MXPA04006042A - Antibodies that immunospecifically bind to trail receptors. - Google Patents

Abstract

The present invention relates to antibodies and related molecules that immunospecifically bind to TRAIL receptor, TR7. Such antibodies have uses, for example, in the prevention and treatment of cancers and other proliferative disorders. The invention also relates to nucleic acid molecules encoding anti-TR7 antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder, especially cancer and other hyperproliferative disorders, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that immunospecifically bind to TRAIL receptor TR7.

Description

ANTIBODIES THAT COME INTO ONE-SPECIFIC ENTE TO TRAIL RECEPTORS FIELD OF THE INVENTION The present invention relates to antibodies and related molecules that bind immunospecifically to the TRAIL receptor, TR7. Such antibodies have uses, for example, in the prevention and treatment of cancers and other proliferative disorders. The invention also relates to nucleic acid molecules encoding anti-TR7 antibodies, vectors and host cells containing these nucleic acids, and methods for producing same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or alleviating a disease or disorder, especially cancer and other hyperproliferative disorders, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that bind immunospecifically to TR7.

BACKGROUND OF THE INVENTION Many biological actions, for example the response to certain stimuli and natural biological processes, are controlled by factors such as cytokines. Many cytokines act by means of receptors coupling with the receptor and producing an intracellular response. For example, tumor necrosis factors (TNF) alpha and beta are cytokines that act through TNF receptors to regulate many biological processes, including protection against infection and induction of shock and inflammatory disease. The TNF molecules belong to the superfamily of "TNF ligands" and act together with their receptors or counter-ligands, the superfamily of "TNF receptors". Up to now, at least 18 members of the TNF superfamily of ligands have been identified and at least 19 members of the TNF receptor superfamily have been characterized (see for example Locksley et al., Cell (2001) 104: 487-501). The ligands include TNF-oc, lymphotoxin a (LT-a, also known as TNF-β), LT-β (found in the heterotrimer complex β-α2-β), FasL, CD40L, CD27L, CD30L, 4-IBBL, OX40L and nerve growth factor (NGF). The superfamily of TNF receptors includes the p55TNF receptor, the p75TNF receptor, the TNF receptor related protein, the FAS or APO-1 antigen, CD40, CD27, CD30, 4-IBB, OX40, low affinity p75 and NGF receptor ( Meager, A., Biologicals, 22: 291-295 (1994)). Many members of the TNF superfamily of ligands are expressed by activated T cells, implying that they are necessary for the interactions of T cells with other cell types that support ontogeny and cell functions (Meager, A., above).

Considerable knowledge has been gained about the essential functions of several members of the TNF receptor family from the identification and creation of mutants that abolish the expression of these proteins. For example, natural mutations in the FAS antigen and its ligand cause lymphoproliferative disease (Watanabe-Fukunaga, R. et al., Nature 356: 314 (1992)), perhaps reflecting a failure of programmed cell death. Mutations of the CD40 ligand cause an immunodeficiency state linked to the X chromosome characterized by high concentrations of immunoglobulin M and low concentrations of immunoglobulin G in the plasma, indicating a defective activation of B cells dependent on T cells (Alien, RC et al., Science 259: 990 (1993)). Targeted mutations of the low affinity nerve growth factor receptor cause a disorder characterized by defective sensory innovation of peripheral structures (Lee, K. F. et al., Cell 69: 737 (1992)). TNF and LT-a are capable of binding to two TNF receptors (the 55 kd and 75 kd TNF receptors). A large number of biological effects caused by TNF and LT-a acting through their receptors, include hemorrhagic necrosis of transplanted tumors, cyxicity, a function in endotoxic shock, inflammation, immunoregulation, proliferation and antiviral responses, as well as protection against the harmful effects of ionizing radiation. TNF and LT-a are involved in the pathogenesis of a wide range of diseases including endotoxic shock, cerebral malaria, tumors, autoimmune disease, AIDS and host-graft rejection (Beutler, B. and von Huffel, C, Science 264: 667-668 (1994)). Mutations in the p55 receptor cause greater susceptibility to microbial infection. In addition, a domain of approximately 80 amino acids near the C-terminus of TNFR1 (p55) and Fas was reported as the "death domain", which is responsible for transducing signals for programmed cell death (Tartaglia et al., Ce // 74 : 845 (1993)). Apoptosis, or programmed cell death, is a physiological process essential for the normal development and homeostasis of multicellular organisms (H. Steller, Science 267, 1445-1449 (1995)). Mismatches of apoptosis contribute to the pathogenesis of several human diseases including cancer, neurodegenerative disorders and acquired immunodeficiency syndrome (C. B. Thompson, Science 267, 1456-1462 (1995)). Recently, much attention has been paid to the signal transduction and biological function of two cell death surface receptors, Fas / APO-1 and TNFR-1 (J. L. Cleveland et al., Cell 81, 479-482 (1995)).; A. Fraser et al., Cell 85, 781-784 (996); S. Nagata et al., Science 267, 1449-56 (1995)). Both are members of the TNF receptor family, which also includes TNFR-2, low affinity NGFR, CD40, and CD30, among others (CA Smith et al., Science 248, 1019-23 (1990); M. Tewari et al. , in "Modular Texts in Molecular and Cell Biology" M. Purton, Heldin, Cari, Ed. (Chapman and Hall, London, 1995), Although family members are defined by the presence of cysteine-rich repeats in their domains extracellular, Fas / APO-1 and TNFR-1 also share a region of intracellular homology, appropriately designated the "death domain", which is distantly related to the Drosophila suicide gene, reaper (P. Golstein et al., Cell 81, 185-6 (1995), K. White et al., Science 264, 677-83 (1994).) This shared-death domain suggests that both receptors interact with a related set of signal transduction molecules that, until recently, do not The activation of Fas / APO-1 recruits the adapter molecule which contains the death domain FADD / MORT1 (A. M. Chinnaiyan et al., Cell 81, 505-12 (1995); M. P. Boldin et al., J. Biol Chem 270, 7795-8 (1995); FC Kischkel et al., EMBO 14, 5579-5588 (1995)), which in turn binds and presumably activates FLICE / ACH1, a member of the ICE / CED-3 family of pro-apoptotic proteases (M. Muzio et al. , Cell 85, 817-827 (1996), MP Boldin et al., Cell 85, 803-815 (996)). Although the central function of Fas / APO-1 is to activate cell death, TNFR-1 can signal an array of diverse biological activities-many of which derive from its ability to activate NF-kB (LA Tartaglia et al., Immunol Today 13, 151-3 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter molecule TRADD, which, like FADD, also contains a death domain (H. Hsu et al., Cell 81, 495-504 (1995), H. Hsu et al., Cell 84 , 299-308 (1996)). Through its associations with several signaling molecules including FADD, TRAF2, and RIP, TRADD can signal both apoptosis and NF-kB activation (H. Hsu et al., Cell 84, 299-308 (1996), H. Hsu and others, Immunity4, 387-396 (1996)). A ligand inducer of apoptosis related to TNF has been reported by several groups and has been assigned the name of apoptosis-inducing molecule 1 (AIM-I) (international application No. WO 97/33899) and ligand-inducing apoptosis related to TNF , or TRAIL (Wiley, SR et al., Immunity 3: 673-682 (1995)). Pitti, R.M. and others refer to the new molecule as the Apo-2 ligand or "Apo-2L". For convenience, it will be referred to here as TRAIL. The amino acid sequence of TRAIL is given in SEQ ID NO: 72. Unlike the FAS ligand whose transcripts appear to be restricted primarily to stimulated T cells, significant concentrations of TRAIL are observed in many tissues, and is constitutively transcribed by some cell lines. It has been shown that TRAIL acts independently of the FAS ligand (Wiley, S.R. and others (1995), above). Some studies by Marsters, S.A. and others have indicated that TRAIL rapidly activates apoptosis, within a time frame similar to death signaling performed by FAS / Apo-IL, but much faster than TNF-induced apoptosis (Current Biology, 6: 750-752 (nineteen ninety six)). As many as five TRAIL receptors have been identified, including TR4 (also known as TRAIL receptor 1 (TRAIL-R1) and death receptor 4 (DR4): Pan et al., Science 276: 111-3 (1997), applications International Patent Nos. WO 98/32856, WO 00/67793, WO 99/37684, WO 2000/34355, WO 99/02653, SEQ ID NO: 1); TR7 (also referred to as TRAIL receptor 2 (TRAIL-R2), DR5 and KILLER: Pan et al., Science 277: 815-8 (1997), Sheridan et al., Science 277: 818-21 (1997), Chaudhury et al. , Immunity 7: 821-30 (1997), International patent applications Nos. WO 98/46643, WO 99/09165, WO 99/11791, WO 98/41629, WO 00/66156, and WO 98/35986, SEQ ID NO: 3); TR1 (also referred to as osteoprotegrin (OPG), osteoclastogenesis inhibiting factor (OCIF), TNFRSF1 1 B, and FTHMA-090 (International patent applications Nos. WO 98/12344, WO 2000/54651, WO 2001/04137, WO 66 / 26217, WO 98/07840, WO 2000/21554, WO 99/53942, and WO 2001/03719, SEQ ID NO: 5); TR5 (also referred to as TRAIL 3 receptor (TRAIL-R3), decoy receptor 1 (DcR1) and TRID) (Degli-Esposti et al., J. Exp. Med. 186: 1165-70 (1997), International patent applications Nos. WO 98/30693, WO 00/71150, WO 99/00423, EP 867509, WO 98/58062, SEQ ID NO: 2), and TR10 (also referred to as TRAIL receptor 4 (TRAIL-R4), DcR2, and TRUNDD: Pan et al., FEBS Lett 424: 41-5 (1998) , Degli-Eposti et al., Immunity 7: 813-20 (1997), International patent applications Nos. WO 98/54202, WO 00/73321, WO 2000/08155, WO 99/03992, WO 2000/34355 and WO 9910484. , SEQ ID NO: 4), TR4 and TR7 contain domains of death in their cytoplasmic tails and the activation of these receptors results in poptosis On the other hand, TR1, TR5 and TR10 can inhibit the apoptosis induced by the cytotoxic TRAIL ligand in part due to their absent or truncated cytoplasmic death domains, respectively. Each of the aforementioned publications and patents is incorporated herein by reference in its entirety, particularly with respect to the nucleotide and amino acid sequences of the TRAIL receptors described herein. The effects of TNF family ligands and TNF family receptors are varied and affect numerous functions, both normal and abnormal, in the biological processes of the mammalian system. Therefore, there is a clear need to identify and characterize compositions such as antibodies that affect the biological activity of TNF receptors, both normally and in pathological states. In particular, there is a need to isolate and characterize antibodies that modulate the biological activities of TRAIL receptors.y.

BRIEF DESCRIPTION OF THE INVENTION The present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically bind to a TR7 polypeptide or TR7 variant or polypeptide fragment. In particular, the invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which immunospecifically binds with a human TR7 polypeptide or polypeptide fragment or variant, such as SEQ ID NO: 3 In some embodiments, an antibody of the invention that immunospecifically binds to a TR7 polypeptide, also binds to TR7 (eg, to SEQ ID NO: 3), but not to other proteins that include TR1, TR5, and TR10 (SEQ ID NOs) : 5, 2 and 4). The present invention relates to methods and compositions for preventing, treating or alleviating a disease or disorder, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules. , which bind immunospecifically to TR7 or to a fragment or variant thereof. In specific embodiments, the present invention relates to methods and compositions for preventing, treating or alleviating a disease or disorder associated with the function of TR7, the function of the ligand of TR7, or the aberrant expression of TR7 or the ligand of TR7, which comprises administering to an animal, preferably a human, an effective amount of one of one or more antibodies, or fragments or variants thereof or related molecules, that immunospecifically bind to TR7 or a fragment or variant thereof. In highly preferred embodiments, the present invention relates to antibody-based methods and compositions for preventing, treating or alleviating cancers and other hyperproliferative disorders (e.g., leukemia, carcinoma and lymphoma). Other diseases and disorders that can be treated, prevented or alleviated with the antibodies of the invention include, without limitation, neurodegenerative disorders (e.g. Parkinson's disease, Alzheimer's disease and Huntington's disease), immune disorders (e.g., lupus, rheumatoid arthritis, multiple sclerosis, myasthenia gravis, Hashimoto's disease and immunodeficiency syndrome), inflammatory disorders (eg, asthma, allergic disorders and rheumatoid arthritis), infectious diseases (eg AIDS, viral infections of herpes and other viral infections) and proliferative disorders. The present invention also encompasses methods and compositions for detecting, diagnosing or predicting diseases or disorders, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies, or fragments or variants thereof or related molecules, which they bind immunospecifically to TR7 or a fragment or variant thereof. In specific embodiments, the present invention also encompasses methods and compositions for detecting, diagnosing or predicting diseases or disorders associated with the function of TR7, the function of the TR7 ligand, or the aberrant expression of TR7 or the ligand of TR7, which comprises administering to an animal, preferably a human, an effective amount of one or more antibodies, or fragments or variants thereof, or related molecules, that bind immunospecifically to TR7 or a fragment or variant thereof. In highly preferred embodiments, the present invention relates to antibody-based methods and compositions for detecting, diagnosing or predicting cancers and other hyperproliferative disorders (e.g., leukemia, carcinoma and lymphoma). Other diseases and disorders that can be detected, diagnosed or predicted with the antibodies of the invention include, without limitation, neurodegenerative disorders, (e.g., Parkinson's disease), Alzheimer's disease and Huntington's disease), immune disorders (eg, lupus, rheumatoid arthritis, multiple sclerosis, myasthenia gravis, Hashimoto's disease and immunodeficiency syndrome), inflammatory disorders (eg, asthma, allergic disorders and rheumatoid arthritis), infectious (eg, AIDS, herpes virus infections and other viral infections) and proliferative disorders. In highly preferred embodiments, the antibodies of the present invention are used in methods and compositions to prevent, diagnose, predict, treat or alleviate the following types of cancer: breast cancer, lung cancer (including non-small cell lung cancer) , colon cancer, urinary tract cancer, bladder cancer, kidney cancer, pancreatic cancer, liver cancer, stomach cancer, prostate cancer, leukemia, non-Hodgkin's lymphoma, esophageal cancer, brain cancer , leukemia, ovarian cancer, testicular cancer, melanoma, uterine cancer, cervical cancer, cancer of the larynx, rectal cancer and cancers of the oral cavity. In specific embodiments, the antibodies of the invention are administered in combination with chemotherapeutic agents such as paclitaxel (Taxol), irinotecan (Camptosar, CPT-11), irinotecan analogs and gemcitabine (GEMZAR ™). Another embodiment of the present invention includes the use of the antibodies of the invention as a diagnostic tool for monitoring the expression of TR7 in cells. The present inventors have generated single chain Fv's (scFvs) that bind immunospecifically to TR7 polypeptides (e.g., SEQ ID NO: 3). Thus, the invention encompasses these scFvs, listed in Table 1. In addition, the invention encompasses cell lines engineered to express antibodies corresponding to these scFvs, which were deposited in the American Type Culture Collection (American Type Culture Collection , "ATCC"), with the dates indicated in Table 1, and received the ATCC deposit numbers identified in Table 1. The ATCC is located at 10801 University Boulevard, Manassas, Virginia, 20110-2209, USA ATCC Deposit it was done in accordance with the terms of the Budapest treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedures. In addition, the present invention encompasses polynucleotides that encode the scFvs, as well as the amino acid sequences of the scFvs. The molecules comprising, or alternatively consisting of, fragments or variants of these scFvs (for example VH domains, VH CDRs, VL domains, or VL CDRs having an amino acid sequence of any of the scFvs referred to in the table. 1), which bind immunospecifically to TR7 or fragments or variants thereof are also encompassed by the invention, as are the nucleic acid molecules encoding these antibodies or molecules. In highly preferred embodiments, the present invention encompasses antibodies, or fragments or variants thereof, that bind to extracellular regions / domains of TR7 or fragments and variants thereof. The present invention also provides antibodies that bind to TR7 polypeptides that are coupled with a detectable label such as an enzyme, a fluorescent label, a luminescent label, or a bioluminescent label. The present invention also provides antibodies that bind TR7 polypeptides that are coupled with a therapeutic or cytotoxic agent. The present invention also provides antibodies that bind TR7 polypeptides that are coupled with a radioactive material. The present invention also provides antibodies that bind to TR7 polypeptides that act as TR7 agonists or TR7 antagonists. In specific embodiments, the antibodies of the invention stimulate apoptosis of cells expressing TR7. In other specific embodiments, the antibodies of the invention inhibit TRAIL that binds to TR7. In other specific modalities, the antibodies of the invention positively regulate the expression of TR7. The present invention also provides antibodies that inhibit apoptosis of cells expressing TR7. In other specific embodiments, the antibodies of the invention negatively regulate the expression of TR7. In further embodiments, the antibodies of the invention have a dissociation constant (KD) of 10"7 M or less.In preferred embodiments, the antibodies of the invention have a dissociation constant (KD) of 10" 9 M or less.

The present invention also provides antibodies that further stimulate apoptosis of cells expressing TR7 than an equal concentration of TRAIL polypeptide that stimulates apoptosis of cells expressing TR7. The present invention further provides antibodies that stimulate apoptosis of cells expressing TR7 equally well in the presence or in the absence of antibody crosslinking reagents; or which stimulate apoptosis with equal or greater potency compared to an equal concentration of TRAIL in the absence of an interlacing antibody or other entanglement agent. In further embodiments, the antibodies of the invention have a dissociation rate (k0ff) of 0 ~ 3 / s or less. In preferred embodiments, the antibodies of the invention have a dissociation rate (k0ff) of 10"/ s or less.In other preferred embodiments, the antibodies of the invention have a dissociation rate (k0ff) of 10" 5 / s or less. The present invention also provides antibodies that bind preferentially to TR7 or TR7 with respect to their ability to bind to other proteins (including TR, TR5 and TR10). In some embodiments, the properties of the antibodies of the present invention, as indicated in detail in the examples below, make the antibodies better therapeutic agents than the TR7 binding antibodies previously described. The present invention also provides panels of antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants), wherein the members of the panel correspond to one, two, three, four, five, ten, fifteen, twenty , or more different antibodies of the invention (for example complete antibodies, Fabs, F (ab ') 2 fragments, Fd fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic antibodies (anti-ld), and scFvs). The present invention further provides mixtures of antibodies, wherein the mixture corresponds to one, two, three, four, five, ten, fifteen, twenty or more different antibodies of the invention (for example, whole antibodies, Fabs, F fragments). ab ') 2, Fd fragments, Fvs linked by disulfide (sdFvs), anti-idiotypic antibodies (anti-ld) and scFvs). The present invention also provides compositions comprising, or alternatively consisting of, one, two, three, four, five, ten, fifteen, twenty or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, fragments of antibody or variants thereof). A composition of the invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty, or more amino acid sequences of one or more antibodies or fragments or variants thereof. Alternatively, a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules that encode one or more antibodies of the invention. The present invention also provides fusion proteins comprising an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), and a heterologous polypeptide (i.e., a polypeptide not related to an antibody or antibody domain). The nucleic acid molecules encoding these fusion proteins are also encompassed by the invention. A composition of the present invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention. Alternatively, a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules encoding one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention. The present invention also provides one or more nucleic acid molecules, generally isolated, that encode an antibody of the invention (including molecules such as scFvs)., VH domains, or VL domains, comprising, or alternatively consisting of, an antibody fragment or variant thereof). The present invention also provides a host cell transformed with a nucleic acid molecule of the invention, and progeny thereof. The present invention also provides a method for the production of an antibody of the invention (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof). The present invention further provides a method of expressing an antibody of the invention (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) from a nucleic acid molecule. These and other aspects of the invention are described below in greater detail.

BRIEF DESCRIPTION OF THE FIGURES Figures 1A-D show the ability of anti-TR7 antibodies to induce apoptosis of MD-MBA-231 and SW480 cells in vitro, in the presence and absence of cycloheximide. Figure 2 shows the effect of treatment of Swiss nu / un mice with anti-TRAIL receptor antibody on tumor formation SW480.

DETAILED DESCRIPTION OF THE INVENTION Definitions The term "antibody", as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen-binding site that bind immunospecifically to an antigen. As such, the term "antibody" encompasses not only complete antibody molecules, but also antibody multimers and antibody fragments, as well as antibody variants (including derivatives), antibody multimers, and antibody fragments. Examples of molecules described with the term "antibody" include, without limitation: single chain Fvs (scFvs), Fab fragments, Fab 'fragments, F (ab') 2, disulfide-linked Fvs (sdFvs), Fvs and fragments which comprise, or alternatively consisting of, a VL domain or a VH domain. The term "single chain Fv" or "scFv", as used herein, refers to a polypeptide comprising a VL domain of antibody bound to a VH domain of an antibody. Antibodies that bind immunospecifically to TR7 may have cross-reactivity with other antigens, for example another TRAIL receptor. Preferably, antibodies that immunospecifically bind to TR7 do not cross-react with other antigens (e.g., other TRAIL receptors or other members of the tumor necrosis factor receptor superfamily). Antibodies that bind immunospecifically to TR7 can be identified for example by means of immunoassays or other techniques known to the person skilled in the art, for example the immunoassays described in the examples below. Antibodies of the invention include, without limitation, monoclonal, multispecific, human or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, anti-idiotypic (anti-ld) antibodies (including for example anti-HIV antibodies). Id for the antibodies of the invention), antibodies made intracellularly (i.e., intrabodies), and epitope binding fragments of any of the foregoing. The immunoglobulin molecules of the invention can be of any type (for example IgG, IgE, IgM, IgD, IgA and IgY), class (for example IgG-i, IgG2, IgG3, IgAi and IgA2) or subclass. Preferably, an antibody of the invention comprises, or alternatively consists of, a VH domain, CDR VH, VL domain or CDR VL, having an amino acid sequence as any of those listed in Table 1, or a fragment or variant Of the same. In a preferred embodiment, the immunoglobulin is an IgG1 isotype. In another preferred embodiment, the immunoglobulin is an IgG4 isotype. The immunoglobulins can have both a heavy chain and a light chain. An array of heavy chains of IgG, IgE, Ig, IgD, IgA and IgY can be paired with a light chain of the kappa or lambda forms. The antibodies of the invention may also include multimeric forms of antibody. For example, antibodies of the invention may take the form of higher order dimer, trimers, or multimers of antibody from immunoglobulin monomer molecules. The dimers of complete immunoglobulin molecules or of F (ab ') 2 fragments are tetravalent, while the dimers of Fab fragments or scFv molecules are bivalent. The individual monomers in a multimeric antibody can be identical or different, that is, they can be heteromeric or homomeric antibody multimers. For example, individual antibodies within a multimer may have identical or different binding specificities. The multimerization of antibodies can be carried out by means of natural antibody aggregation or by means of known chemical or recombinant binding techniques. For example, a certain percentage in purified antibody preparations (e.g., purified IgG1 molecules) spontaneously forms protein aggregates containing antibody homodimers and other higher order antibody multimers. Alternatively, antibody homodimers can be formed by known chemical bonding techniques. For example, heterobifunctional crosslinking agents can be used including, without limitation, SMCC [4- (maleimidomethyl) cyclohexane-1-carboxylate] of succinimidyl and SATA [S-acetylthio-N-succinimidyl acetate] (available for example from Pierce Biotechnology, Inc. (Rockford, Illinois)), to form multimeric antibodies. An exemplary protocol for the formation of homodimeric antibodies is given in Ghetie et al., Proceedings of the National Academy of Sciences USA (1997) 94: 7509-7514, which is incorporated herein by reference in its entirety. Homodimer antibodies can be converted to Fab'2 homodimers by digestion with pepsin. Another way to form homodimeric antibodies is by using the T15 autophilic peptide described by Zhao and Kohler, The Journal of Immunology (2002) 25: 396-404, which is incorporated herein by reference in its entirety. Alternatively, the antibodies can be made to multimerize by means of recombinant DNA techniques. IgM and IgA naturally form multimeric antibodies by interaction with the J-chain polypeptide. Non-IgA or non-IgM molecules, such as IgG molecules, can be engineered to contain the IgA J-chain interaction domain or IgM, thereby conferring the ability to form higher order multimers on non-IgA or non-IgM molecules (see for example, Chintalacharuvu et al., (2001) Clinical Immunology 101: 21-31, and Frigerio et al., (2000) Plant Physiology 123: 1483-94, both incorporated herein by reference in their entirety). The scFv dimers can also be formed by known recombinant techniques; an example of the construction of scFv dimers is given in Goel et al., (2000) Cancer Research 60: 6964-6971, which is incorporated herein by reference in its entirety. The multimeric antibodies can be purified using any suitable method known in the art, including without limitation size exclusion chromatography. Unless defined otherwise in the specification, the specific binding or immunospecific binding by an anti-TR7 antibody means that the anti-TR7 antibody binds to TR7 but does not bind (i.e., does not cross-react ) significantly with proteins other than TR7, such as other proteins from the same protein family. An antibody that binds to the TR7 protein and does not cross-react with other proteins is not necessarily an antibody that does not bind to said other proteins under all conditions; rather, the TR7-specific antibody of the invention preferably binds to TR7 compared to its ability to bind to said other proteins, such that it will be suitable for use in at least one type of assay or treatment, i.e. gives low basal levels, or does not produce undesirable side effects during treatment. It is well known that the portion of a protein bound with an antibody is referred to as the epitope. An epitope can be linear (i.e., sequentially comprised of amino acid residues in a protein sequence) or conformational (i.e., comprised of one or more amino acid residues that are not contiguous in the primary structure of the protein, but which are put in contact by the secondary, tertiary or quaternary structure of a protein). Since the TR7-specific antibodies bind to the TR7 epitopes, an antibody that specifically binds to TR7 may or may not bind with TR7 fragments or TR7 variants (eg, proteins that are at least 90% identical to TR7). ), depending on the presence or absence of the bound epitope by a specific TR7 antibody given in the TR7 fragment or variant. Similarly, the TR7-specific antibodies of the invention can be linked with TR7 orthologous species (including fragments thereof) depending on the presence or absence of the epitope recognized by the antibody in the orthologous. Additionally, the TR7-specific antibodies of the invention can be linked with modified forms of TR7, for example TR7 fusion proteins. In such a case, when the antibodies of the invention bind to TR7 fusion proteins, the antibody must make binding contact with the TR7 portion of the fusion protein so that the binding is specific. Antibodies that bind specifically to TR7 can be identified for example by means of immunoassays or other techniques known to the person skilled in the art, for example the immunoassays described in the examples below. In some embodiments, the present invention encompasses antibodies that bind immunospecifically or specifically to both TR7 and TR4. The specific binding or immunospecific binding of an antibody that binds immunospecifically to TR7 and TR4 means that the antibody binds to TR7 and TR4 but does not bind (i.e. does not cross-react) significantly with proteins other than TR7 or TR4, for example with other proteins of the same protein family. An antibody that binds to TR7 and TR4 proteins and does not cross-react with other proteins is not necessarily an antibody that does not bind to these other proteins under all conditions; rather, the antibody that binds immunospecifically or specifically to both TR7 and TR4 preferentially binds to TR7 and TR4 as compared to its ability to bind with said other proteins, such that it will be suitable for use in at least one type of trial or treatment, that is, it gives low basal levels or does not produce excessive adverse effects during the treatment. It is well known that the portion of a protein linked to an antibody is referred to as the epitope. An epitope can be linear (ie, sequentially comprised of amino acid residues in a protein sequence) or conformational (i.e., comprised of one or more amino acid residues that are not contiguous in the primary structure of the protein, but are contacted by the secondary structure, tertiary or quaternary of a protein). Since antibodies that bind to TR7 and TR4 bind to the common epitopes of TR7 and TR4, an antibody that specifically binds to TR7 and TR4 may or may not bind with TR7, TR4, or TR7 or TR4 variants (eg, example, proteins that are at least 90% identical to TR7 or TR4), depending on the presence or absence of the epitope bound by a given antibody in the fragment or variant of TR7 or TR4. Similarly, antibodies of the invention that bind immunospecifically to TR7 and TR4 can be linked with orthologous TR7 or TR4 species (including fragments thereof) depending on the presence or absence of the epitope recognized by the antibody in the orthologs. Additionally, the antibodies of the invention that bind immunospecifically to TR7 and TR4 can be linked with modified forms of TR7 or TR4, for example fusion proteins of TR7 or TR4. In such a case, when the antibodies of the invention bind to fusion proteins, the antibody must make binding contact with the TR7 or TR4 portion of the fusion protein so that the binding is specific. Antibodies that bind specifically to TR7 or TR4 can be identified for example by means of immunoassays or other techniques known to the person skilled in the art, for example the immunoassays described in the examples below. The term "variant", as used herein, refers to a polypeptide having an identical or similar function to a TR7 polypeptide, a fragment of a TR7 polypeptide, an anti-TR7 antibody or an antibody fragment thereof, but not necessarily comprises an amino acid sequence similar or identical to a TR7 polypeptide, a fragment of a TR7 polypeptide, an anti-TR7 antibody or antibody fragment thereof, or possess a structure similar or identical to a TR7 polypeptide, a fragment of a polypeptide TR7, an anti-TR7 antibody or antibody fragment thereof, respectively. A variant having a similar amino acid sequence refers to a polypeptide that satisfies at least one of the following: (a) a polypeptide comprising, or alternatively consisting of, an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, so minus 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequences described herein of the TR7 polypeptide (SEQ ID NO: 3) or a fragment thereof, an anti-TR7 antibody or an antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR, having an amino acid sequence of any one or more of the scFvs referred to in table 1); (b) a polypeptide encoded by a nucleotide sequence whose hybrid sequence under severe conditions with a nucleotide sequence described herein that encodes TR7 (SEQ ID NO: 3), a fragment of a TR7 polypeptide, an anti-HIV antibody, TR7 or antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR, having an amino acid sequence of any of those listed in Table 1), of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 40 amino acid residues, at least 50 residues of amino acid, at least 60 amino acid residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, per at least 125 amino acid residues, or at least 150 amino acid residues; and (c) a polypeptide encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the nucleotide sequence described herein that encodes a TR7 polypeptide, a fragment of a TR7 polypeptide, an anti-TR7 antibody or antibody fragment thereof (including a VH domain, VHCDR, VL domain or VLCDR , having an amino acid sequence of any one or more of the scFvs referred to in Table 1). A polypeptide with structure similar to a TR7 polypeptide, a fragment of a TR7 polypeptide, an anti-TR7 antibody or antibody fragment thereof, described herein, refers to a polypeptide described herein having a secondary, tertiary or quaternary structure similar to a TR7 polypeptide, a fragment of a TR7 polypeptide, an anti-TR7 antibody or an antibody fragment thereof. The structure of a polypeptide can be determined by methods known to the person skilled in the art, including without limitation X-ray crystallography, nuclear magnetic resonance and crystallographic electron microscopy.

To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (for example, spaces can be introduced into a first amino acid sequence or nucleic acids for optimal alignment with a second amino acid sequence or nucleic acids). The amino acid or nucleotide residues are then compared at corresponding amino acid positions or nucleotide positions. When a position in the first sequence is occupied by the same amino acid or nucleotide residue in the corresponding position of the second sequence, then the molecules are identical in that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (ie, percent identity = number of identical overlapping positions / total number of positions x 100%). In one embodiment, the two sequences are of the same length. The determination of the percentage of identity between the two sequences can be carried out using a mathematical algorithm known to the person skilled in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul, Proc. Nati Acad. Sci. USA 87: 2264-2268 (1990), modified as in Karlin and Altschul, Proc. Nati Acad. Sci. USA 90: 5873-5877 (1993). The BLASTn and BLASTx programs of Altschul et al., J. Mol. Biol. 215: 403-410 (1990), have incorporated said algorithm. The BLAST nucleotide searches can be performed with the BLASTn program (score = 100, word length = 12) to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTx program (score = 50, word length = 3) to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain alignments with spaces for comparison purposes, Gapped BLAST can be used, as described by Altschul et al. In Nucleic Acids Res. 25: 3589-3402 (1997). Alternatively, PSI-BLAST can be used to perform a repetitive search that detects distant relationships between molecules (id). When the BLAST, Gapped BLAST and PSI-BLAST programs are used, the default parameters of the respective programs (for example BLASTx and BLASTn) can be used (see http://www.ncbi.nlm.nih.gov.). Another example of a mathematical algorithm used for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (989). The ALIGN program (version 2.0), which is part of the GCG sequence alignment software package, has incorporated this algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM, as described by Torellis and Robotti in Comput. Appl. Biosci., 10: 3-5 (1994); and FASTA, described by Pearson and Lipman in Proc. Nati Acad. Sci. 85: 2444-8 (1988). Within FASTA, ktup is a control option that establishes the sensitivity and speed of the search. The term "derivative", as used herein, refers to a variant polypeptide of the invention comprising, or alternatively consisting of, an amino acid sequence of a TR7 polypeptide, a fragment of a TR7 polypeptide, or an antibody of the invention that binds immunospecifically to a TR7 polypeptide, which has been altered by introduction of substitutions, deletions or additions of amino acid residues. The term "derivative", as used herein, also refers to a TR7 polypeptide, a fragment of a TR7 polypeptide, or an antibody that immunospecifically binds to a TR7 polypeptide, which has been modified for example by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, a TR7 polypeptide, a fragment of a TR7 polypeptide, or an anti-TR7 antibody, can be modified for example by glycosylation, acetylation, pegylation, phosphorylation, amidation, modification with known protecting / blocking groups, proteolytic cleavage, binding to a cellular ligand or other protein, etc. A derivative of a TR7 polypeptide, a fragment of a TR7 polypeptide, or an anti-TR7 antibody, can be chemically modified using techniques known to those skilled in the art, including without limitation, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. In addition, a derivative of a TR7 polypeptide, a fragment of a TR7 polypeptide, or an anti-TR7 antibody, may contain one or more non-classical amino acids. A polypeptide derivative possesses an identical or similar function to a TR7 polypeptide, a fragment of a TR7 polypeptide, or an anti-TR7 antibody, described herein: The term "epitopes", as used herein, refers to portions of TR7 that have antigenic or immunogenic activity in an animal, preferably a mammal. An epitope having an immunogenic activity is a portion of TR7 that elicits an antibody response in an animal. An epitope having an antigenic activity is a portion of TR7 to which an antibody binds immunospecifically, the binding being determined by any method known in the art, for example by means of the immunoassays described herein. Antigenic epitopes are not necessarily immunogenic. The term "fragment", as used herein, refers to a polypeptide comprising an amino acid sequence of at least 5 amino acid residues, at least 10 amino acid residues, at least 5 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 35 amino acid residues, at least 40 amino acid residues, at least 45 amino acid residues, at least 50 residues of amino acid, at least 60 amino acid residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues , at least 150 amino acid residues, at least 175 amino acid residues, at least 200 amino acid residues, or at least 250 amino acid residues, of the TR7 amino acid sequence, or an antibody anti-TR7 po (including molecules such as scFv's, which comprise, or alternatively consisting of, antibody fragments or vanants thereof), which immunospecifically bind to the TRAIL receptor. The term "fusion protein," as used herein, refers to a polypeptide comprising, or alternatively consisting of, an amino acid sequence of an anti-TR7 antibody of the invention and an amino acid sequence of a heterologous polypeptide (eg. example, a polypeptide not related to an antibody or antibody domain.) The term "host cell", as used herein, refers to the particular subject cell transfected with a nucleic acid molecule, and the progeny or potential progeny of said The progeny may not be identical to the maternal cell transfected with the nucleic acid molecule, due to mutations or environmental influences that may occur in subsequent generations or to integration of the nucleic acid molecule in the genome of the host cell. The antibodies of the present invention are preferably provided in an isolated form, and preferably are substantially pure. or "means an antibody removed from its natural environment. Thus, for example, a polypeptide produced or contained within a recombinant host cell is considered isolated for the purposes of the present invention. By "isolated antibody" is meant an antibody removed from its natural environment. In this manner, an antibody produced or contained within a recombinant host cell is considered isolated for the purposes of the present invention.

Antibody structure It is known that the basic structural unit of an antibody comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having a "light" chain (approximately 25 kDa) and a "heavy" chain (approximately 50-70 kDa). The amino terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids responsible primarily for antigen recognition. The carboxy terminal portion of each chain defines a constant region responsible mainly for effector function. The human light chains are classified as light chains kappa and lambda. The heavy chains are classified as mu, delta, gamma, alpha or epsilon, and define the antibody isotype as IgM, IgD, IgG, IgA and IgE, respectively. See in general "Fundamental Immunology" chap. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989); incorporated as a reference in its entirety for all purposes). The variable regions of each pair of light / heavy chains form the antibody binding site. In this manner, an intact IgG antibody has two binding sites. Except for bifunctional or bispecific antibodies, the two binding sites are the same.

All chains exhibit the same general structure of relatively conserved framework regions (FR), joined by three hypervariable regions also called complementarity determining regions or CDRs. The CDRs of the heavy and light chains of each pair are aligned with the framework regions, allowing binding with a specific epitope. From end N to end C, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The amino acid assignment for each domain is according to the Kabat definitions: "Sequences of Proteins of Immunological Interest" (National Institutes of Health, Bethesda, Maryland (1987 and 1991)), or Chothia and Lesk: J Mol. Biol. 196: 901-917 (1987); Chothia et al., Nature 342: 878-883 (1989). A bispecific or bifunctional antibody is an artificial hybrid antibody that has two different heavy / light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or binding of Fab 'fragments; see for example Songsivilai and Lachmann, Clin. Exp. Immunol. 79: 315-321 (1990), Kostelny et al., J Immunol. 148: 1547-1553 (1992). In addition, bispecific antibodies can be formed as "diabodis" (Holliger et al: "iabodies \ - small bivalent and bispecific antibody fragments", PNAS USA 90: 6444-6448 (1993)) or "Janusins" (Traunecker et al .: " Bispecific single chain molecules (Janusins) target cytotoxic lymphocytes on HIV infected cells ", EMBO J 10: 3655-3659 (1991) and Traunecker and others" Janusin: new molecular design for bispecific reagents "Int J Cancer Suppl 7:51 -52 ( 1992)). The production of bispecific antibodies can be a relatively intense work process compared to the production of conventional antibodies, and the yield and degree of purity are generally lower in bispecific antibodies. Bispecific antibodies do not exist in the form of fragments having a single binding site (eg, Fab, Fab 'and Fv).

Anti-TR7 antibodies Using phage display technology, single-chain antibody molecules ("scFvs") that bind immunospecifically to TR7 (or fragments or variants thereof) have been identified. The molecules comprising, or alternatively consisting of, fragments or variants of these scFvs (for example, including VH domains, VH CDRs, VL domains or VL CDRs having an amino acid sequence of any of those listed in Table 1) , which bind immunospecifically to TR7 (or fragments or variants thereof), are also encompassed by the invention, such as the nucleic acid molecules encoding these scFvs, or molecules. In particular, the invention relates to scFvs comprising, or alternatively consisting of, an amino acid sequence selected from the group consisting of SEQ ID NOs: 42-56, preferably SEQ ID NOs: 42, 50 and 56, as refers in the following table 1. The molecules comprising, or alternatively consisting of, fragments or variants of these scFvs (for example including VH domains, VH CDRs, VL domains, or VL CDRs having an amino acid sequence of any of those listed in Table 1), which bind immunospecifically to TR7 are also encompassed by the invention, such as the nucleic acid molecules encoding these scFvs or molecules (eg, SEQ ID NOs: 57-71). The scFvs corresponding to SEQ ID NOs: 42-56 were selected for their ability to bind to TR7 polypeptide. The present invention provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically bind to a polypeptide or a TR7 polypeptide fragment. In particular, the invention provides antibodies corresponding to the scFvs referred to in Table 1. Such scFvs can routinely be "converted" to immunoglobulin molecules by inserting for example the nucleotide sequences encoding the VH or VL domains of the scFvs into a vector of expression that contains the constant domino sequences, and engineering the expression of the immunoglobulin molecule, as described in greater detail in Example 4 below. NSO cell lines expressing IgG1 antibodies comprising the VH and VL domains of the scFvs of the invention, have been deposited in the "American Type Culture Collection (ATCC)" on the dates indicated in Table 1, and received the numbers of ATCC deposit identified in Table 1. The ATCC is located at 10801 University Boulevard, Manassas, Virginia, 201 10-2209, USA The ATCC deposit was made in accordance with the terms of the Budapest treaty on the international recognition of the deposit of microorganisms for purposes of patent procedures. Accordingly, in one embodiment, the invention provides antibodies comprising the VH and VL domains of scFvs of the invention. In a preferred embodiment, an antibody of the invention is the antibody expressed by the cell line NSO TR7 2521 # 140 p: 12, deposited with the ATCC on March 25, 2002, and which received the ATCC deposit number PTA-4178 ( see table 1). In another preferred embodiment, an antibody of the invention is an antibody expressed by the cell line NSO TR7 2521 (5G08) # 176-41, p: 10 deposited with the ATCC on July 10, 2002, and which received the deposit number ATCC PTA-4539 (see table 1). In a preferred embodiment, the antibody of the invention is the antibody expressed by the cell line NSO TR7 2654 (84A02) # 62 p: 10 deposited with the ATCC on May 21, 2002, and which received the ATCC deposit number PTA- 4376 (see square). In another preferred embodiment, an antibody of the invention is the antibody expressed by the cell line NSO TR7 Ab 2834 # 10, p12, deposited with the ATCC on July 17, 2002, and which received the deposit number ATCC PTA-4547 ( see table 1).

TABLE 1 scFVs that bind immunospecifically to TRAIL receptors TABLE 1 (Continued) ? D The present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically bind to a TR7 polypeptide or fragment, vanant, or fusion protein. same. A TR7 polypeptide includes, without limitation, TR7 (SEQ ID NO: 3), or the polypeptide encoded by the cDNA of the HLYBX88 clone contained in the ATCC deposit 97920 made on March 7, 1997. In some embodiments, the antibodies of the present invention can be immunospecifically bound to both TR7 as described above, such as to TR4 (SEQ ID NO: 1) or to the polypeptide encoded by the cDNA of clone HCUDS60 contained in the ATCC deposit 97853 made on January 21, 1997. can produce TRAIL receptors by the recombinant expression of the nucleic acids encoding the polypeptides of SEQ ID NOs: 1-5, (TR4, TR5, TR7, TR10 and TR1, respectively (for example the cDNAs of the ATCC 97853 deposits (TR4 ), 97798 (TR5, filed November 20, 1996), 97920 (TR7), or 209040 (TR 0, filed May 15, 1997.) In one embodiment, the antibodies of the invention bind preferentially to TR7 ( SEQ ID NO: 3), or fragments, variants or prote Fusion proteins thereof (for example the extracellular region of TR7 fused to an Fe domain), with respect to its ability to bind to other proteins including TR1, TR4, TR5 or TR10 (SEQ ID NOs: 5, 1, 2 and 4), or fragments, variants or fusion proteins thereof. In other preferred embodiments, the antibodies of the invention bind preferentially to TR7 and TR4 (SEQ ID NOS: 3 and 1), or to fragments and variants thereof, with respect to their ability to bind to other proteins including TR1, TR5 or TR10 (SEQ ID NOS: 5, 2 and 4), or fragments, variants or fusion proteins thereof. In other preferred embodiments, the antibodies of the invention bind to TR1, TR4, TR5, TR7 and TR10 (SEQ ID NOs: 5, 1, 2, 3 and 4). The ability of an antibody to preferentially bind to an antigen compared to another antigen can be determined using any method known in the art.

TR7 Polypeptides In some embodiments of the present invention, the antibodies of the present invention bind to the TR7 polypeptide, or fragments or variants thereof. The following section describes in more detail the TR7 polypeptides, fragments and variants that can be linked by the antibodies of the invention. The TR7 polypeptides, fragments and variants that can be linked by the antibodies of the invention are also described for example in international publications Nos. WO 98/41629, WO 00/66156 and WO 98/35986, which are incorporated herein by reference in its entirety In some embodiments, the antibodies of the present invention bind immunospecifically to the TR7 polypeptide. An antibody that binds immunospecifically to TR7, in some embodiments, may bind fragments, variants (including TR7 orthologous species), multimers, or modified forms of TR7. For example, an immunospecific antibody to TR7 can bind to the TR7 portion of a fusion protein comprising all TR7 or a portion thereof. The TR7 proteins can be found as monomers or multimers (ie, dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to antibodies that bind to TR7 proteins found as monomers or as part of multimers. In specific embodiments, the TR7 polypeptides are monomers, dimers, trimers or tetramers. In further embodiments, the multimers of the invention are at least dimers, at least trimers or at least tetramers. The antibodies of the invention can bind homomers or heteromers of TR7. As used herein, the term "homomer" refers to a multimer containing only TR7 proteins of the invention (including fragments), variants and TR7 fusion proteins, as described herein). These homomers may contain TR7 proteins that have identical or different polypeptide sequences. In a specific embodiment, a homomer of the invention is a multimer containing only TR7 proteins that have identical polypeptide sequences. In another specific embodiment, the antibodies of the invention bind to TR7 homomers containing TR7 proteins that have different polypeptide sequences. In specific embodiments, the antibodies of the invention bind to a TR7 homodimer (containing, for example, TR7 proteins having identical or different polypeptide sequences). In further embodiments, the antibodies of the invention bind to at least one homodimer, at least one homotrimer, or at least one TR7 homotetramer. In specific embodiments, the antibodies of the present invention bind to TR7 homotrimers (containing, for example, TR7 proteins having identical or different polypeptide sequences). As used herein, the term "heteromer" refers to a multimer containing heterologous proteins (ie, proteins that contain polypeptide sequences that do not correspond to the TR7 polypeptide sequences), in addition to the TR7 proteins of the invention. In a specific embodiment, the antibodies of the invention bind to a heterodimer, a heterotrimer, or a heterotetramer. In further embodiments, the antibodies of the invention bind to at least one homodimer, at least one homotrimer, or at least one homotetramer, which contains one or more TR7 polypeptides. In specific embodiments, the antibodies of the present invention bind to a heterotrimer of TR7 (containing, for example, 1 or 2 TR7 proteins and 2 or 1, respectively, TR4 proteins). The multimers linked by one or more antibodies of the invention can be the result of hydrophobic, hydrophilic, ionic or covalent associations, or they can be linked indirectly for example by means of liposome formation. Thus, in one embodiment, the multimers linked by one or more antibodies of the invention, such as, for example, homodimers or homotrimers, are formed when the TR7 proteins make contact with one another in solution. In another embodiment, heteromultimers linked by one or more antibodies of the invention, such as for example heterotrimers or heterotetramers, are formed when the TR7 proteins contact in solution with antibodies to the TR7 polypeptides (or antibodies to the heterologous polypeptide sequence in a fusion protein). In other embodiments, the multimers linked by one or more antibodies of the invention are formed by covalent associations with or between the TR7 proteins of the invention. Said covalent associations may include one or more amino acid residues contained in the polypeptide sequence of the protein (for example the polypeptide sequence cited in SEQ ID NO: 3, or the polypeptide encoded by the cDNA clone deposited with No. ATCC 97920 ). In one case, the covalent associations are entanglement between cysteine residues located within the polypeptide sequences of the proteins that interact in the native (i.e., natural) polypeptide. In another case, covalent associations are the result of chemical or recombinant manipulation. Alternatively, said covalent associations may include one or more amino acid residues contained in the heterologous polypeptide sequence in a TR7 fusion protein. In one example, the covalent associations are between the heterologous sequence contained in a fusion protein (see, for example, U.S. Patent No. 5,478,925).

In a specific example, the covalent associations are between the heterologous sequence contained in a TR7-Fc fusion protein (as described herein). In another specific example, the covalent associations of fusion proteins are between heterologous polypeptide sequences of another member of the TNF ligand / receptor family which are capable of forming covalently associated multimers, such as for example osteoprotegerin (see for example the publication of International Patent No. WO 98/49305, the content of which is incorporated herein by reference in its entirety). The multimers that can be linked by one or more antibodies of the invention can be generated using known chemical techniques. For example, the proteins that are desired to be contained in the multimers of the invention can be chemically entangled using known linker molecules and linker molecule length optimization techniques (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference). In its whole). Additionally, the multimers that can be linked by one or more antibodies of the invention, can be generated using known techniques to form one or more intermolecular interlaces between the cysteine residues located within the polypeptide sequence of the proteins that it is desired to contain in the multimer (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). In addition, proteins that can be linked by one or more antibodies of the invention can be routinely modified by adding cysteine or biotin to the C-terminus or N-terminus of the protein's polypeptide sequence, and known techniques can be applied to generating multimers containing one or more of these modified proteins (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). Additionally, known techniques can be applied to generate liposomes containing the protein components that are desired to contain in the multimer that can be linked by one or more antibodies of the invention (see for example U.S. Patent No. 5,478,925, which is incorporated here as a reference in its entirety). Alternatively, the multimers that can be linked by one or more antibodies of the invention can be generated using known genetic engineering techniques. In one embodiment, proteins contained in multimers that can be linked by one or more antibodies of the invention are produced recombinantly, using fusion protein technology that is described herein, or is known (see, for example, US Patent No. 5,478,925, which is incorporated herein by reference in its entirety). In a specific embodiment, polynucleotides encoding a homodimer that can be linked by one or more antibodies of the invention, are generated by ligating a polynucleotide sequence encoding a TR7 polypeptide with a sequence encoding a linker polypeptide, and then also a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). In another embodiment, recombinant techniques described herein or known are applied to generate recombinant TR7 polypeptides that contain a transmembrane domain and which can be incorporated into liposomes by membrane reconstitution techniques (see, for example, US Pat. 5,478,925, which is incorporated herein by reference in its entirety). In another embodiment, two or more TR7 polypeptides are linked by synthetic linkers (e.g., peptide, carbohydrate or soluble polymer linkers). Examples include the peptide linkers that are described in the U.S.A. No. 5,073, 627 (incorporated herein by reference). Using conventional recombinant DNA technology, proteins comprising multiple TR7 polypeptides separated by peptide linkers can be produced. In specific embodiments, the antibodies of the invention bind to proteins comprising multiple TR7 polypeptides separated by peptide linkers. Another method for preparing TR7 multimeric polypeptides includes the use of TR7 polypeptides fused to a leucine zipper or an isoleucine polypeptide sequence. The leucine closing domains and the isoleucine closing domains are polypeptides that promote the multimerization of the proteins in which they are found. Leucine closures were originally identified in several DNA binding proteins (Landschulz et al., Science 240-1759, (1988)), and have since been found in a variety of different proteins. Among the known leucine closures are the natural peptides and their derivatives that dimerize or trimerize. Examples of leucine closure domains suitable for producing soluble multimeric TR7 proteins are those described in PCT application WO 94/10308, incorporated herein by reference. Recombinant fusion proteins comprising a soluble TR7 polypeptide fused to a peptide that dimerizes or trimerizes in solution, are expressed in suitable host cells, and the resulting soluble multimer TR7 is recovered from the culture supernatant using known techniques. In specific embodiments, the antibodies of the invention bind to TR7 fusion protein-leucine lock monomers or TR7 fusion protein-leucine lock multimers. It is considered that some members of the TNF family of proteins exist in trimeric form (Beutler and Huffel, Science 264: 667, 1994; Banner et al., Ce // 73: 431, 1993). In this way, trimeric TR7 may offer the advantage of increased biological activity. Preferred leucine closure portions are those which preferably form trimers. An example is a leucine closure derived from the lung surfactant protein D (SPD), as described by Hoppe et al. (FEBS Letters 344: 191, (1994)), and in the patent application of E.U.A. No. 08 / 446,922, incorporated herein by reference. In specific embodiments, the antibodies of the invention bind to TR7 fusion protein-leucine closure trimers. To prepare trimeric TR7, other peptides derived from natural trimeric proteins can be used. In specific embodiments, the antibodies of the invention bind to TR7 fusion protein monomers or TR7 fusion protein trimers. The antibodies of the invention that bind to TR7 receptor polypeptides can be attached to them as isolated polypeptides or in their natural state. By "isolated polypeptide" is meant a polypeptide removed from its natural environment. In this manner, a polypeptide produced or contained within a recombinant host cell is considered isolated for the purposes of the present invention. Polypeptides that have been purified, partially or substantially, from a recombinant host cell are also considered "isolated polypeptides". For example, a recombinantly produced version of TR7 polypeptide is substantially purified by a one step method described by Smith and Johnson, Gene 67: 31-40 (1988). In this manner, the antibodies of the present invention can be linked with recombinantly produced TR7 receptor polypeptides. In a specific embodiment, the antibodies of the present invention bind to a TR7 receptor expressed on the surface of a cell, wherein said TR7 polypeptide is encoded by a polynucleotide encoding amino acids 1 to 41 of SEQ ID NO: 3, operatively associated with a regulatory sequence that controls the expression of said polynucleotide. The antibodies of the present invention can be linked to polypeptides or TR7 polypeptide fragments that include polypeptides comprising, or alternatively consisting of, an amino acid sequence contained in SEQ ID NO: 3 encoded by the cDNA contained in the ATCC deposit number 97920 , or encoded by nucleic acids that hybridize (eg under severe hybridization conditions) with the nucleotide sequence contained in the ATCC deposit 97920, or the complementary chain thereof. The protein fragments can be "independent" or be comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. The antibodies of the present invention can be attached to polypeptide fragments, including for example the fragments comprising, or alternatively consisting of, the amino acid residues: 1 to 51, 52, 78, 79 to 91, 92 to 1 1 1, 12 to 134, 135 to 151, 152 to 178, 179 to 180, 181 to 208, 209 to 218, 219 to 231, 232 to 251, 252 to 271, 272 to 291, 292 to 31 1, 312 to 323, 324 to 361, 362 to 391, 392 to 41 1, approximately, of SEQ ID NO: 3. In this context, "approximately" includes scales particularly cited, major or minor by several amino acids (5, 4, 3, 2 or 1) at either end or at both ends. In addition, the polypeptide fragments can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 10, 120, 130, 140 or 150 amino acids in length. In this context, "approximately" includes the value particularly cited, greater or lesser by several amino acids (5, 4, 3, 2 or 1) at either end or at both ends. Preferred polypeptide fragments of the present invention include a member selected from the group: a polypeptide comprising, or alternatively consisting of, the extracellular domain of the TR7 receptor (which is predicted to constitute the amino acid residues 52 to 184, approximately, in SEQ ID NO: 3), a polypeptide comprising, or alternatively consisting of, the two cysteine-rich domains of TR7 (which can be found in the protein fragment consisting of amino acid residues 84 to 179, approximately , of SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR7 consisting of amino acid residues 84 to 131, approximately, of SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR7 consisting of amino acid residues 132 to 179, approximately, of SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, the transmembrane domain of the TR7 receptor (which is predicted to constitute the amino acid residues 185 to 208, approximately, in SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, a predicted mature TR7 polypeptide fragment, wherein the fragment has a functional activity of TR7 (eg, antigenic activity or biological activity); a polypeptide comprising, or alternatively consisting of, the intracellular domain of the TR7 receptor (which is predicted to constitute approximately 209 to 411 amino acid residues of SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, the extracellular and intracellular domains of the TR7 receptor, with part or all of the deleted transmembrane domain; a polypeptide comprising, or alternatively consisting of, the death domain of the TR7 receptor (which is predicted to constitute the amino acid residues 324 to 391, approximately, of SEQ ID NO: 3); and a polypeptide comprising, or alternatively consisting of, one, two, three, four or more portions of the epitope-bearing TR7 receptor protein. In further embodiments, the polypeptide fragments of the invention comprise, or alternatively consist of, any combination of 1, 2, 3, 4, 5, 6, 7 or the 8 members mentioned above. As above, with the leader sequence, the amino acid residues that constitute the extracellular, transmembrane and intracellular domains of the TR7 receptor have been predicted by computer analysis. In this way, as the person with average knowledge in the art will appreciate, the amino acid residues that constitute these domains may vary slightly (for example in approximately 1 to 15 amino acid residues), depending on the criteria used to define each domain. The polypeptides encoded by these nucleic acid molecules are also encompassed by the invention. As discussed above, it is considered that one or both extracellular motifs rich in cysteine of TR7 are important for the interactions between TR7 and its ligands (eg TRAIL). Accordingly, in highly preferred embodiments, the antibodies of the present invention bind to TR7 polypeptide fragments comprising, or alternatively consisting of, amino acid residues 84 to 131, or 132 to 179 of SEQ ID NO: 3. In another highly preferred embodiment, the antibodies of the present invention bind to TR7 polypeptides comprising, or alternatively consisting of, the two extracellular cysteine-rich motifs (amino acid residues 84 to 179 of SEQ ID NO: 3). In another preferred embodiment, the antibodies of the present invention bind to TR7 polypeptides comprising, or alternatively consisting of, the soluble extracellular domain of TR7 (amino acid residues 52 to 184 of SEQ ID NO: 2). In other highly preferred embodiments, antibodies of the invention that bind to part or all of the soluble extracellular domain of TR7 (eg, one or both of the cysteine-rich domains), agonize with the TR7 receptor. In other highly preferred embodiments, antibodies of the invention that bind to a part or all of the soluble extracellular domain of TR7 (for example one or both of the cysteine-rich domains), induce cell death of the cell expressing the receptor of TR7. The antibodies of the invention can also be linked to fragments comprising, or alternatively consisting of, structural or functional attributes of TR7. Such fragments include amino acid residues comprising alpha helix and alpha helical regions ("alpha regions"), beta sheet and beta-sheet forming regions ("beta regions"), spinning and spinning regions ("turning regions"). ), spiral and spiral forming regions ("spiral regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions and regions of high antigenic index (i.e., polypeptide regions consisting of amino acid residues that have an antigenic index greater than or equal to 1.5, identified using the default parameters of the Jameson-Wolf program) of TR7. Some preferred regions are those set forth in Table 2 and include, without limitation, regions of the aforementioned types identified by amino acid sequence analysis of SEQ ID NO: 3, said preferred regions include: alpha regions, beta regions, spinning regions and spiral regions predicted according to Garnier-Robson; alpha regions, beta regions and regions of rotation predicted according to Chou-Fasman; Hydrophilic regions predicted by Kyte-Doolittle and hydrophobic regions predicted by Hopp-Woods; alpha and beta amphipathic regions of Eisenberg; surface forming regions of Emini; and regions of high antigenic index of Jameson-Wolf, predicted using the default parameters of these computer programs. The data representing the structural or functional attributes of TR7 indicated in Table 2, as described above, were generated using several modules and algorithms of the DNA * STAR series on the omission parameters. Column I represents the results of a Garnier-Robson analysis of alpha helical regions; column II represents the results of a Chou-Fasman analysis of alpha helical regions; column III represents the results of a Garnier Robson analysis of beta sheet regions; column IV represents the results of a Chou-Fasman analysis of beta sheet regions; column V represents the results of a Garnier Robson analysis of turning regions; column VI represents the results of a Chou-Fasman analysis of turning regions; column VII represents the results of a Gamier Robson analysis of spiral regions; column VIII represents a hydrophilicity graph of Kyte-Doolittle; column IX represents a Hopp-Woods hydrophobicity plot; column X represents the results of an Eisenberg analysis of alpha amphipathic regions; column XI represents the results of an Eisenberg analysis of beta amphipathic regions; column XII represents the results of a Karplus-Schultz analysis of flexible regions; column XIII represents the score of the antigenic index of Jameson-Wolf; and column XIV represents the surface probability graph of Emini. In a preferred embodiment, the data presented in columns VIII, IX, XIII and XIV of Table 2 can be used to determine regions of TR7 that exhibit a high degree of antigenicity potential. The regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII or XIV, by choosing values representing regions of the polypeptide that are likely to be exposed on the surface of the polypeptide in a medium in which antigen recognition may occur in the process of starting an immune response. The columns in Table 2 present the result of different analyzes of the TR7 protein sequence. The aforementioned preferred regions indicated in Table 2 include, without limitation, regions of the aforementioned types identified by analysis of the amino acid sequence indicated in SEQ ID NO: 3. As indicated in Table 2, said preferred regions include the alpha regions, beta regions, spin regions and spiral regions of Garnier-Robson, the alpha regions, beta regions and spin regions of Chou-Fasman, the hydrophilic regions of Kyte-Doolittle, the alpha and beta amphipathic regions of Eisenberg, the flexible regions of Karplus-Schulz, the regions of Jameson-Wolf of high antigenic index and the surface-forming regions of Emini. Preferably, the antibodies of the present invention bind to TR7 polypeptides or TR7 polypeptide fragments and variants comprising regions of TR7 that combine various structural features, such as several of the regions indicated above and in Table 2 (eg, 1, 2, 3, or 4), same or different.

