MXPA06007377A - Il-7 fusion proteins - Google Patents

Abstract

The invention relates to interleukin-7 (IL-7) fusion proteins, methods of their production and uses thereof. The fusion proteins comprise an immunoglobulin portion fused directly or indirectly to IL-7, which was modified at specific positions as compared to the wild -type IL-7 in order to improve biological and pharmaceutical properties. The proteins of the invention are particularly useful in treating disorders accompanied by immune deficiencies and particularly diseases which involve T-cell deficiencies.

Description

FUSION PROTEINS OF IL-7 FIELD OF THE INVENTION The invention relates to fusion proteins of interleukin-7 (IL-7), methods for their production and uses thereof. The fusion proteins comprise a portion of immunoglobulin fused directly or indirectly to IL-7, which is modified at specific positions compared to natural IL-7 in order to improve the biological and pharmaceutical properties. The proteins of the invention are particularly useful for treating disorders accompanied by immunological deficiencies and particularly diseases involving deficiencies of T lymphocytes. BACKGROUND OF THE INVENTION Many disorders and treatments involve a deficiency of immune cells. For example, HIV infection results in the loss of CD4 + T lymphocytes, while treatments such as chemotherapy and radiation therapy generally result in the loss of a wide variety of blood cells. Attempts have been made to improve specific protein drugs that can replenish specific types of immune cells that have been lost as a result of disease or treatment. For example, in cancer chemotherapy, erythropoietin is used to replenish Ref. 172283 erythrocytes, granulocyte colony stimulating factor (G-CSF) is used to replenish neutrophils and granulocyte and macrophage colony stimulating factor (GM-CSF) is used to replenish granulocytes and macrophages. These proteinaceous drugs, although beneficial, have a relatively short serum half-life in such a way that the replenishment of immune cells is often insufficient. In addition, no specific treatment is currently in clinical use to specifically stimulate the development of T or B lymphocytes, although the loss of these cells as a result of disease or after certain myelosuppressive treatments is known to be particularly harmful to health of a patient. Therefore, there is a need in the art to develop stimulators and restorers of the immune system, particularly lymphocytes that have longer serum half-lives. SUMMARY OF THE INVENTION The present invention relates to fusion proteins of interleukin-7 (IL-7) which have improved biological properties compared to the corresponding natural IL-7 proteins. In addition, the present invention is based, in part, on the finding that fusion proteins of IL-7 have particular structural characteristics and exhibit improved biological properties compared to recombinant wild-type IL-7. Accordingly, in one aspect, the invention features a fusion protein that includes a first portion comprising an immunoglobulin (Ig) chain and a second portion comprising interleukin-7 (IL-7), wherein the fusion protein of IL-7 has an increased biological activity such as an extended serum half-life or in promoting the survival or expansion of immune cells, compared to natural IL-7. In one embodiment, the invention represents a fusion protein that includes a first portion that includes an Ig chain and a second portion that includes IL-7, wherein the amino acid residues at positions 70 and 91 of IL-7 are glycosylated and the amino acid residue at position 116 of IL-7 is non-glycosylated. Throughout this document, the amino acid positions of IL-7 refer to the corresponding positions in the mature human IL-7 sequence. In one embodiment, the amino acid residue at position 116 of IL-7 is asparagine. In another embodiment, the amino acid residue at position 116 of IL-7 is altered so that it does not serve as a glycosylation site. In one embodiment, the portion of IL-7 comprises disulfide bonds between Cys2 and Cys92, Cys34 and Cysl29, and Cys47 and Cysl41 of IL-7.

In another embodiment, the invention includes a fusion protein that includes a first portion that includes an Ig chain and a second portion that includes IL-7, wherein IL-7 comprises a disulfide linkage between Cys2 and Cys92, Cys34 and Cysl29, and Cys47 and Cysl41 of IL-7. In one embodiment, the amino acid residue at position 116 of IL-7 is non-glycosylated. In another embodiment, the amino acid residue at position 116 of IL-7 is asparagine or is altered such that it does not serve as a glycosylation site. In another embodiment, amino acid residues at positions 70 and 91 of IL-7 are glycosylated. The Ig chain is generally an intact antibody or a portion thereof, such as an Fe region. The Ig chain of the IL-7 fusion protein can be derived from any known Ig isotype and can include at least a portion of one or more constant domains. For example, in constant domain it can be selected from the group consisting of a CH1 region, a hinge region, a CH2 region and a CH3 region. In one embodiment, the Ig portion includes a hinge portion, a CH2 region and a CH3 region. The chain Ig is optionally connected to the IL-7 portion by a linker. Ig portions of a single antibody isotype, such as IgG1 or IgG2, and hybrid portions of Ig are allowed in the present invention. For example, in one embodiment, the Ig portion includes a hinge region derived from one isotype (for example, IgG2) and a CH region from another isotype (ie, IgG1). An Ig chain that includes a Fe IgGl portion can advantageously be modified to include the Asn297Gln and Tyr296Ala mutations. In addition, an Ig chain that includes a Fe portion of IgG2 can be advantageously modified to include the Asn297Gln and Phe296Ala mutations. The IL-7 portion of the IL-7 fusion protein described above may comprise the mature portion of the IL-7 portion. In one embodiment, the IL-7 portion may further include a deletion, such as an internal deletion. In one example, IL-7 may include eighteen amino acid deletions of amino acids 96 to 114 of IDENTIFICATION SEQUENCE NUMBER: 1. In other embodiments, the invention includes purified nucleic acids encoding the IL-7 fusion proteins described in the above and cultured host cells that include these nucleic acids. In another aspect, the invention includes a method for preparing an IL-7 fusion protein that includes expressing in a host cell the nucleic acid described above and harvesting the fusion protein. In another aspect, the invention includes a composition such as a pharmaceutical composition, which includes the fusion protein described in the foregoing.

In another aspect, the invention includes a method for treating a patient by administering Fc-IL-7 fusion proteins. BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the amino acid sequence of human T.L-7 (SEQUENCE OF IDENTIFICATION NUMBER: 1). In bold, the signal sequence is shown. In bold and italics, a sequence of 18 amino acids is also present, which can be deleted from the IL-7 sequence. Figure 2 shows the amino acid sequence of cow IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 2). The signal sequence is shown in bold. Figure 3 shows the amino acid sequence of sheep IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 3). The signal sequence is shown in bold. Figure 4 shows the amino acid sequence of mature human Fcγ1-IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 4). Figure 5 shows the amino acid sequence of mature human Fc? 2 (h) (FN> AQ) -IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 5). Figure 6 shows the amino acid sequence of Fc? L (linker 1) -IL-7 human mature (SEQUENCE OF IDENTIFICATION NUMBER: 6). Figure 7 shows the amino acid sequence of mature Fc? L (YN> AQ) (linker 2) -IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 7).

Figure 8 shows the amino acid sequence of Fc? I (YN> AQ, d) (linker 2) -IV-7 human mature SEQUENCE OF IDENTIFICATION NUMBER: 8). Figure 9 shows the nucleic acid sequence of the Fe region of human Fcγ1-IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 22). Figure 10 shows the nucleic acid sequence for the Fe region of Fc? I (YN> AQ) -IL-7 human (SEQUENCE OF IDENTIFICATION NUMBER: 21). Figure 11 is a nucleic acid sequence for the Fe region of human Fcγ2 (h) -IL-7 (SEQUENCE OF IDENTIFICATION NUMBER: 20). Figure 12 is the nucleic acid sequence for the Fe region of Fc? 2 (h) (FN> AQ) -IL-7 human (SEQUENCE OF IDENTIFICATION NUMBER: 19). Figure 13 is a graphical representation of the pharmacokinetic profile of recombinant human IL-7 (open frames) and the fusion protein Fc? 2 (h) FN > AQ) -IL-7 (white diamonds) of example 7. The serum concentration of the IL-7 fusion proteins administered (in ng / ml) is measured with respect to time (in hours). Figure 14 is a graphic representation of the reconstitution of B lymphocytes in mice with transplanted bone marrow, and subjected to irradiation and treated with recombinant human IL-7 (white symbols), with human Fc-IL-7 (black symbols) or PBS (X). The proteins are administered every third day (frames) or once a week (triangles). the dotted line represents the concentration of B lymphocytes in donor mice. Figure 15 is a graphical representation of the reconstitution of T lymphocytes in mice with transplanted, irradiated bone marrow treated with recombinant IL-7 (white symbols), with human Fc-IL-7 (black symbols) or with PBS (X). The proteins are administered every third day (frames) or once a week (triangles). The dotted line represents the concentration of T lymphocytes in donor mice. Figure 16 is a plot of dots representing the lymphocyte populations of blood samples (upper row) and spleen (lower row) of irradiated, bone marrow transplanted mice treated with huFc? 2 ( h) (FN > AQ) -IL-7 (first two columns) and untreated controls (last column). The first column represents reconstituted endogenous lymphocytes (CD45.2 +) and the second column represents reconstituted donor lymphocytes (CD45.1 +). T lymphocytes are detected as CD3 positive cells that are shown in the lower right quadrant. B lymphocytes are detected as 220 B positive cells, which are shown in the upper left quadrant.

