sequence of glyphosate oxidoreductase. The structural sequence of glyphosate oxidoreductase (SEQ ID NO: 6) as a 1321 bp BglII / NcoI-EcoRI / HindIII fragment easily cloned into an appropriate plant expression cassette. Such a glyphosate oxidoreductase gene (SEQ ID NO: 6) is cloned as a BglII-EcoRI fragment into a plant transformation and expression vector pMON979 to form PMON17073.

Modification and re-synthesis of the glyphosate oxidoreductase gene sequence
The glyphosate oxidoreductase gene from LBAA contains sequences that may be incompatible with high gene expression in plants. Such sequences include potential polyadenylation sites, which are often A + T-enriched, have a higher G + C% compared with those found in plant genes (56% versus ~ 50%), differ in concentrated regions of G and C residues, and codons rarely used in plant genes. High G + C% in the glyphosate oxidoreductase gene leads to a number of potential consequences, including: higher use of G or C in the third position in the codons compared to plant genes and the potential ability to form strong hairpin structures that can affect expression or RNA stability. Reducing the G + C content of the glyphosate oxidoreductase gene, destroying G and C clusters, removing potential polyadenylation sequences and improving codon usability closer to the more common plant genes can lead to higher glyphosate oxidoreductase expression in plants.

 In the first phase of this experiment, site-directed mutagenesis modifies selected regions of the gene. These modifications are aimed primarily (but not exclusively) at reducing G + C% and at destroying G + C clusters. The processed glyphosate oxidoreductase gene is first recloned into the pMON7258 fragmentid vector as an NcoI-HindIII fragment to form pMON17014. Single-stranded DNA is obtained from dut und E. coli strain. Seven regions of the gene are modified by site-directed mutagenesis using the primers listed in Table IV and the VioRad mutagenesis kit (Catalog No. 170-3576) according to the procedure attached to the kit.

 For clarity, the reverse complements of these primers are given. The base positions in the sequences shown in FIG. 2 and 3, corresponding to the primers, are indicated by the first and second row of numbers, respectively.

 The structure of the obtained gene (SEQ ID NO: 7) was confirmed by sequential analysis and its ability to create glyphosate tolerance at a level comparable to the control treated with the glyphosate oxidoreductase gene. Such a modified gene (SEQ ID NO: 7) is hereinafter referred to as “modified glyphosate oxidoreductase”. G + C% of the glyphosate oxidoreductase gene (FOLLOW N 6) is reduced from ~ 56% in the processed version to ~ 57% in the modified version (FOLLOW N 7). A comparison of the processed and modified glyphosate oxidoreductase genes is shown in FIG. 3, where the processed version is shown above, and the changes introduced to obtain the modified version are shown below. Such a modified glyphosate oxidoreductase gene in the form of a BglII-EcoRI fragment is cloned into a plant expression cassette containing the En-CaMV35S promoter and NOS-3 ′ sequences. Such a cassette is then cloned as a NotI fragment into a pMON886 vector to form pMON17032 (Fig. 5).

 The synthetic glyphosate oxidoreductase gene (FOLLOW N 8) is designed to alter as many incompatible sequences as possible, as discussed above. In short, the gene sequence has been revised to remove as many sequences or sequence features as possible (while avoiding the introduction of unnecessary restriction sites): G or C clusters of 5 or more, A + T-enriched regions (predominantly) that can act as polyadenylation sites or as potential areas of RNA destabilization, or codons rarely found in plant genes. A comparison of the processed (SEQ. N 6) and synthetic (SEQ. N 8) glyphosate oxidoreductase genes is shown in FIG. 4, where the processed gene (FOLLOW-UP. N 6) is shown above, and the changes made to the synthetic gene (FOLLOW-UP. N 8) are shown below. G + C% for the synthetic glyphosate oxidoreductase gene ~ 51%, and the potential for the formation of short hairpin high energy structures is reduced. Such a synthetic gene is cloned as a BglII-EcoRI fragment in pMON979 to form pMON1765 for administration to plants.

Expression of chloroplast-directed glyphosate oxidoreductase
The target for glyphosate in plants is the enzyme 5-enolpiruvilshikimat-3-phosphate synthetase (EPSHFS), located in the chloroplast. Although the glyphosate oxidoreductase activity associated with the cytoplasm reduces / prevents glyphosate from reaching the chloroplast in the transgenic plant, the direction of the glyphosate oxidoreductase enzyme to chloroplast, as found, further reduces the effect of glyphosate on the SPSF synthetase. Many proteins localized in the chloroplast are expressed by the genes as precursors and sent to the chloroplast by the chloroplast transit peptide (CTP), which is removed at the import stages. Examples of such chloroplast proteins include: the small subunit (SSU) of ribulose-1,5-bisphosphate carboxylase (RUBIS CO), 5-enolpyruvyl chicimate-3-phosphate synthetase (EPSHFS), ferredoxin, ferredoxin oxidoreductase, light-absorbing complex protein I and protein I and thioredoxin F. It was shown in vivo and in vitro that non-chloroplast proteins can be sent to the chloroplast using fusion proteins with CTP and that the CTP sequence is sufficient to direct proteins to the chloroplast (della-Gioppa et al., 1987).

The glyphosate oxidoreductase protein was sent to the chloroplast by fusion between the C-terminus of CTP and the N-terminus of glyphosate oxidoreductase. In the first example, specialized CTP derived from the SSU1A gene from Arabidopsis thaliana was used (Timko et al., 1988). Such CTP (designated CTP1) is constructed by a combination of site-directed mutagenesis. The structure of CTP1 (FOLLOW N 9) (Fig. 6) includes SSU1A CTP (amino acids 1-55), the first 23 amino acids of the mature SSU1A protein (amino acids 56-78), the remainder of the serine (amino acid 79), a new segment repeating amino acids 50- 56 of SSU1A CTP and the first two amino acids of the mature protein (amino acids 80-87), as well as residues of alanine and methionine (amino acids (88 and 89). The NotI restriction site is located at the 3'-end (overlaps the Met codon), which facilitates the creation of an accurate fusion with the 5'-end of the glyphosate oxidoreductase gene or another gene. In the last step, the BglII site is introduced in the upstream direction and from the N-terminus of the SSU1A sequence to facilitate the incorporation of the fusion product into plant transformation vectors. The fusion protein is inserted between CTP1 (FOLLOW N 9) and the treated glyphosate oxidoreductase (FOLLOW N 6) (via the NcoI site) in pGEM3 ∋ f (+ ) a vector with the formation of pMON17034. Such a vector can be transcribed in vitro using SP6 polymerase and transcribed by translation of RNA with ³⁵ S-methionine to obtain a product that can be tested for import into chloroplasts isolated from Lactuca sativa using the methods described below (della-Cioppa et al., 1986). The fusion product of CTP1-glyphosate oxidoreductase is then combined with the synthetic glyphosate oxidoreductase gene (SEQ. N 8) and the resulting product is introduced as a BglII-EcoRI fragment into the plant vector pMON979 to form pMON17138 (Fig. 7). After an intermediate cloning step to create a larger number of cloning sites, such a CTP1-glyphosate oxidoreductase fusion product is also cloned as an XbaI-BamHI site into pMON981 to form pMON17138 (FIG. 8).

In a second example, a CTP glyphosate oxidoreductase fusion product is inserted between Arabidopsis thaliana CPSF (Klee et al., 1987) CTP and synthetic glyphosate oxidoreductase coding sequences. Arabidopsis CTP is first subjected to site-directed mutagenesis with the introduction of the SphI restriction site at the CTP processing site. As a result of mutagenesis, Glu-Lys are replaced at the indicated location with Cys-Met. The sequence of such a CTP called CTP2 (FOLLOW N 10) is shown in FIG. 9. The NcoI site of the synthetic glyphosate oxidoreductase gene (FOLLOW N 8) is replaced by the SphI site overlapping the Met codon. At the same stage, the second codon is converted into a codon for leucine. Such a change does not have a visible effect on the in vivo activity of glyphosate oxidoreductase in E. coli. The fusion product CTP2-synthetic glyphosate oxidoreductase is then cloned into pBIue Script KS (+) and the resulting matrix is transcribed in vitro using T7 polymerase, and the ³⁵ S-methionine-labeled product is shown to be imported with efficacy comparable to that of importing the fusion product ChTP1-glyphosate oxidoreductase. The fusion product of the CTP2-synthetic glyphosate oxidoreductase is then cloned as an XbaI-BamI fragment into a plant expression vector to form pMON17164. A structural map of this plasmid is shown in FIG. 12.

 Part of the plant vector pMON17164 (Fig. 12) consists of the following segments. Chimeric kanamycin resistance gene, created for expression in a plant to enable selection of transformed tissue. The chimeric gene consists of the 35S promoter of the cauliflower mosaic virus of 0.35 kb. (P-35S) (Odell et al., 1985), 0.83 k.o. gene neomycin phosphotransferase type II (KAN) and 0.26 K. about. 3'-non-translational region of the nopalin synthetase (NOS3 ') gene (Fraley et al., 1983). 0.45 kb ClaI-DraI fragment from pT 15955 an octopine Ti plasmid containing T-DNA left boundary region (Barker et al., 1983). A 0.75 kb segment containing a replication source from the RK2 plasmid (ori-V) (Stalker et al., 1981). 3 kb SalI-PstI segment from pBR322, which provides a source of replication in E. coli (ori-322) and gives a bom site for conjugation transfer to Agrobacterium tumefaciens cells of a 0.93 kb fragment isolated from transposon T7 and encodes bacterial resistance to spectinomycin / streptomycin (Scp / Str) (Fling et al., 1985), which is determinant for selection in E. coli and Agrobacterium tumefaciens. 0.36 kb PvuI-bclI fragment from a pTiT37 plasmid containing T-DNA of the right border region of the nopaline type (Fraley et al., 1985). Expression cassette consisting of 0.6 k.o. 35S promoter from mosaic Noricum virus (P-FMV) (Cowda et al., 1989), several unique cloning sites and 0.7 kb 3'-non-translational region of the rbcS-E9 pea gene (E9 3 ') (Coruzzi et al., 1984 and Morelli et al., 1985). The fusion product of CTP2-synthetic glyphosate oxidoreductase is cloned into the indicated expression cassette. The introduction of this plasmid into Agrobacterium and the subsequent transformation of plants is disclosed in the following examples.

 It is obvious to the skilled person that a variety of chimeric constructs can be created using the ability of a specific CTP to import the corresponding glyphosate oxidoreductase enzyme into the plant cell chloroplast. The import of glyphosate oxidoreductase into the chloroplast can be determined using the following analysis.

Chloroplast uptake assay
By centrifugation from lettuce (Lactuca sativa, Longifolia cultivar) in the Percol / Ficol gradient, intact chloroplasts are isolated according to the modified method of Bartlett et al., (1982). The resulting debris of intact chloroplasts is suspended in 0.5 ml of sterile 330 mM sorbitol in 50 mM Hepes-KOH (pH 7.7) tested for chlorophyll (Arnon, 1949), and the final chlorophyll concentration is set at 4 mg / ml (using sorbitol / Gepes). The yield of intact chloroplasts from a single hummock salad is 3-6 mg of chlorophyll.

