MXPA97002990A - Amplification and detection of complex species of mycobacterium av - Google Patents

Abstract

The present invention relates to amplification primers and methods for the specific amplification of the complex of target sequences in the genes of adnJ of the complex species of Mycobacterium Avium. Test probes are also provided for the detection of the amplification products and / or for identification of the MAC species that is present

Description

"AMPLIFICATION AND DETECTION OF COMPLEX SPECIES OF" MYCOBACTERIUM AVIUM " FIELD OF THE INVENTION The present invention relates to the amplification and detection of target nucleic acid sequences. In particular, the invention relates to the amplification and detection of target nucleic acid sequences in Mycobacteria.

BACKGROUND OF THE INVENTION Mycobacteria are a genus of batteries that are gram-positive rods, not mobile, resistant to acid. The genus comprises several species including, but not limited to Mycobateri um afri cam? M, M. avi um, M. bovis, M. bovis-BCG, M. chelonae, M. fortui tum, M. gordonae, M. intracell ulare, M. kansasii, M. microti, M. scrofulaceum, M. paratuberculosisi and M. tubercul osis.

Certain of these organisms are the causative agents of the disease. For the first time since 1953, cases of mycobacterial infections are growing in the United States.

United. Even when tuberculosis is of specific concern, other mycobacterial infections are also growing as a result of an increase in the number of compromised immune patients. Many of these new cases are related to the AIDS epidemic, which provides a compromised immune population that is particularly susceptible to mycobacterial infection. Mycobacterium avium, Mycobacterium kansasii and other non-tuberculosis mycobacteria are found as opportunistic pathogens in patients infected with HIV and other compromised immune patients. M. avi um and M. intracell ulare are members of the Mycobacterium um avi um complex (MAC). These species have become important in recent years due to the high prevalence of disseminated MAC infection in AIDS patients. The Micobacterluin avium complex is comprised of 28 serovars that are distinguishable on the basis of their biochemical and seroagglutination characteristics (see the review by Inderlied et al., 1993, Clin. Microbiol Rev. 6, 266-310). Depending on the classification method, 10 to 12 of the 28 serovars are classified as belonging to the Mycojacterium avi um species, and 10 to 12 belong to the Mycojacterium intracellulare species. Six of the MAC serovars have not yet been definitively classified. MAC infections currently amount to approximately 50 percent of the pathogenic isolates identified by mycobacteriology laboratories and are the most common among AIDS patients and other immunocompromised patients. Early diagnosis and treatment of MAC infections can improve and prolong the lives of infected individuals. Currently, the diagnosis of mycobacterial infections depends on acid resistant staining in the body culture, followed by biochemical tests. These procedures are delayed and a typical diagnosis using a conventional culture method may require as much as six weeks. Automated culture systems, such as the BACTEM ™ system (Becton Dickinson Microbiology Systems, Sparks, MD) can decrease diagnostic time from one to two weeks. However, there is still a need to reduce the time required for the diagnosis of mycobacterial infections to less than a week, preferably up to about a day. Nucleic acid amplification is a powerful technology that allows rapid detection of specific target sequences. Therefore, it is a promising technology for the rapid detection and identification of mycobacteria. Examples of nucleic acid amplification technologies that are known in the art are the polymerase chain reaction (PCR: U.S. Patent Nos. 4,683,195; 5,683,202; 4,800,159; 4,965,188), Amplification of Chain Displacement (SDA) (G. Walker et al., 1992, Proc.Wat., Acad. Sci. USA 89, 392-396, G. Walker et al., 1992, Nucí. Acids. Res. 1691-1696; US Patent Number 5,270,184 which is incorporated herein by reference), amplification based on nucleic acid sequence (NASBA: US Patent Number 5,130,238 issued to Cangene), amplification based on transcription (D. Kwoh et al., 1989, Proc. Nat. Acad. Sci. USA 86, 1173-1177), duplication of self-sustained sequence (3SR: J. Guatelli et al., 1990, Proc. Nat. Acad. Sci. USA 87, 1874-1878) and the system of Qß duplication (P. Lizardi et al., 1988 Bio Technology 6, 1197-1201). Isothermal amplification methods, such as SDA and 3SR have specific diagnostic advantages since they do not require the high / low temperature cycling characteristic of methods such as PCR. Therefore, they are simpler protocols and require less specialized equipment to be carried out. However, for any method of nucleic acid amplification, they must be amplified in a target sequence that can be amplified with the desired type and degree of specificity, before the technology is applied. The sequence of a selected target does not necessarily allow the design of amplification primers appropriate for the selected amplification method, and the target does not necessarily have to be amplified and detected as a degree of sensitivity and specificity appropriate for diagnosis. European Patent Application Number 0 528 306 describes the PCR amplification of a target sequence in the 16S ribosomal RNA gene of mycobacteria using amplification primers directed to the conserved regions of the gene. The amplification product, which is approximately 583 basic pairs in length, contains conserved sequence regions that hybridize in genre-specific test probes and variable regions that can be used to identify the species using test probes specific to the species. Even though the assay system described in Patent Number EPO 0 528 306 is based on species of non-specific amplification followed by the detection of specific species of the amplification products, it is important that the product of application produced be very large. The larger the target sequence that is simplified, the more likely that the amplification product contains regions in sequence variation sufficient to allow the design of a variety of test probes specific to the non-cross hybrid species for detection of the amplification. Amplification methods such as SDA at this time are not capable of amplifying targets as large as those capable of being amplified by PCR. Small target sequences severely restrict the ability to design test probes specific to the non-cross hybrid species for the detection of a given blaco, because there is less sequence available in the amplification product for the design of the assay probe . It is clearly not certain whether the amplification primers and the test probes with the desired specificity can be designed even when a target sequence is large. However, the problem of developing specific primers and probes is particularly acute when they are amplifying and detecting small target sequences. The problem is complicated when the target selection is further restricted by the requirement for sequences flanking a variable test region that are not only very close to each other for amplification, but are also highly conserved among the species of interest, not allowing This way the specific amplification of the species in the test region before the specific detection of the species, the comlejo or the group. Heat shock proteins are a family of proteins that are expressed in high amounts when an organism is challenged by an increase in temperature.

