NL2019739B1 - Means and methods for treating muscle degeneration - Google Patents

Abstract

The present invention relates to the use of an agent that inhibits POH1 to treat a patient suffering from or at risk of developing muscle degeneration. The invention arises from the discovery that POH1 regulates PABPN1 protein and thus opens the opportunity to treat diseases or conditions mediated by aberrant or reduced PABPN1 levels, such as muscle degeneration. The invention also relates to methods for selecting a patient for treatment with a POH1 inhibitor.

Description

Means and methods for treating muscle degeneration

The invention relates to the field of treating muscle wasting and other neuromuscular diseases (NMDs), such as oculopharyngeal muscular dystrophy (OPMD), in subjects in need thereof, particularly adults. The invention also relates to the use of compounds for the treatment of muscle degeneration/wasting. The invention also relates to methods for upregulatlng PABPN1 in a cell, in particular a muscle cell, comprising contacting the cell with an agent that inhibits P0H1 gene or POH1 protein. The invention also relates to screening methods to identify putative agents to treat muscle degeneration/wasting (via POH1 Inhibition). The invention also relates to methods for selecting patients suffering from or likely to suffer from muscle deterioration for treatment with a POH1 inhibitor. The methods and medical uses are particularly suited to the treatment of sarcopenia and adult muscular dystrophies such as OPMD.

Proper protein turnover and protein homeostasis are crucial for maintaining cellular integrity. Imbalance of protein homeostasis leading to an increase in protein aggregation Is among the cellular signatures of aging (Ben-Zvl et al. Hum Mol Genet. 13: 829-838, 2009; Lindner & Demarez Biochimica et Biophysica Acta - General Subjects. 1790: 980-996, 2009; and David ef ai. PLoS biology. 8:e 1000450, 201Ö). Protein aggregation characterizes a large spectrum of late-onset neuromuscular degenerative disorders, such as Alzheimer's disease, Huntington's, Parkinson’s disease and OPMD. In these disorders, mlsfolded proteins accumulate in nuclear inclusions or insoluble inclusions (Bingol & Sheng. Neuron. 69:22-32, 2011).

Aging associated muscle wasting, such as sarcopenia, affects mobility, stability and metabolic homeostasis. Muscle wasting is characterized by multiple pathological features including: myofiber atrophy, alterations in myofibertype, thickening of the extracellular matrix (ECM), central nucleation and fatty infiltration, which are regulated by multiple network regulatory pathways (López-Otin et al., Cell 153:1194-1217, 2013). Muscle atrophy, referring to a disease in muscle mass together with a net loss of protein homeostasis, is an important characteristic of aging-associated muscle wasting and muscular dystrophies, like OPMD (Lexell, J. Gerontology Ser. A Biol. Sci. Med. Sci. 6:11-16, 1995).

Muscle aging is associated with genome-wide changes in mRNA expression levels, in part regulated by poly(A)-binding protein 1 (PABPN1). PABPN1 levels reduce from midlife onwards in skeletal muscles and reduced PABPN1 levels correlate with muscle weakness in OPMD (Anvar et al., Aging. 5: 412, 2013).

Riaz, M. et al., (PLoS Genet. 12:1-19, 2016) demonstrated that a muscle-specific reduction in PABPN1 causes myofiber atrophy and the hallmarks of muscle wasting: myofiber type transitions, ECM thickening and altered proteasomal activity.

Several molecular machineries affect aging-associated muscle wasting including regulation of gene expression via mRNA processing (Llorian and Smith, Curr Opin Genet Dev 21, 380-387, 2011).

Messenger RNA processing is regulated by a dynamic protein complex amongst which PABPN1 plays a key role. PABPN1 is a multifunctional regulator of mRNA processing; PABPN1 regulates poly(A) tail length (Benoit et al. Developmental Cell 9 (4): 511-522, 2005), alternative polyadenylation site (APA) in the 3'-UTR of the transcripts (de Klerk et al., Nucleic acids research 40:9089-9101, 2012; Jenal et al., Cell 149:538-553, 2012), internal APA (Abbassi-Daloii, T. et al., Aging Meeh. Dis. 1-8, 2017; Li et al., PLoS Genet 11, el005166, 2015) and mRNA decay (Bergeron et al., Molecular and Cellular Biology 35:2503-2517, 2015).

Muscular dystrophy (MD) is a group of muscle disorders which result in the weakening and breakdown of skeletal muscles over time. These disorders are caused by mutations in genes involved in making muscle proteins and the mutations are either inherited from one or both parents or they arise in early development. In certain disorders the onset of disease is late in life (e.g. after age 20, sometimes after 40 or 60), and so may be termed age-related MD or adult MD. Despite a germline mutation and ubiquitous rtvnrnrci flnn mi ifnnt· παπλ γαι icrln u/nol/nnrr nnrJ Ά hrncic cfnH· nrth/ riiiririrr 1

Examples of age-related MD include: Oculopharyngeal muscular dystrophy (OPMD), Myotonic dystrophy (MD), Facioscapulohumeral muscular dystrophy (FSHD) and Becker muscular dystrophy (Becker).

In addition to those adult disorders where muscle fibrosis is the main feature, loss of muscle mass is a common pathological feature in many adult muscle diseases.

Muscle mass loss can be a consequence of autoimmune diseases like AchR and MuSK myasthenia gravis, muscle denervation or neuronal dysfunction (inherited [SMA] as acquired [e.g. paraplegia]) or muscle disuse (e.g. cast). (Shieh. Neurol Clin. 31(4):1009-10029, 2013).

Myotonic dystrophies (DM) are dominantly-inherited genetic disorder affecting skeletal muscle, heart, brain, and other organs. DM type 1 is caused by expansion of a CTG triplet repeat In DMPK, whereas DM type 2 is caused by expansion of a CCT6 tetramer repeat in CN8P. in both cases the DM mutations lead to expression of dominant-acting RNAs (see Thornton et al., Current Opinion in Genetics and Development. 44:135-140, 2017).

Facioscapulohumeral muscular dystrophy (FSHD) is a clinically recognizable and relatively common muscular dystrophy. It is Inherited mostly as an autosomal dominant disease or in a minority of cases, in a digenic pattern (see Wang and Tawil. Current Neurology and Neuroscience Reports. 16:66, 2016).

Becker muscular dystrophy (Becker) and other muscular dystrophies are described in Shieh (Neurol Clin, 31(4), 2013). OPMD is a late-onset autosomal dominant myopathy characterized by muscle weakness, initially specific skeletal muscles are affected, including the eyelids, pharyngeal muscles and limb muscles (Brais et al., Nat Genet 18:164-167, 1998). The OPMD transcriptome predominantly clusters with muscle aging expression profiles (Anvar et al., Aging (Albany NY) 5:412-426, 2013), suggesting that OPMD is a paradigm for accelerated c· ra rArtnartio ID ·*»τ> Dra-» CrAnf Arrtrvrt Moi irrtCrt *7 ΟΑΊ/lA ΓΛΟΙί/ΙΓΥ ie /•kopa/'föpicö/l Ιλ\/ ptosis, dysphagia and proximal limb muscle weakness that typically appears in the 5th decade (Brais et al., Current Neurology and Neuroscience Reports. 9:76-82, 2009).

Molecular signals of OPMD muscles are similar to those of normally aged muscles, although expression trends progress faster in OPMD. In aging muscles and in OPMD muscles the levels of functional Poly A Binding Nuclear 1 (PABPN1) are reduced compared with controls or young. A poly-alanine repeat expansion mutation in the PABPN1 gene is the underlying genetic cause of OPMD (Brais et al., Nat Genet 18164-167,1998). PABPN1 is a multifunctional regulator of mRNA processing: it controls the length of the poly(A) tails at the 3'UTR of mRNAs, it regulates alternative polyadenylation site (PAS) utilization at the introns and 3'UTR in half of eukaryotic mRNAs. In addition, it regulates poly(A) tail length affecting mRNA nuclear export and mRNA decay in the cytoplasm (Li et al., PLOS Genetics 11(4):1-28, 2015; and, de Klerk et al., Nucleic acids Research 40:9089-9101, 2012).

The expansion mutation in PABPN1, results in an extended polyalanine tract, from 10 alanines to 12-18 alanines, in the N-terminus of the PABPN1 protein (expPABPNl) and is an insoluble form of PABPN1 which forms intranuclear aggregates, resulting in reduced levels of functionally available PABPN1. These aggregates are found in muscles from both OPMD patients and presymptomatic carriers of the PABPN1 mutation, and therefore in affected and nonaffected disease stages.

Recently, it was demonstrated that a reduction of PABPN1 levels in mouse muscles led to muscle pathology including muscle atrophy (Anvar, S. Y. et al., Skelet. Muscle 1:15, 2011).

Furthermore, elevation of wild type PABPN1 levels and replacement of expanded PABPN1 with the wild type genes in the OPMD mouse model restored muscle function (Malerba, A. et al., Nat. Commun. 8:1-14, 2017).

The ubiquitin-proteasome system (UPS), among the cellular machineries, regulates muscle atrophy. (Rang Cao, P., et al., I nt. J. Biochem. Cell Biol. 37:2088-2097, 2005; Sandri, M. Int. J. Biochem. Cell Biol. 45:2121-2129, 2013; and, Attaix, D. et al., Biochem. Soc. 41:173-186, 2005). The UPS regulates protein turnover: proteins are subjected to degradation by the 26S proteasome after attachment of a polyubiquitin chain to the protein. Ubiquitination is carried out by three sequential enzymatic reactions by the ubiquitin activating enzyme (El), the ubiquitin-conjugating enzyme (E2) and the ubiquitin ligase (E3). El and E2 prepare ubiquitin for conjugation, E3 conjugates the activated ubiquitin to the protein. There are thousands of E3 proteins available in the cell but only one El protein and a dozen E2 proteins, therefore E3 is the component of the ubiquitination process that brings protein specificity to the system (Stein TP, et al., Curr Opin Clin Nutr Metab Care.9:395-402, 2006). After the process of ubiquitination, the ubiquitin-tagged protein is recognized by deubiquitinating enzymes (DUBs) which remove the ubiquitin chain. Some specific DUBs are part of the 19S proteasome cup, which is connected to the 20S core catalytic particle of the proteasome, where proteolysis takes place.

Ubiquitin-mediated protein degradation is a major mechanism for regulation of essentially every cellular function. The deubiquitinating enzymes (DUBs), which cleave ubiquitin-protein bonds, constitute the largest class of enzyme in the deubiquitin-mediated proteolysis pathway. The DUB PÖH1 (and its yeast homolog RPN11) is a metalloprotease and is thought to facilitate proteolysis by removing ubiquitin from targeted substrates prior to proteasome entry. in the art, POH1 is also known as PSMD14.

SUMMARY OF THE INVENTION

As described further herein, the inventor has found that the deubiquitinase POH1 is a regulator of muscle cell biology and it regulates PABPN1 levels and that PABPN1 regulates POH1 mRNA. The expression of both proteins is maintained via interplay between both mRNA stability and protein turnover regulatory machineries operating In a feed-

mm 4 *5 •Tt-i-f-.'Tti-fr •’ïZ'-i-kisft/ in mi iCi-Lct Ζ'λΒγ CGto-L proteasome activity leads to increased protein accumulation, in muscles with reduced PABPN1 levels PÖH1 levels increase and proteasome activity decreases. The inventor has surprisingly found that inhibition of POH1 leads to PABPN1 upregulation and an enhancement in myogenesis, thus a compound which inhibits POH1 is useful in the treatment of a disease or disorder or condition associated with reduced PABPN1 in muscle cells. In a mouse model with muscle-specific reduction of PABPN1 (shPab) the inventor found histological features of muscle regeneration and atrophy. In another model with reduced/inactivated pohl gene, features of myogenesis were observed in muscle tissue.