TABLE 2 Res Position I II III IV V VI VII VII IX X XI XII XIII XIV Met 1 A. 1.11 -0.70 * 1.29 2.18 Glu 2 A. 1.50 -0.70. * 1.63 1.69 Gln 3 A. T 1.89 -0.73 * 2.17 2.28 Arg 4 T T 1.69 -0.76. 2.91 3.71 Gly 5 T T 1.87 -0.87 + F 3.40 2.17 Gln 6 T T 1.88 -0.44 * F 2.76 1.93 So- 7. - c 1.29 -0.34 * F 1.87 1.00 Wing 8 c- 0.99 - 0.16 F- í.oa 1.02 Pro 9 c 0.53 0.11 *. 0.44 0.79 Wing 10 A. 0.29 0.14 * -0.10 0.48 Wing 11 A - T 0.40 0.24. 0.10 0.48 Ser 12 A T 0.44 -0.26 * F 0.85 0.61 Gly 13 A T 1.14 -0.69 * F 1.30 1.22 Wing 14 A T 1.32 -1.19 F 1.30 2.36 Arg 15 A T. 1.57 -1.19 * F 1.50 2.39 Lys 16 T 1.94 -1.14 F 1.50 2.39 Arg 17 T 1.90 -1.14 F í.ao 3.66 His 18. c 2.03 -1.21 * * F 1.90 1.85 Gly 19 T c 2.73 -0.79 * * F 2.40 1.43 Pro 20 - T c 2.62 -0.79 * * F 2.70 1.43 Gly 21 T c 1.99 -0.79 F 3.00 1.82 Pro 22 T c 1.99 -0.79. * F 2.70 1.86 Arg 23 A c 1.68 -1.21 * F 2.30 2.35 Glu 24 · A 1.43 -1.21 * F 2.10 2.35 Wing 25 A T. 1.76 -1.14 * F 2.50 1.54 Arg 26 A T 1.89 -1.57 * F 2.50 1.54 Gly 27 T. 1.76 -1.14 * F 3.00 1.37 Wing 28 T c 1.43 -0.71 + F 2.70 1.35 Arg 29 T c 1.54 -0.79 * * F 2.66 1.06 Pro 30? c 1.28 -0.79 * * F 2.62 2.10 Gly 31 T c 0.96 -0.57 * F 2.58 1.54 Pro 32 T c 1.34 -0.64 * F 2.54 1.22 Arg 33 c 1.62 -0.64 * * F 2.60 1.58 Val 34 c 0.70 -0.59 * * F 2.34 2.30 Pro 35 E 0.06 -0.33 * F 1.58 1.23 Lys 36 B B -0.41 -0.11 * F 0.97 0.46 Thr 37 B B -1.06 0.57 * * F -0.19 0.52 Leu 38 B B -2.02 0.57 *? -0.60 0.25 val 39 B B -1.76 0.79 -0.60 0.09 Leu 40 A B -2.13 1.29 -0.60 0.06 al 41 A B -3.03 1.30 -0.60 0.08 Val 42 A B -3.53 1.26 -0.60 0.08 Wing 43 A B -3.53 1.30 -0.60 0.08 Wing 44 A B -3.49 1.30 -0.60 0.09 Val 45 A 3 -3.53 1.34 -0.60 0.10 Leu 46 A B -2.98 1.34 -0.60 0.07 Leu 47 A B -2.71 1.23 -0.60 0.09 Leu 48 A B -2.12 1.23 -0.60 0.13 Val 49 A B -1.83 0.59 -0.60 0.27 Ser 50 A B -1.57 0.29 * -0.30 0.44 TABLE 2 (Continued) Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV Wing 51 A A - 1.57 0.10 -0.30 0.54 Glu 52 A A 1.64 0.10 -0.30 0.60 Ser 53 A A B 1.14 0.14 -0.30 0.31 Wing 54 A A B - 0.29 0.24 -0.30 0.45 Leu 55 A A B 0 .01 0.14 -0.30 0.45 lie 56 A A B 0 .60 0.54 -0.60 0.58 Thr 57 A A B D.21 0.16. F -0.15 0.96 Gln 58 A A B - D .50 0.34 F -0.15 0.96 Gln 59 A A B - D.12 0.16 F 0.00 1.38 Asp 60 A B 0 .69 -0.10 F 1.00 1.48 Leu 61 A c 1 .58 -0.19 * | F 0.80 1.48 Wing 62 A c 2 .00 -0.19 * F 0.80 1.48 Pro 63 A c 1 .41 -0.59 * F 1.10 1.73 Gln 64 A 0 .82 -0.09 * F 1.00"2.13 Gln • 65 A A 0 .61 -0.27 * F 0.60 2.13 Arg 66 A A 1 .42 -0.34 * F 0.60 2.13 Wing 67 A A 2 .01 -0.37 * F 0.94 2.13 Wing 68 A A 2 .27 -0.37 * F 1.28 2.13 Pro 69 A A 2 .38 -0.77 * F 1.92 2.17 Gln 70 A T 2 .08 -0.77 *. F 2.66 4.21 Gln 71 T T 1 .67 -0.89 * * - F 3.40 5.58 Lys 72 T T 2 .04 -1.00 F 3.06 4.84 Arg 73 T T 2 .33 -1.00 F 2.97 4.32 Be 74 '. T c 2 .54 -1.01 F 2.68 3.34 Be 75 T c 2 .20 -1.41 F 2.59 2.89 Pro 76 T T 1 .39 -0.99 F 2.70 1.4S Ser 77 T T 0 .68 -0.30 F 2.50 0.90 Glu 78 T T 0 .36 -0.11 F 2.25 0.35 Gly 79 T. 0 .44 -0.07 F 1.80 0.36 Leu 80 T 0 .40 -0.07 F 1.55 0.42 Cys 81 . c 0 .58 -0.03 0.95 0.24 Pro 82 T c 0.84 0.47 F 0.15 0.33 Pro 83 T T - 3.04 0.54 * F 0.35 0.54 Gly 84 T T. . 0 .00 0.54 0.20 0.70 His 85 T c 0.81 0.36 * 0.30 0.51 His '86 c 1 .48 -0.07 * 0.70 0.58 lie 87 c 1 .34 -0.50 * *. 1.19 1.15 Ser 88 c 1 .67 -0.50 * * F 1.53 0.84 Glu 89 T 2 .01 -1.00 * * F 2.52 1.21 Asp 90 T 1 .38 -1.50 * F 2.86 2.88 Gly 91 T T 0 .52 -1.61 * * F 3.40 1.15 Axg 92 T T 1 .11 -1.31 * * F 2.91 0.47 Asp 93 X T 0 .74 -0.93 * F 2.57 0.37 Cys 94 T T 0 .79 -0.36 * 1.78 0.20 lie 95 T 0 .54 -0.79 * 1.54 0.21 Ser 96 T 0 .54 -0.03 * 1.18 0.19 Cys 97 T T 0 .43 0.40 * 0.76 0.36 Lys 98 T T 0 .43 0.23 1.34 0.88 Tyr 99 T T 0 .86 -0.45 * F 2.52 1.10 Gly 100 T T 1 .44 -0.09 * F 2.80 3.22 TABLE 2 (Continued) Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV Gln 101 - T T 1.43 -0.27 * F 2.52 2.16 Asp 102 T T 2.07 0.21 * * F 1.64 1.99 Tyr 103 T T 1.73 -0.04 * * F 1.96 2.73 Ser 104 T T 1.98 0.44 F 0.78 1.66 Thr 105 T. 2.32 0.44 * F 0.30 1.60 His 105 T ·. 1.51 0.44 * 0.15 1.70 Trp 107 T T 0.70 0.37 * 0.65 1.05 Asn 108 T • T | 0.24 0.67 0.20 0.60 Asp 109 T T -0.12 0.97 * - 0.20 0.38 Leu 110 T -0.62 1.04 * * -0.20 0.19 Leu 111 B T -0.48 0.81 * * -0.20 0.10 Phe 112 B T -0.86 0.41 * * -O.20 0.12 Cys 113 B T -1.17 0.99 * * -0.20 0.08 Leu 114 B T -1.06 0.79 * -0.20 0.13 Arg 115 B T -0.91 0.10 * 0.10 0.30 Cys 116 B T -0.10 -0.11 0.70 0.30 Thr 117 B T 0.30 -0.69 * 1.00 0.61 Arg 118 B T 0.62 -0.99 F 1.49 0.42 Cy3 119 T T · 1.43 -0.56 * F 2.23 0.77 Asp 120 T T 0.47 -1.13 * F 2.57 0.92 Ser 121 T T 1.13 -0.97 F 2.91 0.35 Gly 122 T T 0.63 -0.97 * F 3.40 1.13 Glu 123 A T. 0.22 -0.86 * F 2.51 0.55 Val 124 A A. 0.68 -0.47 * F 1.47 0.56 Glu 125 A T 0.01 -0.43 *. 1.38 0.87 Leu 126 A T 0.00 -0.29 * 1.04 0.27 Ser 127 T c: 0.03 0.20 * F 0.45 0.52 Pro 128 1 T -0.28 0.04 * F 0.93 0.44 Cys 129 T T 0.69 0.53 * F 0.91 0.77 Thr 130? T 0.69 -0.16 * F 2.24 1.12 Thr 131 T. 1.19 -0.14 F 2.32 1.16 Thr 132 T T 0.63 -0.09 * F 2.80 3.13 Arg 133 T T 0.18 -0.01 F 2.52 1.61 Asn 134 T T 0.84 0.07 F 1.49 0.60 Thr 135 T T 0.49 -0.01 F 1.81 0.72 Val 135 T c: 0.80 0.07 * 0.58 0.20 Cys 137 A T 1.11 0.07 * 0.10 0.21 Gln 138 A? . 0.66 -0.33. 0.30 0.25 Cys 139 A 0.34 -0.39 0.70 0.34 Glu 140 A A -0.04 -0.54 * F 0.75 0.91 Glu 141 A A 0.92 -0.33 * * F 0.45 0.46 Gly 142 A 1.59 -0.73 * F 1.30 1.67 Thr 143 A A 1.59 -1.30 * F 0.90 1.67 Phe 144 A A 2.26 -1.30 F 0.90 1.67 Arg 145 A A 1.96 -1.30 F 0.90 2.81 Glu 146 A A 1.74 -1.34 * F 0.90 2.61 Glu 147 A A 2.09 -1.40 * F 0.90 4.66 Asp 148 .A A 1.80 -2.19 * F 0.90 4.12 Ser 149 A - T 1.83 -1.57 F 1.30 2.35 Pro 150 A T 1.83 -1.00 F 1.15 0.73 TABLE 2 (Continued) Res Position I II III IV V VI VII VII IX X XII XIII XIV Glu 151 A T '1.88 -1.00 * F 1.15 0.85 Met 152 A. T 1.21 -1.00 * *. 1.49 1.28 Cys 153 A T 1.32 -0.81 * *. 1.68 0.44 Arg 154 A T 1.31 -1.24 * 2.02 0.50 Lys 155 T T 1.18 -0.76 * + F 2.91 | 0.73 Cys 156 T T 0.51 -0.94 * F 3.40 1.35 Arg 157 T. 0.90 -0.94 F 2.71 0.37 Thr 158 • T 1.58 -0.51 * F 2.37 0.28 Gly 159 T. 1.22 -0.51 * F 2.43 1.04 Cys 160 T C 0.58 -0.66 * F 2.19 0.53 Pro 151 T T 0.39 -0.04 * F 2.00 0.36 Arg 162 T T 0.32 0.11 * F 1.65 0.27 Gly 163 T T -0.22 -0.31 * *. 2.50 1.01 Met 164 B B. . -0.22 -0.24 *. 1.30 0.48 Val 165 B B 0.44 -0.24 * * 1.30 0.24 Lys 166 B B -. -0.01 -0.24 * * 1.30 0.41 Val 167 B. T -0.43 -0.10 * * F 1.85 0.22 Gly 168 T T -0.30 -0.23 F 2.25 0.44 Asp 169 T T 0.01 -0.44 F 2.50 0.34 Cys 170 T T 0.57 0.47 * F 1.35 0.48 Thr 171 T C 0.52 0.21 * F 1.20 0.65 Pro 172 T T 0.49 -0.21 * F 1.75 0.55 Trp 173 T T 0.83 0.47 * F 0.60 0.84 Ser 174 A T 0.17 -0.10 F l.OO 1.01 Asp 175 A A -0.02 -0.01 F 0.45 0.35 lie 176"A A 0.26 0.20 * * -0.30 0.25 Glu 177 A A 0.51 -0.21 * 0.30 0.25 Cys 178 A A 0.80 -0.60 * 0.S0 0.30 Val 179 A A 0.80 -0.60 * * 0.6O 0.74 His 180 A A 0.46 -0.90 0.SO 0.58 Lys 181 A A 0.46 -0.47 * F 0.50 1.0S Glu 182 A T -0.43 -0.36 * F l.OO 1.00 Ser 183 A T -0.66 -0.31 F 0.85 0.52 Gly 184 A T -0.14 -0.13 F 1.25 0.13 lie 185 A T -0.97 0.30 0.10 0.10 lie 186. B B -1.32 0.94 * -0.6D 0.05 lie 187 B B -2.18 1.04 -0.60 0.08 Gly 188 B B -2.47 1.26 * -0.60 0.09 Val 189. B B -2.71 1.07 -0.60 0.13 Thr 190 A B -2.68 0.89 * -0.60 0.18 Val 191 A B -2.64 0.84 -0.60 0.14 Wing 192 A B -2.57 1.06 * -0.60 0.14 Wing 193 A B -3.11 1.10 -0.60 0.08 Val 194 A B -3.11 1.30 -0.60 0.07 Val 195 A B -3.39 1.30 -0.60 0.05 Leu 196. A B -3.39 1.30 -0.60 0.05 lie 197 A B -3.50 1.44 -0.60 0.05 Val 198 A B -3.77 1.59 -0.60 0.06 Wing 199 A B -3.58 1.59 -0.60 0.06 Val 200 A B -2.68 1.47 -0.60 0.04 TABLE 2 (Continued) Res Position I II III IV V VII VII VIII IX X XX XII XIII XIV Phe 201 A B -2.170.79. -0.60 0.12 Val 202 A B. -2.09 0.53 -0.60 0.16 Cys 203 A T -2.04 0.71 -0.20 0.17 Lys 204 A T -1.74 0.76 -0.20 0.17 Ser 205 A T -0.840.89 -0.20 0.24 Leu 206 A T -0.100.24 0.10 0.88 Leu 207 A A -0.10 -0.33 0.30 0.88 Trp 208 A A -0.240.31 -0.30 0.49 Lys 209 A A -0.500.61 -0.60 0.49 Lys 210 A A -0.440.36 * -0.30 0.91 Val 211 A A -0.440.43 * * -0.45 1.36 Leu 212 A B 0.41 0.20 * -0.30 0.56 Pro 213 A B 0.36 0.20 * · -0.30 0.56 Tyr 214 B T -0.580.63 * -0.20 0.75 Leu 215 B T -1,290.67 * -0.20 0.64 Lys 216. B T -0.73 0.56 * -0.20 0.22 Gly 217 B B. -0.270.51 * -0.60 0.19 lie 218 B B -0.400.19 * -0.30 0.23 Cys 219 B. T -0.50 -0.07 * 0.70 0.11 Ser 220 T T -0.03 0.36 F 0.65 0.11 Gly 221 T T -0.080.36 F 0.65 0.16 Gly 222 T T 0.06 -0.33 F 1.25 0.49 Gly 223 c 0.94 -0.47 F 0.85 0.57 Gly 224 c 1.72 -0.86 * F 1.15 0.99 Asp 225 T c 1.17 -1.29 F 1.50 1.97 Pro 226 T c 1.51 -1.07 * F 1.84 1.47 Glu 227 B T 1.97 -1.50 * F 1.98 2.49 Arg 228 B T 2.01 -1.93 * F 2.32 2.92 Val 229 T 2.06 -1.54 * F 2.86 2.53 Asp 230 T T 2.06 -1.59 * F 3.40 1.96 Arg 231 T T 2.38 -1.19 * F 3.06 1.73 Ser 232 T T 2.17 -1.19 * F 2.72 4.57 Ser 233 T T 1.71. -1.40 * * F 2.72 4.23 Gln 234. c 1.98 -0.97 * * F 2.32 2.14 Arg 235 T c 1.98 -0.47 * F 2.22 1.61 Pro 236 T c 1.87 -0.86 * * F 2.86 2.08 Gly 237 'T. 2.17 -1.24 * F 3.40 2.01 Wing 238 T c 1.61 -1.24 7 2.86 1.65 Glu 239 A 0.80 -0.60 * | F 1.97 0.79 Asp 240 A 0.69 -0.34 * F 1.33 0.66 Asn 241 A 0.90 -0.37 * 0.99 1.05 Val 242 A 0.36 -0.87 0.95 1.05 Leu 243 A 0.09 -0.19 * 0.50 0.44 Asn 244 A B -0.210.46 * -0.60 0.20 Glu 245 A B -1.10 0.44 -0.60 0.37 lie 245 A B -1.910.49 -0.60 0.31 Val 247 A B -1,060.49 * -0.60 0.16 Ser 243 B B -0.460.49 * -0.60 0.16 lie 249 B B -0.77 0.91 * -0.60 0.35 Leu 250 B c -0.770.71 -0.40 0.69 T 2 (Continued) Res Position I "II" III "IV" v VI "VII" VIII IX X XI XII XIII XIV Gln '251' T 'c "-0.73 0.47 F 0.15 0.89 Ero 252 T c -0.09 0.73 F 0.15 0.94 Thr 253 T c 0.21 0.47 F 0.30 1.75 Gln 254 T c 1.10 -0.21. F 1.20 1.76 Val 255 A - c 1.91 -0.21 F 0.80 1.97 Pro 256. A c 1.31 -0.64 F 1.10 2.37 Glu 257 A A 1.52 -0.51 * F 0.90 1.35 Gln 258 A A 0.-98- -0.91 * F 0.90 3.15 Glu 259 A A 0.98 -0.91 * F 0.90 1.51 Met 260 A A 1.83 -0.94 * F 0.90 1.51 Glu 261 A A 1.83 -0.94 *. 0.75 1.51 Val 262 A A 1.24 -0.91 * F 0.90 1.35 Gln 263 A A 1.24 -0.41 * F 0.60 1.38 Glu 264 A A 1.03 -1.03 * F 0.90 1.38 Pro 265 A A 1.32 -0.50 * F 1.18 2.88 Wing 266 A A 0.98 -0.76 * F 1.46 2.40 Glu 267 A - T 0.98 -0.73 * F 2.14 1.37 Pro 268 A T 0.98 -0.09 F 1.97 0.66 Thr 269 T T 0.38 -0.11 F 2.80 1.05 Gly 270 A T -0.22 0.00 F 1.37 0.60 Val 271 A 0.07 0.69 0.44 0.32 Asn 272 B -0.14 0.64 0.16 0.30 Met 273. 3 - . -0.28 0.59. 0.18 0.46 Leu 274 c 0.03 0.59. 0.40 0.62 Ser 275 T c 0.08 -O.06 F 1.95 0.66 Pro 276 T c 0.93 -0.07 F 2.25 0.90 Gly 277 - T c 0.90 -0.69 F 3.00 1.89 Glu 278 A T 0.S9 -0.87 F 2.50 1.92 Ser 279 A A 0.69 -0.57 F 1.80 1.02 Glu 280 A A 0.99 -0.31 F 1.05 0.85 His 281 A A 0.99 -0.74 F 1.05 0.85 Leu 282 A A 0.74 -0.31 0.30 0.98 Leu 83 A A 0.74 -0.20 0.30 0.57 Glu 284 A A 0.46 -0.20 F 0.45 0.73 Pro 285 A A 0.46 -0.20 F 0.45 0.89 Wing 286 A A 0.60 -0.89 F 0.90 1.88 Glu 287 A A 1.11 -1.57 F 0.90 2.13 Wing 288 A A 1.92 -1.19 F 0.90 1.84 Glu 289 A A 2.03 -1.21 * F 0.90 3.16 Axg 290 A A 2.36 -1.71 * F 0.90 3.57 Ser 291 A T 3.06 -1.71 * F 1.30 6.92 Gln 292 A T 2.24 -2.21 * F 1.30 7.83 Arg 293 A T 2.02 -1.53 F 1.30 3.30 Arg 294 A T 1.17 -0.84 F 1.30 2.03 Arg 295 B T 0.84 -0.59 * F 1.15 0.87 Leu 296 B B 0.56 -0.56 * 0.60 0.69 Leu 297 3 B 0.56 -0.06 *. 0.30 0.35 Val 298. B. c 0.44 0.34 * * 0.20 0.29 Ero 299 - - '. T c -0.01 0.34 * 0.90 0.61 Wing 300 - - T c -0.12 0.09 * F 1.35 0.73 T 2 (Continued) Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV Asn '301"c" 0-48 -0.60"F 2.70 1.65 Glu 302 T c 0.98 -0.81 F 3.O0 1.65 Gly 303 c 1.83 -0.76 F 2.50 2.35 Asp 304 T c 1.73 -1.26 F 2.40 2.54 Pro 305 - T c 1.51 -1.17 * F 2.10 2.11 Thr 306 A T 1.62 -0.49 * F 1.30 1.75 Glu 307 A T 1.62. -0.91 * * F 1.30 2.07 Thr 308 A -B 1.-30 -0.51 * F 0 -.90 2 · .31 Leu 309 A B 0.60 -0.37 * * F 0.45. 0.86 Arg 310 A B 0.81 -0.07 * * 0.30 0.43 Glu 311 A B 1.12 -0.07 * * 0.30 0.50 Cys 312 A T 0.42 -0.56 * * 1.15 1.01 Phe 313 A T 0.14 -0.46 * * 0.70 0.45 Asp 314 T 0.96 '0.04 * * 0.50 0.26 Asp 315 A T 0.03 -0.36 * 0.70 0.81 Phe 316 A A. -0.82 -0.24 * 0.30 0.77 Wing 317 A A -0.37 -0.39 * 0.30 0.34 Asp 318 A A -0.37 0.04 * -0.30 0.32 Leu 319 A A -0.37 0.83 -0.60 0.32 Val 320 A c -0.67 0.04 -0.10 0.52 Pro 321 - A. c -0.2S -0.07 0.50 0.42 Phe 322 T 0.33 0.84 0.20 0.54 Asp 323 A T 0.12 0.16 '. 0.25 1.25 Ser 324 A T 0.12 -0.06 F 1.00 1.25 Trp 325 A T 0.38 0.20 * F 0.40 1.19 Glu 326 A A 0.70 0.03 + F -0.15 0.71 Pro 327 A A 1.44 0.03 * -0.15 1.03 Leu 328 A A 0.63 -0.36 * 0.45 1.96 Met 329 A A 0.59 -0.59 0.60 0.93 Arg 330 A A 0.07 -0.16 * 0.30 0.60 Lys 331 A A -0.53 0.10 * -0.30 0.60 Leu 332 A A -0.32 0.03 * -0.30 0.60 Gly 333 A A 0.49 -0.59 * 0.60 0.51 Leu 334 A A 1.09 -0.19 * 0.30 0.41 Met 335 A A 0.09 -0.19 * * 0.30 0.86 Asp 335 A A 0.09 -0.19 * F 0.45 0.61 sn 337 A A 0.04 -0.61 * * F 0.90 1.48 Glu 338 A A -0.20 -0.66 * * F 0.90 1.11 lie 339 A A 0.66 -0.77 * * F 0.75 0.67 Lys 340 A A 0.67 -0.77 * F 0.75 0.83 Val 341 A A 0.67 -0.67 * 0.60 0.49 Wing 342 A A 0.08 -0.67 0.75 1.20 Lys 343 A A -0.51 -0.86 * 0.60 0.61 Wing 344 A A 0.03 -0.35 * 0.30 0.83 Glu 345 A A -0.04 -0.57 0.60 0.81 Wing 346 A A 0.92 -0.57 0.60 0.55 Wing 3 7 A A 1.51 -0.57 * 0.75 1.07 Gly 348 A - 1.16 -1.07 * 0.95 1.03 His 349 A - T 0.93 -0.59 1.15 1.47 Arg 350 A T 0.69 -0.40 F 1.00 1.20 TABLE 2 (Continued) Res Position I II III IV V VI VII VIII IX "X XI XII XIII" XIV Asp 351 A T 0.97 -0.14"F 1.00 1.90 Thr 352 A T 0.96 -0.09 F 1.00 2.02 Leu 353 A B 0.49 0.03 -0.15 1.02 Tyr 354 A B -0.37 0.71 * -0.60 0.50 Thr 355 A B -0.43 1.40 * -0.60 0.24 et 356 A B -0.72 0.91 * -0.60 0.59 Leu 357 A B -1.27 1.14 * -0.60 0.40 I have 58 A B -0.46 1".03 '" -0.60? ". 20 Lys 359 A B -0.17 0.94 * * -0.60 0.33 Trp 360 A B -0.17 0.33 * 0.00 0.81 Val 361 A B 0.09 0.13 * *. 0.45 1.66 Asn 362 T c 1.01 -0.13 * F 1.95 0.82 Lys 363 T c 1.90 -0.13 * * F 2.40 1.53 Thr 364 T c 1.27 -1.04 * F 3.00 3.44 Gly 365 T c 1.26 -1.19 * F 2.70 2.16 Arg 366 A. 1.26 -1.20 * F 2.20 1.45 Asp 367 A c 1.22 -0.56 * F 1.55 0.75 Wing 368 A A 0.87 -0.54 F 1.20 1.03 Ser 369 A A 0.37 -0.49 0.30 0.76 Val 370 A A -0.10 0.20 * -0.30 0.37 His 371 A A -0.21 0.89 * -0.60 0.30 Thr 372 A A -0.80 0.39 | * * -0.30 0.38 Leu 373 A A -1.02 0.50 * * -0.60 0.52 Leu 374 A A -0.72 0.54 * -0.50 0.31 Asp 375 A A -0.18 0.04 * -0.30 0.38 Wing 376 A A -0.96 0.04 * -0.30 0.66 Leu 377 A A -0.99 0.04 -0.30 0.66 Glu 378 A A -0.18 -0.21 * 0.30 0.39 Thr 379 A A 0.74 -0.21 F 0.45 0.67 Leu 380 A A -0.07 -0.71 + F 0.90 1.59 Gly 381 A A -0.07 -0.71 F 0.75 0.76 Glu 382 A A 0.79 -0.21 * F 0.45 0.53 Arg 383 A A 0.79 -0.70 * F 0.90 1.28 Leu 384 A A 1.14 -0.99 * F 0.90 2.24 Wing 385 A A 1.07 -1.41 F 0.90 2.59 Lys 385 A A 1.41 -0.73 * F 0.75 0.93 Gln 387 A A 1.41 -0.73 * * F 0.90 1.95 Lys 388 A A 1.27 -1.41 * * F 0.90 3.22 ie 389 A A 1.27 -1.41 * F 0.90 2.19 Glu 390 A A 1.04 -0.73 + * F 0.90 1.04 ASp 391 A A 0.70 -0.44 * F 0.45 0.43 His 392 A A 0.40 -0.06 * *. 0.30 0.82 Leu 393 A A 0.01 -0.36 * *. 0.30 0.64 Leu 394 A A 0.94 0.07 * * F -0.15 0.38 Ser 395 A. 1 0.24 0.07 * * | F 0.25 C.55 Ser 396 A T -0.35 0.35 * * F 0.25 0.58 Gly 397 T -0.57 0.29 F 0.65 0.70 Lys 398 A - 1 -0.57 0.36 F 0.25 0.82 Phe 399 A A. 0.24 0.66 - -. -0.60 0.50 Met 400 A B 0.20 0.27 * -0.30 0.B8 TABLE 2 (Continued) Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV Tyr 401 A B 0.50 0.27. * -0.30 0.44 Leu 402 A A 0.26 0.67. * -0.60 0.81 Glu 403 A A 0.21 0.39. *. -0.30 0.82 Gly 404 to 0.61 -0.23. | F 0.65 0.88 Asn 405 A T 0.62 -0.60. * 3? 1.30 | 1.43 Wing 406 A T 0.27 -0.79. * P 1.15 0.83 Asp 407 A T 0.78 -0.17. F 0.85 0.83 Ser 408 A T 0:39"-0.21. * F 0.85 0.69 Wing 409 A. 0.34 -0.19. +. 0.50 0.88 Met 410 A -0.04 -0.25. 0.50 0.67 Ser 411 A 0.16 0.17. -0.10 0.64 In another aspect, the invention provides an antibody that binds to a peptide or polypeptide comprising, or alternatively consisting of, one, two, three, four, five, or more portions of an epitope-bearing TR7. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein. An "immunogenic epitope" is defined as part of a protein that elicits an antibody response when the entire protein is the immunogen. On the other hand, an "antigenic epitope" is defined as a region of a protein molecule to which an antibody can bind. The number of immunogenic epitopes of a protein is generally less than the number of antigenic epitopes. See for example Geysen et al., Proc. Nati Acad. Sci. USA 8: 3998-4002 (1983). As for the selection of antigenic epitope-bearing peptides or polypeptides (i.e., containing a region of a protein molecule to which an antibody can be attached), it is well known in the art that relatively short synthetic peptides that mimic Part of a protein sequence are routinely capable of producing an antiserum that reacts with the partially imitated protein. See for example, Sutcliffe et al., "Antibodies that react with predetermined sites on proteins". Science 219: 660-666 (1983). Peptides capable of producing protein reactive serum are frequently represented in the primary sequence of a protein; they can be characterized by a series of simple chemical rules, and are not confined to immunodominant regions of intact proteins (ie, immunogenic epitopes) or to the amino or carboxyl termini. Peptides and polypeptides bearing antigenic epitope, therefore, are useful for developing antibodies, including monoclonal antibodies, which bind with a TR7 polypeptide. See, for example, Wilson et al., Cell 37: 767-778 (1984) p. 777. Peptides and polypeptides carrying antigenic epitope preferably contain a sequence of at least seven, preferably at least nine, and preferably between at least fifteen and thirty amino acids, approximately, contained within the amino acid sequence of SEQ. ID NO: 3 The antibodies of the invention can be linked to one or more antigenic TR7 polypeptides or peptides, including without limitation: a polypeptide comprising, or alternatively consisting of, the amino acid residues 62 to 110, approximately, of SEQ ID NO: 3; 119 to 164, approximately, of SEQ ID NO: 3; 224 to 271, approximately, of SEQ ID N0: 3; 275 to 370, approximately, of SEQ ID NO: 3; 69 to 80, approximately, of SEQ ID NO: 3; 88 to 95, approximately, of SEQ ID NO: 3; 99 to 103, approximately, of SEQ ID NO: 3; 1 19 to 123, approximately, of SEQ ID NO: 3; 130 to 135, approximately, of SEQ ID NO: 3; 152 to 163, approximately, of SEQ ID NO: 3; 226 to 238, approximately, of SEQ ID NO: 3; 275 to 279, approximately, of SEQ ID NO: 3; 301 to 305, approximately, of SEQ ID NO: 3; or 362 to 367, approximately, of SEQ ID NO: 3. In this context, "approximately" includes scales particularly cited, greater or lesser by several nucleotides (5, 4, 3, 2, or 1), at either end or both. As indicated above, the inventors have determined that the above polypeptide fragments are antigenic regions of the TR7 receptor protein. TR7 epitope-bearing peptides and polypeptides can be produced by any conventional means: R. A. Houghten, "General Method for the Rapid Solid-Phase Synthesis of Large Numbers of Peptides: Specificity of Antigen-Antibody Interaction at the Level of Individual Amino Acids, "Proc. Nati, Acad. Sci. USA 82: 5131-5135 (1985). This process of" simultaneous multiple peptide synthesis (SMPS) "is further described in U.S. Patent No. 4,631, 211, to Houghten et al. others (1986) As will be appreciated by the person skilled in the art, the TR7 receptor polypeptides and the epitope-bearing fragments thereof described herein (for example corresponding to a portion of the extracellular domain, such as for example amino acid residues 52 to 184 of SEQ ID NO: 3), can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.These fusion proteins facilitate purification and show an increase in half-life in vivo. has shown for example for chimeric proteins consisting of the first two domains of the human CD4 polypeptide and several domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al., Nature 331: 84-86 (1988)). Fusion proteins that have a disulfide linked dimeric structure due to the IgG part may also be more efficient for binding and neutralizing other molecules than the TR7 protein or protein fragment alone (Fountoulakis et al., J Biochem 270 : 3958-3964 (1995)). The TR7 fusion proteins can be used as an immunogen to produce anti-TR7 antibodies. In this manner, the antibodies of the invention can be linked to the TR7 portion of the fusion proteins comprising a part or all of a TR7 polypeptide. Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins" including substitutions, deletions or additions of single or multiple amino acids, or fusion proteins. Such modified polypeptides may show, for example, greater activity or greater stability. In addition, they can be purified in high yields and show greater solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions. The antibodies of the present invention can also be linked to said TR7 polypeptides or modified TR7 polypeptide fragments or their variants. For example, for many proteins, including the extracellular domain of a membrane-associated protein, or the mature form or forms of a secreted protein, it is known that one or more amino acids can be deleted from the N-terminus or the C-terminus without substantial loss of protein. biological function or loss of binding capacity with a specific antibody. However, even if the deletion of one or more amino acids from the N-terminus or the C-terminus of a protein results in the modification or loss of one or more biological functions of the protein, other functional activities of TR7 can still be retained. For example, in many cases, the ability of the shortened protein to induce or bind antibodies that recognize TR7 (preferably antibodies that specifically bind TR7) will be retained regardless of the size or location of the deletion. In fact, polypeptides composed of six amino acid residues of TR7 can often elicit an immune response. It can be easily determined whether a particular polypeptide lacking the N-terminal or C-terminal residues of an entire protein retains said immunological activities, by the routine methods described herein or known in the art. As mentioned above, even if the deletion of one or more amino acids from! N-terminus of a protein results in the modification or loss of one or more biological functions of the protein, other functional activities may still be retained (eg, biological activities, the ability to multimerize, the ability to bind to the TR7 ligand). For example, the ability of shortened TR7 polypeptides to induce or bind antibodies that recognize the full or mature forms of the polypeptides will generally be retained when almost the majority of the complete or mature polypeptide residues are removed from the N-terminus. It can be easily determined whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains said immunological activities, by means of the routine methods described herein or that are known in the art. It is likely that a TR7 polypeptide with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activity. Accordingly, the present invention further provides antibodies that bind to polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence TR7 shown in SEQ ID NO: 3, to the alanine residue at position number 406 , and the polynucleotides encoding said polypeptides. In particular, the present invention provides antibodies that bind to polypeptides comprising the amino acid sequence of residues n5-411 of SEQ ID NO: 3, wherein n5 is an integer from 2 to 406, corresponding to the residue position of amino acid in SEQ ID NO: 3.

More particularly, the invention provides antibodies that bind to polypeptides comprising, or alternatively consisting of, the amino acid sequence of the residues: E-2 to S-411; Q-3 to S-411; R-4 to S-411; G-5 to S-411; Q-6 to S-411; N-7 to S-411; A-8 to S-411; P-9 to S-411; A-10 to S-411; A-1 to S-411; S-12 to S-411; G-13 to S-411; A-14 to S-411; R-15 to S-411; K-16 to S-411; R-17 to S-411; H-18 to S-411; G-19 to S-411; P-20 to S-411; G-21 to S-411; P-22 to S-41; R-23 to S-411; E-24 to S-411; A-25 to S-411; R-26 to S-411; G-27 to S-411; A-28 to S-411; R-29 to S-411; P-30 to S-411; G-31 to S-411; P-32 to S-411; R-33 to S-411; V-34 to S-411; P-35 to S-411; K-36 to S-411; T-37 to S-411; L-38 to S-411; V-39 to S-411; L-40 to S-411; V-41 to S-411; V-42 to S-411; A-43 to S-411; A-44 to S-411; V-45 to S-411; L-46 to S-411; L-47 to S-411; L-48 to S-411; V-49 to S-411; S-50 to S-411; A-51 to S-411; E-52 to S-411; S-53 to S-4 1; A-54 to S-411; L-55 to S-411; I-56 to S-4 1; T-57 to S-411; Q-58 to S-4; Q-59 to S-411; D-60 to S-41; L-61 to S-411; A-62 to S-411; P-63 to S-411; Q-64 to S-411; Q-65 to S-411; R-66 to S-411; A-67 to S-411; A-68 to S-411; P-69 to S-411; Q-70 to S-411; Q-71 to S-411; K-72 to S-411; R-73 to S-411; S-74 to S-411; S-75 to S-411; P-76 to S-4 1; S-77 to S-411; E-78 to S-4 1; G-79 to S-411; L-80 to S-411; C-8 to S-411; P-82 to S-411; P-83 to S-411; G-84 to S-411; H-85 to S-411; H-86 to S-411; I-87 to S-411; S-88 to S-411; E-89 to S-411; D-90 to S-411; G-91 to S-411; R-92 to S-411; D-93 to S-411; C-94 to S-411; I-95 to S-411; S-96 to S-411; C-97 to S-411; K-98 to S-411; Y-99 to S-411; G-100 to S-411; Q-101 to S-411; D-102 to S-411; Y-103 to S-411; S-104 to S-411; T-105 to S-411; H-106 to S-411; W-107 to S-411; N-108 to S-411; D-109 to S-411; L-110 to S-411; L-111 to S-411; F-112 to S-411; C-113 to S-411; L-114a S-411; R-1 5 to S-411; C-116 to S-411; T-117 to S-411; R-118 to S-411; C- 19 to S-411; D-120 to S-411; S-121 to S-411; G-122 to S-411; E-123 to S-411; V-124 to S-411; E-125 to S-4 1; L-126 to S-411; S-127 to S-411; P-128 to S-411; C-129 to S-411; T-130 to S-411; T-131 to S-411; T-132 to S-411; R-133 to S-411; N-134 to S-411; T-135 to S-411; V-136 to S-411; C-137 to S-411; Q-138 to S-411; C-139 to S-411; E-140 to S-411; E-141 to S-411; G-142 to S-411; T-143 to S-411; F-144 to S-411; R-145 to S-411; E-146 to S-411; E-147 to S-411; D-148 to S-411; S-149 to S-411; P-150 to S-411; E-151 to S-411; -152 to S-411; C-153 to S-411; R-154 to S-411; K-155 to S-411; C-156 to S-411; R-157 to S-411; T-158 to S-411; G-159 to S-411; C-160 to S-41; P-161 to S-411; R-162 to S-411; G-163 to S-411; M-164 to S-411; V-165 to S-411; K-166 to S-411; V-167 to S-411; G-168 to S-411; D-169 to S-411; C-170 to S-411; T-171 to S-411; P-172 to S-411; W-173 to S-411; S-174 to S-411; D-175 to S-411; 1-176 to S-411; E-177 to S-411; C-178 to S-411; V-179 to S-411; H-180 to S-411; K-181 to S-411; E-182 to S-411; S-183 to S-411; G-184 to S-411; 1-185 to S-411; 1-186 to S-411; 1-187 to S-411; G-188 to S-411; V-189 to S-411; T-190 to S-411; V-191 to S-411; A-192 to S-411; A-193 to S-411; V-194 to S-411; V-195 to S-411; L- 96 to S-411; 1-197 to S-411; V-198 to S-411; A-199 to S-411; V-200 to S-411; F-201 to S-411; V-202 to S-411; C-203 to S-4 1; K-204 to S-411; S-205 to S-411; L-206 to S-411; L-207 to S-411; W-208 to S-411; K-209 to S-4 1; K-210 to S-4; V-211 to S-411; L-212 to S-4 1; P-2 3 to S-4 1; Y-214 to S-411; L-215 to S-411; K-216 to S-411; G-217 to S-41; 1-218 to S-411; C-219 to S-411; S-220 to S-411; G-221 to S-411; G-222 to S-41; G-223 to S-411; G-224 to S-411; D-225 to S-411; P-226 to S-411; E-227 to S-411; R-228 to S-411; V-229 to S-4 1; D-230 to S-41; R-231 to S-4 1; S-232 to S-41; S-233 to S-411; Q-234 to S-411; R-235 to S-411; P-236 to S-411; G-237 to S-411; A-238 to S-411; E-239 to S-411; D-240 to S-411; N-241 to S-411; V-242 to S-411; L-243 to S-411; N-244 to S-4 1; E-245 to S-4 1; I-246 to S-411; V-247 to S-41; S-248 to S-4 1; I-249 to S-411; L-250 to S-411; Q-251 to S-411; P-252 to S-411; T-253 to S-4 1; Q-254 to S-411; V-255 to S-411; P-256 to S-411; E-257 to S-411; Q- 258 to S-411; E-259 to S-411; M-260 to S-411; E-261 to S-41 V-262 to S-411; Q-263 to S-411; E-264 to S-41; P-265 to S-411; A-266 to S-411 E-267aS-411; P-268 to S-411; T-269 to S-411; G-270 to S-411; V-271 to S-411 N-272 to S-4 1; M-273 to S-411; L-274 to S-411; S-275 to S-411; P-276 to S-411 G-277aS-411; E-278 to S-411; S-279 to S-41; E-280 to S-411; H-281 to S-411 L-282 to S-4 1; L-283 to S-41; E-284 to S-411; P-285 to S-41; A-286 to S-411 E-287 to S-4 1; A-288 to S-411; E-289 to S-411; R-290 to S-411; S-291 to S-411 Q-292 to S-411; R-293 to S-411; R-294 to S-41; R-295 to S-411; L-296 to S-411 L-297a S-411; V-298 to S-411; P-299 to S-411; A-300 to S-411; N-301 to S-411 E-302 to S-411; G-303 to S-411; D-304 to S-411; P-305 to S-411; T-306 to S-411 E-307aS-411; T-308 to S-411; L-309 to S-411; R-310 to S-411; Q-31 to S-4 1 C-312 to S-411; F-313 to S-411; D-314 to S-411; D-315 to S-411; F-316 to S-411 A-317aS-411; D-318 to S-411; L-319 to S-411; V-320 to S-411; P-321 to S-411 F-322 to S-411; D-323 to S-4; S-324 to S-41; W-325 to S-411; E-326 to S-411; P-327 to S-411; L-328 to S-4 1; -329 to S-411; R-330 to S-411; K-331 to S-411; L-332 to S-411; G-333 to S-411; L-334 to S-411; M-335 to S-411; D-336 to S-41; N-337 to S-411; E-338 to S-411; I-339 to S-41 1; K-340 to S-41; V-341 to S-41 1; A-342 to S-411; K-343 to S-41 1; A-344 to S-41 1; E-345 to S-41 1; A-346 to S-41 1; A-347 to S-41 1; G-348 to S-41 1; H-349 to S-411; R-350 to S-411; D-351 to S-41 1; T-352 to S-411; L-353 to S-411; Y-354 to S-411; T-355 to S-41 1; M-356 to S-41 1; L-357 to S-41 1; I-358 to S-411; K-359 to S-411; W-360 to S-411; V-361 to S-41 1; N-362 to S-41 1; K-363 to S-411; T-364 to S-411; G-365 to S-41 1; R-366 to S-41 1; D-367 to S-41 1; A-368 to S-411; S-369 to S-411; V-370 to S-41 1; H-371 to S-411; T-372 to S-411; L-373 to S-411; L-374 to S-411; D-375 to S-41 1; A-376 to S-41 1; L-377 to S-41 1; E-378 to S-411; T-379 to S-411; L-380 to S-411; G-381 to S-411; E-382 to S-41; R-383 to S-41; L-384 to S-4 1; A-385 to S-411; K-386 to S-41 1; Q-387 to S-41 1; K-388 to S-41 1; I-389 to S-411; E-390 to S-411; D-391 to S-41 1; H-392 to S-41 1; L-393 to S-41 1; L-394 to S-411; S-395 to S-411; S-396 to S-411; G-397 to S-41 1; K-398 to S-41 1; F-399 to S-411; M-400 to S-41 1; Y-401 to S-41 1; L-402 to S-411; E-403 to S-411; G-404 to S-41 1; N-405 to S-41 1; or A-406 to S-41 1 of the sequence of TR7 shown in SEQ ID NO: 3. In another embodiment, N-terminal deletions of TR7 polypeptide can be described with general formula n6 to 184, where n6 is a number from 1 to 179 corresponding to the amino acid sequence identified in SEQ ID NO: 3. In specific embodiments, the antibodies of the invention bind to N-terminal deletions of TR7 comprising, or alternatively consisting of, the amino acid sequence of the residues: E-2 to G-184; Q-3 to G-184; R-4 to G-184; G-5 to G-184; Q-6 to G-184; N-7 to G-184; A-8 to G-184; P-9 to G-184; A-10 to G-184; A-1 1 to G-184; S-12 to G-184; G-13 to G-184; A-14 to G-184; R-15 to G-184; K-16 to G-184; R-17 to G-184; H-18 to G-184; G-19 to G-184; P-20 to G-184; G-21 to G-184; P-22 to G-184; R-23 to G-184; E-24 to G-184; A-25 to G-184; R-26 to G-184; G27 to G84; A-28 to G-184; R-29 to G-184; P-30 to G-184; G-31 to G-184; P-32 to G-184; R-33 to G-184; V-34 to G-184; P-35 to G-184; -36 to G-184; T-37 to G-184; L-38 to G-184; V-39 to G-184; L-40 to G-184; V-41 to G-184; V-42 to G-184; A-43 to G-184; A-44 to G-184; V-45 to G-184; L-46 to G-184; L-47 to G-184; L-48 to G-184; V-49 to G-184; S-50 to G-184; A-51 to G-184; E-52 to G-184; S-53 to G-184; A-54 to G-184; L-55 to G-184; I-56 to G-184; T-57 to G-184; Q-58 to G-184; Q-59 to G- 84; D-60 to G-184; L-61 to G-84; A-62 to G-184; P-63 to G-184; Q-64 to G-184; Q-65 to G-184; R-66 to G-184; A-67 to G-184; A-68 to G-184; P-69 to G-184; Q-70 to G-184; Q-71 to G-184; K-72 to G-184; R-73 to G-184; S-74 to G-184; S-75 to G-184; P-76 to G-184; S-77 to G-184; E-78 to G-184; G-79 to G-184; L-80 to G-184; C-81 to G-184; P-82 to G-84; P-83 to G-184; G-84 to G-184; H-85 to G-184; H-86 to G-184; I-87 to G-184; S-88 to G-184; E-89 to G-184; D-90 to G-184; G-91 to G-184; R-92 to G-184; D-93 to G-184; C-94 to G-184; I-95 to G-184; S-96 to G-184; C-97 to G-184; K-98 to G-184; Y-99 to G-184; G-100 to G-184; Q-101 to G-84; D-102 to G-184; Y-103 to G-184; S-104 to G-184; T-05 to G-184; H-106 to G-184; W- 07 to G-184; N-108 to G-184; D-109 to G-184; L-110 to G-184; L-111 to G-184; F-112 to G-184; C-1 13 to G-184; L-1 14 to G-184; R-115 to G-184; C-116 to G-184; T-117 to G-184; R-1 8 to G-184; C-1 19 to G-184; D-120 to G-184; S-121 to G-184; G-122 to G-184; E-123 to G-184; V-124 to G-184; E-125 to G-184; L-126 to G-184; S-127 to G-84; P-128 to G-184; C-129 to G-184; T-130 to G-184; T-131 to G-184; T-132 to G-184; R-133 to G-184; N-134 to G-184; T-135 to G-184; V-136 to G-184; C-137 to G-184; Q-138 to G-184; C-139 to G-184; E-140 to G-184; E-141 to G-184; G-142 to G-184; T-143 to G-184; F-144 to G-84; R-145 to G-184; E-146 to G-184; E-147 to G-184; D-148 to G-184; S-149 to G-184; P-150 to G-184; E-151 to G-184; M- 52 to G-184; C-153 to G-184; R-154 to G-184; K-155 to G-184; C-156 to G-184; R-157 to G-184; T-158 to G-184; G-159 to G-184; C-160 to G-184; P-161 to G-184; R-162 to G-184; G-163 to G-184; M-164 to G-184; V-165 to G-184; K-166 to G-184; V-167 to G-184; G-168 to G-184; D-169 to G-184; C-170 to G-184; T-171 to G-184; P-172 to G-184; W-173 to G-184; S- 74 to G-184; D-175 to G-184; 1-176 to G- 84; E-177 to G-184; C-178 to G-184; or V-179 to G-184; of the extracellular domain sequence of TR7 shown in SEQ ID NO: 3. Also as mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in the modification or loss of one or more biological functions of the protein, other functional activities (eg, biological activities) can still be retained. , the ability to multimerize, the ability to bind TR7 ligand (eg TRAIL)). For example, the ability of shortened TR7 polypeptides to induce or bind antibodies that recognize the full or mature forms of the polypeptide will generally be retained when almost all of the residues of the complete or mature polypeptide are removed from the C-terminus. It can be easily determined whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains said immunological activities, by means of the routine methods described herein or that are known in the art. It is likely that a TR7 polypeptide with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activity. In fact, peptides composed with as few as six amino acid residues of TR7 can often evoke an immune response. Accordingly, the present invention further provides antibodies that bind to polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence TR7 shown in SEQ ID NO: 3, to the glutamic acid residue in the number position 52. In particular, the present invention provides antibodies that bind to polypeptides comprising the amino acid sequence of residues 52-m5 of SEQ ID NO: 3, wherein m5 is an integer from 57 to 410, corresponding to the position of the amino acid residue in SEQ ID NO: 3. More particularly, the invention provides antibodies that bind to polypeptides comprising, or alternatively consisting of, the amino acid sequence of the residues: E-52 to M-410; E-52 to A-409; E-52 to S-408; E-52 to D-407; E-52 to A-406; E-52 to N-405; E-52 to G-404; E-52 to E-403; E-52 to L-402; E-52 to Y-401; E-52 to M-400; E-52 to F-399; E-52 to K-398; E-52 to G-397; E-52 to S-396; E-52 to S-395; E-52 to L-394; E-52 to L-393; E-52 to H-392; E-52 to D-391; E-52 to E-390; E-52 to I-389; E-52 to K-388; E-52 to Q-387; E-52 to K-386; E-52 to A-385; E-52 to L-384; E-52 to R-383; E-52 to E-382; E-52 to G-381; E-52 to L-380; E-52 to T-379; E-52 to E-378; E-52 to L-377; E-52 to A-376; E-52 to D-375; E-52 to L-374; E-52 to L-373; E-52 to T-372; E-52 to H-371; E-52 to V-370; E-52 to S-369; E-52 to A-368; E-52 to D-367; E-52 to R-366; E-52 to G-365; E-52 to T-364; E-52 to K-363; E-52 to N-362; E-52 to V-361; E-52 to W-360; E-52 to K-359; E-52 to I-358; E-52 to L-357; E-52 to M-356; E-52 to T-355; E-52 to Y-354; E-52 to L-353; E-52 to T-352; E-52 to D-351; E-52 to R-350; E-52 to H-349; E-52 to G-348; E-52 to A-347; E-52 to A-346; E-52 to E-345; E-52 to A-344; E-52 to K-343; E-52 to A-342; E-52 to V-341; E-52 to K-340; E-52 to I-339; E-52 to E-338; E-52 to N-337; E-52 to D-336; E-52 to M-335; E-52 to L-334; E-52 to G-333; E-52 to L-332; E-52 to K-331; E-52 to R-330; E-52 to M-329; E-52 to L-328; E-52 to P-327; E-52 to E-326; E-52 to W-325; E-52 to S-324; E-52 to D-323; E-52 to F-322; E-52 to P-321; E-52 to V-320; E-52 to L-319; E-52 to D-318; E-52 to A-3 7; E-52 to F-316; E-52 to D-315; E-52 to D-314; E-52 to F-313; E-52 to C-312; E-52 to Q-3 1; E-52 to R-310; E-52 to L-309; E-52 to T-308; E-52 to E-307; E-52 to T-306; E-52 to P-305; E-52 to D-304; E-52 to G-303; E-52 to E-302; E-52 to N-301; E-52 to A-300; E-52 to P-299; E-52 to V-298; E-52 to L-297; E-52 to L-296; E-52 to R-295; E-52 to R-294; E-52 to R-293; E-52 to Q-292; E-52 to S-291; E-52 to R-290; E-52 to E-289; E-52 to A-288; E-52 to E-287; E-52 to A-286; E-52 to P-285; E-52 to E-284; E-52 to L-283; E-52 to L-282; E-52 to H-281; E-52 to E-280; E-52 to S-279; E-52 to E-278; E-52 to G-277; E-52 to P-276; E-52 to S-275; E-52 to L-274; E-52 to M-273; E-52 to N-272; E-52 to V-27; E-52 to G-270; E-52 to T-269; E-52 to P-268; E-52 to E-267; E-52 to A-266; E-52 to P-265; E-52 to E-264; E-52 to Q-263; E-52 to V-262; E-52 to E-261; E-52 to M-260; E-52 to E-259; E-52 to Q-258; E-52 to E-257; E-52 to P-256; E-52 to V-255; E-52 to Q-254; E-52 to T-253; E-52 to P-252; E-52 to Q-251; E-52 to L-250; E-52 to I-249; E-52 to S-248; E-52 to V-247; E-52 to I-246; E-52 to E-245; E-52 to N-244; E-52 to L-243; E-52 to V-242; E-52 to N-241; E-52 to D-240; E-52 to E-239; E-52 to A-238; E-52 to G-237; E-52 to P-236; E-52 to R-235; E-52 to Q-234; E-52 to S-233; E-52 to S-232; E-52 to R-231; E-52 to D-230; E-52 to V-229; E-52 to R-228; E-52 to E-227; E-52 to P-226; E-52 to D-225; E-52 to G-224; E-52 to G-223; E-52 to G-222; E-52 to G-227; E-52 to S-220; E-52 to C-219; E-52 to 1-218; E-52 to G-217; E-52 to K-216; E-52 to L-215; E-52 to Y-214; E-52 to P-213; E-52 to L-212; E-52 to V-211; E-52 to K-210; E-52 to K-209; E-52 to WY-208; E-52 to L-207; E-52 to L-206; E-52 to S-205; E-52 to K-204; E-52 to C-203; E-52 to V-202; E-52 to F-201; E-52 to V-200; E-52 to A-199; E-52 to V-198; E-52 to 1-197; E-52 to L-196; E-52 to V-195; E-52 to V-194; E-52 to A-193; E-52 to A-192; E-52 to V-191; E-52 to T-190; E-52 to V-189; E-52 to G- 88; E-52 to 1-187; E-52 to 1-186; E-52 to 1-185; E-52 to G-184; E-52 to S-183; E-52 to E-182; E-52 to K-181; E-52 to H-180; E-52 to V-179; E-52 to C-178; E-52 to E-177; E-52 to 1-76; E-52 to D- 75; E-52 to S-174; E-52 to W-173; E-52 to P-172; E-52 to T-171; E-52 to C-170; E-52 to D.-169; E-52 to G-168; E-52 to V-167; E-52 to K-166; E-52 to V-165; E-52 to M-164; E-52 to G-163; E-52 to R-162; E-52 to P-161; E-52 to C-160; E-52 to G-159; E-52 to T- 58; E-52 to R-157; E-52 to C-156; E-52 to K-155; E-52 to R-154; E-52 to C-153; E-52 to M-152; E-52 to E-151; E-52 to P-150; E-52 to S-149; E-52 to D-148; E-52 to E-147; E-52 to E-146; E-52 to R-145; E-52 to F-144; E-52 to T-143; E-52 to G-142; E-52 to E-14; E-52 to E-140; E-52 to C- 39; E-52 to Q-138; E-52 to C-137; E-52 to V- 136; E-52 to T-135; E-52 to N-134; E-52 to R-133; E-52 to T-132; E-52 to T-131; E-52 to T-130; E-52 to C- 29; E-52 to P- 28; E-52 to S-127; E-52 to L-126; E-52 to E-125; E-52 to V-124; E-52 to E-123; E-52 to G-122; E-52 to S-121; E-52 to D-120; E-52 to C-19; E-52 to R-1 18; E-52 to T-1 17; E-52 to C-1 16; E-52 to R-1 5; E-52 to L-1 14; E-52 to C-113; E-52 to F-112; E-52 to L-1; E-52 to L-110; E-52 to D-109; E-52 to N-08; E-52 to W- 07; E-52 to H-106; E-52 to T-105; E-52 to S-104; E-52 to Y-103; E-52 to D-102; E-52 to Q-101; E-52 to G-100; E-52 to Y-99; E-52 to K-98; E-52 to C-97; E-52 to S-96; E-52 to I-95; E-52 to C-94; E-52 to D-93; E-52 to R-92; E-52 to G-91; E-52 to D-90; E-52 to E-89; E-52 to S-88; E-52 to I-87; E-52 to H-86; E-52 to H-85; E-52 to G-84; E-52 to P-83; E-52 to P-82; E-52 to C-81; E-52 to L-80; E-52 to G-79; E-52 to E-78; E-52 to S-77; E-52 to P-76; E-52 to S-75; E-52 to S-74; E-52 to R-73; E-52 to K-72; E-52 to Q-71; E-52 to Q-70; E-52 to P-69; E-52 to A-68; E-52 to A-67; E-52 to R-66; E-52 to Q-65; E-52 to Q-64; E-52 to P-63; E-52 to A-62; E-52 to L-6; E-52 to D-60; E-52 to Q-59; E-52 to Q-58; or E-52 to T-57; of the sequence of TR7 shown in SEQ ID NO: 3. In another embodiment, the antibodies of the invention bind to C-terminal deletions of the TR7 polypeptide that can be described with the general formula 52-m6, wherein m6 is a number from 57 to 183 corresponding to the amino acid sequence identified in SEQ ID NO: 3 In specific embodiments, the antibodies of the invention bind to C-terminal deletions of the TR7 polypeptide comprising, or alternatively consisting of, the amino acid residues: E-52 to S-183; E-52 to E-82; E-52 to K-181; E-52 to H- 80; E-52 to V-179; E-52 to C-178; E-52 to E-177; E-52 to 1-176; E-52 to D-175; E-52 to S-174; E-52 to W-173; E-52 to P- 72; E-52 to T-171; E-52 to C-170; E-52 to D- 69; E-52 to G-168; E-52 to V-167; E-52 to K-166; E-52 to V-165; E-52 to M-164; E-52 to G-163; E-52 to R-162; E-52 to P-161; E-52 to C-160; E-52 to G-159; E-52 to T-158; E-52 to R- 57; E-52 to C-156; E-52 to K-155; E-52 to R-154; E-52 to C-153; E-52 to M-152; E-52 to E-151; E-52 to P-150; E-52 to S-149; E-52 to D-148; E-52 to E-147; E-52 to E-146; E-52 to R-145; E-52 to F- 44; E-52 to T-143; E-52 to G- 42; E-52 to E- 41; E-52 to E-140; E-52 to C-139; E-52 to Q- 38; E-52 to C-137; E-52 to V-136; E-52 to T-135; E-52 to N-134; E-52 to R-133; E-52 to T-132; E-52 to T-131; E-52 to T-130; E-52 to C-129; E-52 to P-128; E-52 to S-127; E-52 to L-126; E-52 to E-125; E-52 to V-124; E-52 to E-123; E-52 to G-122; E-52 to S-121; E-52 to D-120; E-52 to C-119; E-52 to R-118; E-52 to T-117; E-52 to C-116; E-52 to R-1 5; E-52 to L-1 14; E-52 to C-113; E-52 to F-112; E-52 to L-111; E-52 to L-10; E-52 to D-109; E-52 to N-108; E-52 to W-107; E-52 to H-106; E-52 to T-105; E-52 to S-104; E-52 to Y-03; E-52 to D-102; E-52 to Q-101; E-52 to G-100; E-52 to Y-99; E-52 to K-98; E-52 to C-97; E-52 to S-96; E-52 to I-95; E-52 to C-94; E-52 to D-93; E-52 to R-92; E-52 to G-91; E-52 to D-90; E-52 to E-89; E-52 to S-88; E-52 to I-87; E-52 to H-86; E-52 to H-85; E-52 to G-84; E-52 to P-83; E-52 to P-82; E-52 to C-81; E-52 to L-80; E-52 to G-79; E-52 to E-78; E-52 to S-77; E-52 to P-76; E-52 to S-75; E-52 to S-74; E-52 to R-73; E-52 to K-72; E-52 to Q-71; E-52 to Q-70; E-52 to P-69; E-52 to A-68; E-52 to A-67; E-52 to R-66; E-52 to Q-65; E-52 to Q-64; E-52 to P-63; E-52 to A-62; E-52 to L-61; E-52 to D-60; E-52 to Q-59; E-52 to Q-58; or E-52 to T-57; of the extracellular domain sequence of TR7 shown in SEQ ID NO: 3.

The invention also provides antibodies that bind to polypeptides having one or more amino acids deleted from both the amino terminus and the carboxyl terminus of a TR7 polypeptide, which can generally be described as having the residues n5-m5 or n6-m6 of SEQ ID NO. : 3, where n5, n6, m5 and m6 are integers as described above. Also included are antibodies that bind to a polypeptide consisting of a portion of the complete amino acid sequence of TR7 encoded by the cDNA clone contained in the ATCC deposit No. 97920, wherein this portion excludes from 1 to about 78 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in the ATCC deposit No. 97920, or from 1 to about 233 amino acids from the carboxy terminus, or any combination of the aforementioned amino and carboxy terminal deletions of the complete amino acid sequence encoded by the cDNA clone contained in reference No. ATCC 97920. Preferably, the antibodies of the present invention bind to the N- and C-terminal deletion mutants comprising only a portion of the extracellular domain; that is, within residues 52-184 of SEQ ID NO: 3, since any portion is expected to be soluble therein. It will be recognized that a certain amino acid sequence of TR7 can be varied without a significant effect of the structure or function of the protein. If such sequence differences are contemplated, it must be remembered that there will be critical areas on the protein that determine the activity. Such areas will usually comprise residues that form the ligand binding site or the death domain, or which form tertiary structures that affect these domains. Thus, the invention further includes antibodies that bind to variants of the TR7 protein that show substantial TR7 protein activity or that include TR7 regions such as the protein portions discussed below. These mutants include deletions, insertions, inversions, repetitions and substitutions of type. A guide can be found which deals with amino acid changes that are likely to be phenotypically silent in Bowie, J. U. et al., Science 247: 1306-1310 (1990). In this manner, the antibodies of the present invention can be linked to a fragment, derivative or analogue of the polypeptide of SEQ ID NO: 3, or of the one encoded by the cDNA with the deposit No. ATCC 97920. Said fragments, variants or derivatives they may be (i) one in which at least one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably one or more conserved amino acid residues, and preferably at least one but less of ten conserved amino acid residues), and said amino acid residue substituent may or may not be encoded by the genetic code, or (ii) one in which one or more of the amino acid residues include a substituent group, or (iii) one wherein the mature polypeptide is fused to another compound, for example a compound to increase the half-life of the polypeptide (e.g. polyethylene glycol), or (iv) one in which the additional amino acids are n fused to the mature polypeptide, such as a region peptide IgG fusion and Fe, or guide, or a secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and the like are considered within the scope of those skilled in the art from the teachings herein. Of particular interest are substitutions of charged amino acids with other charged amino acids and with neutral or negatively charged amino acids. This results in proteins with reduced positive charge to improve the characteristics of the TR7 protein. The prevention of aggregation is very desirable. The aggregation of proteins not only results in a loss of activity, but can also be problematic when preparing pharmaceutical formulations because they can be immunogenic (Pinckard et al., Clin Exp. Immunol., 2: 331-340 (1967).; Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Came r Systems 10: 307-377 (1993)). Amino acid replacement can also change the selectivity of binding to cell surface receptors. Ostade et al., Nature 361: 266-268 (1993), disclose some mutations that result in the selective binding of TNF-alpha alone with one of the two known types of TNF receptors. In this manner, the antibodies of the present invention can bind to a TR7 receptor containing one or more amino acid substitutions, deletions or additions, either natural or human manipulative mutations. As indicated, the changes are preferably minor in nature, such as conservative amino acid substitutions that do not significantly affect the fold or activity of the protein (see Table 3).