Heat shock proteins are highly conserved (R.J. García et al., 1989, Infection and Immuni ty 57, 204-212, R.S. Gupta et al., 1992, J. Bacteriol ogy 174, 4594-4605). The codes of the adnJ gene for a heat shock protein of 42 kd are thought to be involved in the cell stress response. M. tuberculosis was the first of the mycobacteria for which the nucleotide sequence of the adnJ gene was determined (R.B. Lathigra et al 1988, Nucí Acids, Res. 16, 1636). The nucleotide sequence of a segment of the adnJ gene of M. leprae was subsequently determined (S. S. Harvey et al., 1993, J. Gen. Microbiol. 139, 2003-2008). Subsequently, using the M. tuberculosis sequence published by R.B. Lathigra and others, supra, S.I. Takewaki et al. (1993, J. Clin. Microbiol., 31, 446-450) developed a set of genus-specific PCR primers that amplify a 236-bp fragment of the adnJ gene (bp 1394-1629) on a scale of mycobacterial species, including M. avi um and M. intracell ulare. Species-specific oligonucleotide probes that allowed the identification of M. tuberculosis, M. avium, M. intracellulare and M. kanasii after genome-specific amplification by PCR, were also reported. The adnJ gene from nineteen species of mycobacteria was then sequenced and used to determine phylogenetic relationships and to differentiate species based on species-specific restriction cycles in the gene (SI Takewaki et al., 1994, Int. J. Syst. Bacteriol., 44, 159-1266). Japanese Patent Number Kokai 6-133775 (Takewaki et al., Published May 17, 1994) discloses a pair of genus-specific amplification primers for PCR and several specific waves of the adnJ gene species of mycobacteria. Certain terms used herein are defined as follows: An identification primer is a primer for amplification of a target sequence by extension of the primer after hybridization in the blank sequence. For amplification by SDA, the amplification primers are preferably selected such that the GC content is low, preferably less than 70 percent of the total nucleotide composition of the probe to minimize the secondary structure. The 3 'end of an SDA amplification primer (the target binding sequence) is hybridized at the 3' end of the target sequence. The binding sequence of the blank confers target specificity on the amplification primer. The SDA amplification primer further commits a recognition cycle for a restriction endonuclease near its 5 'end. The recognition site is for a restriction endonuclease that will nick a strand of a duplex DNA when the recognition site is modified, as described by G. Walker et al., (1992, PNAS, supra). For most of the SDA reaction, the amplification primer is responsible for the exponential amplification of the target sequence. The SDA amplification primer can also be referred to as the "S" primer (e.g., Si and S2) when a pair of amplification primers are used for the amplification of a double-stranded sequence. For other amplification methods that do not require specialized sequences at the ends of the target, the amplification primer usually consists essentially of only the target binding sequence. For example, the amplification of a target sequence according to the invention using PCR will employ amplification primers consisting of the target binding sequences of the amplification primers in Table 1. A shock primer or an external primer is a Sequence used to generate targets that can be amplified by SDA: The shock primer is tempered to a target sequence upstream of the amplification primer such that the extension of the shock primer shifts the amplification primer downstream and its product of extension. Shock primers can also be referred to as the "B" primers (e.g., Bl and B2) when a pair of shock primers is used to displace the extension products of a pair of amplification primers. The extension of the shock primers is a method for displacing the extension products of the amplification primers, but heating is also appropriate in certain amplification reactions. The terms "white" or "target sequence" refer to nucleic acid sequences to be amplified. These include the sequence of the original nucleic acid to be amplified, the second strand complementary to the original nucleic acid sequence to be amplified, and either the strand of a copy of the original sequence that is produced by the amplification reaction. these copies also serve as amplifiable target sequences due to the fact that they involve faithful copies of the original target sequences towards which the amplification primers are hybridized. The copies of the target sequence that are generated during the amplification reaction are referred to as amplification products, amplimers or amplicons.