 In a typical absorption experiment with 300 μl, 5 mM ATP, 8.3 mM unlabeled methionine, 322 mM sorbitol, 58.3 mM Hepes-KOH (pH 8), 50 μl reticulocyte lysate translation product and intact chloroplasts from L. sativa ( 200 μg of chlorophyll). The resulting mixture was carefully rotated at room temperature (in test tubes made of glass measuring 10 x 75 mm) immediately in front of a fiber-optic emitter tuned to the maximum light intensity (150 W lamp). Aliquots of the mixture samples (approximately 50 μl) are taken at different time intervals and fractionated in silicone oil gradients (in 150 μl polyethylene tubes) by centrifugation for 30 s at 11000 X G. Under these conditions, intact chloroplasts form debris under the silicone oil layer, and the incubation medium (containing reticulocyte lysate) floats to the surface. After centrifugation, the gradients of silicone oil are immediately frozen in dry ice. Chloroplastic debris is then resuspended in 50-100 μl of lysis buffer (10 mM Hepes-KOH with pH 7.5, 1 mM PMSF, 1 mM benzamidine, 5 mM ∈ amino-n-caproic acid and 30 μg / ml aprotinin) and centrifuged 20 min at 15,000 X G to convert to thylakoid membrane debris. A clear supernatant (stromal proteins) obtained by centrifugation and an aliquot of the incubation medium with reticulocyte lysate from each absorption experiment were mixed with an equal volume of 2X VAT-AGE sample electrophoresis buffer (see below).

VAT-PAGE is carried out according to the method of Laemmli (1970) in 3-17% (w / v) acrylamide gel plates (60 mm x 1.5 mm) with 3% (w / v) acrylamide concentrating gel (5 mm x 1.5 mm). The gel is fixed for 20-30 minutes in a solution of 40% methanol and 10% acetic acid. Then the gel is soaked for 20-30 minutes in EN ³ HANCE ^R (DuPont), followed by drying of the gel in a gel dryer. The gel is developed by autoradiography using an intensifying screen and approximately daily exposure to determine whether glyphosate oxidoreductase was imported into the isolated chloroplasts.

An alternative technique for isolating other structural glyphosate oxidoreductase genes
A number of other glyphosate oxidoreductase genes have been identified and cloned, including the second LBAA glyphosate oxidoreductase gene from cosmid pMON7477 class II. The gene is located (Southern hybridization) on a ~ 23 kb HindIII fragment, described in the cloning section above, using the first glyphosate oxidoreductase gene as a probe. Southern analysis also showed PstI and BglII hybridization bands at ~ 3.5 and ~ 2.5 K. about. respectively. The BglII fragment from pMON7477 is subcloned into the BamHI site of the pBlue Script vector. Clone in E. coli JM101 (pMON7482), in which the cloned fragment is oriented relative to the Iac promoter in the same way as in pMON17469 # 1, IPTG is induced and analyzed for glyphosate oxidoreductase activity. In this experiment, Ud.act. ~ 93 nmol / min • mg. In a subsequent experiment, cosmids of class I and class II were isolated after infection with E. coli JM101 with a packaged cosmid preparation and selection directly for glyphosate tolerance at a glyphosate concentration of 3-5 mM on M9 medium.

 The glyphosate oxidoreductase gene was also subcloned from another microbial isolate, originally identified by its ability to metabolize glyphosate as a source of phosphorus, and for which later the content of the putative glyphosate oxidoreductase gene was shown when hybridized with the LBAA glyphosate oxidoreductase gene probe. This was first cloned into the T7 promoter cosmid by glyphosate tolerance selection in E. coli HB101 / pGPI-2 (Boyer and Rolland-Dussoix, 1969; Tabor and Richardson, 1985) on M9 medium containing 3 mM glyphosate. The presence of the glyphosate oxidoreductase gene was initially indicated by a positive hybridization signal with the LBAA gene, as well as its position on the 2.5 kb BglII fragment. This BglII fragment was cloned into the BamHI site in pBlue Script (pMON17183) and expressed from the Iac promoter by the addition of IPTG. In this experiment, glyphosate oxidoreductase with a specific activity of 53 nmol / min • mg was obtained, confirming gene isolation with this strategy. The following features are usually found in these glyphosate oxidoreductase genes: genes are determined (Southern hybridization using full length glyphosate oxidoreductase gene probes) on BqlII fragments of ~ 2.5 kb, on PstI fragments of ~ 3.5 kb, contain one EcoRI site within a gene and genes do not contain a HindIII site. A schematic diagram (see FIG. 13) illustrates some common features of these genes.

 The great similarity of the glyphosate oxidoreductase genes also suggests a different way in which glyphosate oxidoreductase can be cloned. The apparent conservatism of the regions flanking the genes and the absence of specific restriction sites suggests the application of single-stranded oligonucleotide probes to the flanking regions containing restriction sites for BglII, HindIII, PstI, BamHI, NdeI or other acceptable CRP cloning sites (polymerase chain reaction, all the details of CR for its use, see Erlich, 1989) for amplification of a glyphosate oxidoreductase gene fragment acceptable for cloning. Flanking sequences for 119 bp in the upstream direction (SEQ. N 11) of the wild-type glyphosate oxidoreductase gene (LBAA isolate) and for ~ 290 bp (FOLLOW. N 12) in the downstream direction of the gene are shown in FIG. 2.

Using the CRP approach, glyphosate oxidoreductase genes were isolated from a number of sources. The presence of glyphosate oxidoreductase activity was confirmed by cloning the glyphosate oxidoreductase gene from chromosomal DNA obtained from the species Pseudomanas strain LBr (Jacob et al., 1988) and using primers homologous to the N- and C-termini of the glyphosate oxidoreduced LBAA gene containing the glyphosate oxidoreduced Acceptable restriction cloning sites:
5'-GAGAGACTGT CGACTCCGCG GGAGCATCAT ATG-3 '(LAST N 13)
and 5'-GAACGAATCC AAGCTTCTCA CGACCGCGTA AGTAC-3 '(LAST N 14)
For these CRP reactions, the following cyclothermal parameters are used:
Denaturing at 94 ^o C 1 min;
Hybridization at 60 ^o C 2 min;
Polymerization at 72 ^o C 3 min
30 cycles without auto-amplification, binding by incubation at 4 ^o C.

The expected CRP product of ~ 1.3 kb was formed. and after hydrolysis in the presence of NdeI and HindIII, the fragment is cloned into pMON2123 to express the encoded enzyme. Glyphosate oxidoreductase activity is determined by the above method, and K _m for glyphosate is similar to the above values for enzymes from LBAA.

Glyphosate oxidoreductase gene source K _m (glyphosate, mM) Pseudomonas species, strain LBr
Bacteria isolated from auxiliary glyphosate production waste treatment streams may also be able to convert glyphosate to AMPK. The Pseudomonas LBAA and LBr strains are examples of such bacteria. Such bacteria can be excreted de novo from such waste products.

The bacterial population is isolated from a fixed-bed column of immobilized cells using Mannville R-635 beads of diatomaceous earth coated with tryptone soy agar (Difco) containing 100 ug / ml cycloheximide and incubated at 28 ^° C. The column works for three months on waste water as raw materials from the glyphosate production plant of the Monsanto Company branch, pcs. MS. The column contains 50 mg / ml glyphosate and NH ₃ as NH ₄ Cl. The total organic carbon content of 300 mg / ml and PBC (Biological Oxygen Demand - a measure of the availability of soft carbon) is less than 30 mg / ml. Such a processing column is described by Heitkamp et al. (1990). One of the predominant members of this population, identified as a T10 strain of the species Agrobacterium, grows as it was found in a minimal broth in which glyphosate is the only carbon source at a concentration of 10 mM (such a broth is prepared in the same way as DF medium, but with replacement of glucose, gluconate and citrate with glyphosate). Chromosomal DNA is obtained from this isolate and subjected to the same CRP procedure and with the same primers as described above for the LBr strain. A fragment of the desired size is formed, which is cloned into an E. coli expression vector. Glyphosate oxidoreductase activity is analyzed and, in addition, K is determined for glyphosate:
The source of the gene is K (glyphosate, mm)
Agrobacterium species, strain T10 - 28
The conversion of glyphosate to AMPA has been established for many different soils (for a review see: Malik et al., 1989), and there are a number of techniques for extracting total DNA from mixed environmental samples, such as soil (Holben. Et al, 1988; Steffan and Atlas 1988; Tsai and Olson, 1991), which suggests the possibility of cloning glyphosate oxidoreductase genes without first having to obtain an isolate, such as destroyed microorganisms. Of course, the technique disclosed for cloning glyphosate oxidoreductase genes and based on giving E. coli the ability to metabolize glyphosate or glyphosate tolerance offers a scheme by which other glyphosate oxidoreductase genes and other glyphosate metabolism genes can be cloned without relying on homology specific for the glyphosate oxidoreductase gene disclosed herein. Enrichment of glyphosate-degrading bacteria is also possible, for example, by repeated application of glyphosate to a soil site (Quinn et al., 1988; Talbot et al., 1984). Such an enrichment step can be used to more easily isolate glyphosate oxidoreductase genes from soil or other environmental samples.

Evidence for the presence of the glyphosate oxidoreductase gene in soil bacteria and the method for isolating such genes are presented below. The population of the corresponding bacteria is enriched in order to select bacteria capable of growing in a liquid medium with glyphosate (10 mM) as a carbon source (such a medium is prepared according to the preparation of the Dvorkin-Foster medium, but with the exception of carbon sources and using P as the source of P). The inoculum is created by extracting the soil (from fields in Jerseyville with recently harvested soybeans, Illinois) and selecting the population by successive cultivation at 28 ^° C in the above medium (100 μg / ml cycloheximide added to prevent fungal growth). When applied to plates with L-agar, colonies of 5 types were identified as medium. Chromosomal DNA is obtained from 2 ml of a culture of these isolates in 1-broth and the presence of the glyphosate oxidoreductase gene is probed by PCR selection. Using primers: GCCGAGATGACCGTGGCCGAAAGC (FOLLOW N 15) and GGGAATGCCGCATGCTTCAACGGC (FOLLOW N 16) obtained a DNA fragment of the predicted size with chromosomal DNA from one of the isolates (designated as 3). The conditions of the CRP are as follows: 1 min at 94 ^o C; 2 min at 40 ^o C; 3 min at 72 ^o C, 35 cycles. The DNA fragment obtained in this way is used as a probe (after radiolabelling) to isolate 3 candidates for glyphosate oxidoreductase genes from a cosmid bank constructed as described for LBAA DNA, which greatly accelerates the isolation of other glyphosate oxidoreductase genes. The primers used are homologous to the internal sequences in the LBAA glyphosate oxidoreductase gene. The PCR conditions used allow a significant degree of mismatch between the primers, and the result suggests that the glyphosate oxidoreductase gene from 3 may not be so close to other glyphosate oxidoreductase genes sequentially isolated with primers to the N- and C-terminus of LBAA gene.