The causative link between a decrease in PÖH1 and an increase in PASPN1 opens the opportunity to increase the amount of PABPN1 in a cell in need thereof, and to treat diseases, disorders or conditions mediated by PABPN1, such as muscle degeneration, by targeting POH1.

The invention provides a method for increasingthe level of PABPN1 protein in a cell, in particular in the nucleus of the cell, said method comprising inhibiting POH1 in said cell.

The invention further provides a method for inhibiting a molecular effect of aging in a cell, said method comprising decreasing the level of POH1 protein or activity of PÖH1 protein in said cell.

Also provided is a method for modifying a molecular effect of aging in a cell said method comprising providing the cell with an antisense oligonucleotide that is complementary to and capable of hybridizing to mRNA encoded by the gene P0H1.

The invention also provides an isolated oligonucleotide having 12-40 bases, wherein the oligonucleotide comprises a continuous stretch of at least 7 bases that is complementary to and capable of hybridizing to a continuous stretch of at least 7 bases that is complementary to and capable of hybridizing to POH1 mRNA.

The invention further provides a compound for increasing the level of PABPN1 nm-totA !>a -< z'.'rtH fzxr jjc/Tt infk.A imAhrmon·!· At jrxi'ikr sr4j s 8 r swur γΙα degeneration, in one embodiment, the individual is suffering from sarcopenia, Oculopharyngeal muscular dystrophy (OPMD), Myotonic dystrophy (DM), Pacioscapuiohumerai muscular dystrophy (FSHD), Becker muscufar dystrophy (Becker), Alzheimer's, Parkinson's, autoimmune diseases like AchR and MuSK myasthenia gravis, muscle denervation or neuronal dysfunction. In a preferred embodiment, the individual is suffering from sarcopenia.

The invention further provides a method for the treatment of an individual suffering from an age-related degenerative disease or condition comprising administering to the individual in need thereof a compound that decrease the level of PGH1 protein in a ceil or the activity of POH1 protein in the cell. In a particular embodiment, the age related degenerative disease is a neurodegenerative disease. In particular embodiments, the disease is oculopharyngeal muscular dystrophy (OPMD), myotonic dystrophy (DM), facioscapulohumeral muscular dystrophy (FSHD), Becker muscular dystrophy (Becker), Alzheimer's, Parkinson's, autoimmune diseases like AchR and MuSK myasthenia gravis, muscle denervation or neuronal dysfunction. In one embodiment, the condition is sarcopenia. in other embodiments, the compound is selected from an antibody or an RNAi molecule capable of hybridizing to POH1 mRNA produced by said cell.

DETAILED DESCRIPTION OF THE INVENTION

According to a first aspect of the invention there is provided a method for increasing the amount of PABPN1 protein in a cell comprising contacting the cell with an agent that inhibits POH1.

In one embodiment, the cell is a muscle cell. Examples of muscle cells are card io myocytes, smooth muscle cells, vascular muscle cells, skeletal muscles or myotubes.

In another embodiment, the method is for increasing the amount of PABPN1 in the nucleus of the cell.

As used herein an agent that inhibits POH1 is also referred to as a POH1 inhibitor. I rv jrötHhriir» fkö jprtmnAi rvr -arrevrvf* ic· -v il-viru iifi r\-^+-1 rvr\ iftki

As used herein, the term "inhibit" refer to reducing or stopping the amount of or activity of the protein, e.g. POH1. For example, an inhibitor of POH1 may affect the amount of POH1 protein produced by the cell, e.g. by targeting the transcription or translation of the protein in the cell. Alternatively, it may affect the activity of the protein, e.g. by preventing the protein from forming a complex or catalysing a reaction e.g. deubiquitination, phosphorylation etc., such that the aforementioned amount of protein or ievel of activity of the protein is less than that observed in the absence of the inhibiting compound (e.g. inhibitor). Inhibition may be reversible or irreversible.

According to one aspect of the invention there is provided a method for increasing myotubule formation in a muscle cell comprising contacting the cell with an agent that inhibits POH1. In one embodiment, the method is performed in vitro. in particular embodiments, the cell is a cell of an animal, preferably of a mammal or a bird. In a particular embodiment, the cell is a primate cell, preferably a human cell.

In one embodiment, the POH1 inhibitor causes an increase in the amount of PABPN1 protein in the nucleus of the cell.

In another embodiment, the method is performed in vitro.

In other embodiments, the agent that inhibits POH1 can be a small molecule compound or a large molecule biologic.

As used herein, the terms "compound" and "agent" are used interchangeably.

In another embodiment, the agent that inhibits POH1 is specific for POH1. Specific in the sense that the agent does not significantly inhibit other DUB proteins.

In one embodiment, the agent that inhibits POH1 is a nucleic acid molecule capable of inhibiting mRNA of POH1. In one embodiment, the agent that inhibits POH1 is an antibody molecule that binds to POH1 protein.

The human and mouse gene and protein sequences for PABPN1 and POHl/psmdl4 sequences are known and available from various gene sequence databases such as Ensembl, GenBank, and UniProt.

Human PABPN1 sequences are available from UniProtKB under identifier: Q86U42 (SEQ ID NO: 4). A representative human gene sequence is found in Ensembl under accession number: NM_004643 (SEQ ID NO: 6). The mouse PABPN1 sequences are available from UniProtKB under identifier Q8CCS6. A representative mouse gene sequence is found in Ensembl under accession number: NM_019402.2 (SEQ ID NO: 9).

The human POH1/PSMD14 sequences are available from UniProtKB under identifier: 000487 (SEQ ID NO: 5). A representative human gene sequence is found in Genbank under accession number: NM_005805 (SEQ ID NO:7). The mouse POH1/PSMD14 sequences are available from UniProtKB under identifier 035593. A representative mouse gene sequence is found in Ensemble under accession number NM_021526.2 (SEQ ID N0:8).

As used herein the terms antibody and antibody molecule includes a derivative of an antibody, such as scFV, HCAbs, Fah and VHH molecules, and the like. The antibody molecule is preferably one that neutralizes the activity of P0H1. In one embodiment, the antibody molecule is an intracellular antibody. In other embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is an antibody-derived molecule, such as one selected from a Fab, ScFv, HcABs or VHH antibody. The antibody molecule may be provided to the cell by means of a nucleic acid delivery vehicle comprising one or more nucleic acids encoding said antibody molecule. Intracellular antibody molecules thereof may be provided to the cell by means of said gene delivery vehicle. In another embodiment said P0H1 inhibitor is an RNA inhibitor. Presently there are many different RNA molecules that can inhibit translation of an mRNA and/or decrease the stability of the RNA, The RNA inhibitor is preferably an RNAi molecule specific for POHl; shRNA molecule specific for P0H1 mRNA; or an antisense oligonucleotide (AON) specific for P0H1 mRNA.

In other embodiments, the agent that inhibits POH1 is a nucleic acid or peptide-based aptamer.

Antibody and RNAi technologies are suitably advanced that the person skilled in the art would be able to make an antibody or antibody-derived molecule or an RNAi molecule that could inhibit POH1.

According to particular embodiments, the agent that inhibits POH1 is selected from the group consisting of small interfering RNAs (siRNAs), nucleic acid aptamers, small moiecuies, inorganic compounds, peptide aptamers, antibodies, such as Fab, scFV, VHH, natural single domain antibodies, nanobodies, afflbodies, affibody-antibody chimeras, heavy-chain only antibodies (HCAbs) and non-immunoglobulins. Certain of these agents are discussed in Muyldermans (Ann Rev Biochem, 82:775-797, 2013). Functional Inhibitor agents can be identified on the basis of their ability to induce a down-regulation or inhibition of gene expression and/or down- regulation or Inhibition of the activity of a transcriptional or translational product thereof (i.e. POH1/POH1). The expression is for example reduced or down-reguiated to less than 90%, such as less than 80% such as less than 70% for example less than 60%, for example less than 50%, such as less than 40%, such as less than 30% such as less than 20% for example less than 10%, for example less than 5%, such as completely Inhibited (0%) relative to the expression or activity in the absence of the agent that Inhibits POH1.

According to another aspect of the invention there is provided a method of treating a patient suffering from or at risk of developing muscle degeneration comprising administering to the patient an effective amount of an agent that inhibits POH1.

Muscle degeneration, also referred to herein as muscle wasting, muscle atrophy or muscle fibrosis, is characterized by multiple pathological features including: atrophy, trv nf'tka- /S'Wtr.Wöih itar rtnoTriv /CT'KAV /'zsrx+r'sl ηι ιγΙλ'ϊΙ-ιλα split myofibers and fatty infiltration, and is in effect a decrease in the mass and strength of the muscle. Muscular dystrophy Is a group of inherited diseases that are characterized by weakness and wasting away of muscle tissue, with or without the breakdown of nerve tissue.

According to another aspect of the invention there is provided a method of treating a patient suffering from or at risk of developing muscle degeneration comprising administering to the patient an effective amount of an agent that indirectly increases the amount of PABPN1 in the cell, wherein the agent is one that inhibits POH1.

According to another aspect of the invention there is provided a method of treating a patient suffering from or at risk of developing muscle degeneration comprising administering to the patient an effective amount of an agent that increases the amount of PABPN1 in the cell, wherein said agent is one that inhibits POH1.

According to another aspect of the invention there is provided a method of treating a patient whose muscle cells have reduced levels of PABPN1 relative to control or normal cells comprising administering to the patient an effective amount of an agent that inhibits POH1.

In preferred embodiments, administration of the agent results in an increase in PABPN1 in the nucleus of the cell, in particular in a muscle cell.

The muscle degeneration may be due to a muscular dystrophy or sarcopenia. The muscle degeneration may be associated with other neurodegenerative diseases such as Parkinson's and Alzheimer's. In particular embodiments, the muscle degeneration is age-related, by which is meant arises later in life, such as after childhood. This type of muscle degeneration is termed age-related muscle degeneration and includes muscle degeneration seen in old age (typically after age 70), like sarcopenia, or in muscular dystrophies like OPMD, Becker, DM and FSHD where the muscle degeneration occurs later in life, typically during adulthood.

The inventor has found that inhibition of POH1 leads to an increase in the amount of PABPNl, particularly in the nucleus, and an increase in myogenesis in muscle cells. This Increase in PABPNl may he due to reduced breakdown of PABPNl protein by the proteasome due to there being less or no POH1.

Thus, according to a further aspect of the invention there is provided a method of reducing the amount of PABPNl breakdown/degradation in a cell comprising contacting the cell with an agent that inhibits POH1.

Thus, according to another aspect of the invention there is provided a method for increasing myogenesis in muscle cells in a patient in need thereof comprising administering to the patient an effective amount of an agent that inhibits POH1.

In one embodiment, the myogenesis is increased muscle cell fusion or myotubule formation.

Aberrant PABPN1 protein levels, particularly in the muscle cell nucleus, are known to be involved in muscle degeneration and reduced myogenesis. Thus, therapeutic or prophylactic agents that can regulate PABPNl protein levels could be useful in the treatment of diseases or disorders or conditions that are mediated by PABPNl.

Thus, according to another aspect of the invention there is provided a method of treating a patient suffering from a PABPNl-mediated disease, disorder or condition comprising administering to the patient an effective amount of an agent that inhibits POH1.

In particular embodiments, the PABPNl-mediated disease is a muscular dystrophy, such as one selected from OPMD, Becker, DM and FSHD.

In one embodiment, the PABPNl-mediated condition is sarcopenia.

In one embodiment, the POH1 inhibitor reduces the amount of PABPNl protein in fkn rv> irdzsj flnn roll

In particular embodiments, the agent that inhibits POH1 is a small molecule compound or a large molecule biologic.

In another embodiment, the agent that inhibits POH1 is specific for POH1. Specific in the sense that the agent does not significantly inhibit other DUB proteins.