The term "extension products" refers to the single-stranded copy of a target sequence produced by hybridization of an amplification primer and extension of the amplification primer by polymerase, using the target sequence as a template. The term "test probe" refers to any of the oligonucleotides used in the detection or identification portion of an assay. In the present invention, the test probes are probes used for detection or specific identification of complex, group or species of mycobacteria. Detector probes and capture probes are examples of test probes. The assay region or the sequence of the assay region is the portion of a target sequence, or other nucleic acid to which the assay probe hybridizes. The species-specific term refers to the detection or amplification of a species of organism without considerable detection and amplification in other species of the same genus or species of a different genus. Genus-specific refers to detection or amplification in most species of a genus without significant detection or amplification of the species of a different genus. Group or complex-specific detection refers to the detection or amplification of a majority of related species in a selected group (e.g., MAC) without significant detection or amplification in other species of the same genus or species of a different genus.

COMPENDIUM OF THE INVENTION The present invention provides oligonucleotide primers that can be used for complex-specific amplification of a target sequence found in 26 of the 28 serovars comprising the MAC. The white sequence is a segment of the adnJ gene. Therefore, a single pair of amplification primers allows the amplification of 48 bp target sequences of the adnJ gene from both M. avi um and M. intracell ulare. The oligonucleotide assay waves that hybridize to the assay region of the amplified sequence are used to detect the amplification products, optionally distinguishing between the MAC species. The methods of the invention also allow the detection of the target sequence of adnJ in Myco acteriuiTi paratuberculosis, a subspecies of M. avium associated with Crohn's disease in humans and Johne's disease in cattle.

DETAILED DESCRIPTION OF THE INVENTION Amplification primers that allow complex-specific amplification of a 48 bp target fragment of the adnJ gene (bp 1548-1595) of the MAC species are provided. A highly efficient amplification of targets in both M. avi um and M. intracellulare had not been predicted based on the sequence data of S.I. Takewaki et al. (1994, supra) since the sequences of M. avi um and M. intracell ulare differ by a single nucleotide in the region where the amplification primers are hybridized. Inequalities between the target binding sequences of the primers and the sequences to which they hybridize to the target are generally known to inhibit or otherwise interfere with target amplification. In particular, the present invention provides oligonucleotide probes and primers that allow specific MAC targets in the DNA gene to be amplified by chain shift amplification (SDA), with the subsequent detection of the presence of a MAC species or the identification of the specific MAC species that is present. It has been found that the primers of the invention produce 10 ^ fold amplification in both M. avi um and M. intracell ulare targets despite the difference in the nucleotide sequence between these species at the primer hybridization site of amplification in whites. In addition, after amplification, the amplified target sequences M. avi um and M. intracellulare can be distinguished from one another by hybridization to the test probes of the invention. The different probes and primers developed for SDA and detection of MAC targets are shown in Table 1. The restriction endonuclease recognition sites (HincII) are retained and the target binding sequences are provided in italics. The target binding sequence of the 3 'end of each SDA primer determines its target specificity. The sequences of adnJ to which the amplification primers hybridize in M. avi um and M. intracell ulare differ by a single nucleotide at each end of the target. The amplification primers, therefore, were designed in such a way that the target binding sequence of one of the primers is hybridized to one of the two targets (either M. avium or M. intracell ulare) with perfect complementary Watson-Crick, but they exhibit a single nucleotide inequality when they hybridize to the target in the other species. For example, the target binding sequence of SEQ ID NO: 1 hybridizes to the M. avium target with perfect complementarity, but hybridizes to the target of M. intracell ulare with a one-nucleotide inequality. Similarly, the target binding sequence of SEQ ID NO: 2 hybridizes to the target of M. intracell ulare with perfect complementarity, but hybridizes to the target of M. avi um with a one-nucleotide inequality.