DETAILED DESCRIPTION OF THE INVENTION The invention provides IL-7 fusion proteins that have improved biological activity compared to natural IL-7 proteins. In particular, the invention provides IL-7 fusion proteins that include an immunoglobulin (Ig) moiety. These Ig-IL-7 fusion proteins have improved biological activity, such as an extended serum half-life, compared to natural IL-7 proteins, which makes them suitable for use in the treatment of conditions accompanied by cell deficiencies. immunological conditions such as lymphocyte deficiencies. The invention is additionally based, in part, on the finding that IL-7 fusion proteins having particular structural characteristics also have improved biological properties. Although the amino acid sequence of mammalian IL-7 is well known, information about the structure of eukaryoticly derived IL-7 proteins, including for example the manner in which the protein is renatured and the effects of linked glycosylation sites to N predicted regarding its biological activity, remains incompletely defined. For example, the human IL-7 protein has a cysteine at positions 2, 34, 47, 92, 129 and 141 of the mature protein and 3 potential bound N glycosylation sites in the Asparagine (Asn) 70 positions, Asn91 and Asnll6. However, the precise structure of IL-7 synthesized under eukaryotic conditions is not known. The present invention includes IL-7 fusion proteins that have particular structural forms and improved biological activity. For example, IL-7 fusion proteins having a disulfide-binding pattern of Cys2-Cys92, Cys34-Cysl29 and Cys47-141 are more active in vivo than recombinant wild-type IL-7 protein. In addition, the invention provides a form of an IL-7 fusion protein in which only two of three potential N-linked glycosylation sites of IL-7 are glycosylated. Specifically, Asn70 and Asn91 are glycosylated from the mature protein, whereas the N-linked glycosylation site predicted in IL-7 Asnll6 is not glycosylated. Such a fusion protein of IL-7 is more active in vivo than natural recombinant IL-7. The invention also includes IL-7 fusion proteins wherein the IL-7 portion contains a deletion and which retains comparable activity compared to the corresponding unmodified IL-7 fusion proteins. For example, the invention provides a form of Ig-IL-7 in which the IL-7 portion contains an internal suppression of eighteen amino acids corresponding to the sequence VKGRKPAALGEAQPTKSL (SEQUENCE OF IDENTIFICATION NUMBER: 9).

Interleukin-7 Fusion Proteins Typically, the protein portion of IL-7 is fused to a carrier protein. In one embodiment, the carrier protein is placed towards the N-terminal part of the fusion protein and the IL-7 protein is placed towards the C-terminal part. In another embodiment, the IL-7 fusion protein is placed towards the N-terminal part of the fusion protein and the carrier protein is placed towards the C-terminal part. As used herein, the term "interleukin-7" or "IL-7" mean IL-7 polypeptides and derivatives and analogs thereof having a substantial amino acid sequence identity with natural mature mammalian IL-7, and substantially equivalent biological activity, for example, in standard bioassays or in IL-7 receptor binding affinity assays. For example, IL-7 refers to an amino acid sequence of a recombinant or non-recombinant polypeptide having an amino acid sequence of: i) a native allelic variant or as found in the nature of an IL-7 polypeptide, ii ) a biologically active fragment of an IL-7 polypeptide, iii) a biologically active polypeptide analogue of an IL-7 polypeptide, or iv) a biologically active variant of an IL-7 polypeptide. The IL-7 polypeptides of the invention can be obtained from any species, for example, human, cow or sheep. The nucleic acid for IL-7 as well as the amino acid sequences are well known in the art. For example, the amino acid sequence for human IL-7 has an access number in Genbank NM 000880 (SEQUENCE OF IDENTIFICATION NUMBER: 1) and is shown in Figure 1; the amino acid sequence for mouse IL-7 has a Genbank accession number of NM 008371; the amino acid sequence for rat IL-7 has the Genbank accession number of AF 367210; the amino acid sequence for yaca IL-7 has the access number Genbank of NM 173924 (SEQUENCE OF IDENTIFICATION NUMBER: 2) and is shown in Figure 2; and the amino acid sequence for sheep IL-7 has the Genbank accession number of U10089 (SEQUENCE OF IDENTIFICATION NUMBER: 3) and is shown in Figure 3. The signal sequence for each of the polypeptide species is shown in bold type in each of the figures and is typically not included when the portion of IL-7 is fused in the C-terminal portion to the carrier protein. A "variant" of an IL-7 protein is defined as the amino acid sequence that is altered by one or more amino acids. The variant may have "conservative" changes, wherein the substituted amino acid has similar structural or chemical properties, for example substitution of leucine with isoleucine. More rarely, a variant it can have "non-conservative" changes, for example replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. The guide to determine which and how many amino acid residues can be substituted, inserted or deleted without abolishing the biological activity can be found using computer programs well known in the art, for example the programming elements (software) for molecular modeling. or to produce alignments. The variant of IL-7 proteins included within the invention includes IL-7 proteins that retain IL-7 activity. IL-7 polypeptides which also include additions, substitutions or deletions are also included within the invention to the extent that the proteins retain a substantially equivalent biological activity of IL-7. For example, slices of IL-7 which retain comparable biological activity as the full-length form of the IL-7 protein are included within the invention. The activity of the IL-7 protein can be measured using in vitro cell proliferation assays such as those described in Example 6 below. The activity of the IL-7 variants of the invention that maintain biological activity of at least 10%, 20%, 40% or 60%, but more preferably 80%, 90%, 95% and even more preferably 99% compared to wild-type IL-7. The variant IL-7 proteins also include polypeptides having at least about 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or more of Sequence identity with wild-type IL-7. To determine the percent identity of two amino acid sequences or two nucleic acids, the sequences are aligned for optimal comparison purposes (eg, separations can be introduced into the sequence of a first amino acid or nucleic acid sequence for alignment optimal with a second amino acid or nucleic acid sequence). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (ie,% homology = # of identical positions / total # of positions, multiplied by 100). The determination of the percentage of homology between two sequences can be carried out using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm used for the comparison of the two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nati Acad. Sci. USA 87: 2264-68, modified as indicated by Karlin and Altschul (1993) Proc. Nati Acad. Sci. USA 90: 5873-77. Such an algorithm is incorporated into the NBLAST programs and XBLAST from Altschul, et al (1990) J. Mol. Biol. 215: 403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12. BLAST protein searches can be performed with the XBLAST program, score = 50, word length = 3. To obtain alignments with separations For comparison purposes, Gapped BLAST can be used as described in Altschul et al. , (1997) Nucleic Acids Research 25 (17): 3389-3402. When the BLAST and Gapped BLAST programs are used, the implicit parameters of the respective programs can be used (for example XBLAST and NBLAST). Potential epitopes for T lymphocytes or B lymphocytes in the IL-7 moiety can be separated or modified in the Fc-IL-7 fusion proteins of the invention. IL-7 portions deimmunized in exemplary manner are described in the provisional patent application of E.U.A. entitled "IL-7 Variants with Reduced Immunogenicity" (Proxy File No. LEX-035PR), which was filed with the United States Patent and Trademark Office on December 9, 2004. Carrier Protein Carrier protein may be any portion covalently fused to the IL-7 protein. In one embodiment, the carrier protein is albumin, for example, human serum albumin. In another modality, the protein carrier is an immunoglobulin (Ig) moiety, such as the Ig heavy chain. The Ig chain can be derived from IgA, IgD, IgE, .IgG or IgM. According to the invention, the Ig portion can form an intact antibody and can direct the IL-7 fusion protein to specific target sites in the body. Fusion proteins that make use of antibody targeting are known in the art. In another embodiment, the carrier Ig portion further comprises an Ig light chain. In one embodiment, the Ig portion comprises a Fe region. As used herein, a "Fe moiety" encompasses domains derived from the constant region of an immunoglobulin, preferably a human immunoglobulin, which includes a fragment, analog, variant, mutant or derivative of the constant region. Suitable immunoglobulins include IgG1, IgG2, IgG3, IgG4 and other classes. The constant region of an immunoglobulin is identified as a polypeptide homologue as found in nature or synthetically produced for the C-terminal region of the immunoglobulin and may include a CH1 domain, a hinge, a CH2 domain, a CH3 domain or a CH4 domain, separate or in any combination. In the present invention, the Fe portion typically includes at least one CH2 domain. For example, the Fe portion may include hinge of CH2-CH3. Alternatively, the Fe portion may include all or a portion of the hinge region, the CH2 domain and / or the CH3 domain and / or the CH4 domain. The constant region of an immunoglobulin is responsible for many important functions of the antibody that include binding to the Fe receptor (FcR) and complement fixation. There are five main classes of heavy chain constant region, classified as IgA, IgG, IgD, IgE and IgM. For example, IgG is separated into four subclasses: 1, 2, 3 and 4, also known as IgGl, IgG2, IgG3 and IgG4, respectively. IgG molecules interact with multiple classes of cellular receptors that include three classes of Fc? (Fc? R) specific for the class of antibody IgG, specifically Fc? RI, Fc? RII and Fc? RIII. Important sequences for the binding of IgG to Fc? R receptors have been reported to be located in the CH2 and CH3 domains. The serum half-life of an antibody is determined by the ability of said antibody to bind to a Fe receptor (FcR). Similarly, the half-life of immunoglobulin fusion proteins is also determined by their ability to bind to said receptors (Gillies et al., (1999) Cancer Res. 59: 2159-66). In comparison with IgGl, the CH2 and CH3 domains of IgG2 and IgG4 have biochemically undetectable or reduced binding affinity to Fe receptors. Immunoglobulin fusion proteins containing the CH2 and CH3 domains of IgG2 or IgG4 have been reported to have longer serum half-lives in comparison to corresponding fusion proteins containing the CH2 and CH3 domains of IgGl (US Patent No. 5,541,087; Lo et al., (1998) Protein Engineering, 11: 495-500). Accordingly, in some embodiments of the invention, preferred domains CH2 and CH3 are derived from an antibody isotype with reduced receptor binding affinity and effector functions, such as, for example, IgG2 or IgG4. The most preferred CH2 and CH3 domains are derived from IgG2. The hinge region is normally located in the C-terminal part relative to the CH1 domain of the heavy chain constant region. In the IgG isotypes, the disulfide bonds typically occur within this hinge region, which allows a final tetrameric antibody molecule to be formed. This region is dominated by prolines, serines and threonines. When included in the present invention, the hinge region is typically at least homologous to the immunoglobulin region as found in nature that includes the cysteine residues to form disulfide bonds that link the two Fe portions. The sequences representative of the hinge regions for human and mouse immunoglobulins are known in the technique and can be found in Borrebaeck, ed. , (1992) Antibody Engineering, A Practical Guide, W. H. Freeman and Co. The hinge regions suitable for the present invention can be derived from IgG1, IgG2, IgG3, IgG4 and other classes of immunoglobulins. The IgG1 hinge region has three cysteines, the second and third of which are involved in the disulfide bonds between two heavy chains of the immunoglobulin. These same two cysteines allow the formation of an effective and consistent disulfide bond of a Fe moiety. Therefore, a preferred hinge region of the present invention is derived from IgG1, more preferably human IgG1, wherein the first cysteine preferably it is mutated into another amino acid, preferably serine. The isotype IgG2 hinge region has four disulfide bonds that tend to promote oligomerization and possibly the formation of an incorrect disulfide bond during secretion in recombinant systems. A region of suitable hinges can be derived from an IgG2 hinge; the first two cysteines are preferably mutated, each with another amino acid. It is known that the hinge region of IgG4 inefficiently forms disulfide bonds between chains. However, a hinge region suitable for the present invention can be derived from the hinge region IgG4, which it preferably contains a mutation that enhances the correct formation of disulfide bonds between the portions derived from heavy chain (Angal et al (1993) Mol. Immunol., 30: 105-8). In accordance with the present invention, the Fe moiety may contain CH2, CH3 and / or CH4 domains and a hinge region that is derived from different antibody isotypes, i.e., a hybrid Fe moiety. For example, in one embodiment, the Fe moiety contains CH2 and / or CH3 domains derived from IgG2 or IgG4 and a mutant hinge region derived from IgG1. As used in this application, Fc? 2 (h) refers to a modality in which the hinge is derived from IgGl and the remaining constant domains are from IgG2. Alternatively, a mutant hinge region of another subclass of IgG is used in a hybrid Fe moiety. For example, a mutant of the IgG4 hinge that allows the formation of effective disulfide bonds between the two heavy chains can be used. A mutant hinge can also be derived from an IgG2 hinge in which the first two cysteines have each mutated to another amino acid. Such hybrid Fe portions facilitate a high level of expression and improve the correct assembly of the Fc-IL-7 fusion proteins. The assembly of such hybrid Fe portions is known in the art and has been described in the published patent application of E.U.A. No. 2003-0044423.