In one embodiment, the agent that inhibits POH1 is a nucleic acid molecule capable of inhibiting mRNA of P0H1. In one embodiment, the agent that inhibits POH1 is an antibody molecule that binds to POH1 protein.

The antibody is preferably an antibody that neutralizes the activity of POH1. in a one embodiment said antibody is an intracellular antibody. In another embodiment said antibody is a monoclonal antibody. In other embodiments, said antibody is an antibody-derived molecule such as a Fab, ScFv or VHH antibody. The antibody may be provided to the cell by means of a nucleic add delivery vehicle comprising one or more nucleic acids encoding said antibody, or derivative thereof. Intracellular antibodies may be provided to the cell by means of said gene delivery vehicle.

In another embodiment said PGH1 Inhibitor is an RNA inhibitor. Presently there are many different RNA molecules that can inhibit translation of an mRNA and/or decrease the stability of the RNA. The RNA inhibitor is preferably an RNAI molecule specific for POH1; shRNA molecule specific for POH1 mRNA; or an antisense oligonucleotide (AON) specific for POH1 mRNA. In this context, specific means that the molecule does not significantly binds to any other mRNA,

Examples of two RNAI molecules that can inhibit P0H1 mRNA are disclosed in Example 5 (AON_14,1 and AQN__14.2; see Table 1). In particular embodiments, the RNAi molecule for use in one of the aspects of the present, invention consists of or comprises SEQ. ID NO; 2 or SEQ ID NO; 3.

As used herein, the terms "antibody" and "antibodies", also known as immunoglobulins, refers to a polypeptide or group of polypeptides that are comprised of at least one binding domain that is formed from the folding of polypeptide chains having three-dimensional binding spaces with internal surface shapes and charge distributions complementary to the features of an antigenic determinant of an antigen, and encompasses monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies formed from at least two different epitope binding fragments (e.g., bispecific antibodies), human antibodies, humanized antibodies, camelid antibodies, chimeric antibodies, single-chain Fvs (scFv), single-chain antibodies, single domain antibodies, domain antibodies, VHH, Fab fragments, F(ab')2 fragments, antibody fragments that exhibit the desired biological activity (e.g. the antigen binding portion), disulfide-linked Fvs (dsFv), and anti-idiotypic (anti-id) antibodies (including, e.g., anti-id antibodies to antibodies of the invention), intrabodies, and epitope-binding fragments of any of the above. Various methods are available in the art for obtaining an antibody molecule against POH1. For example, monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma (Kohler et al., Nature, 256:495 (1975); Harlow eta/., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981), recombinant, and phage display technologies, or a combination thereof. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous or isolated antibodies, e.g., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site or muftiple antigenic sites in the case of multi-specific engineered antibodies.

Antibody technologies are suitably advanced that the person skilled in the art would be able to make an antibody molecule that could inhibit POH1.

Nucleic acid oligomeric compounds are another class of therapeutic compounds that can be used to inhibit POH1, by targeting the POH1 gene product, especially POH1 rwDAÈA s* /'/'vfYyt-vr'vi i-Ly-yi' szirx tzsrsz'zsc' -nt” liTi-ncF r» nrHctiiv complementary to a target nucleic acid have been shown to alter the function and activity of the target both in vitro and in vivo. When delivered to a cell containing a target nucleic acid (such as mRNA), oligomeric compounds have been shown to modulate the expression of the target resulting in altered transcription or translation of the target nucleic acid. In certain instances, the oligomeric compound can reduce the expression of the gene by inhibiting the nucleic acid target and/or triggering the degradation of the target nucleic acid. An example of such nucleic acid oligomeric compounds is the aptamer, a class of high-affinity nucleic acid ligands that specifically bind a desired target molecule (see U.S. Pat, No. 5.475.096). Aptamer technology started in the early 1990s and has advanced to the stage where therapeutics have now been approved (e.g. FDA approved pegaptantb for age-related macular degeneration in 2004). The person skilled in the art would be able to design a nucleic acid or peptide-based aptamer against POH1.

If the target nucleic acid is mRNA, one mechanism by which an expression-inhibiting oligomeric compound can modulate the expression of the mRNA target is through RNA interference. RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (e.g, Zamore et al., Cell, 101:25-33, 2000; Fire et al.. Nature. 331:806,1998; Hamilton et al., Science. 286:950-951,1999; Lin et al., Nature. 402:128-129,1999; and Elbashir et ah, Nature. 411:494-98, 2000). The types of synthetic RNA or RNA-like molecules that can trigger the RNAs response mechanism may be comprised of modified nucleotides and/or one or more non-phosphodiester linkages.

Additionally, single-stranded RNA and RNA-like molecules, which can also Include modified nucleotides and have one or more non-phosphodiester linkages, can also alter the expression of a target nucleic acid, such as a target mRNA.

Agents that decrease expression of PGH1 include non-enzymatsc nucleic acid molecules that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid; Egholm et al,, Nature. 365:566,1993) interactions and alters the activity of the target RNA (for a review see Stein and Cheng, Science. 261:1004, 1993) as well as enzymatic decreases expression of POH1 may be selected from the group consisting of: agents for use in RNA interference (RNAi), including small interfering RNA (siRNA) molecules that inhibit POH1 expression; antisense oligonucleotides that inhibit P0H1 expression; and ribozymes that inhibit POH1 expression. Suitable antisense oligonucleotides may be designed with reference to the previously published sequences of nucleic adds, such as mRNA, that encode POH1. Suitable examples of siRNA molecules that may be used as agents that decrease expression of POH1, and which may be employed in the methods or uses of the invention, may be commercially available siRNA molecules that inhibit POH1 expression. Merely by way of example, suitable siRNA molecules include those in Example 5 herein (AON_14.1 and AON__14.2; see Table 1), which comprise sequences disclosed in SEQ. ID NO: 2 or 3.

An enzymatic nucleic acid molecule is one that has complementarity in a substrate binding region to a specified gene target (e.g. POHlf and also has an enzymatic activity which is active to specifically cleave target RNA. Such that the enzymatic nucleic add molecule is able to intermolecularly cleave RNA and thereby inactivate a target RNA molecule. The complementary regions allow sufficient hybridization of the enzymatic nucleic acid molecule to the target RNA and thus permit cleavage. One hundred percent complementarity is preferred, but complementarity as low as 50-75% may also be useful in this invention. The nucleic acids may be modified at the base, sugar, and/or phosphate groups. The term enzymatic nucleic add molecule is used interchangeably with phrases such as enzymatic nucleic acid, ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, aptazyme or aptamer-binding ribozyme, regulatable ribozyme, catalytic oligonucleotides, nucieozyme, DNAzyme, RNA enzyme, endoribonuclease, endonuclease, minizyme, leadzyme, oiigozyme or DNA enzyme. All of these terminologies describe nucleic acid molecules with enzymatic activity. RNAi and other nucleic acid based technologies are suitably advanced that the person skilled in the art would be able to make a molecule that could inhibit pohl.

Compounds that inhibit rpnll/POHl are known. Thiolutin (THL) and other /rrrs·*!zo mrl-rszl Frs ίjkUF rrv-i 11 or ix/rUl or ·ό nu «ύο È Λ &amp;/5 <\Λ metaUoproteases (Lauinger et aL, Nature Chemical Biology. 13:709-714, 2017), Jing Quinoline~8-tbtöl (8ÏQ) and various derivatives thereof are reported to be inhibitors of rpnl.1 (Li et al., (Nature Chemical Biology. 13:486-496, 2017; and Perez et al. (J. Medicinal Chemistry). Inhibitors of JAMM metalloprotease domain are also disclosed in WO2012/158435.

In one embodiment, the agent that inhibits P0H1 is selected from quinoline-8-thioi (8TQ) or its derivative capzimin. These compounds are disclosed in Jing Li et al., (Nature Chemical Biology. 13:486-496, 2017).

As discussed above, age-related muscular dystrophies, such as one selected from OPMD, Becker, DM and PSHD arise in later life. Without being bound by theory it is believed that a secondary trigger brings about, the onset of the disease. It has been observed that reduced PA.BPNl levels are associated with the onset of muscle atrophy and so PA3PN1 may be a second trigger.

The effect that the decline of the levels of PABPN1 has in a cell, for instance, because of the aging of the cell, can be decreased and/or reversed by inhibiting the level of POH1 mRNA and/or protein in the cell. Decreasing the level of PÖH1 mRNA and/or protein in a cell has the effect of elevating the level of PABPN1 mRNA and/or protein in the ceil, particularly the amount of protein in the nucleus. With the terms elevating or increasing the level of PABPN1 is meant a higher level when compared to the same circumstances in the absence of' POH1 manipulation. This increase may be attributed to there being a reduced amount of PABPN1 protein removal or breakdown by the proteasome by virtue of the inhibition of P0H1, The term also encompasses a stabilization or slower decrease of the level of PABPN1 overtime. The level of PABPN1 preferably refers to the level (amount) of PABPN1 in the nucleus.

By "inhibit", is meant that the expression of the gene, or level of RNA or equivalent RNA encoding POH1 protein, or the amount of protein (e.g, P0H1), or the activity of the protein, is reduced below that observed in the absence of the agent. Such reduction can be complete (100%), or a lesser amount, such as reduced by 99%, 90%, 75%, 50%, 35%, 25%, 15%, 15%, 5% or less.

The discovery that agents that can inhibit P0H1 can result in an increase in the amount of PABPN1 protein in muscle cells and induce myogenesls opens the opportunity to treat patients as well as means for identifying or selecting patients fora suitable treatment.

According to another aspect of the invention there is provided a method for selecting an individual suffering from, or at risk of developing, muscle degeneration for treatment with an agent that inhibits POH1 comprising, determining whether the patient's cells express reduced PABPN1 protein levels relative to a control or normal cell, wherein if PABPN1 protein levels in the individual's cells are reduced relative to control or normal cell the individual is selected for treatment with an agent that inhibits POH1.

In one embodiment having selected the patient for treatment with an agent that inhibits P0H1 the patient is administered an effective amount of the agent that inhibits POH1.

According to another aspect of the invention there is provided a method for determining whether an individual suffering from, or at risk of developing, muscle degeneration is likely to be responsive to treatment with an agent that inhibits POH1 comprising determining whether the patient's ceils express reduced PABPfMl protein levels relative to a control or normal cell, wherein if PABPN1 protein levels are reduced in the cells the patient is likely to be responsive to treatment with an agent that inhibits POH1.

In one embodiment, having identified the patient as likely to be responsive to/benefit from treatment with an agent that inhibits PQH1 the patient is administered an effective amount of the agent that inhibits PQH1. in addition to being able to treat patients who have developed muscle wasting, it may be possible to identify patients susceptible to an age-related MD ano prophyiacticaiiy r>’5η.·τι·ί· Aorioor L-ikt H-k j-hc rmnr i-rs λλίρλΊ'tkö η··\!·· vai’sct·»

By prophylactic treatment we mean treating patients before the actual symptoms of muscle deterioration are detected so as to endeavour to prevent or delay the onset in those patients likely to develop the disease, disorder or condition.

Thus, according to another aspect of the invention there is provided a method for selecting an individual at risk of developing age-related muscle deterioration for treatment with an agent that inhibits POH1 comprising, determining whether the patient's cells express reduced PABPNl protein levels relative to a control or normal cell, wherein if PABPNl protein levels in the individual's cells are reduced relative to control or normal cell the individual is selected for treatment with an agent that inhibits POH1. A patient at risk of developing age-related muscle deterioration includes an individual who carries one or more germ-line mutations making them susceptible to develop muscular dystrophies such as oculopharyngeal muscular dystrophy (OPMD), myotonic dystrophy (DM1), facioscapulohumeral muscular dystrophy (FSHD) and Becker muscular dystrophy (Becker).