Table 1 Primers and Probes for Detection of the MAC AdnJ Gene 0 Priming Amplification Primers Sequence Function 5 'TTGAACTCACTCACTATTGTTGACCGGCGAACGA3' 5 (SEQ ID NO: l) IN2B 5'TTGAATAGTAGGATAGTAGTTGACAGGACAACACGT? G-3 '(SEQ ID NO: 2) Prim2 5'TTGAATAGTAGGATAGTAGTTGACCGACAACACGTGG3 '(SEQ ID NO: 3); > o Shock primers BUMP1 5 'AGCTGGGCGTCTC3' (SEQ ID NO: 4) BUMP2 5'GCGCTTGGCCG3 '(SEQ ID NO: 5) BUMP3 5'GACAATCCCGC3' (SEQ ID NO: 6) 5 Test Probes Capture MA133 3BIOTIN-5 'GTGCGCCTCCGAC3' (M. intracellulare) (SEQ ID NO: 7) MA137 5? CCGCCTTGAATC3'-3BI0TIN (M. avium) (SEQ ID NO: 8) Detector of Test Probes MA136 5 'ACGGCTTTGAATC3' -AP (M. intracellulare ) (SEQ ID NO: 9) MA138 AP-5'GTGCGCCTCGGAG3 '(M. avium) (SEQ ID NO: 10) DAV 5' TTCAAGGCGGTCTCC3 (SEQ ID NO: 11) DIN 5 'TTCAAAGCCGTGTCG3' (SEQ ID NO: 12) The presence of the single-nucleotide inequality destabilizes the target-primer complex compared to a perfect complementary complex, but unexpectedly it does not appear to significantly reduce the efficiency of amplification under the SDA reaction conditions. The initial hybridization of the amplification and shock primers to a target sequence in an SDA reaction results in the generation of amplifiable targets as described by G. Walker et al. (1992, Nucí Acids Res.

North American Number 5,270,184). The target generation cascade produces copies of the desired target sequence flanked by mellible restriction of endonuclease recognition sites. Therefore, during blank generation, any of the one-nucleotide inequalities between the blank and the primer that were originally present, are replaced by perfectly complementary sequences contributed by the amplification primers. These terminally modified targets enter the amplification reaction and experiment SDA. Therefore, the terminal sequences of the modified targets in both M. avi um and M. intracell ulare will become identical, but the test regions between the sequences that bind the amplification primers will remain unchanged allowing the products to be distinguished of amplification of M. avi um and M. intracell ulare. Applicants hypothesize that this particular target generation feature coupled with SDA allows the amplification reaction to overcome the deleterious effects of primer / target inequalities as long as there is sufficient hybridization of the mismatched primer relative to the blank to generate a only modified white suitable for amplification. This may be responsible for the high efficiency of the amplification observed in this system despite the inequality. Using the amplification primers and the shock primers listed in Table 1, the adnJ targets of M. avi um and M. intracellulare can be amplified > 107-fold by SDA, allowing detection of as few as 5 copies of the blank in M. avium and 50 copies of the blank in M. intracelullare. In Table 1, SEQ ID NO: 10 is a sensing probe and SEQ ID NO: 8 is a capture probe. Applicants found that cross-reactivity is detected if the functions of these two oligonucleotides are reversed, that is, if the sequence SEQ ID NO: 10 is used as the capture probe and SEQ ID NO: 8 is used as the detection probe in the trial. However, the cross-reactivity is eliminated by the configuration of the probe in Table 1, apparently because the amplification products of the cross reaction are not captured. The development of the primers of the invention also illustrates that obviously small modifications in the amplification primers for SDA frequently have unpredictable effects, such as deletion of the A residue underlined in SEQ ID NO: 2 which reduces the efficiency of amplification in M. intracell ulare by 100 times and in M. avi um by 10 times. This result was unexpected in view of the fact that the underlined A residue is not part of the white binding sequence, but is part of the essentially randomly selected sequence included to separate the restriction endonuclease recognition site from the target binding sequence. The amplification primers of the invention are also useful in other nucleic acid amplification protocols, such as PCR, thermophilic SDA (which uses thermally stable enzymes in a reaction project that is essentially the same as that of conventional low temperature SDA). and 3SR. Specifically, any amplification protocol that used specific cyclic hybridization of primers to the target sequence, the extension of the primers using the target sequence as the template and the displacement of the extension products from the blank sequence can employ the amplification primers of the invention. For amplification methods that do not require non-target binding sequences (e.g., PCR), the amplification primers may consist only of the target binding sequences of the amplification primers listed in Table 1. Amplification methods that require non-target binding sequences that are different from those of the amplification primers in Table 1 (e.g., 3SR) can employ amplification primers that comprise the target binding sequences. with the substitution of the sequence or structure required by the amplification method selected for the HincII site. Another restriction endonuclease recognition site suitable for low temperature SDA can also be replaced by the HincII cycle as is known in the art or an appropriate restriction endonuclease recognition site for thermophilic SDA can be substituted when the target is amplified by the Thermophilic SDA. The MAC species from which amplification products are generated can be identified or distinguished by hybridization to the test probes in the detection portion of the assay. For detection by hybridization, the detector probes are labeled with a detectable radioactivation. Detectable radioactivation is a residue that can be detected either directly or indirectly as an indication of hybridization of the probe to the target nucleic acid. For direct detection of radioactivation, the probes can be labeled with a radioisotope and detected by autoradiography or labeled with a fluorescent residue and detected by fluorescence as is known in the art. Alternatively, the probes can be detected indirectly by being labeled with a radioactivity that requires additional reagents to become detectable. Indirectly detectable radioactivities include, for example, chemiluminescent agents, enzymes that produce visible reaction products, and coordinating groups (e.g., biotin, avidin, streptavidin, haptens, antibodies, or antigens) that can be detected by binding partners. specific irradiated ligations (e.g. antibodies or antigens / haptens). Particularly useful irradiations include biotin (detectable by avidin binding or irradiated streptavidin) and enzymes, such as strong horseradish peroxidase or alkaline phosphatase (detectable by the addition of enzyme substrates to produce colored reaction products). Biotin and other coordinator groups are also useful for labeling capture probes to allow immobilization of the capture probe and the complex to which it hybridizes to a solid phase by binding to the appropriate specific binding partner. Methods for adding these irradiations to or including these irradiations in oligonucleotides are well known in the art, and any of these methods are suitable for use in the present invention. A method for detecting the amplification products employs polyimeriase extension of a specially hybridized primer to the assay region. The primer is irradiated as described above, e.g., in a radioisotope such that the irradiation is incorporated with the primer into an amplicon-specific extension product. Detection by extension of the primer is described by G. Walker et al. (1992, Nuc Acids, Res. And PNAS, supra). A second method for detecting the amplification products is a chemiluminescent assay wherein the amplified products are detected using a biotinylated oligonucleotide capture probe and an enzyme conjugated oligonucleotide detecting probe, as described by CA Spargo et al. (1993, Molec. Cell. Probes 7, 395-404). After hybridization of these two probes to different sites in the test regions, the complex is captured in a microwell plate coated with streptavidin and the chemiluminescent signal is developed and read on a luminometer. The chemiluminescent assay can be carried out in less than two hours and is sensitive enough to detect as few as a pre-amplification target sequence. In one embodiment of the invention, the capture probes and detectors shown in Table 1 can be used to detect the presence of amplification products of M. avi um and / or M. intracell ulare. Because the assay regions of the amplification products in M. avium and M. intracell ulare differ from one another in several nucleotide positions, the species can be distinguished using only the capture and / or detector probes specific to the region. of the desired target. These same test probes also detect M. paratuberculosis. Alternatively, the different assay probes can be combined in a single mixture to detect the amplification products of all MAC species without distinguishing between them.