 There are a variety of gene isolation techniques. Some of these techniques are based on knowledge of the purpose of the gene, which allows the creation of phenotypic screening aids that help isolate. Other methods are based on information about at least a portion of the DNA sequence, which allows the use of probes or primers with partial or complete homology, or the methods are based on the use of antibodies that detect a gene product. All these possibilities can be applied for cloning glyphosate oxidoreductase genes.

Improving the kinetic properties of glyphosate oxidoreductase
Previous examples of the creation of herbicidal resistance by enzymatic deactivation of the herbicide were based on the use of enzymes with the ability to bind and metabolize herbicides with much greater efficiency compared to glyphosate metabolism under the influence of glyphosate oxidoreductase. The glyphosate oxidoreductase enzyme is characterized by a K to glyphosate value of 20-30 mM; therefore, the rate of glyphosate destruction reaction can be brought to the optimum level in transgenic plants either by decreasing K _m or increasing V _max .

Random mutagenesis technology, combined with appropriate selection and / or selection, is a powerful tool that has been successfully used to create a large number of mutagenized gene sequences and potential variants. The same approach can be used to isolate and identify glyphosate oxidoreductase variants with improved glyphosate breakdown efficiency. Mutagenesis technology that can be used includes chemical mutagenesis of bacterial cultures containing the gene of interest or purified DNA containing this gene, as well as the CRP methods used to create copies of the gene (or parts thereof) under conditions conducive to the erroneous introduction of nucleotides ( errors) into a new thread. For example, conduction of CRP in the presence of Mn ⁺⁺ contributes to this.

Suitable means for selecting in vivo mutagenesis-enhanced variants may be improved glyphosate tolerance in E. coli or increased glyphosate growth in Mpu ⁺ strains. For selection, the glyphosate oxidoreductase gene is cloned into a vector containing a weak bacterial promoter and / or replicon with a small number of copies. Glyphosate tolerance phenotypes, as shown, vary in the range of glyphosate concentration and correlate with the level of glyphosate oxidoreductase expression. For example, under non-inducible conditions, Plac-glyphosate oxidoreductase vectors express less glyphosate oxidoreductase than PrecA glyphosate oxidoreductase vectors, and also have less glyphosate tolerance. The mutagenized gene fragment is cloned into the most suitable vector and then the resulting library is selected. Variants are selected for their ability to grow at glyphosate concentrations that inhibit the growth of a control strain containing a related glyphosate oxidoreductase clone. Glyphosate oxidoreductase activity gives E. coli the ability to convert glyphosate to AMPK, and in suitable E. coli strains this AMPK can serve as a phosphate source after cleavage of the CP bond with CP lyase. Suitable strains of E. coli include B strains or Mpu ⁺ derivatives of K strains. The glyphosate oxidoreductase gene gives E. coli strain JM101 Mpu ⁺ (= GB993) minimal growth on glyphosate as the sole source of phosphorus. The growth rate on glyphosate was also shown to correlate with the level of glyphosate oxidoreductase expression. The mutagenized glyphosate oxidoreductase gene is cloned into an acceptable vector and the library of variants is selected at various growth rates on plates or cultured in a medium containing glyphosate as the sole source of phosphorus. Clones showing faster growth on the plates compared to the control strain are then re-selected by growth curve analysis.

Glyphosate oxidoreductase variants identified during each selection / selection are cloned into a vector for expression at a high level and subjected to enzymatic analysis with determination of K _m and V _max values for glyphosate. The best glyphosate oxidoreductase variants are purified for complete kinetic characterization. Glyphosate oxidoreductase variants for which lower K _m values and similar or higher V _max values as compared to the values for the wild-type enzyme are determined are subjected to nucleic acid sequencing to determine the mutation (s). The goal of isolating the options will be to increase the k _cat / K _m ratio for glyphosate oxidoreductase-catalyzed degradation of glyphosate.

Highlighted option with similar improvements. The mutagenesis technique used was the use of CRP with Mn ⁺⁺ poisoning, and the matrix was a linearly transformed gene plasmid of glyphosate oxidoreductase containing the synthetic glyphosate oxidoreductase gene (FOLLOW N 8). The oligonucleotide primers used were homologous to the regions of the vector and flank the glyphosate oxidoreductase gene. The following PCR conditions were used: 1 min at 94 ^o C, 2 min at 55 ^o C, 3 min at 72 ^o C, 35 cycles. Apply a 5: 1 ratio of dCTP + dCTP + TTP to dATP. The reaction mixture contains MnCl ₂ at concentrations of 125, 250, 375 or 500 μM. After the reaction, the amplified product is recloned into a vector containing the weak E. coli promoter. This vector is a pBR327 derivative containing the araBAD promoter and acceptable cloning sites. One hundred colonies from this cloning step are then selected in E. coli GB993 for improved glyphosate tolerance and assimilation phenotypes in a medium that is MOPS minimal medium with glyphosate and Pi or only glyphosate, respectively. Growth rates are determined by measuring A ₅₅₀ for 96 hours. Three clones have been identified that are characterized by faster growth rates in this selection. These transformants differ 1.5-2 times faster phenotype of assimilation. The glyphosate oxidoreductase gene is recloned into a part of the expression vector with verification of this genotype. All kinetic analysis was performed on crude E. coli lysates. Putative glyphosate oxidoreductase protein variants were overexpressed after subcloning the NcoI / HindIII variant of the glyphosate oxidoreductase gene into the PrecA gene IOL expression vector. For overexpressions in PrecA gene IOL constructs, the CB993 vector containing cells are induced at Klett = 110-120 in M9 minimal medium with 50 μg / ml nalidixic acid and allowed to grow 2.5 hours at 37 ^° C with vigorous shaking. Cells were harvested by centrifugation for 5 min at 4000 G and 4 ^° C and resuspended in 100 mM Tris-HCl (pH 7.1), 1 mM EDTA, 35 mM KCl, 20% glycerol and 1 mM benzamidine at 3 ml / g debris. Lysates are obtained by disrupting cells in the French press twice at 1000 psi (68 atm). Insoluble debris was removed by centrifugation for 15 min at 12000G and 4 ^° C, and the supernatant was desalted by passing through a PD-10 column (Sephadex G-25, Pharmacy). The free volume fraction is used as an enzyme source in kinetic analysis. Protein concentrations are determined using a BioRad dye protein binding assay. To determine the linear intervals build the curves of time and concentration of the enzyme. Enzymatic analysis is carried out as follows. The lysate and glyphosate oxidoreductase mixture (final concentration = 0.1 M MOPS, 0.01 M tricin with a pH of 7.4, 0.01 mm FAD, 10 mm MgCl ₂ ) in 100 μl of the reaction medium is incubated for 2 min at 30 ^o C before adding glyphosate (a pure sample for analysis was obtained from water with a pH of 7 adjusted by adding NaOH). It was determined that the optimal time for enzymatic analysis using 10 μg of lysate is 10 minutes. After 10 minutes at 30 ^° C. and shaking, 0.25 ml of dinitrophenylhydrazine reagent (DNPH; 0.5 mg / ml in 0.5 M HCl) is added and the reaction mixture is left for another 5 minutes at 30 ^° C. and shaking. Then, a solution (400 μl) of 1.5 M NaOH was added to the analyzed mixture, and the reaction was continued for 5 minutes at 30 ^° C. and shaken. Enzymatic activity is determined by the amount of glyoxylate-DNPH adduct formed by measuring A ₅₂₀ relative to the glyphosate standard. Enzymatic analysis is carried out in duplicates on at least two isolates of the colonies of the proposed variant glyphosate oxidoreductase. To determine K _m and V _max, enzymatic analysis is carried out in the (0.2-2) xK range of glyphosate concentrations. The values of K _m and V _{max are} determined on the basis of linear construction curves according to Burk, Eadie-Hofstee and hibernolic kinetic curves. The V _max value is obtained after determining the amount of the glyphosate oxidoreductase immunoreactive protein in the lysate using the immunoblot assay described below. Immunoblot analysis is carried out after VAT-PAGE and transfer of the protein from the gel to nitrocellulose at 500 mA in a Hoeffer transfer apparatus in 25 mM Tris-HCl, 192 mM glycine containing 0.1% VAT and 25% methanol, for 1-2 h. After transferring, nitrocellulose is incubated at room temperature and shaken for at least 30 minutes with 50 mM Tris-HCl (pH 7.5), 0.9% NaCl, 0.01% Tween 20, 0.02% NaN ₃ containing 2% bovine serum albumin. After blocking, add the same buffer containing in dilution 1: 25000 goat anti-glyphosate-oxidoreductase antiserum, and the filter is shaken for 45 minutes at room temperature. After incubation with primary glyphosate oxidoreductase antibodies, the filter is washed 45 minutes in an antibody-free buffer, then second rabbit antibodies to goat antibodies bound to alkaline phosphatase (from Pierce) are added in dilution 1: 5000, and the filter is incubated for 45 minutes at room temperature with shaking . The filter is then washed for 30 minutes in a buffer without antibodies before adding NBT and BCIP (Promega) for staining. The immunoreactive glyphosate oxidoreductase protein is also quantified by dot blotting the lysate on nitrocellulose, followed by the filter processing as described above, except that ¹²⁵ I-protein G is used for detection. The amount of glyphosate oxidoreductase protein in the lysate is determined by staining and comparing the level of radioactivity with protein standard glyphosate oxidoreductase. One of the variants (V.247) showed 3-4 times higher specific activity for glyphosate oxidoreductase at 25 mM glyphosate, and immunoblot analysis showed that this was not caused by an increased level of glyphosate oxidoreductase protein. Subsequent analyzes found that this variant has a 10-fold lower K _m value for glyphosate compared to wild-type glyphosate oxidoreductase. The value of K _m for the IMU was determined in a similar way, and the data obtained are presented in table. A.

 The glyphosate oxidoreductase gene was sequenced (FOLLOW N 17), with five changes in nucleotides detected. These changes are indicated below in relation to the codons: GCT on GCC (codon 43), without changing the amino acid; AGC on GGC (codon 84), Ser on Gly; AAG on AGG (codon 153), Lys on Arg; GAC on CGC (codon 334), His on Arg and CCA on CCG (codon 362), without changing the amino acid. The amino acid sequence of the glyphosate oxidoreductase gene from V.247 is presented AFTER. N 18. The importance of these various changes in amino acids was initially determined by the re-cloning of the changed regions into wild-type glyphosate oxidoreductase, followed by the identification of the effect of the changes on the glyphosate oxidoreductase activity and kinetics. This operation was accompanied by the reclamation of the NcoI-NheI fragment (contains codon 84), the NheI-ApaLI fragment (contains codon 153) and the ApaLI-HindIII fragment (contains codon 334) individually into the wild-type gene. These glyphosate oxidoreductase genes are then expressed followed by kinetic analysis. The data obtained are presented in table. B, show that only the changes that occurred in the ApaLI-HindIII fragment (contains codon 334) are responsible for the change in the enzyme.