The reference level of PABPNl can, for example, be determined from normal muscles or could be a pre-determined/recognised value. Thus for example, using a simple scale of 0-10, if from a population based assessment normal muscle cells typically exhibit PABPNl protein levels between 7-10 and those with clinical muscle deterioration/degeneration have levels of 5 and below, the physician or health authority could determine that a value of 4 constituted the threshold for determining whether or not a subject should be treated with the POH1 inhibitor, such that if the detected PABPNl levels in the subject's muscle cell was 0-4 they would be selected for treatment with the POH1 inhibitor.

According to another aspect of the invention there is provided a method of treating a patient with or at risk of developing age-related muscle degeneration comprising determining the amount of PABPNl protein present in muscle ceils of the patient and if this level is lower than a reference level indicative of risk of muscle degeneration selecting the patient for treatment with a POH1 inhibitor. In another aspect of the invention there is provided a method of treating a patient with or at risk of developing age-related muscle of the patient and If this level is lower than a reference level indicative of risk of age-reiated muscle degeneration administering to the patient an effective amount of a POH1 inhibitor.

In one embodiment, the age-related muscle degeneration is sarcopenia.

In other embodiments, the age-reiated muscle degeneration is a muscular dystrophy, such as one selected from: OPMD, Becker, DM and FSHD.

In particular embodiments, the patient at risk of age-related muscle degeneration is one that has been Identified as possessing a germ line mutation that makes them likely to develop OPMD, Becker, DM or FSHD.

The skilled person will readily he able to determine reference values of PABPN1 that associates with onset of muscle atrophy/degeneration and thus a level that would signify that the patient should be selected tor treatment or receive treatment with a POH1 inhibitor. As before, a reference level indicative of muscle cells that are likely to degenerate would be determined from population studies; such that for example if a patient had a genetic predisposition to developing an age-related muscular dystrophy, e.g. OPMD, they would have the PABPN1 levels measured at periodic stages in adulthood and if the levels dropped to a level (e.g. 5 on the 0-10 scale above) indicative of the likely advent of the muscle degeneration, the patient, would be selected for treatment with the POH1 inhibitor so as to endeavour to delay or prevent, the onset of muscle degeneration. As used herein, the terms muscle wasting, muscle degeneration, muscle atrophy and muscle deterioration are used interchangeably.

In particular embodiments of these patient selection methods, the amount of PABPN1 In the patient's cells can be determined In a sample of the patient's cells that have been previously isolated from the patient.

The amount of PABPN1 protein in the cells can be determined using suitably labelled molecules capable of specifically binding to PABPN1. protein, such as a labelled ·λ»’ rvmkft A I ·τι oo m kit ts s dn if* or />*· rt kit inrii mort bn a signal, including but not limited to fiuorescers, radiolabels, enzymes, chemiluminescers or photosensitizers. Thus, binding may be detected and/or measured by detecting, for example, by fluorescence or luminescence, radioactivity, enzyme activity or light absorbance.

Suitable labels include, by way of illustration and not limitation, enzymes such as alkaline phosphatase, glucose-6-phosphate dehydrogenase C'G6PDH’j and horseradish peroxidase; dyes; fiuorescers, such as fluorescein, rhodaroine compounds, phycoerythrin, pbycocyanin, ailophycocyanin, o-phthaldehyde, fluorescamine, fluorophores such as lanthanide cryptates and chelates (Perkin Elmer and Cis Biointernationai); chemiluminescers such as isoiuminol; sensitizers; coenzymes; enzyme substrates; radiolabels including but not limited to 1251,1311, 35S, 32P, 14C and 3H and other radiolabels known to the person skilled in the art.

According to another aspect of the invention there is provided an POH1 inhibitor for use as a medicament.

According to another aspect of the invention there is provided an POH1 inhibitor for use in a method of treating a patient.

According to another aspect of the invention there is provided an POH1 inhibitor for use in a method of treating a patient suffering from muscle degeneration.

According to another aspect of the invention there is provided an POH1 inhibitor for use In a method of treating a patient at risk of developing age-related muscle degeneration.

According to another aspect of the invention there is provided an POH1 inhibitor for use in a method of treating a patient suffering from, or at risk of developing, muscle degeneration by enhancing PABPNl protein in the muscle cells.

According to another aspect of the invention there is provided a pharmaceutical

Aort ‘-tt’ briket· ζνκνΛ AkormTo-outkjz'-nfh/ excipient for use in a method of treating a patient suffering from, or at risk of developing, muscle degeneration.

According to another aspect of the invention there is provided a pharmaceutical composition comprising a POH1 inhibitor and at least one pharmaceutically acceptable excipient for use in a method of treating a patient suffering from muscle degeneration.

According to another aspect of the invention there is provided a pharmaceutical composition comprising a POH1 inhibitor and at least one pharmaceutically acceptable excipient for use in a method of treating a patient at risk of developing age-related muscle degeneration.

According to another aspect of the invention there is provided a pharmaceutical composition comprising a POH1 inhibitor and at least one pharmaceutically acceptable excipient for use in a method of treating a patient suffering from muscle degeneration by enhancing PABPN1 protein in the muscle cells.

According to another aspect of the invention there is provided the use of an PQH1 inhibitor in the manufacture of a medicament for use in a method of treating a patient suffering from, or at risk of developing, muscle degeneration.

According to another aspect of the invention there is provided the use of an POH1 inhibitor in the manufacture of a medicament for use In a method of treating a patient at risk of developing age-related muscle degeneration.

According to another aspect of the invention there is provided the use of an POH1 inhibitor in the manufacture of a medicament for use in a method of treating a patient suffering from muscle degeneration by enhancing PABPN1 protein in the muscle cells.

According to another aspect of the invention there is provided the use of an Ο ΓΛ ί-11 I n 'K J k\ ί +/-» r patient at risk of developing muscle degeneration by enhancing PABPN1 protein in the muscle cells.

According to another aspect of the invention there is provided the use of an POH1 inhibitor in the manufacture of a medicament for use in a method of treating a patient at risk of developing muscle degeneration by inhibiting the breakdown of PABPN1 protein in the muscle cells.

In particular embodiments, the patient at risk of developing muscle degeneration is one that is predicted to develop a muscular dystrophy (MD) selected from: OPMD, Becker, DM and FSHD. As noted previously, an individual may be predicted to develop a muscular dystrophy (such as OPMD, Becker, DM and FSHD) if they have particular germ line mutations that are associated with the specific MD. The mutations that associate with a particular muscular dystrophy are well known (e.g. see Thornton et al., Current Opinion in Genetics and Development. 44:135-140, 2017; Wang and Tawil. Current Neurology and Neuroscience Reports. 16:66, 2016; Shieh (Neurol Clin, 31(4), 2013); Brais et al., Nat Genet 18:164-167,1998; and, Anvar et al., Aging (Albany NY) 5:412-426, 2013).

According to another aspect of the invention there is provided an POH1 inhibitor for use in a method of treating a patient suffering from PABPNl-mediated disease, disorder or condition. In particular embodiments, the PABPNl-mediated disease or disorder is selected from OPMD, Becker, DM and FSHD. In a particular embodiment, the PABPNl-mediated condition is sarcopenia.

According to another aspect of the invention there is provided an POH1 inhibitor for use in a method of increasing myogenesls in a patient in need thereof.

The compounds of the invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the compound and a pharmaceutically acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, ΐΛΛ+c λ* λαλοιλο i »I cat! rvrr ci iKc-f'raraz'zar· ογλ fcr li-v+za ra Uitman Tkö term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.

In still further aspects, the invention relates to a pharmaceutical composition comprising an inhibitor of POH1, for use in the prevention and/or treatment of muscle degeneration. In one embodiment, the muscle degeneration is associated with the presence of reduced levels of PABPN1 protein in the muscle cells.

The pharmaceutical compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use.

When administered, the pharmaceutical compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents or compounds.

Administration may be topical, i.e., substance is applied directly where its action is desired, enteral or oral, i.e., substance is given via the digestive tract, parenteral, i.e., substance is given by other routes than the digestive tract such as by injection.

In one aspect, the active agent and optionally another therapeutic or prophylactic agent are formulated in accordance with routine procedures as pharmaceutical compositions adapted for intravenous administration to human beings. Typically, the active compounds for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anaesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder t-w ΐΛ/τΤ/ar frnn ΖΆΑΓΛηΗ-ιΙη ir* -a lazarrvazafir'-af h/ rza-alorl rAntoinor ciir-la ac on m rvn rsr\i i J λ tKza active compound is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the active compound is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

Compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions can contain one or more optional agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavouring agents such as peppermint, oil of wintergreen, or cherry; colouring agents; and preserving agents, to provide a pharmaceutically palatable preparation. A time delay material such as glycerol monostearate or glycerol stearate can also be used. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.

Compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the active agent (POH1 inhibitor) and optionally another therapeutic or prophylactic agent and their physiologically acceptable salts and solvates can be formulated into pharmaceutical compositions for administration by inhalation or insufflation (either through the mouth or the nose) or oral, parenteral or mucosal (such as buccal, vaginal, rectal, sublingual) administration. In one aspect, local or systemic parenteral administration is used.

For oral administration, the compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations

Mr -a nic-frof !aa + ·^Ιζλ Μλ fr\r· nvononiin cwriuoc nr ci ic r\ar\c or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain buffer salts, flavouring, colouring and sweetening agents as appropriate.

The pharmaceutical compositions of the invention are for administration in an effective amount. An "effective amount" is the amount of a composition that alone, or together with further doses, produces the desired response.

In certain embodiments, the agent that inhibits POH1 can be administered as a pharmaceutical composition in which the pharmaceutical composition comprises between 0.1-lmg, 1-10 mg, 10-50mg, 50-100mg, 100-500mg, or SOOmg to 5 g of the active agent.

If the amount of PABPIM1 in a patient's cells is to be measured, this can be done on a sample of cells (e.g. tissue biopsy) from the patient. For example, a muscle cell or muscle-celi containing sample obtained or obtainable from the patient/individual.

The diagnostic/determining methods of the invention can be undertaken using a sample previously taken from the individual or patient. Such samples may be preserved by freezing or fixed and embedded in formalin-paraffin or other media. Alternatively, a fresh muscle cell containing sample may be obtained and used.

According to another aspect of the invention there is provided a method of screening an agent for its ability to prevent or treat muscle degeneration, in which the ability of the agent to inhibit POH1 activity is assessed. In the case that the agent is able to inhibit POH1 activity, then this indicates that the agent has potential as a drug to prevent or treat muscle degeneration in a patient in need thereof.

According to another aspect of the invention there is provided an in vitro method for determining whether a test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of POH1 protein expressed in a cell that has been contacted with the test compound, wherein if the test compound causes a reduction in the amount of POH1 protein expressed in the contacted cell then the test compound has potential as an agent to treat muscle degeneration.

According to another aspect of the invention there is provided an in vitro method for determining whether a POH1 inhibitor test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of PABPN1 protein expressed in a cell that has been contacted with the test compound, wherein if the test compound causes an increase in PABPN1 protein levels in the contacted cell then the test compound has potential as an agent to treat muscle degeneration.

In one embodiment, the method determines the amount or level of PABPN1 protein in the nucleus of the cell.

According to another aspect of the invention there is provided an in vitro method for determining whether a test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of POH1 protein and the amount of PABPN1 protein expressed in a cell that has been contacted with the test compound, wherein if the test compound causes a reduction in the amount of POH1 protein levels and an increase in PABPN1 protein levels in the contacted cell then the test compound has potential as an agent to treat muscle degeneration.

In one embodiment, the method determines the amount or PABPN1 protein in the nucleus of the cell.

The invention is also directed at screening methods to identify agents that inhibit POH1. These candidates constitute leads for development of therapeutic agents suitable for treating muscle degeneration by impacting PABPN1 protein levels in the cell.