In some embodiments, the Fe moiety contains amino acid modifications that generally extend the serum half-life of a Fe fusion protein. Such amino acid modifications include mutations that substantially decrease or eliminate Fe receptor binding or complement binding activity. For example, the glycosylation site within the Fe portion of an immunoglobulin heavy chain can be eliminated. In IgGl, the glycosylation site is Asn297 within the amino acid sequence Gln-Tyr-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 30). In other immunoglobulin isotypes, glycosylation corresponds to Asn297 of IgGl. For example, in IgG2 and IgG4, the glycosylation site is asparagine within the amino acid sequence Gln-Phe-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 29). Accordingly, a mutation of IgGl Asn297 separates the glycosylation site into a Fe portion derived from IgGl. In one embodiment, Asn297 is substituted with Gln. In other embodiments, the tyrosine within the amino acid sequence Gln-Tyr-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 30) is further mutated to eliminate an epitope of non-self potential T lymphocytes resulting from the mutation of asparagine. As used herein, a T lymphocyte epitope is a polypeptide sequence in a protein that interacts or binds to a CPH molecule class II. For example, the amino acid sequence Gln-Tyr-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 30) within a heavy chain IgGl can be substituted with an amino acid sequence Gln-Ala-Gln-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 28 ). Similarly, in IgG2 or IgG4, an asparagine mutation within the amino acid sequence Gln-Phe-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 29) separates the glycosylation site into a Fe portion derived from the heavy chain IgG2 or IgG4. In one embodiment, asparagine is replaced with a glutamine. In other embodiments, the phenylalanine within the amino acid sequence Gln-Phe-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 29) is further mutated to eliminate a non-self potential T-cell epitope resulting from the mutation of asparagine. For example, the amino acid sequence Gln-Phe-Asn-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 29) within the heavy chain IgG2 or IgG4 can be substituted with an amino acid sequence Gln-Ala-Gln-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 28). It has also been observed that alteration of the amino acids near the junction of the Fe portion and the non-Fe portion can markedly increase the serum half-life of the Fe fusion protein (U.S. Patent Application No. 2002). -0147311). Accordingly, the binding region of an IL-7 Fe or an IL-7 fusion protein Fe of the present invention may contain alterations which, relative to the sequences as found in the nature of an immunoglobulin heavy chain and IL-7, are preferably found within about 10 amino acids of the point of attachment. These amino acid changes can cause an increase in hydrophobicity, for example, by changing the C-terminal lysine of the Fe moiety to a hydrophobic amino acid such as alanine or leucine. In another, additional embodiment of the invention, the licina in the C-terminal portion and the glycine preceding the Fe portion are deleted. In other embodiments, the Fe moiety contains the amino acid alterations of the Leu-Ser-Leu-Ser segment near the C-terminus of the Fe portion of an immunoglobulin heavy chain. The amino acid substitutions of the segment Leu-Ser-Leu-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 27) eliminates the potential epitopes of T lymphocytes in the junctions. In one embodiment, the amino acid sequence Leu-Ser-Leu-Ser (SEQUENCE OF IDENTIFICATION NUMBER: 27) near the C-terminal part of the Fe portion is substituted with an amino acid sequence Ala-Thr-Ala-Thr (SEQUENCE OF IDENTIFICATION NUMBER: 26). In other embodiments, the amino acids within the Leu-Ser-Leu-Ser segment (SEQUENCE OF IDENTIFICATION NUMBER: 27) are substituted with other amino acids such as glycine or proline. Methods detailed to generate amino acid substitutions of the Leu-Ser-Leu-Ser segment (SEQUENCE OF IDENTIFICATION NUMBER: 27) near the C-terminal part of an IgG1, IgG2, IgG3 or IgG4 or other molecules of the immunoglobulin class, as well as other Exemplary modifications for altering epitopes of T lymphocytes in the junctions are found in U.S. Published Patent Application No. 2003-0166877. Separator In one embodiment, a separator or linker peptide is inserted between the carrier protein and the IL-7 fusion protein. For example, the separator can be placed immediately towards the C-terminal part of the last amino acid of an Ig constant region. The separator or binding peptide is preferably not charged, and more preferably is non-polar or hydrophobic. The length of a binder or peptide linker is preferably between 1 and about 100 amino acids, more preferably between 1 and about 50 amino acids, or between 1 and about 25 amino acids, and even more preferably between 1 and about 15 amino acids, and even more preferably less than 10 amino acids. In one embodiment, the separator contains a sequence (GS) n, wherein n is less than 5. In a preferred embodiment, the separator contains the sequence GSG4 (SEQUENCE OF IDENTIFICATION NUMBER: 25). In another additional modality, the The separator contains a motif that is recognized as an N-linked glycosylation site. In yet another embodiment, the separator contains a motif that is recognized by a site-specific separation agent. In an alternative embodiment of the invention, the carrier protein and the IL-7 fusion protein are separated by a synthetic separator, for example a PNA separator, which is preferably uncharged, and preferably is non-polar or hydrophobic. Production of IL-7 Fusion Proteins Non-limiting methods for synthesizing useful embodiments of the invention are described in the examples herein, as well as assays useful for testing in vitro properties and pharmacokinetic activities and in vivo in animal models . IL-7 fusion proteins can be produced using recombinant expression vectors known in the art. The term "expression vector" refers to a replicable DNA construct used to express DNA which encodes the desired IL-7 fusion protein and which includes a transcriptional unit comprising an assembly of: (1) one or several genetic elements that have a regulatory role in the expression of the gene, for example promoters, operators or enhancers, operably linked to: (2) a DNA sequence that encodes the desired IL-7 fusion protein, which is transcribed in MRNA and translated into a protein, and (3) appropriate sequences of transcription and translation initiation and completion. The selection of the promoter and other regulatory elements generally varies according to the proposed host cell. A preferred expression vector of the invention is an expression vector Fe derived from the expression vector PdCs-huFc described in Lo et al., Protein Engineering (1998) 11: 495. In a preferred example, the nucleic acid encoding the IL-7 fusion protein is transfected into a host cell using recombinant DNA techniques. In the context of the present invention, the foreign DNA includes a sequence coding for the proteins of the invention. Suitable host cells include prokaryotic, yeast or higher eukaryotic cells.

