NZ746729B2 - Compositions for treatment of wet age-related macular degeneration - Google Patents

Compositions for treatment of wet age-related macular degeneration Download PDF

Info

Publication number
NZ746729B2
NZ746729B2 NZ746729A NZ74672917A NZ746729B2 NZ 746729 B2 NZ746729 B2 NZ 746729B2 NZ 746729 A NZ746729 A NZ 746729A NZ 74672917 A NZ74672917 A NZ 74672917A NZ 746729 B2 NZ746729 B2 NZ 746729B2
Authority
NZ
New Zealand
Prior art keywords
seq
itr
eye
vector
vegf
Prior art date
Application number
NZ746729A
Other versions
NZ746729A (en
Inventor
Anna P Tretiakova
James M Wilson
Original Assignee
The Trustees Of The University Of Pennsylvania
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Priority to NZ787256A priority Critical patent/NZ787256A/en
Priority claimed from PCT/US2017/027529 external-priority patent/WO2017180936A1/en
Publication of NZ746729A publication Critical patent/NZ746729A/en
Publication of NZ746729B2 publication Critical patent/NZ746729B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0048—Eye, e.g. artificial tears
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

recombinant adeno-associated virus (rAAV) having an AAV8 capsid which is suitable for intra-retinal injection is provided herein. The rAAV comprises a vector genome packaged within the capsid which contains, operably linked to regulatory elements which direct expression of anti- human vascular endothelial growth factor (VEGF) antigen binding antibody fragment (aVEGF), a coding sequence for aVEGF, wherein the coding sequence is operably linked to regulatory elements which direct expression of the anti -VEGF Fab in the eye. Also provided herein are liquid suspensions containing these rAAV8.aVEGF and methods of using same for treatment of wet AMD and other ocular conditions.