According to another aspect of the invention there is provided an in vitro method for determining whether a test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the fold change (FC) in amount of PABPN1 protein expressed in a cell that has been contacted with the test compound, wherein if the test compound causes a FC increase to above 1.5, such as >1.5, >1.6, >1.7, >1.8,>1.9, >2.0, >2.1, >2.2, >2.5 or >3.0, in the contacted cell then the test compound has potential as an agent to treat muscle degeneration. A suitable screening method could use a standardised ubiquitinated or neddylated protein or peptide substrate for POH1 enzyme. The substrate is tagged with a detectable moiety, such as a fluorescent or radioisotope label, that will enable differentiation between the substrate having the ubiquitin or nedd moiety attached or one that has been cleaved. For example, if using a fluorescently tagged substrate the decrease in fluorescence polarisation or the fluorescent moiety can be measured following contact with a test agent. Agents, e.g. compounds, that inhibit POH1 can therefore be identified.

Thus, according to another aspect of the invention there is provided an in vitro method for determining whether a test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the enzyme activity of the POH1 protein comprising contacted the test compound with a labelled POH1 substrate, adding POH1 enzyme and determining the rate of enzyme activity of the POH1 wherein if the test compound causes a reduction in the activity of POH1 protein the test compound has potential as an agent to treat muscle degeneration.

As an alternative to testing for the ability of a candidate molecule to inhibit POH1 activity, screening assays can also be employed that determine the effect that the candidate molecule has on the production of POH1 protein.

Thus, according to another aspect of the invention there is provided an in vitro method for determining whether a test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of POH1 protein expressed in a cell that has been contacted with the test compound, wherein if the test compound causes a reduction in the amount of POH1 protein expressed in the contacted cell then the test compound has potential as an agent to treat muscle degeneration.

An in vitro method for determining whether a POH1 inhibitor test compound has potential as an agent to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of PABPN1 protein present in a cell that has been contacted with the test compound, wherein if the test compound causes an increase in PABPN1 protein levels in the contacted cell then the test compound has potential as an agent to treat muscle degeneration.

An increase in PABPN1 in the cell(s) can be determined using, for example, a labelled probe or antibody.

The method of treating muscle degeneration diseases, disorders or conditions relies on the ability of POH1 to regulate PABPN1 protein. Thus, it may be desirable to determine the effect that a candidate drug or test compound/agent has the amount or activity of POH1 and on the amount of PABPN1 in the cell, by testing the effect the test agent has on POH1 and PABPN1 together in one assay system or separately in sequence or in parallel assays.

In practice, it is likely that putative agents that inhibit POH1 will be identified using in vitro screening assays. However, once a suitable candidate drug has been identified these can then be tested in in animal models of the disease.

For example, the OPMD mouse model as described in de Klerk et al., Nucleic acids Research 40:9089-9101, 2012; Jenal et al., Cell 149:538-553, 2012; and. Trollet et al.

Unm Mni 1 Q/1 1 V71 Q1 7Π1Π

Models of muscle aging are disclosed in Riaz et al. (PLoS Genet. 2016 May 6;12(5):el006031. doi: 10.1371/journal.pgen.1006031)

Models of DM1 are disclosed in EMBO Moi Med. 2013 Dec;5(12):1887-900. doi: 10.1002/emmm. 201303275

Models of FSHD are disclosed in Krom et al. PLOS Genet 9(4) el003415, 2013.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of them mean "including but not limited to", and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

The patent, scientific and technical literature referred to herein establish knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of the issued patents, published and pending patent applications, and other publications that are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of any inconsistencies, the present disclosure will prevail.

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1 94); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with a general dictionary of many of the terms used in the invention. Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art.

The invention will be described further by the following non-limiting examples and Figures.

DESCRIPTION OF THE DRAWINGS

Fig 1. Reduced Pabpni levels Induce muscle regeneration.

M-l=mouse one (high PABPNl FC) M-2=mouse 2 (low PABPNl) FC A. A representative western blot shows PABPNl protein accumulation in scram and shPab muscles. UBE2N was used as loading control. Dot chart shows PABPNl protein levels after normalization to UBE2n. FC for each muscle pair is depicted above the connecting line. B. Muscle histology. Representative images of Gomori-trichrome stained cryosections from the mouse with highest PABPNl FC (-3.3). White arrow points to ECM thickening and black arrows to split myofibers. Scale bar is 50pm. C. Dot chart shows a paired analysis of the mean fraction central nuclei in myofibers. Whiskers represent SD from civ iw-v-aitö fPi-CA Γί Γ)ί-\+· cks-Art- cknu/ ra rt'sirckci orv'ïlv/cic thft w-öiin hi irnkör myofibers per image frame. Whiskers represent SD from six image frames. E. Dot plot shows a paired analysis of the fraction of Pax7 positive nuclei. The mouse with the highest PABPN1 FC (M-l) is depicted in the middle line and the mouse with the lowest PABPN1 FC (M-2) is depicted in the upper line. Quantification of the muscle pathology was carried out over the entire muscle section. P-values were calculated with ratio-paired Student's t-test.

Fig 2. Reduced PABPN1 levels result in a greater effect on proteome compared to transcriptome. A. Scatterplot shows the correlation between the proteome and transcriptome FCs. The significant (p-value = 2.2e-16) pearson correlation of 0.274. Protein FC cut-offs (FC> 11.51) are indicated in red lines. Dark grey dots (below -1.5 line) point out the downregulated proteins (N=30), black dots (above 1.5 line show the upregulated proteins (N=220) and light grey dots indicate not changing proteins. B. Bar chart shows the direction of RNA (N=76) and protein (N=254) with FC> 11.51. C. Bar chart indicates the percentage of the mRNA and proteins (FC> j 1.51) that are dysregulated in similar or opposite direction.

Fig 3. Protein levels correlates with PABPN1 fold changes.

Clustering of protein fold changes with PABPN1 fold changes for 83 proteins whose expression profile correlate with PABPN1 fold changes in absolute values across muscles. The mouse with the highest Pabpnl FC is depicted in the upper row and the mouse with the lowest PABPN1 FC is depicted in the bottom row.

Fig 4. DUBs are up-regulated in shPab muscles.

M-l=mouse one (high PABPN1 FC) M-2=mouse 2 (low PABPN1) FC A. Western blot with anti-ubiquitin antibodies shows accumulation of ubiquitinated proteins in the mouse with the highest PABPN1 fold change. UBE2n shows equal loading. B. A Western blot shows DUBs activity in the mouse with the highest Pabpnl /-Ί-\-~\πγτ/α AntLi-IA too -ά n + ί K rl v / LI A t IkiDr") / /"ΖΛΟΓΜ-Ι rkirsvA/r nrtiml loading. Dot plot shows quantification of ubiquitinated proteins in four mice after normalization to Ube2n. The mice with the highest (M-l) and lowest (M-2) PABPN1 fold changes (FC) are depicted. C. Western blots show the OTUB1, USP14, UCH-L1, UCH-L3 and POH1 levels in the mouse with the highest PABPN1 FC. UBE2n shows equal loading. Molecular weight in kDa are indicated. D. Heatmap of pearson correlations of fold changes for each protein and the bulk of ubiquitinated proteins with PABPN1 (lower row) or with ubiquitinated proteins (upper row). Significant correlation is depicted with full squares and insignificant with stripped squares

Fig 5.

Western blot validation of MS study and RNAseq. Blot quantification in shPab and scram muscles. Statistical significance was assessed with paired ratio t-test, p<0.05 is denoted with *.

Fig 6. Deubiquitination enzymes play a role in muscle biology. A-C. Characterization of down-regulated cell lines in C2C12. (A) UCH-L1 (UL1), (B) USP14 (U14) and (C) POH1 (P14). Bar chart shows mRNA or protein levels in each cell line. mRNA fold change was normalized to Hprt housekeeping genes and Scram (S) cell culture. Averages and standard deviation are from three experiments. Image of a representative Western blot show protein levels and tubulin loading control and fold change was calculated after normalization to tubulin and Scram. D. Bar chart shows the proteasomal activity in the down-regulated cell lines. Black bars indicate the β 1/5 subunits and the grey bars indicate the β2 subunits. The subunits activities in the cell lines were normalized to scram. Averages and standard deviation are from three experiments. E. A representative Western blot shows β5 and β2 expression across the cell lines. Tubulin was used as loading control. F. Representative images show the myotube formation in the DUB-DR cell cultures. The upper row shows the overlay of DAPI and MH20. The lower row shows the segmentation of the overlapping used for quantitation. The scale bar is 20 pm. The /4»nf-ari-f· kor οΙίλιαιο tkio fZ Λ \Λ/nrtnrn kdr\+· tkn DAQDM1 nminir* expression in the different shDub cell lines. Tubulin is used as a loading control. The bar chart shows the normalized PABPN1 fold change. Averages and standard deviation are from four experiments. Η. PABPN1 immunofluorescence in the down-regulated cell lines. The upper row shows PABPN1 signal (grey). The lower row shows PABPN1 and nuclei counterstaining. Scale bar is 10 pm. Bar chart shows nuclear pabpnl levels from a cell-based image quantification, number of cells are indicated (N=). Values are normalized to Scram Significance was assessed by the Student's t-test (p = 0.05-0.005; *, p = 0.005-0.0005; **, p < 0.0005, ***).

Fig 7. The effect of AON to POH1 in muscle cell culture A. A UCSC screenshot of Psmdl4 3'-UTR from poly(A) tail RNAseq in FVB wild type and A17.1 (OPMD model) mouse. The position of AON and primer sets for PCR and schematically indicated. B-H. Experiments in scram or shPab muscle cell culture three days after transfection with scramble or AON_14. B. Barchart shows distal to proximal ratio in Psmdl4 3'-UTR. C. Bar chart shows POH1/Psmdl4 mRNA levels, values were normalized to HPRT and Scram control. D. Western blot, GAPDH is a loading control. E. Bar chart shows POH1 protein levels after normalization to GAPDH and Scram. F. Bar chart shows LWA300 mean florescence intensity. G. Bar chart shows PABPN1 protein levels after normalization to GAPDH and Scram. H. Bar chart shows PABPN1 mRNA levels, values were normalized to HPRT and Scram control. Averages and standard variations are from three biological experiments. The Student's t-test was carried out to assess statistical significance, p<0.05 is assigned by *.

The invention will now be further described with reference to the following Examples, and the drawings described above,

EXAMPLES

Example 1 - Muscle pathology in shPab muscles correlates with Pabpnl levels

Four weeks after injection of AAV9 particles expressing shRNA to Pabpni (named as shPab) into mouse tibialis anterior (TA), resulted in muscle atrophy which was associated with reduced proteasome activity and elevation in Atrogin-1 E3 ligase (Riaz et al., PLoS Genet 12, el006031, 2016). To elucidate the molecular and cellular mechanisms that are affected by Pabpni in muscles we set to generate Pabpni transcriptome and proteome. TA muscle in four male mice of seven weeks old were injected contralateral with AAV9 particle expressing shRNA to Pabpni (shPab) or scramble shRNA (Scram) and muscles were harvested 5 weeks post injection for ex-vivo analyses. Transduction efficiency was assessed in living mice by GFP expression and muscles. GFP mean fluorescence intensity (MFI) did not differ between Scram and shPab muscles. Every harvested muscle was cross-sectional cryo-sectioned and sections across the entire muscle were collected for RNA, protein, or histology. GFP in cryosections confirmed that there was no difference in GFP MFI between shPab and scram. This indicated that molecular differences between paired muscles could not cause by differences in transduction efficiency.