The results are confirmed and extended by repeating the substitution of His for Arg at codon 334 and introducing other specific changes in this residue by site-directed mutagenesis. The primers used are listed below:
Arg - CGTTCTCTAC ACTCGTGCTC GTAAGTTGC (LAST N 19);
Lys - CGTTCTCTAC ACTAAGGCTC GTAAGTTGC (LAST N 20);
Gln - CGTTCTCTAC ACTCAAGCTC GTAAGTTGC (LAST N 21);
Ala - CGTTCTCTAC ACTGCTGCTC GTAAGTTGC (LAST N 22).

 (the given sequences are opposite to the sequences actually used). The presence of these changes is confirmed by sequencing analysis of mutagenized glyphosate oxidoreductase genes and kinetic analysis of glyphosate oxidoreductase enzymes. The data obtained are presented in table. B, show that in this position a number of substitutions are possible, which lead to an enzyme with altered kinetic properties.

 Additional mutagenesis was carried out to replace the H 334 residue with other amino acids. The primers used and the new codons are listed below.

Trp - CTCTACACTTGGGCTCGTAAGCTTCTTCCAGC (LAST N 23);
Ile - CTCTACACTATCGCTCGTAAGCTTCTTCCAGC (LAST N 24);
Leu - CTCTACACTCTGGCTCCTAAGCTTCTTCCAGC (LAST N 25);
Glu - CTCTACACTGAAGCTCGTAAGCTTCTTCCAGC (LAST N 26)
(the sequences shown are opposite to the sequences actually used, in addition, these primers add a “silent” HindIII site that accelerates the mutagenized progeny of this population). The GLU 334 variant retains significant glyphosate oxidoreductase activity, while the TRP334, ILE334 and LEU334 variants retain much less activity.

Of the first-generation variants, those with the highest k _cat / K _m ratios recommend a second round of mutagenesis followed by selection and analysis. An alternative approach is to construct a second generation of glyphosate oxidoreductase variants by combining the single point mutagenesis identified in the first generation variants.

TRANSFORMATION OF PLANTS
Plants to which glyphosate tolerance may be imparted by the practice of the present invention include, but are not limited to: soybean, cotton, corn, rutabaga, oilseed rape, flax, sugar beets, sunflowers, potatoes, tobacco, tomatoes, wheat, rice, alfalfa , salad, apple trees, poplar and pine.

 The double-stranded DNA molecule of the present invention ("chimeric gene") can be introduced into the plant genome by any suitable method. Suitable plant transformation vectors include vectors originating from the Ti plasmid Agrobacterium tumefaciens, as well as vectors written off in the works, for example: Herrera-Estrella (1983), Bevan (1984), Klee (1985) and in EPO publication 120516 (Schilperoort and other). In addition to plant transformation vectors originating from Ti or induced by roots (Ri) of Agrobacterium plasmids, DNA constructs of the present invention can be introduced into plant cells in alternative methods. Such may include, for example: the use of liposomes, electroporation, the use of chemicals that increase the uptake of free DNA, the isolation of free DNA using micro-focused bombardment, and transformation using a virus or pollen.

 The plant transformation vector pMON979 originates from pMON886 (described below) when replacing the neomycin phosphotransferase type II gene (KAN) in pMON886 with a 0.89 kb fragment. containing the bacterial gene of gentamicin-3-N-acetyl transferase type III (AAC (3) -III) (Hayford et al., 1988). The chimeric P-35S / AA (3) -III / NOS3 'gene encodes resistance to gentamicin, which allows the selection of transformed plant cells. pMON979 also contains a 0.95 kb expression cassette consisting of an amplified CaMV35S promoter (Kay et al., 1987), several unique restriction sites, and a NOS3 'end (P-En-CaMV35S / NOS 3'). The remaining DNA segments in pMON979 are exactly the same as in pMON886.

 Plasmid pMON886 is constructed from the following DNA segments. The first is a fragment of 0.93 K. about. from AvaI to the created EcoRV, isolated from Tn7 transposon encoding bacterial resistance to spectinomycin / streptomycin (Spc / Str), which is determinant for selection in E. coli and Agrobacterium tumefaciens. This fragment is connected to a 1.61 kb DNA segment encoding a chimeric kanamycin resistance gene, allowing selection of transformed plant cells. The chimeric gene (P-35S / KAN / NOS 3 ') consists of the 35S promoter of cauliflower mosaic virus (CaMV), the neomycin phosphotransferase gene type II (KAN), and the 3'-non-translational region of the nopalin synthetase gene (NOS 3') (Fraley et al., 1983). The next segment is represented by 0.75 k.o. oriV containing a replication source from an RK2 plasmid. The segment is attached to the 3.1 kb SaII-PvuI segment. plasmid pBR322 (ori 322), which provides a source of replication for establishment in the E. coli and bom site of conjugation transfer into Agrobacterium tumefaciens cells. The following is represented by 0.36 k.o. PvuI-BclI from pTiT37 carrying the right boundary region of T-DNA of nopaline tina (Fraley et al., 1985).

 Plasmid pMON981 contains the following DNA segments: 0.93 k.o. a fragment isolated from transposon Tn7 encoding bacterial resistance to spectinomycin / streptomycin / Spc / Str determinant for selection in E. coli and Agrobacterium tumefaciens (Fling et al., 1985) /; chimeric kanamycin resistance gene, created for expression in plants to select transformed tissue and consisting of 0.35 kb 35S promoter of cauliflower mosaic virus (P-35S) (Odell et al., 1985), 0.83 k.o. type II neomycin phosphotransferase gene (KAN) and 0.26 k.o. The 3'-non-translational region of the nopalin synthetase (NOS 3 ') gene (Fraley et al., 1983); 0.75 k.o. a replication source from an RK2 plasmid (oriV) (Stalker et al., 1981); 3.1 k.o. SaII-PvuI segment from pBR322, providing a replication source for establishment in E. coli (ori-322) and bom site of conjugation transfer to Agrobacterium tumefaciens cells, and 0.36 k.o. PvuI-BclI fragment from pTiT37, a plasmid containing the right boundary region of T-DNA of the nopaline type (Fraley et al., 1985). The expression cassette consists of 0.6 k.o. 35S promoter from mosaic Noricum virus (P-FMV) (Cowada et al., 1989) and 0.7 kb 3'-non-translational region of the rbc S-E9 pea gene (E9 3 ') (Coruzzi et al. 1984 and Morelli et al. 1985), 0.6 kb SspI fragment containing the FMV35S promoter (FIG. 1), create for the implementation of acceptable cloning sites in the downstream direction from the site of the beginning of transcription.

 The plant vector is mobilized in an ABI strain of Agrobacterium tumefaciens. The ABI strain is A208 Agrobacterium tumefaciens, carrying a shoulderless plasmid pTiC58 (pMP90RK) (Koncz u Schell, 1986). The Ti plasmid does not carry the T-DNA genes of phytohormones, as a result of which the strain is not able to cause crown gall disease. The crossing of the plant vector in ABI is carried out in a threefold conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980). When incubating plant tissue with ABI conjugate: the plant vector is transferred to plant cells using vir functions encoded by the non-humeral pTiC58 plasmid. The vector opens at the right boundary region of T-DNA, and the complete sequence of the plant vector can be introduced into the chromosome of the host plant. Plasmid pTiC58 is not transferred to the plant cell, but remains in Agrobacterium.

PLANT REGENERATION
Upon reaching adequate production of glyphosate oxidoreductase activity in transformed cells (or protoplasts), the cells (or protoplasts) regenerate into the whole plant. The choice of the methodology of the regeneration stage does not play a decisive role, and acceptable methods exist for hosts from Leguminosae (Lucerne, soy, clover, etc.), Umbelliferae (carrots, celery, parsnips), Cruciferae (cabbage, radishes, rape, etc. .), Cucurbitaceae (melon and cucumber), Gramineae (wheat, rice, corn, etc.), Solanaceae (potatoes, tobacco, tomatoes, peppers) and various flower crops. See, for example: Ammirato, 1984, Shimamoto, 1989; Fromm 1990; Vasil 1990.

 The following examples are given to better illuminate the practice of the present invention and should in no way be construed as limiting the scope of the present invention. It will be apparent to one skilled in the art that various modifications, truncations, etc., may be made to the methods and genes disclosed herein without departing from the spirit and scope of the present invention.

EXAMPLES
Expression, activity and phenotype of glyphosate oxidoreductase in transformed plants
The following, exemplary embodiments of the invention describe the transformation, expression, activity of glyphosate oxidoreductase and the glyphosate tolerance phenotype imparted to plants by glyphosate oxidoreductase genes introduced into Nicoliana tabacum, Samsun and / or brassica napus cultivar, cultivar West vectors pMON17073, pMON17032, pMON17065, pMON17066, pMON17138 and pMON17164. Baseline tobacco data for the expression of the treated glyphosate oxidoreductase gene (SEQ ID NO: 6) under the control of the En-CaMV35S promoter (see data for pMON17073 in tables VIII and IX, for example) indicate a very low level of glyphosate oxidoreductase expression. Gene transcription was confirmed in the case of 3-4 Northern and S1 plants by analysis, but no glyphosate oxidoreductase protein was detected (the detection limit in this analysis was ~ 0.01% of the expression level). Analysis of R ₀ plants after spraying 0.4 lb / ha (approximately 0.448 kg / ha) of glyphosate also revealed a very low tolerance level. Modification of the gene sequence (see above) led to improved expression in tobacco, as well as the use of the FMV promoter and the use of CTP fusion with the glyphosate oxidoreductase gene. For this reason, most of the data presented relates to transgenic plants obtained using vectors containing these improved glyphosate oxidoreductase constructs. One series of experiments with a modified glyphosate oxidoreductase vector (pMON17032) is presented in Example 1, and a study of processed glyphosate oxidoreductase, synthetic glyphosate oxidoreductase, and CTP1 synthetic glyphosate oxidoreductase is presented in Example 2. Transformation and expression of glycosate oxidoreductase 3.

Example 1
The method of transformation on circles of tobacco leaves requires healthy leaves about 1 month old. After sterilizing the surface for 15-20 minutes, 10% Chlorox plus surfactant leaves are rinsed 3 times with sterile water. Using a sterile paper stamp, circles are cut from the leaves, which are placed with their inner surface upwards on MS104 medium (MS salts 4.3 g / l, sucrose 30 g / l, B5 vitamins 500X 2 ml / l, HYK 0.1 mg / l, BA 1 mg / l) for precultivation within 1 day.

 The circles are then inoculated with an approximately daily culture of a non-braided strain of Agrobacterium ABI containing the target vector diluted in a 1/5 ratio (i.e., approximately 0.6 OD). Inoculation is carried out by placing circles in centrifuge culture tubes. After 30-60 seconds, the liquid is drained and the mugs are placed between sterile filter paper. The mugs are then placed with their inner surface upward on the MS104 growth medium along with filter paper mugs for co-cultivation.