Description

COMPOSITIONS FOR TREATMENT OF WET AGE-RELATED MACULAR DEGENERATION INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED IN ELECTRONIC Applicant hereby incorporates by reference the Sequence Listing material ?led in electronic form herewith. This file is labeled "UPN-l6-7683PCT_ST25.txt".
BACKGROUND OF THE INVENTION Age-related macular degeneration (AMD) is a progressive degenerative macular disease attacking the region of highest visual acuity (VA), the macula, and is the leading cause of blindness in Americans 60 years or older (NIH Medline Plus (2008), Leading cause of blindness, NIH Medline Plus 3(2) 14-15. www.nlm.nih.gov/medlineplus/magazine/ / 08/articles/summer08pgl4—15.html). The neovascular "wet" form of the disease (nAMD or wet AMD) is characterized by choroidal neovascularization which is marked by proliferation of blood vessels and cells including those of the retinal pigment lium (RPE) liet (2005) Nature 438: 932—93 6). Ultimately, photoreceptor death and scar formation result in a severe loss of central vision and the ity to read, write, and recognize faces or drive. Many patients can no longer in gainful employment, carry out daily ties and consequently report a diminished quality of life (Mitchell and Bradley (2006), Health Qual Life Outcomes 4: 97). Preventative therapies have demonstrated little effect and therapeutic strategies have focused primarily on treating the neovascular lesion.
Some currently available treatments for wet AMD include laser photocoagulation, photodynamic therapy with verteporfin, and intravitreal (IVT) injections with the vascular endothelial growth factor (VEGF) inhibitors such as pegaptanib, ranibizumab, bevacizumab or a?ibercept (Schmidt-Erfurth, (2014) Guidelines for the management of cular age- related macular degeneration by the an Society of Retina lists (EURETINA) Br J Ophthalmol 4—1167). While these therapies have some effect on best-corrected visual acuity (BCVA), their s may be limited in restoring visual acuity and in duration (Schmidt-Erfurth, cited above, 2014, AAO PPP (2015) Preferred Practice Patterns: Age Related r Degeneration. American Academy of Ophthalmology).
Several drugs in market that are used to treat wet AMD rely on a mechanism that inhibits VEGF and must be injected intravitreally. While these treatments are reported to d in prohibiting the disease from progressing, they require frequent injections of the drug.
Of specific note, ranibizumab, a recombinant, zed onal IgGl antigen- binding fragment (Fab) is designed to bind and inhibit all active forms of human .
Ranibizumab is a humanized monoclonal antibody fragment produced in Escherichia coli cells by recombinant DNA technology. The binding of zumab to VEGF-A prevents the interaction of VEGF-A with its receptors l and VEGFR—2 on the surface of endothelial cells. This binding inhibits endothelial cell proliferation and neovascularization, as well as vascular leakage, all of which are thought to contribute to the progression of the neovascular (wet) form of age-related macular degeneration (Wet AMD). The safety and efficacy of ranibizumab (Lucentis®) has been established, and ranibizumab is United States (US) Food & Drug stration (FDA) approved for IVT injection treatment in patients with cular AMD, as well as other retinal diseases (initially approved FDA 2006).
While long term y with either monthly ranibizumab or monthly/every 8 week a?ibercept may slow the progression of vision loss and improve vision, none of these treatments t neovascularization ?om recurring (Brown et al (2006) N Engl J Med, 355: 1432—44, Rosenfeld et al., (2006) N Engl J Med 355: 1419—31, Schmidt-Erfurth, 2014, cited above). Each has to be re-administered to prevent the disease from worsening. The need for repeat treatments can incur additional risk to ts and is inconvenient for both patients and treating ians.
SUMMARY OF THE INVENTION In one aspect, the invention provides a recombinant adeno-associated virus (rAAV) having an AAV8 capsid which is suitable for sub-retinal and/or intra-retinal inj ection. The AAV8 capsid packages a vector genome that provides for the production of a soluble antigen-binding fragment (Fab) of a human monoclonal antibody (MAb) that binds and inhibits human vascular endothelial growth factor (hVEGF) — the expression product is sometimes referred to herein as hVEGF Fa " or "aVEGF".
The vector genome packaged within the rAAV8 capsid, comprises: (a) an AAV inverted terminal repeat(s) )) ?anking an expression construct for the anti- VEGF Fab, (b) the expression construct having regulatory elements comprising a chicken beta-actin promoter or a ubiquitin C promoter that direct expression in the eye of a transgene encoding anti-hVEGF Fab, and (c) the transgene Which encodes the heavy and light chains of the VEGF Fab, each chain having a heterologous leader sequence added to its amino terminus, and Wherein the coding sequences for the heavy and light chains are separated by a coding sequence for a "cleavable" peptide linker or an IRES (internal ribosome entry site) to ensure production of separate heavy and light chain polypeptides, and a polyadenylation signal. The resulting transgene expression products may contain an amino acid residue in addition to those normally found in Fab heavy chains.
In particular embodiments, codon sequences for the heavy and light chains optimized for expression in human cells are used. As illustrated by the examples, these can include but are not limited to AAV2/8.CB7.CI.aVEGFvl.rBG, .CB7.CI.aVEGFerBG, AAV2/8.CB7.CI.aVEGFv3.rBG, AAV2/8.CB7.CI.aVEGFv4.rBG, AAV2/8.CB7.CI.aVEGFv5.rBG, AAV2/8.CB7.CI.aVEGFv6.rBG, .CB7.CI.aVEGFv7.rBG, AAV2/8.CB7.CI.aVEGFv8.rBG, AAV2/8.CB7.CI.VEGFv9.rBG, AAV2/8.CB7.CI.aVEGFvl0.rBG, AAV2/8.CB7.CI.aVEGFvl 1.rBG, AAV2/8.CB7.CI.aVEGFverBG, AAV2/8.CB7.CI.aVEGFvl3.rBG.
As used herein, "AAV2/8" and "AAV8" are used interchangeably to refer to a recombinant AAV having an AAV8 capsid and vector genome ?anked by AAVZ ITRs.
In yet r aspect, a liquid suspension of any of the foregoing rAAV8aVEGF for sub-retinal and/or intra-retinal injection is provided. The composition comprises an aqueous liquid and rAAV8aVEGF as described herein, and optionally one or more excipients, preservatives, and/or surfactants.
In still a further aspect, a method for delivering an VEGF Fab to a patient having wet age-related related r degeneration is provided. The method involves subretinally injecting the patient's eye With the liquid suspension sing the rAAV8 vector carrying the sion construct for the anti-hVEGF Fab.
In certain embodiments, the invention provides a rAAV as bed herein, or a liquid suspension, administrable subretinally to a patient. In certain embodiments, use of a rAAV or a liquid sion, for subretinal administration to a patient is provided. The patient may have been previously diagnosed with wet age-related macular degeneration, or another ocular condition as de?ned herein.
In still a further embodiment, a t sing: (a) a first container comprising an rAAV8anti-hVEGF Fab and an aqueous liquid, (b) optionally a second container comprising a t, and (c) a needle for injection. In certain embodiments, the product is an injection kit.
The invention is illustrated by the examples below which demonstrate that subretinal administration of an rAAV8aVEGF vector s in gene transfer throughout the retina, and expression of EGF Fab throughout the retina and in the vitreous and anterior chamber ?uids. This result is surprising in view of prior art gene therapy studies that demonstrated that gene er spreads laterally outside of the original injection bleb but remains confined to those expanded boundaries and did not e gene transfer and transgene expression outside this expanded area of injection (the "bleb" formed in the retina at the injection site), and offers an advantage over standard of care treatment for nAMD in that a single administration of the rAAV8aVEGF vector should result in (i) continuous delivery of the effective amounts of the VEGF inhibitor throughout the retina which may in turn improve performance as compared to repeated IVT administrations of high dose boluses of the VEGF inhibitor that dissipate over time, and (ii) avoidance of repeated ocular injections which pose onal risks and inconvenience to patients. Each aspect may improve therapeutic outcome.
Still other aspects and advantages of the invention will be apparent from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE FIGURES FIG 1 provides a schematic representation of an AAV8 vector genome containing a gene cassette ?anked by the AAVZ inverted terminal repeat (ITRs) and expressing human anti-vascular endothelial growth factor (anti-VEGF) antigen binding antibody fragment (Fab). Control elements e the CB7 promoter consisting of the chicken B-actin promoter and CMV enhancer, n B-actin and a rabbit B-globin poly A signal. The nucleic acid ces coding for the heavy and light chains of anti-VEGF Fab are separated by a self- cleaving furin (F)/F2A linker. A furin recognition site that consists of arginine-lysine- arginine-arginine amino acid sequence was used. In addition, the light and heavy chain each contain a heterologous leader peptide which directs nascent peptide into appropriate cellular compartment where leader peptide is processed away from the mature protein by the host cellular machinery. These and the other synthetic anti-VEGF constructs are termed herein; AAV.aVEGF.
FIG 2 provides the expression levels and kinetics of AAV8.CB7.aVEGFvl or rAAV8.UbC.aVEGFvl at s time points post-injection of the left eye (os) or right eye (od). AAV8.CB7.aVEGF-va is the top line with the closed . AAV8.UBC.aVEGF- va is the bottom line with the closed circle. The middle line with the open circles is AAV8.UBC.aVEGF-va.
FIGs 3A - 3D show sion of anti-VEGF Fab in anterior r ?uid and blood for animals in Groups 2 and 3 as described in e 3 in which Cynomolgus monkeys were administered a single dose of 1.00 X 1011 GC/eye of AAV2/8 vectors into each eye subretinally. Anterior chamber ?uid and blood were collected at prespecified timepoints. Expression of the anti-VEGF Fab was ined using enzyme-linked sorbent assay. In FIGs 3A and 3B; the results for animals in Group 2. In FIGS 3C and 3D; the results for Group 3 are ted. In FIGS 3B and 3D; the gray area in the panel presenting the results in serum denotes baseline levels. Circles denote females and squares denote males. Samples were analyzed in duplicate. The results are presented as mean :: rd deviation. Abbreviations: Fab = fragment antigen-binding; GC = genome copies; OD = right eye; OS = left eye; VEGF = vascular endothelial growth factor.
FIGs 4A - 4D show expression of anti-VEGF Fab in or chamber ?uid and blood for s in Groups 5 and 6 as described in Example 3 in which cynomolgus s were administered a single dose of 1.00 X 1011 GC/eye of AAV2/8 vectors into each eye subretinally. Anterior chamber ?uid and blood were collected at prespecified timepoints. Expression of the anti-VEGF Fab was determined using enzyme-linked immunosorbent assay. The results for Group 5 are presented in FIGS 4A and 4B and the results for Group 6 is presented in FIGS 4C and 4D. In FIGS 4B and 4D; the gray area in the panel presenting the results in serum denotes baseline levels. Circles denote females and squares denote males. Samples were analyzed in duplicate. The results are presented as mean :: standard deviation. Abbreviations: Fab = fragment antigen-binding; GC = genome copies; OD = right eye; OS = left eye; VEGF = vascular endothelial growth factor.
FIGS 5A - 5D provide levels of mRNA for AAV8.aVEGF test vector in retina ined by RT-qPCR. Cynomolgus monkeys were administered a single dose of 1.00 X 1012 GC/eye of a AAV8.aVEGF test vector or FFB-3 14 into the right eye subretinally.
Levels ofmRNA for the AAV8.aVEGF test vector were determined in different ns of the dissected retinas by quantitative reverse transcription polymerase chain reaction (RT- qPCR). In left panels, schematics of injection sites are depicted. In middle panels, retinal dissections are presented. In right panels, levels ofmRNA for AAV8.aVEGF test vector mRNA (GC per 100 ng of RNA) in 4 sections of retina are ed. Abbreviations: BV = major blood vessel, F = fovea, GC = genome copies, IB = injection bleb, ID = identification, 0 = optic disk, UD = undetected.
FIGs 6A - 6D provide results of expression of anti-VEGF Fab in anterior chamber ?uid, us, and retina (Group 2, e 6). Cynomolgus monkeys were administered a single dose of 1.00 X 1011 GC/eye of AAV2/8 vector subretinally. These data represent results from different AAV8.aVEGF vectors than shown in FIGs 5A - 5D. trations of anti-VEGF Fab were ined in anterior chamber ?uid, vitreous, and 4 different parts of retina. Eyes were dissected as described in FIGs 5A - 5D. In FIGS 6A and 6C, infrared spectral domain l coherence tomography images of the retinas with boundaries of injection site are depicted. In FIGS 6B and 6D, graphs of concentrations of anti-VEGF Fab are presented. In this figure, the results for animals in Group 2 in Example 6 are presented.
Abbreviations: ACF = anterior chamber ?uid, BV = major blood vessel, F = fovea, Fab = fragment antigen-binding, FOV =middle section ning fovea, GC = genome copies, IB = injection bleb, ID = identification, INF = inferior retinal section, 0 = optic disk, ODI = middle section containing optic disk, SUP = superior retinal section, VEGF = vascular endothelial growth , VIT = vitreous.
FIGs 7A - 7D provide results of expression of anti-VEGF Fab in anterior chamber ?uid, vitreous, and retina (Group 3, Example 6). Cynomolgus monkeys were administered a single dose of 1.00 X 1011 GC/eye of AAV2/8 vector subretinally. These data ent results from ent AAV8.aVEGF s than shown in FIGs 5A - 5D. Concentrations of anti-VEGF Fab were determined in anterior chamber ?uid, vitreous, and 4 different parts of . Eyes were dissected as described in FIGs 5A - 5D. In FIGS 7A and 7C, infrared spectral domain optical coherence tomography images of the retinas with boundaries of injection site are depicted. In the graphs of FIGS 7B and 7D, concentrations of anti-VEGF Fab are presented. In this ; the results for animals in Group 3 in Example 6 are ted. Abbreviations: ACF = anterior chamber ?uid; BV = major blood vessel; F = fovea; Fab = nt antigen-binding; FOV =middle section containing fovea; GC = genome copies; IB = ion bleb; ID = identi?cation; INF = inferior retinal section; 0 = optic disk; ODI = middle section containing optic disk; SUP = superior retinal section; VEGF = vascular endothelial growth factor; VIT = vitreous.
FIGs 8A - 8D provide s of expression of anti-VEGF Fab in anterior chamber ?uid; vitreous; and retina (Group 5; Example 6). Cynomolgus monkeys were administered a single dose of 1.00 X 1011 GC/eye of AAV2/8 vector subretinally. These data represent results from different AAV8.aVEGF vectors than shown in FIGs 5A - 5D. Concentrations of anti-VEGF Fab were determined in anterior chamber ?uid; vitreous; and 4 different parts of retina. Eyes were dissected as described in FIGs 5A - 5D. In FIGS 8A and 8C; infrared al domain optical coherence tomography images of the retinas with boundaries of injection site are depicted. In the graphs of FIGs 8B and 8D; concentrations of anti-VEGF Fab are presented. In this figure; the results for animals in Group 5 in Example 6 are presented. iations: ACF = anterior chamber ?uid; BV = major blood vessel; F = fovea; Fab = fragment antigen-binding; FOV =middle section containing fovea; GC = genome copies; IB = injection bleb; ID = identification; INF = inferior retinal section; 0 = optic disk; ODI = middle section containing optic disk; SUP = superior retinal section; VEGF = vascular endothelial growth factor; VIT = vitreous.
FIG 9 provides a ?ow diagram of the manufacturing process.
FIGs 10A - 10D illustrate the results of an rcAAV assay for AAV8. thAV8 is spiked into ent GC amounts ofAAV vector and the cap gene copy number per 1 ug of 293 cell DNA is determined after three successive es of the cell lysate onto fresh cells. 3 different spike levels ofthAV8 [one level per panel: 1 x 102 GC; 1 x 103 GC and l x 104 GC] 4 ent vector amounts [0 GC (dark square); 1 x 109 GC (gray square) 1 x 1010 GC (triangle) and l x 1011 GC (marked with X)] are shown and background levels are indicated (controls).
DETAILED DESCRIPTION OF THE INVENTION Recombinant; ation-defective adeno-associated virus (rAAV) vectors having an AAV8 capsid and compositions containing same which are suitable for inal injections to deliver an anti-VEFG antibody binding fragment (Fab). Also provided are compositions containing same, and in ularly, liquid aqueous suspension. Uses of these compositions are also provided.
The rAAV8 s are designed to express an anti-VEGF antibody binding fragment (Fab) in mammalian, and more particularly, human cells. These anti-VEGF Fabs are particularly well suited for treatment of age-related macular degeneration (AMD). For convenience, these vectors are terms AMD. As described herein, a series of novel AAV8aVEGF constructs have been developed which have demonstrated high yield, expression levels, and/or activity.
The invention is illustrated by the examples below which demonstrate that subretinal stration of an rAAV8aVEGF vector results in gene transfer throughout the retina, and expression of anti-VEGF Fab throughout the retina and in the vitreous and anterior chamber ?uids. This result is surprising in view of prior art gene therapy studies that demonstrated that gene transfer spreads laterally outside of the al injection bleb but remains ed to those expanded boundaries and did not achieve gene er and transgene expression outside this expanded area of injection (the "bleb" formed in the retina at the injection site), and offers an advantage over standard of care treatment for nAMD in that a single administration of the rAAV8aVEGF vector should result in (i) continuous ry of the effective amounts of the VEGF inhibitor hout the retina which may in turn improve performance as compared to repeated IVT administrations of high dose boluses of the VEGF inhibitor that dissipate over time, and (ii) avoidance of repeated ocular injections which pose additional risks and inconvenience to ts. Each aspect may improve therapeutic outcome.
The present invention provides constructs encoding a novel EGF Fab having, at a minimum, a heavy chain amino acid sequence of SEQ ID NO: 1 and a light chain amino acid sequence of SEQ ID N022, each of which has been engineered to have an exogenous leader sequence for each the heavy chain and light chain. In certain constructs illustrated herein, the leader ce is derived from a human IL2 leader. Further, in n constructs rated in the working examples, the heavy and light chains are separated by a furin/F2a linker, which may result may result in one or more extra amino acids being added to the heavy chain [SEQ ID NO: 1]. In one embodiment, a single arginine [R] is added to the heavy chain. However, in certain embodiments, another linker may be selected and/or a ent system may result in no additional amino acid, or one or more extra amino acids [e.g., R, Lys (K), RK, RKR, RKRR among others]. In prior provisional applications, the resulting ucts were termed herein, aVEGF-R. However, for y, these ucts encoding the anti-VEGF Fab transgene product described herein, are referred to as: anti- VEGF Fab, aVEGF, anti-hVEGF, anti-human VEGF, or anti-VEGF Fab transgene product.
In the constructs ng this transgene product, a numerical designation following the term aVEGF, e.g., aVEGFvl, aVEGFvZ, aVEGFv3, through aVEGFvl3, refers to different nucleic acid coding sequences for the open reading frame of the immunoglobulin heavy chain and light chains.
In certain embodiments, the amino acid sequence of the anti-VEGF Fab has 513 amino acids, including anti-VEGF is heavy and light chain separated by extra amino acids as a result of the linker. For example, while each of the following expression cassettes s the same EGF heavy chain and light chain, in one embodiment, there may be one amino acid added to the last position of the heavy chain. In still other embodiments, there may be two, three, four or more extra amino acids attached to the heavy chain. For example, in certain embodiments, the c acid sequences coding for the heavy and light chains of anti-VEGF Fab are separated by a self-cleaving furin (F)/F2A linker. A furin ition site that consists of arginine-lysine-arginine-arginine amino acid sequence may be used. Due to the mechanism of furin-mediated cleavage, vector-expressed anti-VEGF Fab may contain an additional arginine (R) residue added to the last position of the heavy chain [SEQ ID NO: 1]. In other ments, the vector-expressed anti-VEGF Fab may contain the dipeptide arginine-lysine at the end of the heavy chain, the tripeptide arginine-lysine-arginine at the end of the heavy chain, or the polypeptide arginine-lysine-arginine-arginine at the end of the heavy chain. In certain embodiments, the vector expressed anti-VEGF Fab are a heterogeneous mixture of two or more of these Fab products. Other furin cleavage sites can be used (arginine-X-X-arginine, or arginine-X-lysine or arginine-arginine), which can also generate C-terminal heterogeneity. In other words, other vector expressed anti-VEGF Fabs may be a heterogeneous population of the Fab in which the heavy chain has 0, l, 2, 3, or 4 amino acids at its inus as a result of the linker processing. In addition, the light and heavy chain each contain a heterologous leader peptide which directs nascent peptide into appropriate cellular compartment where leader peptide is processed away from the mature n by the host cellular ery. In certain embodiments, the anti-VEGF Fab contains no HC or LC leader sequences. See, e.g., SEQ ID NO: 33.
In certain embodiments, the anti-VEGF Fab heavy chain has the amino acid sequence of es 21 - 252 of SEQ ID NO: 33 With a leader sequence. In other embodiments, the anti-VEGF Fab light chain has the amino acid sequence of residues 300 - 513 of SEQ ID NO: 33 with a leader sequence. For example, the leader ce may be from about 15 to about 25 amino acids, preferably about 20 amino acids. In some embodiments, the leader has the sequence of amino acids 1-20 of SEQ ID NO: 33.
In one embodiment, the coding sequences for the heavy chain and light chain of anti- VEGFvl are provided in SEQ ID NO: 24. More particularly, the heavy chain variable region open reading frame (ORF) is provided in nucleotides (nt) 1843 to 2211 and the heavy chain constant region (CH1) ORF is provided in nt 2212-2532, with reference to SEQ ID NO: 24. Thus, the aVEGFvl heavy chain, Without the leader, has the nucleic acid sequence of nt 1843 to 2532. The light chain le region (VL) ORF is provided in nt 2680 to 3000 and the light chain nt region (CL) is provided in nt 3001 to 3321 of SEQ ID NO: 24.
Thus, the aVEGFv2 light chain, Without the leader, has the nucleic acid sequence of nt 2680 to 3321 of SEQ ID NO: 24.
In another embodiment, the coding sequences for the heavy chain and light chain of anti-VEGFV2 are provided in SEQ ID NO: 3. More particularly, the VH ORF is provided in nt 2059 to 2427 and the CH1 is provided in 2428 to 2748 of SEQ ID NO: 3, the heavy chain Without the leader has the nucleic acid sequence of nt 2059 to 2748 of SEQ ID NO: 3. The VL ORF is provided in nt 2896 to 3216 and CL is provided in nt 3217 to 3536 of SEQ ID NO: 3, the light chain Without the leader sequence has the nucleic acid sequence of nt 2896 to 3536 of SEQ ID NO: 3.
In yet another embodiment, the coding sequences for the heavy chain and light chain of aVEGFv3 are provided in SEQ ID NO: 19. The VH ORF is provided in nt 1842 to 2210 and the CH1 is provided in nt 2211 to 2531 of SEQ ID NO: 19, the heavy chain t the leader has the nucleic acid sequence of nt 1842 to 2531 of SEQ ID NO: 19. The VL ORF is provided in nt 2679 to 2999 and CL is provided in nt 3000 to 3320 of SEQ ID NO: 19, the light chain Without the leader has the nucleic acid sequence of nt 2670 to 3320 of SEQ ID NO: 19.
In a further ment, the coding ces for the heavy and light chain of aVEGFv4 are provided in SEQ ID NO: 35. The heavy chain leader sequence is encoded by nt 1993 - 2052, the VH ORF is at nt 2053 - 2421 and the CH1 is at nt 2422 - 2742 of SEQ ID NO: 35. As in the other constructs bed herein, as a result of the location of the F2A cleavage site, sequences encoding additional amino acids may be retained on the VH chain.
The light chain leader sequence is encoded by nt 2830-2889, the VL ORF is ed in nt 2890 - 3210, the CL ORF is located at nt 3211-3531 of SEQ ID NO: 35.
In a further embodiment, the coding ces for the heavy and light chain of aVEGFv5 is provided Within SEQ ID NO: 36. The heavy chain leader sequence is encoded by nt 1993 - 2052, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 36. As in the other constructs described herein, as a result of the location of the F2A ge site, sequences encoding additional amino acids may be retained on the VH chain. The light chain leader sequence is encoded by nt 2830-2889, the VL ORF is provided in nt 2890 - 3210, the CL ORF is located at nt 321 1-3531 of SEQ ID NO: 36.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv6 is provided Within SEQ ID NO: 37. The heavy chain leader sequence is encoded by nt 1993 - 2051, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 27420f SEQ ID NO: 37. As in the other ucts described herein, as a result of the location of the F2A cleavage site, sequences encoding additional amino acids may be retained on the VH chain. The light chain leader sequence is encoded by nt 2830-2889, the VL ORF is provided in nt 2890 - 3210, the CL ORF is located at nt 321 1-3531 of SEQ ID NO: 37.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv7 is provided Within SEQ ID NO: 38. The heavy chain leader ce is encoded by nt 1993 - 2052 the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 38. As in the other constructs described herein, as a result of the location of the F2A cleavage site, an additional Arg codon is retained on the VH chain.
The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is provided in nt 2890-3210, the CL ORF is located at nt 321 1-353lof SEQ ID NO: 38.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv8 is ed Within SEQ ID NO: 39. The heavy chain leader sequence is encoded by nt 1993 - 2052, the VH ORF is encoded by nt 205 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 39. As in the other constructs described herein, as a result of the location of the F2A cleavage site, an onal Arg codon is retained on the VH chain.
The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is ed in 2890 - 3210, the CL ORF is located at nt 3211 - 3531 of SEQ ID NO: 39.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv9 is provided within SEQ ID NO: 40. The heavy chain leader ce is encoded by nt 1999 - 2058, the VH ORF is encoded by nt 2059 - 2427, and the CH1 is encoded by nt 2428 - 2748 of SEQ ID NO: 40. As in the other constructs described herein, as a result of the location of the F2A cleavage site, an additional Arg codon is retained on the VH chain.
The light chain leader sequence is encoded by nt 2836 - 2895, the VL ORF is provided in nt 2896 - 3216, the CL ORF is d at nt 3217 - 3637 of SEQ ID NO: 40.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv10 is provided within SEQ ID NO: 41. The heavy chain leader sequence is encoded by nt 1993 - 2052, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 41. As in the other constructs described herein, as a result of the location of the F2A cleavage site, an additional Arg codon is retained on the VH chain.
The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is provided in nt 2890 - 3210, the CL ORF is located at nt 3211 - 3231 of SEQ ID NO: 41.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFvll is provided within SEQ ID NO: 42. The heavy chain leader sequence is encoded by nt 1993 - 2052, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt nt 2422 - 2742 of SEQ ID NO: 42. As in the other constructs described herein, an F2A cleavage site is located between the end of the heavy chain and the ing of the light chain. The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is provided in nt 2890 - 3210, the CL ORF is located at nt 3211 - 353 lof SEQ ID NO: 42.
In a further ment, the coding sequences for the heavy and light chain of aVEGFv12 is provided within SEQ ID NO: 43. The heavy chain leader ce is encoded by nt 1993 - 2052, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 43. The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is provided in nt 2890 - 3210, the CL ORF is located at nt 3211 - 3531 of SEQ ID NO: 43.
In a further embodiment, the coding sequences for the heavy and light chain of aVEGFv13 is provided within SEQ ID NO: 44. The heavy chain leader sequence is d by nt 1993 - 2052, the VH ORF is encoded by nt 2053 - 2421, and the CH1 is encoded by nt 2422 - 2742 of SEQ ID NO: 44. The light chain leader sequence is encoded by nt 2830 - 2889, the VL ORF is nt 2890 - 3210, the CL ORF is d at nt 3211 - 3531 of SEQ ID NO: 44.
Ranibizumab is bed herein as a positive control and is currently marketed under the brand name Lucentis® It is described as a Fab moiety of a high affinity version of inant humanized monoclonal antibody rhuMAb vascular endothelial growth factor (VEGF). It consists of a 214-residue light chain linked by a disulfide bond at its C-terminus to the 231-residue N-terminal segment of the heavy chain. The expected amino acid sequences of the heavy and light chains are provided in SEQ ID NO: 1 and 2. CAS number 3473961.
As used herein, an "immunoglobulin domain" refers to a domain of an antibody heavy chain or light chain as defined with reference to a conventional, full-length antibody.
More particularly, a full-length antibody ns a heavy (H) chain polypeptide which contains four domains: one N-terminal le (VH) region and three C-terminal constant (CH1, CH2 and CH3) regions and a light (L) chain polypeptide which contains two domains: one N- terminal variable (VL) region and one C-terminal constant (CL) region. An Fc region may contain two s (CH2 - CH3). A Fab region contains one constant and one variable domain for each the heavy and light chains.
In one embodiment, rAAVaVEGF vector has an AAV8 capsid and a vector genome packaged therein which comprises at least one element heterologous to AAV8. In one embodiment, the vector genome contains, from 5’ to 3’: (a) an AAV 5’ ITR, (b) an enhancer, (c) a promoter, (d) an intron, (e) a leader sequence and the anti-VEGF heavy chain coding sequence, (f) a F2a linker, (g) a leader ce and the EFG light chain coding sequence, (h) a polyA signal, and (i) an AAV3’ ITR.
In certain embodiments, the processing of anti-VEGF Fab heavy chain and light chains is directed by leader peptides that are derived from human IL2 protein. In one embodiment the leader sequence is an interleukin (IL) IL-2 leader sequence, which may be the wild-type human IL2, MYRMQLLSCIALSLALVTNS [SEQ ID NO: 29], or a mutated leader, such as MYRMQLLLLIALSLALVTNS [SEQ ID NO: 30] or MRMQLLLLIALSLALVTNS [SEQ ID NO: 31]. In another embodiment, a human serpinFl secretion signal may be used as leader peptides. Other leader sequences can be used, or other leaders exogenous to the heavy and light chain.
As used in the following description of the vector genome unless otherwise specified as the light chain or heavy chain, reference to a coding sequence (e.g., aVEGFv2) encompasses the anti-VEGF heavy chain - furin/F2a linker - anti-VEGF light chain. In one embodiment, a nucleic acid sequence encoding the furin recognition site ne-Lysine- ne-Arginine is selected. In certain embodiments, nucleic acids encoding a F2A linker which is a 24 amino acid peptide derived from FMDV (GenBank # CAA2436.1) is selected.
However, if d, an IRES sequence, e.g., such as d from encephalomycarditis virus (EMCV) : SEQ ID NO: 32: [TATGCTAGTACGTCTCTCAAGGATAAGTAAGTAATATTAAGGTACGGGAGGTAT TGGACAGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTT GTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAA CAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCT CTGGCCTAACTGGCCGGTACCTGAGCTCTAGTTTCACTTTCCCTAGTTTCACTTTC CCTAGTTTCACTTTCCCTAGTTTCACTTTCCCTAGTTTCACTTTCCCCTCGAGGAT ATCAAGATCTGGCCTCGGCGGCCAG], cMyc [Nanbru C, et al (1997). J. Biol. Chem. 272, 32061-32066, Stoneley M, et al., (1998). Oncogene 16, 423-428.], or foot and mouth disease (FMD) may be selected.
Inverted terminal repeats (ITR) from AAV2 may be selected. Vectors having ITRs from a different source than its capsid are termed "pseudotyped". In certain embodiments, ITRs from a source other than AAV2 may be ed for this construct to generate another pseudotyped AAV. Alternatively, ITRs from the same source as the capsid may be selected.
In certain embodiments, ITRs may be selected to generate a self-complementary AAV, such as defined infra.
In certain embodiments, the promoter is CB7, a hybrid between a cytomegalovirus (CMV) ate early enhancer (C4) and the chicken beta actin promoter. In other ments, the promoter is a ubiquitin C (UbC) promoter. See, e.g., See, e.g., k® accession numbers AF232305 (rat) and D6379l (human), respectively.
Still other promoters and/or enhancers may be selected. See, e.g., galovirus (CMV) immediate early enhancer (260 bp, C4, GenBank # K031041). Chicken ctin promoter (281 bp, CB, GenBank # X00182.1). In still other embodiments, multiple ers and/or promoters may be included.
In certain ments, an intron is included. One suitable intron is a chicken beta- actin intron. In one embodiment, the intron is 875 bp (GenBank # X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected.
The vector genomes described herein include a polyadenylation signal ). A variety of suitable polyA are known. In one example, the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank # V00882.1). In other embodiments, an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected.
Optionally, other suitable vector elements may be selected Which may include, e.g., a UTR sequence or a Kozak ce.
In one embodiment, the vector genome contains, ITR-CB7-CI-aVEGFv2-rBG-ITR, [SEQ ID NO: 3]. In another embodiment, the vector genome contains: ITR-UbC-CI- aVEGFv2-SV40-ITR.[SEQ ID NO: 9]. In one embodiment, the vector genome contains, ITR-CB7-CI-aVEGFv3-rBG-ITR [SEQ ID NO: 14]. In another ment, the vector genome contains: ITR-UbC-PI-aVEGFv3-SV40-ITR [SEQ ID NO: 19]. In another embodiment, the vector genome contains: ITR-UbC-PI-aVEGFv1-SV40-ITR [SEQ ID NO: 24].In a further embodiment, the vector genome contains TR- CB7.CI.aVEGFv4.rBG-AAV2 ITR [SEQ ID NO: 35]. In a further embodiment, the vector genome contains TR-CB7.CI.aVEGFv5.rBG-AAV2 ITR [SEQ ID NO: 36]. In a further embodiment, the vector genome contains AAV2-ITR-CB7.CI.aVEG Fv6.rBG-AAV2 ITR [SEQ ID NO: 37]. In a further embodiment, the vector genome contains AAV2-ITR- CB7.CI.aVEGFv7.rBG-AAV2 ITR [SEQ ID NO: 38]. In a further embodiment, the vector genome contains AAV2-ITR-CB7.CI.aVEGFv8.rBG—AAV2 ITR [SEQ ID NO: 39]. In a further ment, the vector genome contains AAV2-ITR-CB7CI.aVEGFv9.rBG—AAV2 ITR [SEQ ID NO: 40]. In a further ment, the vector genome contains AAV2-ITR- CB7.CI.aVEGFv10.rBG—AAV2 ITR [SEQ ID NO: 41]. In a further embodiment, the vector genome contains TR-CB7.CI.aVEGFv11.rBG-AAV2 ITR [SEQ ID NO: 42]. In a further embodiment, the vector genome contains AAV2-ITR-CB7.CI.aVEGFv12.rBG- AAV2 ITR [SEQ ID NO: 43]. In a further embodiment, the vector genome contains AAV2 7.CI.aVEGFvl3.rBG-AAV2 ITR [see, SEQ ID NO: 44]. In a further embodiment, the vector genome contains AAV2 ITR-CMV.PI.aVEGFv7.eCMVIres.aVEGF.SV40-AAV2 ITR [SEQ ID NO: 45]. In another ment, the vector genome contains AAV2 ITR.CMV.PI.aVEGF.FMDVlIRES.SV40 - ITR [SEQ ID NO: 46]. In still a further embodiment, the vector genome contains AAV2 ITR.CMV.PI.aVEGF.cMycIRES.Fab.SV40 - ITR [SEQ ID NO: 47].
For use in producing an AAV viral vector (e.g., a recombinant (r) AAV), the sion cassettes can be carried on any suitable vector, e. g. , a d, which is delivered to a ing host cell. The plasmids useful in this invention may be engineered such that they are suitable for replication and packaging in prokaryotic cells, mammalian cells, or both. Suitable transfection techniques and packaging host cells are known and/or can be readily designed by one of skill in the art. s for generating and isolating AAVs suitable for use as vectors are known in the art. See generally, e. g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene I5 therapy vector: Vector development, production and clinical applications," Adv. Biochem.
Engin/Biotechnol. 99: 119-145, Buning er al., 2008, "Recent developments in adeno- associated virus vector technology," J. Gene Med. -733, and the references cited below, each of which is incorporated herein by reference in its entirety. For packaging a transgene into virions, the ITRs are the only AAV components required in cis in the same construct as the nucleic acid le containing the expression tes. The cap and rep genes can be supplied in trans.
In one embodiment, the expression cassettes described herein are engineered into a genetic element (e.g., a shuttle plasmid) which transfers the immunoglobulin construct sequences carried thereon into a packaging host cell for production of a viral . In one embodiment, the selected genetic element may be delivered to an AAV packaging cell by any suitable method, including transfection, oporation, liposome ry, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
Stable AAV packaging cells can also be made. Alternatively, the expression cassettes may be used to generate a viral vector other than AAV, or for production of mixtures of antibodies in vitro. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY .
As used herein, "AAV8 capsid" refers to the AAV8 capsid having the amino acid sequence of GenBank accession:YP_077180 (SEQ ID NO: 48) encoded by nucleic acid sequence ofNCBI Reference Sequence: NC_006261.1 (SEQ ID NO: 49), both of which are incorporated by reference . Some variation from this encoded sequence is assed by the present invention, which may include sequences having about 99% identity to the referenced amino acid sequence in GenBank accession:YP_077180, US Patent 7,282,199, 7,790,449, 8,319,480, 8,962,330, US 8,962,332, (i.e., less than about 1% variation from the referenced sequence). In another embodiment, the AAV8 capsid may have the VP1 sequence of the AAV8 variant described in W02014/124282, which is incorporated by reference herein. Methods of generating the , coding sequences therefore, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. USA. 100 (10), 6081-6086 (2003), US 2013/0045186A1, and which shows tropism for the desired target cell, e.g., photoreceptors, RPE or other ocular cells is selected. For example, an AAV8 capsid may have Y447F, Y733F and T494V mutations (also called "AAV8(C&G+T494V)" and "rep2-cap8(Y447F+733F+T494V)"), as described by Kay et al, Targeting eceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors, PLoS One. 2013, 8(4): e62097. Published online 2013 Apr 26, which is orated herein by reference. See, e.g., Mowat et al, Tyrosine capsid- mutant AAV vectors for gene delivery to the canine retina ?om a subretinal or intravitreal ch, Gene y 21, 96-105 (January 2014), which is orated herein by reference. In r embodiment, the AAV capsid is an AAV8 capsid, which preferentially s bipolar cells. See, reference.
As used herein, the term "NAb titer" a measurement ofhow much neutralizing antibody (e.g., anti-AAV Nab) is produced which neutralizes the physiologic effect of its targeted epitope (e.g., an AAV). Anti-AAV NAb titers may be measured as described in, e.g., Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno- Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): p. 381-390, which is orated by reference herein.
The terms "percent (%) identity", "sequence identity77 (C , t sequence identity", or "percent identical" in the context of amino acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence. Percent ty may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a e fragment thereof or the corresponding nucleic acid sequence coding sequencers. A le amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids.
Generally, when referring to "identity", "homology", or "similarity" between two different ces, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or n (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. Alignments are performed using any of a y of publicly or cially available Multiple Sequence Alignment Programs. ce ent programs are available for amino acid sequences, e.g., the "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "M",EME and "Match-Box" programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and ms. See, e.g., J. D. Thomson et al, Nucl. Acids. Res, "A comprehensive ison of multiple ce alignments", :2682—2690 (1999). As used herein, the term "operably " refers to both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
A "replication-defective virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression te containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient, i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest ?anked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
The abbreviation "sc" refers to omplementary. "Self-complementary AAV" refers a plasmid or vector having an expression cassette in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA te. Upon infection, rather than waiting for cell mediated synthesis of the second , the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g., D M McCarty et al, "Self-complementary recombinant adeno- associated virus (scAAV) vectors promote efficient transduction ndently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 254. Selfcomplementary AAVs are described in, e.g., US. Patent Nos. 6,596,535, 717, and 7,456,683, each of which is orated herein by reference in its ty.
The term "heterologous" when used with reference to a protein or a nucleic acid indicates that the protein or the nucleic acid comprises two or more sequences or subsequences which are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more ces from unrelated genes arranged to make a new functional nucleic acid. For example, in one embodiment, the nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene. Thus, with reference to the coding sequence, the promoter is logous.