Using paired analysis, we detected reduced Pabpni levels in shPab muscles compared to Scram at both RNA and protein levels (Fig.lA). Notably, changes in Pabpni levels (fold changes) across mice were consistent between mRNA and protein levels. We also noted that in shPab, mRNA or protein levels were similar whereas high variations were found in Scram muscles, and Pabpni levels in Scram muscles correlated with Pabpni fold change (FC). We therefore focused on Pabpni FC to discriminate between mice (Fig.lA). The mouse with the highest PABPNl FC is M-l, and the mouse with the lowest PABPNl FC is M- 2.

Consistent with our previous study (Riaz et al., PLoS Genet 12, el006031, 2016), we detected extracellular membrane (ECM) thickening in shPab (Fig.IB). A higher number of myofiber per image frame was detected in shPab muscles (Fig.ID), indicating the presence of smaller myofibers in the muscle tissue. Smaller myofibers could have arisen from myofiber atrophy and/or split myofibers. In addition, we also detected the presence of central nuclei and split myofibers in shPab muscles (Fig.IB and Fig.1C). Central nucleation and split myofibers, which had previously been shown to be associated with Pax7

AVArArciAn in c IJ 4» λ γαΙΙγ λιά inrii^^fii/λ αΙ ηηιΐΓ/Ίη rnrrnnAr nf ί απ /1 nnnör nf nJ

Development 138, 3639-3646, 2011; Sambasivan et al., Development 138, 3647-3656, 2011). Using quantification of Pax7 immune-signal in nuclei we detected an increase in the fraction of Pax7 positive nuclei in shPab muscles.

These studies show that Pabpnl affects a broad spectrum of muscle histology including regeneration, atrophy and ECM thickening, and that shPab histology severity seems to correlate with Pabpnl fold change in muscles.

Example 2 - Altered RNA and proteome landscapes in shPab muscles

2.1 We investigated the molecular alteration in shPab muscles by generating RNA and protein landscape in the same muscles. Transcriptome was generated using deep RNAseq (average >32 million paired reads per sample) from the poly(A) tail with the average insert length 149 bp. Low quality reads and adaptor sequences (<1%) were filtered out. On average 99% ± 0.2 of the reads passed quality control. Over 10 million reads were mapped and were used for further analysis. We did not find significant differences in quality control sequencing features between scram and shPab muscle. Density plots also indicate that sequencing quality was high and small differences between samples were removed after normalization. Differentially expressed genes (DE) were identified using a linear regression model. 363 genes were identified at 5%, false discovery rate (FDR), from which 51.5% were down-regulated. Because of the paired analysis and N=4, p<0.05 as a cut-off was also considered, suggesting 2257 DE genes, of which 50% were down-regulated. Amongst these were Uspl9, Arih2 and Rad23a, which had previously been reported to be affected in the OPMD mouse model (Anvar et al., Skelet Muscle 1,15, 2011a). Confirming RT-qPCR Pabpnl down-regulation was also found in the RNAseq.

In the OPMD mouse model, PABPN1 causes a switch from distal to proximal polyadenylation site (PAS) in the 3'-UTR (de Klerk et al., Nucleic Acids Research 40:9089-9101, 2012; Jenal et al., Cell 149:538-553, 2012). In agreement with these previous studies, in A17.1 OPMD mouse model that showed a switch in PAS utilization in the 3'-UTR of Psme3, Psmdl4/Pohl and Arih2 in A17.1 (de Klerk et al., Nucleic acids research 40:9089-9101, *)Π1 Ol ίη rh Do K mi If γΙλγ u/λ «alen irlnn+tfinri kiirtU/ar r/a-arlc· -at- nrnvi m nJ r tri λ r>f ITD r>f those genes. Moreover, we reported that in 2300009A05Rik and Vzefl APA in intron is utilized (Abbassi-Daioii et al., NPJ Aging and Mechanisms of Disease 3; 6, 2017). We found higher reads in the same intron in shPab compared with scram. Together, this suggests that reduced PABPN1 levels in shPab leads to a change in APA utilization as in the A17.1 muscles. 2.2 The PABPN1 protein landscape was generated using Mass spectrophotometry (MS) in the same TA muscles. A false discovery rate (FDR) cut-off of 1% was applied for protein identification. MS was carried out in two technical replicates, and variations of the normalised protein abundances between replicates were assessed with Pearson correlation. The correlation confidence between replicates of all 8 muscles was close to 1, indicating excellent technical reproducibility. We only selected proteins that were found in at least 5 (out of 8) muscles for further analyses (N=1213). 248 proteins (20%) showed altered expression levels between Scram and shPab muscles (p<0.05, paired ratio t-test). In contrast to the RNAseq results where the percentage of up- and down-regulated gene was similar, in shPab proteome the fraction of proteins with an average positive fold-change was nearly two-fold higher compared with the fraction of proteins with an average negative fold change (FC). 2.3 We then investigated a correlation between RNA and protein levels in shPab using an average FC. For this analysis, we considered 900 genes with a consistent FC direction in at least three mice. A significant (p<2.2e-16) Pearson correlation was found between RNA and protein fold changes (Fig. 2A), and a fold change density plot demonstrated a larger effect size in the proteome compared with transcriptome. To further describe FC direction correlation, we focused on the molecules with an average FC> 11.51, and found only 67 mRNAs and 254 proteins that were affected by PABPN1. The FC> 11.51 cut-off was selected since PABPN11.4 FC had a resilient effect on muscle pathology (Fig. 2B). From these 67 transcripts, nearly 50% were up regulated, but from the 254 proteins, 88% had higher expression in shPab muscles (Fig. 2B). Amongst the 254 proteins, close to 60% had the same FC direction in mRNA and protein, and the vast majority of genes (87%) showed a positive FC (Fig. 2C). The fraction of down-reguiated genes was only <13%. In the group with opposite FC direction, the fraction of the up-regulated genes (positive average C/* cxrvri norroth/A CP DM AV ια/τυό Qd CQZ. rtnkz Q ολππγ ο negative protein FC and positive RNA FC (Fig. 2C). Together, this suggests that in shPab muscles protein accumulation surpasses mRNA alterations.

Example 3 - Proteomic changes in skeletal muscles correlate with Pabpni levels 3.1 To characterize the shPab proteome we investigated protein landscape per mouse. A heatmap of normalized protein abundances revealed large differences in protein abundances between mice in Scram (N=1213) which could represent natural variation among mice. Therefore, for the protein studies we considered FCs across mice. Consistent with histological changes, the greatest protein changes were found in the mouse with the highest (-2.3) Pabpni FC whereas the least changes were found in the mouse with the smallest (-1.4) PABPNl FC. A potential functional effect for the DE proteins (p<0.05) was found using gene ontology (GO). The entire proteome (N=1213) was set as background and only significant GO terms were considered (p<0.05, Bonferronl corrected). The GO term with most genes (one third) was the mitochondria (one third) and about 8-12% of the genes were mapped to cytoskeleton, ribosome, focal adhesion and sarcomere GO terms. One third of the proteins were not clustered to significant GO terms. 3.2 We then assessed the correlation between PABPNl FCs and the shPab proteome FCs using hierarchal clustering. A cluster of 83 proteins was recognized and its FC pattern in absolute value correlated with PABPNl FC across mice (Fig. 3). The mouse with the highest PABPNl FC showed the highest FC levels for those 83 proteins, whereas, in the mouse with only 1.4 PABPNl FC the changes of the 83 proteins were minimal (Fig.3). MS results were validated for six proteins using Western blot (WB). Moreover, fold changes across mice and correlation with PABPNl levels were also confirmed using WB. Together, this prompted us to assess the PABPNl proteome landscape using average FC of 1.5 as cut-off criteria. DAVID analysis was carried out on the 407 proteins (FC > 11.51) and subsequently on the up-regulated or down-regulated protein clusters. The UPS, ECM and nucleolus were found in addition to the GO terms that were found with the significant proteins. The mitochondrion was found in the down-regulated cluster, and in the up-regulated cluster the ribosome, cytoskeleton, focal adhesion, ECM, nucleolus, and the UPS were found. The sarcomere was -a <-r j rr λ ί-4 \ λ y i-t-Μ» -a rnnrtfir γΜγιάπί ιΙτΤί/>η I I nffkn C Γ'/) Amtr/nr ic consistent with ECM thickening in shPab muscles. Moreover, dysregulation of the UPS could relate to reduced proteasomal activity in shPab muscles (Riaz et al., PLoS Genet 12, el006031,2016).

String analysis was applied to determine which of those protein functional groups could be more affected in shPab. Protein-protein interaction of the ribosome and UPS formed the densest network. However, protein-protein network of the mitochondria was very loose. A cluster of RNA-binding proteins, ECM, cytoskeleton and muscle contraction was also identified. The focal adhesion and nucleolus protein-protein networks were not found. Additionally, a dense RNA-binding protein interaction network was observed. Together this suggests that the ribosome and the UPS could play a central role in shaping shPab proteome.

Example 4 - Deubiquitinating enzymes are predominantly up-regulated in shPab muscles

To investigate an impact of the UPS on shPab proteome we assessed levels of protein ubiquitination using WB and found higher levels ubiquitinated proteins in shPab muscles (Fig. 4A). Consistent with shPab histology and proteome, the highest effect was found in the mouse with highest PABPN1 FC, whereas the smallest difference between shPab and scram was found in the mouse with the lowest PABPN1 FC. As the ubiquitome is regulated by deubiquitinating enzymes (DUBs) (Zheng et al., Frontiers in Aging Neuroscience 8, 303, 2016). We investigated the activity of cysteine proteases DUBs in shPab muscle protein extract using the HAUbBr2, a specific DUBs probe, that irreversibly binds to active DUBs (Borodovsky et al., Chemistry &amp; Biology 9,1149-1159, 2002). In shPab muscles DUBs with cysteine protease activity were mainly higher compared with scram (Fig. 4B). We also determined protein levels for selected candidates using western blot (WB). We validated MS results for certain proteins: UCH-L1, OTUB1, USP14, CSRP3 and MURC. We confirmed that UCHL-3 and UBE2N levels were unchanged. Evidently, most changes were found in the mice with higher PABPN1 FC. Higher UCH-L1 protein level in shPab was concurrent with its cysteine protease activity (Fig. 4C). USP14 had a small increase in the mice with the highest DAQDM1 Cf* ZCirr Λ("\ Uah/λκ I ICDT/I ev/r+AÏnA αχα+αογλ orΗι/ίΉ/ iaj-ic nAorlw r*r\+· Ar+ikln in TA muscles (Fig. 4B). We also validated protein levels for three candidates whose RNA levels are altered in shPab. Consistent with RNA levels, protein levels of POH1, a DUB metalloprotease, were elevated in shPab (Fig. 4C). POH1 was not found it in the MS but we reported that Pohl mRNA levels are regulated by PABPN1 via APA utilization ((de Klerk et al., Nucleic acids research 40:9089-9101, 2012; Riaz et al., PLoS Genet 12, el006031, 2016). Uch-ll mRNA is up-regulated in the OPMD mouse model (Trollet et al., Human Molecular Genetics 19, 2191-2207, 2010) and also in shPab muscle. In both genes, higher reads were found in the 3'-UTR proximal side. This suggests that Uch-ll and Pohl mRNAs are regulated by PABPN1. In turn, if those DUBs regulate PABPN1 protein levels we could expect a correlation between PABPN1 and DUBs protein levels. The strongest correlation was found between PABPN1 and POH1 or OTUB1 (-0.99, Fig. 4D). The correlation between PABPN1 and UCH-L1 or UCHL-3 and also significant but weaker (-0.8), but the correlation between PABPN1 and USP14 was not significant (Fig. 4D). A strong correlation was also found between PABPN1 in the bulk of ubiquitinated proteins (Fig. 4D). To assess the DUBs with the higher impact on protein ubiquitination in shPab, we also determined the correlation between ubiquitinated proteins and DUBs. The only significant correlation was with POH1 (Fig. 4D). The underlying data for Fig. 4D is shown in Fig. 5. Together these data indicate that POH1 and accumulation of ubiquitinated proteins are strongly correlated with PABPN1 FCs.