EXAMPLE 1 To determine the sensitivity of SDA for Mycobacterium um avium and Mycobacterium um intracellulare using the primers of the invention, the target DNA was evaluated and the amplified genomic DNA isolated from the two species was prepared at concentrations of 10,000, 1,000, 100, 10, and 0 genomes in 50 ng of the human placental DNA. The SDA was carried out essentially as described by G. Walker et al. (1992, Nucí Acids Res. Supra) in a reaction stabilizer having the following composition: 45 mM potassium phosphate pH 7.6, 100 micrograms per milliliter of acylated bovine serum albumin, 5 mM of dUTP, .2 mM of each of dGTP, dCTP and alpha-thio-dATP (dATPaS), 6 M of magnesium acetate, 7.5 percent of dimethylsulfoxide and 5 percent of glycerol. The dUTP was included to facilitate the degradation of any of the contamination amplicons (decontamination) with uracil-N-glycosylase (UNG). The amplification primers of SEQ ID N0: 1 and SEQ ID NO: 2 are present in the reaction at a final concentration of 0.5 micrometer and the shock primers of SEQ ID NO: 5 and SEQ ID NO: 6 are present. at a final concentration of .5 micrometer. White DNA was added and initially denatured (95 ° C, 2 minutes) and then cooled to 39 ° C and decontaminated by the addition of UNG (.5 unit / reaction, incubate for 30 minutes). An internal control sequence was also included in each sample to monitor the reaction and amplification. After decontamination, the UNG Ugi inhibitor (uracil N-glycosylate inhibitor) was added to retain the decontamination reaction. Enzymes, magnesium acetate and glycerol were also added. The restriction endonuclease HincII was used at a concentration of 150 units per reaction and the exo ~ Klenow polymer was used at a final concentration of 3.6 units per reaction. the SDA was carried out for two hours at 39 ° C and the amplification reaction was stopped by heating for 3 minutes at 95 ° C.