The term "exogenous" when used with reference to a protein or nucleic acid sequences indicates two or more sequences or subsequences which are from different sources, e.g., an AAV and a human protein.
It is to be noted that the term "a" or "an" refers to one or more. As such, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.
The words "comprise , comprises", and "comprising" are to be interpreted inclusively rather than exclusively. The words "consist", "consisting", and its variants, are to be interpreted exclusively, rather than ively. While s embodiments in the ication are presented using "comprising" language, under other circumstances, a related embodiment is also intended to be interpreted and described using "consisting of" or "consisting essentially of" language.
As used herein, the term "about" means a variability of 10% from the reference given, unless otherwise specified.
Unless defined otherwise in this specification, technical and scienti?c terms used herein have the same g as commonly understood by one of ordinary skill in the art and by reference to hed texts, which provide one d in the art with a general guide to many of the terms used in the present application. rAAV8.aVEGF ation The rAAV8.aVEGF formulation is a suspension containing an effective amount of rAAV8.aVEGF vector suspended in an s solution. In certain embodiments, the suspension contains buffered saline, optionally with a surfactant and/or other excipients. A ed saline typically contains a physiologically compatible salt or mixture of salts, e. g. phosphate buffered saline, sodium chloride, or a mixture thereof.
In one embodiment, the formulation may contain, e.g., about 1 x 108 GC/eye to about 7 x 1012 GC/eye, or about 5 x 109 GC/eye to about 1 x 1011 GC/eye, or about 1010 GC/eye, or about as measured by quCR or digital droplet PCR (ddPCR) as bed in, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr,25(2):115-25. doi: .1089/hgtb.2013. 131. Epub 2014 Feb 14, which is incorporated herein by reference.
For example, a suspension as ed herein may contain both NaCl and KCl. The pH may be in the range of 6.5 to 8, or 7.2 to 7.6. pH may be assessed using any suitable method, e.g., USP <791> [US Pharmacopeial Convention, reference standards]. A suitable surfactant, or combination of tants, may be ed from among a Poloxamers, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) ?anked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN xyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation ns a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. The surfactant may be t in an amount up to about 0.0005 % to about 0.001% of the suspension. In one embodiment, the rAAV8.aVEGF formulation is a suspension containing at least 1x1011 genome copies (GC)/mL, or greater, e.g., about 1 X 1013 GC/mL as measured by quCR or digital droplet PCR (ddPCR) as described in, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr,25(2):115-25. doi: 10.1089/hgtb.2013. 131. Epub 2014 Feb 14, which is incorporated herein by reference. In one embodiment, the vector is suspended in an aqueous solution containing 180 mM sodium chloride, 10 mM sodium phosphate, 0.001% Poloxamer 188, pH 7.3. The formulation is suitable for use in human subjects and is administered subretinally.
In order to ensure that empty capsids are removed from the dose of AAV8.aVEGF that is administered to patients, empty capsids are separated from vector particles during the vector purification process. In one embodiment, the vector particles containing packaged genomes are ed from empty capsids using the process described in International Patent Application No. PCT/US 76, ?led December 9, 2016 and its priority documents, US Patent Appln Nos. 62/322,098, filed April 13, 2016 and 62/266,341, filed on December 11, 2015, and entitled "Scalable Purification Method for AAV8", Which is orated by reference . , a two-step purification scheme is described Which ively captures and isolates the genome-containing rAAV vector particles from the clarified, concentrated supernatant of a rAAV production cell culture. The s utilizes an affinity capture method performed at a high salt concentration followed by an anion ge resin method performed at high pH to provide rAAV vector particles Which are ntially free ofrAAV ediates.
In one embodiment, the pH used is from 10 to 10.4 (about 10.2) and the rAAV les are at least about 50% to about 90% purified from AAV8 intermediates, or a pH of .2 and about 90% to about 99% purified from AAV8 intermediates. In one embodiment, this is determined by genome copies. A stock or preparation of rAAV8 particles ged genomes) is "substantially free" of AAV empty capsids (and other intermediates) When the rAAV8 particles in the stock are at least about 75% to about 100%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least 99% of the rAAV8 in the stock and "empty capsids" are less than about 1%, less than about 5%, less than about 10%, less than about 15% of the rAAV8 in the stock or preparation. In one embodiment, the formulation is be characterized by an rAAV stock having a ratio of "empty" to "full" of l or less, preferably less than 0.75, more preferably, 0.5, preferably less than 0.3.
In a further embodiment, the average yield of rAAV particles is at least about 70%.
This may be calculated by determining titer (genome copies) in the e loaded onto the column and the amount presence in the ?nal elutions. Further, these may be determined based on q-PCR analysis and/or SDS-PAGE techniques such as those described herein or those Which have been described in the art.
For example, to calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., an iodixanol gradient-puri?ed ation Where # of GC = # of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band s of the test article peaks. The number of particles (pt) per 20 uL loaded is then multiplied by 50 to give particles (pt) /mL. Pt/mL divided by GC/mL gives the ratio of particles to genome copies (pt/GC). Pt/mL—GC/mL gives empty pt/mL. Empty pt/mL divided by pt/mL and x 100 gives the percentage of empty particles.
Generally, methods for assaying for empty eapsids and A AV vector particles with packaged s have been known in the art. See, e. g, Grimm et al, Gene Therapy (l 999) 6: l322—l330, Soininer et al.,MoZec. filial", (2003) 7: l22—l28 To test for denatured capsid, the s include subjecting the treated AAV stock to SDS—polyaeiylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3—89in —aeetate in the buffer, then mnning the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose nes, preferably nylon. Anti—A AV eapsid antibodies are then used as the y antibodies that bind to denatured capsid proteins, preterably an anti~AAV capsid monoclonal antibody, most preferably the El anti—AAVQ monoclonal antibody (Wobus et al, J. Viral, (2000) 74:928l— 9293). A secondary antibody is then used, one that binds to the y antibody and contains a means for detecting binding with the primary antibody, more preferably an an ti- lgG antibody containing a ion molecule ntly bound to it, most preferably a sheep an ti ~rnou st lgG dy covalently linked to horseradish peroxidase. A method for detecting binding is used to uantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDSJ’AGE loading buffer containing reducing agent (c.g Eli"), and capsid proteins were resolved on st gradient poly acylaniide gels (cg.
. Silver staining may be performed using SilverXpress (lnvitrogerij CA) according to the manufacturer's instructions. in one embodiment, the concentration ol‘AAV vector genomes {vg) in column fractions can be measured by quantitative real time PCR ).
Samples are diluted and digested with DNase l (or another suitable nuclease) to remove exogenous DNA. Alter inactivation of the nuclease, the samples are liurther diluted and amplified u sing primers and a ’l‘aolvlanl‘M lluorogeriie probe speci?c for the DNA ce n the primers. The number of cycles required to reach a delined level of iluorescence (threshold cycle? Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence ion System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the (243th reaction The cycle old (Ct) values obtained from the s are used to determine vector genome titer by nonnalising it to the Ct value of the plasmid rd curve. End—point assays based on the l PCR can also be used, in one aspect, an optimized q-PCR method is provided herein which utilizes a broad spectrum serine protease, eg proteinase K (such as is commercially available from Qiagen).
More particularly, the optimized dl’CR genome titer assay is similar to a standard assay, except that after the DNase l digestion? samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K butler in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2 fold or higher. 'l‘ypically, proteinase K ent is about (12 mg/mli, but may be varied from (ll nig/mL to about 1 nig/mL. The treatment step is generally conducted at about 55 CC for about l5 minutes, but may he med at a lower temperature (e.g about 37 0C to about 50 0C) over a longer time period (eg. about 20 minutes to about 30. minutes)? or a higher temperature (egg up to about 60 0C) for a shorter time period (egg about 5 to l0 minutes). Similarly; heat vation is generally at about 95 0C for about l5 minutes, but the temperature may be lowered (egg about 70 to about 90 0C) and the time extended (eg. about 20 minutes to about 30 minutes). Samples are then diluted (egg, lOOO fold) and sub} ected to TaqMan analysis as described in the standard assay.
Additionally, or alternatively, droplet digital l’CR (ddl’CR) may be used. For example, methods for determining single—stranded and sell—complementary A139! vector genome titers by ddl’CR have been described. See, erg, lvl Lock et all llu Gene 'l'herapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): l l5-25. doi: ll). lOXQ/hgtbl??. I31.
Epub 20M Feb l4.
Manufacturing The rAAV8aVEGF vector can be ctured as shown in the ?ow diagram shown in FIG 9. Brie?y, cells (6. g. HEK 293 cells) are propagated in a suitable cell culture system and transfected for vector generation. The rAAV8.aVEGF vector can then be harvested, concentrated and puri?ed to prepare bulk vector which is then ?lled and ?nished in a downstream process. Methods for cturing the gene therapy vectors bed herein include s well known in the art such as tion of plasmid DNA used for production of the gene therapy vectors, generation of the vectors, and puri?cation of the s. In some embodiments, the gene therapy vector is an AAV vector and the plasmids generated are an AAV cis-plasmid encoding the AAV genome and the gene of interest, an AAV trans-plasmid containing AAV rep and cap genes, and an adenovirus helper plasmid.
The vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, post- transfection medium exchange to serum free medium, and the harvest of vector-containing cells and culture media. The harvested vector-containing cells and culture media are referred to herein as crude cell harvest.
The crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, dia?ltration of the vector harvest, micro?uidization of the vector harvest, nuclease digestion of the vector harvest, ?ltration of micro?uidized intermediate, cation by chromatography, puri?cation by entrifugation, buffer exchange by tangential ?ow ion, and formulation and ?ltration to e bulk vector.
In a speci?c embodiment, the methods used for manufacturing the gene therapy s are bed in the examples herein.
Patient Population Patients who are candidates for treatment include those with neovascular age-related macular ration, macular edema following retinal vein occlusion (RVO), diabetic macular edema (DME), diabetic retinopathy (non-proliferative diabetic retinopathy (NPDR), proliferative diabetic retinopathy (PDR) in patients with DME, ic retinopathy in patients with diabetic macular edema. These patients are particularly well suited for subretinal treatment with an AAV8aVEGF composition as described herein.
Patients who are candidates for cular, including, e.g., subretinal and/or intravitreal administration, with an AAV8aVEGF as described herein include those with macular degeneration, neovascular/wet/exudative age-related macular degeneration, macular edema following retinal vein occlusion (RVO) (including central retinal vein occlusion (CRVO) and branch retinal vein occlusion (BRVO)) central/hemi/branch retinal vein occlusion, retinal artery occlusion, retinal neovascularization, diabetic r edema (DME), ic retinopathy (non-proliferative diabetic retinopathy (NPDR), proliferative diabetic retinopathy (PDR)) in patients with DME, diabetic retinopathy without macular edema ding eatment of vitrectomy for proliferative diabetic retinopathy), active photocoagulated diabetic retinopathy, choroidal neovascularization, rare causes of choroidal neovascularization (angioid streaks, choroiditis [including choroiditis secondary to ocular histoplasmosis], idiopathic degenerative , l phies, rubeosis iridis, and trauma), idiopathic choroidal neovascularization, corneal neovascularization, retinopathy of prematurity, optic nerve head perfusion, retrolental fibroplasia, retinal degeneration, vitreomacular traction syndrome, retinal detachment, diabetic traction l detachment, submacular vascularized pigment epithelial detachments, Vogt Koyanagi Harada Disease, t epithelial ment, pigment epithelium rip, vitreoretinopathy proliferative, vitreoretinal surgery in diabetic tractional retinal detachment, polypoidal choroidal opathy, punctate inner choroidopathy (PIC), ocal choroiditis, l serous chorioretinopathy (CSC), serpiginous choroiditis, vitreous hemorrhage, pars plana vitrectomy for vitreous hemorrhage, ic premacular hemorrhage with active fibrovascular proliferation, Choroidal hemorrhage amblyopia, myopia, myopic choroidal neovascularization, choroidal subfoveal/juxtafoveal cularization in high myopia, choroidal melanoma, ocular histoplasmosis syndrome, tecalcitrant in?ammatory ocular neovascularization (neovascularization, tuberculosis, multifocal serpiginous choroiditis, harada toxoplasmosis), Pseudoxanthoma elasticum, hereditary eye diseases, corneal endothelial cell loss, Vogt gi Harada Disease, non-arteritic anterior ischemic optic neuropathy, cystoid macular edema, refractory cystoid macular oedema, idiopathic macular telangiectasia, Coat's e s' disease, also known as exudative retinitis or retinal telangiectasis), glaucoma, neovascular glaucoma, steroid-induced glaucoma, ocular hypertension, ma surgery, control of wound healing , uveal melanoma, uveitis, radiation pathy, pattern dystrophy, radiation retinopathy, radiation necrosis, Hippel- Lindau Disease; Von Hippel-Lindau Syndrome; thalmitis; neuromyelitis optica spectrum disorder; pterygium; primary pterygium (including as adjunctive therapy for primary pterygium surgery); ent pterygium; retinal drusen; eye sms; intraocular melanoma; cataract; corneal graft failure; trabeculectomy; lipid keratopathy; penetrating keratoplasty; herpetic keratopathy; rosacea; retinal angioma; retinovascular disease; vision ers; Vitreoretinopathy proliferative; iris neovascularization (NV); corneal NV; including pannus; pars planitis sarcoid or Eale’s disease.
Patients Who are ates for ent With an VEGF (the anti-VEGF transgene product) in a regimen Which involves a combination With; but not limited to 24GyE proton; l6GyE; ine; Proparacaine Hydrochloride; Tetravisc; l; Zimura; inolone acetonide; Ranibizumab; or Ozurdex. Examples of suitable indications include those in the preceding paragraph. For example; a combination regimen involving an AAV8.aVEGF With one or more of the drugs listed above; may be used for treatment of exudative lated macular degeneration; central retinal vein occlusion; idiopathic polypoidal choroidal opathy; and/or diabetic macular edema.
The AAV8.aVEGF composition described herein are also useful in preventing vascularization in a number of cancers; neoplasms and other diseases associated With VEGF.
Such compositions may be administered for any suitable route; ing; e.g.; intravenous; intralesional; direct delivery to a tumor or organ; among others. Such patients may include those With Acute Lymphoblastic Leukemia (ALL); Acute d Leukemia (AML); Adrenocortical Carcinoma; Adrenocortical Carcinoma; AIDS-Related Cancers; Kaposi Sarcoma; AIDS-Related Lymphoma; Primary CNS Lymphoma; Anal Cancer; Appendix Cancer; Astrocytomas; al Teratoid/Rhabdoid Tumor; Basal Cell Carcinoma of the Skin; Bladder Cancer; Bone Cancer (includes Ewing Sarcoma and arcoma and Malignant Fibrous Histiocytoma); Brain Tumors; Breast Cancer; Bronchial Tumors; Burkitt Lymphoma; Non-Hodgkin Lymphoma; Carcinoid Tumors; oma of Unknown Primary; Cardiac Tumors; Central Nervous System Atypical Teratoid/Rhabdoid Tumor; Embryonal Tumors; Germ Cell Tumor; Primary CNS Lymphoma; Cervical Cancer; Unusual Cancers of Childhood; giocarcinoma; Bile Duct Cancer; Chordoma; Chronic Lymphocytic Leukemia (CLL); Chronic Myelogenous Leukemia (CML); Chronic Myeloproliferative Neoplasms; Colorectal Cancer; Craniopharyngioma; Cutaneous T-Cell Lymphoma; Ductal Carcinoma In Situ (DCIS); Central Nervous System nal Tumors; Endometrial Cancer, Ependymoma, Esophageal Cancer, Esthesioneuroblastoma, Ewing Sarcoma , Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Eye Cancer, Intraocular Melanoma, Retinoblastoma, Fallopian Tube Cancer, s cytoma of Bone, Malignant, Osteosarcoma, Gallbladder Cancer, Gastric Cancer, Childhood Gastric Cancer, Gastrointestinal Stromal Tumors (GIST), Germ Cell Tumors, Childhood Central Nervous System Germ Cell Tumors, Childhood Extracranial Germ Cell Tumors, Extragonadal Germ Cell Tumors, Ovarian Germ Cell Tumors, Testicular Cancer, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Heart Tumors, Hepatocellular Cancer, cytosis, Langerhans Cell, Hodgkin Lymphoma, aryngeal Cancer, Intraocular Melanoma, Islet Cell Tumors, Pancreatic Neuroendocrine Tumors, Kaposi Sarcoma, Kidney Cancer, Langerhans Cell Histiocytosis, eal , Childhood Laryngeal Cancer and Papillomatosis, ia, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer (Non-Small Cell and Small Cell), Childhood Lung Cancer, Lymphoma, Male Breast Cancer, Malignant Fibrous Histiocytoma of Bone and Osteosarcoma, Melanoma, Intraocular Melanoma, Merkel Cell Carcinoma, Malignant Mesothelioma, atic Cancer, Metastatic Squamous Neck Cancer With Occult Primary, Midline Tract Carcinoma ing NUT Gene, Mouth Cancer, Multiple Endocrine Neoplasia Syndromes, Multiple Myeloma/Plasma Cell sms, Mycosis Fungoides, Myelodysplastic Syndromes, Myelodysplastic, Myeloproliferative Neoplasms, Myelogenous ia, Chronic (CML), Acute Myeloid Leukemia (AML), Chronic Myeloproliferative Neoplasms, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin Lymphoma, Oral Cancer, Lip and Oral Cavity Cancer and Oropharyngeal Cancer, Osteosarcoma and Malignant Fibrous Histiocytoma of Bone, Ovarian , Pancreatic , Pancreatic Neuroendocrine , Papillomatosis, Paraganglioma, Paranasal Sinus and Nasal Cavity Cancer, Parathyroid Cancer, Penile Cancer, Pharyngeal Cancer, romocytoma, Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, ncy and Breast Cancer, Primary Central Nervous System (CNS) Lymphoma, Primary Peritoneal Cancer, Prostate Cancer, Rectal Cancer, Recurrent Cancer, Renal Cell Cancer, Retinoblastoma, Salivary Gland Cancer, a, Childhood Rhabdomyosarcoma, ood Vascular Tumors, Ewing Sarcoma, Osteosarcoma, Uterine Sarcoma, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Cell Carcinoma of the Skin, Squamous Neck Cancer With Occult Primary, Metastatic, Stomach Cancer, ous T-Cell Lymphoma, ular , Throat Cancer, Nasopharyngeal Cancer, Oropharyngeal Cancer, Hypopharyngeal Cancer, Thymoma and Thymic Carcinoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter y (Renal Cell) Cancer), Carcinoma of n Primary, Childhood Cancer of Unknown Primary, Unusual Cancers of Childhood, Ureter and Renal Pelvis, Urethral Cancer, Endometrial Uterine Cancer, Uterine a, Uterine Leiomyosarcomas, Vaginal Cancer, Vascular Tumors, Vulvar Cancer, Wilms Tumor and Other Childhood Kidney Tumors, abdominal neoplasms (adenocarcinoma, hepatocellular, papillary serous mullerian, Lapatinib, colorectal, ovarian, ian tube, peritoneal ncer/neoplasms/carcinoma/tumors), lymphoproliferative disorder, small ine cancer, acoustic neuroma(e.g. vestibular Schwannoma, Neurofibromatosis Type 2), acute myeloid ia, acute respiratory distress syndrome (ARDS), head and neck cancer, squamous cell carcinoma, le myeloma, gkin's lymphoma, B-cell lymphoma, sarcoma, neuroblastoma, advanced , alignant neoplasms of female genital organs, atic or unresectable solid tumor, anaplastic astrocytoma, Colon Cancer, Metastatic Melanoma, Malignant Ascites, Renal Cell oma, Glioblastoma, Gliosarcoma, Colorectal Liver Metastases, Advanced Malignancy, Myeloma, Gestational Trophoblastic Neoplasia, Choriocarcinoma, Placental Site Trophoblastic Tumor, Epithelioid Trophoblastic Tumor, Biliary Tract Cancer, Malignant Glioma, Cervical Cancer, Uterine Cancer, Mesothelioma. Candidates thereof are treated With said composition alone or in combination With anti-cancer treatments, for example but not d to paclitaxel, carboplatin, oxaliplatin, radiation, capecitabine, irinotecan, ?uorouracil, doxorubin hydrochloride liposome, erlotinib hydrochloride, irinotecan hydrochloride, Irinotecan hydrochloride hydrate (CPT-l l), gemcitabine hydrochloride, Pazopanib Hydrochloride, can hydrochloride, Tri?uridine/tipiracil hydrochloride, Pegylated mal Doxorubicin Hydrochloride, enzastaurin hydrochloride, mitoxantrone hydrochloride, epirubicin hydrochloride, docetaxel, gemcitabine, erlotinib, cisplatin, herapy, cetuXimab, FOLFIRI-Cetuximab, 5-Fluorouracil (5-FU), LVSFUZ, cyclophosphamide, temozolomide, pemetrexed, levofolinate calcium (l-LV), Leucovorin m, FOLFOX, FOLFOX6, mFOLFOX, FOLFOXIRI, FOLFIRI, doxorubicin, Liposomal Doxorubicin, doxorubicin HCL liposome, Sorafenib Tosylate, sorafenib, triamcinolone, Triamcinolone ide, trastuzumab, everolimus, sunitinib, dexamethasone, conventional surgery, xeloda, radiotherapy, temsirolimus, pazopanib, Leucovorin (LV), 1- LV, anitumumab, epirubicin, orfin, AMG 655, Amgen 386, AMG 479, AMG 706, AMG 951, AMG 102, Folinic Acid, levo-folinic acid, etoposide, BAY 43-9006, atezolizumab, Interferon Alfa-2b, Interferon alpha-2a, interferon alfa, Gamma-Interferon- 1b, Photodynamic Therapy, vinorelbine tartrate, vinorelbine, topotecan, tarceva, pemetreXed um, estramustine phosphate sodium, Imetelstat sodium, XELOX, RAD001, pegfilgrastim, aXel albumin-stabilized nanoparticle formulation, ipilimumab, Stereotactic Radiosurgery (SRS), Stereotactic Radiation, ozurdeX, letrozole, AG—013736 (aXitinib), filgrastim, crizotinib, cediranib maleate, nib, bortezomib, abraXane, vorinostat, vincristine, TRC105, rituXimab, regorafenib, pembrolizumab, methotreXate, imatinib, Herceptin, tecentriq, 0Xaliplatin (OXA), lomustine, iXabepilone, CPT-l 1, CGC- 11047, vinorelbine tartrat, tartrate, sone, nivolumab, fulvestrant, enzastaurin, d0Xil, AZD2014, AZD2281, AZD2171, 7, AZD5363, AZD8931, Vitamin B12, Vitamin C, Vitamin D, Valproic acid, mitomycin C, Cediranib e, lenalidomide, lapatinib, HAI AbraXane, HAI Irinotecan, GDC-0941, GDC-0449, GDC-0980, tamide, Xeliri, vandetanib, thalidomide, rapamycin, olaparib, NovoTTF100A, ine, metmab, Imatinib Mesylate (Gleevec), ifosfamide, hydr0Xychloroquine, and GM-CSF.
Still other suitable conditions for treatment may include, e.g., Hemophilia, Synovitis, Hypertension, keloid, in?ammation, Radiation Necrosis, and stic Meningitis. These and the conditions described above may be delivered by any suitable route, except where subretinal or another type of administration to the eye is specified.
In certain embodiments, patients receive a single dose of rAAV8.aVEGF administered subretinally. For example, this is particularly well suited for treatment of neovascular age-related macular degeneration, r edema following retinal vein occlusion (RVO), ic macular edema (DME), ic retinophathy (non-proliferative diabetic retinopathy , proliferative diabetic retinopathy (PDR) in ts with DME, diabetic retinopathy in patients with diabetic macular edema.
The dose of rAAV8.aVEGF stered to a patient is at least 1 X 109 GC/eye to 1 X 1013 GC/eye, or at least 1 X 1010 GC/eye to about 7.5 X 1012 GC/eye (as measured by quCR or ddPCR). r, other doses may be selected. For eXample, therapeutically effective subretinal doses of the rAAV8.aVEGF for patients may range from about 6.6 X 109 GC/eye to about 6.6 X 1011GC/eye, most preferably, 6.6 X 1010 GC/eye, in an injection volume ranging from about 0.1 mL to about 0.5 mL, preferably in 0.1 to 0.15 mL (100 — 150 ul). In still other embodiments, therapeutically effective trations may be about 1X105 concentration can be 1 X 105 GC/uL to l X109 GC/uL, and the volume of injection for any GC concentration in that range can be from 10 uL to 300 uL.
In certain embodiments, patients may e an rAAV8.aVEGF by subretinal administration by a retinal surgeon under local anesthesia. The procedure may e standard 3 port pars plana vitrectomy With a core vitrectomy followed by inal delivery into the subretinal space by a inal cannula (36 to 41 gauge). In certain embodiments, 100 to 150 microliters of rAAV8.aVEGF Will be delivered.
In some embodiments, rAAV8.aVEGF is administered in combination With one or more therapies for the treatment of wetAMD or another selected disorder. In some embodiments, rAAVaVEGF is administered in combination With laser coagulation, photodynamic therapy With orfin, and intravitreal With anti-VEGF agent, including but not d to pegaptanib, ranibizumab, a?ibercept, or bevacizumab.
In certain embodiments, patients for rAAV8.aVEGF therapy may include those Which have previously responded to conventional anti-VEGF antibody (Fab) treatment.
The goal of the gene therapy treatment of the invention is to slow or arrest the progression of retinal degeneration, and to slow or prevent loss of vision with minimal intervention/invasive procedures. In certain embodiments, the efficacy of the gene therapy treatment may be ted by the elimination of or reduction in the number of rescue treatments using standard of care, for example, intravitreal injections With anti-VEGF , including but not limited to pegaptanib, ranibizumab, cept, or bevacizumab.
In certain embodiments, efficacy by measured by one or more of the following: Vision change, visual acuity, including best corrected visual acuity measured by (BCVA) score, Snellen chard or Early Treatment Diabetic Retinopathy (ETDRS) visual acuity score, percentage of ts losing or g measured by ETDRS, distance best corrected visual , reading best corrected visual acuity, change in NEI Visual Functioning Questionnaire-25 (VFQ-25) score of -related quality of life, st , questionnaire sensitivity measured by Pelli-Robson charts, low-contrast visual acuity on Electronic Visual Acuity Tester, peripheral visual field as measured by Goldmann visual field, mean angle opening distance and trabecular-iris spur area measured by Heidelberg Slit-Lamp Optical Coherence Tomography, Preferential-Hyperacuity-Perimeter (PHP) testing of Age Related r Degeneration (AMD) by characterizing central and paracentral metamorphopsia, retinal ivity (meRG, Nidek MP-l microperimetry), Visual Analog Scale (VAS), Macular Mapping Test, electrophysiological changes, including electroretinogram (ERG), pattern electroretinography (PERG) and full ?eld (or ?ash) electroretinography (?ERG), multifocal electroretinography (meRG), meRG central ring amplitude density, mean retinal ivity (dB) in three concentric rings (4°, 8° & 12°), visual evoked potential (VEP): ECG parameters included PR al, QRS interval, and corrected QT interval using icia's formula (QTcF). Anatomical changes, including regression ofNVE (retinal neovascularization), CNVM (Choroidal Neovascular Membranes), changes measured using optical coherence topography (OCT), including macular volume, macular thickness, central macular sub?eld thickness, retinal volume (inner retinal volume and outer retinal volume), retinal thickness, central retinal thickness, central sub?eld retinal thickness (CSRT), eal retinal ess (SRT), foveal thickness, m diameter of foveal avascular zone, ity of l layers, external ng membrane (ELM) integrity, ellipsoidal line/band integrity, lens status, lens opacity, cular membrane regression percentage measured by Optical nce tomography angiography (OCTA), degree of integrity of the photoreceptors in the inner/outer ts layer in the 1 mm centered in the fovea.
Optionally, during trial, AMD lesion size and leakage may be by ?uorescein angiography, change in total lesion size and CNV (choroidal neovascularization) size by ?uorescein angiography (FA) and Indocyanine green angiography (ICG), active CNV leakage Which may include subretinal ?uid or hemorrhage, area of leakage, area of macular leakage, change in percentage of lesion hemorrhage, change in drusen size, amount of ?uid, intra-retinal cystoid changes (IRCs) volume, vessel density, presence of intra/sub-retinal ?uid, sub-retinal ?uid (SRF) height and diameter, intraretinal ?uid volume, anterior chamber reaction, chorioretinal perfusion (ICG), pment of geographic atrophy (GA) as detected by fundus photography (FP) and/or fundus auto?uorescence (AF), presence and extension of capillary occlusion, peripheral retinal ischemia, macular sensitivity using microperimetry, neovascularization of the iris, neovascularization of the angle, diabetic retinopathy.
In certain embodiments, subretinal and/or retinal injection of the AAV8.aVEGF results in plasma and serum levels free of the aVEGF.
In certain embodiments, ef?cacy may be monitored by measuring BCVA (Best- Corrected Visual Acuity), intraocular pressure, slit lamp biomicroscopy, indirect ophthalmoscopy, SD-OCT (SD-Optical nce Tomography). Signs of vision loss, infection, in?ammation and other safety events, including retinal detachment may also be monitored.
SD-OCT is a useful non-invasive, in vivo cross-sectional retinal microscopy technique. Suitable equipment is commercially available. See, e.g., Spectralis OCT, Heidelberg Engineering, Carlsbad, CA. In brief, this technique may be performed by dilating pupils. En face retinal imaging can be performed with near infrared (NIR) re?ectance (REF) and/or with NIR fundus auto?uorescence (FAF) using the scanning laser ophthalmoscope of this g system. Spectral domain optical coherence tomography scanning can be performed with 9 mm long ntal and al cross-sections through the fovea and overlapping 30 X 25 mm raster scans extending into the near midperiphery. The parameters may be ed as , or other suitable parameters determined comparable.
Retinal function can be evaluated by a full-field electroretinogram (ERG). An ERG is a mass electrical potential generated by the retina in se to light stimulus. Usually, it is recorded by an electrode in contact with the corneal surface. Electroretinograms can be I5 conducted in accordance with the recommendations set by the International Society for Clinical Electrophysiology of Vision (ISCEV, McCulloch, Doc Ophthalmol. 2015 Feb,l30(l): 1-12. 2015). In y, an electroretinogram (ERG) is usually generated when all retinal cells actively respond to a ?ash stimulation (a dark-adapted animal, moderate to intense ?ash). The 2 components are the following: 0 a-wave: comea-negative signal, first after the ?ash. Origin: eceptor photocurrent, the most direct signature of photoreceptor function. 0 b-wave: comea-positive signal following the a-wave generated mostly by on- bipolar cells d order neurons downstream from photoreceptors). In the examples described below, the following International Society for Clinical Electrophysiology of Vision (ISCEV) standard and additional protocols were used. However, these ters may be adjusted as needed or ed. Dark-adapted rod ERG: Stimulus intensity: 0.01 to 0.02 cd s m'z. Response: b-wave only, no a-wave. : rod "on" bipolar cells (second order s driven by input from rods). Meaning: a measure of rod function. Dark- adapted standard ?ash ERG: Stimulus intensity: 3 cd s m'z. se: combined rod-cone a- and b-waves, 60% to 70% of the signal being generated by the rod-driven pathway. Source: photoreceptors, both rods and cones (a-wave), higher order neurons driven by both rods and cones. Meaning: a measure of mostly rod function, less ive to the state of dark adaptation and less le than the "dim ?ash" response. Dark-adapted bright ?ash ERG: Stimulus intensity: 10 cd s m'z. Response and meaning: same as for the "standard ?ash" response, but bright ?ash response is larger in magnitude and may be less variable. Lightadapted standard ?ash cone ERG: Stimulus intensity: 3 cd s m'z, delivered in ce of 30 cd m'2 background light after 5 minutes of light adaptation. Response: a- and b-waves generated by cone-driven ys. Meaning: in presence of background light which completely desensitizes rods the ERG is ed exclusively by cones and cone-driven secondary retinal neurons and is a measure of the cone function. Light-adapted bright ?ash cone ERG (in addition to the ISCEV standard): Stimulus intensity: 10 cd s m'z, delivered in presence of 30 cd m'2 background light after 5 s of light adaptation. se and meaning: riven ERG as in case of the "Standard cone ERG", but of greater magnitude and potentially less variable. ERG measures (a-wave amplitude, a-wave implicit time, b- wave amplitude, b-wave it time) were summarized using mean and standard deviation (SD) for treated eyes and control eye.
Another measure of efficacy may include a lack of thickening of the retina.
As illustrated in the examples below, administration of 1 X 1010 GC/eye of an AAV8.aVEFG vector causes no impairment to retinal function. This dose is not a limitation on the therapeutically effective amounts which can be administered.
Measuring Clinical Objectives Safety of the gene therapy vector after administration can be assessed by the number of adverse events, changes noted on physical examination, and/or clinical laboratory ters assessed at multiple time points up to about 36 months post vector stration. Although physiological effect may be ed earlier, e.g., in about 1 day to one week, in one embodiment, steady state levels expression levels are reached by about 12 weeks.
Improvement/efficacy resulting from rAAV.aVEGF administration can be ed as a defined mean change in baseline in visual acuity at about 12 weeks, 12 months, 24 months, 36 months, or at other d time points. Other improvements/efficacy can be assessed as mean change from baseline in central retinal thickness as measured by spectral domain optical coherence tomography (SD-OCT) at 12, 24 and 36 months.
In some embodiments, treatment with VEGF results in a 5%, 10%, 15%, 20%, 30%, 40%, 50% or more increase in visual acuity from baseline. In some embodiments, treatment with rAAV.aVEGF results in a decrease, e.g., about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50% or more decrease in central retinal thickness . In other embodiments, the central retinal thickness is stable, i.e., no increase in central retinal ess. In certain ments, a measure of efficacy includes izing retinal thickness, and/or stabilizing/decreasing) exudate and/or drusen.
In one embodiment, expression may be ed as early as about 8 hours to about 24 hours post-dosing. One or more of the desired clinical effects described above may be observed within several days to several weeks post-dosing.
The ion is illustrated by the examples below which demonstrate that subretinal administration of an rAAV8.aVEGF vector results in gene transfer hout the retina, and expression of anti-VEGF Fab throughout the retina and in the vitreous and anterior chamber ?uids. This result is surprising in view of prior art gene therapy studies that demonstrated that gene transfer spreads laterally outside of the original injection bleb but remains confined to those expanded boundaries and did not achieve gene transfer and transgene expression outside this expanded area of injection (the "bleb" formed in the retina at the injection site), and offers an advantage over standard of care treatment for nAMD in that a single administration of the rAAV8.aVEGF vector should result in (i) continuous delivery of the effective amounts of the VEGF inhibitor throughout the retina which may in turn e mance as compared to repeated IVT administrations of high dose boluses of the VEGF inhibitor that dissipate over time, and (ii) avoidance of repeated ocular injections which pose additional risks and inconvenience to patients. Each aspect may e therapeutic outcome.
EXAM PLES: The following abbreviations are used in the specification: AAV refers to Adeno- Associated Virus. ACF refers to Anterior Chamber Fluid. Ad5 refers to Adenovirus type 5.
AE refers to Adverse Event. AMD refers to Age-Related Macular Degeneration. BCA refers to honinic Acid. BCVA refers to orrected Visual . BH refers to Bulk Harvest. BI refers to Bqu Drug Substance Intermediate. BP refers to Base pairs. CB refers to Chicken Beta Actin Promoter. CB7 refers to a hybrid CMV Enhancer (C4) and Chicken B- Actin Promoter. CBC refers to Complete Blood Count. CI refers to chicken n Intron.
CMC refers to Chemistry, Manufacturing and Control. CMO refers to Contract Manufacturing Organization. CMV refers to Cytomegalovirus. CNV refers to Choroidal Neovascularization. CS-10 refers to g 10-layer CellSTACKs® plates. ddPCR refers to Droplet Digital Polymerase Chain Reaction. DLS refers to Dynamic Light Scattering.
DMEM refers to Dulbecco’s Modi?ed Eagle Medium. DNA refers to deoxyribonucleic Acid. DP refers to Drug Product. ELISA refers to Enzyme-Linked Immunosorbent Assay.
ERG refers to electroretinogram. ELISPOT refers to Enzyme Linked Immunospot. Fab refers to n-Binding Fragment. FBS refers to Fetal Bovine Serum. GC refers to Genome Copies. g refers to gram. GLP refers to Good Laboratory Practices. GMP refers to Good Manufacturing ces. HEK293 refers to Human Embryonic Kidney Cells. HCP refers to Host Cell Protein. HS-36 refers to g 36-layer HYPERStacks® ICH refers to International Conference on Harmonization. IND refers to Investigational New Drug. IP refers to In-Process. ITR refers to Inverted Terminal Repeat. IU refers to Infectious Unit.
IV refers to Intravenous. IVT refers to itreal. KDa refers to KiloDalton. Kg refers to Kilogram. LOQ refers to Limit of fication. Lucentis® is a brand name Ranibizumab.
MCB refers to Master Cell Bank. MED refers to Minimally Effective Dose. ul refers to iter. mL refers to milliliter. Mm refers to millimeter. mRNA refers to Messenger I5 RNA. MS refers to Mass Spectrometry. Ng refers to Nanogram. NHP refers to Non-Human Primate. OCT refers to Optical Coherence Tomography. quCR refers to Optimized Quantitative Polymerase Chain Reaction. PCR refers to Polymerase Chain Reaction. PD refers to codynamics. popPK refers to Population Pharmacokinetics. PEI refers to Polyethylenimine. PK refers to Pharmacokinetics. POC refers to Proof-Of-Concept. PRN refers to pro re nata (as needed). QA refers to Quality Assurance. qPCR refers to Quantitative Polymerase Chain Reaction. rAAV refers to inant Adeno-Associated Virus. RBG refers to Rabbit Beta-Globin. RPE refers to Retinal Pigment Epithelium. S-36 refers to HYPERstack®36-layer. SEND refers to Standards for Exchange of Nonclinical Data. SOC refers to Standard of Care. SOP refers to Standard Operating Procedure. TCID50 refers to Tissue Culture Infectious Dose 50%. TFF refers to Tangential Flow Filtration. uL refers to Microliter. VA refers to Visual Acuity. VEGF refers to Vascular Endothelial Growth Factor. WAMD refers to Wet lated Macular Degeneration. YAG refers to Yttrium-aluminum-garnet.
EXAMPLE 1: Treating Human Subjects This Example relates to a gene therapy treatment for patients with neovascular (wet) age-related macular degeneration (nAMD). In this e, the gene therapy vector, rAAV8aVEGF, a ation de?cient adeno-associated viral vector 8 (AAV8) carrying a coding sequence for a soluble EGF Fab protein is administered to patients with nAMD. The goal of the gene therapy treatment is to slow or arrest the progression of retinal degeneration and to slow or prevent loss of vision with minimal intervention/invasive procedures.
A. Gene Therapy Vector The generation of several rAAV8aVEGF gene therapy vectors is described in Example 2 herein. Moreover, a schematic representation of the VEGF vector genome is shown in FIG 1. rAAV8.aVEGF is a plicating recombinant AAV8 viral vector containing a transgene that leads to the production of a human anti-vascular endothelial growth factor (anti-VEGF) antigen binding antibody fragment (Fab). The gene cassette is ?anked by the AAVZ inverted terminal repeats . Expression from the cassette is driven by a CB7 promoter, a hybrid of a cytomegalovirus ate-early enhancer and the chicken B-actin promoter. Transcription from this promoter is enhanced by the ce of the chicken B-actin . The polyadenylation signal for the expression cassette is from the rabbit in gene. The nucleic acid sequences coding for the heavy and light chains of anti-VEGF Fab are separated by a self-cleaving furin A linker. The incorporation of the furin-F2A linker ensures expression of about equal amounts of the heavy and the light chain polypeptides.
The ?nal product is supplied as a frozen solution of the AAV vector active ingredient in a formulation buffer in Crystal Zenith® vials sealed with latex-free rubber stoppers and aluminum ?ip-off seals. Vials are stored at 360°C.
B. Dosing & Route of Administration A volume of 250 uL of rAAV8aVEGF is administered as a single dose via subretinal delivery in the eye of a subject in need of treatment. The subject receives a dose of3 X 109 , l X 1010 , or 6 X 1010 GC/eye.
VEGF is administered by a single subretinal delivery by a retinal surgeon with the subject under local anesthesia. The procedure involves a standard 3-port pars plana vitrectomy with a core vitrectomy followed by subretinal delivery of rAAV8aVEGF into the subretinal space by a subretinal cannula (38 gauge). The delivery is automated via the vitrectomy machine to deliver 250 uL to the subretinal space. rAAV8aVEGF can be administered in combination with one or more therapies for the treatment of wet AMD. For example, rAAV8aVEGF is administered in combination with laser coagulation, photodynamic therapy with verteporfin, and intravitreal with anti- VEGF agent, including but not limited to pegaptanib, ranibizumab, a?ibercept, or bevacizumab.