TABLE 3 Conservative amino acid substitutions In specific embodiments, the number of substitutions, additions or deletions in the amino acid sequence of SEQ ID NO: 3 or of any of the polypeptide fragments described herein (for example the extracellular domain), is 75, 70, 60, 50 , 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 0 30-20, 20-15, 20-10, 15-10, 10 -1, 5-10, 1-5, 1-3 or 1-2. In specific embodiments, the antibodies of the invention bind to TR7 polypeptides or fragments or variants thereof (especially a fragment comprising, or alternatively consisting of, the soluble extracellular domain of TR7), which contain one or more of the following conservative mutations in TR7: M1 replaced with A, G,], L, S, T or V; E2 replaced with D; Q3 replaced with N; R4 replaced with H or K; G5 replaced with A, I, L, S, T, M or V; Q6 replaced with N; N7 replaced with Q; A8 replaced with G, I, L, S, T, M or V; A10 replaced with G, I, L, S, T, M or V; A1 1 replaced with G, I, L, S, T, or V; S12 replaced with A, G, I, L, T, M or V; G13 replaced with A, I, L, S, T, M or V; A14 replaced with G, I, L, S, T, M or V; R15 replaced with H or K; K16 replaced with H or R; R17 replaced with H or K; H18 replaced with K or R; G19 replaced with A, I, L, S, T, M or V; G21 replaced with A, I, L, S, T, or V; R23 replaced with H or K; E24 replaced with D; A25 replaced with G, I, L, S, T, M or V; R26 replaced with H or K; G27 replaced with A, I, L, S, T, M or V; A28 replaced with G, I, L, S, T, M or V; R29 replaced with H or K; G31 replaced with A, I, L, S, T, or V; R33 replaced with H or K; V34 replaced with A, G, I, L, S, T o; K36 replaced with H or R; T37 replaced with A, G, I, L, S, M or V; L38 replaced with A, G, I, S, T, M or V; V39 replaced with A, G, I, L, S, T or M; L40 replaced with A, G, I, S, T, M or V; V41 replaced with A, G, I, L, S, T or M; V42 replaced with A, G, I, L, S, T or M; A43 replaced with G, I, L, S, T, M or V; A44 replaced with G, I, L, S, T, M or V; V45 replaced with A, G, I, L, S, T or M; L46 replaced with A, G, I, S, T, M or V; L7 replaced with A, G, I, S, T, M or V; L48 replaced with A, G, I, S, T, M or V; V49 replaced with A, G, I, L, S, T or M; S50 replaced with A, G, I, L, T, M or V; A51 replaced with G, l, L, S, T, M or V; E52 replaced with D; S53 replaced with A, G, I, L, T, M or V; A54 replaced with G, I, L, 3, T, M or V; L55 replaced with A, G, I, S, T, M or V; I56 replaced with A, G, L, S, T, M or V; T57 replaced with A, G, I, L, S, M or V; Q58 replaced with N; Q59 replaced with N; D60 replaced with E; L61 replaced with A, G, I, S, T, M or V; A62 replaced with G, I, L, S, T, M or V; Q64 replaced with N; Q65 replaced with N; R66 replaced with H or K; A67 replaced with G, I, L, S, T, M or V; A68 replaced with G, I, L, S, T, M or V; Q70 replaced with N; Q71 replaced with N; K72 replaced with H or R; R73 replaced with H or K; S74 replaced with A, G, I, L, T, M or V; S75 replaced with A, G, I, L, T, M or V; S77 replaced with A, G, I, L, T, M or V; E78 replaced with D; G79 replaced with A, I, L, S, T, M or V; L80 replaced with A, G, I, S, T, M or V; G84 replaced with A, I, L, S, T, M or V; H85 replaced with K or R; H86 replaced with K or R; I87 replaced with A, G, L, S, T, M or V; S88 replaced with A, G, I, L, T, M or V; E89 replaced with D; D90 replaced with E; G91 replaced with A, I, L, S, T, M or V; R92 replaced with H or K; D93 replaced with E; I95 replaced with A, G, L, S, T, M or V; S96 replaced with A, G, I, L, T, M or V; K98 replaced with H or R; Y99 replaced with F or W; G100 replaced with A, I, L, S, T, M or V; Q101 replaced with N; D102 replaced with E; Y103 replaced with F or W; S104 replaced with A, G, I, L, T, M or V; T105 replaced with A, G, I, L, S, M or V; H106 replaced with K or R; W107 replaced with F or Y; N108 replaced with Q; D109 replaced with E; L1 10 replaced with A, G, I, S, T, M or V; L1 1 1 replaced with A, G, I, S, T, M or V; F112 replaced with W or Y; L1 14 replaced with A, G, I, S, T, M or V; R1 15 replaced with H or K; T1 17 replaced with A, G, I, L, S, M or V; R1 18 replaced with H or K; D120 replaced with E; S121 replaced with A, G, I, L, T, M or V; G122 replaced with A, I, L, S, T, M or V; E123 replaced with D; V124 replaced with A, G, I, L, S, T or M; E125 replaced with D; L126 replaced with A, G, I, S, T, M or V; S127 replaced with A, G, I, L, T, M or V; T130 replaced with A, G, I, L, S, or V; T131 replaced with A, G, I, L, S, M or V; T132 replaced with A, G, I, L, S, M or V; R133 replaced with H or K; N134 replaced with Q; T135 replaced with A, G, I, L, S, M or V; V136 replaced with A, G, I, L, S, T or M; Q138 replaced with N; E140 replaced with D; E141 replaced with D; G142 replaced with A, I, L, S, T, M or V; T143 replaced with A, G, I, L, S, M or V; F144 replaced with W or Y; R145 replaced with H or K; E146 replaced with D; E147 replaced with D; D148 replaced with E; S149 replaced with A, G, I, L, T, M or V; E151 replaced with D; M152 replaced with A, G, I, L, S, T or V; R154 replaced with H or K; K155 replaced with H or R; R157 replaced with H or K; T158 replaced with A, G, I, L, S, M or V; G159 replaced with A, I, L, S, T, M or V; R162 replaced with H or K; G163 replaced with A, I, L, S, T, M or V; 164 replaced with A, G, I, L, S, T or V; V165 replaced with A, G, I, L, S, T or M; K166 replaced with H or R; V167 replaced with A, G, I, L, S, T or M; G168 replaced with A, I, L, S, T, M or V; D169 replaced with E; T171 replaced with A, G, I, L, S, M or V; W173 replaced with F or Y; S 74 replaced with A, G, I, L, T, M or V; D175 replaced with E; 1176 replaced with A, G, L, S, T, or V; E177 replaced with D; V179 replaced with A, G, I, L, S, T or M; H180 replaced with K or R; K181 replaced with H or R; E182 replaced with D; S183 replaced with A, G, I, L, T, M or V; G184 replaced with A, I, L, S, T, M or V; 1185 replaced with A, G, L, S, T, M or V; 1186 replaced with A, G, L, S, T, M or V; 1187 replaced with A, G, L, S, T, M or V; G188 replaced with A, I, L, S, T, M or V; V189 replaced with A, G, I, L, S, T or M; T190 replaced with A, G, I, L, S, M or V; V191 replaced with A, G, I, L, S, T or M; A192 replaced with G, I, L, S, T, M or V; A 93 replaced with G, I, L, S, T, M or V; V194 replaced with A, G, I, L, S, T or M; V195 replaced with A, G, I, L, S, T or M; L196 replaced with A, G, I, S, T, M or V; 1197 replaced with A, 3, L, S, T, M or V; V198 replaced with A, G, I, L, S, T or M; A199 replaced with G, I, L, S, T, M or V; V200 replaced with A, G, I, L, S, T or M; F201 replaced with W or Y; V202 replaced with A, G, I, L, S, T or M; K204 replaced with H or R; S205 replaced with A, G, I, L, T, M or V; L206 replaced with A, G, I, S, T, M or V; L207 replaced with A, G, I, S, T, M or V; W208 replaced with F or Y; K209 replaced with H or R; K210 replaced with H or R; V211 replaced with A, G, I, L, S, T or M; L212 replaced with A, G, I, S, T, M or V; Y214 replaced with F or W; L215 replaced with A, G, I, S, T, M or V; K216 replaced with H or R; G217 replaced with A, I, L, S, T, M or V; 1218 replaced with A, G. L, S, T, M or V; S220 replaced with A, G, I, L, T, M or V; G221 replaced with A, I, L, S, T, M or V; G222 replaced with A, I, L, S, T, M or V; G223 replaced with A, I, L, S, T, M or V; G224 replaced with A, I, L, S, T, M or V; D225 replaced with E; E227 replaced with D; R228 replaced with H or K; V229 replaced with A, G, I, L, S, T or M; D230 replaced with E; R231 replaced with H or K; S232 replaced with A, G, I, L, T, M or V; S233 replaced with A, Gl I, L, T, M or V; Q234 replaced with N; R235 replaced with H or K; G237 replaced with A, I, L, S, T, M or V; A238 replaced with G, I, L, S, T, M or V; E239 replaced with D; D240 replaced with E; N241 replaced with Q; V242 replaced with A, G, I, L, S, T or M; L243 replaced with A, G, I, S, T, M or V; N244 replaced with Q; E245 replaced with D; I246 replaced with A, G, L, S, T, or V; V247 replaced with A, G, I, L, S, T or M; S248 replaced with A, G, I, L, T, M or V; I249 replaced with A, G, L, S, T, M or V; L250 replaced with A, G, I, S, T, M or V; Q251 replaced with N; T253 replaced with A, G, I, L, S, or V; Q254 replaced with N; V255 replaced with A, G, I, L, S, T or M; E257 replaced with D; Q258 replaced with N; E259 replaced with D; M260 replaced with A, G, I, L, S, T or V; E261 replaced with D; V262 replaced with A, G, I, L, S, T or M; Q263 replaced with N; E264 replaced with D; A266 replaced with G, I, L, S, T, M or V; E267 replaced with D; T269 replaced with A, G, I,! _, S, s V; G270 replaced with A, I, L, S, T, M or V; V271 replaced with A, G, I, L, S, T or M; N272 replaced with Q; M273 replaced with A, G, I, L, S, T or V; L274 replaced with A, G, I, S, T, M or V; S275 replaced with A, G, I, L, T, M or V; G277 replaced with A, I, L, S, T, M or V; E278 replaced with D; S279 replaced with A, G, I, L, T, M or V; E280 replaced with D; H281 replaced with K or R; L282 replaced with A, G, I, S, T, M or V; L283 replaced with A, G, I, S, T, M or V; E284 replaced with D; A286 replaced with G, I, L, S, T, M or V; E287 replaced with D; A288 replaced with G, I, L, S, T, M or V; E289 replaced with D; R290 replaced with H or K; S291 replaced with A, G, I, L, T, M or V; Q292 replaced with N; R293 replaced with H or K; R294 replaced with H or K; R295 replaced with H or K; L296 replaced with A, G, I, S, T, M or V; L297 replaced with A, G, I, S, T, M or V; V298 replaced with A, G, I, L, S, T or M; A300 replaced with G, I, L, S, T, M or V; N301 replaced with Q; E302 replaced with D; G303 replaced with A, I, L, S, T, M or V; D304 replaced with E; T306 replaced with A, G, I, L, S, M or V; E307 replaced with D; T308 replaced with A, G, I, L, S, M or V; L309 replaced with A, G, I, S, T, M or V; R310 replaced with H or K; Q311 replaced with N; F313 replaced with W or Y; D314 replaced with E; D315 replaced with E; F316 replaced with W or Y; A317 replaced with G, I, L, S, T, or V; D318 replaced with E; L319 replaced with A, G, I, S, T, M or V; V320 replaced with A, G, I, L, S, T or M; F322 replaced with W or Y; D323 replaced with E; S324 replaced with A, G, I, L, T, M or V; W325 replaced with F or Y; E326 replaced with D; L328 replaced with A, G, I, 3, T, M or V; M329 replaced with A, G, i, L, S, T or V; R330 replaced with H or K; K331 replaced with H or R; L332 replaced with A, G, I, S, T, M or V; G333 replaced with A, I, L, S, T, M or V; L334 replaced with A, G, I, S, T, M or V; M335 replaced with A, G, I, L, S, T or V; D336 replaced with E; N337 replaced with Q; E338 replaced with D; I339 replaced with A, G, L, S, T, M or V; K340 replaced with H or R; V341 replaced with A, G, I, L, S, T or M; A342 replaced with G, I, L, S, T, M or V; K343 replaced with H or R; A344 replaced with G, I, L, S, T, M or V; E345 replaced with D; A346 replaced with G, I, L, S, T, M or V; A347 replaced with G, I, L, S, T, M or V; G348 replaced with A, I, L, S, T, M or V; H349 replaced with K or R; R350 replaced with H or K; D351 replaced with E; T352 replaced with A, G, I, L, S, M or V; L353 replaced with A, G, I, S, T, M or V; Y354 replaced with F or W; T355 replaced with A, G, I, L, S, M or V; 356 replaced with A, G, I, L, S, T or V; L357 replaced with A, G, I, S, T, M or V; I358 replaced with A, G, L, S, T, M or V; K359 replaced with H or R; W360 replaced with F or Y; V361 replaced with A, G, I, L, S, T or M; N362 replaced with Q; K363 replaced with H or R; T364 replaced with A, G, I, L, S, M or V; G365 replaced with A, I, L, S, T, M or V; R366 replaced with H or K; D367 replaced with E; A368 replaced with G, I, L, S, T, M or V; S369 replaced with A, G, I, L, T, M or V; V370 replaced with A, G, I, L, S, T or M; H371 replaced with K or R; T372 replaced with A, G, I, L, S, M or V; L373 replaced with A, G, I, S, T, M or V; L374 replaced with A, G, I, S, T, M or V; D375 replaced with E; A376 replaced with G, I, L, S, T, M or V; L377 replaced with A, G, I, S, T, M or V; E378 replaced with D; T379 replaced with A, G, I, L, S, M or V; L380 replaced with A, G, I, S, T, M or V; G381 replaced with A, I, L, S, T, M or V; E382 replaced with D; R383 replaced with H or K; L384 replaced with A, G, I, S, T, M or V; A385 replaced with G, I, L, S, T, M or V; K386 replaced with H or R; Q387 replaced with N; K388 replaced with H or R; I389 replaced with A, G, L, S, T, M or V; E390 replaced with D; D391 replaced with E; H392 replaced with K or R; L393 replaced with A, G, I, S, T, M or V; L394 replaced with A, G, I, S, T, M or V; S395 replaced with A, G, I, L, T, M or V; S396 replaced with A, G, I, L, T, M or V; G397 replaced with A, I, L, S, T, M or V; K398 replaced with H or R; F399 replaced with W or Y; M400 replaced with A, G, I, L, S, T or V; Y401 replaced with F or W; L402 replaced with A, G, I, S, T, M or V; E403 replaced with D; G404 replaced with A, I, L, S, T, M or V; N405 replaced with Q; A406 replaced with G, I, L, S, T, M or V; D407 replaced with E; S408 replaced with A, G, I, L, T, M or V; A409 replaced with G, I, L, S, T, or V; M410 replaced with A, G, I, L, S, T or V; or S41 1 replaced with A, G, I, L, T, M or V of SEQ ID NO: 3. In specific embodiments, antibodies of the invention bind to TR7 polypeptides or fragments or variants thereof (especially a fragment) comprising, or alternatively consisting of, the soluble extracellular domain of TR7), which contain one or more of the following non-conservative mutations in TR7: 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E2 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q3 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R4 replaced with D, E-, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G5 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q6 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; N7 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; A8 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P9 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A10 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; All replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S12 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G13 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A14 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R 5 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K16 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R17 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H18 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G19 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G21 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P22 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R23 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E24 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A25 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R26 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G27 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A28 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R29 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P30 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G31 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P32 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R33 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V34 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P35 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; K36 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T37 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L38 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V39 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L40 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V41 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V42 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A43 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A44 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V45 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L46 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L47 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L8 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V49 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S50 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A51 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E52 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; S53 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A54 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L55 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I56 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T57 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q58 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; Q59 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; D60 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L61 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A62 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P63 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; Q64 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; Q65 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R66 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A67 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A68 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P69 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; Q70 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; Q71 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; K72 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R73 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S74 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S75 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P76 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; S77 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E78 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G79 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L80 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C81 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; P82 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; P83 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G84 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H85 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H86 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I87 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S88 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E89 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D90 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G91 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R92 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D93 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; C94 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; I95 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S96 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C97 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; K98 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Y99 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; G100 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; Q101 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; D102 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Y103 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; S104 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T105 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H106 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; W107 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; N108 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; D109 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L110 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L111 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F1 12 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; C1 13 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; L1 14 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R1 15 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C116 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T1 17 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R118 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C1 19 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; D120 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S121 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G122 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E123 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V124 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E125 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L126 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S127 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P128 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; C129 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T130 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T131 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T132 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R133 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N134 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; T135 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V136 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C137 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; Q138 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; C139 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; E140 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E141 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G142 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T143 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F144 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; R145 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E146 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E147 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D148 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S149 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P150 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; E151 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; M152 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; C153 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; R154 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K155 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C156 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; R157 replaced with D, E, A, G, L, L, S, T, M, V, N, Q, F, W, Y, P or C; T158 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G159 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C160 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; P161 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R162 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G163 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M164 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V165 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K166 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V167 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G168 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D 69 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C170 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T171 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P172 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; W173 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; S 74 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D175 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; 1176 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E177 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C178 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y or P; V179 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H180 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K181 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E182 replaced with H, K, R, A, G, I, L, S, T,, V,, Q, F, W, Y, P or C; S183 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G184 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1185 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1186 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1187 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G188 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V189 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T190 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V191 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A192 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A193 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V194 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V195 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L 96 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1197 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V 98 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A199 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V200 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F201 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; V202 replaced with D, E, H,, R, N, Q, F, W,?,? ? C; C203 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; K204 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; S205 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L206 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L207 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; W208 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; K209 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K210 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; V21 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L212 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P213 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; Y214 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; L215 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K216 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G217 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1218 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C219 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; S220 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G221 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G222 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G223 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; G224 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D225 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P226 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; E227 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R228 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V229 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D230 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R231 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C, S232 replaced with D, E, H, K, R,?, Q, F , W, Y, P or C; S233 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q234 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R235 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P236 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G237 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; A238 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E239 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D240 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N241 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, F, W, Y, P or C; V242 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L243 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N244 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; E245 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I246 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V247 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S248 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I249 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L250 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q251 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; P252 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; T253 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q254 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, F, W, Y, P or C; V255 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P256 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; E257 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q258 replaced with D, E, H, K, R, A, G, i, L, S, T, M, V, F, W, Y, P or C; E259 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; M260 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E261 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V262 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q263 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; E264 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P265 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A266 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E267 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P268 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; T269 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G270 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V271 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N272 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; 273 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L274 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S275 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P276 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G277 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E278 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S279 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E280 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H281 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L282 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L283 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E284 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P285 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A286 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E287 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A288 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E289 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R290 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S291 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q292 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R293 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R294 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R295 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L296 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L297 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V298 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P299 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A300 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N301 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; E302 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; G303 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D304 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P305 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; T306 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E307 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T308 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L309 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R310 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q31 1 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W,?,? ? C; C312 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; F313 replaced with D, E, H, K, R, N, Q, A, G, 1, L, S, T, M, V, P or C; D314 replaced with H, K, R, A, G, I, L, S, T, M, V, N. Q, F, W, Y, P or C; D315 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; F316 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,, V, P or C; A317 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D3 8 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L319 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V320 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P321 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; F322 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; D323 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S324 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; W325 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; E326 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; P327 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y. or C; L328 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M329 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R330 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K331 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L332 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G333 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L334 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M335 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D336 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N337 replaced with D, E, H,, R, A, G, I, L, S, T,, V, F, W, Y, P or C; E338 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I339 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K340 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V341 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A342 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K343 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A344 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E345 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A346 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A347 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G348 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H349 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R350 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D351 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T352 replaced with D, E, H, K4 R, N, Q, F, W, Y, P or C; L353 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Y354 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; T355 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M356 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L357 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I358 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K359 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; W360 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, VI P or C; V361 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N362 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; K363 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T364 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G365 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R366 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D367 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A368 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S369 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V370 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H371 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T372 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L373 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L374 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D375 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A376 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L377 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E378 replaced with H, K, R, A, G, i, L, S, T, M, V, N, Q, F, W, Y, P or C; T379 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L380 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G381 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E382 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R383 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L384 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A385 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K386 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; Q387 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; K388 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; I389 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E390 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D391 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H392 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L393 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L394 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S395 replaced with D, E, H,, R, N, Q, F, W,?,? ? C; 'S396 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G397 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K398 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; F399 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; M400 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Y401 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; I402 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E403 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G404 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N405 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; A406 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D407 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S408 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A409 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M410 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; or S41 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C of SEQ ID NO: 3. The amino acids of the TR7 protein of the present invention that are essential for their function can be identified by means of known methods, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989 )).

In the latter procedure, simple mutations of alanine are introduced in each residue of the molecule. The biological activity of the resulting mutant molecules is then tested, for example bin to the receptor or, in vitro, proliferative activity in vitro. Sites that are critical for ligand-receptor bin can also be determined by structural analysis, eg, crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224: 899-904 (1992 ) and de Vos et al., Science 255: 306-312 (1992)). In preferred embodiments, the antibodies of the invention bind to regions of TR7 that are essential for the function of TR7. In other preferred embodiments, the antibodies of the present invention bind to regions of TR7 that are essential for the function of TR7 and inhibit or abolish the function of TR7. In other preferred embodiments, the antibodies of this invention bind to regions of TR7 that are essential for the function of TR7 and increase the function of TR7. Additionally, protein engineering can be used to improve or alter the characteristics of TR7 polypeptides. Recombinant DNA technology known to the skilled artisan can be used to create novel mutant proteins or polypeptides that include substitutions, simple or multiple deletions and additions of amino acids, or fusion proteins. Such modified polypeptides may show, for example, greater activity or greater stability. In addition, they can be purified in high yields and may show greater solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions. The antibodies of the present invention can bind to said modified TR7 polypeptides. Naturally occurring TR7 variants that can be linked by the antibodies of the invention can be produced using known mutagenesis techniques including, without limitation, oligonucleotide-mediated mutagenesis, alanine scanning, PCR mutagenesis, site-directed mutagenesis (See, for example, Carter et al., Nuci Acids Res. 13: 4331 (1986); and Zoller and others, Nucí. Acids Res. 10: 6487 (1982)), cassette mutagenesis (see for example, Wells et al., Gene 34: 315 (1985)), restriction selection mutagenesis (see for example, Wells et al., Philos. Trans. R. Soc. London SerA 317: 415 (1986)). In this manner, the invention also encompasses antibodies that bind TR7 derivatives and analogs having one or more amino acid residues deleted, added or substituted to generate TR7 polypeptides that are more suitable for expression, ascending scaling, etc., in the host cells chosen. For example, the cysteine residues can be deleted or substituted with another amino acid residue to remove the disulfide bridges; the N-linked glycosylation sites can be altered or eliminated to obtain for example the expression of a homogeneous product that is more easily recovered and purified from yeast hosts, which are known to hyperglycosylate the N-linked sites. For this purpose, several amino acid substitutions in the first or the third amino acid position, or both, in one or more of the glycosylation recognition sequences in the TR7 polypeptides, or an amino acid deletion in the second position of one or more such recognition sequences will prevent glycosylation of TR7 in the modified tripeptide sequence (see, for example, Miyajimo et al., EMBO J 5 (6): 1193-1 197). Additionally, to eliminate unwanted processing by proteases such as furins or kexins, one or more of the amino acid residues of the TR7 polypeptides (e.g., arginine and lysine residues) can be deleted or substituted with another residue. The antibodies of the present invention also include antibodies that bind to a polypeptide comprising, or alternatively consisting of, the polypeptide encoded by the deposited cDNA (the deposit having reference No. ATCC 97920) including the leader; the mature polypeptide encoded by the cDNA deposited minus the leader (ie, the mature protein); a polypeptide comprising, or alternatively consisting of, amino acids 1 to 41 1, approximately, of SEQ ID NO: 3; a polypeptide comprising, or alternatively consisting of, amino acids 2 to 411, approximately, of SEQ ID NO: 3; a polypeptide comprising, or alternatively consisting of, amino acids 52 to 41 1, approximately, of SEQ ID NO: 3; a polypeptide comprising, or alternatively consisting of, the extracellular domain of TR7; a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR7; a polypeptide that compresses, or alternatively consisting of, the transmembrane domain of TR7; a polypeptide comprising, or alternatively consisting of, the intracellular domain of TR7; a polypeptide comprising, or alternatively consisting of, the extracellular and intracellular domains, with a part or all of the deleted transmembrane domain; and a polypeptide comprising, or alternatively consisting of, the death domain of TR7; as well as also polypeptides which are at least 80% identical, preferably at least 90% or 95% identical, preferably at least 96%, 97%, 98% or 99% identical to the polypeptides described above, and also include portions of said polypeptides with at least 30 amino acids, preferably at least 50 amino acids. It is understood that in a polypeptide having at least one amino acid sequence, for example, 95% "identical" to a reference amino acid sequence of a TR7 polypeptide, its amino acid sequence is identical to the reference sequence, except that the polypeptide sequence can include up to five amino acid alterations per 100 amino acids of the reference amino acid sequence of the TR7 polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence can be deleted or substituted with another amino acid, or an amount of amino acids of up to 5% of the total amino acid residues of the reference sequence can be inserted. These alterations of the reference sequence can occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between terminal positions, scattered individually between residues of the reference sequence or in one or more contiguous groups within the reference sequence. As a practical way, using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wisconsin, 53711) can be determined conventionally if any Particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical, for example, to the amino acid sequence shown in Figures 1A-B (SEQ ID NO: 3), to the amino acid sequence encoded by the deposited cDNA clones, or fragments thereof. Of course, when using Bestfit or any other sequence alignment program to determine whether a particular sequence is for example 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of Identity is calculated over the entire length of the reference amino acid sequence, and spaces are allowed in the homology of up to 5% of the total number of amino acid residues in the reference sequence. In a specific modality, the identity between a reference sequence (query; a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, is determined using the FASTDB computer program based on the Brutlag algorithm and others. { Comp. App. Biosci. 6: 237-245 (1990)). The preferred parameters used in an FASTDB amino acid alignment are: Matrix = PAM 0, k-tuple = 2, Mismatch penalty = 1, Junction penalty = 20, Scrambling group length = 0, Cut score = 1, Size window = length of the sequence, space penalty = 5, space size penalty = 0.05, window size = 500 or the length of the subject amino acid sequence, whichever is shorter. According to this modality, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions and not due to internal deletions, a manual correction of the results is made to consider the fact that the program FASTDB does not take into account N- or C-terminal truncations of the subject sequence when calculating the overall percentage of identity. For subject sequences truncated at the N and C ends with respect to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which do not match or they are not aligned with a corresponding subject residue, as a percentage of the total bases of the query sequence. The results of the FASTDB sequence alignment determine whether a residue matches or aligns. This percentage of the identity percentage calculated with the aforementioned FASTDB program is then subtracted using the specified parameters, in order to arrive at a final percentage of identity score. This final score of percentage of identity is the one that is used for the purposes of this modality. To manually adjust the percentage of identity score, only the residues of the N and C ends of the subject sequence that do not match or do not align with the query sequence are considered. That is, only the query residue positions outside the terminal residues N and C furthest from the subject sequence. For example, a subject sequence of 90 amino acid residues is aligned with a query sequence of 100 residues to determine percent identity. Deletion occurs at the N-terminus of the subject sequence and therefore the FASTDB alignment does not show a concordance / alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues in the unpaired N and C ends / total number of residues in the query sequence), so that 10% of the identity percentage score calculated by the FASTDB program is subtracted. If the remaining 90 residues matched perfectly, the final identity percentage would be 90%. In another example, a subject sequence of 90 residues is compared to a query sequence of 100 residues. This time the deletions are internal deletions in such a way that there are no residues at the N or C ends of the subject sequence that do not match or align with the query. In this case, the identity percentage calculated by FASTDB is not manually corrected. Again, it is only manually corrected for residue positions outside the N and C terminus of the subject sequence displayed in the FASTDB alignment that do not match or do not align with the query sequence. No other manual corrections are made for the purposes of this modality. Using methods well known to those skilled in the art, the polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns, and as a source to generate antibodies that bind with the TR7 polypeptides. The present application is also directed to antibodies that bind proteins containing polypeptides at least 90%95%, 96%, 97%, 98% or 99% identical to the TR7 polypeptide sequence designated here as n5-m5 or n6-m6. In preferred embodiments, the application is directed to antibodies that bind to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the N- and C-terminal deletions of TR7 that are discussed here. In some preferred embodiments, the antibodies of the invention bind to TR7 proteins of the invention comprising fusion proteins such as those described above, wherein the TR7 polypeptides are those described herein as n5-m5 and n6- m6.

TR4 Polypeptides In some embodiments of the present invention, the antibodies of the present invention bind to the TR4 polypeptide or its fragments or variants. The following section describes in more detail the TR4 polypeptides, their fragments and variants, which can be linked by the antibodies of the invention. The TR4 polypeptides, fragments and variants which can be linked by the antibodies of the invention are also described in international publications, for example WO 98/32856 and WO 00/67793, which are incorporated herein by reference in their entirety. In some embodiments, the antibodies of the present invention bind immunospecifically to the TR4 polypeptide. An antibody that binds immunospecifically to TR4, in some embodiments, may bind fragments, variants (including TR4 orthologous species), multimers, or modified forms of TR4. For example, an immunospecific antibody to TR4 can bind to the TR4 portion of a fusion protein comprising part or all of TR4. The TR4 proteins can be found as monomers or multimers (ie, dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to antibodies that bind to TR4 proteins found as monomers or as part of multimers. In specific embodiments, the antibodies of the invention bind to TR4 monomers, dimers, trimers or tetramers. In further embodiments, the antibodies of the invention bind to at least dimers, at least trimers, or at least tetramers containing one or more TR4 polypeptides. The antibodies of the invention can bind homomers or heteromers of TR4. As used herein, the term "homomer" refers to a multimer containing only TR4 proteins of the invention (including fragments, variants and TR4 fusion proteins, as described herein). These homomers may contain TR4 proteins that have identical or different polypeptide sequences. In a specific embodiment, a homomer of the invention is a multimer containing only TR4 proteins having an identical polypeptide sequence. In another specific embodiment, the antibodies of the invention bind to TR4 homomers containing TR4 proteins having different polypeptide sequences. In specific embodiments, the antibodies of the invention bind to a TR4 homodimer (for example containing TR4 proteins having identical or different polypeptide sequences) or a homotrimer (for example containing TR4 proteins having identical or different polypeptide sequences). ). In further embodiments, the antibodies of the invention bind to at least one homodimer, at least one homotrimer, or at least one TR4 homotetramer. As used herein, the term "heteromer" refers to a multimer containing heterologous proteins (ie, proteins that contain polypeptide sequences that do not correspond to the polypeptide sequences encoded by the TR4 gene), in addition to the TR4 proteins of the invention . In a specific embodiment, the antibodies of the invention bind to a heterodimer, a heterotrimer or a heterotetramer. In further embodiments, the antibodies of the invention bind to at least one homodimer, at least one homotrimer, or at least one homotetramer containing one or more TR4 polypeptides. The multimers linked by one or more antibodies of the invention can be the result of hydrophobic, hydrophilic, ionic or covalent associations, or they can be linked indirectly for example by means of liposome. Thus, in one embodiment, the multimers linked by one or more antibodies of the invention, such as for example homodimers or homotrimers, are formed when the TR4 proteins make contact with one another in solution. In another embodiment, heteromultimers linked by one or more antibodies of the invention, such as for example heterotrimers or heterotetramers, are formed when the proteins of the invention contact in solution with antibodies to the TR4 polypeptides (including antibodies to the heterologous polypeptide sequence in a fusion protein). In other embodiments, the multimers linked by one or more antibodies of the invention are formed by covalent associations with or between the TR4 proteins of the invention. Said covalent associations may include one or more amino acid residues contained in the polypeptide sequence of the protein (for example the polypeptide sequence recited in SEQ ID NO: 1, or the polypeptide encoded by the cDNA clone deposited as ATCC 97853). In one case, the covalent associations are entanglement between cysteine residues located within the polypeptide sequences of the proteins that interact in the native (i.e., natural) polypeptide. In another case, covalent associations are the result of chemical or recombinant manipulation. Alternatively, said covalent associations may include one or more amino acid residues contained in the heterologous polypeptide sequence in a TR4 fusion protein. In one example, the covalent associations are between the heterologous sequence contained in a fusion protein (see, for example, U.S. Patent No. 5,478,925). In a specific example, the covalent associations are between the heterologous sequence contained in a TR4-Fc fusion protein (as described herein). In another specific example, the covalent associations of fusion proteins are between heterologous polypeptide sequences of another member of the TNF ligand / receptor family that is capable of forming covalently associated multimers, such as for example osteoprotegerin (see for example the publication International Patent No. WO 98/49305, the content of which is incorporated herein by reference in its entirety). The multimers that can be linked by one or more antibodies of the invention can be generated using known chemical techniques. For example, the proteins desired to be contained in the multimers of the invention can be chemically crosslinked using linker molecules and known linker molecule length optimization techniques (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference). In its whole). Additionally, the multimers that can be linked by one or more antibodies of the invention can be generated using known techniques to form one or more intermolecular interlaces between the cysteine residues located within the polypeptide sequence of the proteins that it is desired to contain in the multimer (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). In addition, proteins that can be linked by one or more antibodies of the invention can be routinely modified by adding cysteine or biotin to the C-terminus or N-terminus of the protein's polypeptide sequence, and known techniques can be applied to generating multimers containing one or more of these modified proteins (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). Additionally, known techniques can be applied to generate liposomes containing the protein components that are desired to contain in the multimer, which can be linked by one or more antibodies of the invention (see for example U.S. Patent No. 5,478,925, which is incorporated herein by reference). incorporated here as a reference in its entirety). Alternatively, the multimers that can be linked by one or more antibodies of the invention can be generated using known techniques of genetic engineering. In one embodiment, proteins contained in multimers that can be linked by one or more antibodies of the invention are produced recombinantly., using fusion protein technology which is described herein, or which is known (see, for example, U.S. Patent No. 5,478,925, which is incorporated herein by reference in its entirety). In a specific embodiment, polynucleotides encoding a homodimer that can be linked by one or more antibodies of the invention are generated, by ligating a polynucleotide sequence encoding a TR4 polypeptide with a sequence encoding a linker polypeptide, and then also to a polynucleotide. synthetic that encodes the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (which lacks the leader sequence); see, for example, the patent of E.U.A. No. 5,478,925, which is incorporated herein by reference in its entirety). In another embodiment, recombinant techniques described herein or known are used to generate recombinant TR4 polypeptides that contain a transmembrane domain, and which can be incorporated into liposomes by means of membrane reconstitution techniques (see, for example, the US Pat. US No. 5,478,925, which is incorporated herein by reference in its entirety). In another embodiment, two or more TR4 polypeptides are linked by synthetic linkers (e.g., peptide, carbohydrate or soluble polymer linkers). Examples include the peptide linkers that are described in the U.S.A. No. 5,073,627 (incorporated herein by reference). Using conventional recombinant DNA technology, proteins comprising multiple TR4 polypeptides separated by peptide linkers can be produced. In specific embodiments, the antibodies of the invention bind to proteins comprising multiple TR4 polypeptides separated by peptide linkers. Another method for preparing multimeric TR4 polypeptides includes the use of TR4 polypeptides fused to a leucine zipper or a solucin polypeptide sequence. The leucine closure domains and the isoieucine closure domains are polypeptides that promote the multimerization of the proteins in which they are found. Leucine closures were originally identified in several DNA binding proteins (Landschulz et al., Science 240-1759, (1988)), and have since been found in a variety of different proteins. Among the known leucine closures are the natural peptides and their derivatives that dimerize or trimerize. Examples of suitable leucine closure domains for producing soluble multimeric TR4 proteins are those described in PCT application WO 94/10308, incorporated herein by reference. Recombinant fusion proteins comprising a soluble TR4 polypeptide fused to a peptide that dimerizes or trimerizes in solution, are expressed in suitable host cells, and the resulting soluble multimer TR4 is recovered from the culture supernatant using known techniques. In specific embodiments, the antibodies of the invention bind to fusion protein monomers TR4-leucine closure or multimerics of fusion protein TR4-leucine closure. It is believed that some members of the TNF protein family exist in trimeric form (Beutler and Huffel, Science 264: 667, 1994; Banner et al., Cell 73: 431, 1993). In this way, trimeric TR4 can offer the advantage of greater biological activity. Preferred leucine closure portions are those which preferably form trimers. An example is a leucine closure derived from the surfactant lung protein D (SPD), as described by Hoppe et al. { FEBS Letters 344: 191, (1994)), and in the patent application of E.U.A. No. 08 / 446,922, incorporated herein by reference. In specific embodiments, the antibodies of the invention bind to TR4 fusion protein-leucine closure trimers. Other peptides derived from natural trimeric proteins can be used to prepare trimeric TR4. In specific embodiments, the antibodies of the invention bind to TR4 fusion protein monomers or TR4 fusion protein trimers. The antibodies that bind TR4 receptor polypeptides can bind them as isolated polypeptides or in their natural state. By "isolated polypeptide" is meant a polypeptide removed from its natural environment. In this manner, a polypeptide produced or contained within a recombinant host cell is considered isolated for the purposes of the present invention. Also, an "isolated polypeptide" is considered to be a polypeptide that has been purified, partially or substantially, from a recombinant host cell. For example, a recombinantly produced version of TR4 polypeptide is substantially purified by a one step method described by Smith and Johnson, Gene 67: 31-40 (1988). In this manner, the antibodies of the present invention can be linked with recombinantly produced TR4 receptor polypeptides. In a specific embodiment, the antibodies of the present invention bind to a TR4 receptor expressed on the surface of a cell comprising a polynucleotide encoding amino acids 1 to 468 of SEQ ID NO: 1, operatively associated with a regulatory sequence that controls the expression of the gene. The antibodies of the present invention can be linked to fragments of TR4 polypeptide comprising, or alternatively consisting of, an amino acid sequence contained in SEQ ID NO: 1, encoded by the cDNA contained in the ATCC deposit No. 97853, or encoded by nucleic acids that hybridize (for example under severe hybridization conditions) with the nucleotide sequence contained in the ATCC deposit No. 97853, or the complementary chain thereof. The protein fragments may be "independent" or may be comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. The antibodies of the present invention can be attached to polypeptide fragments including, for example, the fragments comprising, or alternatively consisting of, the amino acid residues: from about 1 to 23, 24 to 43, 44 to 63, 64 to 83 , 84 to 103, 104 to 123, 124 to 143, 144 to 163, 164 to 183, 184 to 203, 204 to 223, 224 to 238, 239 to 264, 265 to 284, 285 to 304, 305 to 324, 325 to 345, 346 to 366, 367 to 387, 388 to 418, 419 to 439, or 440 to 468 of SEQ ID NO: 1. In this context, "approximately" includes the value quoted in particular, greater or lesser by several amino acids (5, 4, 3, 2 or 1) at either end or at both ends. In addition, the polypeptide fragments linked by the antibodies of the invention can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 , 175 or 200 amino acids in length. In this context, "approximately" includes the value quoted in particular, greater or lesser by several amino acids (5, 4, 3, 2 or 1) at either end or at both ends. Preferably, the antibodies of the present invention bind to polypeptide fragments selected from the group of: a polypeptide comprising, or alternatively consisting of, the extracellular domain of the TR4 receptor (which is predicted to constitute amino acid residues 24 to 238, approximately, of SEQ ID NO: 1), a polypeptide comprising, or alternatively consisting of, the two cysteine-rich domains of TR4 (which can be found in the protein fragment consisting of amino acid residues 131 to 229, approximately, of SEQ ID NO: 1); a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR4 consisting of amino acid residues 131 to 183, approximately, of SEQ ID NO: 1); a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR4 consisting of amino acid residues 184 to 229, approximately, of SEQ ID NO: 3); a polypeptide comprising, or alternatively consisting of, the transmembrane domain of the TR4 receptor (which is predicted to constitute the amino acid residues 239 to 264, approximately, of SEQ ID NO: 1); a polypeptide comprising, or alternatively consisting of, a fragment of the predicted mature TR4 polypeptide, wherein the fragment has a functional activity of TR4 (eg, antigenic activity or biological activity); a polypeptide comprising, or alternatively consisting of, the intracellular domain of the TR4 receptor (which is predicted to constitute the amino acid residues 265 to 468, approximately, of SEQ ID NO: 1); a polypeptide comprising, or alternatively consisting of, the extracellular and intracellular domains of the TR4 receptor with a part or all of the deleted transmembrane domain; a polypeptide comprising, or alternatively consisting of, the death domain of the TR4 receptor (which is predicted to constitute the amino acid residues 379 to 422, approximately, of SEQ ID NO: 1); and a polypeptide comprising, or alternatively consisting of, one, two, three, four or more epitopes carrying portions of the TR4 receptor protein. In further embodiments, the polypeptide fragments of the invention comprise, or alternatively consist of, any combination of 1, 2, 3, 4, 5, 6, 7 or the 8 members mentioned above. The amino acid residues that constitute the extracellular, transmembrane and intracellular domains of the TR4 receptor have been predicted by computer analysis. In this way, as the person with average knowledge in the art will appreciate, the amino acid residues that constitute these domains may vary slightly (for example in approximately 1 to 15 amino acid residues), depending on the criteria used to define each domain. The polynucleotides encoding these polypeptides are also encompassed by the invention. It is considered that one or both of the extracellular cysteine-rich motifs of TR4 are important for the interactions between TR4 and its ligands (eg TRAIL). Accordingly, in highly preferred embodiments, antibodies of the present invention bind to TR4 polypeptide fragments comprising, or alternatively consisting of, amino acid residues 131 to 183, or 184 to 229 of SEQ ID NO: 1. In another highly preferred embodiment, the antibodies of the present invention bind to TR4 polypeptides comprising, or alternatively consisting of, the two extracellular cysteine-rich motifs (amino acid residues 131 to 229 of SEQ ID NO: 1). In another preferred embodiment, the antibodies of the present invention bind to TR4 polypeptides comprising, or alternatively consisting of, the soluble extracellular domain of TR4 (amino acid residues 24-238 of SEQ ID NO: 1). In highly preferred embodiments, antibodies of the invention that bind to part or all of the soluble extracellular domain of TR4 (eg, one or both of the cysteine-rich domains), prevent the TRAIL ligand from binding to TR4. In other highly preferred embodiments, antibodies of the invention that bind to part or all of the soluble extracellular domain of TR4 (eg, one or both of the cysteine-rich domains) agonize with the TR4 receptor. In other highly preferred embodiments, antibodies of the invention that bind to part or all of the soluble extracellular domain of TR4 (eg, one or both of the cysteine-rich domains), induce death of cells expressing the TR4 receptor. The antibodies of the invention can also be joined to fragments comprising, or alternatively consisting of, structural or functional attributes of TR4. Such fragments include amino acid residues comprising alpha helix and alpha helical regions ("alpha regions"), beta sheet and beta-sheet forming regions ("beta regions"), spinning and spinning regions ("turning regions"). ), spiral and spiral forming regions ("spiral regions"), hydrophilic regions, hydrophobic regions, alpha antipatic regions, beta antipatic regions, surface forming regions, and regions of high antigenic index (that is, containing four or more amino acids) contiguous that have an antigenic index greater than or equal to 1.5, identified using the default parameters of the Jameson-Wolf program) of full TR4 (ie, full-length). Some preferred regions are those set out in Table 4 and include, without limitation, regions of the aforementioned types identified by analysis of the amino acid sequence represented in SEQ ID NO: 1, said preferred regions include: alpha regions, beta regions , turning regions and spiral regions predicted according to Garnier-Robson; alpha regions, beta regions and regions of rotation predicted according to Chou-Fasman; predicted hydrophilic regions according to Kyte-Doolittle; alpha and beta amphipathic regions of Eisenberg; surface forming regions of Emini; and regions of high antigenic index of Jameson-Wolf, predicted using the default parameters of these computer programs. The data representing the structural or functional attributes of TR4 indicated in Table 4, as described above, were generated using the various modules and algorithms of the DNA * STAR series on the omission parameters. Column I represents the results of a Garnier-Robson analysis of alpha helical regions; column II represents the results of a Chou-Fasman analysis of alpha helical regions; column III represents the results of a Garnier Robson analysis of beta sheet regions; column IV represents the results of a Chou-Fasman analysis of beta sheet regions; column V represents the results of a Garnier Robson analysis of turning regions; column VI represents the results of a Chou-Fasman analysis of turning regions; column VII represents the results of a Garnier Robson analysis of spiral regions; column VIII represents a hydrophilicity graph of Kyte-Doolittle; column IX represents the results of an Eisenberg analysis of alpha amphipathic regions; column X represents the results of an Eisenberg analysis of beta amphipathic regions; column XI represents the results of a Karplus-Schultz analysis of flexible regions; column XII represents the score of the antigenic index of Jameson-Wolf; and column XIII represents the surface probability graph of Emini.

In a preferred embodiment, the data presented in columns VIII, XII and XIII of Table 4 can be used to determine regions of TR4 that exhibit a high potential degree of antigenicity. The regions of high antigenicity are determined from the data presented in columns VIII, XII or XIII, by choosing values representing regions of the polypeptide that are likely to be exposed on the surface of the polypeptide, in a medium in which antigen recognition may occur in the process of starting an immune response. The above-mentioned preferred regions set forth in Table 4 include, without limitation, regions of the aforementioned types identified by amino acid sequence analysis of SEQ ID NO: 1. As shown in Table 4, said preferred regions include the alpha regions, beta regions, spin regions and spiral regions of Garnier-Robson, the alpha regions, beta regions and spin regions of Chou-Fasman, the hydrophilic regions of Kyte-Doolittle, the alpha and beta amphipathic regions of Eisenberg, the flexible regions of Karplus-Schulz, the regions of Jameson-Wolf of high antigenic index and the surface-forming regions of Emini. Preferred polypeptide fragments linked by one or more antibodies of the invention include those regions of TR4 that combine several structural features, such as several of the regions indicated above and in Table 4 (eg, 1, 2, 3, or 4), equal or different.