Preferred host cells are eukaryotic cells. The recombinant IL-7 fusion proteins can be expressed in yeast hosts, preferably of the Saccharomyces species, such as S. cerevisiae. Yeasts of other genera such as Pichia or Kluyveromyces can also be used. Yeast vectors will generally contain an origin of replication of a yeast plasmid or autonomously replicating sequence (ARS), a promoter, a DNA that codes for the IL-7 fusion protein. , sequences for polyadenylation and completion of transcription and a selection gene. Suitable promoter sequences in yeast vectors include metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes such as enolase, glyceraldehyde-3-phosphate, dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-4-phosphate isomerase, 3- Phosphoglycerate mutase, purivate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase. Various mammalian or insect cell culture systems can be used to express the recombinant protein. Baculovirus systems for the production of proteins in insect cells are well known in the art. Examples of suitable mammalian host cell lines include NS / 0 cells, L cells, C127 cells, 3T3 cells, Chinese hamster ovary (CHO), HeLa cells and BHK cell lines. Additional suitable mammalian host cells include CV-1 cells (ATCC CCL70) and COS-7 cells, both derived from monkey kidney. Another line of suitable monkey kidney cells, CV-1 / EBNA is derived by transfection of the CV-1 cell line with a gene encoding the Epstein-Barr virus (EBNA-1) nuclear antigen-1 and with a vector containing CMV regulatory sequences (McMahan et al., (1991) EMBO J. 10: 2821). The gene for EBNA-1 allows the episomal replication of expression vectors, such as HAV-EO or pDC406, which contain the EBV origin of replication. Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, or a suitable promoter or enhancer linked to the gene to be expressed, and other non-transcribed 5 'or 3' flanking sequences, and untranslated sequences. 5 'or 3', such as the necessary ribosome binding sites, a polyadenylation site, a splice donor and acceptor sites as well as transcriptional termination sequences. The promoters and enhancers commonly used are derived from polyoma, adenovirus 2, Simian virus 40 (SV40) and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, of SV40 origin, the early and late promoter, the enhancer, the splice and the polyadenylation sites can be used to provide the other genetic elements necessary for the expression of a sequence of Heterologous DNA. For secretion of the IL-7 fusion protein from a host cell, the expression vector comprises DNA encoding a leader peptide signal. In the present invention, the DNA encoding the native signal sequence of IL-7 can be used or alternatively a DNA encoding a signal sequence can be used. heterologous such as the signal sequence of another interleukin or of a secreted ig molecule. The present invention also provides a method for preparing the recombinant proteins of the present invention which includes culturing host cells transformed with an expression vector comprising a DNA sequence encoding the IL-7 fusion protein under conditions that promote expression. The desired protein is then purified from the culture medium or cell extracts. For example, supernatants of expression systems that secrete recombinant protein into the culture medium must first be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. After the concentration step, the concentrate can be applied to a suitable purification matrix, as is known in the art. For example, Fc-IL-7 fusion proteins are conveniently retained using a matrix coupled to protein A. An "isolated" or "purified" IL-7 fusion protein or a biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the IL-7 fusion protein is derived, or substantially free of chemical precursors or other chemical substances when chemically synthesized. The phrase "substantially free of cellular material" includes IL-7 fusion protein preparations in which the protein is separated from cellular components of the cells from which it is isolated or produced recombinantly. In one embodiment, the phrase "substantially free of cellular material" includes preparations of IL-7 fusion protein having less than about 30% (by dry weight) of fusion protein other than IL-7 (also referred to herein as "contaminating protein"), more preferably, less than about 20% fusion protein other than IL-7, still more preferably less than about 10% fusion protein other than IL-7, and much more more preferable less than about 5% fusion protein other than IL-7. When the IL-7 fusion protein or a biologically active portion thereof is purified from a recombinant source, it is also preferably substantially free of culture medium, i.e., the culture medium represents less than about 20. %, more preferably less than about 10% and much more preferably less than about 5% of the volume of the protein preparation. The term "substantially pure Ig-IL-7 fusion protein" refers to a preparation in which the Ig-IL-7 fusion protein constitutes at least 60%, 70%, 80%, 90%, 95% or 99% of the protein in the preparation. In one embodiment, the invention includes substantially pure preparations of Ig-IL-7 fusion proteins that have a disulfide bonding pattern between Cys2 and Cys92, Cys34 and Cysl29, and Cys47 and Cysl41. In another embodiment, the invention represents substantially pure preparations of the Ig-IL-7 fusion proteins wherein Asnll6 is non-glycosylated but Asn70 and ASn91 are glycosylated. Methods of treatment using Fc-IL-7 proteins The IL-7 fusion proteins of the invention are useful for treating immunological deficiencies and for accelerating the natural reconstitution of the immune system that occurs, for example, after diseases or treatments that are immunosuppressive nature. For example, IL-7 fusion proteins can be used to treat infectious pathogens, immunological disorders and to enhance the growth (including proliferation) of specific immune cells. Further. The IL-7 fusion proteins can be used in the treatment of cancers such as bladder cancer, lung cancer, brain cancer, breast cancer, skin cancer and prostate cancer. In one example, it is useful to treat patients who have experienced one or more cycles of chemotherapy with IL-7 fusion proteins as described above to assist in the replenishment of their immune cells. Alternatively, IL-7 fusion proteins are useful in adoptive T lymphocyte transplants. For example, IL-7 fusion proteins can be administered to facilitate the expansion and survival of transplanted T lymphocytes or to expand other populations of T lymphocytes ex vivo. Alternatively, it is also useful to administer the IL-7 fusion proteins described above to HIV patients, the elderly, patients, receiving a transplant or other patients with a depressed immune system function. Administration The IL-7 fusion proteins of the invention can be incorporated into a suitable pharmaceutical composition for administration. Such compositions typically comprise the IL-7 fusion protein and a pharmaceutically acceptable carrier. As used herein, the phrase "pharmaceutically acceptable carrier" is intended to include any and all of the solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and delaying absorption agents and the like, compatible with the pharmaceutical administration. The use of such media agents for pharmaceutically active substances is well known in the art.

A pharmaceutical composition of the invention is formulated to be compatible with its proposed administration guide. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application may include the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for tonicity adjustment such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multi-dose vials made of glass or plastic. Medicines containing the IL-7 fusion proteins of the invention can have a concentration of 0.01 to 100% (w / w), although the amount varies according to the dosage form of the medicaments.