 After 2-3 days of co-cultivation, the circles are again transferred with the inner surface up to the selection plates with MS104 medium. After 2-3 weeks, callus forms, and separate shoots are removed from the circles from the leaves. The shoots are cleanly cut off from the callus when they become large enough to distinguish them from the stem. The shoots are placed on a hormone-free rooting medium (MSO: MS salt 4.3 g / l, sucrose 30 g / l and B5 vitamins 500X 2 ml / l) with selection. In 1-2 weeks, roots are formed. Any callus analysis is recommended to be carried out with rooted shoots and in a sterile state. Rooted shoots are placed in the soil and kept in high humidity conditions (e.g. in plastic containers or bags). Shoots are tempered by gradual exposure, usually to moisture.

 A total of 45 kanamycin-resistant pMON17032 tobacco lines were tested (Table V).

 Repeated callus formation by leaves on the plant tissue culture medium indicates a low level of glyphosate tolerance (estimated as a +/- phenotype) for at least 11 of these lines. At least 24 of these lines express glyphosate oxidoreductase at a detectable level in the range of 0.5-2 ng per 50 μg of recoverable protein. Glyphosate tolerance, manifested in a leaf callus assay, and a higher level of glyphosate oxidoreductase expression indicate that changes made in the glyphosate oxidoreductase coding sequences to produce the modified glyphosate oxidoreductase gene (AFTER N7). effect on the ability of this gene to be expressed in plants. The same effect can also be achieved by expressing the treated glyphosate oxidoreductase gene (SEQ. N 6) using a stronger plant promoter, using the best 3'-polyadenylation signal sequences, optimizing the sequences near the initiation codon for ribosomal loading and translation initiation, or a combination of these and other sequences or factors of expression or regulation. R1 offspring of a number of these lines with the highest level of glyphosate oxidoreductase expression (NN 18854 and 18848) are sprayed with glyphosate at a dosage of (0.4 and 1 lb / ar (0.448 and 1.12 kg / ha, respectively) and the vegetative behavior (table VI).

After an initial period of time, and especially for plants expressing glyphosate oxidoreductase at the highest level, these plant lines showed vegetative glyphosate tolerance (which improved over time). Glyphosate oxidoreductase enzymatic activity was determined for two pMON17032 lines (NN 18858 and 18881). Leaf tissue (1 g) was collected, frozen in liquid N ₂ and stored at -80 ^° C before extraction. For extraction, the leaf tissue is crushed in a mortar with a pestle and liquid N ₂ . Then, 1 ml of extraction buffer (100 mM Tris Cl with pH 7.4, 1 mM EDTA, 20% glycerol, 35 mM KCl, 1 mM benzamidine • HCl, 5 mM Na ascorbate, 5 mM dithiothreitol and then 1 mg / ml bovine serum albumin, 4 ^° C) and the sample was triturated for another 1 min. The resulting mixture was centrifuged for 5 min (Eppendorf high speed centrifuge) and 70% final saturation (2.33 ml of saturated solution / ml of extract) was achieved by treatment of the supernatant with a saturated solution of ammonium sulfate. The precipitated protein is separated by centrifugation in the above centrifuge and the debris is resuspended in 0.4 ml of extraction buffer. After repeated centrifugation to remove particulate matter, the sample was desalted on a Sephadex G50 loaded into a 1 ml syringe and equilibrated with extraction buffer according to the Penefsky method (1976). Desalted plant extracts are stored on ice and protein concentration is determined by the Bradford method (1976). Glyphosate oxidoreductase reactions are carried out in duplicates for 60 minutes at 30 ^° C. in an assay mixture consisting of 0.1 MOPS / 0.01 tricin buffer (pH 7.4) containing 10 mM MgCl ₂ , 0.01 mM flavin adenine indinuleotide (FAD) , Sigma) and 1 mM ubiquinone Qo (Sigma). Plant extracts (75 μl) were preincubated for 2 min in the analysis mixture and the reaction was initiated by adding iminodiaxusic acid (IMU, 20 μl) as a substrate to a final concentration of 50 mM (total volume of the analyzed mixture 0.2 ml). The reaction mixture is neutralized and derivatized (see below). In addition, control reactions without IMU and without plant extract were carried out. Detection of glyoxylate is carried out using 2,4-dinitrophenylhydrazine (2,4-DNPH) for derivatization and high performance liquid chromatography (HPLC) with reverse phase according to a modified method of Qureshi et al. (1982). The glyphosate oxidoreductase reaction mixture (0.2 ml) was neutralized with 0.25 ml of DNPH reagent (0.5 mg / ml of DNPH / Aldrich / in 0.5 M HCl) and left for 5 min at 25 ^° C for derivatization. Samples were then extracted with ethyl acetate (2x0.3 ml) and the combined ethyl acetate extracts were extracted with 10% Na ₂ CO ₃ (0.3 ml). The Na ₂ CO ₃ phase was washed once with ethyl acetate (0.2 ml) and injected (100 μl) into a Beckman Ultrasphere C18 IP HPLC column (5 μm, 4.6 mm x 25 cm) using an LKB GTi binary HPLC system with Waters 990 UV / VIZ HPLC detector with a photodiode design and Waters WISP HPLC auto-injector. The isocrate mobile phase is a mixture of methanol-water-acetic acid (60: 38.5: 1.5) with 5 mM tetrabutylammonium phosphate (Pierce). DNPH-glyoxylate peak (retention time = 6.7 min) is detected at 365 nm and compared with the glyoxylate standard (Sigma, 20 μM in 0.2 ml), derivatized in the same way (Table VII).

Example 2
Using the “isogenic” glyphosate oxidoreductase vectors pMON17073 (processed glyphosate oxidoreductase) (SEQ. N 6), pMON17065 (synthetic glyphosate oxidoreductase) (SEQ. N8) and pMON17066 (oxidized glyphosate reductase), tobacco. Western analysis (see Table VIII) for some of these lines revealed that plants treated with glyphosate oxidoreductase express up to ~ 0.5 ng glyphosate oxidoreductase per 50 μg of plant protein, plants with synthetic glyphosate oxidoreductase at ~ 0.5-2 ng per 50 μg and plants with CTP1-synthetic glyphosate oxidoreductase - at a level of ~ 2-20 ng per 50 μg.

A number of primary transformants of the R ₀ lines expressing the treated or synthetic glyphosate oxidoreductase or CTP1 synthetic glyphosate oxidoreductase are sprayed with glyphosate at a dosage of 0.4 lbs / ar (0.448 kg / ha) and evaluated according to the previous scale (see Table IX) .

The synthetic glyphosate oxidoreductase line is characterized by a reaction similar to that observed for R ₁ plants with modified glyphosate oxidoreductase, i.e., the immediate action of glyphosate, which disappears over time as a result of the metabolism of the herbicide under the action of glyphosate oxidoreductase to derivatives: AMPK and glyoxyl glyoxate. Since the glyphosate target (SPSF synthetase) is located in the chloroplast, the activity of glyphosate oxidoreductase should reduce the level of glyphosate in this organel by removing the herbicide before it reaches the chloroplast. Plants with CTP1-synthetic glyphosate oxidoreductase are characterized by a higher glyphosate tolerance, which is manifested in the fact that glyphosate does not have a strong, if any, immediate effect at the indicated dosage. In general, processed tolerant plants are also characterized by normal development, flowering, and fruiting.

 Plants with CTP1 synthetic glyphosate oxidoreductase are characterized by a significantly higher level of glyphosate oxidoreductase expression compared to other glyphosate oxidoreductase constructs. An increased level of glyphosate oxidoreductase may be associated with increased translation of the fusion product or with sequestration of glyphosate oxidoreductase in the chloroplast, which increases the half-life of the protein. A higher level of glyphosate oxidoreductase and / or its location in the chloroplast can lead to a higher level of tolerance due to the rapid detoxification of glyphosate in the chloroplast. The presence of glyphosate oxidoreductase in the chloroplast is confirmed. Five leaves from each of the four plants (NN 22844, 22854, 22886, 22887), for which Western positivity is proven, are homogenized in a Waring mixer in 0.9 L GR + buffer (Bartlet et al., 1982) for 3 x 3 with at high speed. The homogenizate is filtered through 4 layers of Miraclosis and centrifuged at 6000 rpm. / min in the GS-3 rotor. The debris was resuspended in GR + buffer (4 ml total) and placed on top of a 40/80% Percol step gradient and rotated for 10 minutes at 9500 rpm. Intact chloroplasts (lower band) are washed once with GR-buffer (Bartlet et al., 1982) and centrifuged (up to 6000 rpm without inhibition). The debris was resuspended in 300 μl of 50 mM Gepes (pH 7.7), 330 mM sorbitol and lysed on ice using ultrasound (small sample, 30% -3 sludge in the micro-tip x 10 s). Debris precipitated into the supernatant was passed through a Sephadex G50 column in 50 mM Gepes (pH 7.5). The concentration of soluble protein is 2.4 ng / ml. The analysis of the enzyme is carried out by the methods described above using 50 mM IDU and 50 mM glyphosate (30 min per analysis) as substrates, but without adding 1 mM ubiquinone (Table IX ').

Example 3
A number of transformed rutabaga lines are created with the vectors pMON17138 (CTP1-synthetic glyphosate oxidoreductase) and pMON17164 (CTP2-synthetic glyphosate oxidoreductase) as follows.

Plant material
Seedlings of Brassica napus, Wistar variety are planted in 2-inch (~ 5 cm) pots containing Metro Mix 350. Seedlings are grown in a growth chamber at 24 ^o C, photoperiod 16/8 h, light intensity 400 yEm ^-2 s ^-1 (HID bulbs). Fertilized with fertilizer brand Peters 20-10-20 Special, general purpose. After 2.5 weeks, the seedlings are transplanted into 6-inch (~ 15 cm) pots and grown in a growth chamber at a temperature of 15/10 ^o C (day / night), a photoperiod of 16/8 h, a light intensity of 800 yEm ^-2 s ^-1 HID bulbs. Fertilized with fertilizers brand Peters 15-30-15 Special High-Fos.

Transformation / Breeding / Regeneration
Four terminal internodes from plants immediately before shooting or during shooting, but before flowering, they are removed and sterilized from the surface in 70% (v / v) ethanol for 1 min, 2% (w / v) sodium hypochlorite for 20 minutes and rinsed 3 times with sterile deionized water. Stems with leaves can be chilled in moistened plastic bags for up to 72 hours before sterilization. Six to seven segments of the stem are cut into 5 mm circles using a Rare Vegetable Cutter 200 with the orientation of the basal end being established.

Agrobacterium is grown for about a day in a rotator at 24 ^o C in 2 ml of Luria broth containing 50 mg / l kanamycin, 24 mg / l chloramphenicol and 100 mg / l spectinomycin. Prepare 1:10 dilution in MS (Murashige and Skoog) medium, giving approximately 9 x 10 ⁸ cells per ml. This is confirmed by the optical density at 660 mu. The stem circles (explants) are inoculated with 1 ml of Agrobacterium, the excess from the explants is sucked off.

 Explants are placed with the basal side down on Petri plates containing 1 / 10X standard MS salts, B5 vitamins, 3% sucrose, 0.8% agar (pH 5.7), 1 mg / L 6-benzyladenine (BA). A layer of 1.5 ml of a medium containing MS salts, B5 vitamins, 3% sucrose (pH 5.7), 4 mg / L p-chlorophenoxyacetic acid, 0.005 mg / L Kinetin was applied to the plates and covered with sterile filter paper.