TABLE 4 Res Position I ir III IV V VI VII VIII IX X XI XII XIII Met 1 B 0.12 -0.10 0.90 Wing 2 c -0.08 * 0.25 1.08 Pro 3. c 0.42 * * 0.10 0.36 Pro 4. T c -0.04 *. 1.05 1.69 Pro 5 A T 0.31 * | F 1.00 1.24 Wing 6 A .- T 0.10 * F 1.00 1.10 Arg 7 A I. 0.3.4 * 0.10 0..58 Val • 8 B B -0.03 * -0.30 0.37 His 9 B B -0.52 * -0.30 0.37 Leu 10 B B -1.12 * -0.60 0.17 Gly 11 B B -1.12 * -0.60 0.18 Wing 12 B B -2.09 * -0.60 0.14 Phe 13 B B -1.54 * -0.60 · 0.12 Leu 14 B B -1.72 -0.60 0.18 Wing 15 B B -0.91 -0.60 0.27 Val 16 3 B -0.73 -0.60 0.51 Tbr 17 B B -0.53 F -0.45 0.95 Pro 18 B c -0.13 F 0.05 0.93 Asn 19 T c 0.09 F 0.60 1.69 Pro 20 T c 0.09 F 0.60 1.18 Gly 21 T. 0.64 F 0.65 0.77 Ser 22 T c 0.61 F 0.45 0.64 Wing 23. c 0.51 F 0.25 0.41 Wing 24 T c 0.51 F 0.45 0.60 Ser 25 T 0.13 F 0.85 0.78 Gly 26 A T -0.11 F 0.85 0.78 T r 27 A T -0.40 F 0.85 0.78 Glu 28 A A -0.40 F 0.45 0.58 Wing 29 A A -0.12. 0.30 0.60 Wing 30 A A -0.03 0.30 0.60 Wing 31 A A 0.01 0.30 0.53 Wing 32 A A 0.37. -0.30 0.71 Thr 33 A T -0.49 F 1.00 1.40 Pro 34 A T -0.19 F 1.00 1.03 Ser 35 B T 0.05 F 0.40 1.07 Lys 36 B T 0.34 F 0.25 0.73 Val 37 B B. 0.63 F -0.15 0.64 Trp 38 B B 0.36 F -0.15 0.64 Gly 39 B B 0.22 * * F -0.15 0.32 Ser • 40 - c 0.63 + * F -0.05 0.43 Ser 41 T c -0.30 * * F 0.45 0.80 Wing 42 1 c 0.56 * F 1.05 0.57 Gly 43 T c 0.63 * * F 1.35 0.73 Arg 44 B 1 1.09 * * F 1.49 0.84 lie 45 B. 1.04 * * F 1.78 1.63 Glu 46 B - 1.00 * * F 2.12 1.63 Pro 47 B T 1.24 * * F 2.51 0.83 Arg 48 T T 1.70 * * F 3.40 1.17 Gly 49 T T 1.24 * F 3.06 1.32 Gly 50 T T 1.54 * * F 2.57 0.84 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Gly 51.. T c 0.73 * * F 2.03 0.44 Arg 52 T c 0.73 * * F 1.39 0.36 Gly 53 B T 0.31 * * F 0.85 0.57 Wing 54 B T 0.36 * F or .as 0.83 Leu 55 B 0.10 * F 0.65 0.57 Pro 56 B 0.10 F -0.25 0.57 Thr 57 B -0.01 F -0.25 0.55 Ser 58 B T 0.30 F 0.10 G.16 Met 59 B. T 0.54 F 0.40 1.02 Gly 60 B T · 1.14 F 0.25 0.70 Gln 61 G T 1.05 F 0.65 0.81 His 62 - c 0.78 * F 0.40 1.10 Gly 63 T c 1.19 * F 0.60 1.12 Pro 64 T c 1.20 * F 1.20 1.27 Ser 65 T c 1.66 * F 1.05 0.94 Wing 66 B T 1.07 * F 1.30 1.86 Arg 67 B 0.76 * *. 1.29 1.22 Wing 68 B. 1.21 * * 1.48 0.90 Arg 69 B T 0.83. 2.17 1.74 Wing 70 B T 0.92 * F 2.51 0.90 Gly 71 G T 1.17 * F 3.40 1.37 Arg 72 T c 0.84 * F 2.71 0.69 Wing 73 T c 1.54 * F 2.48 1.06 Pro 74 'T c 1.22 F 2.70 2.10 Gly 75 T c 1.22 * F 2.62 1.66 Pro 76 T c 1.58 * F 2.24 1.66 Arg 77 c 1.57 * F 2.60 2.10 Pro 78 A B 1.57 * F 1.94 3.68 Wing 79 A B 1.48 * F 1.68 2.40 Arg 80 A B 1.61 * * F 1.42 1.64 GlU 81 A B 1.93 * * F 1.16 1.64 Wing 82 A A 1.01 * * F 0.90 3.19 Ser 83. A T 1.33 * * F 1.30 1.34 Pro 84 A T 1.07 * F 1.30 1.52 Arg 85 A T 0.92 * * F l.OO 1.12 Leu 86 A T 0.97 * 0.85 1.13 Arg 87 A B 1.24 *. 0.75 1.46 Val 88 A B 0.84 * * 0.75 1.08 His 89 A B 1.10 * -0.15 1.13 Lys 90 A B 0.29 * F 0.90 1.16 Thr 91 B B 0.24 * F 0.00 1.35 Phe 92 B B -0.72 * * -0.30 0.74 Lys 93 B B -0.72 * * -0.30 0.27 Phe 94 B B -1.03 -0.60 0.14 Val 95 B B -1.93 * -0.60 0.16 Val 96 B B -2.43 * -0.60 0.06 Val 97 'B B -2.54 * -0.60 0.05 Gly 98 B B -2.59 * -0.60 0.05 Val 99 B B -2.74 -0.60 0.15 Leu 100 B B -2.74 * -0.60 0.15 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Leu 101 B 3 -2.10 + -O.60 0.11 Gln 102 B B -1.54 * -0.60 0.23 Val 103 B B. -1.50. -0.60 0.37 Val 104 B T -1.23. -0.20 0.61 Pro 105 B T -1.01 * F 0.25 0.35 be Í06 A T -0.51 * F -0.05 0.48 Ser 107 A T -1.40 * F • 0.25 0.94 Wing 108 A -0.50 • F - 0.05 0.43 Wing 109 A -0.46 *. 0.50 0.63 Thr 110 A -0.28 * -0.10 0.39 lie 111 A 0.02 * -0.10 0.53 Lys 112 B 0.32 *. 0.50 0.87 Leu 113 B 0.61 + F 1.05 1.04 His 114 B 0.31 * F 1.30 1.99 Asp 115 T 0.28 * F 1.80 0.70 Gln 116 T T 0.86 F 1.65 0.84 Ser 117 T T 0.81 F 2.50 0.89 lie 118 T T 1.52 .F 2.25 0.92 Gly 119 c 1.37 'F 1.00 0.92 Thr 120 - c 1.37 F 0.45 0.72 Gln 121 B c 1.33 F 0.65 1.79 Gln 122 B. . 1.33 F 0.20 2.46 Trp 123 B. 2.01. 0.05 2.28 Glu 124 · c 1.54 0.25 2.04 His 125 c 1.51. 0.10 0.97 Ser 125 T c 1.51 F 0.45 0.91 Pro 127 T T 0.70 F 1.55 0.91 Leu 128 T T 0.32 F 0.65 0.55 Gly 129 T T 0.11 F 0.65 0.22 Glu 130 T -0.07 F 0.45 0.22 Leu 131 B. -0.11 * 0.18 0.42 Cys 132 B -0.20 * F 1.21 0.42 Pro 133 B T 0.58 * * F 1.69 0.32 Pro 134. T T 1.03 * F 1.47 0.53 Gly 135 T T 0.73 * F 2.80 1.94 Ser 136 T c 1.54 * F 2.32 1.68 His 137. . c 2.32 * F 2.48 1.88 Arg 138 B 2.32 + F 2.34 3.72 Ser 139 B. 2.19 * F 2.40 4.29 Glu 140 T - 1.94 * F 2.86. 3.12 Arg 141 T T 1.58 * F 3.40 1.61 Pro 142 T T 1.61 * F 2.91 0.64 Gly 143 T T 1.61 * F 2.57 0.60 Wing 144 T T 1.24 *. 2.08 0.50 Cys 145 T |0.93 * 1.41 0.21 Asn 146 B 0.82 * | 0.84 0.30 Arg 147 B - 0.69 *. 1.01 0.52 Cys 148 B T 0.18 * F 1.83 0.96 Thr 149 B T 0.42 * F 1.70 0.44 Glu 150 B T 0.84 + F 1.53 0.22 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Gly 151 B T 0.53 F 0.76 0.65 Val 152 B B 0.42 * F 0.19 0.65 Gly 153 B B 0.50. -0.13 0.61 Tyr 154 B B 0.51 -0.60 0.62 Thr 155 B B 0.51 F -0.30 1.12 Asn 156 B c 0.86 F 0.20 1.81 Wing 157 T T 0.90 F 0.80 1.86 Ser 158 T T 0.54 F 0.80 1.06 Asn 159 T T 0.20 F 0.35 0.57 Asn 160 T T -0.16 * F 0.35 0.57 Leu 161 A B. -0.97 4 -0.60 0.23 Phe 162 A B -0.59 -0.60 0.12 Wing 163 A B -0.96 -O.60 0.11 Cys 16-1 A B. -i.27 * -0.60 0.07 Leu 165 B T -1.86 -O.20 0.12 Pro 166 B T -1.71 * -0.20 0.12 Cys 167 T -0.97 * 0.20 0.12 Thr 168 A T -0.68 0.10 0.30 Wing 169 A. -0.01 0.50 0.26 Cys 170 A T 0.80 • 0.70 0.80 Lys 171 A 2 1.01 F 1.15 0.96 Ser 172 A T 1.68 * F 1.30 1.65 Asp 173 A T 2.10 * F 1.30 5.33 Glu 174 A A. 2.39 * F 0.90 5.22 Glu 175 A A 2.84 * F 1.24 5.22 Glu 176 A A 2.13 * F 1.58 4.83 Arg 177 A T. 2.12 F 2.32 1.50 Ser 178 . T 1.81 F 2.86 1.25 Pro 179 T T 1.50 * F 3.40 1.04 Cys 1B0 T T 1.61 * F 2.61 0.77 Thr 181 T T 1.61 * F 2.67 1.12 Thr 1B2 T. 1.19 * F 2.38 1.16 Thr 183 T T 0.90 F 2.49 3.13 Arg 184 T T 0.44 F 2.40 2.19 Asn 1B5 T T 1.11 - F 2.50 0.81 Thr 1B6 T T 0.76 * F 2.25 0.98 Wing 187 T. 1.11 * - 1.65 0.27 Cys 188 T 1.21 + 1.40 0.33 Gln 189 B. 0.76 * 0.75 0.36 Cys 190 B. 0.44. 0.50 0.35 Lys 191 £ T 0.06 * F 0.85 0.94 Pro 192 T X 0.76 F 0.65 0.47 Gly 193. 1 T 1.42 * F 1.74 1.72 Thr 194 B T 1.42 * F 1.68 1.38 Phe 195 B. 2.09 * F 1.82 1.49 Arg 195 T. 1.74 * F 2.56 2.42 Asn 197 1 T 1.37 * F 3.40 2.25 Asp 198 T T 1.71 * F 3.06 2.63 Asn 199 T c 1.42 * F 2.52 2.32 Ser 200 A T 1.46 * F 1.98 1.43 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Wing 201 A 1-46 1.14 0.46 Glu 202 A 1.50 * 0.80 0.56 Met 203 A. 0.83 * 1.11 0.83 Cys 204 A. T 0.53 * 1.62 0.44 Arg 205 T T 0.52 * 2.33 0.34 Lys 206 T T 0.77 * F 2.49 0.50 Cys 207 | T T 0.10 * F 3.10 0.92 Ser 208 T 0.49 * F 2.59 0.25 Thr 209 T 1.27 * * F 1.98 0.19 Gly 210 T 0.81 F 1.67 0.71 Cys 211 T 0.17 * * F 1.16 0.53 Pro 212 T T -0.O2 * * F 1.25 0.36 Arg 213 T T · 0.32 * * F -0.65 0.27 Gly 214 B T -0.22 * *. 0.85 '1.01 Met 215 B B 0.17 * * 0.30 0.48 Val 216 B B 0.83 * *. 0.79 0.49 Lys .217 B B 0.38. * * | 0.98 0.83 Val 218 B B "-0.04 * * F 1.32 0.45 Lys 219 B B 0.09 * F 1.51 0.88 Asp 220 B 0.40 F 1.90 0.68 Cys 221 B 0.96 * F 0.81 0.96 Thr 222 T 0.91 * F 1.62 0.65 Pro 223 T T 0.88 * F 1.63 0.65 Trp 224 T T 0.83 * F 0. S4 0.84 Ser 225 A T 0.17 - F 1.00 1.01 Asp 226 A A -0.02 F 0.45 0.35 lie 227 A A 0.26 * -0.30 0.25 Glu 228 A A 0.51 * 0.30 0.25 Cys 229 A 0.80 * 0.60 0.30 Val 230 A A 0.80 * * 0.60 0.74 His 231 A A 0.46 * * 0.60 0.58 Lys 232 A A 1.34 * F 0.60 1.06 Glu 233 A T 1.00 * F 1.30 2.30 Ser 234 T T 1.63 * F 1.70 1.68 Gly 235 T T 2.49 * F 1.70 1.14 Asn 236 T T 1.63 * F 1.40 1.06 Gly 237 T c 1.30 * F 0.45 0.55 His 238 B c 0.44 -0.40 0.59 Asn 239 B c -0.14 -0.40 0.27 lie 240 B B -0.61 -0.60 0.19 Trp 241 B B -1.47 -0.60 0.12 Val 242 B B -1.98 -0.60 0.05 lie 243 B B -2.25 -0.60 0.O6 Leu 244 B B -3.07 -0.60 0.08 Val 245 B B -3.03 -0.60 0.09 Val 246 B B -3.60 -0.60 0.09 Thr 247 B B -2.95 -0.60 0.08 Leu 248 B B -2.88 -0.60 0.17 Val 249 B B -2.88 * -0.60 0.19 Val 250 B B -2.83 -0.60 0.11 TABLE 4 (Continued) Res Position I II I IV V VI VII VIII IX X XI XII XIII Pro 251 B B -2.83 -0.60 0.11 Leu 252. B B -3.11 -0.60 0.11 Leu 253 A B -3.16 -0.60 0.15 Leu 254 A B -3.11 -0.60 0.07 Val 255 A B -3.14 -0.60 0.07 Wing 256 A B -3.79 -0.60 0.06 Val 257. B B -3.64 -0.60 O.05 Su - 258 B B -3.50 -0.60 O.04 lie 259 B B -3.36 -0.60 O.02 Val 250 B B -3.39 -0.60 O.02 Cys 261 B B -3.14 -0.60 0.01 Cys 2S2 B B -2.59 -0.60 0.02 Cys 253 B B -2.12 -0.60 0.03 lie 264 B B -1.90 -0.60 0.06 Gly 265 T T -1.39 F 0.35 0.06 Ser 265 T T -1.07 F 0.35 0.11 Gly 267 T T -0.40 F 0.55 0.16 Cys 268 T T 0.06 F 1.25 0.27 Gly 269 T 0.99 F 1-39 0.31 Gly 270 T 0.67 F 2.03 0.62 Asp 271 T 0.37 F 2.37 0.62 Pro 272 T T 0.71 * F 2.91 0.62 Lys 273 T T 1.49 * * F 3.40 1.05 Cys 274 B T 0.98 * * 2.51 1.23 Me 275 B B 0.66 * * 1.62 0.59 Asp 276 B B -0.04 * * 1.28 0.16 Arg 277 B B -0.12 * 0.04 0.25 val 278 B B -0.06 * -0.50 0.27 Cys 279 B B -0.20 0.30 0.32 Phe 280 B B 0.06 * -0.60 0.13 Trp 281 B B -0.76 -0.50 0.18 Arg 282 B B -1.68 -0.60 0.28 Leu 283 B B -0.71 -0.60 0.26 Gly 284 B -0.39 * -0.20 0.49 Leu 285 B c 0.10 * 0.50 0.25 Leu 28S B c 0.04 * 0.20 0.45 Arg 287 B c -0.56 F 0.65 0.46 Gly 288 T c 0.16 F 1.35 0.57 Pro 289 T c 0.50 * F 2.70 1.19 Gly 290 T c 1.31 F 3.00 1.01 Wing 291 A T 1.53 * F 2.50 1.65 Glu 292 A. 1.39 F 2.00 1.08 Asp 293 A. 1.73 F 1.70 1.48 Asn 294 A T 1.94 * 1.45 2.36 Wing 295 A T 1.40 1.15 2.36 His 296 A T 1.18 * 1.00 0.99 Asn 297 A T 0.88 0.10 0.51 Glu 298 A. 0.88 -0.10 0.67 lie 299 A 0.29 + * -0.10 0.80 Leu 300 A 0.88 * * -0.10 0.50 TABLE 4 (Continued) Res Position I II. III IV V VI VII- VIII IX X XI XII XIII Ser 301 A 0.61 * F 0.65 0.48 Asn 302 A T -0.20 * F 0.25 0.92 Ala 303 A? -0.50 * F 0.25 0.92 Asp 304 A 1. 0.08 * F 0.85 0.92 Ser 305 T c 0.19 * F 1.05 0.83 Leu 306 B c -0.37 * - F 0.05 0.71 Ser 307 B B -0.67 * F -0.15 0.31 'Thr 30'8 B B -0.08 *. -0.50 0.31 Phe 309 B B -0.08 + -0.30 0.66 Val 310 A B 0.22 F -0.15 0.85 Ser 311 A A 0.43 F 0.00 1.03 Glu 312 A A 0.73 F 0.00 1.17 Gln 313 A A 0.74 F 0.90 2.73 Gln 314 A A 1.44 T 0.90 2.73 Met 315 A A 2.30 F 0.90 2.73 Glu 316 A A 2.39 F 0.90 2.73 Ser 317 A A 1.80 F 0.90 2.44 Gln 318 A A 1.80 * F 0.90 2.49 Glu 319 A A 0.99 * F 0.90 - 2.40 Iro 320 A A 1.28 * F 0.90 1.48 Wing 321 A A 0.93 F 0.60 1.23 Asp 322 A A B 0.38 F 0.45 0.70 Leu 323 A A B 0.07 F -0.15 0.34 Thr 324 - A B B -0.79 F -0.15 0.48 Gly 325 A B B -0.58. -0.30 0.21 Val 325 B B -0.29 -0.60 0.45 Thr 327 B B -0.50. -0.60 0.42 Val 328 B B -0.03 * F -0.17 0.65 Gln 329 B B 0.28 * F 0.11 0.87 Ser 330 T c 0.03 * F 2.04 1.05 Pro 331 T c 0.89 * F 2.32 1.42 Gly 332: T 0.53 * F 2.80 1.42 Glu 333 A. T 0.58 F 1.97 0.57 Wing 334 B -0.23 * 0.74 0.30 Gln 335 B -0.28 0.46 0.25 Cys 336 B -0.28 0.18 0.14 Leu 337 B -0.52 * -0.40 0.22 Leu 338 B -0.52 * -0.40 0.13 Gly 339 A -0.52 * F 0.05 0.42 Pro 340 A A -0.52 * F -0.15 0.51 Wing 341 A A -0.20 F 0.60 1.07 Glu 342 A A 0.31 * F 0.90 1.07 Wing 343 A A 1.12 * F 0.75 0.93 Glu 344 A A 1.58 F 0.90 1.60 Gly 345 A A 1.90 * F 0.90 1.80 Ser 346 A T 2.60 * F 1.30 3.50 Gln 347 A T 1.79 * F 1.30 3.96 Arg 348 A T 1.57 * F 1.30 3.30 Arg 349 B • s 0.71 * F 1.30 2.03 Arg 350 B B 0.84 * F. 0.75 0.87 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Leu 351 B B 0.55 * 0.60 0.69 Leu 352 B B 0.56 * 0.30 0.35 Val 353 B B. 0.10 * * -0.30 0.29 Pro 354 B T -0.60 * -0.20 0.35 Wing 355 T -0.71 * 0.50 0.43 Asn 356 T c -0.11 F 1.65 0.96 Gly 357 T c. 0.39 F 1.95 0.96 Ala 358 c 1.24 F 2.20 1.37 Asp 359 T c 1.14 F 3.00 1.48 Pro 360 A T 0.92 F 2.50 2.16 Thr 361 A T 0.32 F 1.90 1.76 Glu 362 A G -0.14 F 1.60 1.04 Thr 363 A B -0.26 F 0.15 0.56 Leu 364 A B -0.96 * -0.60 0.33 Met 365 A B -0.74 + -O.60 0.17 Leu 366 A B -0.39 * -0.60 0.19 Phe 367 A B -1.09 -0.60 0.47 Phe 368 A B -1.37 * -0.60 0.41 Asp 369 A B -0.56 * -0.60 0.50 Lys 370 A A. -0.84 * -0.30 0.93 Phe 371 A A B -0.89 * -0.30 0.75 Wing 372 A A B -0.40 * -0.30 0.34 Asn 373 A B B -0.40 * -0.60 0.26 lie 374 A, B B -0.40 * -0.60 0.26 Val 375 A B B -0.74 -0.60 0.43 Pro 376 A B -0.33 -0.10 0.36 Phe 377 T G 0.26 0.20 0.54 Asp 378 T T 0.26 F 0.80 1.21 Ser 379 - T T 0.33 F 1.40 1.35 Trp 380 A T 0.59 * F 0.40 1.29 Asp 381 A A 0.91 * F -0.15 0.76 Gln 382 A A 1.61 -0.15 1.11 Leu 383 A A 0.80 * -0.15 1.84 Met 384 A A 1.10 * 0.30 0.91 Arg 385 A A 0.58 * 0.30 0.87 Gln 386 A A 0.27 * -0.30 0.87 Leu 387 A A 0.31 * 0.45 1.27 Asp 388 A A 1.12 0.75 1.30 Leu 389 A A 1.72 F 0.60 1.21 Thr 390 A T 0.72 * F 1.30 2.54 Lys 391 A T 0.72 * F 1.30 1.07 Asn 392 A T 0.68 * * 7 1.30 2.16 Glu 393 A T -0.18 * F 1.30 1.11 lie 394 B B 0.74 * F 0.75 0.41 Asp 395 B B 0.47 * 0.60 0.50 Val 396 B B. 0.08 * * 0.60 0.29 Val 397 B B -0.23 0.51 0.41 Arg 398 B. T -0.82 * 1.12 0.36 Wing 399 B T -0.28 * 0.73 0.49 Gly 400 T T -0.49 * F 2.09 0.65 TABLE 4 (Continued) Position I II III IV VI VII VIII IX X XI XII XIII Thr 401 c 0.02 * * P 2.10 0.51 Wing 402 c 0.88 * F 1.09 0.50 Gly 403 T c 0.18 * * F 1.68 0.85 Pro 404 T c -0.04 F 1.47 0.59 Gly 405 T c 0.06 F 1.26 0.48 Asp 406 A T -0.22 F 0.25 0.76 Wing 407 A A -0.23. -O.30 0.50 Leu 408 A A -0.70 -0.60 0.50 Tyr 409 A A -1.09 * -0.60 0.25 Wing 410 A A -0.70 * -0.60 0.24 Met 411 A A -0.99 * -0.60 0.59 Leu 412 A A -1.26 * -0.60 0.39 Met 413 A A -0.44 * -0.60 0.29 Lys 414 A A B -0.16 -0.60 0.47 Trp 415 A A B 0.12 * 0.15 1.14 Val 416 A A B 0.38 0.45 1.66 Asn 417 A. | T 1.30 * F 1.75 0.82 Lys 418 A T 1.90 * 'F 2.20 1.53 Thr 419 T c 1.27 * F 3.00 3.32 Gly 420 T c 1.26 * F 2.70 2.08 Arg 421. 1.22 * F 2.40 1.40 Asn 422 T c 1.19 * F 1.65 0.68 Wing 423 B T 0.83 1.00 0.93 Ser 424 B T 0.33 0.70 0.69. lie 425 B T -0.13 -0.20 0.35 His 426 A B -0.24 * -0.60 0.29 Thr 427 A B -0.83 * * -0.50 0.36 Leu 428 A A -1.06 * * -0.60 0.52 Leu 429 A A -0.76 * * -0.60 0.31 Asp 430 A A 0.24 * -0.30 0.38 Wing 431 A A -0.32 * * 0.30 0.89 Leu 432 A A -0.01 * * 0.75 1.07 Glu 433 A at 0.80 <* * 0.75 1.11 Arg 434 A A 1.72 *? F 0.9O 1.90 Met 435 A A 1.69 * * F 0.90 4.52 Glu 436 A A 1.69 * * F 0.90 3.55 Glu 437 A A 2.54 * F 0.90 1.83 Arg 438 A A 2.54 * * · F 0.90 3.70 His 439 A A 2.48 * * F 0.90 3.70 Wing 440 A A 2.19 * * F 0.90 4.28 Lys 441 A A 2.19 * F 0.90 1.53 Glu 442 A A 2.19 * F 0.90 1.95 Lys 443 A A 1.27 * * F 0.90 3.22 lie 444 A A 0.49 * F 0.90 1.33 Gln 445 A A 0.22 * * • F 0.75 0.63 Asp 446 A A 0.18 * * F -0.15 0.23 Leu 447 A A -0.12 -0.30 0.56 Leu 448 A A -0.51 * 0.55 0.43 Val 449 A A 0.42 * F 0.55 0.26 Asp 450 A T -0.28 * F 1.60 0.62 TABLE 4 (Continued) Res Position I II III IV V VI VII VII IX X XI XII XIII Ser 451 T T -1.17 * F 2.25 0.65 Gly 452 .-. T T -0.60 * F 2.50 0.62 Lys 453 B T -0.60 F 1.25 0.58 P e 454 A B 0.26 0.15 0.36 lie 455 A. B 0.26 0.20 0.62 Tyr 456 A B 0.21 0.55 0.52 Leu 457 A B 0.24 -0.03 0.59 Glu 458 A B ·. . -0.14 F 0.54 1.22 Asp 459 A T 0.26 F 1.S6 0.77 Gly 460 T T 0.56 F 2.78 1.26 T r 461. T c -0.06 * F 2.70 0.73 Gly 462 T c 0.46 F 2.13 0.33 Ser 463 T c -0.36 F 1.26 0.44 Wing 464 A -0.36 0.14 0.25 Val 465 3 -0.40 0.17 0.44 Ser 466 B -0.48 -0.10 0.42 Leu 467 B -0.52 -0.10 0.53 Glu 468 A. -0.61 0.50 0.92 In another aspect, the invention provides an antibody that binds to a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide described herein. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention. An "immunogenic epitope" is defined as part of a protein that elicits an antibody response when the entire protein is the immunogen. On the other hand, a region of a protein molecule to which an antibody can be attached is defined as an "antigenic epitope". The number of immunogenic epitopes of a protein is generally less than the number of antigenic epitopes. See for example Geysen et al., Proc. Nati Acad. Sci. USA 81: 3998-4002 (1983). As for the selection of antigenic epitope-bearing peptides or polypeptides (i.e., containing a region of a protein molecule to which an antibody can be attached), it is well known in the art that relatively short synthetic peptides that mimic part of a protein sequence, they are capable of routinely causing an antiserum that reacts with the partially imitated protein. See, for example, Sutciiffe J.G., Shnnick T.M., Green N. and Learner R.A. (1983) "Antibodies that react with predetermined sites on proteins" Science 219: 660-666. Peptides capable of producing protein reactive serum are frequently represented in the primary sequence of a protein; they can be characterized by a series of simple chemical rules, and they are not confined to immunodominant regions of intact proteins (ie, immunogenic epitopes) or amino or carboxyl terminals. Therefore, antigenic epitope-bearing peptides and polypeptides are useful for developing antibodies, including monoclonal antibodies that bind to a TR4 polypeptide of the invention. See, for example, Wilson et al., Cell 37: 767-778 (1984) p. 777. Peptides and polypeptides carrying antigenic epitope preferably contain a sequence of at least seven, preferably at least nine, and preferably between at least about 15 and 30 amino acids, contained within the amino acid sequence of SEQ ID. NO: 1. The antibodies of the invention can be linked to one or more antigenic TR4 polypeptides or peptides, including without limitation: a polypeptide comprising the amino acid residues 32 to 92, approximately, of SEQ ID NO: 1, a polypeptide comprising the residues of amino acid 114 to 160, approximately, of SEQ ID NO: 1; a polypeptide comprising amino acid residues 169 to 240, approximately, of SEQ ID NO: 1; a polypeptide comprising the amino acid residues 267 to 298, approximately, of SEQ ID NO: 1; a polypeptide comprising the amino acid residues 330 to 364, approximately, of SEQ ID NO: 1; a polypeptide comprising the amino acid residues 391 to 404, approximately, of SEQ ID NO: 1; or a polypeptide comprising the amino acid residues 418 to 465, approximately, of SEQ ID NO: 1. In this context, "approximately" includes the scale particularly cited, greater or lesser by several amino acids (5, 4, 3, 2, or 1), at either end or both. As indicated above, the inventors have determined that the above polypeptide fragments are antigenic regions of the TR4 protein. Epitope-bearing TR4 peptides and polypeptides can be produced by any conventional means: Houghten RA, "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody nteraction at the level of individual amino acids, "Proc. Nati Acad. Sci. USA 82: 5131-5135 (1985). This process of "simultaneous synthesis of multiple peptides (SMPS)" is further described in the patent of E.U.A. No. 4,631, 2 1, by Houghten et al. (1986). As will be appreciated by the person skilled in the art, the TR4 polypeptides and their epitope-bearing fragments, described herein (for example, corresponding to a portion of the extracellular domain, such as, for example, amino acid residues 1 to 240 of SEQ ID NO: 1 ) can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increase in the half-life in vivo. This has been shown, for example, in chimeric proteins consisting of the first two domains of the human CD4 polypeptide and several domains of the constant regions of the heavy and light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al., Nature 331: 84-86 (1988)). Fusion proteins having a disulfide linked dimeric structure due to the IgG part may also be more efficient for the binding and neutralization of other molecules than monomeric TR4 protein alone or a fragment thereof (Fountoulakis et al., J Biochem 270: 3958-3964 (1995)). In this manner, the antibodies of the invention can be linked to fusion proteins comprising either a whole TR4 polypeptide such as TR4 or a portion thereof. Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins" including substitutions, deletions or additions of single or multiple amino acids, or fusion proteins. Such modified polypeptides may show, for example, greater activity or greater stability. In addition, they can be purified in high yields and show greater solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions. The antibodies of the present invention can also bind to said TR4 polypeptides or modified TR4 polypeptide fragments or their variants. For example, for many proteins, including the extracellular domain of a membrane-associated protein, or the mature form or forms of a secreted protein, it is known that one or more amino acids can be deleted from the N-terminus or the C-terminus without substantial loss of protein. biological function or loss of binding capacity with a specific antibody. For example, Ron et al., J. Biol. Chem., 268: 2984-2988 (1993), reported modified KGF proteins that had heparin binding activity even lacking 3, 8 or 27 amino-terminal amino acid residues. In the present case, since TR4 is a member of the family of death domain containing receptor polypeptides (DDCR), deletions of N-terminal amino acids to the cysteine residue at position 109 of SEQ ID NO: 1, may retain some biological activity such as the ability to induce apoptosis. It would be expected that the polypeptides having more N-terminal deletions including the cysteine residue in position 109 (C-109) in SEQ ID NO: 1, do not retain said biological activities because this residue is conserved among the members of the family and it may be required to form a disulfide bridge to give structural stability, which is necessary for ligand binding. However, even if the deletion of one or more amino acids from the N-terminus of a protein results in the modification or loss of one or more biological functions of the protein, other functional activities can still be retained (for example, biological activities, to multimerize, the ability to bind ligand TR4 (eg, TRAIL)). For example, the ability of shortened TR4 polypeptides to induce or bind antibodies that recognize full or mature forms of TR4 polypeptides will generally be retained when almost the majority of the complete or mature polypeptide residues are removed from the N-terminus. One can easily determine whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains said immunological activities, by means of the routine methods described herein and that are otherwise known in the art. It is likely that a TR4 polypeptide with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activity. In fact, peptides composed of six amino acid residues of TR4 can often elicit an immune response. Accordingly, the present invention further provides antibodies that bind to polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence TR4 of SEQ ID NO: 1, to the serine residue at position number 463, and the polynucleotides encoding said polypeptides. In particular, the present invention provides antibodies that bind to polypeptides comprising the amino acid sequence of residues n1-468 of SEQ ID NO: 1, wherein n1 is an integer from 2 to 463, corresponding to the residue position of amino acid in SEQ ID NO: 1. More particularly, the invention provides antibodies that bind to polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues from A-2 to E-468; P-3 to E-468; P-4 to E-468; P-5 to E-468; A-6 to E-468; R-7 to E-468; V-8 to E-468; H-9 to E-468; L-10 to E-468; G-11 to E-468; A-12 to E-468; F-13 to E-468; L-14 to E-468; A- 5 to E-468; V-16 to E-468; T-17 to E-468; P-18 to E-468; N-19 to E-468; P-20 to E-468; G-21 to E-468; S-22 to E-468; A-23 to E-468; A-24 to E-468; S-25 to E-468; G-26 to E-468; T-27 to E-468; E-28 to E-468; A-29 to E-468; A-30 to E-468; A-3 to E-468; A-32 to E-468; T-33 to E-468; P-34 to E-468; S-35 to E-468; K-36 to E-468; V-37 to E-468; W-38 to E-468; G-39 to E-468; S-40 to E-468; S-4 to E-468; A-42 to E-468; G-43 to E-468; R-44 to E-468; I-45 to E-468; E-46 to E-468; P-47 to E-468; R-48 to E-468; G-49 to E-468; G-50 to E-468; G-51 to E-468; R-52 to E-468; G-53 to E-468; A-54 to E-468; L-55 to E-468; P-56 to E-468; T-57 to E-468; S-58 to E-468; M-59 to E-468; G-60 to E-468; Q-61 to E-468; H-62 to E-468; G-63 to E-468; P-64 to E-468; S-65 to E-468; A-66 to E-468; R-67 to E-468; A-68 to E-468; R-69 to E-468; A-70 to E-468; G-71 to E-468; R-72 to E-468; A-73 to E-468; P-74 to E-468; G-75 to E-468; P-76 to E-468; R-77 to E-468; P-78 to E-468; A-79 to E-468; R-80 to E-468; E-81 to E-468; A-82 to E-468; S-83 to E-468; P-84 to E-468; R-85 to E-468; L-86 to E-468; R-87 to E-468; V-88 to E-468; H-89 to E-468; K-90 to E-468; T-91 to E-468; F-92 to E-468; K-93 to E-468; F-94 to E-468; V-95 to E-468; V-96 to E-468; V-97 to E-468; G-98 to E-468; V-99 to E-468; L-100 to E-468; L-101 to E-468; Q-102 to E-468; V-103 to E-468; V- 04 to E-468; P-105 to E-468; S-106 to E-468; S-107 to E-468; A-108 to E-468; A-109 to E-468; T-110 to E-468; 1-1 1 1 to E-468; K-112 to E-468; L-113 to E-468; H-114 to E-468; D-115 to E-468; Q-116 to E-468; S-1 17 to E-468; 1- 18 to E-468; G-1 19 to E-468; T-120 to E-468; Q-121 to E-468; Q-122 to E-468; W-123 to E-468; E-124 to E-468; H-125 to E-468; S-126 to E-468; P-127 to E-468; L-128 to E-468; G-129 to E-468; E-130 to E-468; L-131 to E-468; C-132 to E-468; P-133 to E-468; P-134 to E-468; G-135 to E-468; S-136 to E-468; H-137 to E-468; R-138 to E-468; S-139 to E-468; E- 40 to E-468; R-141 to E-468; P-142 to E-468; G-143 to E-468; A-144 to E-468; C-145 to E-468; N-146 to E-468; R-147 to E-468; C-148 to E-468; T-149 to E-468; E-150 to E-468; G-151 to E-468; V-152 to E-468; G- 53 to E-468; Y-154 to E-468; T-155 to E-468; N- 56 to E-468; A-157 to E-468; S-158 to E-468; N-159 to E-468; N-160 to E-468; L-161 to E-468; F-162 to E-468; A-163 to E-468; C-164 to E-468; L-165 to E-468; P-166 to E-468; C-167 to E-468; T- 68 to E-468; A-169 to E-468; C-170 to E-468; K-171 to E-468; S-172 to E-468; D-173 to E-468; E-174 to E-468; E-175 to E-468; E-176 to E-468; R-177 to E-468; S-178 to E-468; P- 79 to E-468; C-180 to E-468; T-181 to E-468; T-182 to E-468; T-183 to E-468; R-184 to E-468; N-185 to E-468; T-186 to E-468; A-187 to E-468; C-188 to E-468; Q-189 to E-468; C-190 to E-468; K- 91 to E-468; P-192 to E-468; G-193 to E-468; T-194 to E-468; F-195 to E-468; R-196 to E-468; N-197 to E-468; D-198 to E-468; N-199 to E-468; S-200 to E-468; A-201 to E-468; E-202 to E-468; M-203 to E-468; C-204 to E-468; R-205 to E-468; K-206 to E-468; C-207 to E-468; S-208 to E-468; T-209 to E-468; G-2 0 to E-468; C-21 1 to E-468; P-212 to E-468; R-213 to E-468; G-214 to E- 468; M-215 to E-468; V-216 to E-468; K-217 to E-468; V-218 to E-468; K-219 to E-468; D-220 to E-468; C-221 to E-468; T-222 to E-468; P-223 to E-468; W-224 to E-468; S-225 to E-468; D-226 to E-468; I-227 to E-468; E-228 to E-468; C-229 to E-468; V-230 to E-468; H-231 to E-468; K-232 to E-468; E-233 to E-468; S-234 to E-468; G-235 to E-468; N-236 to E-468; G-237 to E-468; H-238 to E-468; N-239 to E-468; I-240 to E-468; W-241 to E-468; V-242 to E-468; I-243 to E-468; L-244 to E-468; V-245 to E-468; V-246 to E-468; T-247 to E-468; L-248 to E-468; V-249 to E-468; V-250 to E-468; P-251 to E-468; L-252 to E-468; L-253 to E-468; L-254 to E-468; V-255 to E-468; A-256 to E-468; V-257 to E-468; L-258 to E-468; I-259 to E-468; V-260 to E-468; C-26 to E-468; C-262 to E-468; C-263 to E-468; I-264 to E-468; G-265 to E-468; S-266 to E-468; G-267 to E-468; C-268 to E-468; G-269 to E-468; G-270 to E-468; D-271 to E-468; P-272 to E-468; K-273 to E-468; C-274 to E-468; M-275 to E-468; D-276 to E-468; R-277 to E-468; V-278 to E-468; C-279 to E-468; F-280 to E-468; W-281 to E-468; R-282 to E-468; L-283 to E-468; G-284 to E-468; L-285 to E-468; L-286 to E-468; R-287 to E-468; G-288 to E-468; P-289 to E-468; G-290 to E-468; A-291 to E-468; E-292 to E-468; D-293 to E-468; N-294 to E-468; A-295 to E-468; H-296 to E-468; N-297 to E-468; E-298 to E-468; I-299 to E-468; L-300 to E-468; S-301 to E-468; N-302 to E-468; A-303 to E-468; D-304 to E-468; S-305 to E-468; L-306 to E-468; S-307 to E-468; T-308 to E-468; F-309 to E-468; V-310 to E-468; S-311 to E-468; E-312 to E-468; Q-313 to E-468; Q-3 4 to E-468; M-315 to E-468; E-3 6 to E-468; S-317 to E-468; Q-318 to E-468; E-319 to E-468; P-320 to E-468; A-321 to E-468; D-322 to E-468; L-323 to E-468; T-324 to E-468; G-325 to E-468; V-326 to E-468; T-327 to E-468; V-328 to E-468; Q-329 to E-468; S-330 to E-468; P-331 to E-468; G-332 to E-468; E-333 to E-468; A-334 to E-468; Q-335 to E-468; C-336 to E-468; L-337 to E-468; L-338 to E-468; G-339 to E-468; P-340 to E-468; A-341 to E-468; E-342 to E-468; A-343 to E-468; E-344 to E-468; G-345 to E-468; S-346 to E-468; Q-347 to E-468; R-348 to E-468; R-349 to E-468; R-350 to E-468; L-351 to E-468; L-352 to E-468; V-353 to E-468; P-354 to E-468; A-355 to E-468; N-356 to E-468; G-357 to E-468; A-358 to E-468; D-359 to E-468; P-360 to E-468; T-361 to E-468; E-362 to E-468; T-363 to E-468; L-364 to E-468; M-365 to E-468; L-366 to E-468; F-367 to E-468; F-368 to E-468; D-369 to E-468; K-370 to E-468; F-371 to E-468; A-372 to E-468; N-373 to E-468; I-374 to E-468; V-375 to E-468; P-376 to E-468; F-377 to E-468; D-378 to E-468; S-379 to E-468; W-380 to E-468; D-381 to E-468; Q-382 to E-468; L-383 to E-468; M-384 to E-468; R-385 to E-468; Q-386 to E-468; L-387 to E-468; D-388 to E-468; L-389 to E-468; T-390 to E-468; K-391 to E-468; N-392 to E-468; E-393 to E-468; I-394 to E-468; D-395 to E-468; V-396 to E-468; V-397 to E-468; R-398 to E-468; A-399 to E-468; G-400 to E-468; T-401 to E-468; A-402 to E-468; G-403 to E-468; P-404 to E-468; G-405 to E-468; D-406 to E-468; A-407 to E-468; L-408 to E-468; Y-409 to E-468; A-410 to E-468; -41 1 to E-468; L-412 to E-468; M-413 to E-468; K-414 to E-468; W-415 to E-468; V-416 to E-468; N-417 to E-468; K-418 to E-468; T-419 to E-468; G-420 to E-468; R-421 to E-468; N-422 to E-468; A-423 to E-468; S-424 to E-468; I-425 to E-468; H-426 to E-468; T-427 to E-468; L-428 to E-468; L-429 to E-468; D-430 to E-468; A-431 to E-468; L-432 to E-468; E-433 to E-468; R-434 to E-468; -435 to E-468; E-436 to E-468; E-437 to E-468; R-438 to E-468; H-439 to E-468; A-440 to E-468; K-441 to E-468; E-442 to E-468; K-443 to E-468; I-444 to E-468; Q-445 to E-468; D-446 to E-468; L-447 to E-468; L-448 to E-468; V-449 to E-468; D-450 to E-468; S-451 to E-468; G-452 to E-468; K-453 to E-468; F-454 to E-468; I-455 to E-468; Y-456 to E-468; L-457 to E-468; E-458 to E-468; D-459 to E-468; G-460 to E-468; T-461 to E-468; G-462 to E-468; or S-463 to E-468 of the sequence of TR4 of SEQ ID N0: 1. In another embodiment, the N-terminal deletions of the TR4 polypeptide can be described with the general formula n2 to 238, wherein n2 is a number from 2 to 238, corresponding to the amino acid sequence identified in SEQ ID NO:. In specific embodiments, the antibodies of the invention bind to N-terminal deletions of the TR4 comprising, or alternatively consisting of, the amino acid sequence of the residues: A-2 to H-238; P-3 to H-238; P-4 to H-238; P-5 to H-238; A-6 to H-238; R-7 to H-238; V-8 to H-238; H-9 to H-238; L-10 to H-238; G-11 to H-238; A-12 to H-238; F-13 to H-238; L-14 to H-238; A-15 to H-238; V- 6 to H-238; T- 7 to H-238; P-18 to H-238; N-19 to H-238; P-20 to H-238; G-21 to H-238; S-22 to H-238; A-23 to H-238; A-24 to H-238; S-25 to H-238; G-26 to H-238; T-27 to H-238; E-28 to H-238; A-29 to H-238; A-30 to H-238; A-3 to H-238; A-32 to H-238; T-33 to H-238; P-34 to H-238; S-35 to H-238; K-36 to H-238; V-37 to H-238; W-38 to H-238; G-39 to H-238; S-40 to H-238; S-41 to H-238; A-42 to H-238; G-43 to H-238; R-44 to H-238; I-45 to H-238; E-46 to H-238; P-47 to H-238; R-48 to H-238; G-49 to H-238; G-50 to H-238; G-51 to H-238; R-52 to H-238; G-53 to H-238; A-54 to H-238; L-55 to H-238; P-56 to H-238; T-57 to H-238; S-58 to H-238; M-59 to H-238; G-60 to H-238; Q-61 to H-238; H-62 to H-238; G-63 to H-238; P-64 to H-238; S-65 to H-238; A-66 to H-238; R-67 to H-238; A-68 to H-238; R-69 to H-238; A-70 to H-238; G-71 to H-238; R-72 to H-238; A-73 to H-238; P-74 to H-238; G-75 to H-238; P-76 to H-238; R-77 to H-238; P-78 to H-238; A-79 to H-238; R-80 to H-238; E-81 to H-238; A-82 to H-238; S-83 to H-238; P-84 to H-238; R-85 to H-238; L-86 to H-238; R-87 to H-238; V-88 to H-238; H-89 to H-238; K-90 to H-238; T-91 to H-238; F-92 to H-238; K-93 to H-238; F-94 to H-238; V-95 to H-238; V-96 to H-238; V-97 to H-238; G-98 to H-238; V-99 to H-238; L-100 to H-238; L-101 to H-238; Q-102 to H-238; V-103 to H-238; V-104 to H-238; P-105 to H-238; S-106 to H-238; S-107 to H-238; A-108 to H-238; A-109 to H-238; T-1 10 to H-238; 1-1 1 1 to H-238; K-1 12 to H-238; L-1 13 to H-238; H-1 14 to H-238; D-115 to H-238; Q-116 to H-238; S-117 to H-238; 1-1 18 to H-238; G-119 to H-238; T-120 to H-238; Q-121 to H-238; Q-122 to H-238; W-123 to H-238; E-124 to H-238; H-125 to H-238; S-126 to H-238; P-127 to H-238; L-128 to H-238; G- 29 to H-238; E-130 to H-238; L-131 to H-238; C-132 to H-238; P-133 to H-238; P-134 to H-238; G-135 to H-238; S-136 to H-238; H-137 to H-238; R-138 to H-238; S-139 to H-238; E-140 to H-238; R-141 to H-238; P-142 to H-238; G-143 to H-238; A-144 to H-238; C-145 to H-238; N-146 to H-238; R-147 to H-238; C-148 to H-238; T-149 to H-238; E-150 to H-238; G-151 to H-238; V-152 to H-238; G-153 to H-238; Y-154 to H-238; T-155 to H-238; N-156 to H-238; A-157 to H-238; S-158 to H-238; N-159 to H-238; N-160 to H-238; L-161 to H-238; F-162 to H-238; A-163 to H-238; C-164 to H-238; L- 65 to H-238; P-166 to H-238; C-67 to H-238; T-168 to H-238; A-169 to H-238; C- 70 to H-238; K-171 to H-238; S-172 to H-238; D-173 to H-238; E- 74 to H-238; E- 175 to H-238; E-176 to H-238; R-177 to H-238; S-178 to H-238; P-179 to H-238; C-180 to H-238; T-181 to H-238; T-182 to H-238; T-183 to H-238; R-184 to H-238; N-185 to H-238; T-186 to H-238; A-187 to H-238; C-188 to H-238; Q-189 to H-238; C-190 to H-238; K-191 to H-238; P-192 to H-238; G-193 to H-238; T-194 to H-238; F-195 to H-238; R-196 to H-238; N-197 to H-238; D-198 to H-238; N-199 to H-238; S-200 to H-238; A-20 to H-238; E-202 to H-238; -203 to H-238; C-204 to H-238; R-205 to H-238; K-206 to H-238; C-207 to H-238; S-208 to H-238; T-209 to H-238; G-210 to H-238; C-211 to H-238; P-212 to H-238; R-213 to H-238; G-214 to H-238; -215 to H-238; V-216 to H-238; K-217 to H-238; V-218 to H-238; K-219 to H-238; D-220 to H-238; C-221 to H-238; T-222 to H-238; P-223 to H-238; W-224 to H-238; S-225 to H-238; D-226 to H-238; I-227 to H-238; E-228 to H-238; C-229 to H-238; V-230 to H-238; H-23 to H-238; K-232 to H-238; or E-233 to H-238; of the extracellular domain sequence of TR4 of SEQ ID NO: 1. As mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in the modification or loss of one or more biological functions of the protein, other functional activities (eg, biological activities) can still be retained, the ability to multimerize, the ability to bind to the DR4 ligand (eg, TRAIL)). For example, the ability of the shortened TR4 polypeptide to induce or bind antibodies that recognize the full or mature forms of the TR4 polypeptide will generally be retained when almost the majority of the complete or mature polypeptide residues are removed from the C-terminus. It can be easily determined if a particular polypeptide lacking C-terminal residues of a complete polypeptide retains said immunological activities, by means of the routine methods described herein and which are otherwise known in the art. It is likely that a TR4 polypeptide with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activity. In fact, peptides composed of six amino acid residues of TR4 can often elicit an immune response. Accordingly, the present invention further provides antibodies that bind to polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the TR4 polypeptide of SEQ ID NO: 1, up to the alanine residue in the number position 30, and the polynucleotides encoding said polypeptides. In particular, the present invention provides antibodies that bind to polypeptides comprising the amino acid sequence of residues 24-m1 of SEQ ID NO: 1, wherein m is an integer from 30 to 467, corresponding to the position of the residue of amino acid in SEQ ID NO: 1. More particularly, the invention provides antibodies that bind to polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues A-24 to L-467; A-24 to S-466; A-24 to V-465; A-24 to A-464; A-24 to S-463; A-24 to G-462; A-24 to T-461; A-24 to G-460; A-24 to D-459; A-24 to E-458; A-24 to L-457; A-24 to Y-456; A-24 to I-455; A-24 to F-454; A-24 to K-453; A-24 to G-452; A-24 to S-45; A-24 to D-450; A-24 to V-449; A-24 to L-448; A-24 to L-447; A-24 to D-446; A-24 to Q-445; A-24 to I-444; A-24 to K-443; A-24 to E-442; A-24 to K-441; A-24 to A-440; A-24 to H-439; A-24 to R-438; A-24 to E-437; A-24 to E-436; A-24 to M-435; A-24 to R-434; A-24 to E-433; A-24 to L-432; A-24 to A-431; A-24 to D-430; A-24 to L-429; A-24 to L-428; A-24 to T-427; A-24 to H-426; A-24 to I-425; A-24 to S-424; A-24 to A-423; A-24 to N-422; A-24 to R-421; A-24 to G-420; A-24 to T-419; A-24 to K-418; A-24 to N-417; A-24 to V-416; A-24 to W-4 5; A-24 to K-414; A-24 to M-413; A-24 to L-412; A-24 to M-411; A-24 to A-4 0; A-24 to Y-409; A-24 to L-408; A-24 to A-407; A-24 to D-406; A-24 to G-405; A-24 to P-404; A-24 to G-403; A-24 to A-402; A-24 to T-401; A-24 to G-400; A-24 to A-399; A-24 to R-398; A-24 to V-397; A-24 to V-396; A-24 to D-395; A-24 to I-394; A-24 to E-393; A-24 to N-392; A-24. to K-391; A-24 to T-390; A-24 to L-389; A-24 to D-388; A-24 to L-387; A-24 to Q-386; A-24 to R-385; A-24 to M-384; A-24 to L-383; A-24 to Q-382; A-24 to D-381; A-24 to W-380; A-24 to S-379; A-24 to D-378; A-24 to F-377; A-24 to P-376; A-24 to V-375; A-24 to [-374; A-24 to N-373; A-24 to A-372; A-24 to F-37; A-24 to K-370; A-24 to D-369; A-24 to F-368; A-24 to F-367; A-24 to L-366; A-24 to M-365; A-24 to L-364; A-24 to T-363; A-24 to E-362; A-24 to T-361; A-24 to P-360; A-24 to D-359; A-24 to A-358; A-24 to G-357; A-24 to N-356; A-24 to A-355; A-24 to P-354; A-24 to V-353; A-24 to L-352; A-24 to L-351; A-24 to R-350; A-24 to R-349; A-24 to R-348; A-24 to Q-347; A-24 to S-346; A-24 to G-345; A-24 to E-344; A-24 to A-343; A-24 to E-342; A-24 to A-341; A-24 to P-340; A-24 to G-339; A-24 to L-338; A-24 to L-337; A-24 to C-336; A-24 to Q-335; A-24 to A-334; A-24 to E-333; A-24 to G-332; A-24 to P-33; A-24 to S-330; A-24 to Q-329; A-24 to V-328; A-24 to T-327; A-24 to V-326; A-24 to G-325; A-24 to T-324; A-24 to L-323; A-24 to D-322; A-24 to A-321; A-24 to P-320; A-24 to E-319; A-24 to Q-318; A-24 to S-317; A-24 to E-316; A-24 to -315; A-24 to Q-314; A-24 to Q-313; A-24 to E-312; A-24 to S-3 1; A-24 to V-310; A-24 to F-309; A-24 to T-308; A-24 to S-307; A-24 to L-306; A-24 to S-305; A-24 to D-304; A-24 to A-303; A-24 to N-302; A-24 to S-301; A-24 to L-300; A-24 to [-299; A-24 to E-298; A-24 to N-297; A-24 to H-296; A-24 to A-295; A-24 to N-294; A-24 to D-293; A-24 to E-292; A-24 to A-291; A-24 to G-290; A-24 to P-289; A-24 to G-288; A-24 to R-287; A-24 to L-286; A-24 to L-285; A-24 to G-284; A-24 to L-283; A-24 to R-282; A-24 to W-281; A-24 to F-280; A-24 to C-279; A-24 to V-278; A-24 to R-277; A-24 to D-276; A-24 to M-275; A-24 to C-274; A-24 to -273; A-24 to P-272; A-24 to D-271; A-24 to G-270; A-24 to G-269; A-24 to C-268; A-24 to G-267; A-24 to S-266; A-24 to G-265; A-24 to I-264; A-24 to C-263; A-24 to C-262; A-24 to C-261; A-24 to V-260; A-24 to I-259; A-24 to L-258; A-24 to V-257; A-24 to A-256; A-24 to V-255; A-24 to L-254; A-24 to L-253; A-24 to L-252; A-24 to P-251; A-24 to V-250; A-24 to V-249; A-24 to L-248; A-24 to T-247; A-24 to V-246; A-24 to V-245; A-24 to L-244; A-24 to I-243; A-24 to V-242; A-24 to W-241; A-24 to I-240; A-24 to N-239; A-24 to H-238; A-24 to G-237; A-24 to N-236; A-24 to G-235; A-24 to S-234; A-24 to E-233; A-24 to K-232; A-24 to H-231; A-24 to V-230; A-24 to C-229; A-24 to E-228; A-24 to 1-227; A-24 to D-226; A-24 to S-225; A-24 to W-224; A-24 to P-223; A-24 to T-222; A-24 to C-22; A-24 to D-220; A-24 to K-219; A-24 to V-218; A-24 to K-217; A-24 to V-2 6; A-24 to M-215; A-24 to G-214; A-24 to R-213; A-24 to P-212; A-24 to C-211; A-24 to G-210; A-24 to T-209; A-24 to S-208; A-24 to C-207; A-24 to K-206; A-24 to R-205; A-24 to C-204; A-24 to M-203; A-24 to E-202; A-24 to A-201; A-24 to S-200; A-24 to N-199; A-24 to D-198; A-24 to N-197; A-24 to R-196; A-24 to F-195; A-24 to T-194; A-24 to G-193; A-24 to P-192; A-24 to K-191; A-24 to C-190; A-24 to Q-189; A-24 to C-188; A-24 to A-187; A-24 to T-186; A-24 to N-185; A-24 to R-184; A-24 to T-183; A-24 to T-182; A-24 to T-181; A-24 to C-180; A-24 to P-179; A-24 to S-78; A-24 to R-177; A-24 to E-76; A-24 to E-175; A-24 to E-174; A-24 to D-173; A-24 to S-172; A-24 to K-171; A-24 to C-170; A-24 to A-169; A-24 to T-168; A-24 to C-167; A-24 to P-166; A-24 to L-165; A-24 to C-164; A-24 to A-163; A-24 to F- 62; A-24 to L-161; A-24 to N-160; A-24 to N-159; A-24 to S-158; A-24 to A-157; A-24 to N- 56; A-24 to T-155; A-24 to Y-154; A-24 to G-153; A-24 to V- 52; A-24 to G-151; A-24 to E-150; A-24 to T-149; A-24 to C-148; A-24 to R-47; A-24 to N-146; A-24 to C-145; A-24 to A- 44; A-24 to G-143; A-24 to P-142; A-24 to R-41; A-24 to E-140; A-24 to S-139; A-24 to R-138; A-24 to H-137; A-24 to S-136; A-24 to G-135; A-24 to P-134; A-24 to P-133; A-24 to C-132; A-24 to L-131; A-24 to E-130; A-24 to G-129; A-24 to L-128; A-24 to P-127; A-24 to S-126; A-24 to H-125; A-24 to E-24; A-24 to W- 23; A-24 to Q- 22; A-24 to Q-2; A-24 to T-20; A-24 to G-119; A-24 to 1-118; A-24 to S- 7; A-24 to Q-1 16; A-24 to D-1 15; A-24 to H-114; A-24 to L-113; A-24 to K-1 12; A-24 to 1-1 1 1; A-24 to T-110; A-24 to A-109; A-24 to A-08; A-24 to S-107; A-24 to S-106; A-24 to P-05; A-24 to V-104; A-24 to V-103; A-24 to Q-102; A-24 to L-101; A-24 to L-100; A-24 to V-99; A-24 to G-98; A-24 to V-97; A-24 to V-96; A-24 to V-95; A-24 to F-94; A-24 to K-93; A-24 to F-92; A-24 to T-91; A-24 to K-90; A-24 to H-89; A-24 to V-88; A-24 to R-87; A-24 to L-86; A-24 to R-85; A-24 to P-84; A-24 to S-83; A-24 to A-82; A-24 to E-81; A-24 to R-80; A-24 to A-79; A-24 to P-78; A-24 to R-77; A-24 to P-76; A-24 to G-75; A-24 to P-74; A-24 to A-73; A-24 to R-72; A-24 to G-71; A-24 to A-70; A-24 to R-69; A-24 to A-68; A-24 to R-67; A-24 to A-66; A-24 to S-65; A-24 to P-64; A-24 to G-63; A-24 to H-62; A-24 to Q-61; A-24 to G-60; A-24 to M-59; A-24 to S-58; A-24 to T-57; A-24 to P-56; A-24 to L-55; A-24 to A-54; A-24 to G-53; A-24 to R-52; A-24 to G-51; A-24 to G-50 50; A-24 to G-49; A-24 to R-48; A-24 to P-47; A-24 to E-46; A-24 to I-45; A-24 to R-44; A-24 to G-43; A-24 to A-42; A-24 to S-41; A-24 to S-40; A-24 to G-39; A-24 to W-38; A-24 to V-37; A-24 to K-36; A-24 to S-35; A-24 to P-34; A-24 to T-33; A-24 to A-32; A-24 to A-31; or A-24 to A-30 of the sequence TR4 of SEQ ID NO: 1. In another embodiment, the antibodies of the invention bind to C-terminal deletions of the TR4 polypeptide which can be described with the general formula 24-m2, wherein m2 is a number from 30 to 238, corresponding to the amino acid sequence identified in SEQ ID NO: 1. In specific embodiments, the invention provides antibodies that bind to TR4 polypeptides comprising, or alternatively consisting of, the amino acid sequence of the residues: A-24 to G-237; A-24 to N-236; A-24 to G-235; A-24 to S-234; A-24 to E-233; A-24 to K-232; A-24 to H-231; A-24 to V-230; A-24 to C-229; A-24 to E-228; A-24 to I-227; A-24 to D-226; A-24 to S-225; A-24 to W-224; A-24 to P-223; A-24 to T-222; A-24 to C-221; A-24 to D-220; A-24 to K-219; A-24 to V-218; A-24 to K-217; A-24 to V-216; A-24 to M-215; A-24 to G-214; A-24 to R-213; A-24 to P-212; A-24 to C-2 1; A-24 to G-210; A-24 to T-209; A-24 to S-208; A-24 to C-207; A-24 to K-206; A-24 to R-205; A-24 to C-204; A-24 to M-203; A-24 to E-202; A-24 to A-201; A-24 to S-200; A-24 to N-199; A-24 to D-198; A-24 to N-197; A-24 to R-196; A-24 to F-195; A-24 to T-194; A-24 to G-193; A-24 to P-192; A-24 to K-191; A-24 to C-190; A-24 to Q-189; A-24 to C-188; A-24 to A-187; A-24 to T-186; A-24 to N-185; A-24 to R-184; A-24 to T-183; A-24 to T-182; A 24 to T-18; A-24 to C-180; A-24 to P-179; A-24 to S-178; A-24 to R- 77; A-24 to E-176; A-24 to E-175; A-24 to E-174; A-24 to D-173; A-24 to S-172; A-24 to K-171; A-24 to C-170; A-24 to A-169; A-24 to T-168; A-24 to C-167; A-24 to P-166; A-24 to L-165; A-24 to C-164; A-24 to A-163; A-24 to F-162; A-24 to L-161; A-24 to N-160; A-24 to N-159; A-24 to S-158; A-24 to A-157; A-24 to N-156; A-24 to T-155; A-24 to Y-154; A-24 to G-153; A-24 to V-152; A-24 to G-151; A-24 to E-150; A-24 to T-149; A-24 to C-148; A-24 to R-147; A-24 to N-146; A-24 to C-145; A-24 to A-144; A-24 to G-143; A-24 to P-142; A-24 to R-14; A-24 to E-140; A-24 to S-139; A-24 to R-138; A-24 to H-137; A-24 to S-136; A-24 to G-135; A-24 to P-134; A-24 to P-133; A-24 to C-132; A-24 to L-131; A-24 to E-130; A-24 to G-129; A-24 to L-128; A-24 to P-127; A-24 to S-126; A-24 to H-125; A-24 to E-124; A-24 to W-123; A-24 to Q-122; A-24 to Q-121; A-24 to T-120; A-24 to G-119; A-24 to I-1 18; A-24 to S-17; A-24 to Q-1 16; A-24 to D-115; A-24 to H-114; A-24 to L-113; A-24 to K-112; A-24 to 1-1 11; A-24 to T-1 10; A-24 to A-109; A-24 to A-108; A-24 to S-107; A-24 to S-106; A-24 to P-105; A-24 to V-104; A-24 to V-103; A-24 to Q-102; A-24 to L-101; A-24 to L-100; A-24 to V-99; A-24 to G-98; A-24 to V-97; A-24 to V-96; A-24 to V-95; A-24 to F-94; A-24 to K-93; A-24 to F-92; A-24 to T-91; A-24 to K-90; A-24 to H-89; A-24 to V-88; A-24 to R-87; A-24 to L-86; A-24 to R-85; A-24 to P-84; A-24 to S-83; A-24 to A-82; A-24 to E-81; A-24 to R-80; A-24 to A-79; A-24 to P-78; A-24 to R-77; A-24 to P-76; A-24 to G-75; A-24 to P-74; A-24 to A-73; A-24 to R-72; A-24 to G-71; A-24 to A-70; A-24 to R-69; A-24 to A-68; A-24 to R-67; A-24 to A-66; A-24 to S-65; A-24 to P-64; A-24 to G-63; A-24 to H-62; A-24 to Q-6; A-24 to G-60; A-24 to M-59; A-24 to S-58; A-24 to T-57; A-24 to P-56; A-24 to L-55; A-24 to A-54; A-24 to G-53; A-24 to R-52; A-24 to G-51; A-24 to G-50; A-24 to G-49; A-24 to R-48; A-24 to P-47; A-24 to E-46; A-24 to I-45; A-24 to R-44; A-24 to G-43; A-24 to A-42; A-24 to S-41; A-24 to S-40; A-24 to G-39; A-24 to W-38; A-24 to V-37; A-24 to K-36; A-24 to S-35; A-24 to P-34; A-24 to T-33; A-24 to A-32; A-24 to A-3; or A-24 to A-30; of the extracellular domain sequence of TR4 of SEQ ID NO: 1. The present invention further provides antibodies that bind to polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of the TR4 polypeptide of SEQ ID NO: 1 to C-221 of SEQ ID NO: 1. In particular, the present invention provides antibodies that bind to polypeptides having the amino acid sequence of the 1-m9 residues of the amino acid sequence of SEQ ID NO: 1, where m9 is any integer on the scale of 221-468. and the residue C-221 is the position of the first C-terminal residue of the complete TR4 polypeptide (shown in SEQ ID NO: 1) which is believed to be necessary for the receptor binding activity of the TR4 protein. The invention also provides antibodies that bind to polypeptides having one or more amino acids deleted from both the amino terminus and the carboxyl terminus of a TR4 polypeptide, which can be described in general because they have the residues n -m1 or n2-m2 of the SEQ ID NO: 1, where n1, n2, my m2 are integers like those described above. Also included are antibodies that bind to a polypeptide consisting of a portion of the complete amino acid sequence of TR4 encoded by the cDNA clone contained in deposit ATCC No. 97853, wherein this portion excludes from 1 to about 108 amino acids of the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in the ATCC deposit No. 97853, or from 1 to about 247 amino acids of the carboxy terminus, or any combination of the aforementioned terminal amino and carboxy terminal deletions of the complete amino acid sequence encoded by the cDNA clone contained in the ATCC deposit No. 97853. Preferably, the antibodies of the present invention bind to TR4 fragments comprising a portion of the extracellular domain; that is, within residues 24-238 of SEQ ID NO: 1, since it is expected that any portion in that stretch will be soluble. It will be recognized that part of the amino acid sequence of TR4 can be varied without significantly affecting the structure or function of the protein. If such sequence differences are contemplated, it must be remembered that there will be critical areas on the protein that determine the activity. Such areas will usually comprise residues that form the ligand binding site or the death domain, or which form tertiary structures that affect these domains.

Thus, the invention further includes antibodies that bind to variants of the TR4 protein that show substantial activity of TR4 protein or that include TR4 regions such as the protein fragments discussed below. These mutants include deletions, insertions, inversions, repetitions and substitutions of type. A guide can be found which deals with amino acid changes that are likely to be phenotypically silent in Bowie, J. U. et al., Science 247: 1306-1310 (1990). In this manner, the antibodies of the present invention can be linked to a fragment, derivative or analogue of the polypeptide of SEQ ID NO: 1, or of the one encoded by the cDNA with deposit No. ATCC 97853. Said fragments, vandals or derivatives they may be (i) one in which at least one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably one or more conserved amino acid residues), and preferably at least one but less than ten conserved amino acid residues), and said amino acid residue substituent may or may not be encoded by the genetic code, or (ii) one in which one or more of the amino acid residues include a substituent group, or (iii) one in which the mature polypeptide is fused to another compound, for example a compound to increase the half-life of the polypeptide (e.g. polyethylene glycol), or (iv) one in which additional amino acids they are fused with the mature polypeptide, such as a peptide from the IgG and Fe fusion region, or a leader, or secretory sequence, or a sequence that is used to purify the mature polypeptide or a proprotein sequence. Such fragments, derivatives and the like are considered within the scope of those skilled in the art from the teachings herein. Of particular interest are substitutions of charged amino acids with other charged amino acids and with neutral or negatively charged amino acids. This results in proteins with reduced positive charge to improve the characteristics of the TR4 protein. The prevention of aggregation is very desirable. The aggregation of proteins not only results in a loss of activity, but can also be problematic when preparing pharmaceutical formulations because they can be immunogenic (Pinckard et al., Clin Exp. Immunol., 2: 331-340 (1967).; Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10: 307-377 (1993)). Amino acid replacement can also change the selectivity of binding to cell surface receptors. Ostade et al., Nature 361: 266-268 (1993), disclose some mutations that result in the selective binding of TNF-alpha alone with one of the two known types of TNF receptors. In this manner, the antibodies of the present invention can bind to a TR4 receptor that contains one or more amino acid substitutions, deletions or additions, either natural or human manipulative mutations. As indicated, the changes are preferably minor in nature, such as conservative amino acid substitutions that do not significantly affect the fold or activity of the protein (see Table 3, above). In specific embodiments, the number of substitutions, additions or deletions in the amino acid sequence of SEQ ID NO: 1 or in any of the polypeptide fragments described herein (for example the exctracellular domain or the intracellular domain), is 75 , 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 30-20, 20-15, 20- 10, 15-10, 10-1, 5-10, 1 -5, 1-3 or 1 -2. In specific embodiments, the antibodies of the invention bind to TR4 polypeptides or fragments or variants thereof (especially a fragment comprising or alternatively consisting of the soluble extracellular domain of TR4) that contain one or more of the following conservative mutations. in TR4: M1 replaced with A, G, I, L, S, T or V; A2 replaced with G, I, L, S, T, M or V; A6 replaced with G, I, L, S, T, M or V; R7 replaced with H or K; V8 replaced with A, G, I, L, S, T or M; H9 replaced with K or R; L10-replaced with A, G, I, S, T, M or V; G1 1 replaced with A, I, L, S, T, M or V; A12 replaced with G, I, L, S, T, M or V; F 3 replaced with W or Y; L14 replaced with A, G, I, S, T, M or V; A15 replaced with G, I, L, S, T, M or V; V16 replaced with A, G, I, L, S, T or M; T17 replaced with A, G, I, L, S, M or V; N19 replaced with Q; G21 replaced with A, I, L, S, T, M or V; S22 replaced with A, G, I, L, T, or V; A23 replaced with G, I, L, S, T, M or V; A24 replaced with G, I, L, S, T, M or V; S25 replaced with A, G, I, L, T, M or V; G26 replaced with A, I, L, S, T, M or V; T27 replaced with A, G, I, L, S, M or V; E28 replaced with D; A29 replaced with G, I, L, S, T, M or V; A30 replaced with G, I, L, S, T, M or V; A31 replaced with G, I, L, S, T, or V; A32 replaced with G, I, L, S, T, M or V; T33 replaced with A, G, I, L, S, M or V; S35 replaced with A, G, I, L, T, M or V; K36 replaced with H or R; V37 replaced with A, G, I, L, S, T or; W38 replaced with F or Y; G39 replaced with A, I, L, S, T, M or V; S40 replaced with A, G, I, L, T, M or V; S41 replaced with A, G, I, L, T, or V; A42 replaced with G, I, L, S, T, M or V; G43 replaced with A, I, L, S, T, M or V; R44 replaced with H or K; I45 replaced with A, G, L, S, T, M or V; E46 replaced with D; R48 replaced with H or K; G49 replaced with A, I, L, S, T, M or V; G50 replaced with A, I, L, S, T, M or V; G51 replaced with A, I, L, S, T, M or V; R52 replaced with H or K; G53 replaced with A, I, L, S, T, M or V; A54 replaced with G, I, L, S, T, M or V; L55 replaced with A, G, I, S, T, M or V; T57 replaced with A, G, I, L, S, M or V; S58 replaced with A, G, I, L, T, M or V; 59 replaced with A, G, I, L, S, T or V; G60 replaced with A, L, L, S, T, M or V; Q61 replaced with N; H62 replaced with K or R; G63 replaced with A, I, L, S, T, M or V; S65 replaced with A, G, I, L, T, M or V; A66 replaced with G, I, L, S, T, M or V; R67 replaced with H or K; A68 replaced with G, I, L, S, T, M or V; R69 replaced with H or K; A70 replaced with G, I, L, S, T, M or V; G71 replaced with A, I, L, S, T, or V; R72 replaced with H or K; A73 replaced with G, I, L, S, T, M or V; G75 replaced with A, I, L, S, T, M or V; R77 replaced with H or K; A79 replaced with G, I, L, S, T, M or V; R80 replaced with H or K; E81 replaced with D; A82 replaced with G, I, L, S, T, M or V; S83 replaced with A, G, I, L, T, M or V; R85 replaced with H or K; L86 replaced with A, G, I, S, T, M or V; R87 replaced with H or K; V88 replaced with A, G, I, L, S, T or M; H89 replaced with K or R; K90 replaced with H or R; T91 replaced with A, G, I, L, S, M or V; F92 replaced with W or Y; K93 replaced with H or R; F94 replaced with W or Y; V95 replaced with A, G, I, L, S, T or M; V96 replaced with A, G, I, L, S, T or M; V97 replaced with A, G, I, L, S, T or; G98 replaced with A, I, L, S, T, M or V; V99 replaced with A, G, I, L, S, T or M; L100 replaced with A, G, I, S, T, M or V; L101 replaced with A, G, I, S, T, M or V; Q102 replaced with N; V103 replaced with A, G, I, L, S, T or M; V104 replaced with A, G, I, L, S, T or M; S106 replaced with A, G, I, L, T, M or V; S107 replaced with A, G, I, L, T, M or V; A108 replaced with G, I, L, S, T, M or V; A109 replaced with G, I, L, S, T, M or V; T1 10 replaced with A, G, I, L, S, M or V; 1111 replaced with A, G, L, S, T, M or V; K1 12 replaced with H or R; L1 13 replaced with A, G, I, S, T, M or V; H114 replaced with K or R; D1 5 replaced with E; Q116 replaced with N; S117 replaced with A, G, I, L, T, M or V; 11 18 replaced with A, G, L, S, T, M or V; G119 replaced with A, I, L, S, T, M or V; T120 replaced with A, G, I, L, S, M or V; Q121 replaced with N; Q122 replaced with N; W 23 replaced with F or Y; E 24 replaced with D; H 25 replaced with K or R; S126 replaced with A, G, I, L, T, M or V; L128 replaced with A, G, I, S, T, M or V; G129 replaced with A, I, L, S, T, M or V; E130 replaced with D; L131 replaced with A, G, I, S, T, or V; G135 replaced with A, I, L, S, T, M or V; S136 replaced with A, G, I, L, T, M or V; H137 replaced with K or R; R138 replaced with H or K; S139 replaced with A, G, I, L, T, M or V; E140 replaced with D; R141 replaced with H or K; G143 replaced with A, I, L, S, T, M or V; A144 replaced with G, I, L, S, T, M or V; N146 replaced with Q; R147 replaced with H or K; T149 replaced with A, G, I, L, S, M or V; E150 replaced with D; G151 replaced with A, I, L, S, T, M or V; V152 replaced with A, G, I, L, S, T or M; G 53 replaced with A, I, L, S, T, M or V; Y154 replaced with F or W; T155 replaced with A, G, I, L, 3, or V; N156 replaced with Q; A157 replaced with G, I, L, S, T, M or V; S158 replaced with A, G, I, L, T, M or V; N159 replaced with Q; N160 replaced with Q; L161 replaced with A, G, I, S, T, M or V; F162 replaced with W or Y; A163 replaced with G, I, L, S, T, M or V; L165 replaced with A, G, I, S, T, M or V; T168 replaced with A, G, I, L, S, M or V; A169 replaced with G, I, L, S, T, M or V; K171 replaced with H or R; S172 replaced with A, G, I, L, T, M or V; D173 replaced with E; E174 replaced with D; E 75 replaced with D; E176 replaced with D; R177 replaced with H or K; S178 replaced with A, G, I, L, T, M or V; T181 replaced with A, G, I, L, S, or V; T182 replaced with A, G, I, L, S, M or V; T183 replaced with A, G, I, L, S, M or V; R184 replaced with H or K; ? 185 replaced with Q; T186 replaced with A, G, I, L, S, M or V; A 87 replaced with G, I, L, S, T, M or V; Q189 replaced with N; K191 replaced with H or R; G193 replaced with A, I, L, S, T, M or V; T194 replaced with A, G, I, L, S, M or V; F195 replaced with W or Y; R196 replaced with H or K; N197 replaced with Q; D198 replaced with E; N199 replaced with Q; S200 replaced with A, G, I, L, T, M or V; A201 replaced with G, I, L, S, T, M or V; E202 replaced with D; M203 replaced with A, G, I, L, S, T or V; R205 replaced with H or K; K206 replaced with H or R; S208 replaced with A, G, I, L, T, or V; T209 replaced with A, G, I, L, S, M or V; G210 replaced with A, I, L, S, T, M or V; R2 3 replaced with H or K; G214 replaced with A, I, L, S, T, M or V; M215 replaced with A, G, I, L, S, T or V; V216 replaced with A, G, I, L, S, T or M; K2 7 replaced with H or R; V218 replaced with A, G, I, L, S, T or M; K219 replaced with H or R; D220 replaced with E; T222 replaced with A, G, I, L, S, or V; W224 replaced with F or Y; S225 replaced with A, G, T, L, T, or V; D226 replaced with E; I227 replaced with A, G, L, S, T, M or V; E228 replaced with D; V230 replaced with A, G, I, L, S, T or; H231 replaced with K or R; K232 replaced with H or R; E233 replaced with D; S234 replaced with A, G, I, L, T, M or V; G235 replaced with A, I, L, S, T, M or V; N236 replaced with Q; G237 replaced with A, I, L, S, T, or V; H238 replaced with K or R; N239 replaced with Q; I240 replaced with A, G, L, S, T, M or V; W241 replaced with F or Y; V242 replaced with A, G, I, L, S, T or M; I243 replaced with A, G, L, S, T, M or V; L244 replaced with A, G, I, S, T, or V; V245 replaced with A, G, I, L, S, T or M; V246 replaced with A, G, I, L, S, T or M; T247 replaced with A, G, I, L, S, M or V; L248 replaced with A, G, I, S, T, M or V; V249 replaced with A, G, I, L, S, T or; V250 replaced with A, G, I, L, S, T or M; L252 replaced with A, G, I, S, T, or V; L253 replaced with A, G, I, S, T, M or V; L254 replaced with A, G, I, S, T, M or V; V255 replaced with A, G, I, L, S, T or M; A256 replaced with G, I, L, S, T, M or V; V257 replaced with A, G, L, L, S, T or M; L258 replaced with A, G, I, S, T, M or V; I259 replaced with A, G, L, S, T, or V; V260 replaced with A, G, I, L, S, T or; I264 replaced with A, G, L, S, T, M or V; G265 replaced with A, I, L, S, T, M or V; S266 replaced with A, G, I, L, T, M or V; G267 replaced with A, I, L, S, T, or V; G269 replaced with A, I, L, S, T, or V; G270 replaced with A, I, L, S, T, M or V; D271 replaced with E; K273 replaced with H or R; M275 replaced with A, G, I, L, S, T or V; D276 replaced with E; R277 replaced with H or K; V278 replaced with A, G, I, L, S, T or M; F280 replaced with W or Y; W281 replaced with F or Y; R282 replaced with H or K; L283 replaced with A, G, I, S, T, M or V; G284 replaced with A, I, L, S, T, M or V; L285 replaced with A, G, I, S, T, M or V; L286 replaced with A, G, I, S, T, M or V; R287 replaced with H or K; G288 replaced with A, I, L, S, T, M or V; G290 replaced with A, I, L, S, T, M or V; A291 replaced with G, I, L, S, T, M or V; E292 replaced with D; D293 replaced with E; N294 replaced with Q; A295 replaced with G, I, L, S, T, M or V; H296 replaced with K or R; N297 replaced with Q; E298 replaced with D; I299 replaced with A, G, L, S, T, M or V; L300 replaced with A, G, I, S, T, M or V; S301 replaced with A, G, I, L, T, M or V; N302 replaced with Q; A303 replaced with G, I, L, S, T, M or V; D304 replaced with E; S305 replaced with A, G, I, L, T, M or V; L306 replaced with A, G, I, S, T, M or V; S307 replaced with A, G, I, L, T, M or V; T308 replaced with A, G, I, L, S, or V; F309 replaced with W or Y; V310 replaced with A, G, I, L, S, T or M; S3 1 replaced with A, G, I, L, T, M or V; E312 replaced with D; Q313 replaced with N; Q314 replaced with N; M315 replaced with A, G, I, L, S, T or V; E316 replaced with D; S317 replaced with A, G, I, L, T, M or V; Q318 replaced with N; E3 9 replaced with D; A321 replaced with G, I, L, S, T, M or V; D322 replaced with E; L323 replaced with A, G, I, S, T, M or V; T324 replaced with A, G, I, L, S, M or V; G325 replaced with A, I, L, S, T, M or V; V326 replaced with A, G, I, L, S, T or M; T327 replaced with A, G, I, L, S, M or V; V328 replaced with A, G, I, L, S, T or M; Q329 replaced with N; S330 replaced with A, G, I, L, T, M or V; G332 replaced with A, I, L, S, T, M or V; E333 replaced with D; A334 replaced with G, I, L, S, T, M or V; Q335 replaced with N; L337 replaced with A, G, I, S, T, M or V; L338 replaced with A, G, I, S, T, M or V; G339 replaced with A, I, L, S, T, M or V; A341 replaced with G, I, L, S, T, M or V; E342 replaced with D; A343 replaced with G, I, L, S, T, M or V; E344 replaced with D; G345 replaced with A, I, L, S, T, M or V; S346 replaced with A, G, I, L, T, or V; Q347 replaced with N; R348 replaced with H or K; R349 replaced with H or K; R350 replaced with H or K; L351 replaced with A, G, I, S, T, M or V; L352 replaced with A, G, I, S, T, M or V; V353 replaced with A, G, I, L, S, T or M; A355 replaced with G, I, L, S, T, M or V; N356 replaced with Q; G357 replaced with A, I, L, S, T, M or V; A358 replaced with G, I, L, S, T, M or V; D359 replaced with E; T361 replaced with A, G, I, L, S, M or V; E362 replaced with D; T363 replaced with A, G, I, L, S, M or V; L364 replaced with A, G, I, S, T, M or V; M365 replaced with A, G, I, L, S, T or V; L366 replaced with A, G, I, S, T, M or V; F367 replaced with W or Y; F368 replaced with W or Y; D369 replaced with E; K370 replaced with H or R; F371 replaced with W or Y; A372 replaced with G, I, L, S, T, M or V; N373 replaced with Q; I374 replaced with A, G, L, S, T, M or V; V375 replaced with A, G, I, L, S, T or M; F377 replaced with W or Y; D378 replaced with E; S379 replaced with A, G, I, L, T, or V; W380 replaced with F or Y; D381 replaced with E; Q382 replaced with N; L383 replaced with A, G, I, S. T, M or V; M384 replaced with A, G, I, L, S, T or V; R385 replaced with H or K; Q386 replaced with N; L387 replaced with A, G, I, S, T, M or V; D388 replaced with E; L389 replaced with A, G, I, S, T, M or V; T390 replaced with A, G, I, L, S, M or V; K391 replaced with H or R; N392 replaced with Q; E393 replaced with D; I394 replaced with A, G, L, S, T, M or V; D395 replaced with E; V396 replaced with A, G, I, L, S, T or M; V397 replaced with A, G, I, L, S, T or M; R398 replaced with H or K; A399 replaced with G, I, L, S, T, or V; G400 replaced with A, I, L, S, T, or V; T401 replaced with A, G, I, L, S, M or V; A402 replaced with G, I, L, S, T, M or V; G403 replaced with A, I, L, S, T, or V; G405 replaced with A, I, L, S, T, M or V; D406 replaced with E; A407 replaced with G, I, L, S, T, M or V; L408 replaced with A, G, I, S, T, M or V; Y409 replaced with F or W; A410 replaced with G, I, L, S, T, M or V; M41 replaced with A, G, I, L, S, T or V; L412 replaced with A, G, I, S, T, M or V; M413 replaced with A, G, I, L, S, T or V; K414 replaced with H or R; W415 replaced with F or Y; V4 6 replaced with A, G, I, L, S, T or M; N417 replaced with Q; K418 replaced with H or R; T419 replaced with A, G, I, L, S, M or V; G420 replaced with A, I, L, S, T, M or V; R421 replaced with H or K; N422 replaced with Q; A423 replaced with G, I, L, S, T, M or V; S424 replaced with A, G, I, L, T, M or V; I425 replaced with A, G, L, S, T, or V; H426 replaced with K or R; T427 replaced with A, G, I, L, S, M or V; L428 replaced with A, G, I, S, T, M or V; L429 replaced with A, G, I, S, T, M or V; D430 replaced with E; A431 replaced with G, I, L, S, T, M or V; L432 replaced with A, G, I, S, T, M or V; E433 replaced with D; R434 replaced with H or K; M435 replaced with A, G, I, L, S, T or V; E436 replaced with D; E437 replaced with D; R438 replaced with H or K; H439 replaced with K or R; A440 replaced with G, I, L, S, T, or V; K441 replaced with H or R; E442 replaced with D; K443 replaced with H or R; I444 replaced with A, G, L, S, T, or V; Q445 replaced with N; D446 replaced with E; L447 replaced with A, G, I, S, T, M or V; L448 replaced with A, G, I, S, T, M or V; V449 replaced with A, G, I, L, S, T or; D450 replaced with E; S451 replaced with A, G, I, L, T, M or V; G452 replaced with A, I, L, S, T, M or V; K453 replaced with H or R; F454 replaced with W or Y; I455 replaced with A, G, L, S, T, M or V; Y456 replaced with F or W; I457 replaced with A, G, I, S, T, M or V; E458 replaced with D; D459 replaced with E; G460 replaced with A, I, L, S, T, M or V; T461 replaced with A, G, I, L, S, M or V; G462 replaced with A, I, L, S, T, M or V; S463 replaced with A, G, I, L, T, M or V; A464 replaced with G, I, L, S, T, M or V; V465 replaced with A, G, I, L, S, T or M; S466 replaced with A, G, I, L, T, M or V; L467 replaced with A, G, I, S, T, M or V; or E468 replaced with D of SEQ ID NO: 1. In specific embodiments, the antibodies of the invention bind to TR4 polypeptides or fragments or variants thereof (especially a fragment comprising, or alternatively consisting of, the soluble extracellular domain of TR4), which contain one or more of the following non-conservative mutations in TR4: M1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A2 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P3 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; P4 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; P5 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A6 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R7 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W,?,? ? C; V8 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H9 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L10 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G1 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A12 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F13 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; L14 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A15 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V16 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T17 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P18 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; N19 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; P20 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y or C; G21 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S22 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A23 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A24 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S25 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G26 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T27 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E28 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A30 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A31 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A32 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T33 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P34 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; S35 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K36 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V37 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; W38 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; G39 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S40 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S41 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A42 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G43 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R44 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I45 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E46 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P47 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R48 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G49 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G50 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; G51 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R52 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; G53 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A54 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L55 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P56 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y. or C; T57 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S58 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M59 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G60 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q61 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; H62 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G63 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P64 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; S65 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A66 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R67 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; A68 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R69 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,?,? ? C; A70 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G71 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R72 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,?,? ? C; A73 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P74 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G75 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P76 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R77 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P78 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A79 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R80 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E81 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A82 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S83 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P84 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R85 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L86 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R87 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V88 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H89 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K90 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T91 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F92 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; K93 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; F94 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; V95 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V96 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V97 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G98 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V99 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; UOO replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L101 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q102 replaced with D, E, H, K, R, A, G, i, L, S, T, M, V, F, W, Y, P or C; V103 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V104 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P105 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; S106 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S107 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A108 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A109 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T1 10 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 111 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K112 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; L113 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H1 14 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D1 5 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q 16 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; S1 17 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 1118 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G119 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T120 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q121 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; Q122 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; W123 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; E124 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H125 replaced with D, E, A, G, L, L, S, T, M, V, N, Q, F, W, Y, P or C; S126 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P127 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; L128 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G129 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E130 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L131 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C132 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; P133 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; P134 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G135 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S136 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H137 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R138 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S139 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E140 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,?,? ? C; R141 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P142 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G143 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A144 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C145 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y or P; N146 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R147 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C148 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T149 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E150 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,?,? ? C; G151 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V152 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G153 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Y154 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; T155 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N156 replaced with D, E, H, K, R, A, G, I, L, S. T, M, V, F, W, Y, P or C; A157 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S158 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N159 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; N160 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; L161 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F162 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; A163 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C164 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; L165 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P166 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; C167 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T168 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A169 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C 70 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; K171 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S172 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D173 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E174 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; E 75 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E176 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R177 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S178 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P179 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; C180 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T181 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T182 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T183 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R184 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N185 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; T186 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A187 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C188 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; Q189 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; C190 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; K191 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P192 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G193 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T194 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F195 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; R196 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N197 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W,?,? ? C; D198 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N199 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; S200 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A201 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E202 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; M203 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C204 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; R205 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W,?,? ? C; K206 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C207 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; S208 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T209 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G210 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C211 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; P212 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; R213 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G214 replaced with D, E, H, K, R, N, Q, F, W,?,? ? C; M215 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V216 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K217 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V218 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K219 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D220 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C221 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; T222 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P223 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; W224 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; S225 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D226 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I227 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E228 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C229 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; V230 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H231 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,?,? ? C; K232 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E233 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S234 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G235 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N236 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; G237 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H238 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N239 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; I240 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; W241 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; V242 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I243 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L244 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V245 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V246 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T247 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L248 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V249 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V250 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P251 replaced with D, E, H,, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; L252 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L253 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L254 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V255 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A256 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V257 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L258 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I259 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V260 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C261 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; C262 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; C263 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; I264 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G265 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S266 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G267 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C268 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; G269 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G270 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D271 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P272 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; K273 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; C274 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; M275 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D276 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R277 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V278 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; C279 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; F280 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; W281 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,, V, P or C; R282 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L283 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G284 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L285 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L286 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R287 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G288 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P289 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y or C; G290 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A291 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E292 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D293 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N294 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; A295 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H296 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N297 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; E298 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I299 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L300 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S301 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N302 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; A303 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D304 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S305 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L306 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S307 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T308 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F309 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; V310 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S311 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E3 2 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q313 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; Q314 replaced with D, E, H, K, R, A, G, L, S, T, M, V, F, W, Y, P or C; M315 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E316 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S317 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q318 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; E319 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P320 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A321 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D322 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L323 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T324 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G325 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V326 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T327 replaced with D, E, H, K, R, N, Q, F, W,?,? ? C; V328 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q329 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; S330 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P331 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G332 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E333 replaced with H, K, R, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; A334 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q335 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; C336 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or P; L337 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L338 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G339 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P340 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A341 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E342 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A343 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E344 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G345 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S346 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q347 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; R348 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R349 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R350 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; L351 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L352 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V353 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P354 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; A355 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N356 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; G357 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A358 replaced with D, E, H, K, R, N, Q, F, W,?,? ? C; D359 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; P360 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; T361 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E362 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T363 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L364 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M365 replaced with D, E, H, K, R, N, Q, F, W,?,? ? C; L366 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; F367 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; F368 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; D369 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q. F, W, Y, P or C; K370 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; F371 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; A372 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N373 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; I374 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V375 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; P376 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; F377 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,, V, P or C; D378 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S379 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; W380 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; D381 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q382 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; L383 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M384 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R385 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; Q386 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; L387 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D388 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L389 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T390 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K391 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N392 replaced with D, E, H, K, R, A, G, I, L, S, T,, V, F, W, Y, P or C; E393 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; I394 replaced with D, E, H, K, R, N, Q, F, W, Y; P or C; D395 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; V396 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V397 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R398 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A399 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G400 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T401 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A402 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G403 replaced with D, E, H, K, R. N, Q, F, W,?,? ? C; P404 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y or C; G405 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D406 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A407 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I408 replaced with D, E, H, K, R, N, Q, F, W,?,? ? C; Y409 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; A410 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; 41 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L12 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; M413 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K414 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; W415 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; V416 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; N417 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; K418 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T419 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G420 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; R421 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; N422 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; A423 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S424 replaced with D, E, H,, R, N, Q, F, W, Y, P or C; I425 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; H426 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; T427 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I428 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L429 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D430 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A431 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; I432 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E433 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R434 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; M435 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E436 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E437 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; R438 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; H439 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; A440 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K441 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; E442 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; K443 replaced with D, E, A, G, I, L, S, T,, V, N, Q, F, W, Y, P or C; I444 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Q445 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P or C; D446 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; L447 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L448 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V449 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; D450 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; S451 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G452 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; K453 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; F454 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; I455 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; Y456 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C; I457 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; E458 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; D459 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C; G460 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; T461 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; G462 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S463 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; A464 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; V465 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; S466 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; L467 replaced with D, E, H, K, R, N, Q, F, W, Y, P or C; or E468 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P or C of SEQ ID NO: 1. The amino acids of the TR4 protein of the present invention that are essential for function can be identified by known methods such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)) . In the latter procedure, simple mutations of alanine are introduced in each residue of the molecule. The biological activity of the resulting mutant molecules is then tested, for example binding to the receptor or, in vitro, proliferative activity in vitro. Sites that are critical for ligand-receptor binding can also be determined by structural analysis, eg, crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224: 899-904 (1992 ) and de Vos et al., Science 255: 306-312 (1992)). In preferred embodiments, the antibodies of the present invention bind to regions of TR4 that are essential for the function of TR4. In other preferred embodiments, the antibodies of the present invention bind to regions of TR4 that are essential for the function of TR4 and inhibit or cancel the function of TR4. In other preferred embodiments, the antibodies of this invention bind to regions of TR4 that are essential for the function of TR4 and increase the function of TR4. Additionally, protein engineering can be used to improve or alter the characteristics of TR4 polypeptides. Recombinant DNA technology known to the skilled artisan can be used to create novel mutant proteins or muteins that include single or multiple substitutions, deletions and additions of amino acids, or fusion proteins. Such modified polypeptides may show, for example, greater activity or greater stability. further, they can be purified in high yields and may show higher solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions. The antibodies of the present invention can bind to said modified TR4 polypeptides. TR4 variants that do not occur naturally can be produced using known mutagenesis techniques including, without limitation, oligonucleotide-mediated mutagenesis, alanine scanning, PCR mutagenesis, site-directed mutagenesis (see, eg, Carter et al. Nucí Acids Res. 13: 4331 (1986); and Zoller and others, Nucí. Acids Res. 10: 6487 (1982)), cassette mutagenesis (see for example, Wells et al., Gene 34: 315 (1985)), restriction selection mutagenesis (see for example, Wells et al., Philos. Trans. R. Soc. London SerA 317: 415 (1986)). In this manner, the invention also encompasses antibodies that bind TR4 derivatives and analogs having one or more amino acid residues deleted, added or substituted to generate TR4 polypeptides that are more suitable for expression, ascending scaling, etc., in the host cells chosen. For example, the cysteine residues can be deleted or substituted with another amino acid residue to remove the disulfide bridges; the N-linked glycosylation sites can be altered or eliminated to obtain for example the expression of a homogeneous product that is more easily recovered and purified from yeast hosts, which are known to hyperglycosylate the N-linked sites. For this purpose, several amino acid substitutions in the first or the third amino acid position, or both, in one or more of the glycosylation recognition sequences in the TR4 polypeptides, or an amino acid deletion in the second position of one or more such recognition sequences will prevent glycosylation of TR4 in the modified tripeptide sequence (see, for example, Miyajimo et al., EMBO J 5 (6): 1 193-1 197). Additionally, to eliminate unwanted processing by proteases such as furins or kexins, one or more of the amino acid residues of TR4 polypeptides (e.g., arginine and lysine residues) can be deleted or substituted with another residue. The antibodies of the present invention also include antibodies that bind to a polypeptide comprising, or alternatively consisting of, the polypeptide encoded by the deposited cDNA (the reservoir having reference No. ATCC 97853) that includes the guide; a polypeptide comprising, or alternatively consisting of, the mature polypeptide encoded by the deposited cDNA minus the leader (ie, the mature protein); a polypeptide comprising, or alternatively consisting of, the polypeptide of SEQ ID NO: 1 including the leader; a polypeptide comprising, or alternatively consisting of, the polypeptide of SEQ ID NO: 1 minus the methionine of the amino terminus; a polypeptide comprising, or alternatively consisting of, the polypeptide of SEQ ID NO: 1 minus the leader; a polypeptide comprising, or alternatively consisting of, the extracellular domain of TR4; a polypeptide comprising, or alternatively consisting of, the cysteine-rich domain of TR4; a polypeptide comprising, or alternatively consisting of, the transmembrane domain of TR4; a polypeptide comprising, or alternatively consisting of, the intracellular domain of TR4; a polypeptide comprising, or alternatively consisting of, the death domain of TR4; a polypeptide comprising, or alternatively consisting of, soluble polypeptides comprising part or all of the extracellular and intracellular domain, but lacking the transmembrane domain; as well as polypeptides that are at least 80% identical, preferaat least 90% or 95% identical, preferaat least 96%, 97%, 98% or 99% identical to the polypeptides described above (e.g. the polypeptide encoded by the deposited cDNA clone (the deposit having the registration number ATCC 97853), the polypeptide of SEQ ID NO: 1, and portions of said polypeptides with at least 30 amino acids, preferaat least 50 amino acids. It is understood that in a polypeptide having at least one amino acid sequence, for example, 95% "identical" to a reference amino acid sequence of a TR4 polypeptide, its amino acid sequence is identical to the reference sequence, except that the polypeptide sequence can include up to five amino acid alterations per 100 amino acids of the reference amino acid sequence of TR4 polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence can be deleted or substituted with another amino acid, or can be insert an amount of amino acids of up to 5% of the total amino acid residues of the reference sequence. These alterations of the reference sequence can occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between terminal positions, scattered individually between residues of the reference sequence or in one or more contiguous groups within the reference sequence. As a practical way, using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wisconsin, 537 1) can be conventionally determined if any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical, for example, to the amino acid sequence shown in SEQ ID NO: 1, to the amino acid sequence encoded by the cDNA clones deposited. Of course, when using Bestfit or any other sequence alignment program to determine whether a particular sequence is for example 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of Identity is calculated over the entire length of the reference amino acid sequence, and spaces are allowed in the homology of up to 5% of the total number of amino acid residues in the reference sequence. In a specific modality, the identity between a reference sequence (query; a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, is determined using the FASTDB computer program based on the Brutlag algorithm and others. { Comp. App. Bioscl. 6: 237-245 (1990)). The preferred parameters used in an FASTDB amino acid alignment are: Matrix = PAM 0, k-tuple = 2, Mismatch penalty = 1, Junction penalty = 20, Scrambling group length = 0, Cut score = 1, Size window = length of the sequence, space penalty = 5, space size penalty = 0.05, window size = 500 or the length of the subject amino acid sequence, whichever is shorter. According to this modality, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions and not due to internal deletions, a manual correction of the results is made to consider the fact that the program FASTDB does not take into account N- or C-terminal truncations of the subject sequence when calculating the overall percentage of identity. For subject sequences truncated at the N and C ends with respect to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which do not match or they are not aligned with a corresponding subject residue, as a percentage of the total bases of the query sequence. The results of the FASTDB sequence alignment determine whether a residue matches or aligns. This percentage of the identity percentage calculated with the aforementioned FASTDB program is then subtracted using the specified parameters, in order to arrive at a final percentage of identity score. This final score of percentage of identity is the one that is used for the purposes of this modality. To manually adjust the percentage of identity score, only the residues of the N and C ends of the subject sequence that do not match or do not align with the query sequence are considered. That is, only the query residue positions outside the terminal residues N and C furthest from the subject sequence. For example, a subject sequence of 90 amino acid residues is aligned with a query sequence of 100 residues to determine percent identity. Deletion occurs at the N-terminus of the subject sequence and therefore the FASTDB alignment does not show a concordance / alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues in the unpaired N and C ends / total number of residues in the query sequence), so that 10% of the identity percentage score calculated by the FASTDB program is subtracted. If the remaining 90 residues matched perfectly, the final identity percentage would be 90%. In another example, a subject sequence of 90 residues is compared to a query sequence of 100 residues. This time the deletions are internal deletions in such a way that there are no residues at the N or C ends of the subject sequence that do not match or align with the query. In this case, the identity percentage calculated by FASTDB is not manually corrected. Again, it is only manually corrected for residue positions outside the N and C terminus of the subject sequence displayed in the FASTDB alignment that do not match or do not align with the query sequence. No other manual corrections are made for the purposes of this modality. The present application is also directed to antibodies that bind to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TR4 polypeptide sequence designated herein as n1-m1, or n2-m2 In preferred embodiments, the application is directed to antibodies that bind to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the sequence of amino acids of the specific N- and C-terminal deletions mentioned here of TR4. In some preferred embodiments, the antibodies of the invention bind to TR4 fusion proteins such as those described above, wherein the TR4 portion of the fusion protein is that described herein as n -m1, or n2-m2 .