The dose of administration depends on the patients' body weight, the severity of the disease and the opinion of the doctor. However, it is generally advisable to administer about 0.01 to about 10 mg / kg of body weight per day, preferably about 0.02 to about 2 mg / kg, and more preferably about 0.5 mg / kg in case of injection. The dose can be administered once or several times daily, depending on the severity of the disease and the opinion of the doctor. The compositions of the invention are useful for being co-administered with one or more additional therapeutic agents, for example a molecule that is also known to be useful for replenishing blood cells. For example, the molecule can be erythropoietin, which is known to be used to replenish erythrocytes, G_CSF, which is used to replenish neutrophils or GM-CSF, which is used to replenish granulocytes and macrophages. EXAMPLE 1 Cloning of human Fc-IL-7 (hu) and hu-FC-IL-7 variants The nucleic acid encoding the mature form of human IL-7 (ie lacking its signal sequence) N terminal) is amplified by polymerase chain reaction (PCR) using direct and inverse primers that incorporate the restriction sites for Sma I and Xho I, respectively. The product amplified by PCR is cloned into a pCRII vector (Invitrogen, Carlsbad, CA) and its sequence verified. The amino acid sequence of mature IL-7 is shown as NUMBER IDENTIFICATION SEQUENCE: 1. The fragment of IL-7 digested with Smal / XhoI is transferred to an expression vector derived pdCs-huFc, treated in a similar manner, resulting in a chimeric sequence between huFc and IL-7, where IL-7 is placed in frame, directly downstream of the sequence encoding the CH3 portion of Fe (see Lo et al., Protein Engineering (1998) 11: 495) . A series of expression vectors are derived from the pdCs-huFc vector which codes for a fragment of Fe that generally includes a hinge, a CH2 domain and an Ig CH3 domain, and which has been manipulated to incorporate specific alterations in the region Fe. In this way, when generating a shuttle of the IL-7 fragment between these vectors, a series of huFc-IL-7 fusion proteins are generated, which differ in their main Fe structure. In order to create several main structures, first appropriate mutations must be introduced into the Fe sequence by methods known in the art. Since the Fe region of the vector derived from pdCs-huFc is flanked by an AflII restriction site and a Smal restriction site, by subjecting the nucleic acid of the structure appropriately modified to PCR using primers that incorporate the restriction sites for AF1II and SmaI, respectively, the resulting Fe coding nucleic acid fragment can be substituted in the vector derived from pdCs-huFc as an AflII or SmaI fragment. The sequence AflII CTTAAGC (SEQUENCE OF IDENTIFICATION NUMBER: 24) is towards the 5 'end of the sequence Fe that begins with GAGCCCAAA (SEQUENCE OF IDENTIFICATION NUMBER: 23), which represents the beginning of the hinge region, as shown in Figure 20. The Smal CCCGGGT site (IDENTIFICATION SEQUENCE NUMBER: 17) is towards the end of the CH3 region, as shown by the nucleic acids underlined in Figure 12 and codes for the preceding Pro-Gly amino acids to the alanine residue from the lysine to alanine mutation at the end of the CH3 region. For example, huFc? L-IL-7 having the hinge region, the CH2 and CH3 domains derived from IgG subclass 1, is constructed. In the context of a Fe fusion protein, the IgG hinge region also contains a mutation that replaces the first cysteine with serine. The sequence of the encoded fusion protein is presented in Figure 4 (SEQUENCE OF IDENTIFICATION NUMBER: 4) while the SEQUENCE OF IDENTIFICATION NUMBER: 22 codes for the main structure huFc? L mature vector. In addition, the Fcγ1-IL-7 fusion proteins are generated so that they include the mutation of the dipeptide YN to AQ for eliminating the glycosylation site in Fe (corresponding to N297 in IgG? L) as well as a potential epitope of immunogenic T lymphocyte, according to the methods described in the above. The sequence of the main structure Fe mature for huFc? L (YN> AQ) is described in SEQUENCE OF IDENTIFICATION NUMBER: 21. The substitution of alanine and glycine in place of tyrosine and asparagine is carried out by first introducing mutations into the main structure Fe by an overlap PCR approach. Two superimposed complementary mutagenic primers are used to generate two PCR fragments, which are used as the template in a second round of amplification to produce a single fragment containing the appropriate codon substitutions. The mutagenic primer in the direct direction is 5 '-AGCAGGCCCAGAGCACGTACCGTGTGGT-3' (the mutation is underlined) (IDENTIFICATION SEQUENCE NUMBER: 36). The complementary chain is 5'- GTACGTGCTCTGGGCCTGCTCCTCCCGC-3 '(IDENTIFICATION SEQUENCE NUMBER: 37). The forward flanking primer is 5'-CTCTCTGCAGAGCCCAAATCT-3 '(SEQUENCE IDENTIFICATION NUMBER: 38), which also contains a PstI site. In the antisense direction, the flanking reverse primer is 5'CAGGGTGTACACCTGTGGTTC-3 '(SEQUENCE OF IDENTIFICATION NUMBER: 33), which also contains a BsrGI site. After amplification, the sequence is verified through standard methods and is restricted by BsrGI and PstI. The resulting fragment is then replaced by the non-mutant fragment of the Fe region. HuFc? 2 (h) (FN> AQ) -IL-7 is also constructed using techniques previously described. This fusion protein includes an altered hinge region which is derived from the subclass IgG? L, while the CH2 and CH3 domains are derived from the subclass IgG? 2. Additionally, the mutation dipeptide FN to AQ is included to remove the glycosylation site in Fe (corresponding to N297 in IgG? L) as well as a potential epitope of immunogenic T lymphocyte. The sequence of the encoded fusion protein is presented in Figure 5 (SEQUENCE OF IDENTIFICATION NUMBER: 5). The sequence of the main structure Fe mature huFc? 2 (h) (FN> AQ) is shown in SEQUENCE OF IDENTIFICATION NUMBER: 19). In addition, Fc-IL-7 fusion proteins are generated which include a flexible linker sequence between the Fe portion and the IL-7 portion. For example, a binding polypeptide is inserted with the sequence GGGGSGGGGSGGGGS (linker 1, IDENTIFICATION SEQUENCE NUMBER: 34). To generate huFc? L (linker I) -IL-7, a synthetic oligonucleotide duplex sequence of the 5 '-G GGT sequence is inserted GCA GGG GGC GGG GGC AGC GGG GGC GGA GGA TCC GGC GGG GGC TC-3 '(SEQUENCE OF IDENTIFICATION NUMBER: 18) by ligation of the blunt end in the single Smal site of the expression vector pdCs-huFc-IL-7 and the orientation of the duplex chain is verified. The forward primer is designed such that the Pro-Gly amino acid residues encoded by the codons span the Smal site (C CCG GGT) (SEQUENCE OF IDENTIFICATION NUMBER: 17) and the following Ala residue (resulting from the encoded substitution of lysine alanine) of the CH3 region is maintained. In Figure 6 the amino acid sequence of the encoded fusion protein is shown (SEQUENCE OF IDENTIFICATION NUMBER: 6). Additional Fc-IL-7 fusion proteins are constructed such that they include a shorter linker polypeptide with the sequence GGGGSGGGG (linker 2, SEQUENCE IDENTIFICATION NUMBER: 25). To generate huFc? L (YN> AQ) (linker2) -IL-7, an amplified PCR product, obtained from the primer pair 5 'CCCGGGCGCCGGCGGTGGAGGATCAGGTGGTGGCGGTGATTGTGATATTGAAGGTAAAG ATG-3' (containing the encoded linker sequence, SEQUENCE OF IDENTIFICATION NUMBER: 15 ) and 5'-ATCATGTCTGGATCCCTCGA-3 '(SEQUENCE OF IDENTIFICATION NUMBER: 14) on an appropriate plasmid template pdCs-Fc-IL-7, is cloned in a pCRII vector (Invitrogen, Carlsbad, CA) and its sequence verified. A fragment digested with Xmal / Xchol encoding the 2 / IL-7 binder is then transferred to an expression vector derived from pdCs-huFc treated from Similarly. The vector is modified to contain a mature feF hu? (YN> AQ) structure of the IDENTIFICATION SEQUENCE NUMBER: 21. The amino acid sequences of the encoded fusion protein are shown in FIG. 7 (SEQUENCE OF IDENTIFICATION NUMBER: 7). Similarly, huFc? L (YN> AQ, d) (linker 2) -IL-7 are generated using the primer pair 5'-CCO-X_ ^ TGGAGGATCAGGTG ^^ (SEQUENCE IDENTIFICATION NUMBER: 16) and 5'AT (^ TGTCTGGATCCCTCGA-3 '(IDENTIFICATION SEQUENCE NUMBER: 12). HuFc 1 (YN> AQ, d) (linker 2) -IL-7 differs from the preceding fusion protein huFc? l (YN> AQ) (linker 2) -IL_7 in that it lacks the two terminal amino acid residues of the Fe portion of fusion protein, specifically, instead of ending with the sequence ... ATATPGA (SEQUENCE OF IDENTIFICATION NUMBER: 11), the Fe portion ends with the sequence ... ATATP (SEQUENCE OF IDENTIFICATION NUMBER: 10). The amino acid sequence of the encoded fusion protein is shown in Figure 8 (SEQUENCE OF IDENTIFICATION NUMBER: 8). EXAMPLE 2 Transfection and Expression of Fc-IL-7 Fusion Proteins Electroporation is used to introduce the DNA encoding the IL-7 fusion proteins described above into a mouse myeloma cell NS / 0 line. To perform electroporation, they are grow NS / O cells in Dulbecco's modified Eagle's medium supplemented with 10% heat inactivated fetal bovine serum, 2 mM glutamine and penicillin / streptomycin. They are washed once with PBS approximately 5 x 106 cells and resuspended in 0.5 ml of PBS. Then 10 μg of linearized plasmid DNA for huFc? -IL-7 is incubated with the cells in a Gene Pulser Cuvette (0.4 cm electrode separation, BioRad) on ice, for 10 min. Electroporation is performed using a Gene Pulser (BioRad, Hercules, CA) with settings at 0.25 V and 500 μF. The cells are allowed to recover for 10 min on ice, after which they are suspended in growth medium and plated onto two 96-well plates. Stably transfected clones are selected for their growth in the presence of methotrexate (MTX) 100 nM, which is added to the growth medium two days after transfection. The cells are fed every 3 days for 2 or 3 more times and the clones resistant to MTX appear in 2 to 3 weeks. The supernatants of the clones are tested by anti-Fc ELISA to identify clones that produce high amounts of IL-7 fusion proteins. Highly producing clones are isolated and propagated in growth medium containing 100 nM MTX. Typically it is used in serum-free growth medium, such as an H-SFM or CD medium (Life Technologies).

EXAMPLE 3 Biochemical analysis of the huFc-IL-7 fusion proteins Systematic SDS-PAGE characterization is used to determine the integrity of the fusion proteins. The differences between huFc-IL-7, variants of huCF1-IL-7, huCF2 (h) (FN> AQ) -IL-7, huCF1 (linker I) -IL-7, are investigated huFc? l (YN> AQ) (linker 2) -IL-7 and huFc? l (YN> AQ, d) -IL-7. The huFc-IL_7 fusion proteins, expressed from NS / 0 cells are retained on Protein A Sepharose spheres (Repligen, Needham, MA) from the tissue culture medium within which they were secreted, and eluted by boiling in protein sample buffer, with or without a reducing agent such as β-mercaptoethanol. The samples are separated by SDS-PAGE and the protein bands are visualized by Coomassie staining. By SDS-PAGE, the huFc-IL-7 fusion proteins tested are generally well expressed, since they are present substantially as a single band in the gel; it was found that in the samples of huFc-IL-7 variants that included a binder, the secondary bands are reduced remarkably, which may represent cut material. The purified huFc-IL-7 fusion proteins are also analyzed by size exclusion chromatography (SEC) to determine the extent to which the huFc-IL-7 variants are aggregated. Briefly, the Cell culture supernatant is loaded onto a pre-equilibrated Fast-Flow Protein A Sepharose column, the column is extensively washed in a physiological buffer (such as 100 mM sodium phosphate, 150 mM NaCl at neutral pH) and the bound protein is eluted at about pH 2.5 to 3 in the same buffer salt as in the previous. The fractions are neutralized immediately. It was found that for each of the fusion proteins tested at least 50%, and generally more than 65% of the product is monomeric. As used herein, the term "monomeric" refers to non-aggregated proteins. It is understood that proteins with a Fe portion normally of a disulfide bridged complex which normally includes two polypeptide chains (unless two Fe portions are present within the same polypeptide, and can be considered to be a "dimeric unit". The term "monomeric" is not intended to exclude each species bound by disulfide bonds, but only to emphasize that the proteins are not aggregated. To obtain a virtually monomeric huFc-IL-7 fusion protein preparation (approximately 98%), the eluate of a Sepharose-protein A purification is loaded onto a preparative SEC column (Superdex) and the monomeric peak fraction is collected. Typically, the concentration of the recovered protein is about 1 mg / ml. If required, the sample is concentrated, for example by dialysis in centrifugation (for example VivaSpin) with a molecular weight limit of 10-30 kDa. Disulfide Linkage Formation IL-7 contains six Cys residues which can produce disulfide bonds at the Cys2, Cys34, Cys47, Cys92, Cysl29 and Cysl41 positions of the mature IL-7 protein sequence. The naturalization of huFc? L-IL-7 is established by determining the disulfide bond pattern present in the IL-7 portion of the fusion protein. Briefly, peptide maps of huFcγ1-IL-7 are generated from trypsinized material and analyzed for the presence of signature peptide fragments. The huFcγ1-IL-7 protein is trypsinized either in a native form or after reduction and alkylation. To take into account the peptide fragments that can be glycosylated, samples of the native and denatured proteins are further treated with PNGaseF to separate the glycosyl chains before digestion with trypsin. The peptide fragments are fractionated by HPLC and their mass determined by spectroscopy. In the context of Fc? L-IL-7 it can be predicted that a peptide fragment containing the disulfide bond Cys47-Cysl41 ("3-6") has a mass of 1447.6, while a peptide fragment containing the disulfide bond Cys2 - Cysl41 ("1-6") is predicted to have a mass of 1426.6. Similarly, it can be predicted that a peptide fragment containing the disulfide bond Cys34-Cysl29 ("2-5") has a mass of 2738.3. In fact, the peptide fragments of a mass of 1447.6 ("3-6") and 2738.3 ("2-5") were identified in samples derived from the native Fc-IL-7 protein regardless of whether the samples were treated with PGNaseF or not, worse not, in samples of reduced Fc-IL-7. Conversely, the peptide fragment of a mass of 1426.6 ("1-6") was not found in any sample. Therefore, Fc? L-IL-7 contains the disulfide bonds Cys47-Cysl41 and Cys34-Cys29, but not Cys2-Cysl41. It is noted that a peptide fragment of the predicted class of 1439.2, which corresponds to a Cys2-Cys92 fragment ("1-4") is uniquely identified in the sample of a native fusion protein treated with PNGasaF. In fact, Cys92 is found within the tripeptide motif Asn91Cys92Thr93, which indicates that Asn91 is glycosylated in huFc? L-IL-7. Therefore, in huFc? L-IL-7, the disulfide binding pattern is consistent with Cys2-Cys92, Cys34-Cysl29 and Cys47-Cysl41. This experimentally determined configuration of Fc-IL-7 disulfide bonds is established in contrast to the experimentally determined configuration reported for bacterially renatured and IL-7 (Cosenza et al (1997) JBC 272 32995).