The amplification products were detected in the chemiluminescence assay of C.A. Spargo and others, supra. Detector probes irradiated with alkaline phosphatase, SEQ ID NO: 9 and SEQ ID NO: 10 were added to the microtiter wells with the capture probes SEQ ID NO: 7 and SEQ ID NO: 8. This mixture was incubated for 45 minutes at 37 ° C. After incubation, the microtiter wells were washed three times with a rigorous wash stabilizer (300 microliters per wash). LUMIPHOS 530 (Limigen, Inc.) and then added to the wells and incubated for 30 minutes at 37 ° C. The luminescence was detected using a luminometer (LUMISCAN, Labsystems) and relative light units (RLU) that were recorded. The results are shown in Table 2. Table 2 GENOMY SPECIES / REACTION RLU M. Avi um 10,000 45049 1,000 31417 100 9656 10 3082 M. Intracell ulare 10,000 46847 1,000 22048 100 3480 10 20 The results demonstrate a sensitivity of 10 genomes per M avium and a sensitivity of 100 genomes for M. intracellulare.

EXAMPLE 2 To determine the specificity of the primers for M. avi um and M. intracell ulare, the genomic DNA of several mycobacteria and non-mycobacterial species (listed in Table 3) were used as a target in SDA. The amplification reaction was carried out as described in Example 1, except that the internal control sequences were not included and the reactions were not decontaminated. The results are shown in Table 3.

Table 3 GENE / GENOME SPECIES / RLU REACTION Mycobacterium africanum 500,000 38 Myc obacteri um avi um 100 2796 Mycobacterium um bovis 500,000 43 Mycobacterium bovis BCG 500,000 118 Mycobacterium um chelonae 500,000 32 -Vfycojacte ium fortui tum 500,000 39 Mycobacterium gordonae 500,000 192 Mycojbacteriu-p intracellulare 100 292 Mycobacteri um kansasii 500,000 45 Mycobacterium paratuberculosis 500,000 77615 Mycobacterium um tuberculosis 500,000 93 Mycobacteri um xenopi 500,000 33 and soil bacteria 500,000 109 Mycobacterium szulgai 500,000 15 Mycobacterium um marinum 500,000 24 Mycobacterium gastri 500,000 60 Mycobacterium haemophil um 500,000 92 Mycobacterium um malmoense 500,000 383 andcobacterium flavescens 500,000 103 Mycobacterium um genovense 500,000 110 Corynebacterium dipftheriae 500,000 18 Nocardia asteroides 500,000 25 Nocardia brazili ensis 500,000 71 Propri oniumbacterium acnes 500,000 10 Rhodococcus eoui 500,000 19 Streptomyces albus 500,000 32 The results show that there is no significant amplification in the species other than the MAC. The amplification in M. paratuberculosis is compatible, since this organism is considered as a subspecies of M. avium. In most cases, the signals of M. intracellular and M. avi um were of similar intensity. However, in this example, the M. intracell ulare target provided a low signal but an easily detectable positive signal. The M. malmoense signal detected in this experiment is believed to be an artifact of high number of copies of the blank and would be negative in copy numbers comparable with the samples of the MAC species.

EXAMPLE 3 The specificity of the amplification was determined using used cells of 28 serovars from M. avi um and M. intracellulare. The SDA was carried out as defined in Example 1 with the exception of the omission of the decontamination and the internal control sequence. Approximately 20,000 genomic targets of each serovar were tested for amplification except for serovars 2 and 16 (100 genomes tested). The results are shown in Table 4.

Table 4 SEROVAR RLU SEROVAR RLU ÍA 35536 13 3509 IB 23534 14 12751 2 12271 (100 GENOMAS) 15 4280 2B 13646 16 10029 (100 GENOMAS) 3 39213 17 18737 4A 42663 18 75 (NEGATIVE) 4B 10564 19 975 (POSITIVE WEAK) 5 32975 20 21150 6 32427 21 35691 7A 479 (POSITIVE WEAK) 22 30 (NEGATIVE) 7B 11705 23 67201 8 11155 24 39853 9 25123 25 2942 10A 17964 26 2978 10B 34342 27 29329 11 13113 28 833 (POSITIVE WEAK) 12 2785 Ventiseis of the ventiocho serovars were amplified and detected satisfactorily using the primers and probes of the invention. The serovars 7A, 19 and 28 were weakly positive, but easily detectable.

The serovars 18 and 22 were not amplified, but represent only a small percentage of the serovars found in the clinical samples. The eight serovars that represent approximately 90 percent of the positive clinical samples were easily detected.