After 2-3 days of co-cultivation, the explants are transferred to deep flat patri dishes containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar (pH 5.7), 1 mg / l BA, 500 mg / l carbenicillin, 50 mg / l cefotaxime, 200 mg / l kanamycin or 175 mg / l gentamicin for selection. Seven explants are placed on each plate. After 3 weeks, the explants are transferred to fresh medium with 5 explants per plate. The explants are cultured in a growth room at 25 ^o C and continuous lighting (cold white light).

Expression analysis
After 3 weeks, shoots are cut from the explants. To confirm the modification of the R ₀ shoots, an analysis is carried out for repeated callus formation in the leaves. Three tiny pieces of leaf tissue are placed on a re-callus medium containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar (pH 5.7), 0.5 mg / L naphthalene acetic acid (NAA), 500 mg / ml carbenicillin, 50 mg / l ceftotoxime and 200 mg / l kanamycin or gentamicin, or glyphosate. The analyzed leaves are incubated in the growth room under the same conditions as the explant culture. After 3 weeks, the callus re-assay assay is evaluated with a position of herbicide tolerance (callus or green leaf tissue) or sensitivity (whitening).

Transplantation
At the time of pruning, the stems of the shoots are immersed in Ruton ^R and placed in 2-inch (~ 5 cm) pots containing Metro-Mix 350, and the pots are placed in a closed moistened environment. Then the pots are placed in a growth chamber at 24 ^o C, a photoperiod of 16/8 h, 480 yEm ^-1 s ^-2 (HID lamps for 3 weeks of the hardening period).

The seeds collected from R ₀ plants are R ₁ seeds from which R ₁ plants are grown. To identify the tolerance of R ₀ plants to glyphosate examine its offspring. Since it is believed that R _{0 the} plant is hemizygous at each location of the insert, “own” leads to a maximum of genotypic segregation in R ₁ . Since each insert acts as a dominant allele in the absence of communication, and assuming that only one hemizygous insert is necessary for expression of tolerance, one insert will segregate at a ratio of 3: 1, two inserts at 15: 1, three inserts at 63: 1, and t / d Therefore, relatively few plants need to be grown to detect at least one phenotype of resistance.

Seeds R ₀ plants are harvested, threshed and dried before planting in a glyphosate spray test. A variety of technologies are used to grow R ₁ plants for subsequent spray testing. Tests are carried out both in greenhouses and in growth chambers. Two planting systems are used: pots ~ 10 cm or planting trays with 32 or 36 cells. The soil used for planting is either Metro 350 plus three types of gradual fertilizers, or Metro 350 for seedlings. Watering is either surface in greenhouses, or subirrigation is used in growth chambers. Fertilizers are applied together with water for irrigation. A temperature acceptable for rutabaga is maintained. The photoperiod is set at 16 o’clock. At the beginning of flowering, the plants are transplanted into ~ 15 cm pots to form seeds.

The sprayed "batch" consists of several groups of R ₁ offspring that are sprayed on the same day. Some batches may also include offspring _of plants other than R ₁ . Each batch includes sprayed and unsprayed non-transgenic genotypes representing, in a particular batch, genotypes that were supposedly transformed. In addition, one or more non-segregated transformed genotypes for which some resistance has previously been identified is included in the batch.

Twenty-six plants from each individual R ₀ offspring are not sprayed and used as a control to compare and evaluate glyphosate tolerance, as well as to evaluate any non-glyphosate abnormalities. When other plants reach the stage of 2-4 leaves (usually 10-20 days after sowing), glyphosate is applied at a dosage of 0.28-1.12 kg / ha, depending on the purpose of the study. The laboratory track sprayer is calibrated to receive a dosage equivalent to field conditions.

To assess the vegetative resistance of sprayed plants, a scale of 0-10 points is used. The scale is correlated with unsprayed plants of the same R ₀ family. 0 means the death of the plant, and 10 means the absence of visible differences from the unsprayed plant. A higher number in the range of 0-10 represents progressively less damage compared to an unsprayed plant. Plants are evaluated on days 7, 14, and 28 after treatment (DTP) or before shooting, and the line gives an average score for sprayed plants within the R _{0 of the} plant family.

Six digital indicators are used to qualitatively assess the degree of reproductive damage from glyphosate:
0 - lack of development of flower buds,
2 - flower buds are present, but disappear before disclosure,
4 - the flowers open, but the anthers are absent or the anthers are not able to extrude beyond the petals,
6 - sterile anthers,
8 - partially sterile anthers,
10 - fully fruitful flowers.

 Plants are evaluated using this scale at the time or immediately after flowering begins, depending on the rate of development of flower structures.

 The following tables X and XI summarize the vegetative and reproductive estimates of rutabaga plants transformed with pMON17138 (spraying at a dosage of 0.56 kg / ha) and pMON17164 (spraying at a dosage of 0.84 kg / ha), respectively. The following results illustrate glyphosate tolerance given to rutabaga plants by expression of glyphosate oxidoreductase gene in plants.

Example 4
The glyphosate oxidoreductase gene is also introduced and expressed in soybeans to give glyphosate tolerance to this plant. The CTP2-synthetic glyphosate oxidoreductase fusion gene (see above) is introduced into soybeans under the control of the FMV promoter and with NOS3'-sequences in pMON17159, the map of which is shown in FIG. 10. This vector consists of the following elements in addition to the glyphosate oxidoreductase gene sequences: pUC is the replication source, NPT11 is the bacterial gene for the selection marker (kanamicia) and the beta-glucoronidase gene (GUS: Jefferson et al., 1986) under the control of the E35S promoter with E9 3'-sequences. With the latest gene, a measurable marker is provided to facilitate the identification of transformed plant material.

Soybean plants are transformed with pMON17159 by microfocus injection using particle injection technology according to Christou et al. (1988). The seeds collected from R ₀ plants are R ₁ seeds from which R ₁ plants grow. To identify the tolerance of R ₀ plants to glyphosate, the progeny of this plant is examined. Since it is assumed that R _{0 the} plant is hemizygous at each location of the insert, “own” leads to a maximum of genotypic segregation in R ₁ . Since each insert acts in the absence of a bond as a dominant allele, and assuming that expression of tolerance requires only one hemizygous insert, which will segregate in the ratio 3: 1, two inserts - 15: 1, three inserts - 63: 1, etc. d. Thus, to identify at least one phenotype of resistance, it is necessary to grow a relatively small number of R ₁ plants.

Seeds R _{0 of} soybean plants are collected and dried before sowing for glyphosate spray testing. Seeds are sown in 4 inch (~ 5 cm) square pots containing Metro 350. Twenty sprouts from each R ₀ plants are considered sufficient for testing. Plants withstand and grow in greenhouse conditions. Set the photoperiod at 12.5-14 hours and a temperature of 30 ^o C during the day and 24 ^o C at night. As needed, water soluble fertilizers of the Peters Pete Light brand are introduced.

The spray lot consists of several groups of R ₁ offspring that are all sprayed on the same day. Some batches may also include offspring _of plants other than R ₁ . Each batch also includes sprayed and unsprayed non-transgenic genotypes that represent genotypes that are supposedly transformed in a particular batch. The party also includes one or more non-segregated genotypes for which some resistance has been previously identified.

One or two plants from each individual R ₀ offspring are not sprayed and used as a control to compare and evaluate glyphosate tolerance, as well as to evaluate any deviations not related to glyphosate. When other plants reach the first stage of three leaves (usually 2-3 weeks after sowing), glyphosate is applied at a dosage equivalent to 128 ounces / ar (8.895 kg / ha) Roundup ^R. The laboratory track sprayer is calibrated for spraying at a dosage equivalent to the specified conditions.

Apply a vegetative rating scale of 0-10 points. The score correlates with the unsprayed offspring of the same R ₀ plant. 0 means the death of the plant. 10 means no apparent difference with the unsprayed plant. A higher numerical value in the range of 0-10 represents progressively less damage compared to an unsprayed plant. Assessment of plants is carried out on 7, 14 and 28 days after treatment (DPO) (see table. XII).

Example 5
The glyphosate oxidoreductase gene is also introduced into the cells of black Mexican sweet (ChMS) corn with the expression of a protein found in callus.

 The plasmid pMON19632 is used to introduce the glyphosate oxidoreductase gene into maize cells. The skeleton of such a plasmid is constructed with an insert of 0.6 k.o. 35S-RNA promoter (E35S) of cauliflower mosaic virus (CaMV) containing a doubling of the region from -90 to -300 (Kay et al., 1987), 0.58 k.o. of the base of the fragment containing the first intron of the maize alcohol hydrogenase gene (Callis et al., 1987) and 3'-termination regions from the nopalin synthetase (NOS) gene (Fraley et al., 1983) in pUC119 (Yanisch-Perron et al., 1985). pMON19632 form an insert of 1.7 k.o. BglII / EcoRI fragment from pNON17064 containing Arabidopsis SSU CTP fused to the coding sequence of synthetic glyphosate oxidoreductase (FOLLOW N 8).

 Plasmid pMON19632 was introduced into the cells of the ChMS of maize by co-bombardment with EC9, a plasmid containing the sulfonylurea-resistant form of the maize acetolactate synthetase gene. Each plasmid (2.5 μg) covers the surface of the tungsten particles and is injected using the PDS - 1000 injector into the ChMS cell in the Iog phase, essentially by the method of Klein et al. (1989). Transformants were selected on M medium containing 20 h / bln chlorosulfuron. After the initial selection for sulfuron, calli are analyzed by Western blotting of glyphosate oxidoreductase.

Callus ChMS (3 g wet weight) is dried on filter paper (Whatman No. 1) under vacuum, outweighed, and then extraction buffer (500 μl / g dry weight; 100 mM Tris, 1 mM EDTA, 10% glycerol) is added. The tissue is homogenized using a Viiton overhead stirrer for 30 s at 2.8 s intervals. After centrifugation (3 min, Eppendorf microcentrifuge), the supernatant is removed and the protein is quantified (protein analysis using the BioRad kit). Samples (50 μg / well) were applied to a VAT-PAGE gel (JuIe 3-17%) together with the glyphosate oxidoreductase standard (10 ng), subjected to electrophoresis and transferred to nitrocellulose in the same manner as previously described (Padgette 1987). The nitrocellulose blot was probed with goat anti-glyphosate oxidoreductase IgS and developed with ¹²⁵ I-protein G. The radioactive blot was made visible by autoradiography. Results are quantified by densitometry.
on the LKB UltraScan XI laser densitometer (see table XIII).

 The data of table XIII show that glyphosate oxidoreductase can be expressed and detected in monocotyledonous plants, such as corn.

Example 6
The glyphosate oxidoreductase gene can be used as a selection marker for plant transformation directly on a medium containing glyphosate. The ability to select and identify transformed plant material depends in most cases on the use of a dominant selection marker gene that promotes tissue in the presence of a usually inhibitory substance. Antibiotic resistance and herbicide tolerance genes have been used almost exclusively as such dominant selection marker genes in the presence of an appropriate antibiotic or herbicide. The nptIII / kanamycin selection scheme is probably the most commonly used. It was shown that glyphosate oxidoreductase is also applicable and, possibly, with great success in the selection marker / selection scheme for the production and identification of transformed plants.