Starting at about 4 weeks post- rAAV8aVEGF administration, a patient may receive intravitreal ranibizumab rescue therapy in the ed eye.
C. Patient Subpopulations Suitable patients may include those: Having a diagnosis of nAMD, Responsive to anti-VEGF y, Requiring frequent ions of anti-VEGF y, Males or females aged 50 years or above, Having a BCVA 520/100 and 220/400 (:65 and 235 ETDRS letters) in the affected eye; Having a BCVA between 520/63 and 0 (:75 and 235 ETDRS letters), Having a documented diagnosis of subfoveal CNV secondary to AMD in the affected eye, Having CNV lesion teristics as follows: lesion size less than 10 disc areas (typical disc area is 2.54 mmz), blood and/or scar <50% of the lesion size, Having received at least 4 intravitreal injections of an EGF agent for treatment of nAMD in the affected eye in the 8 months (or less) prior to treatment, with anatomical response documented on SD-OCT, and/or Having subretinal or etinal ?uid present in the affected eye, evidenced on SD- OCT.
Prior to treatment, patients are ed and one or more of the following criteria may indicate this therapy is not suitable for the patient: 0 CNV or macular edema in the affected eye secondary to any causes other than 0 Blood occupying 250% of the AMD lesion or blood >10 mm2 underlying the fovea in the affected eye, - Any condition preventing VA improvement in the affected eye, e.g., ?brosis, atrophy, or retinal epithelial tear in the center of the fovea, - Active or history of retinal detachment in the affected eye, 0 Advanced ma in the affected eye, - Any condition in the affected eye that may increase the risk to the subject, require either l or surgical intervention to prevent or treat vision loss, or interfere with study procedures or assessments, 0 History of intraocular surgery in the affected eye within 12 weeks prior to screening (Yttrium aluminum garnet capsulotomy may be permitted if performed >10 weeks prior to the screening visit), 0 History of intravitreal therapy in the affected eye, such as intravitreal steroid injection or investigational product, other than anti-VEGF therapy, in the 6 months prior to screening, 0 Presence of an implant in the affected eye at screening ding intraocular lens).
°History of malignancy requiring herapy and/or radiation in the 5 years prior to screening (Localized basal cell oma may be permitted), 0 History of therapy known to have caused retinal ty, or concominant y with any drug that may affect visual acuity or with known retinal toxicity, e. g, chloroquine or hydroxychloroquine, ° Ocular or periocular infection in the affected eye that may interfere with the al procedure, 0 Myocardial infarction, cerebrovascular nt, or transient ischemic attacks within the past 6 months of ent, 0 Uncontrolled hypertension (systolic blood pressure [BP] >180 mmHg, lic BP >100 mmHg) e maximal medical treatment, 0 Any concomitant treatment that may interfere with ocular surgical procedure or healing process, - Known hypersensitivity to ranibizumab or any of its components or past hypersensitivity to agents like rAAV8.aVEGF, 0 Any serious or unstable medical or psychological condition that, in the opinion of the Investigator, would compromise the subject’s safety or successful participation in the study.
° Aspartate aminotransferase (AST)/alanine aminotransferase (ALT) >25 X upper limit of normal (ULN) 0 Total bilirubin >l.5 X ULN unless the subject has a previously known history of Gilbert’s syndrome and a fractionated bilirubin that shows conjugated bilirubin <35% of total bilirubin ° Prothrombin time (PT) >l.5 X ULN - Hemoglobin <10 g/dL for male subjects and <9 g/dL for female subjects . Platelets <100 x 103/uL 0 ted glomerular filtration rate (GFR) <30 mL/min/ 1.73 m2 Starting at about 4 weeks post- rAAV8.aVEGF administration, a patient may receive intravitreal ranibizumab rescue therapy in the affected eye for disease activity if 1 or more of the following rescue criteria apply: 0 Vision loss of 25 letters (per Best Corrected Visual Acuity [BCVA]) associated with lation of retinal ?uid on Spectral Domain l Coherence Tomography (SD- OCT) 0 dal neovascularization (CNV)-related sed, new, or persistent subretinal or intraretinal ?uid on SD-OCT ° New ocular hemorrhage Further rescue injections may be deferred per the Investigator’s discretion if one of the following sets of findings occur: - Visual acuity is 20/20 or better and central retinal thickness is "normal" as assessed by SD-OCT, or 0 Visual acuity and SD-OCT are stable after 2 consecutive injections.
If injections are deferred, they are resumed if visual acuity or SD-OCT get worse per the criteria above.
D. ing Clinical Objectives y clinical objectives include slowing or arresting the progression of retinal degeneration and slowing or preventing loss of vision. Clinical objectives are indicated by the ation of or reduction in the number of rescue treatments using standard of care, for e, intravitreal injections with anti-VEGF agents, including but not limited to pegaptanib, zumab, a?ibercept, or bevacizumab. Clinical objectives are also indicated by a decrease or prevention of vision loss and/or a decrease or prevention of retinal detachment.
Clinical objectives are determined by measuring BCVA (Best-Corrected Visual Acuity), intraocular pressure, slit lamp roscopy, indirect ophthalmoscopy, and/or SD- OCT (SD-Optical Coherence Tomography). In ular, clinical ives are determined by measuring mean change from baseline in BCVA over time, measuring the gain or loss of 215 letters compared to baseline as per BCVA, measuring mean change from baseline in CRT as measured by SD-OCT over time, measuring mean number of ranibizumab rescue injections over time, ing time to 1St rescue ranibizumab injection, ing mean change from baseline in CNV and lesion size and leakage area based on FA over time, measuring mean change from baseline in aqueous aVEGF protein over time, performing vector shedding analysis in serum and urine, and/or measuring immunogenicity to rAAVaVEGF, i.e., measuring Nabs to AAV, measuring binding antibodies to AAV, measuring antibodies to aVEGF, and/or ming ELISpot.
Clinical objectives are also determined by measuring the mean change from baseline over time in area of phic atrophy per fundus auto?uorescence (FAF), measuring the incidence of new area of geographic atrophy by FAF (in subjects with no geographic atrophy at baseline, measuring the proportion of subjects g or losing 25 and 210 letters, respectively, ed with baseline as per BCVA, measuring the proportion of subjects who have a reduction of 50% in rescue injections compared with previous year, measuring the proportion of ts with no ?uid on SD-OCT. ement/efficacy resulting from rAAVaVEGF administration can be assessed as a defined mean change in baseline in visual acuity at about 4 weeks, 12 weeks, 6 months, 12 months, 24 months, 36 months, or at other d timepoints. Treatment with rAAVaVEGF can result in a 5%, 10%, 15%, 20%, 30%, 40%, 50% or more increase in visual acuity from baseline. Improvements/efficacy can be assessed as mean change from baseline in central retinal thickness (CRT) as measured by spectral domain optical coherence tomography (SD-OCT) at 4 weeks, 12 weeks, 6 months, 12 , 24 months and 36 months. Treatment with rAAVaVEGF can result in a 5%, 10%, 15%, 20%, 30%, 40%, 50% or more increase central retinal thickness from baseline.
EXAMPLE 2: Generation of MV.aVEGF Each of the aVEGF vectors described herein include an expression cassette including apromoter which drives sion of the anti-VEGF Fab heavy chain and light chain, each of which has an IL2 leader sequence. The Fab coding sequence in the vector s carried by the rAAV in the tested composition (suspension) were designed to be identical.
The sion cassette is ?anked by a 5' AAV2 ITR and a 3' AAV2 ITR. Each of the tested vector genomes contains a coding ce variant for the same anti-VEGF Fab (previously designated aVEGF-Arg or aVEGF-R). In certain embodiments, the expressed aVEGF Fab is a homogenous population. In certain embodiments, the expressed aVEGF Fab has heterogeneity at the heavy chain carboxy terminus. The open reading frames for the IL2- aVEGF heavy chain and IL2-aVEGF light chain were ted by an encoded furin cleavage site/F2A linker to promote equal molar expression of both, heavy and light chains.
This results in expression of an aVEGF heavy chain which optionally r contains 0, 1, 2, 3 or 4 amino acids at its carboxy terminus. an ne, arginine-lysine, arginine-lysine- arginine, or arginine - lysine - ne - arginine at its carboxy terminus .
Various coding sequences are designated aVEGFvl, v2, etc. These vector genomes are provided in the Sequence Listing, which is incorporated by reference.
The following elements to be included in the transgene cassette in AAV2/8 vector for expression of anti-VEGF Fab in mice were evaluated. 0 7 different promoters (98 male C57BL/6 mice, Jackson Laboratories) were ed using a convenient antibody (F16) expressed from AAV2/8. Expression of FI6 mAb was measured by ELISA against hemagglutinin (HA) protein, 0 2 different leader es (28 male C57BL/6 mice, Jackson Laboratories).
Expression of anti-VEGF Fab was measured by ELISA against VEGF, o 3 different light-heavy chain separators (42 male C57BL/6 mice, Jackson Laboratories) were evaluated using the following vectors.
Group ent No. of animals ROA Dose (GC/eye) 1.00x109 5.00x109 1 AAV2/8.CMV.PI.aVEGFv7.EMCVIRES.Fab. 7 7 Subretinal SV40; the sequence of the expression cassette is provided in SEQ ID NO: 45 2 AAV2/8.CMV.PI.aVEGFv7.FMDVlIRES.Fa 7 7 inal b.SV40; the sequence of the expression cassette is provided in SEQ ID NO: 46 3 .CMV.PI.aVEGFv7.cMycIRES.Fab.S 7 7 Subretinal V40; the sequence of the expression cassette is provided in SEQ ID NO: 47 Abbreviation: GC = genome copies; N0. = number; ROA = route of administration. 0 13 different coding sequences (182 male C57BL/6 mice; Jackson Laboratories).
Expression of anti-VEGF Fab was measured by ELISA against VEGF.
Vectors were delivered into subretinal space of the mouse eye. Expression of reporter genes was determined by enzyme-linked immunosorbent assay (ELISA).
Seven different promoters were evaluated in another study: 3 viral (cytomegalovirus [CMV]; thymidine kinase [TK]; simian virus [SV40]); 3 non-viral hoglycerate kinase [PGK]; human elongation factor-10L [EFla]; ubiquitin C [UbC]); and 1 hybrid en B-actin [CB7]) promoters.
Two different leader peptides were also evaluated using rAAV8 vectors having identical vector elements and the same coding ce; i.e.; v3; with the exception of the leader sequence (interleukin-2 vs the serpin leader). AAV2/8 = adeno associated virus (AAV) capsid type 8 with AAV2 inverted terminal s ?anking the transgene; amd201Lead = EGF Fab with IL2 leader sequence and Furin F2A as light-heavy chain separator; amd201altLead = anti-VEGF Fab with SFl leader sequence and Furin F2A as light-heavy chain separator; CB7 = chicken B actin promoter; CI = chimeric intron; rBG = rabbit B globin polyadenylation sequence.
Three different internal ribosome entry site (IRES) sequences separating heavy and light chains of EGF Fab were evaluated in another study. These IRES sequences were derived from alomyocarditis virus ; cMyc; and foot-and-mouth disease virus 1 (FMDV 1). In this study; the vectors were identical except for the light and heavy chain separators (EMC; FMDVl and cMyc). AAV2/8 = adeno associated virus (AAV) capsid type 8 with AAVZ inverted terminal repeats ?anking the transgene; amd201 = codon variant of anti-VEGF Fab with IL2 leader sequence; CMV = galovirus promoter; EMCV = encephalomyocarditis virus; Fab = nt antigen-binding region; FMDVl = foot and mouth disease virus 1; IRES = internal ribosome entry site; PI = Promega intron; SV40 = simian virus polyadenylation sequence In another study; thirteen different coding sequences for the anti-VEGF Fab were evaluated. The l coding sequence variance was between approximately 20% and 30 %.
The vectors are described in the following Table.
Vectors with Different Coding Sequences Used. The SEQ ID NO for the expression cassettes is provided in the ing table: Vector SEQ ID NO: (vector genome) AAV2/8.CB7.CI.aVEGFv4.rBG 35 AAV2/8.CB7.CI.aVEGFv5.rBG 36 AAV2/8.CB7.CI.aVEGFv1.rBG 34 AAV2/8.CB7.CI.aVEGFv2.rBG: 3 AAV2/8.CB7.CI.aVEGFv6.rBG 37 AAV2/8.CB7.CI.aVEGFv7.rBG 38 AAV2/8.CB7.CI.aVEGFv8.rBG 39 AAV2/8.CB7.CI.aVEGFv9.rBG 40 AAV2/8.CB7.CI.aVEGFv10.rBG 41 AAV2/8.CB7.CI.aVEGFv11.rBG 42 Vector SEQ ID NO: r genome) .CB7.CI.aVEGFv12.rBG 43 AAV2/8.CB7.Cl.aVEGFV3.rBG 14 AAV2/8.CB7.CI.aVEGFv13.rBG 44 s in all studies were diluted in Dulbecco’s phosphate-buffered saline (DPB S).
Animals were assigned into treatment groups and administered 1.00 X 109 or .00 X 109 genome copies (GC)/eye of AAV2/8 vectors into the right eye. The left eye was used as an ted control. Vectors were administered subretinally in a total volume of 1 uL.
A. Subretinal Injections Subretinal injections were conducted using aseptic technique and sterile dissecting instruments. Animals were etized with ketamine/xylazine or 3% to 5% iso?urane and administered meloxicam. s were then placed under a dissection microscope with the eye to be injected under view (using a 15 X cation). The temporal conjunctiva was grasped with jeweler’s forceps and carefully cut down to the sclera using the tip of Vannas iridotomy scissors. Conjunctival peritomy was conducted by introducing the lower lip of the scissors through the incision and extending circumferentially both orly and inferiorly of the conjunctiva. Any conjunctival debris was carefully removed from the surface of the sclera. The conjunctiva adjacent to the cornea was grasped with the forceps, providing traction to rotate the globe and allow optimal surgical exposure. Using a 30 1/z-gauge needle, a small incision, large enough to allow the blunt-tip needle to pass through, was made.
The tip of a 33-gauge tip needle mounted on a Hamilton auto-injector syringe was introduced into the incision tangentially to the surface of the globe. The needle was passed along the inner surface of the sclera with the tip entering approximately 1 mm. The 33-gauge needle passed through the sclera and choroid and then terminated in the subretinal space. Up to 1 uL of vector was delivered. Once the ure was completed, antibiotic ophthalmic ointment was applied to the eye.
B. Assay Methods The collected eyes were homogenized by placing entire eyeball into a conical tube with ess steel beads and 200 uL of cocktail ning protein lysis and extraction buffer (RIPA) and cOmpleteTM, Mini Protease Inhibitor Cocktail tablets (1 tablet/10 mL of RIPA buffer). The eyes were homogenized for at least 2 minutes in a Lyser (Qiagen, USA) or until fully nized. Homogenate was centrifuged for 20 minutes at 12000 RPM at 4°C in a cold room. The supematants were transferred into fresh tubes and used in analytical assays.
Determination of Protein Concentrations in Eye Homogenates Protein concentration in eye homogenate was determined using PierceTM BCA n Assay Kit (Thermo Fisher Scientific) per the cturer’s instructions. Equal amounts of protein in all samples were used in ELISA.
Enzyme-Linked Immunosorbent Assay Ninety-siX-well, round-bottom plates were coated with 2 ug/mL of HA A-Beijing or 1 ug/mL VEGF overnight at 4°C. After coating, the plates were washed 5 times with 200 uL of phosphate-buffered saline (PBS) with 0.05% Tween-20 (PBS-T) using a 405 TS Washer (BioTek ments, Winooski, VT). Plates were then blocked with 200 uL/well of 1% bovine serum albumin (BSA) at room temperature (RT) for 1 hour. After washing (as described), 100 uL/well of sample was loaded into duplicate wells and incubated at 37°C for 1 hour. Following incubation, the plates were washed (as bed) and then blocked with 1% BSA at RT for 1 hour. After washing (as described), 100 l of the primary antibody was added and incubated at RT for 1 hour. Wells were then washed (as described) and incubated with 100 uL/well of the secondary antibody at RT for 1 hour. Following a final wash (as bed), 150 uL/well of 3,3’,5,5’-tetramethylbenzidine, a detection substrate, was added and incubated at RT for 30 minutes protected from light. The reaction was stopped with 50 uL/well of 2N H2SO4. The plates were then read at the excitation/emission of 450 nm/540 nm using spectrophotometer SpectraMaX® M3 (Molecular Devices, Sunnyvale, CA).
The ing primary antibodies were used: 1.0 mg/mL Goat Anti-Human IgG H&L (Biotin) preadsorbed at a 1:10000 dilution in PBS (Abcam 0.5 mg/mL), 0.5 mg/mL Goat Anti-Human IgG H&L (Biotin) preadsorbed at a 1:5000 dilution in PBS (Abcam, 1 mg/mL). The following secondary antibody was used: 1 mg/mL Streptavidin (HRP) at a 1:30000 dilution in PBS.
Statistical Analyses Average and standard deviation values for concentration of reporter genes for ELISA were calculated using Microsoft Office Excel 2010.
C. RESU LTS AAV2/8 vectors with 7 different promoters were evaluated for expression of F16 mAb. sion of F16 mAb was not observed in any animal when promoter EF l-a was used. Expression of F16 mAb was low when ers SV40.P1, PGK.P1 and TK.P1 were used. Promoters CMV.P1, , and UbC.P1 demonstrated the highest expression of F16 mAb. No sion was observed in the untreated left eye in any animal (data on file).
AAV2/8 vectors with 2 different leader peptides were ted for expression of anti-VEGF Fab. Compared to aVEGFv7 with an 1L2 leader, expression of anti-VEGF Fab at low dose was greater when leader peptide aVEGFv7 with SF2 leader was used. At high dose, the expression of anti-VEGF Fab was r for both leader peptides. No expression was observed in the untreated left eye in any animal (data on file). AAV2/8 vectors with 3 different light-heavy chain separators were evaluated for expression of anti-VEGF Fab.
Expression of anti-VEGF Fab was not observed in any animal when cMyc light-heavy chain separator was used. With EMCV and FMDVl light-heavy chain separators, anti-VEGF Fab was expressed at low levels. No expression was observed in the untreated left eye in any animal (data on file).
AAV2/8 vectors with 13 different coding sequences were evaluated for sion of anti-VEGF Fab transgene product. When coding sequences aVEGFv4, aVEGFvS, aVEGFv6, aVEGFv7, aVEGFv8, and aVEGFv9 were used, sion of anti-VEGF Fab was low. Expression was higher with coding sequences aVEGFvl3, aVEGFv 10, aVEGFvl l, and aVEGFle. When coding sequences aVEGFvl, aVEGFv2, and aVEGFv3 were used, expression of anti-VEGF Fab was the highest. No expression was ed in the ted left eye in any animal (data on file).
Each of the vectors encodes the same anti-VEGF transgene product. Based in part on these results, a single replication-defective, recombinant AAV8.aVEGF was ed for further development. This tert vector has an AAV8 capsid and a vector genome in which AAV2 1TRs ?ank a CB7 promoter, an intron, an anti-VEGF coding sequence selected from the coding sequence as described earlier and a rBG poly A sequence. This is termed the test vector (alternatively AAV2/8.aVEGF test vector or AAV8.aVEGF test vector) in the ing examples, except where speci?cally speci?ed otherwise.
EXAMPLE 3: Pharmacokinetic (PK) Study in Non-Human Primates Macaques were used in this study because they are the closest s to humans for studying retinal diseases. Cynomolgus monkeys and humans have similar eye anatomy, including fovea. The dimensions of the eyes are comparable, which allows determination of the human dose based on relative retinal areas.
This study was conducted to select AAV2/8 vector for clinical development and to evaluate ty and immunogenicity of AAV2/8 vector and anti-VEGF Fab in cynomolgus monkeys. The study is ongoing. The results presented are based on the data collected at Month 10. Evaluation of toxicity of AAV2/8 vector and anti-VEGF Fab is described.
Animals were administered AAV2/8 vectors subretinally. Toxicity was evaluated based on clinical ations, body weights, indirect ophthalmoscopy, spectral domain optical coherence tomography, hematology, coagulation, clinical try, and gross pathologic ?ndings. The only adverse ?nding d to AAV2/8 vector or anti-VEGF Fab was some thinning in outer nuclear layer localized to the injection site observed by al domain optical coherence tomography in several eyes of animals administered 1.00 X 1011 GC/eye of AAV2/8 s.
Animals were assigned into 4 ent groups. Animals were administered a single dose of 1.00 X 1011 genome copies (GC)/eye of AAV2/8 vectors into each eye in a total volume of 100 uL. s were administered subretinally (con?rmed visually by appearance of a dome shaped retinal detachment/retinal bleb under microscope) into both eyes. The following table lists the tested vectors.
Group Treatment Dose No. of ROA (GC/eye) animals OD OS 2 AAV2/8.UbC.PI.aVEGFv2.SV40 1.00 x 1011 2 M, 2F Subretinal 3 AAV2/8.UbC.PI.aVEGFv3.SV40 1.00 x 1011 2 M, 2 F Subretinal AAV2/8.CB7.CI.aVEGFvZaVEG 1.00 x 1011 2 M, 2 F Subretinal Fv2.rBG Group Treatment Dose No. of ROA (GC/eye) s OD OS 6 .CB7.CI.aVEGFv3.rBG 1.00 x 1011 2 M; 2 F Subretinal Abbreviation: F = female; GC = genome copies; M = male; N0. = number; OD = right eye; OS = left eye; ROA = route of administration. inal Injections For subretinal injections; a needle was ed through a trocar; introduced by sclerotomy; at the 2 or 10 o’clock position. The needle was advanced through the vitreous to penetrate the retina in the posterior pole. Under the microscopic control; 100 uL of test article was ed into the subretinal space. This was confirmed by appearance of a dome shaped retinal detachment/retinal bleb. If the first injection attempt did not result in retinal ment; the cannula was moved to another site in the retina. The injection site may have resulted in a temporary scotoma. The injected solution was reabsorbed within a few hours by the retina. The retinal detachment was made in the peripheral retina and did not result in permanent blindness. The site of sclerotomy was sutured with absorbable suture and the eye d with PredG ointment or equivalent. Subconjunctival g or equivalent was administered. Animals were observed daily and administered parenteral analgesics as needed. If vitreal in?ammation appeared; animals were treated with topical atropine and PredG ointment or equivalent daily until symptoms resolved.
Collection of Anterior Chamber Fluid Animals were anesthetized and their head stabilized. Betadine 5% antiseptic solution and Proparacaine or equivalent were applied to each eye. An eye speculum was placed to allow access to the anterior chamber. The procedure was performed with a tuberculin syringe attached to a 27- to 30-gauge rmic needle. The eye was held steady with forceps or a cotton tip applicator on the nasal conjunctiva. The needle was inserted bevel up through the paralimbal eral clear cornea; or to the iris plane. Once the eye was entered; a sampler slowly withdrew the plunger of the syringe to aspirate the aqueous ?uid. A m of 100 uL of anterior chamber ?uid was collected. Once anterior chamber ?uid was d; the needle was withdrawn ?om the eye. The anterior chamber ?uid was placed on wet ice until use or storage. After the procedure; topical ?urbiprofen; PredG ointment; and antibiotic drops were applied to each eye. or chamber ?uid was collected on the following Study days (occasionally adjusted due to weekends, holidays or scheduling issues) 0 0, 15, 29, 43, 57, 71, 85, 120, 149, 183, 212, 247, 274, and 302. al Domain Optical nce Tomography Retinal structure (at a micron-level resolution) was evaluated by in viva, non- invasive, cross-sectional retinal microscopy with SD-OCT (Spectralis OCT, Heidelberg Engineering, Carlsbad, CA). Pupils were dilated with phenylephrine 2.5% and tropicamide 1%. En-face retinal g was performed with near infrared (NIR) re?ectance (REF) and in a subset of animals with NIR fundus auto?uorescence (FAF) using the scanning laser ophthalmoscope of this imaging system. Spectral domain optical coherence tomography ng was med with 9 mm long horizontal and al cross-sections through the fovea and overlapping 30 X 25 mm raster scans extending into the near iphery. See, Aleman, Invest Ophthalmol Vis Sci. 2007 Oct,48(10):4759-65.
Enzyme-Linked Immunosorbent Assay (ELISA) I5 The ELISA was performed essentially as described for the mouse studies above.
Ninety-siX-well, round-bottom plates were coated with l ug/mL ofVEGF for expression of anti-VEGF Fab. Plates were coated overnight at 4°C. After coating, the plates were washed 5 times with 200 uL of phosphate-buffered saline (PBS) with 0.05% Tween-20 (PBS-T) using a 405 TS Washer k Instruments, Winooski, VT). Plates were then blocked with 200 uL/well of 1% bovine serum albumin (BSA) at room temperature (RT) for 1 hour. After washing (as described), 100 uL/well of sample was loaded into duplicate wells and incubated at 37°C for 1 hour. Following incubation, the plates were washed (as described) and then blocked with 1% BSA at RT for 1 hour. After washing (as described), 100 l of the primary antibody was added and incubated at RT for 1 hour. Wells were then washed (as described) and incubated with 100 uL/well of the secondary antibody at RT for 1 hour.
Following a final wash (as described), 150 uL/well of 3,3',5,5'-tetramethylbenzidine, a detection substrate, was added and incubated at RT for 30 minutes protected from light.
The reaction was stopped with 50 uL/well of 2N H2SO4. The plates were then read at the excitation/emission of 450 nm/540 nm using spectrophotometer SpectraMax® M3 ular Devices, Sunnyvale, CA). The following primary antibodies were used: 1.0 mg/mL Goat Anti-Human IgG H&L (Biotin) preadsorbed at a 1:10000 dilution in PBS, 0.5 mg/mL Goat uman IgG H&L n) preadsorbed at a 1:5000 dilution in PBS. The following secondary antibody was used: 1 mg/mL Streptavidin (HRP) at a 1:30000 dilution in PBS.
Average and standard deviation values for concentrations of the anti-VEGF Fab in anterior chamber ?uid and blood were ated using Microsoft Office Excel 2010.
A Pharmacology Results Four AAV vectors with different promoters and coding sequences were evaluated as described r in this example. Vectors were administered subretinally. sion of anti-VEGF Fab was determined by enzyme-linked immunosorbent assay.
Expression of Anti-VEGF Fab in Anterior Chamber Fluid In anterior chamber ?uid of s in all groups, r expression kinetics was observed (FIG 3A-3D, FIG 4A-4D). Onset of expression of the EGF Fab was rapid, generally within 7 days. Steady-state expression levels were achieved within 1 month. All except 2 animals continued to express the anti-VEGF Fab at steady-state levels until the last evaluated timepoint.
One animal in Group 2 (FIG 3B) and 1 animal in Group 5 (FIG 4A) lost sion of the anti-VEGF Fab. Loss of expression coincided with appearance of antibodies against the anti-VEGF Fab. No difference in expression of the anti-VEGF Fab between males and s and between the right and the left eye was observed.
Generally, vectors controlled by the CB7.CI promoter (FIG 4A-4D) expressed the anti-VEGF Fab at higher levels than vectors controlled by the UbC.PI promoter (FIG 3).
Vector AAV2/8.CB7.CI.aVEGFv3aVEGFv3.rBG was selected as a primary vector for clinical development. This selection was based on expression level of transgene, better translatability of ve expression levels from mice to cynomolgus monkeys for aVEGFv3 coding sequence, and r level of experience with CB7.CI promoter.
Expression of Anti-VEGF Fab in Blood In some patients administered a single IVT injection of Lucentis, ranibizumab was observed in serum (Xu, 2013). To determine if subretinal administration of AAV2/8 vector results in systemic exposure to the anti-VEGF Fab, its concentrations were measured in serum.
Expression of the EGF Fab was around the baseline levels in blood of all animals (FIGs 3A-3D, FIGs .
B. Toxicology Evaluation of toxicity of AAV2/8 vector and EGF Fab is described in this subpart B. Animals were administered AAV2/8 vectors subretinally. Toxicity was evaluated based on clinical observations, body weights, indirect ophthalmoscopy, spectral domain optical coherence tomography (SD-OCT), hematology, coagulation, clinical chemistry, and gross pathologic findings.
For each variable in each treatment group, the measurements at each time point were ed to the corresponding baseline values using Wilcoxon rank-sum test. The Wilcoxon rank-sum test is a ametric alternative to the two-sample t-test, which is based solely on the order in which the observations from the 2 samples fall. It is a preferable test for dataset with small sample size. Statistical significance was declared at the 0.05 level without the ment for multiple testing. The analysis was done using R program (version 3.3.1, cran.r-proj ect.org/) with function "wilcox.test".
The study is g. The results ted are based on the data collected by Month . There were no mortalities in this study. No adverse clinical observations related to AAV2/8 vector or anti-VEGF Fab were noted in any animal. No clinically meaningful changes in body weight during the study were observed for any animal. No adverse ations related to AAV2/8 vector or anti-VEGF Fab were noted during indirect ophthalmoscopy in any animal.
Spectral Domain Optical Coherence Tomography All 4 animals (8 eyes) in Group 6 were imaged by SD OCT. Injected s in the eyes that received the intermediate dose level of AAV8.aVEGF test vector (1.00 X 1011 GC/eye) showed intermediate outcomes as compared to 1.00 X 1010 and 1.00 X 1012 dose levels described in Example 7 (esp., subpart B). In two animals (Animal C71896 and Animal C65936), some thinning of ONL was observed (data on file). In addition, in 2 animals (Animal C74422 and Animal C744l4), minimal changes were observed (data on file). No clinically icant changes in hematology, coagulation, or clinical try parameters were observed in any animal.
No findings related to AAV2/8 vector or EGF Fab were observed in 2 s sacrificed at Month 10. In Animal C65936, a liver mass was observed, which microscopically was focal chronic grade 3 ation. In Animal C744l4, bilateral grade 3 lymphoid hyperplasia was observed. These finding were not related to AAV2/8 vector or anti-VEGF Fab. At a dose level of 1.00 X 1011 GC/eye of AAV2/8 vector, the only findings related to AAV2/8 vector or anti-VEGF Fab were minimal ation of the lens of the right eye of Animal C65 926. Minimal perivascular mononuclear cell in?ltrates around the vasculature of the right optic nerve in Animal C744l4 were observed. In the same animal, a minimal mononuclear cell in?ltrate in the junctiva of the left eye and a minimal perivascular exocular mononuclear cell in?ltrate in right eye were also noted.
The only adverse finding related to AAV2/8 vector or anti-VEGF Fab was some thinning in ONL localized to the ion site observed by SD OCT in several eyes of animals administered 1.00 X 1011 GC/eye of AAV2/8 vectors.
C. Immunology In this section, evaluation of immunogenicity of AAV2/8 vector and anti-VEGF Fab is described. Vectors were administered inally as described earlier in this example.
Immunogenicity was assessed by the presence of IgM and IgG antibodies t anti-VEGF Fab, neutralizing antibodies against AAV8 capsid, and cellular immune response against AAV2/8 vector and anti VEGF Fab.
To ize, one animal each in Groups 2 and 5 had antibodies against anti-VEGF Fab, high levels of NAbs to AAV8 capsid, and T-cell responses. Both animals lost expression of anti-VEGF Fab. Animals with pre-existing NAbs to AAV8 capsid generally had sed response after stration of AAV2/8 vector when compared to animals without pre-existing NAbs. In some animals sacri?ced at approximately Study day 300, NAbs to AAV8 capsid were observed in vitreous ?uid. No antibodies against anti-VEGF Fab and no T-cell responses were observed in animals in Group 6. Only mild ?uctuations in the levels ofNAbs were observed in animals in Group 6 after administration of AAV2/8 vector.
EGF Fab was expressed in all animals stered AAV2/8 vectors (Part A of this Example). Two animals (Animal C74440 and Animal C68127) lost sion of the anti-VEGF Fab. Loss of expression coincided with ance of antibodies against the anti- VEGF Fab.
Overall, levels of IgM and IgG against anti-VEGF Fab were below baseline levels in anterior chamber ?uid and serum. ses above the baseline levels at some timepoints were observed in some animals. In 1 animal each in Groups 2 (Animal C74440) and 5 (Animal C68127), levels of IgG against anti-VEGF Fab in anterior chamber ?uid increased above baseline levels approximately at approximately 6 months . The levels generally sed thereafter. In both s, IgG against EGF Fab increased above the baseline levels in serum. These increases in IgG coincided with loss of expression of anti- VEGF Fab. Importantly, IgM and IgG t anti-VEGF Fab in animals in Group 6 were not detected or were below the ne levels for the duration of the study.
In brief, the animal immune system permitted continued localized expression of anti- VEGF transgene t, e the fact that the transgene product is a human antibody.
Presence of Neutralizing Antibodies Against AAV8 Capsid Baseline levels of NAbs t AAV8 capsid were determined in serum from blood samples collected on Study day 0. The limit of detection was a 1:5 dilution, titers of < 5 were considered undetectable. In 2 of 16 animals (Animal C63 1 l6 and Animal ), pre- existing NAbs in serum were not observed. The levels ofNAbs in these 2 animals following administration of AAV2/8 vectors remained below the limit detection or were low. In 14 of 16 animals, pre-existing NAbs were observed. In 11 of these animals, levels of NAbs ?uctuated throughout the study. In 1 animal each in Groups 2 l C74440) and 5 (Animal C68 127), levels ofNAbs following administration of AAV2/8 vector increased up to 256 and 128 two-fold dilutions respectively at two months. These increases in NAbs coincided with loss of expression of anti-VEGF Fab. In 6 sacrificed animals from Groups 2, 3 and 5, the presence ofNAbs was evaluated in vitreous ?uid. In 2 animals (Animal C63 1 l6 and Animal C66122), with undetectable NAb in serum time of sacrifice, NAbs were not present in vitreous ?uid at sacrifice. In the remaining animals, levels ofNAbs at ice did not correlate with levels in serum at time of sacrifice. In all animals in Group 6, pre-existing NAbs were observed. The levels ofNAbs in these s ?uctuated mildly throughout the study.
T-Cell Responses to AAV2/8 Vector and Anti-VEGF Fab In 1 animal (Animal C74440) in Group 2, elevated T-cell responses were observed at a single time point. In this animal, antibodies against EGF Fab and NAbs against AAV8 capsid were also observed. This animal lost expression of anti-VEGF Fab. In 1 animal (Animal C65 873) in Group 5, displayed sustained T-cell responses to the pool B peptides of AAV8 capsid were observed including pre-injection baseline sample. The same animal had the highest levels ofNAbs after administration of AAV2/8 vector. Another animal (Animal C68 127) in the same group developed T-cells to all peptide pools ofAAV8 capsid which were not sustained over time. This animal had antibodies against anti-VEGF Fab and the second highest level ofNAbs. The animal lost expression of anti-VEGF Fab.
No other ned T-cell responses to the transgene product were ed. No sustained T-cell responses were observed in animals in Group 6.
E 4 - Animal Models Useful For Evaluating AAV2/8.aVEGF and Anti-VEGF Transgene Product VEGF transgenic mice are used as animal models of Wet AMD. Two such models include the Rho/VEGF mouse model and the Tet/opsin/VEGF model.
A. Rho/VEGF Mouse Model Rho/VEGF mice are transgenic mice in which the rhodopsin er drives expression of human vascular endothelial growth factor (VEGF165) in photoreceptors, causing new vessels to sprout ?om the deep capillary bed of the retina and grow into the subretinal space, starting at postnatal Day 10. The production of VEGF is ned and therefore the new vessels continue to grow and enlarge and form large nets in the subretinal space similar to those seen in humans with cular age-related macular degeneration.
See Tobe, Takao, et al. "Evolution of neovascularization in mice with overexpression of vascular endothelial growth factor in photoreceptors." Investigative ophthalmology & visual science 39.1 : 180-188.
An enzyme-linked immunosorbent assay (ELISA) can be performed as follows.
Brie?y, plates are coated with lug/mL ofVEGF overnight at 4°C. 1% BSA is used as blocking buffer and is allowed to incubate at room temperature for 1 hour at 200uL per well.
Samples are loaded in duplicate at 100uL per well and incubated for 1 hour at 37°C, followed by a second blocking buffer incubation. The primary antibody is a goat Anti- Human IgG H&L conjugated with Biotin which is left to incubate for 1 hour at room temperature at 100uL per well. Secondary antibody is a 130,000 dilution of Streptavidin, loaded at 100uL per well and incubated at room ature for 1 hour. TMB solution is used as detection substrate (0.1M NaOAc Citric Buffer (pH 6.0), Hydrogen Peroxide, 100X TMB Stock), loaded at 150 uL per well and incubated at room ature for 30 minutes without exposure to light. 50uL of stop solution (2N H2SO4) is added to each well, and each plate was then read at 450nm-540nm.
In one study performed using this model and a test VEGF as described in the preceding examples, the ELISA results were as follows: AAV8> Dose Eye 1R Eye 1L Eye 2R Eye 2L Eye 3R Eye 3L aVEGF GC/e e -—m-m-m-m_m_m- "MM-mum- AAV8.aVEGF 09 0.00 530.45 0.00 0.00 324.01 0.00 AAV8.aVEGF 3.00E+09 0.00 0.00 0.00 0.00 208.71 0.00 mum-m- Vector Dose Eye 4R Eye 4L (GC/eye) Empty 1o 0.00 0.00 m—mm- mum-mm- —_EE__EE_EEE- —__EE___ Anti-VEGF FAb levels are shown in ng/eye.
B. Tet/opsin/VEGF Mouse Model Tet/opsin/VEGF mice are transgenic mice that are normal until given doxycycline in ng water. Doxycycline induces very high photoreceptor expression of vascular endothelial growth facto r(VEGF), leading to massive ar leakage, culminating in total ive retinal detachment in 80-90% of mice within 4 days of induction. See, Ohno- Matsui, Kyoko, et al. "Inducible expression of vascular endothelial growth factor in adult mice causes severe proliferative retinopathy and retinal detachment." The American journal of pathology 160.2 (2002): 711-719.
The ELISA can be performed as described in Part A of this Example. In one study performed using this model and a test AAV8.aVEGF as described in the preceding examples, the ELISA results were as follows. Results are shown in the tables below as the average :: standard deviation (Std).
Mouse Eye lD's 1R 1L 2R 2L Sample Vector Avg:Std Empty Empty 1.00E+10 0.00:0.00 0.00:0.00 0.00:0.00 0.00:0.00 1.00E+11 AAV8.aVEGF 1.00E+08 .00 216.34i14.85 0.00:0.00 0.00:0.00 3.00E+11 VEGF 3.00E+08 88.23i0.10 i1.01 0.00:0.00 0.00:0.00 1.00E+12 AAV8.aVEGF 09 424.07i19.26 0.00:0.00 344.51i30.67 0.00:0.00 3.00E+12 AAV8.aVEGF 3.00E+09 581.28i50.45 175.23i20.45 254.13i21.33 477.85i34.54 1.00E+13 AAV8.aVEGF 1.00E+10 366.10i20.76 309.06i2.45 234.42i4.78 173.46i1.86 Mouse Eye lD's 3R 4R 5L Sample Dose Avg: Avg: Avg : GC/e e Std Std Std Std Std Empty Empty 1.005+10 0.00: 0.00: 0.00 0.00 0.00 0.00 0.00 0.00 1.005+11 AAV8.aVEGF 1.00E+08 0.00: 0.00: 322.39: 0.00 0.00 0.00 0.00 23.43 3.005+11 AAV8.aVEGF 3.00E+08 0.00: 88.25: 444.96: 0.00 1.96 0.00 26.63 54.45 1.005+12 VEGF 1.005+09 0.00: 537.61: 0.00: 0.00 17.07 0.00 0.00 0.00 3.005+12 AAV8.aVEGF 3.005+09 270.15: .85 1.005+13 AAV8.aVEGF 1.005+10 301.23: 21.10 C. Other Animal Models Other animal models of Wet AMD are ed. In the laser trauma model, high- powered, focused laser energy is used to induce a break in Bruch's membrane. Subretinal injection of matrigel, VEGF, macrophages, lipid hydroperoxide, and/or polyethylene glycol induces choroidal cularization (CNV), a wet AMD pathology. See Pennesi, Mark E., Martha Neuringer, and Robert J. Courtney. "Animal models of age related macular degeneration." Molecular aspects of medicine 33.4 (2012): 487-509.
Optimized rAAV.aVEGF vectors are generated, diluted and delivered into subretinal space of the transgenic mice eye with dosage described in the us es. sions of reporter genes, VEGF and anti-VEGF antibodies in the eye and/or plasma are determined by PCR, qPCR, ddPCR, quCR, Western Blot and ELISA as described in previous Examples. Electron Microscopy and Immunohistochemical analysis are also performed to evaluate the retinal cularization. The number of lesions per retina, area per lesion, neovascularization area per retina and traction retinal detachment athological Evaluation of Retinas are quantified.
EXAMPLE 5 - Assessment of Expression of Anti-VEGF Fab (Transgene Product) in Cynomolgus Monkeys This study was conducted to assess the expression of the anti-VEGF Fab (transgene product) and to evaluate toxicity, genicity, and biodistribution of an AAV8 vector expressing the anti-VEGF Fab following its stration in cynomolgus monkeys. In this report, expression of the transgene product and immunogenicity of the vector are described.
Animals were administered an AAV2/8.aVEGF vector as bed in these Examples or FFB-3 14 (control article) subretinally. Expression of transgene product in anterior chamber ?uid and blood was determined by enzyme linked immunosorbent assay (ELISA).
Immunogenicity was assessed by the presence of neutralizing antibodies (NAbs) against AAV8 capsid before and after administration. The ene product is expressed in or chamber ?uid of all animals administered the vector. The ene t is not expressed in blood. Increase in levels ofNAbs was observed in 1 animal (C73723) administered AAV8.aVEGF, this animal had pre-existing NAbs.
Animals in this study were administered a single dose of 1.00 X 1012 genome copies (GC)/eye of AAV8.CB7.CI.aVEGFv3.rBG or formulation buffer, FEB-314.
AAV8.CB7.CI.aVEGFv3.RBG and FEB-3 14 were administered subretinally into the right eye (confirmed visually by appearance of a dome shaped retinal detachment/retinal bleb under microscope) in a total volume of 100 uL.
Animals were randomized using www.j amestease.co.uk/team-generator. One of 4 animals was selected using www.randomizer.org/ by random and assigned to Group 2. The remaining 3 animals were assigned to Group 1. Group designation and dose levels for this study are presented in the following Table.