EXAMPLE 4 The target sequence of adnJ was amplified in M. avium and M. intracell ulare using SEQ ID NO: 1 and SEQ ID NO: 3 as amplification primers. SEQ ID NO: 4 and SEQ ID: 5 were the shock primers. The SDA reactions were carried out essentially as described in Example 1 with either 0 or 20,000 copies of the genomic DNA of M. avi um or M. intracell ulare. For comparison purposes, SEQ ID NO: 3 was replaced by SEQ ID NO: 2 in some reactions. The finished reaction mixtures were assayed for the presence of specific amplification products for the target fragment of adnJ of any species using the detector probe of SEQ ID NO: 11 for M. avi um and the SEQ ID detector probe. NO: 12 for M. intracell ulare in a primer extension assay. To perform the assay, a 10 microliter aliquot of the finished reaction mixture was combined with 24 microliters of a mixture containing 35 mM TRIS-HCl (pH 8.0), 7 mM MgCl2, 350 microns of each dCTP , dGTP, dTTP and dATPaS yy 1.65 pmoles of the detector probe irradiated with 5'-32P. The mixtures were heated at 95 ° C for two minutes and then placed in a 3 ° C water bath. After 3 to 5 minutes, an exo unit "Klenow in 3 microliters of H2O was added to each sample and the samples were incubated at 37 ° C for 20 minutes.The extension reactions were terminated by the addition of 40 microliters of 50 percent urea and 0.5X TBE After heating at 95 ° C for 2 minutes, aliquots of 10 microliters were analyzed by denaturing gel electrophoresis on a 10 percent polyacrylamide gel and autoradiography. that SEQ ID NO: l SEQ ID NO: 3 amplified the target in both species. However, the M. avium target was amplified at least up to 50 times more efficiently by this pair of amplification primers than the M. intracell ulare target. The target binding sequences of SEQ ID NO: 1 and SEQ ID NO: 3 form perfect duplicates when they hybridize to the M. avi um target, but contain single nucleotide mismatches when any primer hybridizes to M. intracell ulare . This may account for a less efficient amplification of the M. intracell ulare target. When SEQ ID NO: 3 is replaced by SEQ ID NO: 2, the amplification efficiency is increased by approximately 10 times. This may be due to the fact that the target binding sequence of SEQ ID NO: 2 hybridizes to the target of M. intracell ulare, with perfect complementarity. Unexpectedly, however, the substitution of SEQ ID NO: 2 does not reduce the efficiency of target amplification in M. avi um despite the introduction of the single-nucleotide inequality when this primer hybridizes to the M. blank. avi um LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: Schram, James L. Nadeau, James G. Dean, Cheryl H. (ii) TITLE OF THE INVENTION: AMPLIFICATION AND DETECTION OF COMPLEX SPECIES OF MYCOBACTERIUM AVIUM (iii) SEQUENCE NUMBER: 12 (iv) ADDRESS FOR CORRESPONDENCE: (A) CONSIGNEE: Richard J. Rodrick, Becton Dickinson and Company (B) STREET: 1 Becton Drive (C) CITY: Franklin Lakes (D) STATUS: NJ (E) COUNTRY: United States (F) POSTAL CODE: 07417 (V) COMPUTER LEADABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patent in release # 1.0, Version # 1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) ATTORNEY / AGENT INFORMATION: (A) NAME: Fugit; Donna R. (B) REGISTRATION NUMBER: 32,135 (C) ATTORNEY'S NUMBER OF REFERENCE / TOCA: P-3274 (2) INFORMATION FOR SEQ ID NO: l (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (ix) PARTICULARITY: (A) NAME / KEY: linkage (B) LOCATION: 25..34 (D) OTHER INFORMATION: / function = "target link sequence" (ix) PARTICULARITY (A) NAME / KEY: particularity_subsequence (B) LOCATION: 19..24 (D) OTHER INFORMATION: / name_normal = "restriction endonuclease recognition site" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: l: TTGAACTCAC TCACTATTGT TGACCGGCGA ACGA 34 (2) INFORMATION FOR SEQ ID NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) PARTICULARITY: (A) NAME / KEY: linkage (B) LOCATION: 25..38 (D) OTHER INFORMATION: / normal_name = "white link sequence" (ix) PARTICULARITY: (A) NAME / KEY: particularity_subsequence (B) LOCATION: 19..24 (D) OTHER INFORMATION: / normal_name = "restriction endonuclease recognition site" ( xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: TTGAATAGTA GGATAGTAGT TGACAGGACA ACACGTTG 38 (2) INFORMATION FOR SEQ ID NO: 3 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) PARTICULARITY: (A) NAME / KEY: linkage (B) LOCATION: 25..37 ( D) OTHER INFORMATION: / name_normal = "white link sequence" (ix) PARTICULARITY: (A) NAME / KEY: particularity_multiple (B) LOCATION: 19..24 (D) OTHER INFORMATION: / name_normal = "recognition sequence of restriction endonuclease "(xi) DESCRIPTION OF SEQUENCE SEQ ID NO: 3: TTGAATAGTA GGATAGTAGT TGACCGACAA CACGTTG 37 (2) INFORMATION FOR SEQ ID NO: 4 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: AGCTGGGCGT CTC 13 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 5: GCGCTTGGCC G 11 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: GACAATCCCG C 11 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGOIA: linear ( ii) TYPE OF THE MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: GTGCGCCTCC GAC 13 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: ACCGCCTTGA ATC 13 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: ACGGCTTTGA ATC 13 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 10: GTGCGCCTCG GAG 13 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 11: TTCAAGGCGG TCTCC 15 (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) ) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF CHAIN: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO : 12: TTCAAAGCCG TGTCG 15