If Unbound Glycosylation Units in Human IL-7 contains three potential glycosylation sites at the Asn70, Asn91 and Asn6 positions of the mature IL-7 protein sequence. The peptide maps of huFc? I-IL-7 (reduced / alkylated) are analyzed for the presence of signature peptide fragments. If glycosylated, these signature fragments can be revealed in samples treated with P? GasaF. The masses of 1489.7, 1719.9 and 718.3 can be predicted for peptide fragments treated with trypsin containing the unmodified residues for Asn70, Asn91 and Asnlld, respectively. In fact, the peptide fragments of a mass of 1489.7 and 1719.9 were identified in samples that have been treated with P? GasaF, but were absent in the untreated sample, indicating that Asn70 (content in the sequence ... M? STG ...) (SEQUENCE OF IDENTIFICATION NUMBER: 31) and Asn91 (content in the sequence ... LNCTG ... (SEQUENCE OF IDENTIFICATION NUMBER: 32) are actually glycosylated, surprisingly, a typical fragment of a mass of 718.3, which corresponds to SLEENK (IDENTIFICATION SEQUENCE NUMBER: 35) was identified both in a sample treated with PNGasaF and in an untreated sample, which indicates that Asnll6 is not glycosylated, this was not expected because Asnll6 in the sequence of human IL-7 ... PTKSLEENKSLKE ... (SEQUENCE OF IDENTIFICATION NUMBER: 13) (see SEQUENCE OF IDENTIFICATION NUMBER: 1) it is predicted to be an N-linked glycosylation site. The putative NKS glycosylation site is conserved in sheep and cows as well as in humans. In analysis of the disulfide bonding patterns and the N-linked glycosylation sites repeated with the samples of Fc? I- (linker 1) -IL-7 and of Fc? 2h (FN> AQ) -IL-7 provide results Similar. EXAMPLE 4 ELISA Procedures The concentrations of protein products in the supernatants of MTX resistant clones and other test samples are determined by anti-huFc ELISA, as described in detail in the following. ELISA plates are coated with goat antibody, anti-human IgG AffiniPure (H + L) (Jackson Immuno Research Laboratories, West Grove, PA) at 5 μg / ml in PBS and 100 μl / well in 96-well plates. Cover plates are covered and incubated at 4 ° C overnight. The plates are washed four times with 0.05% Tween (Tween 20) in PBS and blocked with BSA / 1% goat serum in PBS, 200 μl / well. After incubation with the blocking buffer at 37 ° C for 2 h, the plates are washed four times with 0.05% Tween in PBS and capped dry. The test samples are diluted as appropriate in a sample buffer (1% BSA / 1% goat serum / 0.05% Tween in PBS). A standard curve is prepared using a chimeric antibody (with a Fe human) of known concentration. To prepare a standard curve, serial dilutions are made in the same buffer to provide a standard curve that varies from 125 ng / ml to 3.9 ng / ml. Diluted samples and standards are added to the plate, 100 μl / well and the plate is incubated at 37 ° C for 2 hours. After incubation, the plate is washed 8 times with 0.05% Tween in PBS. To each well is added 100 μl of anti human IgG antibody conjugated with horseradish peroxidase, diluted to approximately 1: 120,000 in sample buffer. The exact dilution of the secondary antibody is determined for each batch of anti-human IgG antibody conjugated with HRP. After incubation at 37 ° C for 2 h, the plate is washed 8 times with 0.05% Tween in PBS. The substrate solution is added to a 100 μl / well plate. This solution is prepared by dissolving 30 mg of OPD (o-phenylenediamine dihydrochloride (OPD), (1 tablet) in 15 ml of citric acid buffer 0. 025 M / Na2HP04 0.05 M, pH 5, which contains 0.03% of newly added hydrogen peroxide. The color is allowed to develop for approximately 30 minutes at room temperature in the dark. The reaction is stopped by adding 4N sulfuric acid, 100 μl / well. The plate is read by means of a plate reader, which is set at 490 and 650 nm and programmed to subtract the background OD at 650 nm from the OD at 490 nm.

The concentration of human IL-7 in the serum samples of animals treated with the huFc-IL-7 fusion proteins or with recombinant human IL-7 are determined by ELISA, essentially as described above. Human IL-7 is retained by means of a mouse anti-human IL-7 antibody (R & D Systems, Minneapolis, MN) and is detected with a goat anti-human IL-7 antibody and biotin (R & D Systems , Minneapolis, MN). EXAMPLE 5 Purification of huFc-IL-7 proteins A standard purification of Fe-containing fusion proteins is performed based on the affinity of the Fe protein portion by Protein A. Briefly, they are grown in tissue culture medium. NS / 0 cells expressing the appropriate fusion protein and the supernatant containing the expressed protein is harvested and loaded onto a pre-equilibrated Past Flow Protein A Sepharose column. The column is then extensively washed with buffer (such as 100 mM sodium phosphate, 150 mM NaCl, neutral pH). The bound protein is eluted at a low pH (pH 2.5-3) in the same buffer as in the above and the fractions are immediately neutralized. To obtain a non-aggregated huFc-IL-7 fusion protein preparation (approximately 98% monomer), the eluate is loaded onto a preparative SEC column (Superdex) and the monomeric peak fraction is collected. Typically, the concentration of the protein is from about 0.5 mg / ml to 2 mg / ml and, when appropriate, the sample is concentrated by centrifugation dialysis (for example Viva Spin with a molecular weight limit of 30 kDa). EXAMPLE 6 In Vitro Activity of HuFc-IL-7 Proteins The cytokine activity of purified huFc-IL-7 fusion proteins is determined in vitro in a cell proliferation bioassay. Human PBMCs (Peripheral Blood Mononuclear Cells) are activated by PHA-P to produce cells which respond to IL-7. Proliferation is measured in a standard thymidine incorporation assay. Briefly, the PBMC are first incubated for five days with 10 μg / ml of PHA-P, the cells are washed and then incubated in a medium supplemented with the huFc-IL-7 fusion proteins, in a serial dilution, by a total of 48 hours. During the final 12 hours, the samples are pulsed with 0.3 μCi of [methyl ~ 3H] thymidine (Dupont-NEN-027). The cells are then extensively washed, harvested and lysed on glass filters. It is measured at 3 H-thymidine incorporated in the DNA in a scintillation counter. As a standard, assays are performed with natural huIL-7 protein, which is obtained from R &R Systems (Minneapolis, MN) or obtained from the National Institute for Biological Standars and Control (NIBSC).

An ED50 value of the cell proliferation for the huFc-IL-7 fusion proteins is obtained from a plot of a dose-response curve, according to standard techniques and determination of protein concentration resulting in a half-maximal response. The fusion proteins huFc? -IL-7, huFc? 2 (h) (FN > AQ) -IL-7 and huFc? L (linker) -IL-7 were evaluated. The DES0 values of the fusion proteins are very similar to each other, and descend in an interval of 3 times from each other. Therefore, it was found that these alterations in the Fe portion have little influence on the IL-7 activity of the fusion protein. Furthermore, it was found that the ED 50 values of these fusion proteins are approximately 3 to 10 times higher than the ED50 value obtained for huIL-7 commercially available from R &D Systems. Since this commercial preparation is produced in bacteria and is not glycosylated, the enzymatically cleaved huFc? -IL-7 protein is evaluated by treatment with PNGasaF. It was found to have an activity very similar to the untreated form. Without wishing to be bound by any theory, the activity diminished to some extent of the fusion proteins may be due not to the glycosylation of the IL-7 portion but to a steric effect resulting from an obstructed N-terminal part of the IL-7 portion.