The antibodies of the invention can bind to modified TRAIL receptor polypeptides It is specifically contemplated that the antibodies of the present invention can be linked to modified forms of TR7 proteins of SEQ ID NO: 3. In embodiments wherein an antibody of the present invention binds specifically to both TR7 (SEQ ID NO: 3) and TR4 (SEQ ID NO: 1), it is also specifically contemplated that antibodies can bind to modified forms of TR7. or TR4, or both. Modified forms of TR4 would include, for example, the modified forms of TR4 corresponding to the modified forms of TR7 described below. In specific embodiments, the antibodies of the present invention bind to TR7 polypeptides (such as those described above) including, without limitation, TR7 naturally purified polypeptides, TR7 polypeptides produced by synthetic chemical methods and TR7 polypeptides produced by recombinant techniques from a prokaryotic or eukaryotic cell, including for example bacterial, yeast, higher plant, insect and mammalian cells, using for example the recombinant compositions and the methods described above. Depending on the host employed in a recombinant production method, the polypeptides can be glycosylated or non-glycosylated. In addition, the TR7 polypeptides may also include an initial residue of modified methionine, in some cases as a result of host-mediated processes. In addition, TR7 proteins that are linked by the antibodies of the present invention can be chemically synthesized using known techniques (see for example Creighton, "Proteins: Structures and Molecular Principles", WH Freeman &Co., NY (1983), and Hunkapiller et al., Nature 310: 105-1 (1984)). For example, a peptide corresponding to a fragment of a TR7 polypeptide can be synthesized using a peptide synthesizer. In addition, if desired, non-classical amino acids or amino acid chemical analogs can be introduced as a substitution or addition in the TR7 polypeptide sequence. Non-classical amino acids include without limitation the D isomers of the common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, g-Abu, e-Ahx, 6- aminohexanoic, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulin, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids , designer amino acids such as b-methylamino acids, Ca-methyl amino acids, Na-methyl amino acids and amino acid analogs in general.

In addition, the amino acid can be D (dextrorotatory) or L (levorotatory). The invention further encompasses antibodies that bind TR7 polypeptides that are differentially modified during or after translation, for example, by glycosylation, acetylation, phosphorylation, amidation, formation of derivatives with known protecting / blocking groups, proteolytic cleavage, linkage with a antibody molecule or other cellular ligand, etc.

Any of many chemical modifications can be carried out by known techniques, including without limitation specific chemical cleavage with cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc. Further post-translational modifications for TR7 polypeptides are for example N-linked or O-linked cardrate chains, N-terminal or C-terminal processing, binding of chemical moieties to the amino acid skeleton, chemical modifications of cardrate chains N-linked or O-linked, and addition or deletion of an N-terminal methionine residue as a result of expression in a prokaryotic host cell. Polypeptides can also be modified with a detectable brand, such as an enzymatic, fluorescent, isotopic or affinity label, to allow detection and isolation of the protein. The invention also provides antibodies that bind to chemically modified derivatives of TR7 polypeptides that may provide additional advantages such as increased solubility, stability and circulation time of the polypeptide, or reduced immunogenicity (see U.S. Patent No. 4,179,337). The chemical portions for modification can be selected from water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol and the like. The polypeptides can be modified at random positions within the molecule, or at predetermined positions within the molecule, and can include one, two, three or more added chemical moieties. The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, the preferred molecular weight for ease of handling and manufacture is about 1 kDa to 100 kDa (the term "about" indicates that in polyethylene glycol preparations some molecules will weigh more, some less, than the indicated molecular weight). Other sizes may be used, depending on the desired therapeutic profile (for example the desired duration of sustained release, effects on biological activity if any, ease of handling, degree or lack of antigenicity and other known effects of polyethylene glycol for a therapeutic or analogue protein). For example, polyethylene glycol can have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000 , 9500, 10,000, 10,500, 1, 000, 11, 500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000 , 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa. As indicated above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in the US patent. No. 5,643,575; Morpurgo and others, Appl. Biochem. Biotechnol. 56: 59-72 (1996); Vorobjev et al., Nucleosides Nucleotides 18: 2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10: 638-646 (1999), whose descriptions are incorporated herein by reference. The polyethylene glycol molecules (or other chemical moieties) must bind to the protein considering the effects on the functional or antigenic domains of the protein. There are several joining methods available to the person skilled in the art, for example: EP 0 401 384, incorporated herein by reference (coupling of PEG to G-CSF); see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (which report the pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol can be covalently linked through amino acid residues by means of a reactive group such as a free amino or carboxyl group. The reactive groups are those to which an activated polyethylene glycol molecule can be linked. Amino acid residues having a free amino group can include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group can include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue. The sulfhydryl groups can also be used as a reactive group to adhere the polyethylene glycol molecules. For the purpose of therapy, binding to an amino group is preferred, for example the N-terminal connection or a lysine group. As suggested above, polyethylene glycol can be bound to proteins by any of several amino acid residues. For example, polyethylene glycol can be linked to proteins by means of covalent bonds with residues of lysine, histidine, aspartic acid, glutamic acid or cysteine. One or more reaction chemistries may be employed to adhere the polyethylene glycol to specific amino acid residues of the protein (eg lysine, histidine, aspartic acid, glutamic acid or cysteine), or to more than one type of amino acid residue of the protein ( for example lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof). Chemically modified proteins can be specifically searched at the N-terminus. By using polyethylene glycol as an illustration of the present composition, from a variety of polyethylene glycol molecules the proportion of polyethylene glycol molecules to molecules can be selected (by molecular weight, branching, etc.). of protein (or peptide) in the reaction mixture, the type of pegylation reaction to be performed and the method for obtaining the N-terminally pegylated protein. The method for obtaining the N-terminally pegylated preparation (ie, the separation of this portion from other mono-pegylated portions if necessary) can be by purification of the N-terminal pegylated material from a population of pegylated protein molecules. Selective chemical modification at the N-terminus can be performed by reductive alkylation which exploits the differential reactivity of different types of primary amino groups (lysine compared to the N-terminus) available for modification in the particular protein. Under the appropriate reaction conditions, the substantially selective modification of the N-terminal protein with a carbonyl group-containing polymer is obtained. As indicated above, the pegylation of the proteins of the invention can be carried out by any number of means. For example, polyethylene glycol can be attached to the protein directly or by means of an interposed linker. Systems without linker for adhering polyethylene glycol to proteins are described in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9: 249-304 (1992); Francis and others, Intern. J. of Hematol. 68: -18 (1998); patent of E.U.A. No. 4,002,531; patent of E.U.A. No. 5,349,052; WO 95/06058; and WO 98/32466, the descriptions of which are incorporated herein by reference. A system for adhering polyethylene glycol directly to amino acid residues of protein without an interposed linker employs three-fold MPEG, which is produced by the modification of monomethoxy polyethylene glycol (MPEG) using tresyl chloride (CISO2CH2CF3). Upon reaction of the protein with three-fold MPEG, the polyethylene glycol directly binds with amino groups of the protein. In this manner, the invention includes protein-polyethylene glycol conjugates produced by reacting the proteins of the invention with a polyethylene glycol molecule having a 2,2,2-trifluoroethanesulfonium group. Polyethylene glycol can also be added to proteins using several different interposed linkers. For example, the patent of E.U.A. No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses urethane linkers for linking polyethylene glycol to proteins. Protein-polyethylene glycol conjugates can also be produced in which the polyethylene glycol is bound to the protein by a linker by reaction of the proteins with compounds such as MPEG-succinimidylsuccinate, activated MPEG with 1,1'-carbonyldiimidazole, MPEG-2,4 , 5-trichlorophenylcarbonate, MPEG-p-nitrophenol carbonate, and various MPEG-succinate derivatives. Various additional polyethylene glycol derivatives and reaction chemistries for adding polyethylene glycol to proteins are described in WO 98/32466, the complete disclosure of which is incorporated herein by reference. The pegylated protein products produced using the reaction chemistries described herein are included within the scope of the invention. The number of polyethylene glycol moieties added to each TR7 polypeptide (i.e., the degree of substitution) may also vary. For example, the pegylated proteins of the invention can be linked, on average, with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules . Similarly, the average degree of substitution is within scales such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10- 12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 portions of polyethylene glycol per protein molecule. Methods for determining the degree of substitution are discussed, for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9: 249-304 (1992). As mentioned, the antibodies of the present invention can be linked to modified TR7 polypeptides by natural processes such as post-translational processing, or by chemical modification techniques that are well known. It will be appreciated that the same type of modification may be present in equal degrees, or variable at several sites in a given TR7 polypeptide. TR7 polypeptides can be branched, for example, as a result of ubiquitination, and can be cyclic with or without branching. TR7 cyclic, branched or cyclic and branched polypeptides can result from natural post-translational processes, or can be made by synthetic means. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, entanglement, cyclization, disulfide bond formation, demethylation, formation of covalent entanglements, cysteine formation, pyroglutamate formation, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing , phosphorylation, reward, racemization, selenoylation, sulfation, addition of amino acids to proteins mediated by transfer RNA, such as arginilation and ubiquitination (see, for example, "Proteins-structure and molecular properties", 2nd ed., TE Creighton, WH Freeman and Company, New York (1993); "Posttranslational covalent modification of proteins", B.C. Johnson, Ed., Academic Press, New York, p. 1-12 (1983); Seifter et al., Meth Enzymol 182: 626-646 (1990); Rattan et al., Ann NYAcad Sci 663: 48-62 (1992)).

Anti-TR7 Antibodies In one embodiment, the invention provides antibodies (eg, antibodies comprising two heavy chains and two light chains linked together by disulfide bridges) that immunospecifically bind to TR7 (SEQ ID NO: 3), or fragments or variants thereof, wherein the amino acid sequence of the heavy chain and the amino acid sequence of the light chain are the same amino acid sequence of a heavy chain and a light chain expressed by one or more scFvs or cell lines referred to in In another embodiment, the invention provides antibodies (consisting of two heavy chains and two light chains linked together by disulfide bridges to form an antibody), which bind immunospecifically to TR7 or fragments or variants thereof, wherein the amino acid sequence of the heavy chain or the amino acid sequence of the light chain are the same amino acid sequence of a heavy chain or a light chain expressed by one or more scFvs or cell lines referred to in Table 1. Immunospecific binding to TR7 polypeptides can be determined by means of known immunoassays or those described herein, to test the specific antibody-antigen binding. Molecules comprising, or alternatively consisting of, fragments or variants of these antibodies that immunospecifically bind to TR7, are also encompassed by the invention, such as the nucleic acid molecules encoding these antibody molecules, fragments or variants (e.g. SEQ ID NOs: 57-71). In one embodiment of the present invention, antibodies that immunospecifically bind to a TR7 or a fragment or variant thereof, comprise a polypeptide having the amino acid sequence of any of the heavy chains expressed by at least one of the scFvs or the cell lines referred to in Table 1, or any of the light chains expressed by at least one of the scFvs or cell lines referred to in Table 1. In another embodiment of the present invention, antibodies that immunospecifically bind to TR7 or a fragment or variant thereof, comprise a polypeptide having the amino acid sequence of any of the VH domains of at least one of the scFvs referred to in Table 1, or any of the VL domains of at least one of the referred scFvs in Table 1. In preferred embodiments, the antibodies of the present invention comprise the amino acid sequence of a VH domain and a VL domain of a single scFv referred to in table 1. In alternative embodiments, the antibodies of the present invention comprise the amino acid sequence of a VH domain and a VL domain of different scFvs referred to in Table 1. Molecules comprising, or alternatively consisting of, fragments or antibody variants of the VH or VL domains of at least one of the scFvs referred to in Table 1, which immunospecifically bind to TR7, are also encompassed by the invention, as the nucleic acid molecules encoding these VH and VL domains, molecules, fragments or variants. The present invention also provides antibodies that immunospecifically bind to a polypeptide, or fragment or variant of TR7 polypeptide, wherein said antibodies comprise, or alternatively consist of, a polypeptide having an amino acid sequence of any one, two, three or more of the VH CDRs contained in a VH domain of one or more scFvs referred to in Table 1. In particular, the invention provides antibodies that immunospecifically bind to a TRAIL receptor, comprising, or alternatively consisting of, a polypeptide. having the amino acid sequence of a VH CDR1 contained in a VH domain of one or more scFvs referred to in Table 1. In another embodiment, antibodies that immunospecifically bind to TR7 comprise, or alternatively consist of, a polypeptide having the amino acid sequence of a VH CDR2 contained in a VH domain of one or more scFvs referred to in Table 1. In a preferred embodiment, antibodies that immunospecifically bind to TR7 comprise, or alternatively consist of, a polypeptide having the amino acid sequence of a VH CDR3 contained in a VH domain of one or more scFvs referred to in Table 1. Molecules that comprise, or alternatively consisting of, these antibodies or antibody fragments or variants thereof, that immunospecifically bind to TR7, or to a TR7 fragment or variant thereof, are also encompassed by the invention, such as molecules of nucleic acid encoding these antibodies, molecules, fragments or variants (for example SEQ ID NOs: 57-71). The present invention also provides antibodies that immunospecifically bind to a polypeptide, or fragment or variant of TR7 polypeptide, wherein said antibodies comprise, or alternatively consist of, a polypeptide having an amino acid sequence of any one, two, three or more of the VL CDRs contained in a VL domain of one or more scFvs referred to in Table 1. In particular, the invention provides antibodies that bind immunospecifically to TR7, comprising, or alternatively consisting of, a polypeptide having the amino acid sequence of a VL CDR1 contained in a VL domain of one or more scFvs referred to in Table 1. In another embodiment, antibodies that immunospecifically bind to TR7 comprise, or alternatively consist of, a polypeptide having the sequence of amino acids of a VL CDR2 contained in a VL domain of one or more scFvs referred to in Table 1. In a preferred embodiment, the antibodies that bind immunospecifically to TR7 comprise, or alternatively consist of, a polypeptide having the amino acid sequence of a VL CDR3 contained in a VL domain of one or more scFvs referred to in Table 1. The molecules comprising, or alternatively which consist of, these antibodies or antibody fragments or variants thereof, which bind immunospecifically to TR7, or a TR7 fragment or variant thereof, are also encompassed by the invention, such as the nucleic acid molecules encoding these antibodies , molecules, fragments or variants (for example SEQ ID NOs: 57-71). The present invention also provides antibodies (including molecules comprising, or alternatively consisting of, fragments or antibody variants) that immunospecifically bind to a TR7 polypeptide, or a fragment or variant of TR7, wherein said antibodies comprise, or alternatively consist of, one, two, three or more of VH CDRs and one, two, three or more VL CDRs, contained in a VH domain or in a VL domain of one or more scFvs referred to in Table 1. In particular, The invention provides antibodies that immunospecifically bind to a polypeptide or fragment or variant of TR7 polypeptide, wherein said antibodies comprise, or alternatively consist of, a VH CDR1 and a VL CDR1, a VH CDR1 and a VL CDR2, a VH CDR1 and a VL CDR3, a VH CDR2 and a VL CDR1, a VH CDR2 and a VL CDR2, a VH CDR2 and a VL CDR3, a VH CDR3 and a VH CDR1, a CDR3 of VH and a CDR2 of VL, a CDR3 of VH and a VL CDR3, or any combination thereof, of VH CDRs and VL CDRs contained in a VH or VL domain of one or more scFvs referred to in Table 1. In a preferred embodiment, one or more of these combinations they are from the same scFvs set forth in Table 1. Molecules comprising, or alternatively consisting of, fragments or variants of these antibodies, which bind immunospecifically to TR7, are also encompassed by the invention, such as nucleic acid molecules that they encode these antibodies, molecules, fragments or variants (for example SEQ ID NOs: 57-71).

Nucleic acid molecules encoding anti-TR7 antibodies The present invention also provides nucleic acid molecules, generally isolated, that encode an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants of the themselves). In specific embodiments, the nucleic acid molecules encoding an antibody of the invention comprise, or alternatively consist of, SEQ ID NO: 57-71, or fragments or variants thereof. In a specific embodiment, a nucleic acid molecule of the invention encodes an antibody (which includes molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), comprising, or alternatively consisting of, a domain VH having an amino acid sequence of any of the VH domains of at least one of the scFvs referred to in Table 1, and a VL domain having an amino acid sequence of the VL domain of at least one of the scFvs referred to in box 1 In another embodiment, a nucleic acid molecule of the invention encodes an antibody (which includes molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), comprising, or alternatively consisting of, a VH domain having an amino acid sequence of any of the VH domains of at least one of the scFvs referred to in Table 1, or a VL domain having an amino acid sequence of a VL domain of at least one of the scFvs referred to in Table 1. The present invention also provides antibodies comprising, or alternatively consisting of, variants (including derivatives) of the antibody molecules (e.g., the VH domains or VL domains) described herein, said antibodies bind immunospecifically to TR7 or fragments or variants thereof. Known standard techniques can be used to introduce mutations into the nucleotide sequence encoding a molecule of the invention, including for example site-directed mutagenesis and PCR-mediated mutagenesis that produces amino acid substitutions. Preferably, the variants (including derivatives) encode less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions , less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the VH domain, VHCDR1, VHCDR2, VHCDR3, VL domain , VLCDR1, VLCDR2 or VLCDR3, reference. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues that have side chains with similar charges have been defined. These families include amino acids with basic side chains (eg lysine, arginine, histidine), acid side chains (eg aspartic acid, glutamic acid), uncharged polar side chains (eg glycine, asparagine, glutamine, serine, threonine, tyrosine) , cysteine), non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine , phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along part or all of the coding sequence, for example by saturation mutagenesis, and the resulting mutants can be examined for their biological activity to identify mutants that retain activity (for example the ability to union with TR7).

For example, it is possible to introduce mutations only in framework regions or only in CDR regions of an antibody molecule. The introduced mutations may be silent or neutral encoding missense mutations, ie they have little or no effect on the ability of the antibody to bind to the antigen. These types of mutations can be useful to optimize the codon usage or improve the production of the antibody of a hybridoma. Alternatively, non-neutral, miscoding mutations may alter the ability of the antibody to bind antigen. The localization of most of the silent and neutral encoding missense mutations is probably in the framework regions, whereas the location of most of the non-neutral encoding missense mutations is probably in the CDR, although this is not a requirement absolute. The person skilled in the art would be able to design and test mutant molecules with desired properties, such as without altering the antigen binding activity or altering the binding activity (e.g., enhancements of the antigen-binding activity or change of the antibody specificity). After mutagenesis, the encoded protein can be expressed routinely and the functional or biological activity of the encoded protein (e.g., the ability to immunospecifically bind to TR7) can be determined using the techniques described herein or routinely modifying known techniques. In a specific embodiment, an antibody of the invention (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), which binds immunospecifically to TR7 or a fragment or variant thereof, comprises, or alternatively consists of, an amino acid sequence encoded by a nucleotide sequence that hybridizes with a nucleotide sequence that is complementary to that encoding one of the VH or VL domains of one or more scFvs referred to in Table 1 under severe conditions, example hybridization with DNA bound to filter in 6X sodium chloride / sodium citrate (SSC) solution at approximately 45 ° C, followed by one or more washes in 0.2x SSC / 0.1% SDS at approximately 50-65 ° C; under very severe conditions, for example hybridization with filter-linked nucleic acid in 6x SSC at about 45 ° C, followed by one or more washes in 0.1 x SSC / 0.2% SDS at about 68 ° C, or under other severe hybridization conditions which are known for the prior art (see, for example, Ausubel, FM et al., eds., 1989, "Current Protocols in Molecular Biology," Vol. 1, Green Publishing Associates, Inc. and John Wiley &Sons , Inc., New York P. 6.3.1-6.3.6 and 2.10.3). The nucleic acid molecules encoding these antibodies are also encompassed by the invention. It is well known that polypeptides or fragments or variants thereof with similar amino acid sequences often have a similar structure and many biological activities. Thus, in one embodiment, an antibody (including a molecule comprising, or alternatively consisting of, an antibody or vanant fragment thereof), that binds immunospecifically to TR7 or fragments or variants of TR7, comprises, or alternatively consists of, a VH domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a VH domain of at least one of the scFvs referred to in Table 1. In another embodiment, an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) , which binds immunospecifically to TR7 or a fragment or variant of TR7, comprises, or alternatively consists of, a VL domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, per at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least less 99% identical to the amino acid sequence of a VL domain of at least one of the scFvs referred to in Table 1.

Methods for producing antibodies Antibodies according to the invention are preferably prepared using a phage scFv display collection. The technology used to achieve it is set out in the patents, applications and references described here. In phage display methods, antibody functional domains are displayed on the surface of phage particles carrying the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from collections of animal cDNAs (e.g., cDNA collections from human or murine lymphoid tissues) or collections of synthetic cDNA. The DNA encoding the VH and VL domains is linked by means of a scFv linker via PCR and cloned into a phagemid vector (for example p CANTAB 6 or pComb4 HSS). The vector is electroporated in E. coli and E. coli is infected with helper phage. The phage used in these methods is typically filamentous phage including fd and M13 and the VH and VL domains are usually fused recombinantly with gene II or phage gene VIII. The phage expressing an antigen-binding domain that binds to an antigen of interest (ie, a TRAIL receptor polypeptide or a fragment thereof) can be selected or identified with antigen, for example using labeled antigen or bound antigen or captured on a solid surface or globule. Examples of phage display methods that can be used to make the antibodies of the present invention include, without limitation, those described by Brinkman et al., J. Immunol. Methods 182: 41 -50 (1995); Ames et al., J. Immunol. Methods 184: 177-186 (1995); Kettieborough et al., Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT application No.

PCT / GB91 / 01 134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18719; WO 93/1 1236; WO 95/15982; WO 95/20401; W097 / 13844; and the patents of E.U.A. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821, 047; 5,571, 698; 5,427,908; 5,516,717; 5,780,225; 5,658,727; 5,735,743 and 5,969,108; each incorporated here in its entirety as a reference. For some uses, such as for in vitro affinity maturation of an antibody of the invention, it may be useful to express the VH and VL domains of one or more scFvs referred to in Table 1 as single chain antibodies or Fab fragments in a phage display collection. For example, the cDNAs encoding the VH and VL domains of the scFvs referred to in Table 1 can be expressed in all possible combinations using a phage display library, allowing the selection of VHA / L combinations that bind to TR7 polypeptides. with preferred binding characteristics such as improved affinity or improved dissociation rates. Additionally VH and VL segments, and in particular the CDR regions of the VH and VL domains of the scFvs referred to in Table 1, can be mutated in vitro. The expression of VH and VL domains with "mutant" CDRs in a phage display collection allows selection of VHA L combinations that bind to TR7 polypeptides with preferred binding characteristics, such as improved affinity or improved dissociation rates.

Additional Methods of Production of Antibodies The antibodies of the invention (including antibody fragments or variants) can be produced by any known method. For example, it will be appreciated that the antibodies according to the present invention can be expressed in cell lines other than hybridoma cell lines. The sequences encoding the cDNAs or genomic clones for the particular antibodies can be used to transform suitable mammalian or non-mammalian host cells or to generate phage display libraries, for example. Additionally, the polypeptide antibodies of the invention can be chemically synthesized or can be produced using recombinant expression systems. One way of producing the antibodies of the invention would be to clone the VH or VL domains of the scFvs referred to in Table 1. To isolate the VH and VL domains of bacteria transfected with a vector containing the scFV, PCR primers complementary to the VH or VL nucleotide sequences (see example 4) can be used to amplify the VH and VL sequences. The PCR products can then be cloned using vectors, for example, having a PCR product cloning site consisting of a single 5 'and 3' T-nucleotide overhang, which is complementary to the outgoing stretch of a single adenine nucleotide added at the 5 'and 3' end of PCR products by means of many DNA polymerases used for PCR reactions. The VH and VL domains can then be sequenced using known conventional methods.

Alternatively, the VH and VL domains can be amplified using vector-specific primers designed to amplify the entire scFv (ie, the VH domain, linker and VL domain). The cloned VH and VL genes can be put into one or more suitable expression vectors. By way of non-limiting example, to amplify the VH or VL sequences, PCR primers can be used which include VH or VL nucleotide sequences, a restriction site and a flanking sequence to protect the restriction site. Using known cloning techniques, the VH domains amplified by PCR can be cloned into vectors expressing the appropriate immunoglobulin constant region, for example the constant region of lgG1 or human lgG4 for the VH domains, and the human kappa or lambda constant regions for the VL kappa and lambda domains, respectively. Preferably, the vectors for expressing the VH or VL domains comprise a promoter suitable for directing the expression of the heavy and light chains in the chosen expression system, a secretion signal, a cloning site for the immunoglobulin variable domain, constant domains of immunoglobulin and a selection marker such as neomycin. The VH and VL domains can also be cloned into a single vector that expresses the necessary constant regions. The heavy chain conversion vectors and the light chain conversion vectors are then cotransfected in cell lines to generate stable or transient cell lines expressing full-length antibodies, eg, IgG, using known techniques (see, for example. , Guo et al., J. Clin Endocrinol, Metab.82: 925-31 (1997), and Ames et al., J. Immunol.Methods 184: 177-86 (1995), which are incorporated herein by reference in its entirety). The invention provides polynucleotides comprising, or alternatively consisting of, a nucleotide sequence encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). The invention also encompasses polynucleotides that hybridize under conditions of high stringency hybridization, or alternatively of medium or low stringency, for example as defined above, with polynucleotides complementary to nucleic acids having a polynucleotide sequence encoding an antibody of the invention or a fragment or variant thereof. The polynucleotides can be obtained and their nucleotide sequence can be determined by any known method. If the amino acid sequences of the VH domains, VL domains and CDRs thereof are known, nucleotide sequences encoding these antibodies can be determined using well-known methods, that is, the nucleotide codons that are known to encode particular amino acids are assemble in order to generate a nucleic acid encoding the antibody of the invention. Said polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (for example as described by Kutmeier et al., BioTechniques 17: 242 (1994), which, briefly, includes the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, pairing and ligation of the oligonucleotides, and then amplification of the bound oligonucleotides by PCR). Alternatively, a polynucleotide encoding an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) can be generated from a nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin can be chemically synthesized or can be obtained from a suitable source (e.g. a collection of antibody cDNA, or a collection of cDNA generated from, or nucleic acid-preferably polyA + RNA-isolated from, any tissue or cell expressing an antibody, such as hybridoma cells or B cell lines transformed with Epstein Barr virus expressing a antibody of the invention), by means of PCR amplification using synthetic primers hybridizable to the 3 'and 5' ends of the sequence, or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, for example, a cDNA clone from a cDNA library encoding the antibody. The amplified nucleic acids generated by PCR can then be cloned into duplicatable cloning vectors using any known method. Once the nucleotide sequence of the antibody is determined (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), the nucleotide sequence of the antibody can be manipulated using methods well known in the art for manipulating sequences of nucleotides, for example recombinant DNA techniques, site-directed mutagenesis, PCR, etc. (see, for example, the techniques described by Sambrook et al., 1990, "Molecular Cloning, A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, "Current Protocols in Molecular Biology", John Wiley & amp; amp; amp; amp;; Sons, NY, which are incorporated herein by reference in its entirety), to generate antibodies having a different amino acid sequence, for example to create substitutions, deletions or amino acid insertions. In a specific embodiment, VH and VL domains of one or more scFvs referred to in Table 1, or fragments or variants thereof, are inserted into framework regions using known recombinant DNA techniques. In a specific embodiment, one, two, three, four, five, six or more of the CDRs of the VH or VL domains of one or more scFvs referred to in Table 1, or fragments or variants thereof, are inserted within frame regions, using known recombinant DNA techniques. Frame regions may be natural or consensus framework regions and are preferably human framework regions (for a listing of human framework regions see for example Chothia et al., J. Mol. Biol. 278: 457-479 (1998) , which is incorporated herein by reference in its entirety). Preferably, the polynucleotides generated by the combination of frame regions and CDRs encode an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically binds to a TRAIL receptor. Preferably, as set forth above, polynucleotides encoding antibody variants or fragments of antibodies having one or more amino acid substitutions can be made within the framework regions and preferably the amino acid substitutions do not significantly alter the binding of the antibody with its antigen. Additionally, such methods can be used to make amino acid substitutions or deletions of one or more cysteine residues of the variable region that participate in an intrachain disulfide bond, to generate antibody molecules or fragments or antibody variants lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and are within the general knowledge in the art. The ability to clone and reconstruct megabase-sized human loci in YACs, and to introduce them into the mouse germline, provides a powerful approach to elucidate the functional components of very large or crudely mapped loci, and also to generate useful models of disease human In addition, the use of such technology for substitution of mouse locus with their human equivalents could provide unique knowledge on the expression and regulation of human gene products during development, their communication with other systems, and their implication in the induction and progression of the disease. . An important practical application of this strategy is the "Humanization" of the mouse humoral immune system. The introduction of the human immunoglobulin (Ig) locus in mice whose endogenous Ig genes have been inactivated offers the opportunity to study the mechanisms that support the programmed expression and assembly of antibodies, as well as their function in the development of B cells. Furthermore, such a strategy could provide an ideal source for the production of fully human monoclonal antibodies (mAbs), an important event to fulfill the promise of antibody therapy in human disease. The fully human antibodies are expected to minimize the intrinsic immunogenic and allergic responses of mouse monoclonal antibodies or derivatives in mice, and thus increase the efficacy and safety of the antibodies administered. The use of fully human antibodies can be expected to provide a substantial advantage in the treatment of chronic and recurrent human diseases, such as cancer, that require repeated administrations of antibody. One approach toward this goal was to engineer and engineer mouse breeds deficient in mouse antibody production with large fragments of the human Ig loci in anticipation that such mice would produce a large repertoire of human antibodies in the absence of mouse antibodies. . Large fragments of human Ig would preserve the great variable genetic diversity as well as the proper regulation of antibody production and expression. Taking advantage of the mouse machinery for antibody selection and diversification and the lack of immunological tolerance towards human proteins, the repertoire of human antibody reproduced in these mouse breeds would produce high affinity antibodies against any antigen of interest, including human antigens. Using the hybridoma technology, antigen-specific human monoclonal antibodies with the desired specificity could be easily produced and selected. This general strategy was demonstrated with the generation of the first XenoMouse ™ breeds as published in 1994; see Green et al., Nature Genetics 7: 13-21 (1994). The XenoMouse ™ breeds were engineered with yeast artificial chromosomes (YACS) containing fragments of germline configuration of 245 kb and 10 190 kb in size, the locus of the heavy chain and the human kappa light chain locus, respectively, which contained variable region and core constant sequences (id.). It was proved that the YACs containing human Ig were compatible with the mouse system both for transposition and for antibody expression, and were able to replace the inactivated mouse lg genes. This was demonstrated by its ability to induce B cell development, to produce a human-like repertoire of fully human antibodies, and to generate antigen-specific human monoclonal antibodies. These results also suggest that the introduction of larger portions of the human Ig locus containing larger amounts of V genes, additional regulatory elements and constant regions of human Ig, could substantially recapitulate the complete repertoire that is characteristic of the human humoral response to infection. and immunization. The work of Green and others recently extended to the introduction of more than 80%, approximately, of the human repertoire of antibodies, introducing fragments of YAC of germline configuration of megabase size of the locus of the heavy chain and the locus of the human kappa light chain, respectively, to produce XenoMouse ™ mice. See Mendez et al., Nature Genetics 15: 146-156 (1997), Green and Jakobovits, J. Exp. Med. 188: 483-495 (1998), Green, Journal of Immunological Methods 231: 11-23 (1999) and US patent application Ser. No. 08 / 759,620, filed December 3, 1996, the descriptions of which are incorporated herein by reference. This approach is further explained in the patent applications of E.U.A. Nos. Of Series 07 / 466,008, filed on January 12, 1990, 07 / 710,515, filed on November 8, 1990, 07 / 919,297, filed on July 24, 1992, 07 / 922,649, filed on July 30, 1992, 08/031, 801, filed on March 15, 1993, 08 / 112,848, filed on August 27, 1993, 08 / 234,145, filed on April 28, 1994, 08 / 376,279, filed on January 20, 1995, 08 / 430,938, April 27, 1995, 0-8 / 464,584, filed on June 5, 1995, 08 / 464,582, filed on June 5, 1995, 08/471, 191, filed on June 5, 1995 1995, 08 / 462,837, filed on June 5, 995, 08 / 486,853, filed on June 5, 1995, 08 / 486,857, filed on June 5, 1995, 08 / 486,859, filed on June 5, 1995, 08 / 462,513, presented on June 5, 1995, 08 / 724,752, filed on October 2, 1996, and 08 / 759,620, filed on December 3, 1996. See also Méndez et al., Nature Genetics 15: 146-156 (1997) and Green and Jakobovits, J. Exp. Med. 188: 483 495 (1998). See also European patent No. EP 0 471 151 B1, grant published on June 12, 1996, international patent application No. WO 94/02602, published on February 3, 1994, international patent application No. WO 96 / 34096, published on October 31, 1996, and WO 98/24893, published June 1, 1998. The descriptions of all of these patents, applications and references are hereby incorporated by reference in their entirety. Human anti-mouse antibody (HAMA) responses have led the industry to prepare chimeric or otherwise humanized antibodies. Although the chimeric antibodies have a human constant region and a murine variable region, it is expected to observe some responses of human anti-chimeric antibody (HACA), particularly in chronic or multiple dose uses of the antibody. In this way, it would be convenient to provide fully human antibodies against TR7 polypeptides to invalidate the consequences or effects of the HAMA or HACA responses. Monoclonal antibodies specific for TR7 polypeptides can be prepared using hybridoma technology (Kohier et al., Nature 256: 495 (1975); Kohier et al., Eur. J. Immunol. 6: 511 (1976); Kohier et al., Eur. J Immunol 6: 292 (976); Hammerling et al in: "Monoclonal Antibodies and T-Cell Hybridomas," Elsevier, NY, p.571-681 (1981)). Briefly, XenoMouse ™ mice can be immunized with TR7 polypeptides. After immunization, the splenocytes of said mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be employed according to the present invention; however, it is preferable to use the myeloma cell line (SP20), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80: 225-232 (1981)). Hybridoma cells obtained by said selection are then analyzed to identify clones that secrete antibodies capable of binding to the TR7 polypeptides. For some uses, including in vivo use of antibodies in humans and in vitro screening tests, it may be preferable to use human or chimeric antibodies. Fully human antibodies are particularly suitable for the treatment of human patients. See also U.S.A. Nos. 4,444,887 and 4,716.1 1 1; and PCT publications WO 98/46645, WO 98/50435, WO 98/24893, W098 / 6654, WO 96/34096, WO 96/35735 and WO 91/10741; each of which is incorporated herein by reference in its entirety. In a specific embodiment, the antibodies of the present invention comprise one or more VH and VL domains of the invention and constant regions of another immunoglobulin molecule, preferably a human immunoglobulin molecule. In a specific modality, the antibodies of the present invention comprise one or more CDRs corresponding to the VH and VL domains of the invention and framework regions of another immunoglobulin molecule, preferably a human immunoglobulin molecule. In other embodiments, an antibody of the present invention comprises one, two, three, four, five, six or more VL CDRs or VH CDRs that correspond to one or more of the VH or VL domains of one or more scFvs referred to in the table. 1, or fragments or variants thereof, and framework regions (and optionally one or more CDRs not derived from the antibodies expressed by scFvs referred to in Table 1) of a human immunoglobulin molecule. In a preferred embodiment, an antibody of the invention comprises a CDR3 VH, CDR3 VL, or both, corresponding to the same scFv or different scFvs selected from the scFvs referred to in Table 1, or fragments or variants thereof, and framework regions of a human immunoglobulin.

A chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules, such as antibodies having a variable region derived from a human antibody and a non-human immunoglobulin constant region (eg, murine), or vice versa . The methods for producing chimeric antibodies are known. See, for example, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Gillies et al., J. Immunol. Methods 125: 191-202 (1989); US patents Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entirety. Chimeric antibodies comprising one or more CDRs of human species and framework regions of a non-human immunoglobulin molecule (e.g., frame regions of a murine, canine or feline immunoglobulin molecule) (or vice versa) can be produced using a variety of known techniques, including for example CDR grafting (EP 239,400; PCT publication WO 91/09967; US patents Nos. 5,225,539; 5,530,101; and 5,585,089), plating or coating (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28; 4/5): 489-498 (1991), Studnicka et al, Protein Engineering 7 (6): 805-814 (994), Roguska et al., PNAS 91: 969-973 (1994)), chain revolution (patent of US No. 5,565,352). In a preferred embodiment, the chimeric antibodies comprise a human CDR3 having an amino acid sequence of any of the VH CDR3's or VL CDR3 * s of a VH or VL domain of one or more of the scFvs referred to in Table 1, or a variant thereof, and non-human framework regions or human framework regions different from the frames in the corresponding scFvs set forth in Table 1. Frequently, the framework residues in the framework regions will be substituted with the corresponding residue of the CDR donor antibody to alter, preferably improve, the binding of the antigen. These frame substitutions are identified by known methods, for example modeling the interactions of CDR and frame residues to identify framework residues important for antigen binding, and sequence comparison to identify unusual frame residues at positions particular (see, for example, Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature 352: 323 (1988), which are incorporated herein by reference in their entirety). Intrabodies are antibodies, often scFvs, which are expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (eg retained in the cytoplasm, endoplasmic reticulum or periplasm). Intrabodies can be used, for example, to override the function of a protein to which the intrabody joins. The expression of intrabodies can also be regulated using inducible promoters in the nucleic acid expression vector comprising the intrabody. Intrabodies of the invention can be produced using known methods such as those reviewed and discussed by Chen et al., Hum. Gene Ther. 5: 595-601 (1994); Marasco, W. A., Gene Ther. 4: 1-15 (1997); Rondón and Marasco, Annu. Rev.

Microbe!. 51: 257-283 (1997); Proba et al., J. Mol. Biol. 275: 245-253 (1998); Cohen et al., Oncogene 17: 2445-2456 (1998); Ohage and Steipe, J. Mol. Biol. 291: 1 1 19-1 128 (1999); Ohage et al., J. Mol. Biol. 291: 1 129-1 134 (1999); Wirtz and Steipe, Protein Sci. 8: 2245-2250 (1999); Zhu et al., J. Immunol. Methods 231: 207-222 (1999); and the references cited there. The recombinant expression of an antibody of the invention (including antibody fragments or fragments thereof (eg a heavy or light chain of an antibody of the invention)), requires the construction of one or more expression vectors containing a polynucleotide which encodes the antibody. Once a polynucleotide encoding an antibody molecule of the invention has been obtained (e.g., a complete antibody, a heavy or light chain of an antibody, or portion thereof (preferably, but not necessarily containing the variable domain of the heavy or light chain)), the vectors for the production of the antibody molecule can be produced by means of technology of recombinant DNA using well-known techniques. Thus, methods for preparing a protein by expressing a polynucleotide containing a nucleotide sequence encoding an antibody are described herein. The methods, which are well known to those skilled in the art, can be used to construct expression vectors containing antibody coding sequences and appropriate transcription and translation control signals. These methods include, for example, recombinant DNA techniques in vivo, synthetic techniques and genetic recombination in vivo. The invention thus provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention (e.g., a complete antibody, a heavy or light chain, a heavy or light chain variable domain of an antibody, or a portion thereof, or a heavy or light chain CDR, a single chain Fv, or fragments or variants thereof), operatively linked to a promoter. Such vectors include the nucleotide sequence that encodes the constant region of the antibody molecule (see for example PCT publication WO 86/05807; PCT publication WO 89/01036; and the patent of E.U.A. No. 5,122,464, the content of which is incorporated herein by reference in its entirety), and the variable domain of the antibody can be cloned into said vector for the expression of the entire heavy chain, the entire light chain, or both heavy and light chain. The expression vectors are transferred to a host cell by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. In this manner, the invention includes host cells containing polynucleotides that encode an antibody of the invention (e.g., complete antibody, a heavy or light chain thereof, or a portion thereof, or a single antibody chain, or a fragment or vanant thereof), operatively linked to a heterologous promoter. In preferred embodiments, the vectors encoding both heavy and light chains for the expression of the entire immunoglobulin molecule can be coexpressed in the host cell to express the complete antibody molecules, as detailed below. A variety of host expression vector systems can be used to express the antibody molecules of the invention. Said host expression systems represent vehicles by means of which the coding sequences of interest can be produced and subsequently purified, but also represent cells that when transformed or transfected with the appropriate nucleotide coding sequences can express an antibody molecule in situ of the invention. These include, without limitation, bacteriophage particles engineered to express antibody fragments or variants thereof (single chain antibodies), microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with bacteriophage DNA. recombinant, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (for example Saccharomyces, Pichiia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (for example baculoviruses) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (eg cauliflower mosaic virus, CaMV, tobacco mosaic virus, TV), or transformed with recombinant plasmid expression vectors (eg Ti plasmid) which contain antibody coding sequences; or mammalian cell systems (eg, COS, CHO, BHK, 293, 3T3, NSO cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian virus. (for example, the adenovirus late promoter, the 7.5K vaccine virus promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably eukaryotic cells, especially for the expression of the complete recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary (CHO) cells, in conjunction with a vector such as the early intermediate promoter element greater than the human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45: 101 (1986), Cockett et al., Bio / Technology 8: 2 (1990), Bebbington et al., Bio / Techniques 10: 169 (1992), Keen and Hale, Cytotechnology 18: 207 (1996)). These references are incorporated herein in their entirety as a reference. In bacterial systems, several expression vectors can advantageously be selected depending on the use of the antibody molecule being expressed. For example, when a large amount of said protein is to be produced for the generation of pharmaceutical compositions of an antibody molecule, vectors that direct the expression of high concentrations of fusion protein products that are easily purified may be convenient. Such vectors include, without limitation, the expression vector pUR278 of E. coli (Ruther et al., EMBO 1. 2: 1791 (1983)), in which the antibody coding sequence can be ligated individually into the vector in frame with the coding region of lac Z, such that a fusion protein is produced; pPIN vectors (Inouye &Inouye, Nucleic Acids Res. 13: 3101-3109 (1985); Van Heeke &Schuster, J. Biol. Chem. 24: 5503-5509 (1989)); and similar. PGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione 5-transferase (GTS). In general, said fusion proteins are soluble and can be easily purified from lysed cells by adsorption and binding to glutathione matrix agarose beads, followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin protease or factor Xa cut sites, such that the target cloned gene product can be released from the GST portion. In an insect system, Autographa californica nuclear polyhedra virus (AcNPV) can be used as a vector to express foreign genes. The virus develops in Spodoptera frugiperda cells. Antibody coding sequences can be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus, and can be placed under the control of an AcNPV promoter (for example the polyhedrin promoter). In mammalian host cells, various virus-based expression systems can be used. In case of using an adenovirus as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription / translation control complex, for example the late promoter and the tripartite leader sequence. This chimeric gene can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (e.g., the E1 or E3 region) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (see for example Logan &Shenk, Proc. Nati, Acad. Sci. USA 8 1: 355-359 (1984)). Specific initiation signals may be necessary for efficient translation of the inserted antibody coding sequences. These signals include the ATG start codon and adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous signals of translation control and initiation codons can be of a variety of both natural and synthetic origins. The efficiency of expression can be increased by the inclusion of appropriate transcription enhancing elements, transcription terminators, etc. (see for example Bittner et al., Methods in Enzymol, 153: 51-544 (1987)). In addition, a host cell strain can be chosen that modulates the expression of the inserted sequences, or modifies and processes the product of the gene in the specific manner desired. Such modifications (eg glycosylation) and processing (eg, cutting) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms of post-translational processing and modification of proteins and gene products. Appropriate cell lines and host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. For this purpose, eukaryotic host cells possessing the cellular machinery for proper processing of the primary transcript, glycosylation and phosphorylation of the gene product can be used. Said mammalian host cells include, without limitation CHO, VERY, BHK, Hela, COS, NSO, MDCK, 293, 3T3, W138, and in particular breast cancer cell lines such as for example BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell lines such as for example CRL7030 and HsS78Bst. For a prolonged and high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines stably expressing the antibody can be engineered. Instead of using expression vectors containing viral origins of replication, the host cells can be transformed with DNA controlled by the appropriate expression control elements (eg promoter, enhancer, transcription terminators, polyadenylation sites, etc.), and a marker will be selected. After the introduction of foreign DNA, the constructed cells can be allowed to grow 1 or 2 days in an enriched medium that is then changed to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and allows the cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can be used advantageously to engineer and engineer cell lines expressing the antibody molecule. Such engineered cell lines can be particularly useful for screening, screening and evaluating compositions that interact directly or indirectly with the antibody molecule. Various screening systems can be used including, without limitation, thymidine kinase genes from herpes simplex virus (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska &; Szybalski, Proc. Nati Acad. Sci. USA 48: 202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22: 8-17 (1980)), which can be employed in tk-, hgprt- or aprt- cells, respectively. Antimetabolite resistance can also be used as the basis of selection for the following genes: dhfr, which confers resistance to metrotexate (Wigler et al., Nati, Acad. Sci. USA 77: 357 (1980); O'Hare et al., Proc. Nati, Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan &Berg, Proc. Nati, Acad. Sci. USA 78: 2072 (1981)); neo, which confers resistance to aminoglycoside G-418 (Clinical Pharmacy 12: 488-505; Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.

Toxic!. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); TIB TECH 11 (5): 155-215 (May, 1993)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)). Methods commonly known in the recombinant DNA art can be routinely applied to select the desired recombinant clone, and such methods are described for example in Ausubel et al. (Eds.), "Current Protocols in Molecular Biology", John Wiley & Sons, NY (1993); Kriegler, "Gene Transfer and Expression, A Laboratory Manual", Stockton Press, NY (1990); and in chapters 12 and 13 of Dracopoli et al. (eds), "Current Protocols in Human Genetics," John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150: 1 (1981), which are incorporated herein by reference in their entirety. The levels of expression of an antibody molecule can be increased by means of amplification of the vector (for a review see Bebbington and Hentschel, "DNA cloning in gene clones in mammalian cells" ", Vol.3 (Academic Press, New York, 1987)). When a label in the vector system expressing the antibody is amplifiable, an increase in the level of inhibitor present in the culture of the host cell will increase the copy number of the marker gene. Since the amplified region is associated with the antibody coding sequence, antibody production will also increase (Crouse et al., Mol.Cell. Biol. 3: 257 (1983)). Vectors that use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine, sulfoximine or methotrexate, respectively. An advantage of glutamine synthase-based vectors is the availability of cell lines that are negative glutamine synthase (for example the murine myeloma cell line NSO). Glutamine synthase expression systems can also function in cells expressing glutamine synthase (eg Chinese hamster ovary (CHO) cells) by supplying additional inhibitor to prevent the functioning of the endogenous gene. A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87 / 04462; WO86 / 05807; WO89 / 01036; WO89 / 10404; and WO91 / 06657, which are hereby incorporated by reference in their entirety. Additionally, glutamine synthase expression vectors that can be used in accordance with the present invention are commercially available from suppliers including, for example, Lonza Biologics, Inc. (Portsmouth, New Hampshire). Expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells are described in Bebbington et al., Bio / technology 10: 169 (1992) and in Biblia and Robinson, Biotechnol. Prog. 11: 1 (1995), which are incorporated herein by reference in its entirety. The host cell can be co-transfected with two expression systems of the invention, the first vector encoding a heavy chain-derived polypeptide and the second vector encoding a light chain-derived polypeptide. The two vectors may contain identical selectable markers that allow for equal expression of heavy and light chain polypeptides. Alternatively, a single vector can be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain is preferably placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322: 52 (1986); Kohler, Proc. Nati. Acad. Sci. USA 77: 2197 ( 1980)). The coding sequences for the heavy and light chains can comprise cDNA or genomic DNA. Once an antibody molecule of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) has been chemically synthesized or recombinantly expressed, it can be purified by any known method of purification of immunoglobulin molecules, or more generally of protein molecules, such as for example by chromatography (for example, ion exchange, affinity, particularly affinity to the specific antigen after protein A, and size exclusion column chromatography), centrifugation, differential solubility, or by any other standard technique for protein purification. In addition, to facilitate their purification, the antibodies of the present invention can be fused with heterologous polypeptide sequences that are described herein or are known in the art. Antibodies of the present invention include naturally purified products, products of synthetic chemical processes and products produced by recombinant techniques from a prokaryotic or eukaryotic cell, including for example bacterial, yeast, higher plant, insect and mammalian cells. Depending on the host employed in a recombinant production method, the antibodies of the present invention can be glycosylated or can be non-glycosylated. In addition, the antibodies of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. The antibodies of the invention can be chemically synthesized using known techniques (see for example Creighton, 1983, "Proteins: Structures and Molecular Principles," W. H. Freeman &; Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310: 05-111). For example, a peptide corresponding to an antibody of the invention can be synthesized using a peptide synthesizer. In addition, if desired, non-classical amino acids or chemical amino acid analogs may be introduced as a substitution or addition to the antibody polypeptide sequence. Non-classical amino acids include, without limitation, the D isomers of the common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, g-Abu, e-Ahx, acid 6-aminohexanoic, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulin, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro -amino acids, designer amino acids such as b-methylamino acids, Ca-methylamino acids, Na-methylamino acids and amino acid analogues in general. In addition, the amino acid can be D (dextrorotatory) or L (levorotatory). The invention encompasses antibodies that are differentially modified during or after translation, for example, by glycosylation, acetylation, phosphorylation, amidation, modification by known protecting / blocking groups, proteolytic cleavage, binding to an antibody molecule or other cellular ligand, etc. . Any of many chemical modifications can be carried out by known techniques, including without limitation specific chemical cleavage with cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc. Further post-translational modifications encompassed by the invention include for example N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends, attachment of chemical moieties to the amino acid backbone, chemical modifications of O-linked carbohydrate chains or N-linked, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The antibodies can also be modified with a detectable label, such as an enzymatic, fluorescent, radioisotopic or affinity tag, to allow detection and isolation of the antibody.

Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, glucose oxidase or acetyl cholinesterase; examples of suitable complexes with prosthetic group include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include biotin, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin; and examples of suitable radioactive material include a radioactive metal ion, for example alpha emitters such as for example 213Bi, or other radioisotopes such as for example iodine (13 l, 25l, 123l, 121l), carbon (14C), sulfur (35S ), tritium (3H), indium (115ml, 113ml, 12ln, 111ln), and technetium ("Te, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (03Pd), molybdenum (99 o), Xenon (133Xe), Fluorine (18F), 53Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 165Ho, 90Y, 47Sc, 186Re, 88Re, 1 2Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd , 69Yb, 5Cr, MMn 5Se, 113Sn, and 17Tn In specific embodiments, the antibodies of the invention can be labeled with europium, For example, the antibodies of the invention can be labeled with europium using the labeling equipment of the invention. Eu DELFIA (catalog # 1244-302, Perkin Elmer Life Sciences, Boston, assachusetts), following the manufacturer's instructions In specific embodiments, the antibodies of the invention bind to chelators macrocyclics useful for conjugating radiometal ions including, without limitation, 1ln, 177Lu, 90Y, 166Ho, 53Sm, 2 5Bi and 225Ac, with polypeptides. In a preferred embodiment, the radiometa ion! associated with the macrocyclic chelators attached to the antibodies of the invention is 11ln. In another preferred embodiment, the radiometal ion associated with the macrocyclic chelator bound to the antibody polypeptides of the invention is 90Y. In specific embodiments, the macrocyclic chelator is acid, 4,7,10-tetraazacyclododecane-N, N, N ", N", -tetraacetic (DOTA). In specific embodiments, the macrocyclic chelator is α- (5-isothiocyanato-2-methoxyphenyl) -, 4,7,10-tetraaza-cyclododecane-1, 4,7,10-tetraacetic acid. In other specific embodiments, DOTA binds to the antibody of the invention via a linker molecule. Examples of linker molecules useful for conjugating a macrocyclic chelator such as DOTA with a polypeptide are commonly known - see for example, DeNardo et al., Clin Cancer Res. 4 (0): 2483-90, 1998; Peterson and others, Bioconjug. Chem. 10 (4): 553-7, 1999; and Zimmerman and others, Nucí. Med. Biol. 26 (8): 943-50, 1999, which are incorporated herein by reference in their entirety. In addition, the patents of E.U.A. Nos. 5,652,361 and 5,756,065, which describe chelating agents that can be conjugated with antibodies, and methods for preparing and using them, are incorporated herein by reference in their entirety. In one embodiment, the antibodies of the invention are labeled with biotin. In other related embodiments, the biotinylated antibodies of the invention can be used for example as an imaging agent or as a means to identify one or more co-receptors of the TRAIL receptor or ligand molecules. The invention also provides chemically modified derivatives of the antibodies of the invention which may provide additional advantages such as increased solubility, stability and time of circulation in vivo or in vitro of the polypeptide or lower immunogenicity (see U.S. Patent No. 4,179,337). The chemical portions for modification can be selected from water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol and the like. The antibodies can be modified at random or predetermined positions within the molecule, and can include, one, two, three or more added chemical portions. The polymer can be any molecular weight and can be branched or unbranched. For polyethylene glycol, the preferred molecular weight for ease of handling and manufacturing is between about 1 kDa and 100 kDa (the term "about" indicating that in polyethylene glycol preparations, some molecules will weigh more and others less than the indicated molecular weight). Other sizes may be used depending on the desired therapeutic profile (for example the required duration of sustained release, the effects, if any, on biological activity, ease of handling, the degree or lack of antigenicity and other known effects of polyethylene glycol for a therapeutic or analogous protein). For example, polyethylene glycol can have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000 , 9500, 10,000, 10,500, 11, 000, 1 1, 500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa. As indicated above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in the US patent. No. 5,643,575; Morpurgo and others, Appl. Biochem. Biotechnol. 56: 59-72 (1996); Vorv et al., Nucleosides Nucleotides 18: 2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10: 638-646 (1999), whose descriptions are incorporated herein by reference. The polyethylene glycol molecules (or other chemical moieties) must be bound to the antibody by considering the effects on the functional or antigenic domains of the antibody. There are several joining methods available; see for example EP 0 401 384, which is incorporated herein by reference (coupling of PEG with G-CSF); see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (which report the pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol can be covalently linked via amino acid residues through a reactive group such as a free amino or carboxyl group. The reactive groups are those to which an activated polyethylene glycol molecule can be linked. Amino acid residues having a free amino group may include for example lysine residues and the N-terminal amino acid residue; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups can also be used as a reactive group to join the polyethylene glycol molecules. For therapeutic purposes, binding to an amino group is preferred, such as, for example, binding to the N-terminal group or to lysine. As suggested above, polyethylene glycol can bind to proteins, for example antibodies, by binding to any of several amino acid residues. For example, polyethylene glycol can be linked to proteins by means of covalent bonds with residues of lysine, histidine, aspartic acid, glutamic acid or cysteine. One or more reaction chemistries may be used to bind polyethylene glycol with the protein-specific amino acid residues (eg lysine, histidine, aspartic acid, glutamic acid or cysteine), or with more than one type of amino acid residue of the protein (for example lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof). Chemically modified antibodies may be specifically required at the N-terminus of the heavy chain or the light chain or both. Using polyethylene glycol as an illustration, from a variety of polyethylene glycol molecules one can select (by molecular weight, branching, etc.) the ratio of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mixture, the type of reaction of pegylation to be performed, and the method to obtain the N-terminally selected pegylated protein. The method for obtaining the N-terminally pegylated preparation (ie, the separation of this portion from other mono-pegylated portions if necessary) can be purification of the N-terminal pegylated material from a population of pegylated protein molecules. The selective chemical modification at the N-terminus can be carried out by means of reductive alkylation, which exploits the differential reactivity of different types of primary amino groups (lysine against N-terminal) available for modification in a particular protein. Under the appropriate reaction conditions a substantially selective modification of the N-terminal protein with a carbonyl group-containing polymer is achieved. As indicated above, the pegylation of the antibodies of the invention can be carried out by any of several methods. For example, the polyethylene glycol can be directly linked to the antibody or can be linked by means of an interposed linker. Delgado et al. Describe non-linker systems for linking polyethylene glycol to proteins: Crit. Rev. Thera. Drug Carrier Sys. 9: 249-304 (1992); see also Francis and others, Intern. J. of Hematol. 68: 1-18 (1998); patent of E.U.A. No. 4,002,531; patent of E.U.A. No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of which are incorporated herein by reference. A system for directly attaching polyethylene glycol to an antibody-free amino acid residue interposed employs three-ply MPEG, which is produced by modifying monomethoxy polyethylene glycol (MPEG) using tresyl chloride (CISO2CH2CF3). By reaction of the protein with three-fold MPEG, the polyethylene glycol directly binds with amino groups of the protein. In this manner, the invention includes antibody-polyethylene glycol conjugates produced by reacting the antibodies of the invention with a polyethylene glycol molecule having a 2,2,2-trifluoroethanesulfonyl group. Polyethylene glycol can also be linked with antibodies using several different interposed linkers. For example, the patent of E.U.A. No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses urethane linkers for linking polyethylene glycol with proteins. Antibody-polyethylene glycol conjugates can also be produced in which the polyethylene glycol is bound to the antibody by means of a linker, by reacting the antibodies with compounds such as MPEG-succnimidylsuccinate, MEPG activated with 1,1 '-carbonyldiimidazole, MPEG-2, 4,5-trichlorophenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG-succinant derivatives. WO 98/32466 discloses several additional polyethylene glycol derivatives and the reaction chemistries for linking polyethylene glycol to proteins; the full description is incorporated here as a reference. The pegylated antibody products produced using the reaction chemistries noted herein are included within the scope of the invention. The number of polyethylene glycol moieties attached to each antibody of the invention (ie, the degree of substitution) can also be varied. For example, the pegylated antibodies of the invention can be linked on average to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly, the average degree of substitution is within scales such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10- 12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 portions of polyethylene glycol per antibody molecule. Methods for determining the degree of substitution are set forth for example in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9: 249-304 (1992).

Characterization of anti-TR7 antibodies The antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) can also be described or specified in terms of their binding to TR7 polypeptides or fragments. or variants of TR7 polypeptides. In specific embodiments, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a dissociation constant or KD less than or equal to 5x10"2 M, 10 ~ 2 M, 5x10" 3 M, "3 M, 5x10" 4, 10"4, 5x10" 5 M, or 10"5 M. Most preferably, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a dissociation constant or KD less than or equal to 5x10"6 M, 10" 6, 5x10"7 M, 10" 7M, 5x10"8 M, or 10" 8 M. Most preferably, the antibodies of the invention bind TR7 polypeptides or fragments or variants thereof with a dissociation constant or KD less than or equal to 5x10"9 M, 1 (T9 M, 5x1CT10 M, 10" 10 M, 5x10"11 M, 10" 11, 5x10"12 M, 1 CT12 M, 5x 3M, 10"13, 5x10" 14 M, 10"14 M, 5x10" 15 M, or 0"15 M. The invention encompasses antibodies that bind TR7 polypeptides with a dissociation constant or KD that is within of any individual value of the indicated scales. specific antibodies, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a dissociation rate (k0ff) less than 5x10"2 s ~ 1, 10 ~ 2 s", 5x0"3 s 10"3 s" 1. More preferably, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a dissociation rate (k0ff) less than or equal to 5x10"4 s", 10"4 s-, 5x10" 5 s "1, or 10" 5 s "1, 5x10" 5 s ", 10" 6 s ", 5x10" 7 s "1 or 10" 7 s. "The invention encompasses antibodies that bind to TR7 polypeptides at a rate of dissociation (k0ff) which is within the individual values indicated in any of these scales In other embodiments, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a higher formation rate (kon) or equal to 103 M "1 s ~ 1, 5x103 M" 1 s "1, 104 M" 1 s "1 or 5x104 M" 1 s "1. Preferably, the antibodies of the invention bind TR7 polypeptides, or fragments or variants thereof, with a formation rate (kon) greater than or equal to 105 M "1 s" 1.5 × 10 5 M "s" 1, 106 M "1 s 'or 5x106 M" 1 s "1 or 107M" 1 s' The invention encompasses antibodies that bind to TR7 polypeptides with a formation rate (kon) that falls within the individual values indicated in any of these scales . The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) are immunospecifically bound to a human TR7 polypeptide or polypeptide variant or polypeptide fragment (SEQ ID NO: 3). In another embodiment, the antibodies of the invention immunospecifically bind to a simian TR7 polypeptide or polypeptide variant or polypeptide variant. In another embodiment, the antibodies of the invention are immunospecifically bound to a murine TR7 polypeptide, polypeptide fragment or variant of polypeptide. In one embodiment, the antibodies of the invention bind immunospecifically to TR7 human and simian polypeptides. In another embodiment, the antibodies of the invention bind immunospecifically to human TR7 polypeptides and murine TR7 polypeptides. Most preferably, the antibodies of the invention are preferably linked to human TR7 polypeptides compared to murine TR7 polypeptides. In preferred embodiments, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), are immunospecifically bound to TR7 polypeptides and do not cross-react with any other antigen. In preferred embodiments, the antibodies of the invention immunospecifically bind to TR7 polypeptides (eg, SEQ ID NO: 3, or fragments or variants thereof), and do not cross-react with one or more additional members of the polypeptides of the family of tumor necrosis factor receptors (eg TR1, TR5, TR10, BCMA, TACI, CD30, CD27, OX40, 4-1 BB, CD40, NGFR, TNFR1, TNFR2, Fas and NGFR). In another embodiment, the antibodies of the present invention (including molecules that comprise, or alternatively consisting of, antibody fragments or variants thereof), immunospecifically bind to TR7 polypeptides and cross-react with other antigens. In other embodiments, the antibodies of the invention bind immunospecifically to TR7 polypeptides (e.g., SEQ ID NO: 3, or fragments or variants thereof), and cross-react with one or more additional members of the polypeptides of the receptor family. of the tumor necrosis factor (for example, TR1, TR5, TR10, BCMA, TACI, CD30, CD27, OX40, 4-1 BB, CD40, NGFR, TNFR1, TNFR2, Fas and NGFR). In a preferred embodiment, the antibodies of the invention are preferably linked to TR7 (SEQ ID NO: 3), or fragments and variants thereof, with respect to their ability to bind to TR1, TR4, TR5 or TR10 (SEQ ID NOs: 5, 1, 2, and 5) or fragments or variants thereof. In other preferred embodiments, the antibodies of the invention bind preferentially to TR7 and TR4 (SEQ ID NOs: 3 and 1), or fragments and variants thereof, with respect to their ability to bind to TR1, TR5 or TR10 (SEQ. ID NOs: 5, 2 and 4), or fragments or variants thereof. In other preferred embodiments, the antibodies of the invention bind to TR1, TR7, TR5, TR4, and TR10 (SEQ ID NOs: 5, 1, 2, 3, and 4). The ability of an antibody to preferentially bind to an antigen compared to another antigen can be determined using any known method. By way of non-limiting example, an antibody can be considered to bind preferentially to a first antigen if the binding with said first antigen has a dissociation constant (KD) lower than the KD of the antibody for the second antigen. In another non-limiting embodiment, an antibody can be considered to preferentially bind to a first antigen if the binding to said first antigen has an affinity (ie, KD) that is at least an order of magnitude less than the KD of the antibody. for the second antigen. In another non-limiting embodiment, an antibody can be considered to preferentially bind to a first antigen if the binding to said first antigen has an affinity (ie, KD) that is at least two orders of magnitude lower than the KD of the antibody for the second antigen. In another non-limiting embodiment, an antibody can be considered to bind preferentially to a first antigen if the binding to said first antigen has a dissociation rate (k0ff) lower than the k0ff of the antibody for the second antigen. In another non-limiting embodiment, an antibody can be considered to preferentially bind to a first antigen if the binding to said first antigen has a k0ff that is at least an order of magnitude less than the k0ff of the antibody for the second antigen. In another non-limiting embodiment, an antibody can be considered to preferentially bind to a first antigen if the binding to said first antigen has a k0ff that is at least two orders of magnitude less than the k0ff of the antibody for the second antigen. The invention also encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) having one or more of the same biological characteristics as one or more of the antibodies described herein. By "biological characteristics" is meant the activities or properties of the antibodies in vitro or in vivo, such as, for example, the ability to bind TR7 polypeptides (eg, TRAIL receptors embedded in the membrane), the ability to stimulate biological activity mediated by TR7 (for example to stimulate apoptosis of cells expressing TR7, see example 3); the ability to substantially block the TR7 ligand (e.g., TRAIL (SEQ ID NO: 72), also known as AIM-I, international application No. WO 97/35899 and U.S. Patent No. 5,771, 223), or a fragment, variant or fusion protein thereof, which binds to the TRAIL receptor; see example 2; or the ability to positively regulate the expression of TR7 on the surface of the cells. Other biological activities that the antibodies against the TR7 polypeptides may have, include without limitation the ability to inhibit the biological activity mediated by TR7 (for example to inhibit the apoptosis of cells expressing TR7) or the ability to downregulate the expression of TR7 on the surface of the cells. Optionally, the antibodies of the invention will bind to the same epitope as by at least one of the antibodies specifically referred to herein. Said epitope binding can be determined routinely using known tests. The present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or vandals thereof), which stimulate biological activities mediated by TR7. In one embodiment, an antibody that stimulates the biological activities mediated by TR7 comprises, or alternatively consists of, a VH domain or a VL domain of at least one of the scFvs referred to in Table 1, or a fragment or vanant thereof. . In a specific embodiment, an antibody that stimulates biological activities mediated by TR7 comprises, or alternatively consists of, a VH or VL domain of any of the scFvs referred to in Table 1, or a fragment or variant thereof. The nucleic acid molecules encoding these antibodies are also encompassed by the invention. The present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which stimulate apoptosis of cells expressing TR7 (see example 3). In one embodiment, an antibody that stimulates apoptosis of cells expressing TR7 comprises, or alternatively consists of, a VH or VL domain of at least one of the scFvs referred to in Table 1, or a fragment or variant thereof. In a specific embodiment, an antibody that stimulates apoptosis of cells expressing TR7 comprises, or alternatively consists of, a VH domain and a VL domain of any of the scFvs referred to in Table 1, or a fragment or variant thereof. The nucleic acid molecules encoding these antibodies are also encompassed by the invention. In preferred embodiments, the present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which stimulate apoptosis of cells expressing TR7 equally well in the presence or absence of reagents of antibody entanglement, such as for example anti-lg Fe reactive cells (see for example example 3). In a specific embodiment, the antibodies of the present invention stimulate the apoptosis of HeLa cells, equally well in the presence or in the absence of an interlacing reagent of anti-Ig antibody. In another specific embodiment, the antibodies of the present invention stimulate the HeLa cell apoptosis, equally well in the presence and in the absence of an anti-Ig antibody interlacing reagent, in the presence of 2 pg / mL cycloheximide. In another embodiment, the antibodies of the present invention stimulate apoptosis of SW480 cells, either in the presence or in the absence of an anti-Ig antibody interlacing reagent. In another specific embodiment, the antibodies of the present invention stimulate apoptosis of SW480 cells, equally well in the presence or in the absence of an interlacing reagent of anti-lg Fe antibody, in the presence of 2 pg / mL of cycloheximide. In other preferred embodiments, the present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which stimulate apoptosis of cells expressing TR7, at least as well as an equal concentration (in terms eg of ng / mL) of the TRAIL polypeptide (including TRAIL polypeptide fragments, variants or fusion proteins) that stimulates apoptosis of cells expressing TR7 (see for example example 3). In a specific embodiment, the antibodies of the invention stimulate apoptosis of cells expressing TR7 more than an equal concentration (e.g. in terms of ng / mL) of TRAIL polypeptide (including TRAIL polypeptide fragments, variants or fusion proteins) that stimulates the apoptosis of cells that express TR7. In a specific embodiment, the antibodies of the invention stimulate HeLa cell apoptosis more than an equal concentration (in terms of eg ng / mL) of TRAIL polypeptide (including TRAIL polypeptide fragments, variants or fusion proteins) that stimulates apoptosis of cells expressing TR7. In another specific embodiment, the antibodies of the present invention stimulate HeLa cell apoptosis more than an equal concentration (in terms of eg ng / mL) of TRAIL polypeptide (including TRAIL polypeptide fragments, variants or fusion proteins) that stimulates apoptosis of cells expressing TR7 in the presence of 2 pg / mL of cycloheximide. In other preferred embodiments, the present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which further stimulate apoptosis of cells expressing TR7 when administered in combination with a chemotherapeutic drug, compared to the chemotherapeutic drug alone or the antibodies alone. In specific embodiments, the antibodies of the present invention further stimulate the apoptosis of cells expressing TR7 when administered in combination with topotecan, as compared to the topotecan alone or the antibodies alone. In specific embodiments, the antibodies of the present invention further stimulate apoptosis of cells expressing TR7 when administered in combination with cycloheximide, as compared to cyclohexidone alone or antibodies alone. The present invention also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which block or inhibit the binding of TRAIL with a TR7 polypeptide (see example 2). In one embodiment, an antibody that blocks or mimics the binding of TRAIL with TR7 comprises, or alternatively consists of, a VH or VL domain of at least one of the scFvs referred to in Table 1, or a fragment or variant thereof. In a specific embodiment, an antibody that blocks or inhibits the binding of TRAIL to TR7 comprises, or alternatively consists of, a VH domain and a VL domain of any of the scFvs referred to in Table 1, or a fragment or variant of the same. The nucleic acid molecules encoding these antibodies are also encompassed by the invention. The present invention also provides fusion proteins comprising, or alternatively consisting of, an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically binds to TR7 and a heterologous polypeptide . Preferably, the heterologous polypeptide in which the antibody is fused is useful for function or is useful for directing cells expressing TR7. In a specific embodiment, the invention encompasses bispecific antibodies in which an antibody binding site is specific for TR7 and the second antibody binding site is specific for a heterologous polypeptide such as TR4 or a tumor specific antigen. In an alternative preferred embodiment, the heterologous polypeptide to which the antibody is fused is useful for targeting the antibody to a tumor cell. In a modality, a fusion protein of the invention comprises, or alternatively consists of, a polypeptide having the amino acid sequence of one or more of the VH domains of an antibody of the invention or the amino acid sequence of one or more of the VL domains of an antibody of the invention, or fragments or variants thereof, and a heterologous polypeptide sequence. In another embodiment, a fusion protein of the present invention comprises, or alternatively consists of, a polypeptide having the amino acid sequence of one, two, three or more of the VH CDRs of an antibody of the invention, or the sequence of amino acids of one, two, three or more of the VL CDRs of an antibody of the invention, or fragments or variants thereof, and a heterologous polypeptide sequence. In a preferred embodiment, the fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody of the invention, or fragment or variant thereof, and a heterologous polypeptide sequence, said fusion protein binds immunospecifically to TR7. In another embodiment, a fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of at least one V H domain of an antibody of the invention and the amino acid sequence of at least one V L domain of a antibody of the invention, or fragments or variants thereof, and a heterologous polypeptide sequence. Preferably, the VH and VL domains of the fusion protein correspond to a single antibody of the invention (or a scFvs or Fab fragment). In another embodiment, a fusion protein of the invention comprises, or alternatively consists of, a polypeptide having the amino acid sequence of one, two, three or more of the VH CDRs of an antibody of the invention and the amino acid sequence of one, two, three or more of the VL CDRs of an antibody of the invention, or fragments or variants thereof, and a heterologous polypeptide sequence. Preferably, two, three, four, five, six or more of the VHCDR (s) or VLCDR (s) correspond to a single antibody of the invention (or a scFv or Fab fragment). The nucleic acid molecules encoding these fusion proteins are also encompassed by the invention. The antibodies of the present invention (including antibody fragments or variants thereof) can be characterized by a variety of forms. In particular, the ability of the antibodies and related molecules of the invention to bind immunospecifically to TR7 or a fragment or variant of TR7 can be tested, using techniques described herein or routinely modifying known techniques. Tests to determine the ability of the antibodies of the invention to bind immunospecifically to TR7 or to a fragment or variant of TR7 can be carried out in solution (for example: Houghten, Bio / Tech ñiques 13: 412-421 (1992)), in globules (for example: Lam, Nature 354: 82-84 (1991)), in chips (Fodor, Nature 364: 555-556 (1993)), in bacteria (for example: US Patent No. 5,223,409), in spores (for example: U.S. Patent Nos. 5,571, 698; 5,403,484; and 5,223,409), in plasmids (for example: Culi et al., Proc. Nati, Acad. Sci. USA 89: 1865-1869 (1992)) or in phage (for example: Scott and Smith, Science 249: 386-390 ( 1990), Devlin, Science 249: 404-406 (1990), Cwirla et al, Proc. Nati, Acad. Sci. USA 87: 7178-7182 (1990), and Felici, J. Mol. Biol. 222: 301- 310 (1991)) (each of these references is incorporated herein in its entirety as a reference). Identified antibodies that bind immunospecifically to TR7 or a TR7 fragment or variant can then be analyzed for their specificity and affinity for TR7 or a fragment or variant of TR7, using or routinely modifying the techniques described herein or known. The antibodies of the invention can be analyzed by any known method for determining immunospecific binding to TR7 polypeptides and cross-reactivity with other antigens. Immunoassays that can be used to analyze immunospecific binding and cross-reactivity include, without limitation, competitive and non-competitive test systems using techniques such as BIAcore analysis (see for example example 1), FACS analysis (activated cell sorter by fluorescence, see for example example 3), immunofluorescence, immunocytochemistry, radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoprecipitation tests, western blots, precipitin reactions, gel diffusion precipitin reactions , immunodiffusion tests, agglutination tests, complement fixation tests, immunoradiometric tests, fluorescent immunoassays, and protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see for example Ausubel et al., Eds, 1994, "Current Protocols in Molecular Biology", Vol. 1, John Wiley &Sons, Inc., New York, which is incorporated here as a reference in its entirety). Exemplary immunoassays are described below (but are not considered to be limiting). ELISA tests comprise preparing the antigen, coating the cavities of a 96-well microtiter plate with the antigen, washing the antigen that does not bind in the cavities, adding to the cavities the antibody of interest conjugated with a detectable compound such as a enzyme substrate (for example horseradish peroxidase or alkaline phosphatase), and incubate for a period; wash the unbound antibodies or the antibodies bound nonspecifically, and detect the presence of the antibodies specifically bound to the antigen that covers the cavity. In ELISA tests, the antibody of interest does not have to be conjugated to a detectable compound; instead it can add to the cavity a second antibody (which recognizes the antibody of interest), conjugated with a detectable compound. Alternatively, it is not necessary to apply the antigen directly to the cavity; instead, the ELISA plates can be coated with an anti-lg Fe antibody, and the antigen in the form of a TRAIL-Fc receptor fusion protein, can be linked to the anti-lg Fe coating plate. This may be convenient in order to maintain the antigenic protein (e.g. TR7 polypeptides) in a more natural conformation than it can have when applied directly on a plate. In another alternative, instead of coating the cavity with the antigen, the cavity can be coated with the antibody. In this case, the detectable molecule could be antigen conjugated to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase). The person skilled in the art will recognize the parameters that can be modified to increase the detected signal, as well as other variations of the known ELISA tests. For further description of the ELISA tests see for example Ausubel et al., Eds, 1994, "Current Protocols in Molecular Biology", Vol. 1, John Wiley & amp;; Sons, Inc., New York in 11.2.1. The binding affinity of an antibody (including a scFv or other molecule comprising, or alternatively consisting of, antibody fragments or variants thereof) for an antigen and the dissociation rate of an antibody-antigen interaction can be determined by means of competitive union tests. An example of a competitive binding test is a radioimmunoassay comprising the incubation of a labeled antigen (eg, a 3 H or 125 I labeled antigen), or a fragment or variant thereof, with the antibody of interest in the presence of increasing amounts of an unlabeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of the present invention for TR7 and the dissociation rates can be determined from the data by means of analysis of a Scatchard plot. Competition with a second antibody can also be determined using radioimmunoassays. In this case, a TR7 polypeptide is incubated with an antibody of the present invention conjugated to a labeled compound (e.g. a compound labeled with 3 H or 25 L) in the presence of increasing amounts of a second unlabeled anti-TR7 antibody. This type of competitive test between two antibodies can also be used to determine whether two antibodies bind to the same epitopes or to different epitopes. In a preferred embodiment, BIAcore kinetic analysis is used to determine the rates of formation and dissociation of binding of the antibodies (including antibody fragments or variants thereof) to a TRAIL receptor or fragments of a TRAIL receptor. BIAcore kinetic analysis comprises analyzing the binding and dissociation of chip antibodies with TRAIL receptors immobilized on their surface as described in detail in Example 1. Immunoprecipitation protocols generally comprise producing a lysis of a population of cells in a lysis buffer as buffer RIPA (NP-40 or Triton X-100 1%, sodium deoxycholate 1%, SDS 0.1%, NaCl 0.15 M, sodium phosphate 0.01 M at pH 7.2, Trasylo 1%) supplemented with protein phosphatase or inhibitors of protease (e.g. EDTA, PMSF, aprotinin, sodium vanadate); add the antibody of interest to the cell lysate; incubate for a period (for example 1 to 4 hours) at 40 ° C; adding sepharose globules of protein A or protein G to the cell lysate; incubate approximately 1 hour or more at 40 ° C; wash the globules in lysis buffer; and resuspend the beads in SDS / sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be determined for example by means of western blot analysis. The person skilled in the art will recognize the parameters that can be modified to increase the binding of the antibody to an antigen and reduce the background (for example by previously washing the cell lysate with sepharose beads). For further description about immunoprecipitation protocols see for example Ausubel et al., Eds, 1994, "Current Protocols in Molecular Biology", Vol. 1, John Wiley & Sons, Inc., New York on 10.16.1. The western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyachlamide gel (for example PAGE-SDS 8% -20%, depending on the molecular weight of the antigen); transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon; blocking the membrane in blocking solution (for example PBS with 3% BSA or defatted milk); wash the membrane in wash buffer (e.g., PBS-Tween 20); block the membrane with primary antibody (the antibody of interest) diluted with blocking buffer; wash the membrane in wash buffer; blocking the membrane with a secondary antibody (which recognizes the primary antibody, for example an anti-human antibody) conjugated to an enzymatic substrate (for example horseradish peroxidase or alkaline phosphatase) or radioactive molecule (for example 32p 0 125 | put it in lock damper; wash the membrane in a wash buffer; and detect the presence of the antigen. The person skilled in the art will recognize the parameters that can be modified to increase the detected signal and to reduce the background noise. For further discussion of western blot protocols, see for example Ausubel et al., Eds, 1994, "Current Protocols in Molecular Biology," Vol. 1, John Wiley & Sons, Inc., New York on 10.8.1.

Antibody conjugates The present invention encompasses antibodies (including antibody fragments or variants thereof) recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) to a heterologous polypeptide (or portion thereof, preferably at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 amino acids of the polypeptide ), to generate fusion proteins. It is not necessary that the fusion be direct, but that it can occur through linker sequences. For example, the antibodies of the invention can be used to direct heterologous polypeptides to particular cell types (eg, cancer cells), either in vitro or in vivo, by fusing or conjugating the heterologous polypeptides with antibodies of the invention that are specific for particular cell surface antigens, or that bind to antigens that bind to particular cell surface receptors. The antibodies of the invention can also be fused to albumin (including without limitation recombinant human serum albumin (see for example US Patent No. 5,876,969, issued March 2, 1999, EP 0413622, and US Patent No. 5,766,883, issued June 16, 1998, incorporated herein by reference)), resulting in chimeric polypeptides. In a preferred embodiment, the polypeptides or antibodies of the present invention (including fragments or variants thereof) are fused with the mature form of human serum albumin (i.e., amino acids 1-585 of human serum albumin as shown in Figures 1 and 2 of EP 0 322 094, which is incorporated herein by reference in its entirety). In another preferred embodiment, the polypeptides or antibodies of the present invention (including fragments or variants thereof) are fused with polypeptide fragments comprising, or alternatively consisting of, amino acid residues 1-z of human serum albumin, where z is an integer from 369 to 419, as described in the US patent No. 5,766,883, which is incorporated herein by reference in its entirety. Polypeptides or antibodies of the present invention (including fragments or variants thereof) may be fused to either the N- or C-terminus of the heterologous protein (eg Fe immunoglobulin polypeptide or human serum albumin polypeptide). The polynucleotides that encode fusion proteins of the invention are also encompassed by the invention. Such fusion proteins, for example, can facilitate purification and can increase the half-life in vivo. Antibodies fused or conjugated to heterologous polypeptides can also be used in in vitro immunoassays and purification methods using the known methods. See for example Harbor et al., Supra, and PCT publication WO 93/2 1232; EP 439,095; Naramura et al., Immunol. Lett. 39: 91-99 (1994); patent of E.U.A. No. 5,474,981; Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Immunol. 146: 2446-2452 (1991), which are hereby incorporated by reference in their entirety. The present invention further includes compositions comprising, or alternatively consisting of, heterologous polypeptides fused or conjugated to antibody fragments. For example, heterologous polypeptides can be fused or conjugated to a Fab fragment, an Fd fragment, an Fv fragment, an F (ab) 2 fragment or a portion thereof. Methods for fusing or conjugating polypeptides with antibody portions are known. See for example the patents of E.U.A. Nos. 5,356,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; the PTC publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc. Nati Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al., J. Immunol. 154: 5590-5600 (1995); and Vil and others, Proc. Nati Acad. Sci. USA 89: 357-11341 (1992) (said references are incorporated by reference in their entirety). Additional fusion proteins of the invention can be generated by means of gene mixing techniques, mixing of motifs, mixing of exons or codon mixing (collectively referred to as "DNA blending"). DNA mixing can be used for modulating the activities of the antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), said methods can be used to generate antibodies with altered activity (e.g., antibodies with higher affinities and lower dissociation.) See generally U.S. Patent Nos. 5,605,793, 5,811, 238, 5,830,721, 5,834,252, and 5,837,458, and Patten et al., Curr Opinion Biotechnol 8: 724-35 (1997); Harayama, Trends Biotechnol 16 (2): 76-82 (1998), Hansson, et al., J. Mol. Biol. 287: 265-76 (1999), and Lorenzo and Blasco, Biotechniques 24 (2): 308-13 (1998) (Each of these patents and publications is incorporated here in or totality as a reference). In one embodiment, the polynucleotides encoding the antibodies of the invention can be altered by subjecting them prior to recombination to random mutagenesis by means of trial and error PCR, random nucleotide insertion or other methods. In another embodiment, one or more portions of a polynucleotide encoding an antibody whose portions immunospecifically bind to TR7 can be recombined with one or more components, motifs, sections, parts, domains, fragments, etc., of one or more heterologous molecules. . In addition, the antibodies of the present invention (including antibody fragments or variants thereof) can be fused with marker sequences such as polypeptides to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine polypeptide, such as the tag provided by a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, California, 91311), among others, many of which They are commercially available. As described in Gentz et al., Proc. Nati Acad. Sci. USA 86: 821-824 (1989), for example, hexa-histidine provides convenient purification of the fusion protein. Other peptide labels useful for purification include, without limitation, the haemagglutinin label "HA", which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)) and the brand. FLAG® (Stratagene, La Jolla, California). The present invention also encompasses antibodies (including antibody fragments or variants thereof) conjugated to a diagnostic or therapeutic agent. Antibodies can be used diagnostically, for example, to monitor or predict the development or progression of a tumor as part of a clinical test procedure, for example to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody with a detectable substance. Examples of detectable substances include, without limitation, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals that utilize various positron emission tomographies, and non-radioactive paramagnetic metal ions. The detectable substance can be coupled or conjugated using the known techniques, either directly with the antibody, or indirectly by means of an intermediate (such as for example a linker known in the art). See, for example, the US patent. No. 4,741, 900, to see the metal ions that can be conjugated with antibodies for use as diagnostics in accordance with the present invention. Examples of suitable enzymes include, without limitation, horseradish peroxidase, alkaline phosphatase, beta-galactosidase or acetyl cholinesterase; examples of suitable complexes with prosthetic group include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include, without limitation, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes, without limitation, luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin; and examples of suitable radioactive material include, without limitation, iodine (2 I, 123 I, 125 l, 13 l), carbon (4 C), sulfur (35 S), tritium (3 H), indium (1 1 l, 12 l, 13 ml, 15 ml) , technetium ("Te, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (35Xe), fluorine (18F), 153Sm, 177Lu, 59Gd, 149Pm, 140La , 175B, 166Ho, 90Y, 7Sc, 86Re, 188Re, 142Pr, 105Rh and 97Ru In addition, an antibody of the invention (including a scFv or other molecule comprising, or alternatively consisting of, antibody fragments or variants thereof) ), can be coupled or conjugated to a therapeutic portion such as a cytotoxin, for example a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, for example alpha emitters such as for example 2 3 Bi, or other radioisotopes such as for example 103Pd, 135Xe, 13l, 68Ge, 57Co, 65Zn, 85Sr, 32P, 35S, 90Y, 53Sm, 153Qd i 169Ybj 51Crj 54Mn j 75ge > 90 ^ 117-j- ^ 186 ^ 188Re and 1 B6Ho £ n specific embodiments, an antibody or fragment thereof binds macrocyclic chelators that chelate radiometal ions, including without limitation, 177Lu, 90Y, 66Ho and 153Sm, to the polypeptides. In specific modalities, the macrocyclic chelator. it is 1, 4,7,10-tetraazacyclododecane-N, N ', N ", N'" -tetraacetic acid (DOTA). In other specific embodiments, DOTA is linked to an antibody of the invention or fragment thereof by means of a linker molecule. Examples of linker molecules useful for conjugating DOTA with a polypeptide are commonly known in the art - see for example DeNardo et al., Clin Cancer Res. 4 (10): 2483-90, 1998; Peterson and others, Bioconjug. Chem. 10 (4): 553-7, 1999; and Zimmerman and others, Nucí. Med. Biol. 26 (8): 943-50, 1999, which is incorporated herein in its entirety as a reference. Chelating molecules are known in the art. The chelating molecules can be linked to antibodies of the invention to facilitate the labeling of said antibodies with metal ions that include radionuclides or fluorescent labels. See for example Subramanian, R. and Meares, CF, "Bifunctional Chelating Agents for Radiometal-labeled monoclonal Antibodies," in "Cancer Imaging with Radiolabeled Antibodies (DM Goldenberg, Ed.) Kluwer Academic Publications, Boston; Saji, H.," Targeted delivery of radiolabeled imaging and therapeutic agents: bifunctional radio pharmaceuticals "Crit. Rev. Ther. Drug Carrier Syst. 16: 209-244 (1999); Srivastava SC and Mease R. C," Progress in research on ligands, nuclides and techniques for labeling monoclonal antibodies "Int. J. Rad. Appl. Instrum. B 18: 589-603 (1991); and Liu, S. and Edwards, DS," Bifunctional chelators for therapeutic lanthanide radiopharmaceuticals "Bioconjug., Chem. 12: 7 -34 (2001) Any chelator that can be covalently linked to an antibody can be used in accordance with the present invention The chelator may further comprise a linker portion that connects the chelator portion to the antibody. anticue The compounds of the invention are linked to an acyclic chelator such as diethylenetriamno-N, N, N ', N ", N" -pentaacetic acid (DPTA), DPTA analogs and DPTA derivatives. As non-limiting examples, the chelator may be 2- (p-isothiocyanatobenzyl) -6-methyldiethylenetriaminepentaacetic acid (1B4-DPTA, also known as X-DPTA), 2-methyl-6- (rho-nitrobenzyl) -1 acid, 4,7-triazaheptane-N, N, N ', N ", N" -pentaacetic (nitro-1 B4M-DTPA or nitro-MX-DTPA); 2- (p-isothiocyanatobenzyl) -cyclohexyldietlentriaminepentaacetic acid (CHX-DTPA), or N- [2-amino-3- (rho-nitrophenyl) propyl] -trans-cyclohexane-1,2-d acid Amino- N, N ', N "-pentaacetic (nitro-CHX-A-DTPA) In another embodiment, the antibodies of the invention are linked to an acyclic terpyridine chelator such as 6,6" -bis [[N , N, N ", N" -tetra (carboxymethyl) amino] methyl] -4 '- (3-amino-4-methoxyphenyl) -2,2': 6 ', 2"-terpyridine (TMT-amine). In specific embodiments, the macrocyclic chelator that binds to the antibody of the invention is 1,4,7,10-tetraazacyclododecane-N, N ', N ", N" -tetraacetic acid (DOTA). In other specific embodiments, DOTA is linked to an antibody of the invention by means of a linker molecule. Examples of linker molecules useful for conjugating DOTA with a polypeptide are commonly known in the art - see for example DeNardo et al., Clin. Cancer Res. 4 (10): 2483-90,1998; Peterson and others, Bioconjug. Chem. 10 (4): 553-7, 1999; and Zimmerman and others, Nucl. Med. Biol. 26 (8): 943-50, 1999, which are hereby incorporated by reference in their entirety. In addition, the patents of E.U.A. Nos. 5,652,361 and 5,756,065, which describe chelating agents that can be conjugated with antibodies, and methods for preparing and using the same, are incorporated herein by reference in their entirety. Although the patents of E.U.A. Nos. 5,652,361 and 5,756,065 focus on the conjugation of chelating agents with antibodies, the person skilled in the art could easily adapt the method described herein to conjugate chelating agents with other polypeptides. Bifunctional chelators based on macrocyclic ligands in which conjugation is by means of an activated arm or a functional group attached to the carbon skeleton of the ligand can be used as described by M. Moi et al., J. Amer. Chem. Soc. 49: 2639 (1989) (2-p-nitrobenzyl-1, 4,7, 10-tetraazacyclododecane-N, N ', N ", N" -tetraacetic acid); S. V. Deshpande et al., J. Nucl. Med. 31: 473 (1990); G. Ruser and others, Bioconj. Chem. 1: 345 (1990); C. J. Broan et al., J.C. S. Chem. Comm. 23: 1739 (1990); and C. J. Anderson et al., J. Nucl. Med. 36: 850 (1995). In one embodiment, the antibodies of the invention bind with a macrocyclic chelator, such as polyazamacrocyclic chelators, optionally containing one or more carboxy, amino, hydroxamate, phosphonate or phosphate groups. In another embodiment, the chelator is a chelator selected from the group consisting of DOTA, DOTA analogs and DOTA derivatives.

In one embodiment, suitable chelating molecules that can bind to the antibodies of the invention include DOXA (1-oxa-4,7,10-triazacyclododecanotriacetic acid), NOTE (1,4,7-triazacyclononotriacetic acid), TETA (acid) 1, 4.8, -tetraazacyclotetradecane-tetraacetic) and THT (4 '- (3-amino-4-methoxy-phenyl) -6,6"-bis (N', N'-dicarboxymethyl-N-methyl) drazino) -2,2 ': 6 \ 2"-terpyridine), and analogs and derivatives thereof. See for example Ohmono et al., J. Med. Chem. 35: 157-162 (1992); Kung et al., J. Nucí. Med. 25: 326-332 (1984); Jurisson et al., Chem. Rev. 93: 1137-156 (1993); and the patent of E.U.A. No. 5,367,080. Other suitable chelators include the chelating agents described in the U.S. Patents. Nos. 4,647,447; 4,687,659; and 4,885,363; EP-A-71564; W089 / 00557; and EP-A-232751. In another embodiment, suitable macrocyclic carboxylic acid chelators that can be used in the present invention include 1,4,7,10-tetraazacyclododecane-N, N, 'N ", N" -tetraacetic acid (DOTA); 1, 4,8, 12-tetraazacyclopentadecane-N, N ', N ", N"' - tetraacetic acid (15N4); 1, 4,7-triazacyclononane-N, N ', N "-triacetic acid (9N3); 1, 5,9-triaza-cyclododecane-N, N', N" -triacetic acid (12N3); and 6-bromoacetamido-benzyl-1,4,8,11-tetraazacyclotetradecane-N, N ', N ", N"' - tetraacetic acid (BAT). A preferred chelator that can bind antibodies of the invention is a- (5-isothiocyanato-2-methoxyphenyl) -1,4,7,10-tetraazacyclododecan-1,4,7,10-tetraacetic acid, which also it is known as MeO-DOTA-NCS. A salt or ester of a- (5-isothiocyanato-2-methoxyphenyl) -1,4,7,10-tetraazacyclododecane-1, 4,7,1-tetraacetic acid may also be used. The antibodies of the invention to which chelators are covalently bound as described, can be labeled (via the chelator coordination site) with radionuclides that are suitable for therapeutic, diagnostic, or both therapeutic and diagnostic purposes. Examples of suitable metals include Ag, At, Au, Bi, Cu, Ga, Ho, In, Lu, Pb, Pd, Pm, Pr, Rb, Re, Rh, Se, Sr, Te, TI, Y, and Yb. Examples of the radionuclides used for diagnostic purposes are Fe, Gd, 1 1ln, 67Ga, or 68Ga. In another embodiment, the radionuclide used for diagnostic purposes is 1 ln or 67Ga. Examples of radionuclides used for therapeutic purposes are 166Ho, 165Dy, 90Y, 115ml, 52Fe or 72Ga. In one embodiment, the radionuclide used for diagnostic purposes is 166Ho or 90Y. Examples of radionuclides used for both therapeutic and diagnostic purposes include 153Sm, 177Lu, 159Gd, 75Yb or 47Sc. In one embodiment, the radionuclide is 53Sm, 77Lu, 75Yb or 159Gd. Preferred metal radionuclides include a radionuclide selected from 90Y, 99mTc, 111ln, 47Sc, 67Ga, 51Ga, 51Cr, 177mSn, 67Cu, 167Tm, 97Ru, 188Re, 177Lu, 199Au, 47Sc, 67Ga, 5Cr, 177mSn, 67Cu, 167Tm, 95Ru , 188Re, 77Lu, 199Au, 203Pb and 141Ce. In a particular embodiment, the antibodies of the invention to which the chelators are covalently linked, can be labeled with a metal ion selected from the group consisting of 90Y, 111n, 177Lu, 166Ho, 2 5Bi and 225Ac. In addition, α-emitting radionuclides, such as 99mTc, 1 In, 67Ga and 69Yb have been used for diagnostic imagography, while β-emitters such as 67Cu, 111Ag, 186Re and 90Y are useful for applications in tumor therapy. Also, other radionuclides include emitters? such as 99mTc, 111ln, 67Ga and 169Yb, and ß emitters such as 67Cu, 11 Ag, 186Re, 188Re and 90Y, as well as other radionuclides of interest such as 211At, 2Bi, 177Lu, 86Rb, 105Rh, 153Sm, 198Au, 49Pm, 85Sr, 142Pr, 214Pb, 109Pd, 166Ho, 208TI and 44Sc. The antibodies of the invention to which the chelators are covalently linked can be labeled with the radionuclides described above. In another embodiment, the antibodies of the invention to which the chelators are covalently linked can be labeled with paramagnetic metal ions including transition metal ions and lanthanides, such as metals having atomic numbers 21-29., 42, 43, 44 or 57-71, in particular ions of Cr, V, Mn, Fe, Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho , Er, Tm, Yb and Lu. The paramagnetic metals used in the compositions for magnetic resonance imagography include the elements having atomic numbers 22 to 29, 42, 44 and 58-70. In another embodiment, the antibodies of the invention to which the chelators are covalently linked, can be labeled with fluorescent metal ions including lanthanides, in particular, La, Ce, Pr, Nd, Pm, Sm, Eu (for example; Eu), Gd, Tb, Dy, Ho, Er, Tm, Yb and Lu.

In another embodiment, the antibodies of the invention to which the chelators are covalently linked can be labeled with reporters containing heavy metal, including atoms of Mo, B, Si and W. The radiolabeled antibodies of the invention can be used not only to destroy cells to which they are attached, but they can also be useful in destroying neighboring cells. For example, the expression of TR7 may not be universal in all tumor cells. However, since the energy of certain radioactive decay events may encompass more than the diameter of a single cell, the radiolabelled antibodies of the invention can be used to kill cells that do not express TR7, for example cancer cells, but which are very close to the cells that do express TR7. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include, without limitation, paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracendione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propanolol, thymidine kinase, endonuclease, RNAse and puromycin, and fragments, variants or homologs thereof. Therapeutic agents include, without limitation, antimetabolites (e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g. mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU ), cyclotosfamide, busulfan, dibromomanitol, streptozotocin, mitomycin C and cis-dichlorodiammine platinum (II) (DDP), cisplatin), anthracyclines (for example daunorubicin (first daunomycin) and doxorubicin), antibiotics (for example dactinomycin (first actinomycin), bleomycin, mithramycin and anthramycin (AMC)), and antimitotic agents (for example vincristine and vinblastine). Known techniques can be applied to label the antibodies of the invention. Such techniques include, without limitation, the use of bifunctional conjugating agents (see for example US patents 5,756,065 us;. 5,714,71 1; 5,696,239; 5,652,371; 5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the content of which is incorporated herein by reference in its entirety) and direct coupling reactions (eg, Bolton-Hunter and chloramine T reaction). The antibodies of the invention that are conjugated can be used to modify a given biological response; the therapeutic agent or drug portion is not considered limited to classical chemical therapeutic agents. For example, the drug portion can be a protein or polypeptide having a desired biological activity. Such proteins may include, without limitation, a toxin such as abrin, ricin A, alpha toxin, pseudomonas exotoxin, or diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin; a protein such as factor tumor necrosis, alpha interferon, beta interferon, growth factor nerve growth factor, platelet derived plasminogen activator tissue, an apoptotic agent, for example TNF-alpha, TNF-beta, A1M I (see international publication No. WO 97/35899), AIM II (see for example international publication No. WO 97/34911), Fas ligand (Takahashi et al., Int. Immunol., 6: 1567-1574 (1994 )), VEGI (see international publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, for example angiostatin or endostatin; or modifying the biological response such as for instance lymphokines, nterleucina I (IL-1), interleukin 2 (IL-2), interleukin 6 (IL-6), colony stimulating factor macrophage granulocyte (GM-CSF) , granulocyte colony stimulating factor (G-CSF), or other growth factors. The antibodies of the invention (including antibody fragments or variants thereof) can also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, without limitation, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. Techniques for conjugating a therapeutic moiety with antibodies are well known, see for example, Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy," in "Monoclonal Antibodies And Cancer Therapy," Reisfeld et al. (Eds.), p. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom and other "Antibodies for Drug Delivery", in "Controlled Drug Delivery" (2nd ed.), Robinson et al. (Eds.), P. 623-53 (Marcel Dekker, Inc. 987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in "Monoclonal Antibodies '84: Biological And Clinical Applications", Pinchera et al. (Eds.), P. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in "Monoclonal Antibodies For Cancer Detection And Therapy", Baldwin et al. (Eds.), P. 303-16 (Academic Press 985), and Thorpe et al. "The Preparation and Cytotoxic Properties of Antibody-Toxin Conjugates", Immunol. Rev. 62: 119-58 (1982). Alternatively, an antibody of the invention can be conjugated to a second antibody to form an antibody conjugate, as described by Segal in the U.S. patent. No. 4,676,980, which is incorporated herein by reference in its entirety. An antibody of the invention (which includes other molecules comprising, or alternatively consisting of, an antibody fragment or variant thereof), with or without a conjugated therapeutic moiety, administered alone or in combination with one or more cytotoxic factors or cytokines , it can be used as a therapeutic agent.

Uses of the Antibodies of the Invention The antibodies of the present invention can be used, for example, without limitation, to purify, detect and direct the polypeptides of the present invention, in diagnostic and therapeutic methods both in vitro and in vivo. For example, antibodies have use in immunoassays to qualitatively and quantitatively measure the concentration of TR7 polypeptides in biological samples. See, for example, Harlow et al., "Antibodies: A Laboratory Manual" (Coid Spring Harbor Laboratory Press, 2nd ed., 1988) (which is incorporated herein by reference in its entirety).

Immunological determination of phenotypes The antibodies of the invention can be used to immunologically determine the phenotype of cell lines and biological samples (see for example example 3). The translation product of the gene of the present invention may be useful as a cell-specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation or maturation of particular cell types, particularly tumors and cells of cells. Cancer. Monoclonal antibodies directed against an epitope or combination of specific epitopes will allow the examination and selection of cell populations that express the marker. Several techniques using monoclonal antibodies can be used to screen and select cell populations that express the markers, and include magnetic separation using magnetic beads coated with antibody, "separation" with antibody bound to a solid matrix (ie, plaque), and cytometry of flow (see for example U.S. Patent No. 5,985, 660; and Morrison et al., Celi, 96: 737-49 (1999)).

These techniques allow the examination of particular populations of cells, such as those that may have hematological malignancies (ie, minimal residual disease (MRD) in patients with acute leukemia) and "non-self" cells in transplants to prevent graft-versus-host disease. (GVHD). Alternatively, these techniques allow the examination and selection of hematopoietic stem and progenitor cells capable of experiencing proliferation or differentiation, as could be found in human umbilical cord blood.

Epitope Mapping The present invention provides antibodies (including antibody fragments or variants thereof), which can be used to identify epitopes of a TR7 polypeptide. In particular, the antibodies of the present invention can be used to identify epitopes of a human TR7 polypeptide (e.g., SEQ ID NO: 3) or a TR7 polypeptide expressed on human cells; a murine TR7 or a TR7 polypeptide expressed in murine cells; a rat TR7 receptor polypeptide or a TR7 polypeptide expressed in rat cells; or a monkey TR7 polypeptide or TR7 polypeptide expressed in monkey cells, using the techniques described herein or known. Fragments that function as epitopes can be produced by any conventional means (see, for example, Houghten, Proc. Nati, Acad. Sci. USA 82: 5131-5135 (1985), which is further described in U.S. Patent No. 4,711 , 21 1). The identified epitopes of the antibodies of the present invention can be used for example as vaccine candidates, that is, to immunize an individual to elicit antibodies against the natural forms of TR7 polypeptides.

Diagnostic Uses of the Antibodies The labeled antibodies of the invention (which include molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a TR7 polypeptide, can be used for diagnostic purposes to detect , diagnose, forecast or monitor diseases or disorders. In specific embodiments, the labeled antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), which specifically bind to a TR7 polypeptide, can be used for diagnostic purposes to detect, diagnose, predict or monitor diseases or disorders associated with the expression or aberrant activity of TR7. TR7 is expressed in primary cells and tissue samples that include T cells (both resting and activated T cells, for example T cells activated with recombinant IL-2), both resting and activated monocytes, for example monocytes activated with G- CSF, smooth muscle cells, chondrocytes, fibroblasts, endothelial cells, epithelial cells and skeletal muscle cells. TR7 is also expressed in cell lines that include, without limitation, the human fibrosarcoma cell line HT-1080; the human cervical carcinoma cell lines ME-180 and HeLa; the human malignant melanoma cell lines RPMI-7951, SK-MEL-1 and G361; the Jurkat cell line of adult human T-cell leukemia; the human uterine carcinoma cell lines SK-UT-1 and RL-95; the line of human lung carcinoma cells SK-MES-1; the human colon cancer cell lines, LS174T, HT29 and HCT1 16; the pancreatic cancer cell lines su.86.86 and CFPAC, the human ovarian cancer cell line TOV21G, and the human hepatocellular cancer cell lines HepG2 and SNU449, and the human neuroloblastoma cell line SK-N-SH. Cancers, as well as other tissue diseases corresponding to these cell lines, can be diagnosed or treated with the antibody compositions according to the invention. The invention provides for the detection of expression of a TR7 polypeptide comprising: (a) testing the expression of a TR7 polypeptide in a biological sample from an individual using one or more antibodies of the invention that immunospecifically bind to TR7; and (b) comparing the concentration of TR7 polypeptide in the biological sample with a standard concentration of TR7 polypeptide (e.g., concentration in normal biological samples). The invention provides for the detection of aberrant expression of a TR7 polypeptide comprising: (a) testing the expression of a TR7 polypeptide in a biological sample from an individual using one or more antibodies of the invention that bind nonspecifically to TR7; and (b) comparing the concentration of a TR7 polypeptide in the biological sample with a standard concentration of a TR7 polypeptide, for example in normal biological samples, whereby an increase or decrease in the tested concentration of a TR7 polypeptide in Comparison with the standard concentration of a TR7 polypeptide is indicative of aberrant expression. By "biological sample" is meant any fluid or cell obtained from an individual, body fluid, body tissue, body cell, cell line, tissue culture, or other source which may contain a protein or TR7 polypeptide mRNA. The body fluids include without limitation, serum, plasma, urine, synovial fluid, spinal fluid, saliva and mucosa. Tissue samples can be taken from virtually any tissue in the body. Tissue samples can also be obtained from autopsy material. Methods for obtaining tissue biopsies and mammalian body fluids are well known in the art. When the biological sample includes mRNA, the preferred source is a tissue biopsy. Antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that are immunospecifically bound to a TR7 polypeptide, can be used for diagnostic purposes to detect, diagnose, predict or monitor cancers and other hyperproliferative disorders, or diseases or conditions associated therewith.

The invention provides for the detection of aberrant expression of TR7 polypeptide comprising: (a) testing expression of TR7 polypeptide in a biological sample from an individual using one or more antibodies of the invention that immunospecifically bind to a TR7 polypeptide; and (b) comparing the concentration of a TR7 polypeptide with a standard concentration of TR7 polypeptide, for example in normal biological samples, whereby an increase or reduction in the tested concentration of TR7 polypeptide compared to the standard concentration of TR7 polypeptide, is indicative of a cancer or a hyperproliferative disorder. In some cases it has been shown that TRAIL selectively destroys tumor cells (see for example Oncogene 19: 3363-71 (2000)). This may be a result of differential expression of TRAIL receptors on normal and cancerous cells. Thus, in specific embodiments, an increase in the tested concentration of a TR7 polypeptide is indicative of a cancer or a hyperproliferative disorder. Other reports suggest that the reduction of TR7 expression in tumor cells may be a mechanism by which tumor cells evade the immune system (see for example Int. J. Oncol. 16: 917-25 (2000)) . Thus, in other specific embodiments, a reduction in the tested concentration of TR7 polypeptide is indicative of a cancer or a hyperproliferative disorder. One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of TR7 in an animal, preferably a mammal, and most preferably a human. In one embodiment, the diagnosis comprises: (a) administering to a subject (e.g., parenterally, subcutaneously, or intraperitoneally) an effective amount of a labeled antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments) or variants thereof) that binds immunospecifically to a TR7 polypeptide; (b) waiting a while after administration to allow the labeled antibody to be concentrated preferentially at sites of the subject where the TR7 polypeptide is expressed (and so that the unbound labeled molecule is removed to the basal level); (c) determine the basal level; and (d) detecting the labeled antibody in the subject, such that detection of antibody or fragments thereof above the baseline level, and above or below the level observed in a person without the disease or disorder, indicates that the subject has a particular disease or disorder associated with aberrant expression of TR7 polypeptide. The basal level can be determined with several methods that include comparing the amount of labeled molecule detected with a predetermined standard value for a particular system. It will be understood that the size of the subject and the magography system used will determine the amount of image portion necessary to produce diagnostic images. In case of a portion of radioisotope, for a human subject, the amount of radioactivity injected will generally vary from about 5 to 20 millicuries of 99Tc. The labeled antibody will then accumulate preferably at the location of cells that contain the specific protein. Imaging of live tumor is described in SW Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in "Tumor lmaging: The Radiochemical Detection of Cancer", SW Burchiel and BA Rhodes, eds., Masson Publishing Inc. (1982). Depending on several variables, including the type of brand used and the mode of administration, the interval after administration to allow the labeled molecule to concentrate preferentially at the sites in the subject, and for the molecule to marked unbound is eliminated to the basal level, is from 6 to 48 hours or 6 to 24 hours, or 6 to 12 hours., the interval after administration is 5 to 20 days or 5 to 10 days. In one embodiment, the monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disorder, for example one month after the initial diagnosis, six months after the initial diagnosis, one year after the initial diagnosis , etc. The presence of the labeled molecule can be detected in the patient using known methods for live screening. These methods depend on the type of brand used. The expert technicians will be able to determine the appropriate method to detect a particular brand. Methods and devices that can be used in the diagnostic methods of the invention include, without limitation, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI) and sonography. . In a specific embodiment, the molecule is labeled with a radioisotope and detected in the patient using a surgical instrument sensitive to radiation (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and detected in the patient using a fluorescence-sensitive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and detected in the patient using positron emission tomography. In another embodiment, the molecule is marked with a paramagnetic mark and detected in a patient using magnetic resonance imaging (MRI): Therapeutic uses of the antibodies One or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically bind to TR7 can be used locally or systemically in the body as a therapy The present invention is further directed to antibody-based therapies that include the administration of antibodies of the invention to an animal (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), preferably a mammal , and most preferably a human, to prevent or treat one or more of the diseases, disorders or conditions described. The therapeutic compounds of the invention include, without limitation, the antibodies of the invention and nucleic acids encoding the antibodies (and anti-idiotypic antibodies) of the invention as described herein. In one embodiment, the antibodies of the invention can be used to treat, alleviate or prevent diseases, disorders or conditions, including without limitation any of the diseases, disorders or conditions described herein. The treatment or prevention of diseases, disorders or conditions, includes, without limitation, alleviating the symptoms associated with such diseases, disorders or conditions. The antibodies of the invention can be provided in pharmaceutically acceptable compositions known in the art, or as described herein. In certain embodiments, the properties of the antibodies of the present invention as detailed in the following examples make the antibodies better therapeutic agents than the previously described TR7 binding antibodies.

Therapeutic Uses of Antibodies to Treat Cancer In highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate cancer. In other highly preferred embodiments, antibodies of the invention that bind to a TR7 polypeptide are used to treat, prevent or alleviate cancer. In specific embodiments, the antibodies of the invention are used to inhibit the progression or metastasis of cancers and other related disorders. Cancers and related disorders include, without limitation, colon cancer, cervical cancer, leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (eg. examples are chronic myelocytic leukemia (granulocytic) and chronic lymphocytic leukemia), polycythemia vera, lymphomas (for example, Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease and solid tumors including, without limitation, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphanangiosarcoma, lymphangio-endotheliosarcoma, sinovioma, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, pancreatic cancer, breast cancer, cancer ovarian, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm tumor, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma , melanoma, neuroblastoma and retinoblastoma. In highly preferred modalities, the antibodies of the invention that bind to TR7 and stimulate the apoptosis of cells expressing TR7, are used to treat, prevent or alleviate renal cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate renal cancer. In highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate melanoma. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate melanoma. In highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate liver cancers such as hepatomas. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate liver cancers such as hepatomas. In highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate central nervous system cancers such as meduioblastoma, neuroblastoma and glioblastoma. In other preferred embodiments, the antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate central nervous system cancers such as medulloblastoma, neuroblastoma and glioblastoma. In highly preferred embodiments, antibodies of the invention that bind to TR7 and that stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate multiple myeloma. In other preferred embodiments, the antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate multiple myeloma. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and that stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate non-Hodgkin's lymphoma. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate non-Hodgkin's lymphoma. In highly preferred embodiments, antibodies of the invention that bind to TR7 and that stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate prostate cancer and metastatic prostate cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate prostate cancer and metastatic prostate cancer. The expression of the TRAIL TR7 receptor on lung carcinoma tissue, bladder carcinoma tissue and ovarian carcinoma tissue has been shown in accordance with the present invention. Additionally, it has been shown according to the present invention that the TRAIL TR7 receptor is expressed in primary tumor tissue of breast, colon, lung and stomach. Thus, in highly preferred embodiments, the antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat lung cancer, including but not limited to non-small cell lung cancers. In other preferred embodiments, the antibodies of the invention that bind to TR7 are used to treat lung cancer, including without limitation non-small cell lung cancers. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat bladder cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat bladder cancer. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat ovarian cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat ovarian cancer. In other highly preferred modalities, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7, are used to treat breast cancer and breast cancers that have metastases. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat breast cancer and breast cancers that have metastases. In other highly preferred embodiments, antibodies of the invention that bind TR7 and stimulate apoptosis of TR7 expressing cells are used to treat colon cancer or colorectal cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat colon cancer or colorectal cancer. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat stomach cancer. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat stomach cancer. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of TR7 expressing cells are used to treat, prevent or alleviate renal cancer, melanoma, pancreatic cancer and liver cancers such as hepatomas. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate renal cancer, melanoma, pancreatic cancer and liver cancers such as hepatomas. In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate leukemia. In other preferred embodiments, the antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate leukemia.

In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate chronic lymphocytic leukemia (CLL). In other preferred embodiments, the antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate chronic lymphocytic leukemia (CLL). In other highly preferred embodiments, antibodies of the invention that bind to TR7 and stimulate apoptosis of cells expressing TR7 are used to treat, prevent or alleviate myelodysplastic syndrome. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate myelodysplastic syndrome. In other highly preferred embodiments, antibodies of the invention that bind TR7 and stimulate apoptosis of TR7 expressing cells are used to treat, prevent or alleviate bone cancers including without limitation Ewing's sarcoma and osteosarcoma. In other preferred embodiments, antibodies of the invention that bind to TR7 are used to treat, prevent or alleviate bone cancers including without limitation Ewing's sarcoma. and osteosarcoma. In another embodiment, the antibodies of the invention that bind to TR7 and optionally stimulate apoptosis of cells expressing TR7, are used to treat diseases or disorders associated with increased cell survival or inhibition of apoptosis, including cancers (such as follicular lymphomas, carcinomas with p53 mutations and hormone-dependent tumors, including without limitation colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteobiastoma, osteoclastoma, osteosarcoma, chondro sarcoma , adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and rheumatoid arthritis and immune glomerulonephritis) and viral infections (such as herpes virus, virus of smallpox and adenovirus), graft-versus-host disease, acute graft rejection and chronic graft rejection. In preferred embodiments, the antibodies and antibody compositions of the invention are used to inhibit the growth, progression or metastasis of cancers, particularly those indicated above. In preferred embodiments, the antibodies and antibody compositions of the invention are not hepatotoxic either in vitro or in vivo. In preferred embodiments, the antibodies of the invention that are used to treat, prevent or alleviate the cancers described above bind specifically or preferentially to TR7. In other preferred embodiments, the antibodies of the invention that are used to treat, prevent or alleviate the cancers described above bind specifically or preferentially to TR7 and TR4.

Additional Therapeutic Uses of Antibodies In another embodiment, the invention provides methods and compositions for killing cells that express TR7 or inhibit its growth, comprising, or alternatively consisting of, administering to an animal in which said destruction or inhibition is desired. of cells expressing TR7, the antibody or antibody compositions of the invention (eg fragments and variants of antibody, antibody mixtures, antibody multimers, fusion proteins of the invention, and antibodies in combination with other therapeutic compounds such as agents chemotherapeutics), in an amount effective to destroy or inhibit the growth of cells expressing TR7. In one aspect, the present invention is directed to a method for increasing apoptosis induced by a ligand of the TNF family (especially TRAIL (SEQ ID NO: 72)), which includes administering to a cell expressing a TR7 polypeptide an effective amount of an antibody of the invention, preferably an anti-TR7 agonist antibody, capable of inducing or enhancing TR7-mediated signaling. In another aspect, the present invention is directed to a method for increasing apoptosis induced by a ligand of the TNF family (especially TRAIL (SEQ ID NO: 72)), which includes administering to a cell expressing a TR7 or TR4 polypeptide a effective amount of an antibody of the invention, preferably an agonist antibody that specifically binds both TR7 and TR4, capable of inducing or increasing signaling mediated by TR7 or TR4. Preferably, the signaling mediated by TR7 or TR4 is increased or induced by an antibody of the invention to treat a disease wherein apoptosis reduction or reduction of cytokine and adhesion molecule expression occurs. In one aspect, the present invention is directed to a method for inducing apoptosis of cells expressing TR7 or TR4, including administering to a cell expressing TR7 or TR4, an effective amount of an antibody of the invention, preferably an anti-agonist antibody. -TR7 or anti-TR7 and TR4 (that is, an antibody that binds immunospecifically to both TR7 and TR4), capable of inducing or increasing signaling mediated by the TRAIL receptor, especially signaling mediated by TR7 and TR4. In a further aspect, the present invention is directed to a method for inhibiting apoptosis induced by a ligand of the TNF family (especially TRAIL (SEQ ID NO: 72)), which includes administering to a cell expressing a TR7 polypeptide, a effective amount of an antibody of the invention, preferably an anti-TR7 antagonist antibody, capable of reducing signaling mediated by TR7. In another aspect, the present invention is directed to a method for inhibiting apoptosis induced by a ligand of the TNF family (especially TRAIL (SEQ ID NO: 72)), which includes administering to a cell expressing a TR7 or TR4 polypeptide, an effective amount of an antibody of the invention, preferably an antagonist antibody that specifically binds both TR7 and TR4, capable of reducing signaling mediated by TR4 or TR7. Preferably, signaling mediated by TR7 or TR4 is decreased to treat a disease where there is an increase in apoptosis or expression of NFkB. In one aspect, the present invention is directed to a method. for inhibiting apoptosis of cells expressing TR7 or TR4, which includes administering to a cell expressing TR7 or TR4 an effective amount of an antibody of the invention, preferably an anti-TR7 or anti-TR7 and TR4 antibody (ie, an antibody that binds nonspecifically to both TR7 and TR4), capable of reducing signaling mediated by the TRAIL receptor, especially signaling mediated by TR7 and TR4. By "agonist" of TR7 is understood the natural and synthetic compounds capable of increasing or enhancing the apoptosis mediated by the TRAIL receptor. By "antagonist" of TR7 is understood the natural and synthetic compounds capable of inhibiting the apoptosis mediated by the TRAIL receptor. It can be determined whether any candidate "agonist" or "antagonist" of the present invention can increase or inhibit apoptosis, respectively, using known assays of the cellular response to the ligand / receptor of the TNF family, including those described in greater detail below.