Example 5 - 19S-associated DUBs play a role in myogenesis and regulate Pabpnl levels 5.1 We next investigated whether UCH-L1, USP14 and POH1 play a role in myogenesis using C2C12 muscle cell lines that stably express shRNA to Uch-Ll, Uspl4 or Pohl in C2C12 muscle cell culture (named here UL1, U14 and P14, respectively). We selected these three genes for functional genomic studies because UCH-L1 and POH1 are regulated by PABPN1, and USP14 plays a regulatory role in the 19S proteasome cap (Lee et al., Nature 532, 398-401, 2016). Knockdown (KD) was confirmed on mRNA and protein levels (Fig 6A-C). As USP14 and POH1 are associated with the 19S cup, we determined proteasomal activity in those clones, using the LWA300 proteasome activity probe. LWA300 was demonstrated to measure proteasomal activity in muscle and muscle cells (Raz et al., J. Cachexia Sarcopenia Muscle, doi: 10.1002/jcsm.12211, 2017). Consistent with results λ J-i+oi nnr) I t-ii irv-i on Amkn/Anir roilr ƒ I λ/-» -ί I M -afi ica A 170.10/1 ΤΩ1 Ω) ίη »ύί i ic /~Ιω cell culture USP14 KD also led to higher activity of β5, βΐ and β2 catalytic subunits (Fig. 6D). In POH1 β5/1 activity was reduced whereas β2 activity was unaffected, however, in UCH-L1 KD proteasomal activity was unchanged (Fig. 6D). It had previously been suggested that UCH-L1 does not affect the proteasome (Walters et al., 2008). In all three KD cultures β5 and β2 protein levels were unchanged (Fig 6E). This indicated that in C2C12 cells the catalytic activity of β-subunits, rather than proteasomal protein levels, are affected by USP14 or POH1. 5.2 The effect these three DUBs had on myogenesis was assessed using a high throughput imaging procedure. Cell cultures were incubated in fusion medium for 10 days, and the fused cells were marked with Myosin heavy chain (MyHC) using immunofluorescence. Fusion index was calculated from the fraction of nuclei in MyHC positive objects across more than 40,000 myonuclei. Most dramatically, in P14 cell fusion was nearly 3-fold higher compared with control (Fig 6F). In U14 cells fusion was slightly reduced, and UCH-L1 did not effect on cell fusion (Fig 6F). This indicates a role for POH1 in myogenesis. In addition, we noticed that altered proteasomal activity correlated with cell fusion; reduced proteasomal activity was accompanied by higher cell fusion in P14, whereas higher proteasomal activity in U14 was accompanied by lower cell fusion. 5.3 We then investigated whether PABPNl levels are altered by the three DUBs. A WB revealed higher Pabpni levels in UL1, U14 and P14 cells lines (Fig. 6G). Notably, PABPNl levels were higher in the POH1 KD culture (Fig. 6G). Since functional PABPNl is predominantly nuclear, levels of nuclear PABPNl were determined using a cell-based imaging analysis. Higher PABPNl levels were found in P14 KD myoblasts only (Fig. 6H). This is consistent with WB showing highest PABPNl accumulation in P14 cells. Together those results suggest that POH1 regulates levels of functional PABPNl.

Example 6 - AON to Psmdl4

In the pohl/Psmdl4 3'-UTR, two polyadenylation sites are recognized, and PAS utilization is altered by PABPNl expression. In the A17.1 mouse model, which expressed ΑΐηηίηΛ nvAonrlnrl DADDM1 nrrwtm -a J DAC ic «i +· i f i i a ri Κι»+ I γλαΙταΙ +·Ιαλ /-iicfol DAC ic utilized (Fig. 7A). To assess whether PAS utilization affect Psmdl4 levels we masked proximal PAS utilization using antisense oligo nucleotides (AON) flanking Proximal PAS in m_Psmdl4 3'-UTR. AONs were designed using mFOLD online tool and two AONs (AON_14.1 and AON_14.2; Table 1) masking PAS utilization was assayed in transfected shPab muscle cell culture. Scramble AON (sAON) (Table 1) was used as control. PAS utilization was determined in qRT-PCR using proximal or distal primer sets (Fig. 7A). The distal primer set measures the long transcript from distal PAS, and the proximal primer set measures long and short transcripts. A change in the ratio between proximal and distal PCR products indicates a change in PAS utilization. In shPab the ratio decreases indicating proximal PAS utilization (Fig. 7B). The ratio was elevated in shPab transfected with AON_14.2 (named AON_14) indicating masking of proximal PAS and reversion of PAS utilization (Fig. 8B). In addition, Psmdl4 mRNA levels were elevated in shPab cell culture after transfection with AON_14 (Fig. 7C). In accordance with a higher binding energy AON_14.2 transfection resulted in a more pronounced affect and further studies were carried out only with AON_14. PSMD14/POH1 protein levels were determined using Western blot. In agreement with reduced mRNA levels, in shPab culture POH1 protein levels were lower compared with Scram, but protein levels were higher after AON_14 transfection (Fig. 7D-E). POH1 is part of the 19S cup, and altered reduced activity is associated with reduced proteasomal activity. We then assessed whether higher POH1 levels in shPab AON_14-transfected affect proteasome activity. Proteasome activity was measured using LWA300, β-subunits specific inhibitor (Li et al., Nat Protoc 2013, 8(6):1155-1168). In shPab culture proteasome activity was reduced, but after AON_14 transfection, proteasome activity was elevated (Fig. 7F). In Scram culture AON_14 effect is not significant. This indicated that the higher POH1 expression is associated with its function. PABPN1 protein level is altered in shP14 cell culture. Interestingly, PABPN1 protein levels but not mRNA are higher in shPab culture AON_14-transfected (Fig. 7G-H). This supports our previous observations suggesting that PABPN1 protein level is regulated by the UPS and DUBs (Anvar et al., Skelet Muscle 2011, 1(1):15, 2011; Raz et al., Am J Pathol. 30(14):00016-00019, 2014; Raz et al., Am J Pathol. 179(4):1988-2000, 2011), albeit the exact mechanism is not fully understood.

TiKizi 1 « mCDI Π ΛΓΛΜ rizncirrrx AON N Tm GC mFOLD Self Binding (bp) AG dimeriz energy (kcal/mol) ation

Scramble GCUCUCUACGUCACUUUAUUUAAAU 32 58 34 -13.5 ACAACAG (SEQID NO: 1) AON_14.1. CG UCACUUU AU UUAAAU ACAACAG 24 48.8 29 -13.8 -6 27.2 (SEQID NO: 2) AON_14.2. CUCUACGUCACUUUAUUUAAAUACA 27 51.1 30 -13.4 -6 33.3 AC (SEQID NO: 3)

Materials and Methods

Animal ethics Statement

Animal experiments were conducted according the animal research protocol (DEC # 13113) approved by the animal ethical committee, LUMC, Leiden the Netherlands, and all experiments were carried out in accordance with the ARRIVE guidelines as previously described (Riaz et al., PLoS Genet 12, el006031, 2016).

Mouse strain, AAV injection and live mice imaging

The adeno-associated virus (AAV) expression cassettes containing shRNA to Pabpni or scramble shRNA and AAV9 particle production were same as described in (Riaz et al., PLoS Genet 12, el006031, 2016)). AAV9 particles expressing of shRNA to Pabpni (shPab) or scramble shRNA (Scram) were injected contralateral (1.5 x 1012gc in 50 μΙ PBS) into TA muscles of 7-8 weeks old male, wild-type C57BL/6 mice (n=4 mice). Muscles were harvested five weeks post injection. Injections were carried out under general anaesthesia of 2% isoflurane (Pharmachemie BV, Haarlem, The Netherlands). Mice were housed in ventilated cages with sterile bedding, water, rodent food and air at DM-III containment level. Mice were imaged for GFP expression at the third week post-injection using the Maestro™ in-vivo fluorescence imaging system (Xenogen product from Caliper Life Sciences, Hopkinton, Massachusetts, USA) as detailed previously (Riaz et al., PLoS Genet 12, el006031, 2016). Harvested TA muscles were immersed immediately in isopentane chilled with liquid nitrogen (30-45 seconds) and stored at -80°C prior to ex-vivo analyses. Muscles were divided for proteomic, histology and RNA extraction.

Muscle cell culture

Knockdown in immortalized mouse myoblasts (C2C12) were generated by Lipofectamine® 2000 reagent (ThermoFisher) transfection of shRNA DNA constructs. Stable cells were selected by cell growth in the presence of puromycin (2.5 0g/mL; Sigma-Aldrich). Per gene two shRNA were analysed, and the clone with the highest DR was selected for functional analysis. Muscle cell fused was carried out in 48 well plate, cells were seeded to ~90% confluence (100,000 cells per well) and fusion was carried out in 2% horse-serum for 10 days. RNA procedures RNA isolation, library preparation and sequencing RNAseq analysis

Total RNA was isolated from soleus and quadriceps muscles (N=6 for each muscle) using Qiagen miRNeasy Mini kit (Qiagen BV, Venlo, The Netherlands) as described in Riaz et al., (PLoS Genet 12, el006031, 2016). Briefly, RNA was extracted using miRNeasy kit. Following DNAse treatment and phenol-chloroform extraction RNA was participated with ethanol. The quality of bulk RNA including small RNA was determined using bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). cDNA library for mRNAseq was prepared from

CZOnurr DMA ΓΚ/η·^ J-nrsnrle Zl ij-ATArln C d (ΊΓΠ\f D-i ri/kiAmrlm i lz n + ίΙ TflflQ) Τ(ηΛ MCD

Next generation sequencing kit was used to prepare the samples for strand-specific sequencing without a size selection step, according to the manufacturer instructions with following modifications: the library was treated with USER enzyme (NEB M5505L, New England BioLabs Inc, Ipswich, MA, USA) to digest fragments derived from the second strand. After amplification of the libraries, samples with unique sample indexes were pooled and subjected to paired-end 2x100 base pair sequencing on one Hlumina-HiSeq2000-v3 lane as per manufacturer instructions (lllumina HQ San Diego CA, USA). Image analysis and base calling were done by the lllumina pipeline (lllumina HQ San Diego CA, USA). The paired end raw reads were aligned to the GRCm38/mmlO mouse reference genome using the GENTRAP (Generic Transcriptome Analysis Pipeline, March 2015, developed in LUMC using the SASC pipeline. Strand specific alignment was carried out with GSNAP version 2013-10-12 using default settings except for novel splicing (=1). UCSC Ensembl transcripts (downloaded on July 17, 2014) were used to identify coding regions (CDS) annotations. Cufflinks v.2.1.1 strict mode was used for quantification of reads at gene and transcript levels. Normalization was carried out using the trimmed mean of M values (TMM)(Robinson and Oshlack,

Genome Biology 11, R25-R25, 2010). The effect of TMM normalization on reads' distribution. The DiffExpr2 in-house developed pipeline was used to identify differential expression. Raw counts were normalized in EdgeR version 3.14.0using TMM, and differential expression was determined after fitting a generalized linear model with two fixed effects, donor (mouse) and type (muscle type), using the glmFit function and using tag-wise dispersion estimates. Differential expression was determined using the paired log-ratio likelihood (LRT) carried out on gene level. P-values were corrected for multiple testing using Benjamini and Hochberg's false discovery rate. BAM files of normalized reads were uploaded to UCSC, and differential reads within gene regions were visualized and compared to our previous studies in the A17.1 mouse model (Abbassi-Daioii et al., NPJ Aging and Mechanisms of Disease 3:6, 2017; de Klerk et al., Nucleic acids Research 40:9089-9101, 2012).