Group Treatmenta Dose No. of animals Follow-up (GC/eye) 1 AAV8.aVEGF 1.00 x 1012 1 M; 2 F 7 days 2 FFB-314 NA 1 M iation: F = female; GC = genome copies; M = male; NA = not applicable; N0. = number. a Test and control articles were administered subretinally into the right eye.
Animals were euthanized on Study day 7. Samples of anterior chamber ?uid and blood were collected for determination of expression of the EGF FAb transgene product and/or the presence ofNAbs t AAV8 capsid.
Subretinal injections were performed as described in the earlier examples.
Collection of or chamber ?uid was as described in earlier examples. For the ELISA; ninety-six-well; round-bottom plates were coated with 1 ug/mL ofVEGF for expression of the anti-VEGF Fab transgene product; or 0.5 ug/mL of a commercial anti-VEGF Fab for expression of IgM and IgG against the Anti-VEGF Fab transgene t. The ELISA methods were as described in the r es.
The following primary antibodies were used: 1.0 mg/mL Goat Anti-Human IgG H&L (Biotin) preadsorbed at a 1:10000 dilution in PBS; 0.5 mg/mL Goat uman IgG H&L (Biotin) preadsorbed at a 1:5000 dilution in PBS. The following secondary antibody was used: 1 mg/mL Streptavidin (HRP) at a 1:30000 dilution in PBS.
Neutralizing Antibody Assay Neutralizing antibody responses to AAV8 capsid were analyzed as follows. A Poly D lysine-coated l black-walled/clear-bottom plate was seeded with human embryonic kidney 293 (HEK293) cells at 1 X 105 cells/well (referred to as a cell plate); the plate was incubated at 37°C overnight. The ing day; the serum sample was heat-inactivated at 56°C for 35 minutes. The nactivated sample and a recombinant vector (AAV8.CMV.LacZ at 1 X 109 GC/well; provided by the Penn Vector Core at the University of Pennsylvania) were used to formulate a serum-vector plate. The recombinant vector was diluted in serum-free Dulbecco’s ed Eagle Medium (DMEM) and incubated with 2- fold serial dilutions (starting at 1:5) of the heat inactivated samples at 37°C for 1 hour. Prior to combining the serum vector plate with the cell plate, the HEK293 cells (now at 2 X 105 cells/well) were infected with wild type HAdV5 (90 particles/cell) and incubated at 37°C for 2 hours. After the incubation, the serum—vector plate and the cell plate were combined and incubated at 37°C for 1 hour. Following the incubation, an equal volume of 20% fetal bovine serum (FBS) with DMEM was added to each well and the combined plate was incubated at 37°C for additional 18 to 22 hours. The next day, the combined plate was washed with PBS and the HEK293 cells were lysed, and the lysate was ped using a mammalian B- galactosidase bioluminescence assay kit per the manufacturer’s ctions. As a control, mouse serum was used instead of serum sample. The resulting luminescence was measured using a SpectraMax® M3 microplate luminometer. The ing NAb titer was reported as the serum dilution that ts transduction of vector by at least 50% compared to the mouse serum.
Statistical Analyses Average and standard deviation values for concentrations of the Anti-VEGF Fab transgene product in anterior chamber ?uid and blood were calculated using Microsoft Office Excel 2010.
RESU LTS Expression of EGF Fab transgene t in Anterior Chamber Fluid The EGF Fab transgene product was not sed in anterior chamber ?uid of the animal administered FFB-3 14. The anti-VEGF Fab transgene product was expressed in anterior chamber ?uid collected from the right eye of all animals administered AAV8. aVEGF test vector. No expression was observed in the left eye. No difference in expression of the Anti-VEGF Fab ene product between males and females was observed.
Expression of Anti-VEGF Fab transgene product in Blood In some patients administered a single IVT injection of Lucentis, ranibizumab was observed in serum (Xu, Invest Ophthalmol Vis Sci, 54: l6l6-24(2013)). To determine if subretinal administration of AAV8.aVEGF test vector results in systemic exposure to the Anti-VEGF Fab transgene product, its concentrations were measured in serum. sion of the Anti-VEGF Fab transgene product was below nonspecific background levels in blood of the animal stered FFB-3 l4 and all s administered the AAV8.aVEGF vector as compared to matched pre-inj ection level.
Presence of Neutralizing Antibodies Against AAV8 capsid Baseline levels of NAbs against AAV8 capsid were determined in serum from blood samples collected on Study day 0. The limit of detection was a 1:5 dilution, titers of < 5 were considered undetectable.
Treatment Animal NAb titer Identification Study day 7 C65027 40 10 Abbreviations: GC = genome copies; NAb = neutralizing antibody.
Note: the NAb titer values reported are the reciprocal dilutions of serum at which the ve luminescence units (RLUs) were reduced for 50% comparted to control wells (without sample). The limit of detection was 1:5 dilution of sample.
Animal administered FFB-3 14 had isting NAbs against AAV8 capsid (see preceding Table). One animal (C7443 1) administered AAV8.aVEGF test vector did not have able NAbs to AAV8 capsid. In 2 animals (C73723, C65027) administered AAV8.aVEGF test vector, pre-eXisting NAbs against AAV8 capsid were observed, which persisted on Day 7 (see preceding Table).
Toxicity was evaluated based on clinical observations, body weights, ct l5 ophthalmoscopy, hematology, coagulation, clinical chemistry, and gross ogic findings.
There were no mortalities or unscheduled sacri?ces in this study. No adverse clinical observations related to AAV8.aVEGF test vector or the Anti-VEGF Fab transgene t were noted for any animal. Several animals exhibited ittent transient bouts of diarrhea with no impact to the welfare of the animals because body weights remained stable. No clinically meaningful changes in body weight during the study were observed for any animal. No adverse observations related to VEGF Test vector or the Anti-VEGF Fab ene t were noted during indirect lmoscopy in any animal. No ally signi?cant changes in hematology, coagulation, or clinical chemistry parameters were observed in any animal. All clinical pathology parameters were within normal ranges in all animals. There were no gross finding in animals C64956 and C7443 l. The surfaces of the right and left kidney of C73 723 were pale. There was a focal lesion on the liver in C65027. In sion, there were no major toxicology ?ndings.
The test vector in Examples 6-11 is rAAV8.CB7.CI.aVEGFrv3.rBG.
EXAMPLE 6 - sion of AAV2/8.aVEGF Vector in Cynomolgus Monkeys This study was conducted to assess expression of the anti-VEGF transgene product and to evaluate toxicity, immunogenicity, and effect on normal retinal function of AAV2/8.aVEGF and the anti-VEGF transgene product, and shedding of AAV8.aVEGFin cynomolgus s. The study is ongoing.
An .aVEGF described earlier in the examples is used this study. The vector is diluted in co’s phosphate-buffered saline (DPBS) with 0.001% Pluronic F-68. As a l article, FFB-314 (DPBS with 0.001% Pluronic F-68) was used. The study is ongoing.
The results ted are based on the data collected at Month 3.
Macaques were used because they are the closest species to humans for studying retinal diseases. These monkeys and humans have similar eye anatomy, including fovea. The dimensions of the eyes are comparable, which allows determination of the human dose based on relative retinal areas.
Animals in this Example were administered a single dose of 1.00 X 1010 genome copies (GC)/eye ofAAV8.aVEGF, or 1.00 x 1012 GC/eye ofAAV8.aVEGF, or FFB-314.
AAV8.aVEGF and FFB-314 were administered subretinally into the right eye (confirmed visually by appearance of a haped retinal detachment/retinal bleb under microscope) in a total volume of 100 uL.
Animals were randomly assigned to 6 sets of 4 animals per set using www.jamestease.co.uk/team-generator. After assigning the sets, 1 of 4 s from each of the 6 sets was selected using www.randomizer.org/ at random and assigned to groups administered FFB-314 for each given administration date (Groups 2, 4, 6, 8, 10, and 12). The remaining 3 animals were assigned to groups administered 1 X 1012 GC/eye or 1 x 1010 GC/eye AAV8.aVEGF (Groups 1, 3, 5, 7, 9, and 11). Group designation and dose levels for Examples 6 and 7 are presented below.
Group Designation and Dose Levels Group Treatmenta Dose Number (#) Follow-up (GC/eye) of animals 1 AAV8.aVEGF test vector 1.00 x 1012 1 V1, 2 F 3 months 2 FFB-314 \A 1v1 3 AAV8.aVEGF test vector 1.00 x 1010 2 V1, 1 F 4 FFB-314 \A 1v1 VEGF test vector 1.00 x 1012 2 V1, 2 Fb 1 year 6 FFB-314 \A 1F 7 AAV8.aVEGF test vector 1.00 x 1010 1 V1, 2 F 8 FFB-314 \A 1F 9 AAV8. aVEGF test vector 1.00 x 1012 2 V1, 1F 7 days 4 \A 1v1 11 AAV8.aVEGF test vector 1.00 x 1010 2 V1, 1 F 12 FFB-314 \A 1F Abbreviation: F = female, GC = genome copies, M = male, NA = not able, N0. = a Test and l articles were administered subretinally into the right eye. 1’ One female animal was euthanized during the study because of severe eye infection. The animal was replaced.
Samples of anterior chamber ?uid and blood were collected for determination of expression of the Anti-VEGF Fab transgene product Subretinal injections were performed as described in earlier examples.
A. Pharmacology The results presented are based on the data collected at Month 3. In this report, expression of the anti-VEGF Fab transgene product is bed. 1. Methods Animals were administered AAV8.aVEGF test vector or FFB-3 14 (control e) subretinally. Expression of anti-VEGF transgene product in anterior chamber ?uid and blood was determined by enzyme linked immunosorbent assay (ELISA) which was performed as described in previous examples. 2. Pharmacology Results (a) Expression of Transgene Product in Anterior r Fluid: The transgene product was not expressed in anterior chamber ?uid of any animal stered FFB-314. The transgene t was expressed in anterior chamber ?uid of all animals administered AAV8.aVEGF test vector. Onset of expression was rapid, generally within 7 days. Steady-state expression levels were achieved within 1 month. All animals continued to express the transgene product at steady-state levels until the last ted timepoint. However, l expression levels of the anti- transgene product were greater in animals administered 1.00 X 1012 GC/eye of AAV8.aVEGF test vector. No difference in expression of the transgene product between males and females was observed. (b) Expression of Transgene Product in Blood In some patients administered a single IVT injection of Lucentis, ranibizumab was observed in serum (Xu, Invest Ophthalmol Vis Sci. 2013 Mar 5,54(3):1616-24). To determine if subretinal administration of an AAV2/8aVEGF test vector described in these examples results in systemic re to the anti-VEGF Fab transgene t, its concentrations were measured in serum. Expression of the anti-VEGF Fab transgene product was below nonspecific ound levels in blood of all animals administered AAV8.aVEGF test vector compared to matched pre-injection levels. 3. Conclusion: Anti-VEGF Fab transgene product is expressed in or chamber ?uid of all s stered AAV8.aVEGF test vector.
Anti-VEGF Fab transgene product is not expressed in blood of any animal administered AAV8.aVEGF test vector.
B. Toxicology In this report, evaluation of ty of an AAV2/8aVEGF test vector is described.
Animals were administered AAV8.aVEGF test vector or FFB-314 (control article) subretinally. Toxicity was evaluated based on clinical observations, body weights, ocular pressure, indirect ophthalmoscopy, spectral domain optical coherence tomography, hematology, coagulation, clinical chemistry, and gross pathologic findings, and histopathologic findings.
Ocular pressure was evaluated via d tonometry et). This method is easy to use and does not e topical anesthesia. Rebound tonometry estimates OP by using an induction coil to magnetize a small, c-tipped metal probe that is launched against the cornea. As the probe rebounds back to the instrument, it creates an induction current from which the OP is calculated. Up to 2 readings were taken, from which an average OP was determined, and accuracy of the results was ted. Application with the device was performed according to the manufacturer’s instructions.
Retinal structure (at a micron-level resolution) was evaluated by in viva, non- ve, cross-sectional retinal microscopy with SD-OCT (Spectralis OCT, Heidelberg Engineering, Carlsbad, CA). Pupils were dilated with phenylephrine 2.5% and tropicamide 1%. En-face retinal imaging was performed with near infrared (NIR) re?ectance (REF) and in a subset of animals with NIR fundus orescence (FAF) using the scanning laser ophthalmoscope of this imaging system. Spectral domain optical coherence tomography scanning was med with 9 mm long horizontal and vertical cross-sections through the fovea and overlapping 30 X 25 mm raster scans extending into the near midperiphery.
The only adverse AAV8.aVEGF test vector - related finding was significant retinal thinning and loss of photoreceptors ed by spectral domain optical coherence tomography in s administered 1.00 X 1012 GC/eye of test vector.
C. Electroretinogram (ERG) In this subpart, assessment of effects of AAV8.aVEGF test vector and the anti-VEGF Fab transgene t on normal retinal function is described. Animals were stered AAV8.aVEGF test vector or FFB-314 (control article) inally. Retinal function was evaluated by the full-field electroretinogram (ERG). The full-field ERG is a widely used electrophysiologic test of retinal function. Electroretinogram is a mass electrical potential generated by the retina in response to light stimulus. Usually, it is recorded by an electrode in contact with the l surface. Electroretinograms in this study were conducted in accord with the recommendations set by the International Society for Clinical Electrophysiology of Vision , McCulloch, Doc Ophthalmol. 2015 Feb,130(1):1-12. 2015). The results presented are based on the data collected at Month 3. In this report, ment of effects of AAV8.aVEGF test vector and the anti-VEGF Fab transgene product on normal retinal function is described. s were stered AAV8.aVEGF test vector or FFB-314 (control article) subretinally. Retinal function was evaluated by the full- field electroretinogram. In summary, administration of 1.00 X 1010 genome copies (GC)/eye ofAAV8aVEGF test vector do not impair retinal function. In contrast, administration of 1.00 X 1012 GC/eye ofAAV8aVEGF test vector impairs retinal function. 1. Electroretinogram (ERG) Parameters An electroretinogram (ERG) generated y when all retinal cells are active d to a ?ash stimulation (a dark-adapted animal, moderate to intense ?ash). The 2 components are the following: 0 a-wave: comea-negative signal, first after the ?ash. Origin: photoreceptor photocurrent, the most direct signature of photoreceptor function. 0 b-wave: comea-positive signal following the a-wave generated mostly by on- bipolar cells (second order neurons downstream from photoreceptors).
In this study, the following International Society for Clinical Electrophysiology of Vision (ISCEV) standard and additional protocols were used: 0 Dark-adapted rod ERG: Stimulus intensity: 0.01 to 0.02 cd s m'z. Response: b- wave only, no a-wave. Source: rod "on" bipolar cells (second order neurons driven by input from rods). g: a measure of rod function. Designation in data : "Dim ?ash". 0 Dark-adapted standard ?ash ERG: Stimulus intensity: 3 cd s m'z. Response: combined rod-cone a- and b-waves, 60% to 70% of the signal being ted by the rod- driven pathway. Source: photoreceptors, both rods and cones (a-wave), higher order neurons driven by both rods and cones. Meaning: a measure of mostly rod function, less sensitive to the state of dark adaptation and less variable than the "dim ?ash" se. Designation in data sheets: "Standard ?ash". 0 Dark-adapted bright ?ash ERG: Stimulus intensity: 10 cd s m'z. se and meaning: same as for the "standard ?ash" response, but bright ?ash response is larger in magnitude and may be less variable. Designation in data sheets: "Bright ?ash". 0 adapted standard ?ash cone ERG: us intensity: 3 cd s m'z, delivered in presence of 30 cd m'2 ound light after 5 s of light adaptation. Response: a- and b-waves generated by cone-driven pathways. Meaning: in presence of background light which tely itizes rods the ERG is produced exclusively by cones and cone- driven secondary retinal neurons and is a measure of the cone function. Designation in data sheets: "Standard cone ERG".
° Light-adapted bright ?ash cone ERG (in addition to the ISCEV standard): Stimulus intensity: 10 cd s m'z, delivered in presence of 30 cd m'2 background light after 5 minutes of light adaptation. Response and meaning: riven ERG as in case of the "Standard cone ERG", but of greater magnitude and potentially less le.
ERG measures (a-wave amplitude, a-wave implicit time, b-wave amplitude, b-wave implicit time) were summarized using mean and standard deviation (SD) for treated eyes and control eye, and for each treatment (FEB-314 le) groups, AAV8aVEGF test vector 1.00 X 1010 GC/eye groups, AAV8aVEGF test vector 1.00 X 1012 GC/eye groups). The paired t-test was used for comparing the ERG measures between AAV8aVEGF test vector (treated) eye and 4 (control eye), and for comparison between post-injection vs. pre- injection. The two-sample t-test was used for comparing the ERG measures between AAV8aVEGF test vector 1.00 X 1010 GC/eye groups vs. FFB-314 (vehicle) groups, AAV8aVEGF test vector 1.00 X 1012 GC/eye groups vs. FFB-314 (vehicle) groups, and AAV8aVEGF test vector 1.00 X 1012 GC/eye groups vs. EGF test vector 1.00 X 1010 GC/eye groups. The t-test is riate even when the sample size is small [Winter JCF. Using the Student’s t-test with eXtremely small sample sizes. Practical Assessment, Research and tion. 2013,18 (10). Available online: line.net/- getvn.asp?v=18&n=10] 1 or the data are not normally distributed. See, Shuster JJ.
Diagnostic for assumptions in moderate to large simple al : do they really help? Statist. Med. 2005;24:2431-2438, Ganju J. D. Comment on "Diagnostic for assumptions in moderate to large simple clinical trials: do they really help?" Statist. Med. 2006,25: 1798- 1800.] All the statistical analyses were med in SAS v9.4 (SAS Institute Inc., Cary, NC), and two-sided p-value 5 0.05 is considered as tically significant. 2. Results Anti-VEGF Fab transgene product was eXpressed in all animals administered AAV8aVEGF test vector (see pharmacology results in Part A of this EXample). Retinal function 3 months following administration of AAV8aVEGF test vector or FFB-314 (post-inj ection) was compared to retinal function before administration (pre-inj ection) for treated and untreated eyes. An animal in Group 8 was eXcluded from data analyses due to an unobtainable ERG following administration of FFB-314.
FFB- Low High e 314 dose dose ERG Parameter Stimulus Mean Mean Mean Low High High test intensity (SD) (SD) (SD) dose dose dose (ed - s- m'z) vs. vs. vs.
FFB- FFB- Low 314 314 dose Dark- a-wave 3 68.2 58.4 31.3 0.4 0.003 0.01 adapted amplitude (10.0) (17.4) (12.4) (uv) 10 113.8 109.8 54.1 0.8 0.002 0.002 (0.9) (25.6) (21.0) Light- a-wave 3 19.9 18.7 9.8 0.65 0.007 0.002 adapted amplitude (4. 1) (3.5) (3.7) (uv) 10 36.1 33.3 19.5 0.61 0.02 0.01 (7.1) (7.4) (8.6) Abbreviations: ERG = electroretinogram, GC = genome copies; SD = standard deviation.
Low dose: 1.00 X 1010 GC/eye of AAV8.aVEGF test vector High dose: 1.00 x 1012 GC/eye of AAV8.aVEGF test vector. a. Comparison of Retinal Function n ent Groups For treated eyes, retinal function post-inj ection was comparable between animals in low-dose group (1.00 X 1010 GC/eye of AAV8.aVEGF test vector) and FFB-314 group (see preceding Table). For treated eyes, retinal function post-injection in animals in high-dose group (1.00 X 1012 GC/eye of AAV8.aVEGF test vector) was significantly d compared to animals in FFB-314 group (see preceding Table). For treated eyes, retinal function post- injection in animals in high-dose group was significantly reduced ed to animals in low-dose group (see preceding Table). For ted eyes, l function post-injection was comparable to pre-inj ection for all groups. b. Comparison of Retinal Function Within Treatment Groups For treated eyes, in animals in low-dose and FFB-314 groups, retinal function njection was comparable to matched pre-injection ne. For treated eyes, in animals in high-dose group, retinal function post-injection was significantly reduced compared to matched pre-injection baseline. For untreated eye, retinal function post-inj ection was comparable to matched pre-injection ne.
E. VHusSheddMg Shedding of AAV8.aVEGF test vector was determined by quantitative PCR analysis targeting transgene-specific sequence in samples of tears, nasal secretion, serum, saliva, urine, and feces. Samples were ted before and after administration of AAV8.aVEGF test vector or FFB-3 l4. AAV8.aVEGF test vector DNA was readily detectable in most samples collected from animals administered AAV8.aVEGF test vector. The presence of AAV8.aVEGF DNA was dose-dependent, transient, and decreased over time.
F. Inununogenm?y In this study, immunogenicity of AAV8.aVEGF test vector and the anti-VEGF Fab transgene product is described. Immunogenicity was assessed by the following: o The ce of IgM and lgG antibodies t the anti-VEGF Fab transgene product using enzyme linked immunosorbent assay (ELISA), ° The presence of neutralizing antibodies (NAbs) against AAV8 capsid using NAb assay, 0 T-cell responses to AAV8.aVEGF test vector and the anti-VEGF Fab transgene product using enzyme linked immunospot (ELISPOT) assay.
Animals were administered AAV8.aVEGF test vector or FFB-3 14 (control article) subretinally as described earlier in this Example. No sustained IgM, IgG, or T-cell responses to the anti-VEGF Fab transgene product were observed in any animal. Animals administered 1.00 X 1012 GC/eye AAV8.aVEGF test vector developed a higher neutralizing antibody (Nab) response to AAV8 capsid than s administered 1.00 X 1010 GC/eye AAV8.aVEGF test vector. The NAb response was higher in animals with isting NAbs.
Slightly sed T-cell ses against AAV8 capsid were observed in 2 of 6 animals stered 1.00 X 1012 GC/eye test vector.
Resu?s Anti-VEGF Fab transgene product was expressed in all animals administered AAV8.aVEGF test vector (Example 6). There was no significant IgM t the Anti- VEGF Fab transgene product in serum or in anterior r ?uid of animals administered FFB-3 l4. lgG against the Anti-VEGF Fab transgene t above baseline level was not observed in animals administered FFB-3 14.
IgM against the anti-VEGF Fab transgene product was elevated above the baseline level in anterior chamber ?uid of 1 animal administered 1.00 X 1010 GC/eye of AAV8aVEGF test vector. However, as there was no corresponding elevation in the serum, therefore this observation was not clinically significant. IgG against the anti-VEGF Fab transgene product above baseline level was not observed in this treatment group.
IgM against the anti-VEGF Fab transgene product above baseline level was ed in anterior chamber ?uid of 1 animal administered 1.00 x 1012 GC/eye of AAV8.aVEGF test vector. However, as there was no corresponding elevation in the serum, this observation was not clinically meaningful. IgG t the anti-VEGF Fab transgene product above baseline level was observed in serum and or chamber ?uid from another animal and in anterior chamber ?uid only of a third animal in this treatment group. However, as r was preceded by any able IgM, these observations were not clinically meaningful. The presence of IgG in these s was not associated with loss of expression of the anti- VEGF Fab transgene t.
Baseline levels of NAbs against AAV8 capsid were determined in serum from blood samples collected on Study day 0. The limit of ion was a 1:5 dilution, titers of < 5 were considered undetectable.
In 4 of 6 animals administered FFB-3 l4, pre-existing NAbs were not observed. Two s that were followed by Study day 90 did not develop NAbs. In 2 animals administered FFB-3 l4, pre-existing NAbs were observed. The levels ofNAbs in these 2 animals ?uctuated no more than 2 two-fold serial dilutions during the study.
In 2 of 9 animals administered 1.00 x 1010 GC/eye of AAV8.aVEGF test vector, pre- existing NAbs were not ed. In 1 animal that was followed by Study day 90, NAbs were not observed following administration ofAAV8aVEGF test vector. In animals with pre-existing NAbs, their levels increased by no more than 4 ld serial dilutions following administration ofAAV8aVEGF test vector.
In 4 of 9 animals administered 1.00 x 1012 GC/eye of AAV8.aVEGF test vector, pre- existing NAbs were not ed. Regardless of status of pre-existing NAbs, in most animals, an increase in NAb response of up to 9 two-fold serial dilutions was observed following administration of EGF. This response was sustained through the Study day 90.
T-cell responses to AAV8aVEGF test vector were observed in 1 animal administered FFB-3 14 at a single timepoint. In 1 , non-specific T cell responses were observed at all timepoints.
Sustained T-cell responses to AAV8aVEGF test vector were not observed in animals administered 1.00 X 1010 GC/eye of test vector.
In 4 of 6 animals stered 1.00 x 1012 GC/eye ofAAV8aVEGF test vector, low- level immune se t AAV8aVEGF test vector was observed. In 2 of 4 animals with low-level immune response, a sustained (more than 2 consecutive time points) response was observed. Sustained T-cell responses to the anti-VEGF Fab transgene product were not observed in any animal.
No sustained IgM, IgG, or T-cell responses to the EGF Fab transgene product were ed in any animal.
Animals administered 1.00 X 1012 GC/eye AAV8aVEGF test vector developed a higher NAb response to EGF test vector than animals administered 1.00 X 1010 GC/eye of the same test vector. The NAb response was higher in animals with isting NAbs. Slightly increased T-cell responses t this AAV8aVEGF test vector were ed in 2 of 6 animals administered 1.00 X 1012 GC/eye the AAV8aVEGF test vector.
EXAMPLE 7 - Evaluation of Distribution of AAV2/8 Vector mRNA and Anti-VEFG Fragment Antigen-Binding Following Subretinal Administration of AAV2/8 Vectors in Cynomolgus Monkeys This study was conducted to evaluate retinal bution of AAV2/8 vector mRNA and distribution of anti-VEGF Fab throughout the eye following subretinal administration of AAV2/8 vector utilizing tissues from Example 3, Example 5 and Example 6. Levels of mRNA in different parts of retina were assessed by quantitative reverse transcription- polymerase chain reaction and by in situ hybridization. Concentrations of anti-VEGF Fab were determined in retinal sections, anterior chamber ?uid and vitreous humor by enzyme- linked immunosorbent assay. mRNA for AAV2/8 vector is distributed throughout the entire retina following subretinal administration. Similarly, anti-VEGF Fab is distributed throughout the entire retina and is detected in both, us and anterior chamber ?uid.
Vector AAV2/8.UbC.PI.aVEGFv2. SV40 AAV2/8.UbC.PI.aVEGFv3 . SV40 AAV2/8.CB7.CI.aVEGFerBG AAV2/8.CB7.CI.aVEGFV3.rBG Site of subretinal administration is denoted by a l bleb, which can be Visualized by SD OCT. In all SD OCT , retinal blebs are Visible.
Levels of mRNA for AAV2/8.aVEGF Test Vector in Retina Determined by RT-qPCR mRNA for EGF test vector was not ed in the retina of the animal administered FFB-3 l4. mRNA for the AAV8aVEGF test vector was detected in retinas of all animals administered the AAV8aVEGF test vector. The highest level ofmRNA was detected in the retinal sections that incorporated the site of the subretinal injection. However, mRNA for the AAV8aVEGF test vector was also detected in sections outside of the injection bleb. mRNA levels in these sections were lower than those in the bleb. The levels were up to 4 logs lower in sections most eral to the injection blebs. In sections immediately adjacent to the injection bleb, the levels ofmRNA were intermediate.
Expression of mRNA for AAV2/8 Vectors in Retina Determined by In Situ Hybridization (ISH) sion ofmRNA for the AAV2/8 vector determined by ISH was high at the injection site. The transduced cells within retinal layers included RPE cells, photoreceptors, and ganglion cells. Expression ofmRNA was lower when moving away from the injection site, disappearing almost tely in the areas most distal to the injection site.
Concentrations of Anti-VEGF Fab in Anterior Chamber Fluid, Vitreous, and Retina Anti-VEGF Fab was expressed in retinas, Vitreous, and anterior chamber ?uid of eyes of all animals administered AAV2/8 vector (FIGs 6-8) . Expression in the Vitreous was 3- to 9-fold higher than in the anterior chamber ?uid. With the exception of 1 animal (C65 873) in Group 5 (FIG 8), l expression in the retinal segments was 1.2- to 3.6- fold higher than in the Vitreous. This concentration gradient is likely a re?ection of the ism of distribution of anti-VEGF Fab. Anti-VEGF Fab is secreted into vitreous by transduced retina and then diffuses form vitreous to the anterior chamber ?uid. Of note, expression of anti-VEGF Fab throughout the retina is more uniform than expression of mRNA. l, functional AAV2/8 vector is surprisingly distributed throughout the entire retina following subretinal administration as evidenced by the expression of the vector mRNA by the transduced cells, instead of being limited to the injection bleb. Anti-VEGF Fab is also surprisingly distributed throughout the entire retina including retinal segments that are peripheral to the injection bleb, and is detected in both, vitreous and anterior chamber ?uid.
E 8 - Determination Of Affinity For Binding OF Anti-VEGF ene Product To Recombinant Human VEGF This study was conducted to determine affinity for binding of the Anti-VEGF Fab heavy and line chains product to recombinant human VEGF. Binding affinity was determined using Biacore 3000 system, based on surface plasmon resonance (SPR) technique. This technique is based on the plane-polarized light hitting a sensor chip under the conditions of total internal re?ection. Interaction between immobilized s (e.g., VEGF) and interacting molecules (e.g., Anti-VEGF Fab transgene product) on the sensor chip causes a change in angle of re?ectivity of plane-polarized light. This change is immediately detected by sensogram in real time as response units stani, Theory and applications of surface plasmon resonance, resonant mirror, resonant waveguide grating, and dual polarization interferometry biosensors. Sensors (Basel). 2010,10(l 1): 9630-46.). The equilibrium binding affinity constant for binding of the EGF Fab transgene product is consistent with published range for ranibizumab.
EXAMPLE 9: Tissue Cross-Reactivity Study The objective of this study was to assess using immunohistochemical techniques, the potential reactivity of the Sponsor supplied antibody Fab fragment aVEGF transgene product with histologically ed cryo-sections from a selected panel of human tissues.
EGF Fab transgene product (1 mg/mL) ("Test t") and ranibizumab (0.97 mg/mL) were used for this study. l Human lgG Fab Fragment Protein (the "Control Article") was supplied at a protein concentration of 14.64 mg/mL. To facilitate immunohistochemical detection the Test transgene product, natural human lgG Fab ?agment protein and ranibizumab were conjugated with biotin. The respective protein concentrations were 2.79 mg/mL, 2.88 mg/mL and 2.89 mg/mL. Cryo-sections from the control material and the human s for examination were prepared. The assessment of tissue viability indicated that the panel of human tissues was viable. ing slide evaluation of the control titration the following three concentrations of Test ene t-Biotin: 5, 2.5 and 1.25 ug/mL, and the following concentration of ranibizumab-Biotin: 2.5 ug/mL, were ed for use in the tissue titration. In the tissue ion no specific positive staining was observed with anti-VEGF transgene product-Biotin or ranibizumab-Biotin in any of the tissues examined. All other observed staining was variable and considered to be non-specific.
Under the conditions of this study, antigen-specific binding of Test transgene product-Biotin and ranibizumab-Biotin was demonstrated in the positive control materials (human glioblastoma and VEGF protein spots). No similar staining was observed with Natural human lgG Fab ?agment protein-Biotin or the antibody diluent at the concentrations ed in the tissue titration.
E 10 - Clinical Study A rAAV8aVEGF vector was selected for further study which provides the advantage of single sub-retinal administration, thereby reducing the burden of repeated injections. Continued expression of anti-VEGF Fab in NHP for over 6 months and reduction in neovascularization in an animal model ofWAMD treated with an rAAV8.aVEGF vector have been demonstrated in inical studies, and safety of sub-retinal ion is evaluated in non-human primates. The initial clinical study evaluates the safety and transgene expression after a single sub-retinal injection of an aVEGF test vector as described above. Once injected sub-retinally, these vectors are expected to continue to release an anti-VEGF Fab transgene product and block the angiogenic signal thereby protecting the retina from further .
Each dosing cohort includes 3 subjects. The first 3 subjects enrolled start with the lowest dose and each group escalates. After each first aVEGF dose, there is a 4 week observation period for safety prior to the next t being dosed. The primary safety endpoint is at 6 weeks post administration of rAAV8.aVEGF.
Primary endpoints Ocular and non-ocular safety assessment at 6 weeks, 24 weeks, 6 and 12 months post procedure.
Secondary endpoints o Ocular and non-ocular safety over 106 weeks 0 Mean change from baseline in aqueous rAAV8.aVEGF protein over time 0 Mean change from baseline in BCVA over time 0 Proportion of ts gaining or losing 215 letters compared to baseline as per BCVA at Week 26, Week 54, and Week 106 0 Mean change from baseline in CRT as measured by SD-OCT over time 0 Mean number of ranibizumab rescue injections over time 0 Time to 1st rescue zumab injection 0 Mean change from baseline in CNV and lesion size and leakage area based on FA over time o Immunogenicity measurements (NAb to AAV8, binding antibodies to AAV8, antibodies to aVEGF protein, and Enzyme-Linked lmmunoSpot [ELISpot]). 0 Vector shedding is in serum and urine.
Exploratory endpoints: 0 Mean change from baseline over time in area geographic atrophy per fundus auto?orescence (FAF) Incidence of new area of geographic atrophy by FAF (in subjects with no geographic atrophy at baseline) 0 Proportion of subjects g or losing 2 and 210 letters, respectively, compared with baseline as per BCVA 0 Proportion of subjects who have a ion of 50% in rescue injections compared with previous year 0 Proportion of subjects with no ?uid on SD-OCT For the present study, patients must have a diagnosis of neovascular age-related r ration (wet AMD) and meet the following criteria.
Inclusion Criteria: In order to be eligible to participate in this study, a subject must meet all of the following criteria. It is understood that one or more of these criteria may not be required for r s and for treatment of other populations. 1. Males or females aged 50 years or above. 2. Sentinel subject for each dose cohort must have a BCVA 520/100 and 220/400 (:65 and 235 ETDRS letters) in the study eye. a. Following the sentinel subject evaluation, the rest of the ts in the dose cohort must have a BCVA between 520/63 and 220/400 (:75 and 235 ETDRS letters). 3. In the case both eyes are eligible, study eye must be the subject’s worse-seeing eye, as determined by the Investigator. 4. Must have a documented diagnosis of subfoveal CNV secondary to AMD in the study eye. a. CNV lesion characteristics: lesion size needs to be less than 10 disc areas I5 (typical disc area is 2.54 mm2), blood and/or scar <50% of the lesion size.
. Must have received at least 4 intravitreal injections of an anti-VEGF agent for treatment ofnAMD in the study eye in the 8 months (or less) prior to Visit 1, with anatomical response documented on SD-OCT. 6. Must have subretinal or intraretinal ?uid present at Visit 1 in the study eye, evidenced on . 7. Must be pseudophakic (status post cataract surgery) in the study eye. 8. Must be willing and able to comply with all study procedures and be ble for the duration of the study. 9. Females of childbearing potential must have a negative urine pregnancy test at the screening visit, have negative serum results by Day 8, and be willing to have additional ncy tests during the study.
. Sexually active ts (both female and male) must be willing to use a medically accepted method of barrier contraception (e. g., condom, diaphragm, or abstinence) from screening visit until 24 weeks after vector administration. Cessation of birth control after this point should be sed with a responsible physician. 11. Must be willing and able to provide written, signed informed consent.
Exclusion Criteria: Subjects who meet any of the following exclusion criteria are not eligible to participate in the study. It is understood that future studies and treatment of other patient populations may not e any or all of these criteria. 1. CNV or macular edema in the study eye secondary to any causes other than 2. Blood occupying 250% of the AMD lesion or blood >10 mm2 underlying the fovea in the study eye. 3. Any condition preventing VA ement in the study eye, eg, ?brosis, atrophy, or retinal epithelial tear in the center of the fovea. 4. Active or history of retinal detachment in the study eye.
. Advanced glaucoma in the study eye. 6. Any condition in the study eye that, in the opinion of the Investigator, may increase the risk to the subject, require either medical or al intervention during the course of the study to prevent or treat vision loss, or interfere with study procedures or assessments. 7. History of intraocular surgery in the study eye within 12 weeks prior to the screening visit. Yttrium aluminum garnet capsulotomy is permitted if performed >10 weeks prior to the ing visit. 8. History of intravitreal therapy in the study eye, such as itreal steroid injection or investigational product, other than anti-VEGF therapy, in the 6 months prior to screening. 9. ce of an implant in the study eye at screening (excluding cular lens).
. History of malignancy requiring chemotherapy and/or radiation in the 5 years prior to screening. Localized basal cell carcinoma is permitted. 11. Receipt of any igational product within the 30 days of enrollment or 5 half- lives of the investigational product, whichever is . 12. Participation in any other gene therapy study. 13. History of therapy known to have caused retinal toxicity, or inant therapy with any drug that may affect visual acuit or with known retinal toxicity, eg, chloroquine or hydroxychloroquine. 14. Ocular or periocular infection in the study eye that may interfere with the surgical procedure.
. Myocardial infarction, cerebrovascular accident, or transient ischemic attacks within the past 6 months. 16. Uncontrolled hypertension (systolic blood pressure [BP] >180 mmHg, diastolic BP >100 mmHg) despite maximal medical treatment. 17. Any concomitant treatment that, in the opinion of the Investigator, may interfere with ocular surgical procedure or healing process. 18. Known hypersensitivity to ranibizumab or any of its components or past hypersensitivity (in the Investigator’s opinion) to agents like rAAV8.aVEFG test . 19. Any serious or unstable medical or psychological condition that, in the opinion of the Investigator, would compromise the subj ect’s safety or successful participation in the study.
Criteria for uing Study After ing Ranibizumab At Visit 2, subjects are assessed for initial anti-VEGF response to ranibizumab.
Subjects undergo both SD-OCT and BCVA, which are compared by the Investigator with the Visit 1 values: 1. Responsive (subjects continue in the study): Response is defined as reduction in CRT >50 microns or >30% improvement in ?uid by SD-OCT. 2. Non-responsive (subjects exit the study as early withdrawals): Non-response is defined as not meeting the criteria above. Additional subjects continue to be enrolled until up to 6 ts in each cohort receive a single dose of rAAV8.aVEFG test vector.
At this visit l lab results are reviewed. Any subjects with the following values are withdrawn: 3. ate aminotransferase (AST)/alanine aminotransferase (ALT) >2.5 X upper limit of normal (ULN) 4. Total bilirubin >1.5 X ULN unless the subject has a previously known history of t’s syndrome and a fractionated bilirubin that shows conjugated bilirubin <35% of total bilirubin 5. Prothrombin time (PT) >1.5 X ULN 6. Hemoglobin <10 g/dL for male subjects and <9 g/dL for female subjects 7. Platelets <100 X 103/uL 8. Estimated glomerular ?ltration rate (GFR) <30 mL/min/1.73 m2 In the l study, ranibizumab (LUCENTIS, Genentech) 0.5 mg is administered by itreal injection on Visit 1, 14 days prior to rAAV8.aVEGF test vector subretinal delivery. The rAAV8.aVEGF is given by subretinal administration by a retinal surgeon under local esia. The ure involves rd 3 port pars plana tomy with a core vitrectomy followed by a single subretinal administration into the subretinal space by a subretinal cannula (36 to 41 gauge). 100 — 150 microliters of rAAV8.aVEGF is delivered.
Patients receive one of 3, 4 or 5 doses. Three dose levels: 3 X 109 genome copies (GC)/eye, 1 X 1010 GC/eye, and 6 X 1010 . Starting at 4 weeks post-rAAV8.aVEGF test vector administration, the subject may receive intravitreal ranibizumab rescue therapy in the study eye for disease activity if 1 or more of the following rescue criteria apply: Vision loss of 25 letters (per Best Corrected Visual Acuity [BCVA]) associated with accumulation of retinal ?uid on Spectral Domain Optical Coherence Tomography (SD-OCT). Choroidal neovascularization (CNV)-related increased, new, or persistent subretinal or intraretinal ?uid on . New ocular hage.
Further rescue injections may be deferred per the clinician's discretion if one of the following sets of findings occur: Visual acuity is 20/20 or better and central retinal thickness is "normal" as ed by SD-OCT, or Visual acuity and SD-OCT are stable after 2 consecutive injections. If injections are deferred, they are resumed if visual acuity or SD- OCT get worse per the criteria above.