 The plant transformation vector that can be used in such a scheme is pMON17226 (Fig. 11). This plasmid is similar to many other plasmids already described, and essentially consists of the previously disclosed bacterial replicon system, allowing this plasmid to replicate to E. coli, as well as to be introduced and replicated in Agrobacterium, a bacterial selection marker gene (Spc / Str) and between the right border of T-DNA and the left border is the synthetic glyphosate oxidoreductase gene in the FMS promoter-E9 3 ′ cassette. This plasmid also has unique sites for a number of restriction enzymes located within the boundaries and outside the expression cassette. This makes it possible to easily add other genes and genetic elements to the vector for introduction into plants.

The method of direct selection of transformed plants on glyphosate is given for tobacco. Explants are prepared for precultivation according to the standard procedure described in Example 1. The surface of the leaves of a tobacco plant at the age of 1 month is sterilized (15 minutes in 10% chlorox + surfactant; washing 3X dH ₂ O); explants are cut into squares of 0.5 x 0.5 cm in size with the removal of the edges of the leaves, the middle vein of the leaf, tip and petiole to obtain a uniform tissue type; explants are placed with the inner surface up one layer on the MS104 plate + 2 ml of 4C005K surface wetting medium; preculture 1-2 days. Explants are inoculated with an approximately daily culture of Agrobacterium containing a plant transformation plasmid in which a titer of 1.2 x 10 ⁹ bacteria / ml with 4C005K medium is set. The explants are placed in a centrifuge tube, a suspension of Agrobacterium is added and the mixture of bacteria and explants is intensively rotated for 25 seconds at maximum speed to ensure uniform penetration of bacteria. Bacteria are drained, and explants are placed between layers of dry sterile filter paper to remove excess bacteria. The dried explants are placed with the inner surface up on MS104 plates + 2 ml of 4C005K medium + filter circle. Sokultiruyut 2-3 days. Explants are transferred to MS104 + 1000 mg / L carbenicillin + 100 mg / L cefotaxime for 3 days (aging phase). Explants then transfer M104 + 0.05 mM glyphosate + 1000 mg / L carbenicillin + 100 mg / L cefotaxime for the selection phase. Roots are formed within 3-5 days and at that moment pieces of the leaf can be taken from rooted plates to confirm glyphosate tolerance and that the material is transformed.

 The presence of glyphosate oxidoreductase protein in these transformed tissues was confirmed by immunoblot analysis of leaf circles. Below is the data from one of the experiments with pMON17226. Shoots (25 pieces) formed on glyphosate from 100 explants inoculate Agrobacterium ABI / pMON17226; 15 of them were positive for repeated callus formation on glyphosate and 19 of them were positive for glyphosate oxidoreductase protein when detected by immunoblotting. The data obtained indicate the degree of transformation of 15-19 per 100 explants, which characterizes such a process of plant transformation as highly efficient and time-saving. A similar transformation frequency was achieved with the derivative pMON17226 (pMON17241) containing the gene for glyphosate oxidoreductase V. 247 (FOLLOW N 17). The glyphosate oxidoreductase gene was also shown to allow direct selection of transformants in other plant species, including: Arabidopsis, potatoes, and sugar beets.

 From the foregoing, it can be seen that the present invention meets the objectives and has advantages that are obvious and inseparable from the invention.

 It must be indicated that certain features and subcombinations can be used without reference to other features and subcombinations. This is defined and covered by the scope of the claims.

 Since it is possible to implement many embodiments of the invention without departing from its scope, it is necessary to indicate that all of the material presented or shown in the diagrams should be considered as illustrative, but not as restrictive.

List of references
Ammirato, PV, et al. Handbook of Plant Cell Culture - Crop Species. Macmillan Publ. Co. (1984).

 Avila, L.Z., Loo, S.H. and Frost, J.W. (1987) Chemical and mutagenic analysis of aminomethylphosphonate biodegradation. J. Amer. Chem. Soc. 109: 6758-6764.

 Balthazor, T.M. and Hallas, L.E. (1986) Glyphosate-degrading microorganisms from industrial activated sludge. Appl. Environ. Microbiol. 51: 432-434.

 Bartlett, S. G., Grossman, A.R., and Chua, N.H. (1982) in Methods in Chloroplast Molecular Biology, pp. 1081-1091. M. Edelman, R. B., Hallick, and Chua, N. H., eds.

 Bevan, M. (1984) Nucleic Acids Res 12 (22): 8711-8721.

 Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl. Acids Res. 7: 1513-1525.

 Boyer, H.W. and Rolland-Dussoix, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41: 459.

 Bradford, M. Anal. Biochem. 72, 248 (1976).

 Callis, J., Fromm, M., and Walbot, V. (1987) Introns increase gene expression in cultured maize cells. Genes and Dev. 1: 1183-1200.

 Christou, P., D.E. McCabe, and W.F. Swain (1988) Stable transformation of Soybean Callus by DNA-Coated Gold Particles. Plant Physiol. 87: 671-674.

 Cook, A.M., Daughton, C.G. and Alexander, M. (1978) Phosphonate utilization by bacteria. J. Bacteriol. 133: 85-90.

 Coruzzi, G., Broglie, R., Edwards, C., and Chua, N.H. (1984). Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J 3, 1671-1679.

 Coupland, D, (1985) Metabolism of glyphosate in plants, in The Herbicide Glyphosate. eds. E. Grossbard and D. Atkinson. Butterworths. pp. 25-34.

 Daughton, C. G., Cook, A.M. and Alexander, M. (1979a) Bacterial conversion of alkylphosphonates to natural products via carbon-phosphorus bond cleavage. J. Agric. Food Chem. 27: 1375-1382.

 Daughton, C. G., Cook, A.M. and Alexander, M. (1979b) Biodegradation of phosphonate toxicants yields methane or ethane on cleavage of the C-P bond. FEMS Microbiol. Lett. 5: 91-93.

 Daughton, C.G., Cook, A.M. and Alexander, M. (1979c) Phosphate and soil binding: factors limiting bacterial degradation of ionic phosphorous-containing pesticide metabolites. Appl. Environ. Microbiol. 37: 605-609.

 della-Cioppa, G., Bauer, S.C., Klein, B.K., Shah, D.M., Fraley, R.T. and Kishore G. K. (1986) Translocation of the precursor of 5-enolpyruvylshikimate-3-phosphate synthase into chloroplasts of higher plants in vitro. Proc, Natl. Acad Sci. USA 83: 6873-6877.

 della-Cioppa, G., Bauer, S.C., Taylor, M.T., Rochester, D.E., Klein, B. K., Shah, D.M., Fraley, R.T. and Kishore G.M. (1987) Targeting a herbicide-resistant enzyme from Escherichia coli to chloroplasts of higher plants. Bio / Technology 5: 579-584.

 Ditta, G., Stanfield, S., Corbin, D., and Helinski, D.R. (1980). Broad host range DNA cloning system for Gram-Negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77, 7347-7351.

 Erlich, H.A. (1989) Ed. PCR Technology - Principles and Applications for DNA Amplification. Stockton Press, New York.

 Fling, M. E., Kopf, J., and Richards, C. (1985). Nucleotide sequence of the transposon Tn7 gene encoding an aminoglycoside-modifying enzyme, 3 '' (9) -O-nucleotidyltransferase. Nucleic Acids Research 13 no.19, 7095-7106.

 Fraley, RT, Rogers, SG, Horsch, RB, Sanders, PR, Flick, JS, Adams, SP, Bittner, ML, Brand, LA, Fink, CL, Fry, JS, Galluppi, GR, Goldberg, SB, Hoffmann, Nl and Woo, S.C. (1983) Expression of bacterial genes in plant cells. Proc. Natl. Acad Sci. USA 80: 4803-4807.

 Fraley, R. T., Rogers, S. G., Horsch, R. B., Eichholtz D. A., Flick, J. S., Fink, C. L., Hoffmann, N. L. and Sanders, P.R. (1985) The SEV system: a new disarmed Ti plasmid vector system for plant transformation.

 Franz, J. E. (1985) Discovery, development and chemistry of glyphosate, in The Herbicide Glyphosate. eds, E. Grossbard and D. Atkinson. Butterworths. pp. 3-17.

 Fromm, M., (1990) UCLA Symposium on Molecular Strategies for Crop Improvement, April 16-22, 1990. Keystone, CO.

 Gowda, S., Wu, F.C., and Shepard, R.J. (1989). Identification of promoter sequences for the major RNA transcripts of figwort mosaic and peanut chlorotic streak viruses (caulimovirus group). Journal of Cellular Biochemistry supplement 13D, 301. (Abstract).

 Hallas, L. E., Hahn, E.M. and Korndorfer, C. (1988) Characterization of microbial traits associated with glyphosate biodegradation in industrial activated sludge. J. Industrial Microbiol. 3: 377-385.

 Hayford, M.B., Medford, J.I., Hoffmann, N.L., Rogers, S.G. and Klee, H. J. (1988) Development of a plant transformation selection system based on expression of genes encoding gentamicin acetyltransferases. Plant Physiol. 86: 1216-1222.

 Heitkamp, M.A., Hallas, L. and Adams, W.J. (1990) Biotreatment of industrial wastewater with immobilized microorganisms - Presented in Session 11, Paper S40, Society for Industrial Microbiology Annual Meeting, Orlando, Florida, July 29 - August 3, 1990.

 Herrera-Estrella, L., et al. (1983) Nature 303: 209 Horsch, R. B. and H. Klee. (1986) Proc. Natl. Acad Sci. U.S.A. 83: 4428-32.

 Holben, W. E., Jannson, J.K., Chelm, B.K. and Teidje, J.M. (1988) DNA probe method for the detection of specific microorganisms in the soil bacterial community. Appl. Environ. Microbiol. 54: 703-711.

 Hohn, B. and Collins J. (1980) A small cosmid for efficient cloning of large DNA fragments. Gene 11: 291-298.

 Jacob, G. S., Schaefer, J., Stejskal, E.O. and McKay, R.A. (1985) Solid-state NMR determination of glyphosate metabolism in a Pseudomonas sp. J. Biol. Chem. 260: 5899-5905.

 Jacob, G. S., Garbow, J., Hallas, L.E., Kishore, G.M. and Schaefer, J. (1988) Metabolism of glyphosate in Pseudomonas sp. strain LBr. Appl. Environ. Microbiol. 54: 2953-2958.

 Jefferson, R.A., T.A .. Kavanaugh, M.W. Bevan (1987) GUS fusions: β -glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal vol. 6, N 13. pp 3901-3907.

 Kay, R., Chan, A., Daly, M. and McPherson, J. (1987) Duplication of the CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236: 1299-1302.

 Kishore, G. M. and Jacob G.S. (1987) Degradation of glyphosate by Pseudomonas sp. PG2928 via a sarcosine intermediate. J. Biol. Chem. 262: 12164-12168.