The antibodies of the invention may be used to treat, alleviate or prevent diseases, disorders or conditions associated with the expression or aberrant activity of TR7 or the TR7 ligand, including without limitation one or more of the diseases, disorders or conditions herein describe. The treatment or prevention of diseases, disorders or conditions associated with the expression or aberrant activity of TR7 or the aberrant expression or activity of the TR7 ligand includes, without limitation, alleviating the symptoms associated with such diseases, disorders or conditions. The antibodies of the invention can be provided in pharmaceutically acceptable compositions as are known in the art, or as described herein. In addition, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that activate biological activities mediated by the TRAIL receptor (eg, the induction of apoptosis in cells that express the TRAIL receptor), can be administered to an animal to treat, prevent, or alleviate a disease or disorder such as those described herein, particularly cancers and other hyperproliferative disorders. These antibodies can potentiate or activate all the biological activities of the TRAIL receptor or a subgroup thereof, for example by inducing a conformational change in the TRAIL receptor. In a specific embodiment, to treat, prevent or alleviate a disease or disorder in an animal, an antibody of the invention is administered which increases the activity of TR7 by at least 5%, at least 10%, by at least 15%. %, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, so at least 99%, at least twice, at least three times, at least four times, at least five times, at least ten times, at least twenty times, at least fifty times, or at least one hundred times with respect to the activity of TR7 in the absence of the antibody. In another embodiment, to treat, prevent or alleviate a disease or disorder in an animal, a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments or antibody variants, which increases the activity of TR7 by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% , at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least twice, at least three times, at least four times, per at least five times, at least ten times, at least twenty times, at least fifty times, or at least one hundred times with respect to the activity of TR7 in the absence of said antibodies or fragm antibodies or antibody variants. In addition, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that activate the biological activities mediated by TR7 (e.g., the induction of apoptosis in cells expressing TR7) , can be administered to an animal, to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of TR7 ligand, or inactivity of the TR7 ligand. These antibodies can potentiate or activate all the biological activities of the TRAIL receptor or a subset of them, for example inducing a conformational change in the TRAIL receiver. In a specific embodiment, to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of the TR7 ligand, or inactivity of the TR7 ligand, is administered to an animal an antibody of the present invention which increases the activity of TR7 by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, thus less 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least twice, at least three times, at least four times, at least five times, at least ten times, at least twenty times, at least fifty times, or at least one hundred times with respect to the activity of TR7 in the absence of the antibody. In another embodiment, to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7 or inactivity of TR7, or aberrant expression of the TR7 ligand or inactivity of the TR7 ligand, a combination is administered to an animal. of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments or antibody variants, which increases the activity of TR7 by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, so less 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95 %, at least 99%, at least twice, at least three times, at least four times, at least five times, at least ten times, at least Twenty times, at least fifty times, or at least one hundred times with respect to the activity of TR7 in the absence of said antibodies or antibody fragments or antibody variants. The antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that function as agonists or antagonists of a TRAIL receptor, preferably of transduction of the TR7 signal, are they can be administered to an animal to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of the TR7 ligand, or inactivity of the TR7 ligand. For example, the antibodies of the invention that mimic the binding action of TRAIL to TR7, all or in part, the TR7 agonists, can be administered to an animal to treat, prevent or alleviate a disease or disorder associated with expression. aberrant of TR7, the inactivity of TR7, the aberrant expression of the ligand of TR7, or the inactivity of the ligand of TR7. As an alternative example, the antibodies of the invention that interrupt or prevent the interaction between TR7 and its ligand, or inhibit, reduce or prevent signal transduction through TR7, can be administered to an animal to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of the TR7 ligand, or inactivity of the TR7 ligand. The antibodies of the invention which do not prevent TR7 from binding to its ligand but which inhibit or down-regulate TR7 signal transduction, can be administered to an animal to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, the inactivity of TR7, the aberrant expression of the ligand of TR7, or the inactivity of the TR7 ligand. The ability of an antibody of the invention to increase, inhibiting, positively regulating or negatively regulating the signal transduction of TR7, can be determined by the techniques described herein or known in the art. For example, TRAIL-induced receptor activation and activation of signaling molecules can be determined by detecting the association of adapter proteins such as FADD and TRADD with TR7.; by immunoprecipitation followed by western blot analysis (for example as described herein). In addition, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that activate biological activities mediated by TR7 (e.g., induction of apoptosis in cells expressing TR7) , can be administered to an animal to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of the TR7 ligand, or inactivity of the TR7 ligand. These antibodies can potentiate or activate all the biological activities of the TRAIL receptor or a subgroup thereof, for example by inducing a conformational change in the TRAIL receptor. In a specific embodiment, to treat, prevent or alleviate a disease or disorder associated with aberrant expression of TR7, inactivity of TR7, aberrant expression of the TR7 ligand, or inactivity of the TR7 ligand, is administered to an animal an antibody of the present invention that increases the activity of TR7 by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, so less 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least twice, at least three times, at least four times, at least five times, at least ten times, at least twenty times, at least fifty times or at least one hundred times, with respect to the activity of TR7 in the absence of the antibody. In another embodiment, to treat, prevent or ameliorate a disease or disorder associated with aberrant expression of TR7, or inactivity of TR7 or aberrant expression of the TR7 ligand or inactivity of the TR7 ligand, a combination is administered to an animal. of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments or antibody variants that increase the activity of TR7 by at least 5%, at least 10%, by at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% , at least 99%, at least twice, at least three times, at least four times, at least five times, at least ten times, at least Twenty times, at least fifty times or at least one hundred times, with respect to the activity of TR7 in the absence of said antibodies or antibody fragments or antibody variants. In a specific embodiment, to treat or alleviate a disease or disorder associated with aberrant expression of TR7, excessive function of TR7, aberrant expression of the TR7 ligand, or excessive function of the TR7 ligand, is administered to an animal an antibody of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that inhibits or down-regulates, in whole or in part, the activity of TR7 (e.g. stimulation of apoptosis), in at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, by at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% with respect to the activity of TR7 in the absence of the antibody. In another embodiment, to treat, prevent or alleviate a disease or disorder associated with the aberrant expression of TR7, excessive function of TR7, aberrant expression of TR7 ligand or excessive function of TR7 ligand, an antibody combination, a combination of antibody fragments, a combination of antibody variants, or a combination is administered to an animal. of antibodies, fragments or antibody variants, which inhibits or down-regulates the activity of TR7 by at least 95%, by at least 90%, by at least 85%, by at least 80%, by at least 75%, by at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% with respect to the activity of TR7 in the absence of said antibodies, antibody fragments or antibody variants. In one embodiment, therapeutic or pharmaceutical compositions of the invention are administered to an animal to treat, prevent or alleviate a disease or disorder associated with an increase in apoptosis, including without limitation, AIDS, neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease). , amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration), myelodysplastic syndromes (such as aplastic anemia), ischemic damage (for example caused by myocardial infarction, stroke and reperfusion injury), toxin-induced liver disease (eg caused by by alcohol), septic shock, cachexia and anorexia. In another embodiment, the therapeutic or pharmaceutical compositions of the invention are administered to a mammal to treat, prevent or alleviate bone marrow failure, for example aplastic anemia and myelodysplastic syndrome. The therapeutic or pharmaceutical compositions of the invention may also be administered to treat, prevent or alleviate rejection of organ or host-graft disease (GVHD) or the conditions associated therewith. Organ rejection occurs by cellular destruction of the transplanted tissue by means of an immune response of the host. Similarly, an immune response in the GVHD is also involved, but in this case the foreign transplanted immune cells destroy the tissues of the host. Cell death induced by effector functions of immune cells is apoptotic death. In this way, the administration of the antibodies of the invention (for example those that inhibit apoptosis) can be an effective therapy to prevent rejection of organ or GVHD. In another embodiment, the therapeutic or pharmaceutical compositions of the invention are administered to an animal to treat, prevent or alleviate infectious diseases. Infectious diseases include diseases associated with yeast infections, fungi, viruses and bacteria. Viruses associated with viral infections that can be treated or prevented according to this invention include, without limitation, retroviruses (e.g., human T-cell lymphotrophic virus (HTLV) type I and II, and human immunodeficiency virus (HIV)). ), herpes virus (eg, herpes simplex virus (HSV) type I and II, Epstein-Bar virus, HHV6-HHV8 and cytomegalovirus), arena virus (eg, Lassa fever virus), paramyxovirus (e.g. morbillivirus viruses, human respiratory syncytial viruses, mumps and pneumoviruses), adenoviruses, buniaviruses (for example hantaviruses), cornaviruses, fiioviruses (for example Ebola virus), flaviviruses (for example hepatitis C virus (HCV), yellow fever virus and Japanese encephalitis virus), hepadnivirus (e.g. hepatitis B virus (HBV)), orthomyovirus (e.g. influenza A, B and C viruses), papovavirus (e.g. papillomavirus), picomavirus (e.g. rhinovirus, enterovirus and virus of hepatitis A), pox viruses, reovirus (for example rotavirus), togaviruses (for example rubella virus), rhabdoviruses (for example rabies virus). Microbial pathogens associated with bacterial infections include, without limitation, Streptococcus pyogenes, Streptococcus pneumoniae, Neisseria gonorrhea, Neisseria meningitidis, Corynebacterium diphtheriae, Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Haemophilus influenzae, Klebsiella pneumoniae, Klebsielia ozaenae, Klebsiella rhinoscleromotis, Staphylococcus aureus, Vibrio cholerae, Escherichia coli, Pseudomonas aeruginosa, Campylobacter (Vibrio) fetus, Campylobacter jejuni, Aeromonas hydrophila, Bacillus cereus, Edwardsiella tarda, ersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Salmonella typhimurium, Treponema pallidum, Treponema pertenue, Treponema carateneum, Borrelia vincentii, Borrelia burgdorferi, Leptospira icterohemorrhagiae, Mycobacterium tuberculosis, Toxoplasma gondii, Pneumocystis carinii, Francisella tularensis, Brucella abortus, Brucella suis, Brucella melitensis, Mycoplasma spp., Rickettsia prowazeki, Rickettsia tsutsugumush i, Chlamydia spp., and Helicobacter pylori. In other embodiments, the antibodies and antibody compositions of the invention are used to treat, prevent or alleviate diseases associated with increased apoptosis, including without limitation, AIDS, neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, sclerosis). amyotrophic lateral, retinitis pigmentosa, cerebellar degeneration), brain tumor or disease associated with prions), autoimmune disorders (such as multiple sclerosis (rheumatoid arthritis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polyomyositis , systemic lupus erythematosus and glomerulonephritis and rheumatoid arthritis related to the immune system), myelodysplastic syndromes (such as aplastic anemia), graft-versus-host disease, ischemic damage (for example caused by myocardial infarction, stroke and reperfusion injury), liver injury (for example, injury the liver related to hepatitis, ischemia / reperfusion damage, cholestosis (damage to the bile ducts) and liver cancer); toxin-induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia. In preferred embodiments, anti-TR7 antagonist antibodies which prevent TRAIL from binding to the TRAIL receptors to which the antibodies bind but which do not transduce the biological signal that results in apoptosis are used to treat the diseases and disorders described above. . Many of the pathologies associated with HIV are mediated by apoptosis, including HIV-induced nephropathy and HIV encephalitis. Thus, in further preferred embodiments, the antibodies, preferably the anti-TR7 antagonist antibodies of the invention are used to treat AIDS and the pathologies associated with AIDS. Another embodiment of the present invention is directed to the use of antibodies of the invention to reduce TRAIL-mediated death of T cells in patients infected with HIV. In additional embodiments, the antibodies of the present invention, particularly anti-TR7 antagonist antibodies, are administered in combination with other T cell apoptosis inhibitors.

For example, Fas-mediated apoptosis has been implicated in the loss of T cells in individuals with HIV (Katsikis et al., J. Exp. Med. 181: 2029-2036, 1995). In this way, a patient susceptible to T-cell death mediated by Fas ligand and mediated by TRAIL, can be treated with an agent that blocks TRAIL / TR7 interactions and an agent that blocks Fas / Fas ligand interactions. Agents suitable for blocking the binding of the Fas-Fas ligand include, without limitation, soluble Fas polypeptides; soluble multimeric forms of Fas polypeptides (for example Fas / Fc dimers); anti-Fas antibodies that bind to Fas without transducing the biological signal that results in apoptosis; anti-Fas ligand antibodies that block the binding of the Fas ligand with Fas; and Fas ligand proteins that bind Fas but do not transduce the biological signal that results in apoptosis. Preferably, the antibodies used according to this method are monoclonal antibodies. Examples of agents suitable for blocking Fas / Fas ligand interactions, including blocking anti-Fas monoclonal antibodies, are described in International Application Publication No. WO95 / 10540, incorporated herein by reference. Suitable agents that also block the binding of TRAIL with a TR7, which can be administered with the antibodies of the invention, include without limitation, TR7 soluble polypeptides (for example a soluble form of OPG, TR5 (International Patent Publication No. WO 98). / 30693), a soluble form of TR7 (international publication No. WO 98/32856), TR4 / DR5 (publication of international application No. WO 98/41629), and TR10 (publication of international application No. WO 98 / 54202)); multimeric forms of soluble TR7 polypeptides; and TR7 antibodies that bind to TR7 without transducing the biological signal that results in apoptosis, anti-TRAIL antibodies that block the binding of TRAIL with one or more TRAIL receptors and TRAIL muteins that bind to TRAIL receptors but that do not transduce the biological signal that results in apoptosis. In the rejection of an allograft, the immune system of the recipient animal has not been prepared to respond because the immune system for the most part is only prepared by environmental antigens. The tissues of other members of the same species have not been presented in the same way as they have been presented, for example, viruses and bacteria. In the case of allograft rejection, immunosuppression regimens are designed to prevent the immune system from reaching the effector stage. However, the immune profile of xenograft rejection may resemble disease recurrence rather than allograft rejection. In the case of recurrence of disease, the immune system has already been activated, which is evident by the destruction of natural isieta cells. Therefore, in recurrent disease the immune system is already in the effector stage. The antibodies of the present invention (for example agonist antibodies of the invention) are capable of suppressing the immune response to both allografts and xenografts because the activated and differentiated lymphocytes in effector cells will express the TR7 polypeptides, and with them are susceptible to the compounds that increase apoptosis. In this way, the present invention also provides a method for creating privileged immune tissues. Antagonists of the invention can be used additionally in the treatment of inflammatory bowel disease. The antibodies and antibody compositions of the invention may be useful for treating inflammatory diseases, such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia and inflammatory bowel disease. In addition, due to the lymphoblast expression of the TR7 polypeptides, the antibodies and antibody compositions of the invention can be used to treat this form of cancer. further, antibodies and antibody compositions of the invention can be used to treat various chronic and acute forms of inflammation, such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia and inflammatory bowel disease. In one embodiment, the antibodies and antibody compositions of the invention can be used to treat cardiovascular disorders including peripheral artery disease, such as limb ischemia. Cardiovascular disorders include cardiovascular abnormalities such as arterioarterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar syndrome. Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel abnormalities, cross-linked heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger's complex, hypoplastic left heart syndrome, levocardia, tetralogy of Fallot, transposition of large vessels , double exit from the right ventricle, tricuspid atresia, persistent truncus arteriosus and septal defects of the heart such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher syndrome, Fallot trilogy, ventricular septal defects of the heart. Cardiovascular disorders also include heart diseases, such as arrhythmias, carcinoid heart disease, high heart rate, low heart rate, cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, edema heart disease, hypertrophy of the heart, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, cardiac rupture after infarction, ventricular septal rupture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous ), pneumopericardium, postperiocardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular complications of pregnancy, Scimitar syndrome, cardiovascular syphilis and cardiovascular tuberculosis.

Arrhythmias include sinus arrhythmias, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes syndrome, branch-bundle block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine syndrome, preexcitation syndrome, ahaim type, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardia and ventricular fibrillation. Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentrant tachycardia, ectopic atrial tachycardia, ectopic union tachycardia, sinoatrial nodal reentrant tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia. Heart valve diseases include aortic valve failure, aortic valve stenosis, heart murmurs, prolapse of the aortic valve, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis , pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid nerve disease, tricuspid valve insufficiency, and tricuspid valve stenosis. Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns syndrome, myocardial reperfusion injury, and myocarditis.

Myocardial ischemias include coronary diseases such as angina pectoris, coronary aneurysm, coronary arteriesclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction, and myocardial stunning. Cardiovascular diseases also include cardiovascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau disease, Klippel-Trenaunay-Weber syndrome, Sturge-Weber syndrome, angioneurotic edema, aortic diseases, Takayasu arteritis, aortitis, Leriche syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolism, thrombosis, erythromegaly, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, veno-occlusive disease pulmonary, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcer, vasculitis and insufficiency to venous Aneurysms include dissection aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, aneurysms of the heart, and iliac aneurysms. Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya's disease, renal artery obstruction, retinal artery occlusion, and thromboangitis obliterans. Cerebrovascular disorders include diseases of the carotid artery, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, breast thrombosis, Wallenberg, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency . The embolisms include air embolisms, embolisms of amniotic fluid, cholesterol embolisms, blue tongue syndrome, fatty emboli, pulmonary emboli and thromboembolism. Thromboses include coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg syndrome, and thrombophlebitis. Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injury, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's syndrome, Churg-Strauss syndrome, mucocutaneous lymph node syndrome, thromboangitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis. In one embodiment, the antibodies and antibody compositions of the invention are used to treat thrombotic microangiopathies. One such disorder is thrombotic thrombocytopenic purpura (TTP) (Kwaan, H.C., Semin.Hematol.:24:71 (1987)).; Thompson et al., Blood 80: 1890 (1992)). The Disease Control Center of the U.S. has reported increasing mortality rates associated with TTP (Torok et al., Am. J. Hematol, 50:84 (1995)). Plasmas of patients affected with TTP (including HIV-positive and HIV-negative patients) induce apoptosis of human endothelial cells of dermal microvascular origin, but not of large vessel origin (Laurence et al., Blood 87: 3245 (1996)). Therefore, it is thought that the plasma of TTP patients contains one or more factors that induce apoptosis directly or indirectly. As described in the international patent application No. WO 97/01715 (incorporated herein by reference), TRAIL is present in the serum of TTP patients, and probably has a role in the induction of apoptosis of microvascular endothelial cells. Another thrombotic microangiopathy is hemolytic-uremic syndrome (HUS) (Moake, J. L, Lancet, 343: 393 (1994), Melnyk et al., Arch. Intern. Med., 155: 2077 (1995), Thompson et al. above). Thus, in one embodiment, the invention is directed to the use of antibodies and antibody compositions of the invention to treat the condition that is often referred to as "adult HUS" (although it may also attack children). A disorder known as HUS associated with childhood diarrhea differs in etiology from adult HUS. In another embodiment, conditions characterized by coagulation of small blood vessels can be treated by the use of antibodies and antibody compositions of the invention. Such conditions include, without limitation, those described herein. For example, it is thought that heart problems seen in approximately 5% to 10% of pediatric patients with AIDS, involve coagulation of small blood vessels. Collapse of the microvasculature of the heart has been reported in patients with multiple sclerosis. As another example, the treatment of systemic lupus erythematosus (SLE) is contemplated. In one embodiment, antibodies and compositions of antibodies of the invention, preferably anti-TR7 antagonist antibodies of the invention, can be administered in vivo to a patient afflicted with a thrombotic microangiopathy. Thus, the present invention provides a method for treating a thrombotic microangiopathy, which involves the use of an effective amount of an antibody or antibody composition of the invention. Antibodies and antibody compositions of the invention can be used in combination with other agents useful for treating a particular disorder. For example, in an in vitro study reported by Laurence et al. (Blood 87: 3245 (1996)), some reduction of plasma TTP-mediated endothelial cell apoptosis was achieved by the use of an anti-Fas blocking antibody. , aurintricarboxylic acid or normal plasma depleted in cryoprecipitate. In this manner, a patient can be treated with an antibody or antibody composition of the invention, in combination with an agent that inhibits endothelial cell apoptosis mediated by the FAS ligand such as, for example, an agent described above. In one embodiment, antibodies of the invention and an anti-FAS blocking antibody are administered to a patient afflicted with a disorder characterized by thrombotic microangiopathy, such as TTP or HUS. Examples of blocking monoclonal antibodies directed against the FAS antigen (CD95) are described in the international patent application publication number WO 95/10540, incorporated herein by reference. The balance of natural occurrence between endogenous stimulators and inhibitors of angiogenesis is one in which the inhibitory influences predominate (Rastinejad et al., Cell 56: 345-355 (1989)). In those rare cases in which neovascularization occurs under normal physiological conditions, such as wound healing, organ regeneration, embryonic development and female reproductive processes, angiogenesis is strictly regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis, such as those that characterize the growth of solid tumors, these regulatory controls fail. Unregulated angiogenesis becomes pathological and supports the progression of many neoplastic and non-neoplastic diseases. Many serious diseases are dominated by abnormal neovascularization, including growth of solid tumors and metastases, arthritis, some types of eye disorders and psoriasis. See, for example, reviews by Moses and others, Biotech. 9: 710-714 (1991); Folkman et al., N. Engt. J. Med., 353: 1757-1771 (1995); Auerbach et al., J. Microvasc. Res. 29: 401-411 (985); Folkman, "Advances in Cancer Research", eds. Klein and Weinhouse, Academic Press, New York, p. 175-203 (1985); Patz, Am. J. Opthalmol. 94: 7 5-743 (1982); and Folkman et al., Science 221: 719-725 (1983). In many pathological conditions, the process of angiogenesis favors the disease state. For example, significant data have been accumulated suggesting that the growth of solid tumors depends on angiogenesis. See Folkman and Klagsbrun, Science 235: 442-447 (1987). The present invention provides treatment of diseases or disorders associated with neovascularization, by administration of an antibody or antibody compositions of the invention. Malignant and metastatic conditions that can be treated with the polynucleotides and polypeptides of the invention include, without limitation, those malignancies, solid tumors and cancers described herein, and known elsewhere in the art (for a review of such disorders, see Fishman and others, "Medicine", 2nd ed., JB Lippincott Co., Philadelphia (1985)). Moreover, ocular disorders associated with neovascularization which can be treated with an antibody or antibody composition of the invention include, without limitation, neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of premature macular degeneration, corneal graft neovascularization, and like other ocular inflammatory diseases, eye tumors and diseases associated with choroidal or iris neovascularization. See, for example, reviews by Waltman et al., Am. J. Ophthal. 85: 704-710 (1978), and Gartner et al., Surv. Ophtlzal. 22: 291-312 (1978). Additionally, disorders which can be treated with an antibody or antibody composition of the invention include, without limitation, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, healing delayed wound, granulations, hemophilic joints, hypertrophic scars, fractures nonunion , Osler-Weber syndrome, pyogenic granuloma, scleroderma, trachoma and vascular adhesions. The antibodies and antibody compositions of the invention are useful in the diagnosis and treatment or prevention of a wide range of diseases or conditions. Such diseases and conditions include, but are not limited to, cancer (e.g., cancers related to immune cells, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma, cancer associated with mutation or alteration of p53, brain tumor , bladder cancer, cervical cancer, colon cancer, colorectal cancer, non-small cell carcinoma of the lung, small cell carcinoma of the lung, stomach cancer, etc.), lymphoproliferative disorders (eg, lymphadenopathy), microbial infection ( for example, viral, bacterial, etc.) (eg, HIV-1 infection, HIV-2 infection, herpes virus infection (including, but not limited to, HSV-, HSV-2, CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection, smallpox virus infection, human papillomavirus infection, hepatitis infection (eg, HAV, HBV, HCV, etc.), Helicobacter pylori infection , Staphylococcus i nvasivos, etc.), parasitic infection, nephritis, bone disease (eg osteoporosis), atherosclerosis, pain, cardiovascular disorders (eg, neovascularization, hypovascularity or reduced circulation (eg, ischemic disease (eg myocardial infarction, stroke, etc.))), AIDS, allergy, inflammation, neurodegenerative disease (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration, etc.), graft rejection (acute and chronic) , disease of graft against host, diseases due to osteomyelodysplasia (for example, aplastic anemia, etc.), joint tissue destruction in rheumatism, liver disease (eg, acute and chronic hepatitis, liver injury and cirrhosis), autoimmune disease (eg, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus , autoimmune lymphoproliferative syndrome (ALPS), immune complex glomerulonephritis, autoimmune diabetes, autoimmune thrombocytopenic purpura, Grave's disease, Hashimoto's thyroiditis, etc.), cardiomyopathy (eg, dilated cardiomyopathy), diabetes, diabetic complications (eg, nephropathy diabetic, diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis, glomerulonephritis, septic shock and ulcerative colitis. The antibodies and antibody compositions of the invention 3 They are useful for promoting angiogenesis and wound healing (eg, wounds, burns and bone fractures). The antibodies and antibody compositions of the invention are also useful as an adjuvant for improving the immune sensitivity to a specific antigen, such as in antiviral immune responses. More generally, the antibodies and antibody compositions of the invention are useful in regulating (i.e., raising or reducing) an immune response. For example, the antibodies and antibody compositions of the invention may be useful in the preparation or recovery of surgery, trauma, radiotherapy, chemotherapy and transplantation, or may be used to increase the immune response or recovery in elderly and immunocompromised individuals. . Alternatively, the antibodies and antibody compositions of the invention are useful as immunosuppressant agents, for example, in the treatment or prevention of autoimmune disorders. In specific embodiments, the antibodies and antibody compositions of the invention are useful for treating or preventing chronic inflammatory, allergic or autoimmune conditions, such as those described herein or otherwise known in the art.

Therapeutic / prophylactic compositions and administration thereof The invention provides methods of treatment, inhibition and prophylaxis by administering, to a subject, an effective amount of antibody (or fragment or variant thereof) or pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, an antibody or fragment or variant thereof is substantially purified (ie, substantially free of substances that limit its effect or produce undesired side effects). The subject is preferably an animal including, but not limited to, animals such as cows, pigs, horses, chickens, dogs, dogs, etc., and is preferably a mammal, and more preferably a human. Formulations and methods of administration which may be used when the compound comprises a nucleic acid or an immunoglobulin; other administration routes and suitable formulations may be selected from those described hereinafter. Various delivery systems are known and can be used to administer an antibody or a fragment or variant thereof of the invention, for example, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antibody or antibody fragment, mediated endocytosis. by receptors (see, for example, Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987)), construction of a nucleic acid as part of a retroviral vector or other vector, etc. Introduction methods include, without limitation, the intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, intracerebral, epidural and oral routes. The compositions may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous coatings (eg, oral, rectal and intestinal mucosa, etc.), and may be administered together with other agents biologically active The administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; Intraventricular injection can be facilitated by the use of an intraventricular catheter, for example, attached to a reservoir, such as an Ommya reservoir. Pulmonary administration can also be used, for example, by an inhaler or nebulizer, and formulation with a dispersing agent in air. In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment.; this can be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, for example, in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous or gelatinous material, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a protein, including an antibody of the invention, care must be taken to use materials to which the protein is not absorbed.

In another embodiment, the composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249: 1527-1535 (1990); Treat et al., In "Liposomes in the Therapy of Infectious Disease and Cancer", López-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989), López-Berestein, ibid., pp. 3 17-327, see generally ibid.). In another embodiment, the composition can be delivered in a controlled release system. In one embodiment, a pump can be used (see Langer, cited above, Sefton, CRC Cr. Ref Biomed Eng 14: 20 1 (1987), Buchwald et al., Surgery 88: 507 (1980); Saudek et al. N. Engl. J. Med. 321: 574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Relay, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974), "Controlled Drug Bioavailability, Drug Product Design and Performance", Smolen and Ball (eds.), Wiley, New York (1984), Ranger and Peppas, J., Macromol, Sci. Rev. Macromol, Chem. 23: 71 (1983), see also Levy et al., Science 228: 190 (1985). ), During et al, Ann Neurol 25: 351 (1989), Howard et al, J. Neurosurg 71: 105 (1989)). In another embodiment, a controlled release system may be placed near the therapeutic agent, i.e., the brain, thus requiring only a fraction of the systemic dose (see, eg, Goodson, in "Medical Applications of Controlled Relay," cited above, vol.2, p. 115-138 (1984)). Other controlled-release systems are described in the review by Langer (Science 249: 1527-1535 (1990)).

In a specific embodiment wherein the composition of the invention is a nucleic acid encoding an antibody, the nucleic acid can be administered in vivo to promote the expression of its encoded antibody, constructing it as part of a suitable nucleic acid expression vector, and administering it so that it becomes intracellular, for example, by the use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by the use of microparticle bombardment (e.g. genes; Biolistic, Dupont), or by coating with lipids or cell surface receptors or transfectant agents, or by administering it in linkage to a homeotic box-like peptide, which is known to enter the nucleus (see, for example, Joliot et al., Proc. Nati, Acad. Sci. USA 88: 1864-1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly, and can be incorporated into the host cell DNA for expression, by homologous recombination. The present invention also provides pharmaceutical compositions. Said compositions comprise a therapeutically effective amount of an antibody or a fragment thereof, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the federal or state government, or listed in the United States Pharmacopoeia, or other Pharmacopoeia generally recognized for use in animals, and more particularly in humans. The term "vehicle" refers to a diluent, adjuvant, excipient or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including petroleum, animal, vegetable or synthetic, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is a preferred vehicle when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous solutions of dextrose and glyceroi can also be used as liquid carriers, in particular for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, clay, silica gel, sodium stearate, glyceryl monostearate, talcum, sodium chloride, dehydrated skimmed milk, glycerin, propylene glycol, water, ethanol, and the like. If desired, the composition may also contain minor amounts of wetting or emulsifying agents, or buffers. These compositions may take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations, and the like. The composition can be formulated as a suppository, with binders and traditional carriers such as triglycerides. The oral formulation may include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences", by E. W. Martin. Said compositions will contain a therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of vehicle, to provide the form for suitable administration to the patient. The formulation should favor the mode of administration. In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to relieve pain at the site of injection. In general, the ingredients are provided separately, or mixed in a unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container, such as a vial or sachet indicating the amount of active agent Where the composition is administered by infusion, it can be dispensed with an infusion flask containing saline or sterile pharmaceutical grade water. Where the composition is administered by injection, a sterile water vial for injection or saline may be provided, so that the ingredients can be mixed prior to administration. The compositions of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as derivatives of hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as the derivatives of sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. The amount of the composition of the invention that will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression or activity of a polypeptide of the invention can be determined by standard clinical techniques. In addition, in vitro tests can optionally be used to help identify optimal dosing scales. The precise dose that will be used in the formulation will also depend on the route of administration and the seriousness of the disease or disorder, and should be decided according to the judgment of the general practitioner and the circumstances of each patient. Effective doses can be extrapolated from dose-response curves derived from animal or in vitro model test systems. For antibodies, the dosage administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferably from 1 mg / kg to 10 mg / kg (e.g., 3 mg / kg or 5 mg / kg). kg) of the patient's body weight. In general, human antibodies have a longer half-life inside the human body than antibodies from other species, due to the immune response to foreign polypeptides. In this way, minor dosages of human antibodies and less frequent administration are often possible. Furthermore, the dosage and frequency of administration of the pharmaceutical or therapeutic compositions of the invention can be reduced by improving the uptake of the antibodies and penetration of the same into the tissues (for example, in the brain), by modifications such as, for example, , lipidation. The antibodies of the invention can be formulated in pharmaceutically acceptable carriers. A formulation of an antibody of the invention may comprise a buffer. Shock absorbers are well known in the art and can be applied usually to maintain the desired pH of the compositions of the invention in solution. Shock absorbers suitable for use in the preparation of a pharmaceutical composition of the invention include, for example, those described w. Shock absorbers suitable for use in the preparation of an antibody composition of the invention may include, without limitation, citrate, acetate, phosphate, carbonate, diphosphate, glycyl-glycine-piperazine-2HCl-NaOH; MES-NaOH-NaCl; TRIS-malic acid-NaOH; MES-NaOH; ACES-NaOH-NaCl; BES-NaOH-NaCl; MOPS-NaOH-NaCl; TES-NAOH-NaCI; MOPS-KOH; HEPES-NaOH-NaCl; TRIS-HCI; HEPPSO-NaOH; TAPS-NaOH-NaCl; HEPPS (EPPS) -NaOH; citric acid-disodium acid phosphate; boric acid-citric acid-potassium diacid phosphate-diethyl-barbituric acid-NaOH; citric acid-sodium citrate; sodium acetate-acetic acid; histidine; phosphate; phthalate acid potassium-NaOH; sodium salt of cacodylic acid-HCl; potassium dihydrogen phosphate disodium acid phosphate; potassium dihydrogen phosphate-NaOH; sodium diacid phosphate-disodium acid phosphate; Midazole-HCl; sodium tetraborate-boric acid; 2-amino-2-methyl-1,3-propanediol-HCl; Diethanolamine-HCI; potassium chloride-boric acid-NaOH; boric acid-NaOH-KCI; glycine-NaOH; and sodium carbonate-sodium acid carbonate. In one embodiment, the buffer is a citrate buffer or an acetate buffer. In another embodiment, the buffer includes an acetate buffer having a concentration of about 1 to about 50 mM and having a NaCl concentration of about 1 to about 500 mM. In another embodiment, the buffer includes an acetate buffer having a concentration of about 10 mM and having a NaCl concentration of about 140 mM. Suitable acetate buffers include acetate buffers having a concentration of about 1, 20, 25, 50, 75, 100, 200, 250, 300, 400 or 500 mM. Suitable solutions and buffers include those having a NaCl concentration of about 1, 50, 75, 100, 125, 140, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450 or 500 mM. Another suitable buffer is a HEPES buffer, in particular a HEPES buffer having a concentration of about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 mM. In another embodiment, the solution comprises a HEPES buffer having a concentration of about 50 mM.

In other embodiments, the antibodies of the invention are formulated in a citrate buffer solution having a pH on the scale of 5.5 to 6.5. In other embodiments, the antibodies of the invention are formulated in a citrate buffer solution having a pH of about or exactly 6.0. In other embodiments, the antibodies of the invention are formulated in a citrate buffer solution having a pH on the scale of 5.5 to 6.5 and also containing between 0 and 2.0%, preferably between 0 and 0.1%, and more preferably less 0.05%, of a surfactant such as Tween 80 or polysorbate 80. In one embodiment, the antibodies of the invention are formulated in 10 mM sodium citrate, 1.9% glycine, 0.5% sucrose and 0.02% polysorbate 80, pH 6.5. In other embodiments, the antibodies of the invention are formulated in a histidine buffer solution having a pH on the scale of 6.5 to 7.5. In other embodiments, the antibodies of the invention are formulated in a histidine buffer solution having a pH in the range of 6.5 to 7.5, and also containing between 0 and 2.0%, preferably between 0 and 0.1%, and more preferably less than 0.05%, of a surfactant such as Tween 80 or polysorbate 80. In other embodiments, the antibodies of the invention are formulated in a phosphate buffer solution having a pH in the range of 7.0 to 8.0. In other embodiments, the antibodies of the invention are formulated in a phosphate buffer solution having a pH on the scale of 7.0 to 8.0, and also containing between 0 and 2.0%, preferably between 0 and 0.1%, and more preferably less than 0.05%, of a surfactant such as Tween 80 or polysorbate 80. In general, the administration of products originating from a species or reactivity to a species (in the case of antibodies), which is the same species, is preferred. which belongs to the patient. Thus, in a preferred embodiment, human antibodies, fragments or variants (e.g., derivatives), or nucleic acids, are administered to a human patient for therapy or prophylaxis. It is preferred to use neutralizing antibodies or potent or high affinity in vivo inhibitors of the invention (including molecules comprising, or consisting alternatively of, antibody fragments or variants thereof) that immunospecifically bind TR7, or polynucleotides that encode antibodies that immunospecifically bind to TR7, for immunoassays and therapy of disorders related to polypeptides or TR7 polynucleotides, including fragments thereof. Said antibodies will preferably have an affinity for TR7 or fragments of TR7 polypeptides. Preferred binding affinities include those with a dissociation constant or KD less than or equal to 5 X 10'2 M, 10"2 M, 5 X 10" 3 M, 10"3 M, 5 X 10" 4 M, 10'4 M, 5 X 10'5 M or 10"5 M. More preferably, the antibodies of the invention bind to TR7 polypeptides or fragments or variants thereof, with a dissociation constant or KD less than or equal to 5 X 10"6 M, 0" 6 M, 5 X 10 ~ 7 M, 10"7 M, 5 X 10 M or 10. Even more preferably, the antibodies of the invention bind to TR7 polypeptides or fragments or variants thereof, with a dissociation constant or KD less than or equal to 5 X 10"9, 10" 9 M, 5 X 10"10 M, 10-10 M, 5 X 10"11 M, 10-11 M, 5 X 10" 12 M, 10"12 M, 5 X'13 M, 10" 13 M, 5 X 10"14 M, 10 ~ 14 M, 5 X 10"15 M or 10" 15 M. In a preferred embodiment, the antibodies of the invention induce apoptosis of cells expressing TR7. As described in more detail below, the antibodies of the present invention can be used alone or in combination with other compositions. The antibodies can additionally be fused recombinantly to a heterologous polypeptide at the amino or carboxyl terminus, or they can be chemically conjugated (including covalent and non-covalent conjugations) with polypeptides or other compositions. For example, the antibodies of the present invention can be fused in recombinant form, or can be conjugated with useful molecules such as labels in detection tests and effector molecules such as heterologous polypeptides, drugs, radionuclides or toxins. See, for example, PCT publications WO 92/08495; WO 91/14438; WO 89/12624; patent of E.U.A. No. 5,314,995; and EP 396,387. The antibody and antibody compositions of the invention can be administered alone or in combination with other therapeutic agents including, but not limited to, chemotherapeutic agents, antibiotics, antivirals, anti-retroviral agents, spheroidal and non-spheroidal anti-inflammatories, conventional immunotherapeutic agents, and cytokines The combinations may be administered concomitantly, for example, as a mixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also methods in which the combined agents are mixed separately but simultaneously, for example, as through separate intravenous lines in the same individual. Administration "in combination" further includes separate administration of one of the compounds or agents administered first, followed by the second. In preferred embodiments, the antibodies of the invention that are administered to an animal, preferably a human, for therapeutic uses, are multimeric antibodies. In specific embodiments, the antibodies of the invention are homodimeric IgG molecules. In other specific embodiments, the antibodies of the invention are homodimeric IgG1 molecules. In specific embodiments, the antibodies of the invention are homotrimeric IgG molecules. In other specific embodiments, the antibodies of the invention are trimeric IgG1 molecules. In other specific embodiments, the antibodies of the invention are multimers of higher order IgG molecules (e.g., tetramers, pentamers and hexamers). In other specific embodiments, the antibodies of the IgG molecules comprising the multimers of higher order IgO molecules are IgG1 molecules. Alternatively, the antibodies of the invention for therapeutic use can be administered in combination with entanglement agents known in the art including, without limitation, anti-IgG antibodies.

Combination therapies with anti-TR4 antibodies, TRAIL, apoptosis-inducing peptides or chemotherapeutic agents Anti-TR7 antibodies can be administered in combination with other anti-TR7 antibodies, TRAIL or chemotherapeutic agents. In specific embodiments, an antibody of the invention that specifically binds to TR7 is used or is administered in combination with an antibody that specifically binds to TR4. In another embodiment, antibodies specific for TR7 and TR4 are agonist antibodies that induce apoptosis of cells expressing TR7 or TR4 (eg, cells expressing TR7 and TR4). In a specific embodiment, the combination of treatment with anti-TR7 and treatment with anti-TR4, induces more apoptosis of cells expressing TR7 and TR4, than treatment with anti-TR7 antibodies or treatment with anti-TR4 antibodies alone. The anti-TR7 and anti-TR4 antibodies can be administered simultaneously, sequentially, or by a combination of simultaneous administration or sequence! throughout the dosing regimen. In another specific embodiment, anti-TR7 and anti-TR4 antibodies are used, or are administered in combination with a chemotherapeutic drug, such as those described herein (see, for example, below and example 3). In a particular embodiment, the synergistic induction of apoptosis resulting from treatment with anti-TR7 and anti-TR4 antibodies is more evident or more pronounced when anti-TR7 and anti-TR4 antibodies are used, or are administered in combination with a chemotherapeutic agent or an interlacing reagent. In a preferred embodiment, the compositions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered with the compositions of the invention include, without limitation, antibiotic derivatives (e.g., doxorubicin (adriamycin), bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (eg, fluorouracil, 5-FU, methotrexate, floxuridine, interferon alfa-2b, glutamic acid, plicamycin, mercaptopurine and 6-thioguanine); cytotoxic agents (eg, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin and vincristine sulfate); hormones (eg, medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene and testolactone); nitrogen mustard derivatives (for example, mephalene, chlorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids, and combinations (e.g., sodium phosphate of betamethasone); and others (eg, dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, etoposide, Topotecan, 5-fluorouracil, paclitaxel (Taxol), cisplatin, cytarabine and IFN-gamma, irinotecan (Camptosar, CPT-1 1) , irinotecan analogs, gemcitabine (GEMZAR ™) and oxaliplatin, nitrosourea compounds). In a specific embodiment, the antibodies and antibody compositions of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisone), or any combination of the CHOP components. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with Rituxmab. In another embodiment, the antibody and antibody compositions of the invention are administered with Rituxmab and CHOP or Rituxmab, and any combination of the CHOP components. In other preferred embodiments, the compositions of the invention are administered in combination with TRAIL polypeptides, or fragments or variants thereof, in particular from the soluble extracellular domain of TRAIL. In one embodiment, the compositions of the invention are administered in combination with other members of the TNF family, or antibodies specific to members of the TNF receptor family. Molecules TNF molecules unrelated to TNF, or TNF molecules may be administered with the compositions of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-the alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1 BBL, DcR3, OX40L, TNF-gamma (international publication No. WO 96 / 14328), TRAIL, AIM-II (international publication No. WO 97/3491 1), April (J. Exp. Med. 188 (6): 1185-1190), endocina-alpha (international publication No. WO 98 / 07880), TR6 (international publication No. WO 98/30694), OPG and neutrocina-alpha (international publication No. WO 98/18921, OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (international publication No. WO 96/34095), DR3 (international publication No. WO 97/35904), TR5 (international publication No. WO 98/30693), TR6 (int publication WO 98/30694 ernat No.), TR4 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892), TR10 (International Publication No. WO 98/54202), 312C2 (publication International No. WO 98/06842) and TR12, and soluble forms of CD154, CD70 and CD153. In one embodiment, the antibody compositions of the invention are administered in combination with apoptosis-inducing polypeptides. In a specific embodiment, the antibodies of the invention are administered in combination with protein Smac (second derived activator of caspases mitochondria), also known as protein binding DIABLO (IPA (apoptosis inhibitor) direct reduced pl) (number of GenBank access: NU063940, which is incorporated herein by reference in its entirety). Smac is a protein of 239 amino acids. The N-terminal 55 amino acids serve as a mitochondrial targeting sequence that is split after entering the mitochondria.

Apoptosis-inducing polypeptides can be delivered using techniques known in the art. For example, one way of supplying the Smac protein would be through the delivery of a nucleic acid encoding the mature or full-length form of Smac (amino acids 56-239 of GenBank accession number NU063940, a cytosolic form that prevents mitochondrial processing). Alternatively, the antibody compositions of the invention can be administered in combination with cell-permeable synthetic Smac peptides that are capable of inhibiting IAP proteins (eg, those containing amino acid residues 56-62 of GenBank accession number: NP063940; AVPIAQK as described in Chai et al. (2000) Nature 406: 855-862, and Fulda et al. (2002) Nature Medicine 8: 808-815, citations which are incorporated herein by reference in their entirety.

Additional combination therapies In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with an antimalarial agent, methotrexate, anti-TNF antibody, ENBREL ™ or sulfasalazine. In one embodiment, the antibody and antibody compositions of the invention are administered in combination with methotrexate. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with an anti-TNF antibody. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with methotrexate and anti-TNF antibody. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with sulfasalazine. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with methotrexate, anti-TNF antibody and sulfasalazine. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with ENBREL ™. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with ENBREL ™ and methotrexate. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with ENBRETL ™, methotrexate and sulfasalazine. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with ENBREL ™, methotrexate and sulfasalazine. In other embodiments, one or more antimalarial agents are combined with one of the combinations mentioned above. In a specific embodiment, the antibody and antibody compositions of the invention are administered in combination with an antimalarial agent (eg hydroxychloroquine), ENBREL ™, methotrexate and sulfasalazine. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with an antimalarial agent (for example hydroxychloroquine), sulfasalazine, anti-TNF antibody and methotrexate. Antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) can be administered alone or in combination with other therapeutic or prophylactic regimens (e.g., radiation therapy, chemotherapy, hormone therapy , immunotherapy, antitumor agents, anti-angiogenic agents and anti-inflammatory agents). This combinatorial therapy can be administered sequentially or concomitantly. Conventional nonspecific immunosuppressive agents that can be administered in combination with the antibody and antibody compositions of the invention, include without limitation, steroids, cyclosporin, cyclosporin analogs, cyclophosphamide, cyclophosphamide IV, methylprednisolone, prednisolone, azathioprine, FK-506, 15-deoxyspergualin and other immunosuppressive agents that act by suppressing the function of reactive T cells. In specific embodiments, the antibody and antibody compositions of the invention are administered in combination with immunosuppressants. Immunosuppressive preparations that can be administered with the antibody and antibody compositions of the invention include, without limitation, ORTHOCLONE ™ (OKT3), SANDIMMUNE ™ / NEORAL ™ / SANGDYA ™ (cyclosporine), PROGRAF ™ (tacrolimo), CELLCEPT ™ (mycophenolate), azathioprine, glucocorticosteroids, and RAPAMUNE ™ (sirolimus). In a specific embodiment, immunosuppressants can be used to prevent rejection of an organ or bone marrow transplant. In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with a steroid therapy. Steroids that can be administered in combination with the antibody and antibody compositions of the invention include, without limitation, oral corticosteroids, prednisone and methylprednisolone (for example methylprednisolone IV). In a specific embodiment, the antibody and antibody compositions of the invention are administered in combination with prednisone. In a further specific embodiment, the antibody and antibody compositions of the invention are administered in combination with prednisone and an immunosuppressive agent. The immunosuppressive agents that can be administered with the antibody and the antibody compositions of the invention and prednisone are those described herein and include, without limitation, azathioprine, cyclophosphamide and cyclophosphamide IV. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with methylprednisolone. In a further specific embodiment, the antibody and antibody compositions of the invention are administered in combination with methylprednisolone and an immunosuppressive agent. The immunosuppressive agents that can be administered with the antibody or antibody compositions of the invention and methylprednisolone, are those described herein and include, without limitation, azathioprine, cyclophosphamide and cyclophosphamide IV. The invention also encompasses the combination of the polynucleotides or polypeptides of the invention (or agonists or antagonists thereof) with other proposed or conventional hematopoietic therapies. Thus, for example, the polynucleotides or polypeptides of the invention (or agonists or antagonists thereof) can be combined with compounds that individually exhibit erythropoietic stimulatory effects, such as erythropoietin, testosterone, progenitor cell stimulators, similar growth factor to insulin, prostaglandins, serotonin, cyclic AMP, prolactin and triiodothyronine. Also encompassed are combinations of the antibody and antibody compositions of the invention with compounds generally used to treat aplastic anemia such as, for example, methenolene, stanozolol and nandrolone; for treating iron deficiency anemia, such as for example iron preparations; for treating malignant anemia, such as for example vitamin B-i2 or folic acid; and for treating hemolytic anemia such as, for example, adrenocortical spheroids, for example corticoids. See for example, Resegotti et al., Panminerva Medica, 23: 243-248 (1981); Kurtz, FEBS Letiers, 14a: 05-108 (1982); McGonigle et al., Kidney Int., 25: 437-444 (1984); and Pavlovic-Kantera, Expt. Hematol., 8 (sup 8) 283-291 (980), the content of which is incorporated herein by reference in its entirety. Compounds that increase the effects of erythropoietin or have synergy therewith are also useful herein as adjuvants, and include, without limitation, adrenergic agonists, thyroid hormones, androgens, hepatic erythropoietic factors, erythropoietins and erythrogens; see for example Dunn, "Current Concepts in Erythropoiesis", John Wiley and Sons (Chichester, England, 1983); Kalmani, Kidney Int., 22: 383-391 (1982); Shahidi, New Eng. J. Med., 289: 72-80 (1973); Urabe et al., J. Exp. Med., 149: 1314-1325 (1979); Billat et al., Expt. Hematol., 10: 35-140 (1982); Naughton et al., Acta Haemat, 69: 171-179 (1983); Cognote and others in the abstract 364 of Proceedings 7th Intl. Cong. of Endocrinology (Cd. Quebec, Quebec, 1-7 July 1984); and Rothman et al., 1982, J. Surg. Oncol., 20: 105-108 (1982). Methods for stimulating hematopoiesis comprise administering to a patient a hematopoietically effective amount (i.e., an amount that causes the formation of blood cells) of a pharmaceutical composition containing polynucleotides or polypeptides of the invention (or agonists or antagonists thereof) . The polynucleotides or polypeptides of the invention or agonists or antagonists thereof are administered to the patient by any suitable route, including, without limitation, parenteral, sublingual, topical, intrapulmonary and intranasal, and the techniques disclosed herein. The pharmaceutical composition optionally contains one or more members of the group consisting of erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, triiodothyronine, metholene, stanozolol and nandrolone, iron preparations , vitamin Bi2, folic acid or adrenocortical steroids. In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with hematopoietic growth factors. Hematopoietic growth factors that can be administered with the antibody and antibody compositions of the invention include, without limitation, LEUKINE ™ (SARGRAMOSTIM ™) and NEUPOGEN ™ (FILGRASTIM ™). In a further embodiment, the antibody and antibody compositions of the invention are administered alone or in combination with one or more anti-angiogenic agents. Antiangiogenic agents that can be administered with the antibody and antibody compositions of the invention include, without limitation, Angiostatin (Entremed, Rockville, Maryland), Troponin-1 (Boston Life Sciences, Boston, assachusetts), and Anti-invasive Factor, retinoic acid and its derivatives, paclitaxel (Taxol), Suramin, tissue inhibitor of metalloproteinase-1, tissue inhibitor of metalloproteinase-2, VEGI, plasminogen activator inhibitor 1, plasminogen activator inhibitor 2, and various forms of lighter transition metals of "group d". The lighter transition metals of "group d" include, for example, species of vanadium, molybdenum, tungsten, titanium, niobium and tantalum. Said target species! of transition can form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes. Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as for example ammonium metavanadate, sodium metavanadate and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate, including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrate. Representative examples of tungsten and molybdenum complexes include oxo complexes. Suitable tungsten oxo complexes include tungsten oxide and tungsten complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include tungsten oxide (IV) and tungsten oxide (VI). Suitable oxo molybdenum complexes include complexes of molybdate, molybdenum oxide and molybdenyl. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum oxide (VI), molybdenum oxide (VI) and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable complexes of tungsten and molybdenum include the hydroxo derivatives thereof, derived for example from glycerol, tartaric acid and sugars. A wide variety of other anti-angiogenic factors can also be used in the context of the present invention. Representative examples include, without limitation, platelet factor 4; protamine sulfate; Sulphated chitin derivatives (prepared from queen crab shells; Murata et al., Cancer Res. 51: 22-26, 1991); polysaccharide complex and sulphated peptidoglycan (SP-PG; the function of this compound can be enhanced with the presence of steroids such as estrogen and tamoxifen citrate); staurosporine; modulators of matrix metabolism including, for example, proline analogs, cishydroxyproline, d, L-3,4-dehydroproline, thiaproline, alpha.alpha.-dipyridyl, aminopropionitrile fumarate; 4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; methotrexate; mitoxantrone; heparin; interferons; serum macroglobulin 2; ChlMP-3 (Pavloff et al., J. Bio.

Chem. 267: 17321-17326, 1992); Chymostatin (Tomkinson et al., Biochem J. 286: 475-480, 1992); cyclodextrin tetradecasulfate; eponemycin; camptothecin; fumagillin (Ingber et al., Nature 348: 555-557, 1990); sodium and gold thiomalate ("GST"; Matsubara and Ziff, J. Clin.Invest.79: 1440-1446, 1987); serum anticolagenase; alpha2-antiplasmin (Holmes et al., J.

Biol. Chem. 262 (4): 1659-1664, 1987); Bisantrene (National Cancer Institute); lobenzarit disodium (disodium salt of N- (2) -carboxyphenyl-4-chloroanthronilic acid or "CCA"; Takeuchi et al., Agents Actions 36: 312-316, 1992); and metalloproteinase inhibitors such as BB94. Additional anti-angiogenic factors that can also be used in the context of the present invention include thalidomide (Celgene, Warren, New Jersey); angiostatic steroid; AGM-1470 (H. Brem and J.

Folkman, J Pediatr. Surg. 28: 445-51 (1993)); an alpha v beta 3 integrin antagonist (C. Storgard et al., J Clin Invest. 103: 47-54 (1999)); carboxyminolmidazole; carboxyamidotriazole (CAI) (National Cancer Institute, Bethesda, Maryland); Conbretastatin A-4 (CA4P) (OXiGENE, Boston, Massachusetts); Squalamine (Magainin Pharmaceuticals, Plymouth Meeting, Pennsylvania); TNP-470, (Tap Pharmaceuticals, Deerfield, Illinois); ZD-0101 AstraZeneca (London, United Kingdom); APRA (CT2584); Benefin, Byrostatin-1 (SC359555); CGP-41251 (PKC 412); CM101; Dexrazoxane (ICRF187); DMXAA; endostatin; flavopridiol; genestein; GTE; IrmTher; Iressa (ZD1839); octreotide (Somatostatin); Panretin; pentacylamine; Photopoint; PI-88; Prinomastat (AG-3540) Purlytin; Suradista (FCE26644); tamoxifen (Nolvadex); tazarotene; tetrathiomolybdate; Xeloda (Capecitabine); and 5-fluorouracil. Anti-angiogenic agents that can be administered in combination with the compounds of the invention can function through a variety of mechanisms including, without limitation, inhibition of proteolysis of the extracellular matrix, blocking the function of the adhesion molecules of the extracellular matrix of endothelial cell, antagonization of the function of angiogenesis inducers such as growth factors, and inhibition of integrin receptors expressed on proliferative endothelial cells. Examples of antiangiogenic inhibitors that affect proteolysis of the extracellular matrix and that can be administered in combination with the antibody and antibody compositions of the invention, include without limitation, AG-3540 (Agouron, La Jolla, California), BAY-12 -9566 (Bayer, West Haven, Connecticut), BMS-275291 (Bristol Myers Squibb, Princeton, New Jersey), CGS-27032A (Novartis, East Hanover, New Jersey), Marimastat (British Biotech, Oxford, United Kingdom), and Metastat (Aetema, St-Foy, Quebec). Examples of anti-angiogenic inhibitors that act by blocking the function of adhesion molecules of the endothelial cell extracellular matrix, and which can be administered in combination with the antibody and antibody compositions of the invention, include without limitation, EMD-121974 (Merck KcgaA Darmstadt, Germany) and Vitaxin (Ixsys, La Jolla, California / Medimmune, Gaithersburg, Maryland). Examples of antiangiogenic agents that act by directly antagonizing or inhibiting the angiogenesis inducers and that can be administered in combination with the antibody and antibody compositions of the invention, include without limitation, Angiozyme (Ribozyme, Boulder, Colorado), Anti-VEGF antibody ( Genentech, S. San Francisco, California), PTK-787 / ZK-225846 (Novartis, Basel, Switzerland), SU-101 (Sugen, S. San Francisco, California), SU-5416 (Sugen / Pharmacia Upjohn, Bridgewater, New Jersey), and SU-6668 (Sugen). Other angiogenic agents act to directly inhibit angiogenesis. Examples of indirect inhibitors of angiogenesis that can be administered in combination with the antibody and antibody compositions of the invention include, without limitation, IM-862 (Cytran, Kirkland, Washington), Interferon-alpha, IL-12 (Roche, Nutley, New Jersey) and Pentosan polysulfate (Georgetown University, Washington, D.C.). In particular embodiments, the use of the antibody and antibody compositions of the invention in combination with anti-angiogenic agents for the treatment, prevention or alleviation of cancers and other hyperproliferative disorders is contemplated. In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with an antiviral agent. Antiviral agents that can be administered with the antibody and antibody compositions of the invention include, without limitation, acyclovir, ribavirin, amantadine and remantidine. In some embodiments, the therapeutic agents of the invention are administered in combination with antiretroviral agents, nucleoside / nucleotide reverse transcriptase inhibitors (NRTls), non-nucleoside reverse transcriptase inhibitors (NNRTIs), or protease inhibitors (Pls). NRTls that can be administered in combination with the therapeutic agents of the invention include, without limitation, RETROVIR ™ (zidovudine / AZT), VIDEX ™ (didanosine / ddl), HIVID ™ (zalcitabine / ddC), ZERIT ™ (stavudine / d4T) ), EPIVIR ™ (lamivudine / 3TC), and COMBIVIR ™ (zidovudine / lamivudine). NNRTIs that can be administered in combination with the therapeutic agents of the invention include, without limitation, VI RAM UNE ™ (nevirapine), RESCRIPTOR ™ (delavirdine) and SUSTIVA ™ (efavirenz). The protease inhibitors that can be administered in combination with the therapeutic agents of the invention include, without limitation, CRIXIVAN ™ (indinavir), NORVIR ™ (ritonavir), INVIRASE ™ (saquinavir) and VIRACEPT ™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, or protease inhibitors, may be used in combination with the therapeutic agents of the invention to treat AIDS or to prevent or treat the infection for HIV. In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with an antibiotic agent. Antibiotic agents that can be administered with the antibody and antibody compositions of the invention include, without limitation, amoxicillin, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, erythromycin, fluoroquinolones, macrolides , metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamethoxazole and vancomycin. In other embodiments, the antibody and antibody compositions of the invention can be administered in combination with agents against opportunistic infections. Examples of these agents that can be administered in combination with the antibody and antibody compositions of the invention, include without limitation, TRIMETHOPRIM-SULFAMETHOXAZOLE ™, DAPSONE ™, PENTAMIDINE ™, ATOVAQUONE ™, ISONIAZID ™, RIFAMPIN ™, PYRAZINAMIDE ™, ETHAMBUTOL ™, RIFABUTIN ™, CLARITHROMYCIN ™, AZITHROMYCIN ™, GANCICLOVIR ™, FOSCARNET ™, CIDOFOVIR ™, FLUCONAZOLE ™, ITRACONAZOLE ™, KETOCONAZOLE ™, ACYCLOVIR ™, FAMCICOLVIR ™, PYRIMETHAMINE ™ , LEUCOVORIN ™, NEUPOGEN ™ (filgrastim / G-CSF), and LEUKINE ™ (sargramostim / GM-CSF). In a specific embodiment, the antibody and antibody compositions of the invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLE ™, DAPSONE ™, PENTAMIDINE ™ or ATOVAQUONE ™, to prophylactically treat, prevent or diagnose a pneumonia infection caused by Pneumocystis carinii. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with ISONIAZID ™, RIFAMPIN ™, PYRAZINAMIDE ™ or ETHA BUTOL ™ to prophylactically treat, prevent or diagnose an opportunistic complex infection caused by Mycobacterium avium. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with RIFABUTIN ™, CLARITHROMYCIN ™ or AZITHROMYCIN ™ to prophylactically treat, prevent or diagnose an opportunistic infection caused by Mycobacterium tuberculosis. In another specific embodiment, the antibody and antibody compositions of the invention are used in combination with GANCICLOVIR ™, FOSCARNET ™ or CIDOFOVIR ™ to prophylactically treat, prevent or diagnose an opportunistic infection caused by cytomegalovirus. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with FLUCONAZOLE ™, ITRACONAZOLE ™ or KETOCONAZOLE ™ to prophylactically treat, prevent or diagnose an opportunistic infection caused by fungi. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with ACYCLOVIR ™ or FAMCICOLVIR to prophylactically treat, prevent or diagnose an opportunistic infection caused by herpes simplex virus type I or type II. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with PYRIMETHAMINE ™ or LEUCOVORIN ™ to prophylactically treat, prevent or diagnose an opportunistic infection caused by Toxoplasma gondii. In another specific embodiment, the antibody and antibody compositions of the invention are used in any combination with LEUCOVORIN ™ or NEUPOGEN ™ to prophylactically treat, prevent or diagnose a bacterial opportunistic infection. In a further embodiment, the antibody and antibody compositions of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that can be administered with the antibody and antibody compositions of the invention include, without limitation, glucocorticoids and nonsteroidal antiinflammatories, aminoarilcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, acid derivatives arylpropionic, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrin, bendazac, benzydamine, bucolome, diphenpyramide, ditazole, emorfazone, guayazulene, nabumetone, nimesulid , orgoteína, oxaceprol, paraniiina, perisoxal, pifoxima, proquazona, proxazol and tenidap.