EXAMPLE 11 - Dose Escalation Study This Phase I, open-label, multiple-cohort, dose-escalation study is designed to evaluate the safety and tolerability of rAAV8.aVEGF gene therapy in ts with previously treated neovascular AMD (nAMD). Three doses are studied in approximately 18 subjects. Subjects who meet the inclusion/exclusion criteria and have an anatomic response to an initial anti VEGF injection receive a single dose of rAAV8.aVEGF administered by inal delivery. rAAV8.aVEGF uses an AAV8 vector that contains a gene that encodes for a monoclonal antibody fragment which binds to and neutralizes VEGF ty. Safety is the primary focus for the initial 24 weeks after rAAV8.aVEGF stration (primary study period). In certain embodiments, the study includes administering an anti-VEGF antibody, e.g., ranibizumab, and response is measured at week 1 (Visit 2) by SD-OCT. For patients responsive to this treatment, rAAV8.aVEGF may be administered at Visit 3 (week 2), post- EGF antibody administration and safety is then assessed through week 26 (24 weeks post-rAAV8.aVEGF administration). Following completion of the primary study period, subjects continue to be assessed until 104 weeks following treatment with rAAV8.aVEGF.
Subjects who meet the inclusion/exclusion criteria are enrolled and receive a 0.5 mg intravitreal injection of ranibizumab in the study eye (Visit 1). At Visit 2 (7 days after ranibizumab injection), subjects are evaluated by SD-OCT to confirm anatomic se to the l anti-VEGF activity associated with the zumab injection compared with their baseline assessment. Subjects who do not have an anatomic response are withdrawn from the study. For withdrawn subjects, anyone who has an AB associated with the ranibizumab injections on Visit 1 is followed until the AE resolves (up to 30 days post-injection). At Visit 3 (Week 2), subjects e a single dose of rAAV8.aVEGF Fab administered in an operating room by subretinal delivery. The sentinel subject in each cohort has vision of 520/100 and 220/400 (:65 and 235 ETDRS letters). After rAAV8.aVEGF Fab administration to the sentinel subject, there is a 4-week observation period for safety. Up to 5 additional subjects (with expanded vision ia of 520/63 and 220/400 [:75 and 235 ETDRS letters]) may be enrolled in el with a minimum of 1 day between each enrollment. If no safety review triggers (SRTs) are observed, then 4 weeks after the last t is dosed. Subjects have 3 visits within the first 4 weeks after treatment with rAAV8.aVEGF Fab. ng 4 weeks after rAAV8.aVEGF Fab administration, subjects may receive intravitreal ranibizumab rescue therapy if they meet ined rescue injection criteria. Immunogenicity to the vector and transgene of rAAV8.aVEGF Fab is assessed throughout the study.
Safety is the primary focus for the initial 24 weeks after rAAV8.aVEGF administration (primary study period). ing completion of the primary study period, subjects continue to be ed until 104 weeks following treatment with rAAV8.aVEGF (Week 106). At the end of the study, subjects are d to participate in a long-term follow- up study. The safety and bility of rAAV8.aVEGF are assessed in each dosed subject and are monitored through assessment of ocular and ular ABS and SAEs, chemistry, hematology, coagulation, urinalysis, immunogenicity, ocular examinations and imaging (BCVA, intraocular pressure, slit lamp biomicroscopy, indirect ophthalmoscopy, and SD- OCT), and vital signs.
A. Arms and Interventions Arms Assigned Intervention Dose 1 Biological/Vaccine: rAAV8aVEGF 3 X 109 GC of is a recombinant adeno-associated rAAV8.aVEGF virus (AAV) gene therapy vector carrying a coding sequence for a soluble anti-VEGF protein Experimental: Dose 2 ical/Vaccine: rAAV8aVEGF 1 X 1010 GC of is a recombinant adeno-associated rAAV8.aVEGF virus (AAV) gene therapy vector ng a coding sequence for a soluble anti-VEGF protein Experimental: Dose 3 Biological/Vaccine: rAAV8aVEGF 6 X 1010 GC of is a inant adeno-associated rAAV8.aVEGF virus (AAV) gene therapy vector carrying a coding sequence for a soluble anti-VEGF protein B. nts: Primary outcome measure: 1. Safety: Incidence of ocular adverse events (AE) and non-ocular serious adverse events (SAE) over 26 weeks Secondary outcome measure: 2. Safety: Incidence of ocular and non-ocular ABS and SAEs over 106 weeks 3. Change in best corrected visual acuity (BCVA) over 106 weeks 4. Change in central retinal thickness (CRT) as measured by SD-OCT over 106 weeks.
. Rescue injections: mean number of rescue ions over 106 weeks 6. Change in choroidal neovascularization and lesion size and leakage area CNV changes as measured by FA over 106 weeks WO 80936 2017/027529 Criteria: Inclusion Criteria: 1. ts 2 50 years with a diagnosis of subfoveal CNV secondary to AMD in the study eye receiving prior intravitreal anti-VEGF therapy. ed patient population is not gender based (males and females included). 2. BCVA between 320/100 and 220/400 (£65 and 235 Early Treatment Diabetic Retinopathy Study [ETDRS] s) for the first patient in each cohort followed by BCVA between 320/63 and 220/400 (£75 and 235 ETDRS letters) for the rest of the cohort. 3. History of need for and response to anti-VEGF therapy. 4. Response to EGF at trial entry (assessed by SD-OCT at week 1 Wisit 2) . Must be pseudophakic (status post cataract surgery) in the study eye. 6. Aspartate aminotransferase (AST)/ Alanine aminotransferase (ALT) <25 >< upper limit of normal (ULN), Total Bilirubin (TB) < 1.5 X ULN, Prothrombin time (PT) < 1.5 X ULN, Hemoglobin (Hb) > 10 g/dL (males) and > 9 g/dL (females); Platelets > 100 X 103/ u L, estimated glomerular filtration rate (eGFR) > 30 mL/min/1.73 m2 7. Must be willing and able to provide written, signed informed consent.
Exclusion Criteria: 1. CNV or r edema in the study eye secondary to any causes other than AMD. 2. Any condition preventing visual acuity improvement in the study eye, eg, is, atrophy, or retinal epithelial tear in the center of the fovea. 3. Active or history of retinal detachment in the study eye. 4. ed glaucoma in the study eye.
. History of intravitreal y in the study eye, such as intravitreal steroid injection or investigational product, other than anti-VEGF therapy, in the 6 months prior to screening. 6. Presence of an implant in the study eye at screening (excluding intraocular lens). 7. Myocardial infarction, cerebrovascular accident, or transient ischemic attacks within the past 6 months. 8. Uncontrolled hypertension (systolic blood pressure [BP] >180 mmHg, diastolic BP >100 mmHg) despite maximal medical treatment.
EXAMPLE 12 - Vector Production and Manufacturing A. Description of the cturing Process Cell g: A qualified human embryonic kidney 293 cell line is used for the tion process. Cell culture used for vector production is initiated from a single thawed MCB vial, and expanded per a Master Batch Record Document (MBR). Cells are expanded to 5 x 109 — 5 x 1010 cells using Corning T-?asks and CS-10, which allow sufficient cell mass to be generated for seeding up to 50 HS-36 for vector production per BDS lot. Cells are cultivated in medium composed of Dulbecco’s Modi?ed Eagle Medium (DMEM), supplemented with 10% gamma irradiated, US-sourced, Fetal Bovine Serum (FBS). The cells are anchorage dependent and cell disassociation is accomplished using M , an animal product-free cell dissociation reagent. Cell seeding is accomplished using sterile, single-use able bioprocess bags and tubing sets. The cells are maintained at 37°C (:: 2°C), in 5% (:: 0.5%) C02 atmosphere.
Transient Transfection: Following approximately 3 days of growth (DMEM media + % FBS), HS-36 cell culture media are replaced with fresh, serum free DMEM media and transfected with the 3 production plasmids using an zed PEI-based transfection method. All plasmids used in the production process are produced in the context of a CMO quality system and infrastructure utilizing controls to ensure bility, nt l, and materials segregation.
Sufficient DNA plasmid transfection complex are prepared in the BSC to transfect 50 HS-36 (per BDS batch). Initially a DNA/PEI mixture is ed containing 7.5 mg of the relevant vector genome plasmid) 150 mg of pAdDeltaF6(Kan), 75 mg of pAAV2/8Kan AAV helper plasmid and GMP grade PEI (PElPro, PolyPlus Transfection SA). This plasmid ratio is determined to be l for AAV production in small scale optimization studies.
After mixing well, the solution is allowed to sit at room temperature for 25 min. and then added to serum-free media to quench the reaction and then added to the HS-36’s. The transfection mixture is equalized between all 36 layers of the HS-36 and the cells are incubated at 37°C (:: 2°C) in a 5% (:: 0.5%) C02 atmosphere for 5 days.
Cell Media Harvesting: Transfected cells and media are harvested from each HS-36 using disposable bioprocess bags by aseptically draining the medium out of the units.
Following the harvest of media, the ~ 200 liter volume is supplemented with MgClz to a ?nal concentration of 2 mM (co-factor for ase) and Benzonase nuclease (Cat#: 1.0167970001, Merck Group) is added to a ?nal concentration of 25 units/mL. The product (in a disposable bioprocess bag) is incubated at 37°C for 2 hr in an incubator to provide suf?cient time for tic digestion of residual cellular and plasmid DNA present in the harvest as a result of the transfection procedure. This step is performed to minimize the amount of residual DNA in the ?nal vector DP. After the incubation period, NaCl is added to a ?nal concentration of 500 mM to aid in the recovery of the t during ?ltration and downstream tangential ?ow ion. cation: Cells and cellular debris is removed from the product using a depth ?lter capsule (1.2/0.22 um) connected in series as a sterile, closed tubing and bag set that is driven by a peristaltic pump. Clari?cation assures that downstream ?lters and chromatography columns are ted ?om fouling and bioburden reduction ?ltration ensures that at the end of the ?lter train, any bioburden potentially uced during the upstream production process is removed before downstream puri?cation. The harvest material is passed through a Sartorius Sartoguard PES capsule ?lter (1.2/0.22 um) (Sartorius Stedim Biotech Inc.).
Large-scale Tangential Flow Filtration: Volume reduction (10-fold) of the clari?ed product is achieved by tial Flow tion (TFF) using a custom sterile, closed bioprocessing tubing, bag and membrane set. The principle of TFF is to flow a solution under pressure parallel to a membrane of suitable porosity (100 kDa). The pressure differential drives molecules of smaller size through the membrane and effectively into the waste stream while retaining molecules larger than the membrane pores. By recirculating the solution, the parallel ?ow sweeps the membrane surface preventing membrane pore fouling.
By choosing an riate membrane pore size and surface area, a liquid sample may be rapidly reduced in volume while retaining and trating the desired molecule. ration in TFF applications involves addition of a fresh buffer to the recirculating sample at the same rate that liquid is passing through the membrane and to the waste stream.
With increasing volumes of dia?ltration, increasing amounts of the small les are removed from the recirculating sample. This s in a modest puri?cation of the clari?ed t, but also achieves buffer exchange compatible with the subsequent y column chromatography step. ingly, a 100 kDa, PES membrane is used for concentration that is then dia?ltered with a minimum of 4 diavolumes of a buffer composed of: 20 mM Tris pH 7.5 and 400 mM NaCl. The dia?ltered product is stored overnight at 4°C and then further clari?ed with a 1.2/0.22 um depth ?lter capsule to remove any precipitated material.
Af?nity tography: The dia?ltered t is applied to a PorosTM Capture SelectTM AAV8 af?nity resin (Life Technologies) that ef?ciently captures the AAV8 serotype. Under these ionic conditions, a signi?cant percentage of residual cellular DNA and proteins ?ow through the column, while AAV particles are ef?ciently captured. Following application, the column is washed to remove additional feed ties followed by a low pH step elution (400 mM NaCl, 20 mM Sodium Citrate, pH 2.5) that is ately neutralized by collection into a 1/10th volume of a neutralization buffer (Bis Tris Propane, 200 mM, pH .2).
Anion Exchange Chromatography: To achieve further reduction of in-process impurities including empty AAV particles, the Poros-AAV8 elution pool is diluted 50-fold (20 mM Bis Tris Propane, 0.001% Pluronic F68, pH 10.2) to reduce ionic strength to enable binding to a usTM QA monolith matrix (BIA Separations). Following a low-salt wash, vector product is eluted using a 60 CV NaCl linear salt gradient (10-180 mM NaCl). This shallow salt gradient effectively separates capsid particles without a vector genome (empty particles) from particles containing vector genome (full particles) and results in a preparation enriched for full s. ons are collected into tubes containing 1/ 100th volume of 0.1% pluronic F68 and 1/27th volume of Bis Tris pH 6.3 to minimize non-speci?c binding to tubes and the length of exposure to high pH tively. The appropriate peak n is collected, and the peak area assessed and compared to previous data for determination of the approximate vector yield.
Final Formulation and Bioburden Reduction Filtration to yield the BDS: TFF is used to achieve ?nal formulation on the pooled AEX ?actions with a 100 kDa membrane. This is accomplished by diafiltration of ation buffer (PBS with NaCl and 0.001% Pluronic or PBS with 0.001% Pluronic to be ed following completion of stability studies) and concentrated to yield the BDS Intermediate at a desired target Samples are removed for BDS Intermediate testing (described in the section below). The BDS Intermediate is stored in sterile polypropylene tubes and frozen at 360°C in a quarantine location until release for Final Fill. ity studies are underway to assess stability following e at <-60°C.
Final Fill: The frozen BDS is thawed, pooled, ed to the target concentration (dilution or concentrating step via TFF) using the final ation buffer (PBS with NaCl and 0.001% Pluronic or PBS with 0.001% ic to be selected following completion of stability studies). The product is then be terminally filtered through a 0.22 pm filter and filled into either West Pharmaceutical’s "Ready-to-Use" (pre-sterilized) glass vials or Crystal Zenith (polymer) vials (vial type pending the outcome of comparability studies) and stoppers with crimp seals at a fill volume 2 0.1 mL to 5 0.5 mL per vial. Vials are individually labeled according to the specifications below. Labeled vials are stored at 5 -60°C. All doses e dilution in the ation buffer prior to administration. The dilution is ted by the pharmacy at the time of dosing.
B. Assay Methods Sterility and Bacteriostasis/ tasis: This procedure is med once according to United States Pharmacopeia (USP) <7l>, to ensure that the sample matrix does not cause inhibition of the assay. Included in the test is the suitability test.
Particle Aggregation: Drug product particle aggregation is assessed using a dynamic light scattering (DLS) assay. DLS measures ?uctuations in scattered light intensity due to diffusing particles and is used to characterize the size of various particles in the .
DLS instrument software typically displays the particle population at different diameters. If the system is monodisperse, only one population is detected and the mean effective diameter of the particles can be determined. In a polydisperse system, such as in the case of aggregation, multiple le populations are detected and sized using CONTIN analysis.
Residual plasmid DNA: Detection of plasmid DNA sequences is accomplished using qPCR and primer probe sets specific for the kanamycin gene present in the plasmid backbone but not in vector genomes. The assay is performed in both the presence and absence of DNase digestion such that the amount of free plasmid and the amount packaged into vector particles can be determined.
El DNA: Adenoviral El DNA is a host cell contaminant and is detected by qPCR specific for the gene. The assay is performed in both the ce and absence of DNase digestion such that both free and packaged El DNA can be quantified.
Residual Host Cell DNA: Levels of residual host cell DNA (HCDNA) are quantified using qPCR directed against the human 18s rDNA gene which is a high copy number DNA sequence and thus confers sensitivity. In addition to total residual HCDNA levels, the amount of DNA at s size ranges is also determined.
Residual Host Cell Protein: al 293 host cell protein (HCP) is detected using commercially available ELISA kits such as that sold by Cygnus Technologies.
Poros-AAV8 Leachable Ligand: An Enzyme-Linked Immunosorbent Assay (ELISA) kit supplied by Life Technologies, the maker of the Poros-AAV8 resin, is used to detect leached camelid antibody in the drug product.
Mycoplasma Detection: Mycoplasma testing is performed according to USP <63>.
Bioburden Testing: This test is med according to USP <6l>.
Endotoxin Testing: This assay is performed according to USP <85>.
In vitro Assay for Adventitious Agents: The purpose of the in vitro assay for viral contaminants is to detect possible adventitious s introduced during AAV8.AMD vector production and is based upon CBER’s 1993 Points to Consider and ICH Q5A. The in vitro assays use 3 indicator cell lines - human diploid lung (MRC-S) cells, African green monkey kidney (Vero) cells, and human foreskin fibroblast (Hs68) cells. Assay endpoints are observation of thic effects (CPE) over a course of at least 28 days as well as hemadsorption at the end of the assay period, which facilitates the detection of a broad range of viruses.
Vector Genome Identity: DNA Sequencing: Viral Vector c DNA is isolated and the ce determined by 2-fold sequencing coverage using primer walking. Sequence alignment is performed and compared to the expected sequence.
Vector Capsid Identity: AAV Capsid Mass spectrometry of VPl: Confirmation of the AAV2/8 serotype of the drug product is achieved by an assay based upon analysis of peptides of the AAV capsid n.
Genomic Copy (GC) Titer: A droplet l PCR (ddPCR)-based technique for determining the genome copy (GC) titer for AAV vectors is described in Lock et al. Human Gene Therapy Methods 25: 115—125. The assay utilized involves digestion with DNase I, followed by digital PCR analysis to e encapsulated vector genomic copies. DNA detection is accomplished using sequence specific primers targeting the RBG polyA region in combination with a fluorescently tagged probe izing to this same region. A number of standards, validation s and controls (for background and DNA contamination) have been introduced into the assay.
Empty to Full Particle Ratio: The total particle content of the drug product is ined by SDS-PAGE is. A reference vector preparation puri?ed on an iodixanol gradient is analyzed by various methods (analytical ultracentrifugation, electron microscopy and absorbance at 260/280 nm) to established percentage of full particles in the preparation.
This reference material is serially diluted to known genome copy numbers (and thus by extension, particle numbers) and each dilution is run on an SDS PAGE gel along with a similar on series of the drug product. Peak area volumes of both the reference material and drug product VP3 protein bands are determined by densitometry and the reference material volumes are plotted versus particle number. The total particle concentration of the drug product is determined by extrapolation from this curve and the genome copy (GC) titer is then subtracted to obtain the empty particle titer. The empty to full particle ratio is the ratio of the empty particle titer to the GC titer.
Infectious Titer: The infectious unit (IU) assay is used to determine the productive uptake and replication ofAAV8.AMD vector in RC32 cells (rep2 expressing HeLa cells). A 96-well end-point format has been employed similar to that previously published. Brie?y, RC32 cells are co-infected by serial dilutions of AAV8.AMD BDS and a uniform dilution of Ad5 with 12 ates at each on of rAAV. Seventy-two hours after infection the cells are lysed, and qPCR performed to detect rAAV vector ication over input. An end- point dilution Tissue Culture Infectious Dose 50% (TCID50) calculation (Spearman-Karber) is performed to determine a replicative titer expressed as IU/mL. Since "infectivity" values are dependent on particles coming into t with cells, receptor binding, internalization, transport to the s and genome replication, they are ced by assay geometry and the presence of appropriate receptors and post-binding pathways in the cell line used.
Receptors and post-binding pathways are not usually ined in alized cell lines and thus infectivity assay titers are not an absolute measure of the number of "infectious" particles present. However, the ratio of encapsidated GC to "infectious units" (described as GC/IU ratio) can be used as a measure of product consistency from lot to lot.
Host Cell DNA: A qPCR assay is used to detect residual human 293 DNA. After g with a "non-relevant DNA", total DNA (non-relevant, vector and residual genomic) is ted from ~l mL of product. The Host Cell DNA is quantified using qPCR targeting the 188 rDNA gene. The quantities of DNA detected are normalized based on the recovery of the spiked non-relevant DNA.
Host Cell Protein: An ELISA is performed to measure levels of contaminating host HEK293 cell proteins. The Cygnus Technologies HEK293 Host Cell ns 2nd Generation ELISA kit is used according to instructions.
Replication-competent AAV (rcAAV) Assay: A sample is analyzed for the presence of replication competent AAV2/8 (rcAAV) that can potentially arise during the production process.
An example of this type of assay is shown in (FIGs lOA-lOD), Where thAV8 is spiked into different GC amounts ofAAV8 vector and the cap gene copy number per 1 ug of 293 cell DNA is determined after 3 successive passages of the cell lysate onto fresh cells.
The details of the assay development are included in the CTA submission. These s indicate that the minimum detectable amount ofthAV8 using this assay is 104 GC. This number is equivalent to approximately 1 TCID50 IU and s the lack of infectivity of AAV8 for 293 cells as evidenced by the high GC:IU ratios obtained compared to AAV2.
The low sensitivity appears unavoidable With the t assay system but might be overcome in future by ering a cell line With a yet to be discovered AAV8 ar receptor or other protein important in post-entry pathways. Spiking the thAV8 into AAV8 vector concentrations of up to 1011 GC had little effect on ion and indicates a lack of interference of the vector on thAV8 replication at this vector level. While Wildtype AAV has been used extensively as a surrogate in the past for rcAAV2 and in our own rcAAV assay development efforts for AAV8 the best ate is a AAV8 capsid containing AAV2 ITRs, an AAV2 rep gene and an AAV8 cap gene.
Analytical Method Acceptance Criteria1 Final Drug Clear to slightly Opaque, Product in colorless to faint White vials Appearance Visual tion solution, free of non- product related foreign particulates USP<791> Test Analytical Method Acceptance Criteria1 GC Titer ddPCR 21x10"GC/mL** AAV Vector Genome Sequencing(S anger) Confirm expected sequence Identity Final Drug Total Protein Micro BCA Report result Product in Content Vials lity USP<785> < 400 mOsm Content Empty/Full Particle PT(by SDS-PAGE)/GC ratio Report result Ratio Purity Empty: Full le ratio 280 Report result Purity Viral Capsid Purity Report result SDS-PAGE Purity Aggregation Characterization Dynamic Light Scattering Report result Purity In Vitro potency HEK293transduction/ Conforms to reference Potency ranibizumab ELISA standard Transgene expression In Vitro expression and terization Positive for ranibizumab ELISA Identity Infectious Titer Characterization TCIDSO/qPCR Report results Potency ical Method Acceptance Criteria1 rcAAV by triple passage HEK293 + Ad5 Cell Culture/qPCR Report results Characterization Safety AAV-8 signature peptide Capsid Identity detected. ure Characterization UPLC/Mass Spectrometry peptides for AAV1,2,6,9 hu37 and Rth not detected <0.80 EU/mg* Endotoxin > 6 the safety limit based on Safety Kinetic Chromogenic dose calculations, pending the verification of total protein) Sterility Safety Container Closure Integrity (for stability study Dye Ingress Test Container is Integral only and not for lot release) 1The acceptance criteria is determined upon completion of the first GMP campaign.
*Endotoxin limit calculation is based on dose in Mass. Once the total protein tration is confirmed from the GMP run, the limit can be recalculated. The current limit is based on the protein concentration from the Tox materials in relation to GC titer. The value is an approximation and not a definitive value. The dual acceptance criteria presented here.
** DP GC Titer criteria may change depending on the final selected dose levels for the study The clinically suitable surfactant Pluronic F68 is added to the ?nal formulation buffer ofAAV8.AMD and is anticipated to minimize this type of loss. The interaction of the drug product with both the storage vial and the al delivery device is investigated to ine the amount of vector loss through binding to surfaces. GC titers (quCR) of the engineering run drug product are determined before and after vialling and storage at 3 -60°C.
For the delivery device, the DP is thawed, diluted in the appropriate clinical diluent to the correct dosing concentration and passed through the device. GC ions are performed on the DP directly after thaw, after dilution and after passage through the , and the appropriate number of replicates is included to assure statistical significance. Comparison of GC titers in this manner enables an assessment of DP loss during storage and administration to the patient. el s are also performed in a similar way to assess the activity of the drug product after passing through the delivery device. For this purpose the in vitro ranibizumab expression-based potency assay is employed.
(Sequence Listing Free Text) The following information is provided for sequences containing free text under numeric identifier <223>.
SEQ ID NO: (containing free text) Free text under <223> l <223> Humanized anti-VEGF Fab heavy chain <220> <221> EATURE <222> (39) <223> complementarity determining region MISC_FEATURE (54). . (8 3) complementarity determining region 2 Humanized anti-VEGF Fab MISC_FEATURE (26)..(37) complementarity determining region MISC_FEATURE (107)..(117) complementarity determining region 3 <223> 5'ITR.CB7.CI.aVEGFV2.rBG.3'ITR <220> <221> repeat_region <222> 130) <223> 5' ITR <220> <221> promoter <222> .(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer with 2 mismatches <220> <221> misc_feature <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) CB promoter TATA_signal (836)..(839) misc_feature (955)..(1829) n beta-actin intron Intron (956)..(1928) chicken beta-actin intron Intron (956)..(1928) n beta-actin promoter 'UTR (1946)..(1993) c-myc 5' UTR <220> <221> misc_feature <222> (1994)..(1999) <223> kozak sequnce <220> transit_peptide (1999)..(2058) (2059)..(2427) (2428)..(2748) misc_feature (2752)..(2763) Furin cleavage site (2764)..(2835) F2A linker transit_peptide (2836)..(2895) (2896)..(3216) aVEGFvZ VL <220> <221> CDS <222> (3217)..(3537) <223> CL <220> <221> polyA_signal <222> (3613)..(3739) <223> rabbit globin polyA <220> <221> repeat_region <222> (3828)..(3957) <223> 3'ITR 4 Synthetic Construct —<223>Synthetic Construct 6 —<223>Synthetic Construct 7 <223> Synthetic Construct s —<223>Synthetic Construct 9 <213> Arti?cial Sequence <220> <223> AAVZS‘ITRUbC.Ci.aVEGFV2.rBG.AAV23'ITR <220> <221> repeat_region <222> (146) <223> 5' ITR <220> <221> promoter <222> (207)..(1435) <223> UbC With C insertion at 289 and G insertion at 990 <220> <221> Intron <222> ..(1661) <223> chimeric intron <220> <221> 5'UTR <222> (1736)..(1783) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1784)..(1789) <223> kozak <220> <221> misc_feature <222> (1789)..(1848) <223> kozak <220> <221> CDS <222> (1849)..(2217) <223> aVEGFv2 VH <220> <221> CDS <222> (2218)..(2538) misc_feature (2542)..(2553) furin cleavage site misc_feature (2554)..(2625) F2a linker misc_feature (2626)..(2685) Leader ..(3006) aVEGFvZ VL <220> <22 l> CDS <222> (3007)..(3327) <223> CL <220> <221> polyA_signal <222> (3345)..(3576) <223> SV40 late polyadenylation signal <220> <221> repeat_region <222> (3641)..(3770) <223> 3' ITR <223> Synthetic Construct 11 <223> tic Construct 12 <223> Synthetic Construct 13 <223> Synthetic Construct 14 <223> 7.CI.aVEGRV3.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer with 2 mismatches <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> TATA_signal (836)..(839) Intron (956)..(1928) chicken beta-actin intron 'UTR (1940)..(1987) eature (1988)..(1993) Kozak misc_feature (1993)..(2052) leader (2053)..(2421) aVEGFv3 VH (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature ..(2829) F2a linker misc_feature (2830)..(2889) leader (2890)..(3210) aVEGFv3 VL (3211)..(3531) <220> <22 l> polyA_signal <222> (3607)..(3733) <223> rabbit globin polyA repeat_region <222> (3822)..(3951) <223> 3' ITR <223> Synthetic uct 16 <223> Synthetic Construct 17 <223> Synthetic Construct 18 <223> Synthetic Construct 19 <223> ITR.UbC.PI.aVEGFV3.SV40.ITR <220> <221> repeat_region <222> (17)..(146) <223> AAVZ 5' ITR <220> <221> promoter <222> (207)..(1434) <223> UbC, With C insert at 289 and G insert at <220> <221> Intron <222> (1528)..(1660) <223> chimeric intron 'UTR (1729)..(1776) c-myc 5'UTR misc_feature <222> (1777)..(1782) <223> kozak <220> <221> misc_feature <222> ..(l84l) <223> leader <220> <221> CDS <222> (1842)..(2210) <223> aVEGFV3 VH (2211)..(2531) misc_feature (2535)..(2546) furin cleavage site misc_feature (2547)..(2618) F2a linker misc_feature (26 l9)..(2678) leader <220> <221> CDS <222> ..(2999) <223> aVEGFV3 VL <220> <221> CDS <222> ..(3320) <223> CL <220> <221> polyA_signal <222> (3338)..(3569) <223> SV40 late polyA <220> <221> repeat_region <222> (3634)..(3763) <223> AAV2 3'ITR <223> Synthetic Construct 21 <223> Synthetic Construct 22 <223> Synthetic Construct 23 <223> Synthetic Construct 24 <223> ITR.UbC.PI.aVEGFV1.SV40.ITR <220> <221> repeat_region <222> (17)..(146) <223> ITR <220> <221> promoter <222> (207)..(1435) <223> UbC <220> <221> Intron <222> (1529)..(1661) <223> Promoga chimeric intron <220> <221> 5'UTR <222> (1730)..(1777) <223> c-myc 5'UTR <220> <221> eature <222> (1778)..(1783) <223> kozak <220> <221> misc_feature <222> (1783)..(1842) <223> leader (1843)..(2211) aVEGFvl VH (2212)..(2532) misc_feature (2536)..(2547) furin cleavage site misc_feature (2548)..(2619) F2A linker misc_feature (2620)..(2679) leader <220> <221> CDS <222> (2680)..(3000) <223> aVEGFvl VL <220> <221> CDS <222> (3001)..(3321) <223> CL <220> <221> polyA_signal <222> (3339)..(3570) <223> SV40 polyadenylation signal <220> <22 l> repeat_region <222> (3635)..(3764) <223> ITR <223> Synthetic Construct 26 <223> tic Construct 27 <223> Synthetic Construct 28 <223> Synthetic Construct <223> synthetic leader 31 <223> synthetic leader 2 32 <223> derived from encephalomycarditts Virus 33 <223> aVEGF <220> <22 l> MISC_FEATURE <222> (1)..(20) <223> leader <220> <22 l> MISC_FEATURE <222> (21)..(252) <223> aVEGF Heavy Chain <220> <22 l> EATURE <222> (280)..(299) <223> leader <220> <22 l> MISC_FEATURE <222> (300)..(513) <223> aVEGF Light Chain 34 <223> ITR.CB7.CI.aVEGFV1.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5' ITR <220> <221> promoter <222> (204)..(584) <223> CMV IE promoter <220> <221> promoter <222> (585)..(862) <223> CB promoter <220> <221> TATA_signal <222> (836)..(839) <220> <221> Intron <222> .(1928) <223> chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak <220> <221> misc_feature <222> (1993)..(2052) <223> leader <220> <221> misc_feature <222> (2053)..(2421) <223> aVEGFvl VH <220> <221> misc_feature <222> (2422)..(2742) <223> CH1 misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader eature (2890)..(3210) aVEGFvl VL misc_feature (3211)..(3531) <220> <221> misc_feature <222> (3532)..(3537) <223> stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> Rabbit globin poly A <220> <221> misc_feature <222> (3785)..(3821) <223> part ofAAV <220> <221> repeat_region <222> (3822)..(3951) <223> 3'ITR <223> 7.CI.aVEGFV4.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> <221> Intron <222> (956)..(1928) <223> chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak <220> <221> misc_feature <222> (1993)..(2052) <223> leader misc_feature (2053)..(2421) aVEGFV4 VH misc_feature ..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature <222> (2830)..(2889) <223> leader <220> <221> misc_feature <222> (2890)..(3210) <223> aVEGFV4 VL <220> <221> misc_feature <222> (3211)..(3531) <223> CL misc_feature (3532)..(3537) stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> Rabbit globin poly A <220> <221> repeat_region <222> (3822)..(3951) <223> 3'ITR 36 <223> ITR.CB7.CI.aVEGFV5.rBG.ITR <220> <221> repeat_region <222> 130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> <221> Intron <222> (956)..(1928) <223> chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak misc_feature ..(2052) leader misc_feature (2053)..(2421) aVEGFvS VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature (2890)..(3210) aVEGFVS VL misc_feature (3211)..(3531) misc_feature (3532)..(3537) stop cassette <220> <221> signal <222> (3607)..(3733) <223> rabbit globin poly A <220> <221> repeat_region <222> (3822)..(3951) <223> 3'ITR 37 <223> ITR.CB7.CI.aVEGFV6.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter Intron .(1928) chicken beta-actin intron 'UTR (1940)..(1987) c-myc 5'UTR misc_feature (1993)..(2052) leader misc_feature (2053)..(2421) aVEGFV6 VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature ..(2889) leader misc_feature (2890)..(3210) aVEGFV6 VL misc_feature (3211)..(3531) <220> <221> misc_feature <222> (3532)..(3537) <223> stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> Rabbit globin poly A <220> <221> _region <222> (3822)..(3951) <223> 3'ITR 38 <223> ITR.CB7.CI.aVEGFV7.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter Intron (956)..(1928) chicken ctin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak <220> <221> misc_feature <222> (1993)..(2052) <223> leader misc_feature (2053)..(2421) aVEGFV7 VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature (2890)..(3210) aVEGFV7 VL eature (3211)..(3531) misc_feature (3532)..(3537) stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> rabbit globin poly A <220> <221> repeat_region <222> (3822)..(3951) <223> 3'ITR 39 <223> ITR.CB7.CI.aVEGFV8.rBG.ITR <220> <221> repeat_region <222> 130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter Intron (956)..(1928) chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak <220> <221> misc_feature <222> (1993)..(2052) <223> leader misc_feature (2053)..(2421) aVEGFv8 VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature (2890)..(3210) aVEGFV8 VL misc_feature (3211)..(3531) misc_feature (3532)..(3537) stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> rabbit globin poly A <220> <221> repeat_region <222> (3822)..(3951) <223> 3'ITR 40 <223> ITR.CB7.CI.aVEGFV9.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> <221> Intron <222> (956)..(1928) chicken beta-actin intron 'UTR (1946)..(1993) c-myc 5'UTR <220> <221> misc_feature <222> (1994)..(1999) <223> kozak <220> <221> misc_feature <222> (1999)..(2058) <223> leader eature (2059)..(2427) aVEGFV9 VH misc_feature (2428)..(2748) misc_feature (2752)..(2763) furin cleavage site misc_feature (2764)..(2835) F2A linker misc_feature (2836)..(2895) leader misc_feature (2896)..(3216) aVEGFV9 VL misc_feature (3217)..(3537) misc_feature (3538)..(3543) Stop Cassette <220> <22 l> signal <222> (3613)..(3739) <223> rabbit globin poly A repeat_region <222> (3828)..(3957) <223> 3'ITR 41 <223> ITR. CB7. CI.aVEGFV 1 0.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> <221> Intron <222> (956)..(1928) <223> chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <22 l> misc_feature <222> (1988)..(1993) <223> kozak <220> <22 l> misc_feature <222> ..(2052) <223> leader misc_feature (2053)..(2421) aVEGFle VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature (2890)..(3210) misc_feature (3211)..(3531) misc_feature (3532)..(3537) stop cassette <220> <22 1> polyA_signal <222> (3607)..(3733) <223> rabbit globin poly A repeat_region (3822)..(3951) 3'ITR 42 <223> ITR.CB7.CI.aVEGFV11.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter Intron (956)..(1928) chicken ctin intron 'UTR (1940)..(1987) c-myc 5' UTR <22 l> misc_feature <222> ..(1993) <223> kozak <220> <22 l> misc_feature <222> (1993)..(2052) <223> leader <220> <22 l> misc_feature <222> (2053)..(2421) <223> aVEGFvll VH misc_feature (2422)..(2742) misc_feature (2746)..(2754) furing cleavage site misc_feature (2755)..(2829) F2A linker misc_feature (2830)..(2889) misc_feature (2890)..(3210) aVEGFvl 1 VL misc_feature (3211)..(3531) misc_feature (3532)..(3537) stop cassette polyA_signal (3607)..(3733) rabbit globin poly A repeat_region (3822)..(3951) 3' ITR 43 <223> ITR. CB7. CI.aVEGFV12.rBG.ITR <220> <22 1> _region <222> (1)..(130) <223> 5'ITR <220> <221> promoter <222> (198)..(579) <223> CMV IE promoter <220> <221> enhancer <222> (279)..(538) <223> C4 enhancer <220> <221> promoter <222> (582)..(862) <223> CB promoter Intron .(1928) chicken beta-actin intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak misc_feature (1993)..(2052) leader misc_feature (2053)..(2421) aVEGFV 12 VH misc_feature (2422)..(2742) eature (2746)..(2757) furing cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature <222> (2890)..(3210) <223> aVEGFV12 VL <220> <221> misc_feature <222> (3211)..(3531) <223> CL <220> <221> misc_feature <222> (3532)..(3537) <223> stop cassette <220> <221> polyA_signal <222> ..(3733) <223> rabbit globin poly A repeat_region (3822)..(3951) 3'ITR 44 <223> ITR.CB7.CI.aVEGFV13.rBG.ITR <220> <221> repeat_region <222> (1)..(130) <223> 5'ITR <220> <221> misc_feature <222> (131)..(167) <223> part ofAAV <220> <221> promoter <222> (198)..(579) <223> CME IE promoter <220> <221> misc_feature <222> (204)..(233) <223> promoter start enhancer (279)..(538) C4 er With 2 mismatches <220> <221> misc_feature <222> .(584) <223> CMV promoter end <220> <221> promoter <222> (582)..(862) <223> CB promoter <220> <221> misc_feature <222> (585)..(615) <223> begin promoter TATA_signal (836)..(839) Intron (956)..(1928) chichen beta-actin intron <220> <221> misc_feature <222> (1814)..(1830) <223> end of intron <220> <221> 5'UTR <222> (1940)..(1987) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1988)..(1993) <223> kozak <220> <221> misc_feature <222> (1993)..(2052) <223> leader misc_feature (2053)..(2421) aVEGFV13 VH misc_feature (2422)..(2742) misc_feature (2746)..(2757) furin cleavage site misc_feature (2758)..(2829) F2A linker misc_feature (2830)..(2889) leader misc_feature (2890)..(3210) aVEGFV 13 VL misc_feature (3211)..(3531) <220> <221> misc_feature <222> (3532)..(3537) <223> stop cassette <220> <221> polyA_signal <222> (3607)..(3733) <223> rabbit globin poly A <220> <221> misc_feature <222> (3785)..(3821) <223> part ofAAV <220> <221> repeat_region <222> ..(3951) <223> 3'ITR 45 <223> ITR.CMV.PI.aVEGFV7.eMCV.IRES.SV40.ITR <220> <221> repeat_region <222> (1)..(130) <223> ITR <220> <221> promoter <222> (19 1). . (932) human CMV I.E. enhancer & promoter Intron (1047)..(1179) Promega ic intron <220> <221> 5'UTR <222> (1248)..(1295) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1299)..(1307) <223> kozak <220> <221> misc_feature <222> (1305)..(1364) <223> leader misc_feature (1365)..(1685) aVEGFV7 VL misc_feature (1686)..(2006) enhancer (2018)..(2608) misc_feature (2606)..(2665) leader <220> <221> misc_feature <222> (2666)..(3034) <223> aVEGFV7 VH <220> <221> misc_feature <222> (3035)..(3355) <223> CH1 <220> <221> polyA_signal <222> (3384)..(3615) <223> SV40 late polyadenylation signal repeat_region (3680)..(3 809) 46 <223> V.PI.aVEGFV7.fdeRES. SV40.ITR repeat_region (1)..(130) <220> <221> promoter <222> (19 1). . (932) <223> human CMV 1E. enhancer and promoter <220> <221> TATA_signal <222> (897)..(901) <220> <221> Intron <222> (1047)..(1179) <223> Promega ic intron <220> <221> 5'UTR <222> (1248)..(1295) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1299)..(1307) <223> kozak <220> <221> misc_feature (1305)..(1313) leader eature (1314)..(1364) leader misc_feature (1365)..(1685) aVEGFV7 VL misc_feature (1686)..(2006) misc_feature (2021)..(2482) misc_feature (2501)..(2542) leader misc_feature (2543)..(2911) aVEGFV7 VH <220> <221> misc_feature <222> (2912)..(3232) <223> CH1 <220> <221> polyA_signal <222> ..(3492) <223> SV40 late polyadenylation signal <220> <221> repeat_region <222> (3557)..(3686) <223> ITR 47 <223> ITR.CMV.PI.aVEGFV7.cMycIRES.SV40.ITR <220> <221> repeat_region <222> (1)..(130) <223> ITR <220> <221> promoter <222> (191)..(932) <223> human CMV LE. enhancer and promoter <220> <221> TATA_signal <222> (897)..(901) Intron (1047)..(1179) Promega chimeric intron <220> <221> 5'UTR <222> (1248)..(1295) <223> c-myc 5'UTR <220> <221> misc_feature <222> (1299)..(1307) <223> kozak <220> <221> eature <222> (1305)..(1313) <223> leader misc_feature (1314)..(1364) leader misc_feature (1365)..(1685) aVEGFV7 VL WO 80936 2017/027529 misc_feature (1686)..(2006) misc_feature (2021)..(2415) IRES c-myc misc_feature (2226)..(2273) mini c-myc IRES misc_feature (2275)..(2275) this C to T mutaion increases expression misc_feature (2434)..(2475) leader misc_feature (2476)..(2844) aVEGFV7 VH misc_feature (2845)..(3165) <223> CH1 <220> <221> polyA_signal <222> (3194)..(3425) <223> SV40 late polyadenylation signal <220> <221> repeat_region <222> ..(3619) <223> ITR 48 <223> AAV8 capsid 49 <223> Nucleic acid sequence ofAAV8 capsid All publications cited in this speci?cation are orated herein by reference in their entireties, as are US Provisional Patent Application No. 62/466,721, ?led March 3, 2017, US Provisional Patent Application No. 62/460,515, ?led February 17, 2017, US Provisional Patent Application No. 62/442,946, ?led January 5, 2017, US ional Patent Application No. 62/331,100, ?led May 3, 2016 and US ional Patent Application No. 62/323,184, ?led April 15, 2016. Similarly, the Sequence Listing ?led herewith is hereby incorporated by reference. While the invention has been described With reference to particular embodiments, it Will be appreciated that modi?cations can be made Without departing from the spirit of the invention. Such modi?cations are intended to fall Within the scope of the ed claims.