 Klee, H. J., et al. (1985) Bio / Technology 3: 637-42.

 Klee, H. J., Muskopf, Y.M. and Gasser, C.S. (1987) Cloning of an Arabidopsis thaliana gene encoding 5-enolpyruvylshikimate-3-phosphate synthase: sequence analysis and manipulation to obtain glyphosate tolerant plants. Mol. Gen. Genet. 210: 437-442.

 Klein, T.M., Kornstein, L., Sanford, J.C., and Fromm, M.E. (1989) Genetic transformation of maize cells by particle bombardment Plant Phys. 91: 440-444.

 Koncz, C. and Schell, J. (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet 204: 383-396.

 Lerbs, W., Stock, M. and Parthier, B. (1990) Physiological aspects of glyphosate degradation in Alcaligenes sp. strain GL. Arch. Microbiol. (1990) 153: 146-150.

 Liu, C. -M., McLean, P.A., Sookdeo, C.C. and Cannon, F.C. (1991) Degradation of the herbicide glyphosate by members of the family Rhixobiaceae. Appl. Environ. Microbiol. 57: 1799-1804.

 Maier, L. (1983) Phosphorus Sulfur 14: 295.

 Malik, J., Barry, G. and Kishore, G. (1989) The herbicide glyphosate. BioFactors 2: 17-25.

 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

 Marshall, G., Kirkwood, R.C. and Martin, D.J. (1987) Pestic. Sci. 18: 65-77.

 Mastalerz, P., Wieczorek, Z. and Kochman, M (1965) Utilization of carbon-bound phosphorus by microorganisms. Acta Biochim. Pol. 12: 151-156.

 Miller, J.H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

 Moore, J.K., Braymer, H. D. and Larson, A.D. (1983) Isolation of a Pseudomonas sp. which utilizes the phosphonate herbicide glyphosate. Appl. Environ. Microbiol. 46: 316-320.

 Morelli, G., Nagy, F., Fraley, R.T., Rogers, S.G., and Chua, N.H. (1985). A short conserved sequence is involved in the light-inducibility of a gene encoding ribulose 1,5-bisphosphate carboxylase small subunit of pea. Nature 315, 200-204.

 Neidhardt, F. C., Bloch, P.L. and Smith, D.F. (1974) Culture media for enterobacteria. J. Bacteriol. 119: 736-747.

 Nomura, N. S. and Hilton, H.W. (1977) The adsorption and degradation of glyphosate in five Hawaiian sugarcane soils. Weed Res. 17: 113-121.

 Odell, J. T., Nagy, F., and Chua, N.H. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810-812.

 Padgette, S., et al. (1987) Bacterial Expression and Isolation of Petunia hybrida EPSP Synthase. Arch. Biochem. Biophys. 258: 564-573.

 Penefsky, H.S., Meth. Enzymol. 56, 527-530 (1979).

 Pipke, R., Schulz, A. and Amrhein, N. (1987b) Uptake of glyphosate by an Arthrobacter sp. Appl. Environ. Microbiol. 53: 974-978.

 Pipke, R. and Amrhein, N. (1988) Degradation of the phosphonate herbicide glyphosate by Arthrobacter atrocyaneus ATCC 13752. Appl. Environ. Microbiol. 54: 1293-1296.

 Pipke, R., Amrhein, N., Jacob, G.S. and Kishore, G.M. (1987a) Metabolism of glyphosate by an Arthrobacter sp. GLP-1. Eur. J. Biochem. 165: 267.273.

 Quinn, J.P., Peden, J.M.M. and Dick, E. (1988) Glyphosate tolerance and utilization by the microflora of soils treated with the herbicide. Appl. Microbiol. Biotechnol. 29: 511-516.

 Quinn, J. P., Peden, J. M. M. and Dick, R.E. (1989) Appl. Microbiol. and Biotechnology 31: 283-287.

 Qureshi, A.A., Elson, C.E., and Lebeck, L.A., J. Chromotog. 249.333-345 (1982).

 Rueppel, M. L., Brightwell, B. B., Schaefer, J. and Marvel, J.T. (1977) Metabolism and degradation of glyphosate in soil and water. J. Agric. Food Chem. 25: 517-528.

 Schowanek, D. and Verstraete, W. (1990) Phosphonate utilization by bacterial cultures and enrichments from environmental samples. Appl. Environ. Microbiol. 56: 895-903.

 Shah, D., Horsch, R., Klee, H., Kishore, G., Winter, J., Tumer, N., Hironaka, C., Sanders, P., Gasser, C., Aykent, S., Siegal, N., Rogers, S., and Fraley, R. (1986). Engineering herbicide tolerance in transgenic plants. Science 233.478-481.

 Shimamoto, K. et al. (1989) Nature 338: 274-276.

 Shinabarger, D. L. and Braymer, H.D. (1986) Glyphosate catabolism by Pseudomonas sp. strain PG2982. J. Bacteriol. 168: 702-707.

 Stalker, D. M., Thomas, C. M., and Helinski, D.R. (1981). Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2. Mol Gen Genet 181: 8-12.

 Steffan, R. J. and Atlas, R.M. (1988) DNA amplification to enhance detection of genetically engineered bacteria in environmental samples. Appl. Environ. Microbiol. 54: 2185-2191.

 Tabor, S. and Richardson, C.C. (1985) A bacteriophage T7 RNA polymerase / promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad Sci. USA 82: 1074-1078.

 Talbot, H.W., Johnson, L.M. and Munnecke, D.M. (1984) Glyphosate utilization by Pseudomonas sp. and Alcaligenes sp. isolated from environmental sources. Current Microbiol. 10: 255-260.

 Tanaka, J., Kuwano, E. and Eto, M. (1986) Synthesis and pesticidal activities of phosphonate analogs of amino acids. J. Fac. Agr. Kyushu Univ. 30: 209-223.

 Timko, MP, Herdies, L., de Alameida, E., Cashmore, AR, Leemans, J. and Krebbers, E. (1988) Genetic engineering of nuclear-encoded components of the photosynthetic apparatus of Arabidopsis in The Impact of Chemistry on Biotechnology - A Mutlidisciplinary Discussion. ACS Books, Washington DC pp. 279-295.

 Torstensson, L. (1985) Behavior of glyphosate in soils and its degradation, in The Herbicide Glyphosate. eds. E. Grossbard and D. Atkinson. Butterworths. pp. 137-150.

 Tsai, Y.-L. and Olson, B.H. (1991) Rapid method for direct isolation of DNA from soil and sediments. Appl. Environ. Microbiol. 57: 1070-1074.

 Vasil, V., F. Redway and I. Vasil. (1990) Bio / Technology 8: 429-434.

 Vieira, J. and Messing, J. (1987) Production of single-stranded plasmid DNA. Methods Enzymol. 153: 3.

 Wackett, L.P., Shames, S.L., Venditti, C.P. and Walsh, C.T. (1987a) Bacterial carbon-phosphorus lyase: products, rates, and regulation of phosphonic and phosphinic acid metabolism. J. Bacteriol. 169: 710-717.

 Wackett, L. P., Wanner, B.L., Venditti, C.P. and Walsh, C.T. (1987b) Involvement of the phosphate regulon and the psiD locus in the carbon-phosphorus lyase activity of Escherichia coli K-12. J. Bacteriol. 169: 1753-1756.

 Weidhase, R., Albrecht, B., Stock, M., and Weidhase, R.A. (1990) Utilization of glyphosate by Pseudomonas sp. GS. Zentralbl. Mikrobiol. 145: 6.

 Wong, E.Y., Seetharam, R., Kotts, C.E., Heeren, R.A., Klein, B.K., Braford, S.R., Mathis, K.J., Bishop, B.F., Siegel, N.R., Smith, C.E. and Tacon, W.C. (1988) Expression of excreted insulin-like growth factor-1 in Escherichia coli. Gene 68: 193-203.

 Yanisch-Perron, C., Vierra, J. and Messing, J, (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.

 Zeleznick, L.D., Meyers, T.C. and Titchener, E.B. (1963) Growth of Escherichia coli on methyl - and ethylphosphonic acids. Biochim. Biophys. Acta. 78: 546-547.

Claims (9)

 1. The molecule of the selected double-stranded DNA, including the DNA encoding the glyphosate oxidoreductase enzyme, the amino acid sequence of the enzyme being selected from the group consisting of SeqID 5, SeqID 5 with the histidine residue at position 333 replaced by arginine, SeqID 5 with the histidine residue replaced at position 333 with lysine, SeqID 5 with histidine residue at position 333 replaced with glutamine, SeqID 5 with histidine residue at 333 position with alanine, SeqID 5 with histidine residue at 333 position with tryptophan, SeqID 5 with histidine residue attack at position 333 with leucine, SeqID 5 with histidine residue at position 333 replaced with isoleucine, SeqID 5 with histidine residue at position 333 replaced with glutamic acid and SeqID 18.  2. A recombinant double-stranded DNA molecule, consisting of the following sequences: a) a promoter whose action in plants causes the production of an RNA sequence, c) a structural DNA sequence represented by the molecule according to claim 1, causing the production of an RNA sequence encoding the glyphosate oxidoreductase enzyme, and c) 3'-untranslated region, the action of which in plants causes the addition of polyadenylated nucleotides to the 3'-end of the RNA sequence, the promoter being heterologous with respect to the structure molecular DNA sequence and capable to cause sufficient expression of said enzyme in plant tissue, including meristematic tissue, plant cell with increased tolerance transformed with such a gene, glyphosate.  3. The DNA molecule according to claim 2, characterized in that the structural DNA sequence encodes a fusion polypeptide consisting of an amino-terminal chloroplast transit peptide and the glyphosate oxidoreductase enzyme.  4. The DNA molecule according to claim 3, characterized in that the promoter is a plant DNA viral promoter.  5. The DNA molecule according to claim 4, characterized in that the promoter is selected from the group comprising CaMV 35S and FMV 35S.  6. A method of producing genetically transformed plants with glyphosate herbicide tolerance, characterized in that the following steps are carried out: a) introducing a recombinant double-stranded DNA molecule into the plant cell genome, consisting of: I) a promoter whose action in plant cells causes the production of an RNA sequence, II) a structural DNA sequence that causes the production of an RNA sequence encoding the glyphosate oxidoreductase enzyme; III) a 3'-untranslated DNA sequence, acting which in plant cells causes the addition of polyadenylated nucleotides to the 3'-end of the RNA sequence, the promoter being heterologous with respect to the structural DNA sequence and capable of causing sufficient expression of this enzyme in plant tissue, including meristematic tissue, with an increase in the tolerance of a plant cell transformed by such the genome, to glyphosate, c) obtaining a transformed plant cell and c) regenerating from a transformed plant cell eticheski transformed plant with increased tolerance to the herbicide glyphosate.  7. The method according to claim 6, characterized in that the structural DNA sequence encodes a fusion polypeptide consisting of an amino-terminal chloroplast transit peptide and a glyphosate oxidoreductase enzyme.  8. The method according to claim 7, characterized in that the promoter comes from the plant DNA of the virus.  9. The method of claim 8, wherein the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters.

Images