EXAMPLE 7 Pharmacokinetics of huFc-IL-7 proteins Pharmacokinetic profiles (PK) of a huFc-IL-7 fusion protein and a recombinant human IL-7 (Peprotech, Rocky Hill, NJ) were evaluated. ), and the results are presented in Figure 13. A single subcutaneous injection of equimolar amounts of huFc? 2 (h) (FN> AQ) -IL-7 or recombinant human IL-7 (50 μg) is administered to groups of C57BL6 / J mice. Blood samples are obtained by retro-orbital bleeding at the time of injection (ie, t = 0 min), and at 30 min, 1 h, 2 h, 4 h, 8 h, 24, 48, 72, 96 , 120 and 144 h post-injection. Samples are collected in heparin tube to avoid coagulation and the cells are separated by centrifugation in a high speed Eppendorf microcentrifuge for 4 min at 12,500 g. The PK values are calculated with the PK (Program Research Elements) software package (Summit Research Services, Montrose, CO). The concentration of IL-7 administered in plasma samples is determined in quadruplicate at each time point by a specific ELISA test for human IL-7. It is found that the pharmacokinetic behavior of huFc-IL-7 and recombinant IL-7 differs markedly. For recombinant human IL-7, the maximum concentration (Cma?) Is 23.5 ng / ml at 2.0 hours after injection (Tmax) while for huFc-IL-7, Cmax is 1588.7 ng / ml 24 hours after injection. In addition, although recombinant human IL-7 is absorbed more rapidly than huFc-IL-7 (half-life of the beta phase of 0.9 hours versus 12.4 hours), huFc-IL-7 is eliminated approximately 9 times more slowly from the circulation during the phase ß. Therefore, in terms of AVC (area under the curve) as a measure of total drug exposure, mice receiving huFc ~ IL-7 exhibit a 572-fold greater exposure to the protein administered compared to the mice that received Recombinant human IL-7. These data demonstrate a significant improvement of the huFc-IL-7 fusion proteins relative to free recombinant human IL-7 with respect to their PK. It was further found that the PK profiles of the huFc-IL-7 fusion proteins such as huFc? L-IL-7 and huFc? 2 (h) (FN> AQ) -IL-7, huFc? L (YN > AQ) (linker 2) -IL-7 and huFc? l (YN> AQ, d) (linker 2) -IL-7, which were administered to the mice by intravenous injection, are similar to each other. EXAMPLE 8 Efficacy of huFc-IL-7 in lymphopenic mice after bone marrow transplantation (BM) The efficacy of the huFc-IL-7 fusion proteins was evaluated in vivo compared to recombinant human IL-7. For example, huFc? 2 (h) (FN> AQ) -IL-7 or recombinant human IL-7 (Peprotech, Rock Hill, New Jersey) was administered to lymphopenic mice after bone marrow transplantation without T-lymphocytes (BM) and the recovery of immune cell populations was determined. Essentially, the recipient mice were irradiated deadly before BM transplantation with two doses of 600 cGy total body irradiation at a 4 h interval, and the BM cells were suspended in PBS and administered by infusion into the tail vein of the recipient mice. At regular intervals from day 5 onwards, an equimolar amount of 7 μg of huFc-IL-7 or 2.5 μg of recombinant human IL-7 is administered subcutaneously to the recipient mice (Peprotech, Rocky Hill, NJ). During the development of the experiment, blood samples are taken from the recipient mice, and the concentrations of lymphocyte cells in the samples are measured. For BM cell transplants, BM cells are obtained aseptically from femurs and tibias of BL / 6.SJL (H2, CD45.1) mice (Jackson Labs, Bar Harbor, ME) and T lymphocytes are deleted by separation. of T lymphocytes magnetically labeled on MACS ™ columns (Miltenyi Biotec, Auburn, CA). The degree of suppression of T lymphocytes is monitored by FACS analysis with fluorescently labeled antibodies against CD45, aβ-TCR (T lymphocytes) and 7-amino actinomycin D (7-AAD, apoptotic cells) (Calbiochem, X). 10 x 106 live BM cells (negative to 7-AAD) (containing less than 1% of T lymphocytes) are used per recipient mouse. In BM congenital transplants, B6 (H2, CD45.2) mice were used as the strain of recipient mice, and B6C3F1 (H2 / k, CD45.2) mice were selected with allogeneic BM transplants. The concentrations of lymphocyte cells (as presented in Table 1) are measured essentially as described in Brocklebank and Sparrow (Brockleband and Sparrow (2001) Cytometry 46: 254). Briefly, fluorescent spheres (TruC0UNTMR Tubes, BD Biosciences, San Jose, CA) are dissolved in 40 μl of PBS containing a mixture of lymphocyte-specific antibodies. Subsequently, 10 μl of anticoagulated blood is added, mixed and incubated for 30 minutes in the dark at room temperature. The erythrocytes are lysed in 450 μl of lysis solution for erythrocytes (BD Biosciences, San José, CA) and the samples are analyzed by flow cytometry (BD FACScalibur "11, BD Biosciences, San José, CA). of a particular lymphocytic population (eg, B lymphocytes, T lymphocytes, or total leukocytes) by creating separate gates around the lymphocytes and fluorescent spheres and by reading the number of events within each gate The number of lymphocytes passing through the gate microliter is calculated by dividing the number of events in a region Lymphocytic gate between the number of events in the gate sphere region. This number is multiplied by the fraction of the number of spheres per tube TruCOUNTm (provided by the supplier) on the volume of the sample and finally multiplied by the dilution factor of the sample. In one experiment, lymphocytic reconstitution is determined in a congenital BM transplant setting using materials and methods specified in the above. The recipient mice are injected with huFc? 2 (h) (FN> AQ) -IL-7 at a dose of 7 μg (125 μg IL-7 / kg body weight) and the lymphocytic cells are measured as has described. The donor lymphocytes are detected as positive CD45.1 cells, while the endogenous lymphocytes of the recipient mice are detected as CD45.2 positive cells. B lymphocytes and T lymphocytes are identified using lymphocyte markers B220 and CD3, respectively. It is found that, on day 49, the donor lymphocytes (CD45.1 positive cells) have repopulated the recipient mouse at concentrations comparable to the non-irradiated control mice, while the endogenous lymphocytes (CD45.2 positive cells) have not expanded in a significative way. In addition, treatment with the huFc-IL-7 fusion protein does not cause significant toxicity. These results show that the effectiveness of the protein of fusion to expand lymphocyte populations transferred in an adopted manner. Figure 16 shows these results. In another experiment, a model of allogeneic BM transplantation is used which can best simulate the clinical transplant setting in order to compare the huFc-IL-7 fusion protein with recombinant IL-7 and the results are shown in Table 1. Again, the methods and materials described in the above are used. HuFc? 2 (h) (FN> AQ) -IL-7 of human IL-7 (equivalent to 125 μg of IL-7 / kg body weight) is administered either every third day (q2d) or once at day (q7d) from day 5 to day 56 after transplantation. The donor mice treated with PBS and irradiated, bone marrow recipient mice treated with PBS serve as controls. In recipient mice treated with the fusion protein, donor derived B lymphocytes (CD45.1 +, B220 +, CD19 +) reached initial concentrations (as defined by blood concentration of B lymphocytes in donor control mice) 14 or 16 days after the transplant, when q2d or q7d are administered, respectively. In contrast, recipient mice treated with recombinant human IL-7 had no dosage regimen; the amounts of B lymphocytes in recipient mice treated with PBS or with human IL-7 require approximately the same time to reach the initial levels, approximately 28 days. In addition to the accelerated reconstitution of B lymphocytes, treatment with huFc-IL-7 promotes the continuous expansion of B lymphocytes until day 33: huFc-IL-7 administered q2d results in a 7-fold increase, while administered q7d results in a 2.5-fold increase in the numbers of B lymphocytes compared to the control mice. After day 33, the numbers of B lymphocytes decrease, but they are still approximately 2 times higher than those found in control mice. In addition, after day 33, the concentrations of IL-7 proteins administered decrease in the blood, which may be partially due to the formation of neutralizing antibodies to the human fusion protein. Figure 14 depicts these results of reconstitution of B lymphocytes in mice that are transplanted bone marrow irradiated and treated with recombinant human IL-7 and with huFc-IL-7. A similar result is observed with respect to donor T lymphocytes (CD45.1 +, CD3 +, TCRaβ +). Treatment with the huFc-IL-7 fusion protein results in accelerated reconstitution of T-lymphocytes, whereas treatment with recombinant human IL-7 does not. The maximum concentrations of T lymphocytes are reached approximately on day 49. However, the amounts of T lymphocytes above the initial value (i.e. blood concentration of T lymphocytes in donor mice) is achieved only with a q2d dosing protocol of the huFc-IL- fusion protein. 7, reaching approximately 1.5 times the number of T lymphocytes in control mice. Figure 15 depicts these results of reconstitution of T lymphocytes in mice that were transplanted bone marrow and irradiated, treated with recombinant human IL-7 and with huFc-IL-7. Despite the transiently high numbers of B lymphocytes and donor T lymphocytes in the recipient mice under certain conditions, none of the experimental mice showed any signs of morbidity during the development of the experiment. The analysis of internal organs on day 55 showed no pathological abnormalities in liver, kidney, lung, spleen, thymus, lymph nodes, stomach, small intestine and colon. Therefore, this allogeneic transplant experiment demonstrates that the huFc-IL-7 fusion protein is significantly superior in vivo with respect to recombinant human IL-7 in the reconstitution of lymphocytes after myelosuppressive conditioning.