Quantitative RT-PCR

Complementary DNA synthesis was carried out using the RevertAid First Strand λΠΜΛ Innr Cr-Iori-hifi1 Π ηη λΠΜΛ u/or i icnr) oc rd η+Λ nnr reaction with specific primers. Quantitative RT-PCR was carried out using LightCycler 480 System (Roche Diagnostics). Fold change was calculated after normalisation to the mean of Hprt housekeeping genes.

Protein procedures

Protein extraction

To minimize biological variations parts of the same muscles that were used for histology and RNA analyses were used for protein analysis. 20 mg muscle tissue was homogenised with plastic beads using bead beater (Precellys Stretton Scientific). Proteins were extracted using RIPA buffer (50mM Tris, pH 7.4,150mM NaCI, 1% SDS, 0.5% sodium deoxycholate, 1% Igepal CA-630 and protease inhibitors cocktail (Sigma-Aldrich), and protein concentration was determined with a BCA protein assay kit (Pierce, Thermofisher Scientific).

Mass spectrometry and proteomics analysis

Peptides were obtained by a tryptic digestion according to the filter-aided sample preparation (FASP) method as previously described (Wisniewski et al., Nat Meth 6, 359-362, 2009). In brief, 50 pg protein was pretreated with DTT (20mM), IAA (1M) and washed with urea (8M) in between. Protein digestion was carried out with 1.7 pg trypsin at 375C overnight. Trypsin was deactivated with 5% formic acid (FA) and the peptides were then washed with NaCI (0.5M) and Η2Ο. Desalting was performed using C18 Sep-Pack cartridges (Waters), the purified peptides were then dried using miVac DUO concentrator from Genevac, UK. Peptides were resuspended in 20 pi solution A (98% MilliQ-H20, 2% CH3CN and 0.1% FA), vortexed and sonicated before injection into the Q Exactive™ HF Hybrid Quadrupole-Orbitrap™ Mass Spectrometer (Thermofisher Scientific), lpl of the samples was injected and allowed to run on a one-hour gradient in two technical replicates. The chromatograms were aligned using Progenesis Ql software (Nonlinear dynamics, Nonlinear dynamics, Waters, Version 2.0.5556.29015). The peptides were identified using fkn !\/HrrM / Λ Λ -afriv Cninnrn v/nrcMn O C 1 \ Ληοίηη I I run rot icn +

Carbamidomethylation (C) was set as a fixed, and deamidation (N) and oxidation (M) were set as variable modifications in the MS/MS Ions searches. Protein identification confidence was set up with 1% false discovery rate (FDR). Proteins that passed the confidence threshold set in Progenesis Ql and were found in at least five muscles out of eight were included in further analyses (N=1213). Differences between technical replicates were assessed by Pearson correlation. The average of protein abundances from the technical replicates was used for further analysis. Expression values were normalized to the sum of the complete proteome excluding the highly abundant myosin heavy chain proteins in Progenesis Ql. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Perez-Riverol et al., Molecular &amp; Cellular Proteomics : MCP 15, 305-317, 2016) partner repository with the dataset identifier PXD004865 and 10.6019/PXD004865.

Differential expression between shRNA and Scram was determined by a paired t-test (p<0.05) comparing the Iog2-transformed abundances for each protein (n=4 mice) computed in R. Significance of differential expression was determined with the ratio-paired t-test as the differences of the pairs were not consistent (p<0.05). Heatmap based on hierarchical clustering was generated using Perseus 1.5.3.0 software. Diagram of abundance profiles was generated in Progenesis Ql using technical replicates of the whole dataset (N=1213) as input. The shPab dysregulated proteins were clustered to functional groups gene ontology (GO) using the online DAVID bioinformatics tool version 6.7 (Huang et al., Nature Protoc. 4(1):44-57, 2009). P-values (Benjamini) were calculated using the overall proteome (N=1213) as background. DAVID analyses were carried out for the significant (p<0.05) protein group (n=248), and for the average FC (> 11.51) as a cut-off (n=407) protein group. In addition, DAVID analysis was carried out for the up or down regulated protein groups. Proteins whose FC direction were consistent across two mice or less were excluded (N=10). Significant groups were considered with a p-value <0.05 (FDR), redundancy in GO terms was manually removed. Protein networks were created in STRING online tool (Nucleic Acids Res. 2015 Jan 28; 43(Database issue): D447-D452.

Published online 2014 Oct 28. doi: 10.1093/nar/gkul003/). The FC criteria (AVG

Cf* l Ί Cl Μ —/ΙΠ“7\ kAzae i jmz-l nr irkruif- nncl nnh rl/c ια(λγλ L-kmz··'} av αλγι γαλα+τ η»ιζ*Ι fhn string-database using the high-confidence (0.7) interaction score. Networks visualisation was then adjusted by cytoscape (v.3.5.1).

Extraction and Deubiquitinating enzyme labelling of muscle extracts

Part of the muscles was extracted with NP-40 buffer (50 mM Tris (pH 7.4), 5 mM MgCb, 250 mM sucrose, 1 mM DTT, 0.5mM EDTA and 0.5% NP-40) for DUB labelling. Active DUBs of 15pg protein lysate were labelled with HAUbBrZ for 1 hour at 37 °C (Börodövsky et al., Chemistry &amp; Biology 9,1149-1159, 2002), The labelled DUBs were subsequently blotted and probed with anti-HA tag monoclonal antibody 12CA5,

In Vitro analysis of proteasomal activity

Proteasomal activity was determined after cell labelling with LWA300 activity probe as previously described (Raz et al., J Cachexia, Sarcopenia and Muscle. 2017 Jul 3. doi: 10.1002/jcsm.12211). In brief, C2C12 cells were incubated with 0.5 μΜ LWA300 for 40 min at 37”C and proteins were directly extracted in lysis buffer (50 mM Tris-HCI [pH 7.5], 250 mM sucrose, 5 mM MgÖ2,1 mM DTT, 0.025% digitonjn, Proteins were separated using 12.5% SDS-PAGE. Wet gels were visualized using BioRad ChemiDoc imaging systems (BioRad, CA, USA; (Aex = 530 nm, Aem = 560 nm). Equal loading was determined with Coomassie.

Western blotting and western blot analyses 50 pg aliquots of protein extracts were separated by SDS-PAGE (Criterion XT, Bio-Rad). Western blot was carried out using PVDF membranes. First antibodies used in this study were: rabbit anti-PABPNl (1:2000; LS-B8482, LS Bio, WA. USA), mouse anti-UCH-Ll (1:1000, sc-58594, Santa Cruz), rabbit anti-USP14 (1:1000, sc-100630, Santa Cruz), rabbit anti-UCH-L3 (1:1000, abl26703, Abeam, CAM, UK), rabbit anti-POHl (1:1000, #7662, Cell Signaling, MA. USA), proteasome β-subunit 2 (PSB2) (1:1000, anti-mouse, sc-58410, Santa Cruz, CA, USA), proteasome β-subunit 5 (PSB5) (1:1000; anti-rabbit, #09-278, Miilipore, MA, USA), rabbit anti-QTUBl (1:800,10573-1-ap, Proteintech, MAN, UK), mouse anti-i ikiri,u-bir,/1-1 nnn ολλι _ο\Λ/ηα2ζνηιηη cvc ιιι/\ ιμω_ι/3 Z1 ·ιηηη 4974, Cell Signaling, MA, USA) rabbit anti-CSRP3 (1:1000; GTX110536, GeneTex, CA. USA); rabbit anti-MURC (1:1000, HPA021021, Atlas antibodies), rabbit anti-UBE2n (1:1000; ab25885, Abeam, CAM, UK); mouse anti-Tubulin (1:2000; T6199; Sigma-Aldrich);. Secondary antibodies were IRDye 800CW or IRDye 680RD conjugated (LICOR, NE. USA). Fluorescent signals were detected using the Odyssey CLx Infrared imaging system (LiCOR, NE. USA). Coomassie blue (CB) stained gels were used as loading controls. Quantification of protein accumulation was performed with ImageJ version 1.48 (https://imagej.nih.gov/ij/). Values were corrected for background and normalised to loading controls.

Histology and immunofluorescence

Cryosections (10 pm) were made from the middle of TA muscles with a cryostat CM3050S (Leica Microsystems) and pasted on Super Frost Plus glass slides (Menzel-Glaser; Thermofisher Scientific). Cryosections were stained with Gomori-Trichrome staining (Gomori, American journal of clinical pathology 20, 661-664,1950). GFP distribution in myofibers was directly visualised in non-fixed sections after mounting with Aqua Polymount (Polyscience) containing DAPI. Muscle immunohistochemistry was carried out in non-fixed sections as previously described Riaz et al., (PLoS Genet 12, el006031, 2016). Primary antibodies employed here is: Pax-7 (1:200; DSHB). Sections were mounted with Aqua Polymount (Polyscience) containing DAPI.

Fused cells in cell culture were visualized using the MF20 antibody, described in (Anvar et al., Aging (Albany NY) 5, 412-426, 2013). The fraction of nuclei within MF20 structures was determined using co-localization bio-application V4 in the Cellomics software. Nuclear PABPNl was determined in myoblast cell cultures using anti-PABPNl antibody. The nucleus was segmented using DAPI staining, and nuclear PABPNl signal was determined using compartment bio-application V4 in the Cellomics software.

Imaging and image quantification

Fluorescent and Nomarski interference imaging were carried out with DM5500 (Leica Microsystems). Images were captured with the LAS AF software versions: 2.3.6 for the DM5500. Gomori-Trichome stained images were captured using a LAS software version: 4.5.0 for the DM-LB light microscope. High throughput imaging in cell culture was carried out with Arrayscan VTI HCA, Cellomics (Thermo Scientific). Statistical analyses were carried out in Graphpad Prism version 6.0.

Claims (15)

A method for increasing the amount of PABPN1 protein in a cell, comprising contacting the cell with an agent that inhibits POH1. The method of claim 1, wherein the cell is a muscle cell. The method of claim 1 or claim 2, wherein the amount of PABPN1 is driven up into the core of the cell. A method of treating a patient suffering or at risk of developing muscle degeneration, comprising administering to the patient an effective amount of an agent that inhibits POH1. The method of claim 4, wherein the patient suffers from or is at risk of developing a PABPN1-mediated disease, disorder, or condition. The method of claim 4 or claim 5, wherein the patient suffers from or is at risk of developing sarcopenia or muscular dystrophy. The method of claim 6, wherein the muscular dystrophy is selected from OPMD, Becker, DM, and FSHD. A method according to any one of the preceding claims wherein the POH1 inhibiting agent is a small molecule compound or a large molecule biopharmaceutical. The method of claim 8, wherein the POH1 inhibitor is a nucleic acid molecule capable of inhibiting POH1 mRNA. The method of claim 8, wherein the POH1 inhibiting agent is an antibody that binds to POH1 protein. The method of claim 10, wherein the antibody is an antibody-derived molecule selected from a monoclonal antibody, a Fab, a ScFv, HCAb, and a VHH antibody. A method for selecting an individual suffering or at risk of developing muscle degeneration, for treatment with an agent that inhibits POH1, comprising determining whether the cells of the patient express reduced PABPN1 protein levels relative to a control or normal cell, wherein if the PABPN1 protein levels in the cells of the individual are reduced relative to control or normal cells, the individual is selected for treatment with an agent that inhibits POH1. The method of claim 12, wherein the patient at risk for developing muscle degeneration has a germline mutation that makes the patient susceptible to developing a muscular dystrophy selected from: OPMD, Becker, DM1, and FSHD. An in vitro method for determining whether a POH1 inhibitor test compound has a potential as a means to treat muscle degeneration, comprising determining the effect that the test compound has on the amount of PABPN1 protein expressed in a cell contacted with the test compound, wherein if the test compound causes an increase in PABPN1 protein levels in the contacted cell, the test compound has potential as a means to treat muscle degeneration. The method of claim 14, wherein the method determines the amount of PABPN1 protein in the core of the cell.