Claims (17)

1. R E I V I N D I C A C I O N E S: 1. An amplification primer comprising a target binding sequence that is selected from the group consisting of the target binding sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. 2. The primer of amplification of claim 1, which is selected from the group consisting of SEQ ID NO: l, SEQ ID NO: 2 and SEQ ID NO: 3. 3. An oligonucleotide consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. 4. An oligonucleotide consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12. The oligonucleotide of claim 4 which is irradiated with a detectable radioactivity. 6. A method for specific amplification of a target nucleotide complex complex of ycojbacterium avi um comprising: (a) hybridizing to the target nucleic acid a first amplification primer comprising the target binding sequence of the SEQ ID NO: 1, and a second amplification primer comprising the target binding sequence of SEQ ID NO: 2 or the target binding sequence of SEQ ID NO: 3, and; (b) amplifying the target nucleic acid in an amplification reaction in which the first and second primers of hybridized amplification extend into the target nucleic acid. The method according to claim 6, further comprising detecting the target nucleic acid amplified by hybridization to a detected probe comprising SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, marked as a detectable irradiation. 8. The method according to claim 7, wherein the amplified target nucleic acid is captured for detection by hybridization to a capture probe consisting of SEQ ID NO: 7 or SEQ ID NO: 8 labeled with a coordinator group. . The method according to claim 6, wherein the first and second amplification primers further comprise a recognition site for a restriction endonuclease that in it the recognition site when the recognition site is modified and the nucleic acid of White is simplified by Chain Offset Amplification. 10. The method according to claim 9, wherein the second amplification primer comprises the target binding sequence of SEQ ID NO: 2 and the first and second hybridized amplification primers are displaced from the target nucleic acid by extension of a first shock primer consisting of SEQ ID NO: 5 and a second shock primer consisting of SEQ ID NO: 6. 11. The method according to claim 9, wherein the second amplification primer comprises the sequence linkage of SEQ ID NO: 3 and the first and second hybridized amplification primers are displaced from the target nucleic acid by extension of a first shock primer consisting of SEQ ID NO: 4 and a second shock primer which consists of SEQ ID NO: 5. The method according to claim 6, wherein the first amplification primer consists of the target binding sequence of SEQ ID N O: 1, and the second amplification primer consists of the target binding sequence of SEQ ID NO: 2 or the target binding sequence of SEQ ID NO: 3, and the target nucleic acid is amplified by the Polymerase Chain Reaction. 13. A method for the specific amplification of a target nucleic acid complex of the MycoJac eriuin avium complex comprises: a) hybridizing to the target nucleic acid a first amplification primer consisting of SEQ ID NO: 1 and a second primer of amplification consisting of SEQ ID NO: 2 or SEQ ID NO: 3, and; b) Amplify the target nucleic acid by means of a Chain Displacement Amplification. 14. The method according to claim 13, which further comprises detecting the target nucleic acid amplified by hybridization to a detector probe consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12, labeled with a detectable irradiation . 15. The method according to claim 14, wherein the amplified target nucleic acid is captured for detection by hybridization to a capture probe consisting of SEQ ID NO: 7 or SEQ ID NO: 8 labeled with a coordinating group. . 16. The method according to claim 13, wherein the second amplification primer consists of SEQ ID NO: 2 and the first and second hybridized amplification primers are displaced from the target nucleic acid by extension of a first primer of shock that consists of the SEQ ID NO: 5 and a second shock primer consisting of SEQ ID NO: 6. 17. The method according to claim 13, wherein the second amplification primer consists of SEQ ID NO: 3 and the first and second hybridized amplification primers are displaced from the target nucleic acid by extension of a first shock primer consisting of SEQ ID NO: 4 and the second shock primer consisting of SEQ ID NO: 5.