Table 1: Effect of the huFc-IL-7 fusion protein on the reconstitution of immune cells EXAMPLE 9 Effectiveness of huFc-IL-7 in T lymphocyte transplants in lymphopenic mice The efficacy of huFc-IL-7 fusion proteins was also evaluated in a T lymphocyte transplant model. In essence, a homogeneous population is transferred (clonal) of T lymphocytes to irradiated and immunodeficient mice, the recipient mice were administered the huFc-IL-7 fusion protein and the degree of reconstitution of T lymphocytes and, finally, the function of the T lymphocytes were determined. To obtain a homogenous population of lymphocytes T, splenocytes are extracted from P14 TCR-tg / RAG mice (Charles River Laboratories, Wilmington, MA), which lack B lymphocytes. In addition, all T lymphocytes from these mice express the transgenic T cell receptor (TCR, its acronym in English), P14, which is specific for a viral epitope (gp33 of LCMV). Single cell suspensions of splenocytes are injected intravenously into the tails of RAG C? + Immunodeficient mice (Charles River Laboratories) that have been irradiated once with 650 Rads (submortal dose) 4 h before transplantation. On alternating days starting from day 2, the recipient mice are administered 7 μg of the huFc? 2 (h) fusion protein (FN > aq) -IL-7. A control group of recipient mice was administered PBS. The degree of reconstitution of T lymphocytes in response to the huFc-IL-7 fusion protein or PBS was determined by measuring the presence of P14 T lymphocytes (CD8 + Vß8.1 + V 2+ cells) in blood, by cytometry. flow. It was found that on day 35, the mice to which the huFc-IL-7 fusion protein was administered they show a 17-fold increase in the number of T lymphocytes (35,000 cells / μl) compared to the control mice (2000 cells / μl). In fact, the reconstitution of T lymphocytes exceeds that observed in untreated P14 TCR mice (23,000 cells / μl). In addition, in these mice treated with huFc-IL-7 a significant fraction of the reconstituted T lymphocytes present activation of the receptor subunit IL-2Ra, CD25, on the cell surface. Therefore, not only the huFc-IL-7 fusion protein is useful for expanding transplanted T lymphocytes, but it may also have been preconditioned to the transferred T lymphocytes to respond to cytokines, such as IL-2. EXAMPLE 10 Adjuvant treatment with huFc-IL-7 for immunosuppressed patients Numerous clinical approaches are considered in which patients may benefit from adjuvant treatment with huFc-IL-7. For example, new treatment modalities are being developed for pediatric patients with malignant diseases such as lymphoblastic or myeloid leukemias who, after myeloablative treatment, are treated by haematopoietic stem cell transplantation to reconstitute the immune system. In order to significantly increase the potential donor reserve for these patients, it has been found that Peripheral blood stem cells (PBSCs) mobilized by G-CSF from unrelated paired donors or from haplo-identical donors with 1-3 discrepancies of HLA loci can be a source of cells, with the proviso that the transplant lacks T lymphocytes (see Handgretinger et al (2001) Annals NY Acad. Sciences 938: 340-357). This suppression significantly reduces the presentation of a rejection of acute reverse rejection transplantation (GvHD); however, it is considered that due to the low concentration of T lymphocytes, there is a significant delay in the immuno-reconstitution. Patients with a high risk of viral infections for at least 6 months after transplantation, and T lymphocytes do not return to normal concentrations for one year (Handgretinger et al. (2001) Annals NY Acad. Sciences 938: 340-357; Lang et al., (2003) Blood 101: 1630-6). Therefore, it would be advantageous to increase the rate of repopulation of T lymphocytes of other immune cells in these patients. Patients who will benefit from treatment with huFc-IL-7 include patients with childhood leukemia, such as lymphoblastic leukemia or myeloid leukemia. Children who have this disorder will first experience a myelosuppressive conditioning treatment which can be based either on a busulfan chemotherapeutic agent or total body irradiation combined with chemotherapy. For example, according to the diagnosis and age of the patient, said patient is treated with total body irradiation (typically 6 treatments of 2 Gy each) with anti-thymocyte rabbit globulin (10 mg / kg daily for 3 days), etoposide ( 40 mg / kg) and cyclophosphamide (120 mg / kg). To obtain CD34 positive (post) transplants for cytoblast, peripheral blood cytoblast (PBSC) of a histocompatible (allogeneic) donor is immobilized with a daily dose of 10 μg / kg of G-CSF for 6 days and are harvested by leucafaresis on days 5 and 6. Generally 20 x 106 / kg of CD34 stem cells are obtained and transplanted. The CD34 cytoblasts are then purified from PBSC by positive selection with an anti-CD34 antibody in a SuperMACS system (magnetic sorting of cells activated by Miltenyi Biotec) and eluted. The suppression of T lymphocytes is typically from about 5 logarithmic units (100,000 times), to about 10 x 10 3 cells / kg. Aggregates and other residues are excluded from the graft by FACS classification. The cell suspension is delivered by infusion to the patient via a central venous catheter. Optionally, the graft may include populations purified from other immune cells such as haploidentical NK cells, DC, monocytes as well as CD34neg cytoblasts.

To determine if the graft has been switched on, an absolute neutrophil count is performed. A graft that has been ignited is considered successful once the neutrophil concentrations remain above 50 cells / μl. The reconstitution of immune cells is monitored by FACS analysis, weekly at the beginning and once the recovery of the T lymphocytes begins, every 3 months. To increase the immunoconstitution, the patient is treated with a huFc-IL-7 fusion protein such as huFc? 2h (FN> AQ) -IL-7 or huFcyl (YN> AQ) (linker 2) -IL- 7 Approximately 3 weeks after the transplant (or after the graft has been established), the patient receives a subcutaneous administration of huFc? Lh (FN > AQ) -IL-7 or huFc? L (YN > AQ) (binder 2) -IL-7 at a dose of approximately 1.5 mg / m2 (or a dose in the range of 0.15 mg / m2 to 15,000 mg / m2) approximately 2 times a week for 6 months - 12 months until the accounts of T lymphocytes reach 50% of normal levels. It is found that the patient's prognosis improves due to a decreased risk of viral infection, one of the main complications after a transplant. It is also found that this treatment does not significantly increase the risk of acute rejection of GvHD. In addition to the administration of the huFc-IL-7 protein, other prophylactics are administered optimally medications These include, for example, acyclovir, metronidazole, fluconazole or co-trimoxazole. During the first three months, the patient can receive weekly administration of immunoglobulins as well as G-CSF. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (28)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An IL-7 fusion protein characterized in that it comprises an immunoglobulin chain and an IL-7 molecule, which is modified, compared to natural IL-7, bound together directly or via a binding molecule, wherein the modification in IL -7 is: (i) the amino acid residues at positions 70 and 91 are glycosylated and the amino acid residue at position 116 is non-glycosylated; and / or (ii) disulfide bonds exist within the IL-7 portion, between Cys2 and Cys92, Cys34 and Cysl29 and Cys47 and Cysl41.

2. The IL-7 fusion protein according to claim 1, characterized in that the amino acid residues at positions 70 and 91 of IL-7 are glycosylated and the amino acid residue at position 116 of IL-7 is non-glycosylated , and disulfide bonds exist within the IL-7 portion between Cys2 and Cys92, Cys34 and Cysl29 and Cys47 and Cysl41.

3 . The fusion protein of IL-7, according to claim 1, characterized in that the amino acid residue at position 116 is asparagine. Four . The fusion protein of IL-7, according to claim 1, characterized in that the amino acid residue at position 116 is non-glycosylated. 5 . The fusion protein of IL-7, according to claim 1, characterized in that the amino acid residue at position 116 is altered so that it does not serve as a glycosylation site. 6 The fusion protein of. IL-7, according to claim 1, characterized in that the IL-7 molecule comprises a deletion. 7 The fusion protein of IL-7, according to claim 6, characterized in that truncated IL-7 comprises a suppression of 18 amino acids from amino acid 96 to amino acid 114 of SEQUENCE OF IDENTIFICATION NUMBER: 1. 8. The fusion protein of IL-7, according to claim 1, characterized in that the IL-7 molecule is human IL-7. 9. The fusion protein of IL-7, according to claim 1, characterized in that IL-7 is a mature IL-7 portion. 10 The fusion protein of IL-7, according to any of claims 1-9, characterized because the immunoglobulin chain comprises at least a portion of a constant domain. 11. The IL-7 fusion protein according to claim 10, characterized in that the constant domain is selected from the group consisting of CH1, CH2 and CH3. 12. The fusion protein of IL-7, according to claim 10 or 11, characterized in that the constant domain is a constant domain of IgG1. 13. The fusion protein of IL-7, according to claim 12, characterized in that Asn297 of the constant domain of IgG1 is modified. 1

4. The fusion protein of IL-7, according to claim 13, characterized in that the modification of Asn297 is Asn297Gln. 1

5. The fusion protein of IL-7, according to claim 13, characterized in that it also comprises a modification in Tyr29

6. 16. The fusion protein of IL-7, according to claim 15, characterized in that the modification of Tyr296 is Tyr296Ala. 1

7. The fusion protein of IL-7, according to claim 10 or 11, characterized in that the constant domain is a constant domain of IgG2. 1

8. The fusion protein of IL-7, according to claim 17, characterized in that the chain of IgG2 comprises a hinge of IgGl. 1

9. The fusion protein of IL-7, according to claim 17 or 18, characterized in that Asn297 of the constant domain of IgG2 is modified. 20. The fusion protein of IL-7, according to claim 19, characterized in that the modification of Asn297 is Asn297Gln. 21. The IL-7 fusion protein, according to claim 19, characterized in that it also comprises a modification of Phe296. 22. The fusion protein of IL-7, according to claim 21, characterized in that the modification Phe296 is Phe296Ala. 23. The IL-7 fusion protein according to any of the preceding claims, characterized in that the IL-7 portion of the fusion protein has an increased biological activity compared to natural IL-7. 24. An isolated DNA molecule, characterized in that it encodes an IL-7 fusion protein, according to any of claims 1-23. 25. A cultured host cell, characterized in that it comprises the DNA according to claim 24. 26. A method for preparing a fusion protein characterized in that it comprises: transforming a host cell with the DNA according to claim 24, culturing the host cell and expressing and harvesting the IL-7 fusion protein. 27. A pharmaceutical composition suitable for the treatment of immunological disorders or cancer, characterized in that it comprises in a pharmaceutically effective amount an IL-7 fusion protein according to any of claims 1-23, optionally together with a carrier, diluent or pharmaceutically acceptable excipient. 28. The use of an IL-7 fusion protein, according to any of claims 1-23, for the manufacture of a medicament for the treatment of immunological deficiencies and cancer.