Claims (34)

1. A recombinant adeno-associated virus (rAAV) formulated for administration to an eye, wherein the rAAV has an AAV8 capsid and comprises a vector genome packaged within the capsid, said vector genome sing: (a) an AAV 5’ inverted terminal repeat (ITR); (b) a coding sequence for an anti- human vascular endothelial growth factor (VEGF) antigen binding antibody fragment (Fab) operably linked to regulatory elements which direct expression thereof in the eye, wherein the coding sequence comprises an anti-VEGF Fab heavy immunoglobulin chain having an IL-2 leader sequence, an F2A linker, and an EGF Fab light immunoglobulin chain having an IL-2 leader sequence; (c) the regulatory elements of (b) which comprise a cytomegalovirus immediate early (CMV IE) enhancer, a chicken beta action promoter, a chicken beta action intron, and a rabbit beta globin enylation ) signal; and (d) an AAV 3’ITR.
2. The rAAV according to claim 1, wherein the coding ce for the anti-VEGF Fab heavy immunoglobulin chain encodes the amino acid sequence of SEQ ID NO: 1 and the coding sequence for the anti-VEGF Fab light immunoglobulin chain encodes the amino acid sequence of SEQ ID NO:2.
3. The rAAV according to claim 1 or claim 2, wherein the regulatory elements further se a UTR sequence.
4. The rAAV according to any one of claims 1 to 3, wherein the coding sequence for the anti-VEGF Fab heavy chain (HC) and light chain (LC) variable regions of a VEGFv3 comprises nucleotides (nt) 1842 to 2210 for SEQ ID NO: 19 for HC variable region and nt 2679 to 2999 of SEQ ID NO: 19 for the LC le region.
5. The rAAV according to any one of claims 1 to 3, wherein the coding sequences for the anti-VEGF Fab heavy chain (HC) and light chain (LC) variable regions are selected from a group consisting of: (a) aVEGFv1 (nucleotides (nt) 1843 to 2211 of SEQ ID NO: 24 for the HC variable region and nt 2680 to 3000 of SEQ ID NO: 24 for the LC variable region); (b) aVEGFv2 (nt 2059 to 2427 of SEQ ID NO: 3 for the HC variable region and nt 2896 to 3216 of SEQ ID NO: 3 for the LC variable region); (c) aVEGFv4 (nt 2053 to 2421 of SEQ ID NO: 35 for the HC variable region, and nt 2890 to 3210 of SEQ ID NO: 35 for the LC variable ); (d) aVEGFv5 (nt 2053 to 2421 of SEQ ID NO: 36 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 36 for the LC variable region); (e) aVEGFv6 (nt 2053 to 2421 of SEQ ID NO: 37 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 37 for the LC variable region); (f) aVEGFv7 (nt 2053 to 2421 of SEQ ID NO: 38 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 38 for the LC variable region); (g) aVEGFv8 (nt 2053 to 2421 of SEQ ID NO: 39 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 39 for the LC le region); (h) aVEGF v9 (nt 2059 to 2427 of SEQ ID NO: 40 for the HC variable region and nt 2896 to 3216 of SEQ ID NO: 40 for the LC variable ); (i) aVEGFv10 (nt 2053 to 2421 of SEQ ID NO: 41 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 41 for the LC variable region); (j) aVEGFv11 (nt 2053 to 2421 of SEQ ID NO: 42 for the HC le region and nt 2890 to 3210 of SEQ ID NO: 42 for the LC variable region); (k) aVEGFv12 (nt 2053 to 2421 of SEQ ID NO: 43 for the HC variable region and nt 2890 to 3210 of SEQ ID NO: 43 for the LC variable region); or (l) aVEGFv13 nt 2053 to 2421 of (SEQ ID NO: 44 for the HC le region and nt 2890 to 3210 of SEQ ID NO: 44 for the LC variable region).
6. A recombinant adeno-associated virus (rAAV) having an AAV8 capsid according to claim 1 which is suitable for administration to an eye, wherein the rAAV comprises a vector genome packaged within the AAV8 , said vector comprising ITR-CB7-CI-aVEGFv3-rBGITR (SEQ ID NO: 14).
7. A recombinant adeno-associated virus (rAAV) having an AAV8 capsid according to claim 1 which is suitable for administration to an eye, wherein the rAAV comprises a vector genome packaged within the AAV8 capsid, said vector genome selected from the group consisting of: (a) ITR-CB7-CI-aVEGFv2-rBG-ITR (SEQ ID NO: 3); (b) ITR-CB7.CI.aVEGFv4.rBG-ITR (SEQ ID NO: 35); (c) ITR-CB7.CI.aVEGFv5.rBG-ITR (SEQ ID NO: 36); (d)ITR-CB7.CI.aVEGFv6.rBG- ITR (SEQ ID NO: 37); (e) ITR-CB7.CI.aVEGFv7.rBG- ITR (SEQ ID NO: 38); (f) ITR-CB7.CI.aVEGFv8.rBG- ITR (SEQ ID NO: 39); (g) ITR-CB7.CI.aVEGFv9.rBG- ITR (SEQ ID NO: 40); (h) ITR-CB7.CI.aVEGFv10.rBG- ITR (SEQ ID NO: 41); (i) ITR-CB7.CI.aVEGFv11.rBG- ITR (SEQ ID NO: 42); (j) ITR-CB7.CI.aVEGFv13.rBG- ITR (SEQ ID NO: 43); or (k) ITR-CB7.CI.aVEGFv14.rBG- ITR (SEQ ID NO: 44);
8. A formulation comprising an effective amount of inant adeno-associated virus (rAAV) according to any one of claims 1 to 5 suspended in an aqueous solution, and optionally buffered saline with a surfactant and/or other ents.
9. A liquid suspension for or suitable for administration to an eye, said liquid suspension comprising an aqueous liquid and recombinant adeno-associated virus (rAAV) according to any one of claims 1 to 7 and optionally one or more excipients, vatives, and/or surfactants.
10. A recombinant adeno-associated virus (rAAV) according to any one of claims 1 to 7 or a liquid sion according to claim 9 in a formulation for administration subretinally to a patient.
11. The rAAV according to claim 10, the formulation according to claim 8, or the liquid suspension according to claim 9, wherein said patient has wet age-related macular ration.
12. Use of an rAAV according to any one of claims 1 to 7 or a liquid suspension according to claim 9 in the preparation of a medicament for administration to an eye of a patient, optionally n the t has wet age-related macular degeneration.
13. The use according to claim 12, wherein the injection comprises rAAV at a dose of 1 x 108 genome copies (GC) per eye to 1.5 x 1012 GC per eye, wherein GC is as determined using digital droplet PCR.
14. The use according to claim 13, wherein the ion comprises rAAV at a dose of 5 x 108 GC/eye to 2 x 1011 GC/eye, or wherein the injection comprises rAAV at a dose 7 x 109 GC/eye to 2 x 1010 GC/eye.
15. The use according to any one of claims 12 to 14, wherein the rAAV are delivered in a volume of 10 µL to 300 µL of the suspension, 75 µL to 150 µL of the suspension, or wherein the rAAV are to be delivered in a volume of 100 µL of the sion.
16. A product comprising: (a) a first container comprising an rAAV according to any one of claims 1 to 3 and an aqueous , and optionally sing a second container comprising (b) a diluent, and (c) a needle for injection.
17. A recombinant nucleic acid molecule comprising an expression cassette comprising a coding sequence for an anti-human vascular endothelial growth factor (VEGF) antigen binding antibody fragment (Fab) (anti-VEGF Fab) under the control of regulatory elements which l expression f, wherein the expression cassette is flanked by an AAV5' inverted terminal repeat (ITR) and an AAV3' ITR at its 5' end and its 3' ends, respectively, wherein the coding sequence for the anti-VEGF Fab comprises a heavy immunoglobulin chain having an IL-2 leader sequence and comprising variable region of aVEGFv3 (nt 1842 to 2210 for SEQ ID NO: 19), an F2A linker, and a light immunoglobulin chain having an IL-2 leader sequence and comprising variable region of aVEGFv3 (nt 2679 to 2999 of SEQ ID NO: 19), and wherein the regulatory elements se a cytomegalovirus immediate early (CMV IE) enhancer, a n beta actin promoter, a chicken beta actin intron, and a rabbit beta globin enylation ) signal.
18. The recombinant nucleic acid molecule according to claim 17, wherein the CMV IE enhancer and chicken beta actin promoter has a sequence of nucleotides 198 to 862 of SEQ ID NO: 14.
19. The recombinant nucleic acid molecule according to claim 17, wherein the chicken beta actin intron has a sequence of nucleotides 956 to 1928 of SEQ ID NO: 14.
20. The inant c acid molecule according to claim 17, wherein the F2A linker has a sequence of nucleotides 2758 to 2829 SEQ ID NO: 14, and wherein the IL2 leader sequence has a sequence of nucleotides 1993 to 2052 of SEQ ID NO: 14.
21. The inant nucleic acid molecule according to claim 17, wherein the regulatory elements further comprise a UTR sequence.
22. The recombinant nucleic acid molecule according to claim 21, wherein the UTR sequence has a ce of nucleotides 1940 to 1987 of SEQ ID NO: 14.
23. The recombinant nucleic acid molecule according to any one of claims 17 to 22, wherein the coding ce for the anti-VEGF Fab comprises heavy chain (HC) comprising nucleotides 2053 to 2742 having an exogenous leader comprising nucleotides 1993 to 2052 of SEQ ID NO: 14, and light chain (LC) comprising nucleotides 2890 to 3531 of SEQ ID NO: 14 having an exogenous leader comprising nucleotides 2830 to 2889 of SEQ ID NO: 14.
24. The recombinant nucleic acid molecule according to any one of claims 17 to 23, wherein the expression cassette comprises the contiguous nucleotides 198 to 3733 of SEQ ID NO: 14.
25. A recombinant nucleic acid molecule comprising ITR-CB7-CI-aVEGFv3-rBGITR (SEQ ID NO: 14).
26. A plasmid comprising the recombinant nucleic acid molecule according to any one of claims 17 to 25.
27. An in vitro host cell sing the recombinant nucleic acid molecule ing to any one of claims 17 to 25 or the d according to claim 26.
28. The in vitro host cell according to claim 27, wherein the cell is a prokaryotic cell.
29. The in vitro host cell according to claim 27, wherein the cell is a mammalian cell.
30. The in vitro host cell according to claim 29, wherein the ian cell is a HEK293 cell.
31. An isolated packaging host cell comprising (a) the expression cassette of any one of claims 17-25 or the plasmid of claim 25; (b) a recombinant nucleic acid molecule encoding an AAV rep protein; (c) a inant nucleic acid molecule encoding an AAV capsid protein; and (d) sufficient helper sequences to package the expression cassette into the AAV .
32. The isolated packaging host cell according to claim 31, wherein the cell is a mammalian cell.
33. The isolated packaging host cell according to claim 32, wherein the mammalian cell is a HEK293 cell.
34. A method for producing recombinant adeno-associated virus (rAAV) particles in an isolated packaging host cells comprising culturing the isolated ing host cells of any one of claims 31 to 33, wherein the isolated packaging host cells express rep and capsid proteins and package the expression te into assembled capsid to produce the rAAV particles. WM inim “ ~ ~~ ~ §‘ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ : x , \\\\\\\\\\\\\\\\\\
NZ746729A 2016-04-15 2017-04-14 Compositions for treatment of wet age-related macular degeneration NZ746729B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NZ787256A NZ787256A (en) 2016-04-15 2017-04-14 Compositions For Treatment of Wet Age-Related Macular Degeneration

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201662323184P 2016-04-15 2016-04-15
US201662331100P 2016-05-03 2016-05-03
US201762442946P 2017-01-05 2017-01-05
US201762460515P 2017-02-17 2017-02-17
US201762466721P 2017-03-03 2017-03-03
PCT/US2017/027529 WO2017180936A1 (en) 2016-04-15 2017-04-14 Compositions for treatment of wet age-related macular degeneration

Publications (2)

Publication Number Publication Date
NZ746729A NZ746729A (en) 2023-08-25
NZ746729B2 true NZ746729B2 (en) 2023-11-28

Family

ID=

Similar Documents

Publication Publication Date Title
US20220288238A1 (en) Compositions for treatment of wet age-related macular degeneration
US20210093734A1 (en) Compositions for treatment of wet age-realted macular degeneration
US20220111015A1 (en) Treatment of ocular neovascularization using anti-vegf proteins
US20180353614A1 (en) VE-PTP Extracellular Domain Antibodies Delivered by a Gene Therapy Vector
CN113966236A (en) Gene therapy for ocular conditions
KR20190038536A (en) Compositions and methods for reducing ocular angiogenesis
JP2021513355A (en) Non-viral DNA vectors, as well as their use for the production of antibodies and fusion proteins
US20230295243A1 (en) Composition and method for treating eye diseases
NZ746729B2 (en) Compositions for treatment of wet age-related macular degeneration
NZ787256A (en) Compositions For Treatment of Wet Age-Related Macular Degeneration
NZ787237A (en) Compositions For Treatment of Wet Age-Related Macular Degeneration
TW202235618A (en) Treatments for intraocular pressure related disorders
CN117535299A (en) Isolated nucleic acid molecules, recombinant viruses or uses thereof