The antibodies and antibody compositions of the invention can be administered alone or in combination with other adjuvants. Adjuvants that can be administered with the antibody and antibody compositions of the invention include without limitation, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG and MPL . In a specific embodiment, the antibody and antibody compositions of the invention are administered in combination with alum. In another specific modality, the antibody and the antibody compositions of the invention are administered in combination with QS-21. Additional adjuvants that can be administered with the antibody and antibody compositions of the invention include, without limitation, monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, aluminum salts, MF-59 and adjuvant Virosomal. Vaccines that can be administered with the antibody and antibody compositions of the invention include, without limitation, vaccines for protection against MMR (measles, mumps, rubella), polio, varicella, tetanus / diphtheria, hepatitis A, hepatitis B, Haemophilus Influenzae B, whooping cough, pneumonia, influenza, Lyme disease, rotavirus, cholera, yellow fever, Japanese encephalitis, polio, rabies, typhoid and pertussis, or PNEUMOVAX-23 ™. The combinations can be administered concomitantly, for example as a mixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also methods in which the combined agents are administered separately but simultaneously, for example by means of separate intravenous canals towards the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents first, and then the second. In another specific embodiment, the antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23 ™ to treat, prevent or diagnose an infection or any disease, disorder or condition associated therewith. In one embodiment, the antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23 ™ to treat, prevent or diagnose any bacterial Gram-positive infection or any disease, disorder or condition associated therewith. In another embodiment, the antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23 ™ to treat, prevent or diagnose an infection or any disease, disorder or condition associated with one or more members of the genus Enterococcus or the genus Streptococcus In another embodiment, the antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23 ™ to treat, prevent or diagnose an infection or any disease, disorder or condition associated with one or more members of group B of streptococci. In another embodiment, the antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23 to treat, prevent or diagnose an infection or any disease, disorder or condition associated with Streptococcus pneumoniae. In a preferred embodiment, the antibody and antibody compositions of the invention are administered with CD40 ligand (CD40L), a soluble form of CD40L (for example AVREND ™), biologically active fragments, variants or derivatives of CD40L, anti-CD40L antibodies. (for example, agonist or antagonist antibodies), or anti-CD40 antibodies (for example, agonist or antagonist antibodies). In another embodiment, the antibody and antibody compositions of the invention are administered in combination with an anticoagulant. Anticoagulants that can be administered with the antibody and antibody compositions of the invention include, without limitation, heparin, warfarin and aspirin. In a specific embodiment, the antibody and antibody compositions of the invention are administered in combination with heparin or warfarin. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with warfarin. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with warfarin and aspirin. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with heparin. In another specific embodiment, the antibody and antibody compositions of the invention are administered in combination with heparin and aspirin. In another embodiment, the antibody and antibody compositions of the invention are administered in combination with an agent that suppresses the production of anticardiolipin antibodies. In specific embodiments, the polynucleotides of the invention are administered in combination with an agent that blocks or reduces the ability of the anticardiolipin antibodies to bind to the plasma phospholipid-beta-2-glycine protein I binding protein (b2GPI). In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with an antimalarial agent. Antimalarial agents that can be administered with the antibody and antibody compositions of the invention include, without limitation, hydroxychloroquine, chloroquine or quinacrine. In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with an NSAID. In a non-exclusive embodiment, the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five, ten or more of the following drugs: NRD-101 (Hoechst Marion Roussel), diclofenac ( Dimethaid), potassium oxaprozin (Monsanto), mecasermin (Chiron), T-714 (Toyama), pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib (Monsanto), eltenac (Byk Gulden), campath, AGM-1470 (Takeda), CDP-571 (Celltech Chiroscience), CM-101 (CarboMed), ML-3000 (Merckle), CB-2431 (KS Biomedix), CBF-BS2 (KS Biomedix), gene therapy IL-1 Ra (Valentis ), JTE-522 (Japan Tobacco), paclitaxel (Angiotech), DW-166HC (Dong Wha), darbufelone mesylate (Warner-Lambert), soluble receptor for TNF 1 (synergen); Amgen), IPR-6001 (Institute for Pharmaceutical Research), trocade (Hoffman-La Roche), EF-5 (Scotia Pharmaceuticals), BIIL-284 (Boehringer Ingelheim), BIF-1149 (Boehringer Ingelheim), LeukoVax (Inflammatics), MK-671 (Merck), ST-1482 (Sigma-Tau) and butixocort propionate (WamerLambert). In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five or more of the following drugs: methotrexate, sulfasalazine, sodium aurothiomalate, auranofin, cyclosporin, penicillamine, azaíioprina, an antimalarial drug (for example, as those described here), cyclophosphamide, chlorambucil, gold, ENBREL ™ (Etanercept), anti-TNF antibody, LJP 394 (La Jolla Pharmaceutical Company, San Diego, California) and prednisolone. In a further embodiment, the antibody and antibody compositions of the invention are administered alone or in combination with one or more intravenous immunoglobulin preparations. Intravenous immunoglobulin preparations that can be administered with the antibody and antibody compositions of the invention, include, without limitation, GAMMAR ™, IVEEGAM ™, SANDOGLOBULIN ™, GAMMAGARD S / D ™ and GA IMUNE ™. In a specific embodiment, the antibody and antibody compositions of the invention are administered in combination with intravenous immunoglobulin preparations in transplantation therapy (e.g., bone marrow transplantation). Ligand CD40 (CD40L), a soluble form of CD40L (for example AVREND ™), biologically active fragments, variants or derivatives of CD40L, anti-CD40L antibodies (for example agonist or antagonist antibodies), or anti-CD40 antibodies (for example antibodies agonists or antagonists). In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with cytokines. Cytokines that can be administered with the antibody and antibody compositions of the invention include, without limitation, GM-CSF, G-CSF, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-alpha, IFN-beta, IFN-gamma, TNF-alpha and TNF-beta. In preferred embodiments, the antibody and antibody compositions of the invention are administered with a TRAIL receptor. In another embodiment, the antibody and antibody compositions of the invention can be administered with any etherleucine, including without limitation, IL-alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-4, IL-15, IL-16, IL-17, IL- 18, IL-19, IL-20, IL-2 and IL-22. In preferred embodiments, the antibody and antibody compositions of the invention are administered in combination with IL4 and IL10. In other preferred embodiments, the antibody and antibody compositions of the invention are administered in combination with IL-2. In preferred embodiments, the antibody and antibody compositions of the invention are administered in combination with G-CSF. In one embodiment, the antibody and antibody compositions of the invention are administered in combination with one or more chemokines. In specific embodiments, the antibody and antibody compositions of the invention are administered in combination with a (CxC) chemokine selected from the group consisting of interferon-gamma-10 (ß-10), interleukin 8 (IL-) inducible protein. 8), platelet factor 4 (PF4), neutrophil activating protein (NAP-2), GRO-a, GRO-β, GRO- ?, neutrophil activating peptide (ENA-78), chemoattractant granulocyte protein 2 (GCP) -2), and stromal cell-derived factor 1 (SDF-1, or pre-B cell stimulating factor (PBSF)); or a p (CC) chemokine selected from the group consisting of: RANTES (regulated by activation, normal and expressed T secreted), macrophage inflammatory 1-alpha protein (MIP-1a), inflammatory protein of macrophage 1-beta (?? Β -1 β), monocyte chemotactic protein 1 (MCP-1), monocyte chemotactic protein 2 (MCP-2), monocyte chemotactic protein 3 (MCP-3), monocyte chemotactic protein 4 (MCP-4), inflammatory protein of macrophage-gamma (??? - 1?), inflammatory protein of macrophage 3-alpha (IP-3a), inflammatory protein of macrophage 3-beta (??? - 3ß), inflammatory protein of macrophage 4 (MIP) -4 / DC-CK-1 / PARC), eotaxin, Exodus and I-309; or the Y (C) chemokine lymphotactin. In preferred embodiments, the antibody and antibody compositions of the invention are administered in combination with agents that increase the activity of IFN-gamma or caspase, particularly the activity of caspase 8. In another preferred embodiment, the antibody and the antibody compositions of the invention are administered with chemokine beta-8, chemokine beta-1 or macrophage inflammatory protein 4. In a preferred embodiment, the antibody and antibody compositions of the invention are administered with beta-8-chemokine. In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with an IL-4 antagonist. IL-4 antagonists that can be administered with the antibody and antibody compositions of the invention include, without limitation: soluble IL-4 receptor polypeptides, multimeric forms of soluble IL-4 receptor polypeptides; Anti-IL-4 receptor antibodies that bind to the IL-4 receptor without transducing the biological signal elicited by IL-4, anti-IL-4 antibodies that block the binding of IL-4 with one or more IL-4 receptors 4, and IL-4 muteins that bind to IL-4 receptors but do not transduce the biological signal elicited by IL-4. Preferably, the antibodies used according to this method are monoclonal antibodies (including antibody fragments such as for example those described herein). In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with fibroblast growth factors. Fibroblast growth factors that can be administered with the antibody and antibody compositions of the invention include, without limitation, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14 and FGF-15.

Demonstration of the Therapeutic or Prophylactic Utility of a Composition The compounds of the invention are preferably tested in vitro and then in vivo to determine the desired therapeutic or prophylactic activity before use in humans. For example, in vitro tests that can be used to determine whether administration of an antibody or composition of the present invention is indicated, include in vitro cell culture tests in which a tissue sample from the patient is cultured and administering, or being exposed to, an antibody or composition of the present invention, and observing the effect of said antibody or composition of the present invention on the tissue sample. In several specific embodiments, in vitro tests can be carried out with cells representative of the cell types involved in the disorder of a patient, to determine whether an antibody or composition of the present invention had a desired effect on said cell types. . Preferably, the antibodies or compositions of the invention are also analyzed with in vitro tests and animal model systems prior to administration in humans.

The toxicity of the antibodies or compositions of the present invention for use in therapy can be tested in suitable animal model systems, including without limitation, models of rats, mice, chickens, cows, monkeys and rabbits. To analyze the toxicity of an antibody or composition in vivo, any known animal model system can be used. The antibodies or compositions of the invention can be analyzed for their ability to reduce tumor formation in in vitro, ex vivo and in vivo tests. The ability of the antibodies or compositions of the invention to inhibit viral duplication or reduce viral load in in vitro and in vivo tests can also be tested. The ability of the antibodies or compositions of the invention to reduce bacterial concentration in known in vitro and in vivo tests can also be tested. The ability of the antibodies or compositions of the invention to alleviate one or more symptoms associated with cancer, an immune disorder (eg, an inflammatory disease), a neurological disorder or an infectious disease can also be tested. The ability of the antibodies or compositions of the invention to reduce the duration of the infectious disease can also be tested. In addition, one can test the ability of the antibodies or compositions of the invention to increase the survival period of animals suffering from a disease or disorder, including cancer, an immune disorder or an infectious disease. In order to analyze the function of the antibodies or compositions of the invention in vivo, techniques known to those skilled in the art can be used. Efficacy in the treatment or prevention of a viral infection can be demonstrated by detecting the ability of an antibody or composition of the invention to inhibit duplication of the virus, to inhibit transmission or prevent the virus from establishing itself in its host, or to prevent , decrease or alleviate the symptoms of the advance of a disease. The treatment is considered therapeutic if for example there is a reduction of viral load, decrease of one or more symptoms, or a reduction of mortality or morbidity after the administration of an antibody or composition of the invention. The antibodies or compositions of the invention can be analyzed for their ability to modulate the biological activity of immune cells by contacting the immune cells, preferably human immune cells (e.g. T cells, B cells and natural killer cells), with a antibody or composition of the invention or a control compound, and determining the ability of the antibody or composition of the invention to modulate (i.e., increase or decrease) the biological activity of immune cells. The ability of an antibody or composition of the invention to modulate the biological activity of immune cells can be determined by detecting the expression of antigens., detecting the proliferation of immune cells (ie, the proliferation of B cells), detecting the activation of signaling molecules, detecting the effector function of immune cells, or detecting the differentiation of immune cells. To measure these activities, techniques known to the expert can be used. For example, cell proliferation can be analyzed by 3 H-thymidine incorporation tests and tripan blue cell count. Antigen expression can be analyzed, for example, by means of immunoassays including, without limitation, competitive and non-competitive assay systems using techniques such as Western blots, immunohistochemistry radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), immunoassays "sandwich", immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and FACS analysis. The activation of signaling molecules can be determined, for example, by means of kinase tests and electrophoretic deviation tests (EMSAs). In a preferred embodiment, the ability of an antibody or composition of the invention to induce the proliferation of B cells is measured. In another preferred embodiment, the ability of an antibody or composition of the invention to modulate the expression of immunoglobulin is measured.

Panels / Mixtures The present invention also provides mixtures of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that bind immunospecifically to TR7 or a fragment or variant thereof, in wherein the mixture has at least one, two, three, four, five or more different antibodies of the invention. In specific embodiments, the invention provides mixtures of at least 2, preferably at least 4, at least 6, at least 8, at least 10, at least 12, at least 15, at least 20 , or at least 25 different antibodies that bind immunospecifically to TR7 or fragments or variants thereof, wherein at least 1, at least 2, at least 4, at least 6, or at least 10 antibodies of the mixture are antibodies of the invention. In a specific embodiment, each antibody in the mixture is an antibody of the invention. The present invention also provides panels of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that immunospecifically bind to TR7 or a fragment or variant thereof, wherein the panel it has at least one, two, three, four, five or more different antibodies of the invention. In specific embodiments, the invention provides panels of antibodies that have different affinities for the TRAIL receptor, different specificities for the TRAIL receptor, or different dissociation rates. The invention provides panels of at least 10, preferably at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 antibodies. The antibody panels can be used, for example, in 96-well plates for tests such as ELISAs. The present invention further provides compositions comprising one or more antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). In one embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VH domains of one or more of the scFvs referred to in table 1, or a variant thereof. In another embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the CDRI's of VH of a VH domain of one or more of the scFvs referred to in Table 1, or a variant thereof. In another embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VH CDR2's of a VH domain of one or more of the scFvs referred to in Table 1, or a variant thereof. In a preferred embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VH CDR3's of a VH domain of one or more of the scFvs referred to in Table 1, or a variant thereof. Other embodiments of the present invention that provide compositions comprising one or more antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). In another embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VL domains of one or more of the scFvs referred to in table 1, or a variant thereof. In another embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VL CDR1 domains of one or more of the scFvs referred to in Table 1, or a variant thereof. In another embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VL CDR2's of one or more of the scFvs referred to in table 1, or a variant thereof. In a preferred embodiment, a composition of the present invention comprises one, two, three, four, five or more antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one or more of the VL CDR3 domains of one or more of the scFvs referred to in Table 1, or a variant thereof.

Equipment The invention also provides a pharmaceutical package or equipment comprising one or more containers with one or more of the ingredients of the pharmaceutical compositions of the invention. With said containers a tag may optionally be associated in the manner prescribed by a governmental agency that regulates the manufacture, use or sale of pharmaceutical or biological products; said label reflects the approval of the agency to manufacture, use or sell the product for human administration. The present invention provides equipment that can be used in the aforementioned methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In an alternative embodiment, a kit comprises an antibody fragment that immunospecifically binds to TR7 polypeptides or fragments or variants thereof. In a specific embodiment, the kits of the present invention contain a substantially isolated TR7 polypeptide or a fragment or variant thereof as a control.

Preferably, the kits of the present invention further comprise a control antibody that does not react with any, some or all of the TRAIL receptors. In another specific embodiment, the kits of the present invention contain a means for detecting the binding of an antibody to TR7 polypeptides (for example the antibody can be conjugated to a detectable substrate such as a fluorescent compound, an enzyme substrate, a radioactive compound or a luminescent compound, or a second antibody recognizing the first antibody can be conjugated to a detectable substrate). In specific embodiments, the kit may include a TRAIL receptor recombinantly produced or chemically synthesized. The TR7 provided in the equipment can also be fixed to a solid support. In a more specific embodiment, the detection means of the above described equipment includes a solid support to which TR7 is fixed. Said equipment may also include an anti-human antibody labeled with a reporter, not bound. In this embodiment, binding of the antibody with TR7 can be detected by the binding of said reporter-labeled antibody. In a further embodiment, the invention includes diagnostic equipment for use in the examination of serum containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody, specifically immunoreactive with a TRAIL receptor, and means for detecting the binding of TR7 polypeptides to the antibody. In one embodiment, the antibody is fixed on a solid support. In a specific embodiment, the antibody can be a monoclonal antibody. The equipment detection means may include a second labeled monoclonal antibody. Alternatively, or additionally, the detection means may include a labeled competent antigen. In a diagnostic configuration, test serum is reacted with a solid phase reagent having TRAIL receptors bonded to the surface, obtained by the methods of the present invention. After the TR7 polypeptides bind to a specific antibody, the unbound serum components are removed by washing, reporter-labeled anti-human antibody is added, the unbound anti-human antibody is removed by washing, and it reacts a reagent with the anti-human antibody labeled with reporter to bind the reporter with the reagent, in proportion to the amount of anti-TR7 antibody bound on the solid support. Typically, the reporter is an enzyme that is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate. The solid surface reagent in the aforementioned test is prepared by known techniques for fixing protein material in a solid support material, such as polymeric beads, dip bars, 96-well plate or filter material. These methods of attachment generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically by means of a free amino group, to a chemically reactive group on the solid support, such as a carboxyl, hydroxyl or aldehyde group. activated. Alternatively, streptavidin-coated plates may be used in conjunction with biotinylated antigens. In this way, the invention provides a system or test equipment for carrying out this diagnostic method. The kit generally includes a support with recombinant TRAIL receptor bound to the surface, and an anti-human antibody labeled with a reporter to detect the anti-TR7 antibody bound to the surface.

Placental expression of TRAIL receptors The expression of the receptors and ligands of the tumor necrosis family in the placenta and in the placental cells of macrophage and trophoblast cells has been carefully examined. It was observed that trophoblasts, which express TR7 and TR5 but not TR10, are completely resistant to destruction by recombinant TRAIL, whereas macrophages, which express TR4, TR7 and TR10, but not TR5, are sensitive (Phillips et al., J Immunol 15: 6053-9 (1999), which is incorporated herein by reference in its entirety). Thus, methods for using anti-TR7 antibodies described herein can also be used on placenta and placental cell types (eg, macrophages and trophoblasts) to prevent, treat, diagnose, alleviate or monitor diseases and disorders of cell types. placentations of the placenta.

QENIC THERAPY In a specific embodiment, nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to treat, inhibit or prevent a disease or disorder associated with the expression or aberrant activity of TRAIL receptors or their ligands. (for example TRAIL), by means of gene therapy. Gene therapy refers to therapy performed by administering a expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein that mediates a therapeutic effect. Any of the methods for gene therapy available in the art can be used according to the invention. Below, exemplary methods are described. For general reviews of gene therapy methods, see Goldspíel et al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, TIBTECH 1 l (5): 155-215 (1993). Methods commonly known in the area of recombinant DNA technology that can be used are described in Ausubel et al. (Eds.), "Current Protocols in Molecular Biology," John Wleyley & Sons, NY (1993); and Kriegler, "Gene Transfer and Expression, A Laboratory Manual," Stockton Press, NY (990).

In a preferred aspect, a composition of the invention comprises, or alternatively consists of, nucleic acids encoding an antibody; said nucleic acids being part of an expression vector expressing the antibody or fragments or chimeric proteins or heavy or light chains thereof, in a suitable host. In particular, such nucleic acids have promoters, preferably heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, and optionally tissue specific. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequence are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing intrachromosomal expression of the nucleic acids encoding the antibody (Koller and Smithies, Proa Nati, Acad. Sci. USA 86: 8932-8935 (1989); Zijlstra et al., Nature 342: 435-438 (1989). In specific embodiments, the antibody molecule expressed is a scFv; alternatively, the nucleic acid sequences include sequences encoding both heavy and light chains of an antibody, or fragments or variants thereof The delivery of the nucleic acids to a patient can be direct, in which case the patient is exposes directly to the nucleic acid or to vectors that carry the nucleic acid, or indirectly, in which case the cells are first transformed in vitro with the ac nucleic acid and then the patient is transplanted. These two approaches are known, respectively, as gene therapy in vivo and ex vivo. In a specific embodiment, the nucleic acid sequences are administered directly in vivo, where they are expressed to produce the encoded product. This can be done by means of many known methods, for example, by constructing them as part of an appropriate nucleic acid expression vector and administering them so that they are made intracellular, for example by infection, using retroviral vectors or other defective or attenuated viral vectors. (see U.S. Patent No. 4,980,286), or by direct injection of pure DNA, or using microparticle bombardment (e.g., a gene gun); Biolistic, Dupont), or by coating with lipids or cell surface receptors or transfection agents, by encapsulation in liposomes, microparticles or microcapsules, or by administering them in conjunction with a peptide known to enter the nucleus, administering them in conjunction with a ligand. subject to receptor-mediated endocytosis (see for example Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987)) (which can be used to direct them to cell types that specifically express receptors), etc. In another embodiment, nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to break down endosomes, allowing the nucleic acid to prevent lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell-specific incorporation and expression by targeting a specific receptor (see, for example, PCT publications WO 92/06180, WO 92/22715, WO 92/20316; WO 93/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated into host cell DNA for expression, by means of homologous recombination (Koller and Smithies, Proc. Nati, Acad. Sci. USA 86: 8932-8935 (1989); Zijlstra; and others, Nature 342: 435-438 (1989)). In a specific embodiment, viral vectors are used that contain nucleic acid sequences encoding an antibody of the invention or fragments or variants thereof. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol, 217: 581-599 (1993)). These retroviral vectors contain the necessary components for the correct packaging of the viral genome and integration into the DNA of the host cell. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene to a patient. More details about retroviral vectors can be found in Boesen et al., Biotherapy 6:29 1-302 (1994), which describe the use of a retroviral vector to deliver the mdr 1 gene to hematopoietic stem cells to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93: 644-651 (1994); Klein et al., Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4: 129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3: 110-114 (1993). Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium where they cause mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage that they are capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3: 499-503 (1993), present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3-10 (1994) showed the use of adenovirus vectors to transfer genes to the respiratory epithelium of macaques from India. Other uses of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252: 431-434 (1991); Rosenfeld et al., Cell 68: 143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91: 225-234 (1993); PCT publication WO 94/12649; and Wang et al., Gene Therapy 2: 775-783 (1995). Adenovirus vectors are used in a preferred embodiment. Adeno-associated viruses (AAV) have also been proposed for gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204: 289-300 (1993), U.S. Patent No. 5,436,146). Another approach to gene therapy involves the transfer of a gene to cells in tissue culture by methods such as electroporation, lipofection, transfection mediated by calcium phosphate or viral infection. Usually, the transfer method includes the transfer to the cells of a selectable marker. Then, the cells are put under selection to isolate the cells that have incorporated and express the transferred gene. The cells are then delivered to a patient. In this embodiment, the nucleic acid is introduced into a cell before the resulting recombinant cell is administered live. Such introduction can be carried out by any known method, including without limitation, transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, transfer of gene mediated by microcell, fusion of sporoblast, etc. Many techniques for introducing foreign genes into cells are known (see, for example, Loeffler and Behr, Meth. Enzymol., 217: 599-718 (1993)).; Cohen and others, Meth. Enzymol. 217: 718-644 (1993); Clin. Pharma. Ther. 29: 69-92m (1985)), and can be used according to the present invention, provided that the development and necessary biological functions of the recipient cells are not disturbed. The technique should provide stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its progeny. The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (e.g. stem cells or hematopoietic progenitors) are preferably administered intravenously. The amount of cells contemplated for use depends on the desired effect, the condition of the patient, etc., and can be determined by a person skilled in the art. Cells into which a nucleic acid can be introduced for gene therapy purposes encompass any type of available desired cell, and include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; several stem or progenitor cells, in particular stem cells or hematopoietic progenitors, for example obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc. In a preferred embodiment, the cell used for gene therapy is autologous to the patient. In an embodiment in which recombinant cells are used in gene therapy, the nucleic acid sequences encoding an antibody or fragment thereof are introduced into the cells in such a way that they are expressible by the cells or their progeny, and then the recombinant cells they are administered live for a therapeutic effect. Stem or progenitor cells are used in a specific modality. Potentially any stem or progenitor cell that can be isolated and maintained in vitro can be used in accordance with this embodiment of the present invention (see, for example, PCT publication WO 94/08598; Stemple and Anderson, Cell 7 1: 973 -985 (1992), Rheinwald, Meth Cell Bio 21A: 229 (1980), and Pittelkow and Scott, Mayo Clinic Proc. 71: 771 (1986)). In a specific embodiment, the nucleic acid to be introduced for gene therapy purposes comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by monitoring the presence or absence of the appropriate transcription inducer.

EXAMPLES EXAMPLE 1 Biacore analysis of the affinity and specificity of TR7 binding polypeptides Materials BIAcore 2000 BIAcore 2000 control software, version 3.1.1 BIAevaluation, version 3.1 BIAcore CM5 Sensor Chip, Cat # BR-1000-14 Lot # 0364 (BIAcore) Shock Absorber HBS-EP Amine Coupling Amine Coupling Kit Cat # BR-1000-50 (BIAcore) EDC, # 1048-950345 (BIAcore) NHS, # 1048-950345 (BIAcore) Ethanolamine, # 1048-950345 ( BIAcore) 10 mM Acetate, pH 4.0 Cat # BR1003-50 Lot # 1821-9503844 (BI Acore) TRAIL-FLAG (Alexis Biochemicals Cat # 522-003-C010 # L04793 / a) The temperature was 25 ° C in all the experiments.

General Methods The following protocol is an example of a protocol that can be used to determine the affinity of anti-TR7 antibodies for TR7 polypeptides. Additionally, the following protocols can be used to determine the specificity of the antibodies of the invention. TR4, TR5, TR7 and TR10 (in the form of Fe fusion proteins) are immobilized on individual flow cells of a BIAcore ip sensor. The TR7-Fc fusion protein comprises residues E52-G184 of TR7 (SEQ ID NO: 3). This protein is expressed in a baculovirus expression system that uses the GP signal peptide. In this manner, the post-translation processing of this fusion protein results in a TR7-Fc fusion protein comprising the last 3 residues of the GP signal peptide (Ala-Asp-Pro) fused to E52-G184 of TR5 ( SEQ ID NO: 3) fused with the Fe region. The TR4-Fc fusion protein comprises residues M1-I240 of TR4 (SEQ ID NO: 1). The post-translation processing of this fusion protein results in a TR4-Fc fusion protein comprising residues A109-1240 of TR4 (SEQ ID NO: 1). The TR5-Fc fusion protein comprises residues R70-S282 of TR5 (SEQ ID NO: 2). This protein is expressed in a baculovirus expression system that uses the GP signal peptide. In this manner, post-translational processing of this fusion protein results in a TR5-Fc fusion protein comprising the last 3 residues of the GP signal peptide (Ala-Asp-Pro) fused to TR70-S282 of TR5 (SEQ. ID NO: 2) fused with the Fe region. The TR10-Fc fusion protein comprises residues M1-G204 of TR10 (SEQ ID NO: 4). Post-translational processing of this fusion protein results in a TR10-Fc fusion protein comprising residues A56-G204 of TR10 (SEQ ID NO: 4). Amine coupling is used to covalently link each receptor (Fe) with the dextran matrix on the CM5 sensor chip. The optimum pH for this coupling is determined using preconcentration experiments that vary the pH from 4 to 7, and is determined based on the slope of the binding. The actual coupling is done using the manual injection mode. An objective level of -2000RU is set for all flow cells (this may vary from 2000 to 3100, depending on the molecular weight of the receiver). The concentration of all the receptors for immobilization was 10 ug / ml in 10 mM acetate, pH 4.0. The whole immobilization experiment is performed at 5 μ? / Min. The contact time for the EDC / NHS injection is 7 minutes. Ethanolamine is injected for 7 minutes. The exploration can be done with the following procedures. The flow rate for the entire bonding cycle is 25 μ? / Min. The antibodies corresponding to scFvs are diluted in HBS-EP and flowed through the four cells with immobilized TRAIL receptors. Each sample is in contact with the receivers for 4 minutes. The regeneration is done using 15 μ? of 25 mM NaOH. Successful regeneration is considered not only by removal of the antibody, but also by lack of denaturation of the immobilized receptor. The positive control for this scanning experiment is an identical injection (in flow velocity and duration) of the soluble TRAIL ligand. The concentration is 1 pg / ml. The negative control is a 1: 10 dilution in HBS-EP of the antibody diluent. The data can be analyzed using the BIAevaluation software package.

Biacore analysis of anti-TR7 antibodies In the following experiment based on the general methods described above, the affinities to TR7 of some antibodies (corresponding to the scFvs of the invention) were determined, using a "double subtraction reference" method using the receptor TR7-Fc in the experimental flow cell and TR2-Fc (comprising amino acids 1-192 of TR2, also known as herpes virus entry mediator (HVEM), described in WO 96/34095, which is incorporated in the present as a reference in its entirety) as a negative control. TR7-Fc and TR2-Fc were immobilized on individual flow cells of a CM5 sensor chip of BIAcore (BIAcore, Cat # BR-1000-14). Amine coupling (BIAcore, Cat # BR-1000-50) was used to covalently attach each receptor to the dextran matrix on the sensor chip. The optimum pH for this coupling was analyzed using previous concentration experiments by varying the pH from 4 to 7, and it was determined to be 4.0 based on the binding slope. The actual coupling was done using the manual injection mode. An objective level of 200 relative units (RU) was set for both fluid cells. A response of 1000 RU correlates with a change in surface concentration of approximately 1 ng / mm2 for proteins. The molecular weight of the fusion proteins of TR7 and TR2 was almost identical. The concentration of both receptors for immobilization was 5 g / ml in 10 mM acetate, pH 4.0 (BIAcore, Cat # BR-1003-49). The entire experiment was carried out at a flow rate of 5 pL / min. The contact time for the injection of N-ethyl-N '- (3-dimethylaminopropyl) carbodiimide hydrochloride / ethanolamine hydrochloride-NaOH, pH 8.5 (EDC / NHS), was 3 minutes. The ethanolamine was injected for 3 minutes. A kinetic analysis of CM005G08 was performed using the BIAcore 2000 instrument with the software '2000 control software', version 3.1.1. The flow rate for the entire binding cycle was 25 plJmin. The purified antibodies were diluted from 3.75 pg / mL (25 nM) to 0.023 pg / mL (0.015 nM) in 0.01 M HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.005% Surfactant P20 (working buffer HBS-EP; BIAcore, Cat # BR-1001-88). Each concentration, in triplicate, was contacted with both receptors during a 5 minute association phase. The dissociation rate of CM005G08 was determined by washing the complex in the presence of HBS-EP buffer for 10 minutes. Regeneration was made at the end of each cycle using a variable volume (5-12 μ? _) Of 25 mM NaOH at a flow rate of 50 pL / min. The temperature was kept constant at 25 ° C throughout the analysis. The binding data was analyzed using the software BIAevaluation, version 3.1. The Langmuir binding model 1: 1 was used. Due to the relatively high association and dissociation rates, separate adjustment curves were used for the association and dissociation phase instead of the overall fit. The binding data were corrected for non-specific effects by subtracting the control flow cell and also a buffer injection, referred to as a double reference subtraction (Myszka, (1999) "Improving Biosensor Analysis", J. Molec. Recognition 12, 1-6). The following symbols and definitions were used to characterize the joining parameters (software manual BIAevaluation Software Handbook v. 3.0, 1997, BIAcore). RU the primary reading of the BIAcore instrument, represents the intensity of the resonance signal and is proportional to the weight of the material linked to the sensor chip.

RL value of the resonance signal that characterizes the amount of TR7 linked to the chip. ka (M'V) constant of the association velocity kd (s ") constant dissociation speed KA (1 / M) constant binding at equilibrium KD (M) constant dissociation at equilibrium Rmax (RU) capacity Maximum binding of the chip for the analyte To ensure accurate estimation of the kinetic parameters of the binding of different batches of CM005G08 or TRAIL with TR7 covalently immobilized on the dextran matrix, three separate runs were made for each experiment. The density of the sensor chip and the flow rate were chosen based on preliminary optimization experiments to avoid the bivalent binding of the antibodies and limiting effects of mass transfer. The observed binding was specific for TR7 since no resonance signal was observed for the binding of CM005G08 with a TR2-Fc control protein (Figure A.1). The union follows a first-order kinetics and conforms to a Langmuir 1: 1 binding model. The overall affinity estimate of the antibodies to TRAILR2 was based on three independent experiments. All kinetic parameters are presented as mean values ± STD of three individual experiments. Two independent batches of CM005G08 were characterized by a KD value of 0.25 ± 0.013 nM and 0.33 ± 0.003 nM with a dissociation speed of 2.66 x 10"3 ± 0.12 x 10 ~ 3 1 / s and 2.68 x 10" 3 ± 0. 05 x 10"3 1 / s, respectively TRAIL binds to TR7 with a higher overall affinity (KD = 0.04 ± 0.003 nM) compared to CM005G08, due predominantly to a lower dissociation rate (kd = 1.37 x 10" 4 ± 0.10 x 10"4 / s).

EXAMPLE 2 Inhibition of binding of biotinylated TRAIL to TR7 I. PBS 10X Materials (Quaiity Biological Cat 130-069-161, Lot 708712) Immulon 4 Microplate (Dynex Cat 3855, Lot ND540319) Fraction V Bovine Serum Albumin (Sigma, # 58H0456) Tri-hydroxymethyl aminomethane (Base TRIS) Tween 20 (Sigma) Anti-human goat Fe (Sigma, 1-2136, # 89H4871) TR-4; Fc (as described above) Biotinylated TRAIL (AM100200-Peprotech) HRP-Streptavidin (Vector, # L0328) TMB Peroxidase System MicroweII Substrate '(KPL, Kirkegaard &Perry Laboratories, Inc.) H2S04 (Fisher) 96-well dilution plate (Costar) II. Shock Absorbers: Coating Shock Absorber (PBS 1X) Blocking Shock Absorber (3% BSA in PBS) General Diluent (PBSA 1% in PBST) Wash Shock Absorber (Tween 20 0.1% and PBS 1X) III. Methods Fe anti-human goat is diluted to 0.1 pg / ml in coating buffer. An Immulon 4 microplate is coated with 100 μl per cavity of the goat anti-human Fe solution and incubated overnight at 4 ° C. The coating solution is decanted from the plate and 200 pL of the blocking solution is dispensed per cavity. The plate is incubated at room temperature for 1 hour. After 1 hour of incubation period, the blocking solution is decanted from the plate and 1 pg / mL of TR7-Fc is dispensed at 100 pL / well, and incubated 2 hours at room temperature. After incubation, the plate is washed manually five times using a Wheaton manifold. The antibodies corresponding to the scFvs of the present invention are prepared (previously) in a low-binding dilution plate using diluent. The antibodies are prepared in duplicate and diluted from the working concentration with dilutions of 2.5 times for the 7 subsequent cavities. If a pure form of the antibody is available, the initial concentration is 5 pg / mL. The positive control (TR7-Fc) is diluted 5 pg / mL. Transfer 100 μm to the ELISA plate and preincubate for 30 minutes at room temperature. Add 20 μl of biotinylated TRAIL at 5 pg / mL to the 100 pL of the supernatant and mix. The combined 120 pL are incubated 2 hours at room temperature. After an incubation of 2 hours, the washing cycle is repeated and the plate is decanted and subjected to blotting. HRP-streptavidin is diluted at 1: 2000 and 100 pL per well is dispensed. The incubation is for 1 hour at room temperature. Meanwhile, equal amounts of the substrate of TMB peroxidase and solution B of peroxidase are removed, and the solutions are equilibrated at room temperature. After incubation for 1 hour, the plate is decanted and washed with PBST five times and subjected to blotting. The TMB peroxidase substrate and peroxidase solution B are combined and 100 pL of the mixture is dispensed to each cavity. The color develops at room temperature for 15 minutes. The color development is stopped by adding 50 pL of 1M H2SO4 to each cavity. Immediately afterwards the plate is read at 450 nm using the Molecular Devices spectrometer. The Cl50 is then measured, i.e., the concentration of purified antibody that results in 50% inhibition of plateau binding. For comparison purposes a TR7 polypeptide can be used as a sample in this test. Using the above described test it was shown that a complete IgG1 antibody comprising the VH and VL domains of the scFv CM005G08, strongly inhibits the binding of biotinylated TRAIL to TR7, indicating that CM005G08 and TRAIL compete for binding to TR7. The Cl50 values for two batches of CM005G08 were 5.30 and 6.89 nM, compared to an IC50 of 1.77 nM for TRAIL. The difference in IC50 values reflects the fact that CM005G08 has a lower binding affinity for TR7 than TRAIL.

EXAMPLE 3 Testing the ability of anti-TRAIL-TR7 antibodies to induce apoptosis General methods Anti-TR7 antibodies are analyzed for their ability to induce apoptosis of cells expressing TR7, alone or in combination with cycloheximide, chemotherapeutic agents or entanglement agents. Briefly, the activity of the antibodies is tested to induce TR7-mediated apoptosis of the cell lines expressing TR7, SW480, MDA-MB-231 and Colo205. A cell line that does not express TR7 can be used as a negative control. To induce apoptosis, MDA-MB-231, SW480, or Colo205 cells are incubated with the indicated concentration of monoclonal antibodies of the invention or a human control antibody. One day before the test the cells (1.5 x 10 5 cells MDA-MB-231 / ml, 4 x 10 5 cells SW480 / ml or 4 x 10 5 cells Colo205 / ml; 100 ul / cavity) are sown in cavities of a 96-well plate and allowed to adhere during the night. The next day, the test antibody is added in the presence or absence of cycloheximide (1.0 to 2.0 pg / ml, Sigma R75010-7). In some experiments, the potency of anti-TR7 monoclonal antibody is compared to the rhuTRAIL-FLAG protein (Alexis Biochemicals) or unlabeled soluble rhuTRAIL produced in HGS. RhuTRAIL-FLAG is used at the indicated concentrations in the presence of 2 pg / ml anti-FLAG enhancer antibody. The secondary entanglement effect can be determined by measuring the ability of the monoclonal antibodies to destroy the cells, alone or in the presence of a specific anti-goat IgG human Fe (SIGMA) secondary antibody. The secondary interlacing antibody is added to the cells at an equivalent concentration as the test monoclonal antibody. Tests with MDA-MB-231 or SW480 are performed for 16-18 h at 37 ° C, after which viability is revealed using the blue alamar reagent (Biosource, cat. # DAL1100), using the conditions suggested by the maker. The fluorescence of alamar blue is detected using the fluorescence reader CytoFluor at 530 nm excitation and 590 nm emission. The results are expressed as a percentage of viability compared to cells not treated with antibody. Tests are performed with Colo205 for 48 hours at 37 ° C, after which viability is revealed using the CelITiter 96® colorimetric reagent; Aqueous One Solution (Promega, cat. # G3581), using the conditions suggested by the manufacturer. Absorbance is detected using the SPECTRAmax Plus384 96-well plate reader from Molecular Devices (or equivalent) at 490 nm. Other chemotherapeutic agents that can be used in this test (and are used in treatment regimens in conjunction with the antibodies of the present invention) include, for example, 5-fluorouracil, etoposide, taxol, cisplatin, cytosine (Cytosar), IFN gamma , camptothecin, irinotecan (camptosar, CPT-11), adriamycin (doxorubicin), methotrexate, paraplatinin, interferon alpha, interferon beta, paclitaxel, docetaxel, the inhibitor NF-kappa-B SN50, and gemcitabine (Gemzar ™). Other cell lines that can be used in this test include, for example, the human fibrosarcoma cell line HT-1080; the human cervical carcinoma cell lines ME-180 and HeLa; the human malignant melanoma cell lines RPMI-795, SK-MEL-1 and G361; the Jurkat cell line of human adult T-cell leukemia; the human uterine carcinoma cell lines SK-UT-1 and RL-95; the line of human lung carcinoma cells SK-MES-1, the human colon cancer cell lines, LS174T, HT29 and HCT1 16, the pancreatic cancer cell lines su.86.86 and CFPAC, the cell lines of human ovarian cancer TOV21G, and the human hepatocellular cancer cell lines HepG2 and SNU449 and the human neuroblastoma cell line SK-N-SH. The tissue cancers corresponding to these cancer cell lines can be treated with the therapeutic compositions according to the invention.

Analysis of anti-TR7 antibodies Using the above-mentioned test, the capacity of several scFvs of the present invention that had been converted to complete IgG1 molecules was determined to induce apoptosis of cells expressing TR7. In the assays described above, IgG1 antibodies were tested corresponding to the scFvs CM083C12, CM014C10, CM088F10, CM084G02, CM084A02, CM005G08 and CM059H03. A human IgG1 antibody of irrelevant specificity was used as a negative control and TRAIL as a positive control. The lgG1 format of CMOOSG08, CM084A02 and CM084G02 induces apoptosis of the cells of the human colon cancer cell line SW480, and the human breast cancer cell line MDA-MB231, in the presence of 1 pg / mL of cycloheximide. In the absence of cycloheximide, little or no destruction of MDA-MB231 and SW480 cells was observed by anti-TR7 or TRAIL antibodies in this test, except that TRAIL was able to kill MDA-MBA-231 cells in the absence of cycloheximide. With the human colon carcinoma cell line Colo205, the anti-TR7 antibodies tested CM005G08, CM084A02 and CM059H03, induced apoptosis in the absence of cycloheximide and additional entanglement agents. TRAIL also induced apoptosis in the Colo205 cell line (see Figures 1A-1 D, and data not shown). The ability of the anti-TR7 antibodies to reduce the viability of the tested cell lines was increased with the addition of entanglement agents (data not shown). In addition, the test described in this example can also be used to test the effect of more than one anti-TRAIL receptor antibody on cells expressing the TRAIL receptor. For example, cells can be treated with an antibody that specifically binds to TR4 and an antibody that specifically binds to TR7. As above, this experiment can be performed in the presence or absence of one or more chemotherapeutic agents or entanglement agents. In another variation of the present experiment, the antibodies of the invention can be tested for the apoptosis-inducing effect when used in the presence of TRAIL. The degree of apoptosis induced by double treatment with anti-TR4 and anti-TR7 may be synergistic compared to treatment with either anti-TR4 or anti-TR7 alone. This effect may be more pronounced when the experiment is performed in the presence of chemotherapeutic or entanglement agents.

EXAMPLE 4 Identification and cloning of VH and VL domains One method to identify and clone VH and VL domains of cell lines expressing a particular antibody, is to perform PCR with VH and VL specific primers on cDNA made from the cell lines expressing the antibody. Briefly, RNA is isolated from the cell lines and used as a template for RT-PCR designed to amplify the VH and VL domains of the antibodies expressed by the EBV cell lines. The cells can be lysed in the TRIzol® reagent (Life Technologies, Rockville, Maryland) and extracted with one fifth volume of chloroform. After addition of chloroform, the solution is allowed to incubate at room temperature for 10 minutes and centrifuged at 14,000 rpm for 15 minutes at 4 ° C in a tabletop centrifuge. The supernatant is collected and the RNA is precipitated using an equal volume of isopropanol. The precipitated RNA is pelleted by centrifugation at 14,000 rpm for 15 minutes at 4 ° C in a tabletop centrifuge. After centrifugation, the supernatant is discarded and washed with 75% ethanol. After washing, the RNA is centrifuged again at 800 rpm for 5 minutes at 4 ° C. The supernatant is discarded and the pellet is allowed to air dry. The RNA is dissolved in DEPC water and heated at 60 ° C for 10 minutes. The amount of RNA can be determined using optical density measurements. CDNA can be synthesized according to methods well known in the art, starting from .5-2.5 pg of RNA using reverse transcriptase and random hexamer primers. The cDNA is then used as a template for PCR amplification of the VH and VL domains. The primers used to amplify the VH and VL genes are shown in Table 6. Typically, a PCR reaction uses a single 5 'primer and a single 3' primer. Sometimes, when the amount of available RNA template is limiting, or for greater efficiency, groups of 5 'or 3' initiators can be used. For example, the five VH-5 'primers and all JH3' primers are sometimes used in a single PCR reaction. The PCR reaction is carried out in a volume of 50 μ? containing 1X PCR buffer, 2 mM of each dNTP, 0.7 units of high fidelity Taq polymerase, 5 'starter mixture, 3' starter mixture and 7.5 pL of cDNA. The 5 'and 3' primer mixture of both VH and VL can be made by pooling 22 pmol and 28 pmol, respectively, of each individual primer. The PCR conditions are: 96 ° C for 5 minutes; followed by 25 cycles of 94 ° C for 1 minute, 50 ° C for 1 minute, and 72 ° C for 1 minute; followed by an extension cycle of 72 ° C for 10 minutes. After completing the reaction, the sample tubes are stored at 4 ° C.

TABLE 6 Initiator sequences used to amplify the VH and VL domains Initiator Name SEQ ID NO: Initiator Sequence Initiators VH Hu VH1-5 '6 CAGGTGCAGCTGGTGCAGTCTGG Hu VH2-5"7 CAGGTCAACTTAAGGGAGTCTGG Hu VH3-5' 8 GAGGTGCAGCTGGTGGAGTCTGG Hu VH4-5 '9 CAGGTGCAGCTGCAGGAGTCGGG Hu VH5-5" 10 GAGGTGCAGCTGTTGCAGTCTGC Hu VH6- 5 '11 CAGGTACAGCTGCAGCAGTCAGG Hu JH1.2-5' Hu JH3-5 TGAGGAGACGGTGACCAGGGTGCC 12 '13 TGAAGAGACGGTGACCATTGTCCC Hu JH4.5-5' Hu JH6-5 TGAGGAGACGGTGACCAGGGTTCC 14 * 15 TGAGGAGACGGTGACCGTGGTCCC VL Primers Hu Vkappa1-5"16 GACATCCAGATGACCCAGTCTCC Hu Vkappa2a-5 ' 17 GATGTTGTGATGACTCAGTCTCC Hu Vkappa2b-5 '18 GATATTGTGATGACTCAGTCTCC Hu Vkappa3-5' GAAATTGTGTTGACGCAGTCTCC Hu Vkappa4-5 19 '20 GACATCGTGATGACCCAGTCTCC Hu Vkappa5-5' 21 GAAACGACACTCACGCAGTCTCC Hu Vkappa6-5 'GAAATTGTGCTGACTCAGTCTCC Hu Vlambda1-5 22' 23 CAGTCTGTGTTGACGCAGCCGCC Hu Vlambda2-5 '24 CAGTCTGCCCTGACTCAGCCTGC Hu Vlambda3-5 '25 TCCTATGTGCTGACTCAGCCACC Hu Vlambda3b-5' 26 TCTTCTGAGCTGACTCAGGACCC Hu Vlambda4-5 '27 CACGTTATACTGACTCAACCGCC Hu Vlambda5-5' 2 8 CAGGCTGTGCTCACTCAGCCGTC Hu VIambda6-5 '29 AA I I I I ATGCTGACTCAGCCCCA Hu Jkappa1-3' 30 ACGTTTGATTTCCACCTTGGTCCC Initiator Name SEQ ID NO: Sequence Initiator Initiators Hu Jkappa2-3 VL '31 ACGTTTGATCTCCAGCTTGGTCCC Hu Jkappa3-3' 32 ACGTTTGATATCCACTTTGGTCCC Hu Jkappa4-3"33 ACGTTTGATCTCCACCTTGGTCCC Hu Jkappa5-3" 34 ACGTTTAATCTCCAGTCGTGTCCC Hu Hu Jlambda1-3'35 CAGTCTGTGTTGACGCAGCCGCC Jlambda2- 3.36 CAGTCTGCCCTGACTCAGCCTGC Hu Hu Jlambda3-3'37 TCCTATGTGCTGACTCAGCCACC Jlambda3b-3 '38 TCTTCTGAGCTGACTCAGGACCC Hu Hu Jlambda4-3'39 CACGTTATACTGACTCAACCGCC Jlambda5-3'40 CAGGCTGTGCTCACTCAGCCGTC Hu Jiambda6-3'41 AATTTTATGCTGACTCAGCCCCA Then PCR samples are electrophoresed in 1.3% agarose gel. DNA bands of the expected size can be cut from the gel (-506 base pairs for VH domains, and 344 base pairs for VL domains), and can be purified using well-known methods. The purified PCR products can be ligated into a PCR cloning vector (TA vector from Invitrogen Inc., Carlsbad, California). Individual cloned PCR products can be isolated after transfection of E. coli and blue / white color selection. Then, the cloned PCR products can be sequenced using commonly known methods.

EXAMPLE 5 Anti-TR7 antibodies retard the growth of tumor cells in hairless mice To nine-week-old female athymic mice (mice Balb / c a, 20-25 g of body weight, purchased from Taconic, Germantown, New York) were injected subcutaneously in one side with 107 Coló 205 tumor cells (colorectal adenocarcinoma, ATCC No. CCL-222) in phase of logarithmic growth on day 0. The tumors were allowed to develop for five days before treatment with antibody, after which the tumors were approximately 100 mm3 in size. Mice were treated with an antibody comprising the VH and VL domains of CM005G08 (an anti-TR7 antibody, see Table 1) or T1014G03 (an anti-TR4 antibody, described for example in the US application No. Series 60 / 341, 237, which is incorporated herein by reference in its entirety), or with both antibodies, CM005G08 and T1014G03, or with PBS diluent alone. In this example and in Examples 6 and 8 below, the antibodies comprising both the VH and VL domains of CM005G08 or T1014G03 will be referred to as "CM005G08" or "T10114G03", respectively. Antibody treatment was as follows: loading dose: 0.4 mg (20 mg / kg) intravenously, 6 days after injection of tumor cells, with two maintenance doses of 0.2 mg (10 mg / kg) intravenously, a 1 week intervals. Tumor size was measured on days 1 1, 14, 18, 21 and 25. The tumor volume was calculated by measuring the tumor dimensions on 2 axes in triplicate using a calibrator and the formula (width2 x length) / 2. mice treated with T1014G03 only had significantly fewer tumors than the control group treated with PBS on day 14. Mice treated with CM005G08 or CM005G08 and T1014G03 had no palpable tumor on day 18 (data not shown). The test described above can also be used to test the effect of treatment with one or more anti-TRAIL receptor antibodies in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be used in this test (and are used in treatment regimens in conjunction with the antibodies of the present invention) include, for example, 5-fluorouracil, etoposide, taxol, cisplatin, cytabarin (Cytosar), IFN gamma, camptothecin, irinotecan (camptosar, CPT-1 1), adriamycin (doxorubicin), methotrexate, paraplatinin, interferon alfa, paclitaxel, docetaxel , the inhibitor NF-kappa-B SN50 and gemcitabine (Gemzar ™). Other cell lines that can be used in this test include, for example, human colon cancer cell lines SW480, LS174T and HCT1.; the human mammary carcinoma cell line MDA-MB-231 (see example 8 below); the human cervical cancer cell line Hela; the line of human lung carcinoma cells SK-MES-1; the pancreatic cancer cell lines CFPAC, HPAF-II, MPANC-96 and su.8686; the human hepatocellular cancer cell lines SNU449, Hep3B2.1-7 and HepG2; and the human ovarian cancer cell lines OV90, Caov-3, TOV21 G and SKOV3. The tissue cancers corresponding to these cancer cell lines can be treated with the therapeutic compositions according to the invention. In another variation of the present experiment, the antibodies of the invention can be administered in combination with TRAIL. The ability of such combination therapy to inhibit the growth of tumor cells compared to treatment with an antibody can only be tested using the methods detailed above, and comparing the results obtained between combination therapy with the results obtained by treatment with either anti-TR4, anti-TR7 or anti-TR4 and anti-TR7.

EXAMPLE 6 Anti-TR7 antibodies retard the growth of tumor cells in hairless mice The tumor cell line SW480 (colorectal adenocarcinoma) was maintained in vltro in Leibovitz L-15 medium supplemented with fetal bovine serum, glutamine and antibiotics according to the instructions received from the American Type Culture Collection. Cells were used in step 3-10 for in vivo studies. The tumor cells were harvested from the T-50 flasks, rinsed with sterile PBS and then resuspended in sterile saline at a density of 5x104 cells / μ ?. SW480 tumor cells were implanted subcutaneously in the upper back or sides of athymic Swiss male mice (6-8 weeks of age, 20-25 g of body weight, purchased from Taconic, Germantown, New York) at a density of 107 cells per site, 2 sites per animal. In tumor (de novo) preventive models, treatments with chemotherapeutic agents and antibody were initiated 24 hours after inoculation of the tumor cells. T1014G03, CM005G08 or an IgG1 antibody of irrelevant specificity were administered intraperitoneally (i.p.) at a dose of 10 mg / kg each on days 1, 3 and 5, then weekly for three additional doses. The effect of the antibody and control treatments was evaluated by calibrating the size of the tumor on 2 axes at intervals of 3-4 days. Treatment with both T1014G03 and CM005G08 significantly reduced tumor formation compared to the IgG1 control treatment (see Figure 2). The test described above can also be used to test the effect of treatment with one or more anti-TR7 or TR4 antibodies on the growth of tumor cells in vivo. For example, animals in which tumor cells had been injected can be treated with either an antibody that specifically binds with TR4 or with an antibody that specifically binds with TR7. As above, this experiment can be performed in the presence or absence of one or more chemotherapeutic agents. In another variation of the present experiment, the antibodies of the invention can be administered in combination with TRAIL. The ability of such combination therapy to inhibit the growth of tumor cells compared to a single antibody treatment can be determined using the methods detailed above, and comparing the results obtained between combination therapy and treatment with anti-human antibodies. -TR4 or anti-TR7 alone.

EXAMPLE 7 Effect of anti-TR7 antibodies on human hepatocytes The following protocol is exemplary of how the effect of the anti-TR7 antibodies of the invention can affect the viability of human primary hepatocytes, for example, by measuring caspase activation or cell viability. Human hepatocytes are treated with 15.6, 62.5, 250 or 1000 ng / mL of TRAIL (amino acid residues 114-281, Biomol Research Laboratories Inc., Plymouth Meeting, Pennsylvania), 62.5, 125, 250 or 1000 ng / mL of control mAb of isotype (hlgGi, CAT002), or 62.5, 125, 250 or 1000 ng / ml of anti-TR7 antibody. Caspase activation is determined 6 hours after treatment, while viability is determined 24 hours after treatment. Caspase activity is measured using a fluorimetric test utilizing the caspase substrate DEVD conjugated to rhodamine (eg the 'Homogeneous Fluorimetric Caspases Assay' test, available from Roche Molecular Biochemicals (Indianapolis, Indiana)). Cell viability is determined using an ALAMAR Blue ™ test (Biosource International, Camarillo, California).

EXAMPLE 8 Effect of anti-TR7 antibodies on the breast carcinoma model MDA-MB-231 The MDA-MB-231 cell line is a line of human breast adenocarcinoma cells expressing TR7. Based on this finding, the MDA-MB-231 model was selected in athymic mice to test the in vivo efficacy of CM005G08 (lgG1 format) to reduce the volume of pre-existing tumors. The objective of this experiment was to examine whether CM005G08 was capable of altering the growth pattern of a pre-established tumor in MDA-MB-231 in athymic mice in a dose-dependent manner, when used as a single agent. To evaluate the effect of CM005G08 on MDA-MB-231 tumors, CM005G08 was only tested at various concentrations, compared to a negative control antibody (CAT002). Hairless Swiss mice were divided into 6 groups of 10 mice each. On day 0, 1 × 10 6 MDA-MB-231 cells were injected subcutaneously (se) into the lower right mammary area (inguinal area) of the mice. On days 6, 11, 16 and 21, the negative control antibody (CAT002) was administered intravenously (iv) to a group of 2 mice at doses of 10 or 0.1 mg / kg, and 4 groups were administered iv CM005G08 a doses of 10, 5, 1 and 0.1 mg / kg. Tumor volume was measured twice a week until day 46 after tumor inoculation.

CM005G08 at a dose of 1.0 to 10 mg / kg inhibited tumor growth in a dose-dependent manner. Tumor growth analysis throughout the 46-day period showed a very significant drop in tumor progression in mice given CM005G08 at 10, 5 and 1 mg / kg, compared to the two antibody groups of negative control. Tumor volume analysis on day 46, at the end of the experiment, showed that mice treated with 10 and 5 mg / kg of CM005G08 had a significant reduction in tumor volume compared to the negative control group at 10 mg / kg (p = 0.0025 and p = 0.0036, respectively). Mice that received 0.1 mg / kg of CM005G08 did not show any beneficial effect in this experiment. These data suggest that C 005G08 alone is capable of efficiently delaying tumor growth in a dose-dependent manner. It will be clear that the invention can be practiced in a different manner to that which is particularly described in the description and the preceding examples. Many modifications and variations of the present invention are possible in light of the above teachings and therefore are within the scope of the appended claims. The full description of each cited document (including patents, patent applications, journal articles, abstracts, laboratory manuals, books or other exposures) in the background of the invention, the detailed description and the examples, is incorporated herein by reference.

In addition, the sequence listing annexed herein is incorporated by reference in its entirety. The complete description (including the specification, the sequence listing and the drawings) of each of the following applications of E.U.A. it is incorporated herein by reference in its entirety: provisional applications of E.U.A. Nos. Of Series 60/341, 237, filed on December 20, 2001; 60 / 369,877, filed on April 5, 2002; 60 / 384,828, filed June 4, 2002; 60 / 396,591, filed July 18, 2002; 60 / 403,370, filed on August 15, 2002; and 60 / 425,737, filed on November 13, 2002.

LIST OF SEQUENCES < 110 > Human Genome Sciences, Inc. < 1"20> Antibodies that bind immunospecifically to TRAIL receptors < 130 > PF585PCT < 140 > Unassigned 5 < 141 > 2002-12-19 < 1S0 > 60 / 341,237 < 151 > 2001-12-20 < 150 > 60 / 369,877 < 151 > 2002-04-05 < 150 > 60 / 384,828 < 151 > 2002-06-04 < 150 > 60 / 396,591 • j Q < 151 > 2002-07-18 < 150 > 60 / 403,370 < 151 > 2002-08-15 < 150 > 60 / 425,737 < 151 > 2002-11-13 < 160 > 72 < 210 > 1 < 211 > 468 ... < 212 > PRT < 213 > Homo sapiens < 400 > 1 Met Wing Pro Pro Pro Wing Arg Val His Leu Gly Wing Phe Leu Wing Val 1 5 10 15 Thr Pro Asn Pro Gly Ser Wing Wing Ser Gly Thr Glu Wing Wing Wing Wing 20 25 30 Thr Pro Ser Lys Val Trp Gly Ser Wing Gly Arg lie Glu Pro Arg 35 40 45 0 Gly Gly Gly Arg Gly Wing Leu Pro Thr Ser Met Gly Gln His Gly Pro 50 55 60 Wing Wing Arg Wing Arg Wing Gly Arg Wing Pro Gly Pro Arg Pro Wing Arg 65 70 75 80 Glu Ala Ser Pro Arg Leu Arg Val His Lys Thr Phe Lys Phe Val Val 85 90 95 LIST OF SEQUENCES (Continued) Val Gly Val Leu Leu Gln Val Val Pro Ser Be Ala Wing Thr lie Lys 100 105 110 Leu His Asp Gln Ser lie Gly Thr Gln Gln Trp Glu His Ser Pro Leu 115 120 125 Gly Glu Leu Cys Pro Pro Gly Ser His Arg Ser Glu Arg Pro Gly Wing 130 135 140 Cys Asn Arg Cys Thr Glu Gly Val Gly Tyr Thr Asn Wing Ser Asn Asn 145 150 155 160 Leu Phe Ala Cys Leu Pro Cys Thr Ala Cys Lys Ser Asp Glu Glu Glu 165 170 175 Arg Ser Pro Cys Thr Thr Thr Arg Asn Thr Wing Cys Gln Cys Lys Pro 180 185 190 Gly Thr Phe Arg Asn Asp Asn Ser Wing Glu Met Cys Arg Lys Cys Ser 195 200 205 Thr Gly Cys Pro Arg Gly Met Val Lys Val Lys Asp Cys Thr Pro Trp 210 215 220 Ser Asp lie Glu Cys Val His Lys Glu Ser Gly Asn Gly His Asn lie 225 230 235 240 Trp Val lie Leu Val Val Thr Leu Val Val Pro Leu Leu Leu Val Ala 245 250 255 Val Leu lie Val Cys Cys Cys lie Gly Ser Gly Cys Gly Gly Asp Pro 260 265 270 Lys Cys Met Asp Arg Val Cys Phe Trp Arg Leu Gly Leu Arg Gly 275 280 285 Pro Gly Ala Glu Asp Asn Ala His Asn Glu lie Leu Ser Asn Ala Asp 290 295 300 Ser Leu Ser Thr Phe Val Ser Glu Gln Gln Met Glu Ser Gln Glu Pro 305 310 315 320 Wing Asp Leu Thr Gly Val Thr Val Gln Ser Pro Gly Glu Wing Gln Cys 325 330 335 Leu Leu Gly Pro Wing Glu Wing Glu Gly Ser Gln Arg Arg Arg Leu Leu 340 345 350 Val Pro Wing Asn Gly Wing Asp Pro Thr Glu Thr Leu Met Leu Phe Phe 355 360 365 LIST OF SEQUENCES (Continued) Asp Lys Phe Wing Asn lie Val Pro Phe Asp Ser Trp Asp Gln Leu Met 370 375 380 Arg Gln Leu Asp Leu Thr Lys Asn Glu lie Asp Val Val Arg Ala Gly 385 390 395 400 Thr Ala Gly Pro Gly Asp Ala Leu Tyr Ala Met Leu Met Lys Trp Val 405 410 415 Asn Lys Thr Gly Arg Asn Ala Ser lie His Thr Leu Leu Asp Ala Leu 420 425 430 Glu Arg Met Glu Glu Arg His Wing Lys Glu Lys lie Gln Asp Leu Leu 435 440 445 Val Asp Ser Gly Lys Phe lie Tyr Leu Glu Asp Gly Thr Gly Ser Ala 450 455 460 Val Ser Leu Glu 465 < 210 > 2 < 211 > 299 < 212 > P T < 213 > Homo sapiens < 400 > 2 Met Gln Gly Val Lys Glu Arg Phe Leu Pro Leu Gly Asn Ser Gly Asp 1 5 10 15 Arg Pro Arg Pro Pro Asp Gly Arg Arg Arg Arg Pro Arg Thr 20 25 30 Gln Asp Gly Val Gly Asn His Thr Met Ala Arg lie Pro Lys Thr Leu 35 40 45 Lys Phe Val Val Val lie Val Ala Val Leu Leu Pro Val Leu Ala Tyr 50 55 60 Be Wing Thr Thr Wing Arg Gln Glu Glu Val Pro Gln Gln Thr Val Wing 65 70 75 80 Pro Gln Gln Gln Arg His Ser Phe Lys Gly Glu Glu Cys Pro Wing Gly 85 90 95 Ser His Arg Ser Glu His Thr Gly Ala Cys Asn Pro Cys Thr Glu Gly 100 105 110 LIST OF SEQUENCES (Continued) Val Asp Tyr Thr Asn Wing Ser Asn Asn Glu Pro Ser Cys Phe Pro Cys 115 120 125 Thr Val Cys Lys Ser Asp Gln Lys His Lys Ser Ser Cys Thr Met Thr 130 135 140 Arg Asp Thr Val Cys Gln Cys Lys Glu Gly Thr Phe Arg Asn Glu Asn 145 150 155 160 Ser Pro Glu Met Cys Arg Lys Cys Ser Arg Cys Pro Ser Gly Glu Val 165 170 175 Gln Val Ser Asn Cys Thr Ser Trp Asp Asp lie Gln Cys Val Glu Glu 180 185 190 Phe Gly Wing Asn Wing Thr Val Glu Thr Pro Ala Wing Glu Glu Thr Met 195 200 205 Asn Thr Ser Pro Gly Thr Pro Wing Pro Wing Ala Glu Glu Thr Met Asn 210 215 220 Thr Ser Pro Gly Thr Pro Wing Pro Wing Ala Glu Glu Thr Met Thr Thr 225 230 235 240 Be Pro Pro Gly Thr Pro Pro Wing Pro Wing Glu Glu Thr Met Thr Thr Ser 245 250 255 Pro Gly Thr Pro Wing Pro Wing Wing Glu Glu Thr Met Thr Thr Ser Pro 260 265 270 Gly Thr Pro Wing Ser Ser His Tyr Leu Ser Cys Thr lie Val Gly lie 275 280 285 lie Val Leu lie Val Leu lie Val Phe Val 290 295 < 210 > 3 < 211 > 411 < 212 > PRT < 213 > Homo sapiens < 400 > 3 Met Glu Gln Arg Gly Gln Asn Wing Pro Wing Wing Ser Gly Wing Arg Lys 1 5 10 15 Arg His Gly Pro Gly Pro Arg Glu Wing Arg Gly Wing Arg Pro Gly Pro 20 25 30 LIST OF SEQUENCES (Continued) Arg Val Pro Lys Thr Leu Val Leu Val Val Ala Wing Val Leu Leu Leu 35 40 45 Val Ser Wing Glu Wing Ala Leu lie Thr Gln Gln Asp Leu Wing Pro Gln 50 55 60 Gln Arg Wing Ala Pro Gln Gln Lys Arg Ser Ser Pro Ser Glu Gly Leu 65 70 75 80 Cys Pro Pro Gly His His lie Ser Glu Asp Gly Arg Asp Cys lie Ser 85 90 95 Cys Lys Tyr Gly Gln Asp Tyr Ser Thr His Trp Asn Asp Leu Leu Phe 100 105 110 Cys Leu Arg Cys Thr Arg Cys Asp Ser Gly Glu Val Glu Leu Ser Pro 115 120 125 Cys Thr Thr Thr Arg Asn Thr Val Cys Gln Cys Glu Glu Gly Thr Phe 130 135 140 Arg Glu Glu Asp Ser Pro Glu Met Cys Arg Lys Cys Arg Thr Gly Cys 145 150 155 160 Pro Arg Gly and Val Lys Val Gly Asp Cys Thr Pro Trp Ser Asp lie 165 170 .175 Glu Cys Val His Lys Glu Ser Gly lie lie Gly Val Thr Val Wing 180 185 190 Wing Val Val Leu lie Val Wing Val Phe Val Cys Lys Ser Leu Leu Trp 195 200 205 Lys Lys Val Leu Pro Tyr Leu Lys Gly lie Cys Ser Gly Gly Gly Gly 210 215 220 Asp Pro Glu Arg Val Asp Arg Ser Ser Gln Arg Pro Gly Ala Glu Asp 225 230 235 240 Asn Val Leu Asn Glu lie Val Ser lie Leu Gln Pro Thr Gln Val Pro 245 250 255 Glu Gln Glu Met Glu Val Gln Glu Pro Wing Glu Pro Thr Gly Val Asn 260 265 270 Met Leu Ser Pro Gly Glu Ser Glu His Leu Leu Glu Pro Wing Glu Wing 275 280 285 LIST OF SEQUENCES (Continued) Glu Arg Ser Gln Arg Arg Arg Leu Leu Val Pro Wing Asn Glu Gly Asp 290 295 300 Pro Thr Glu Thr Leu Arg Gln Cys Phe Asp Asp Phe Wing Asp Leu Val 305 310 315 320 Pro Phe Asp Ser Trp Glu Pro Leu Met Arg Lys Leu Gly Leu Met Asp 325 330 335 Asn Glu lie Lys Val Wing Lys Wing Glu Wing Wing Gly His Arg Asp Thr 340 345 350 Leu Tyr Thr Met Leu lie Lys Trp Val Asn Lys Thr Gly Arg Asp Wing 355 360 365 Ser Val His Thr Leu Leu Asp Ala Leu Glu Thr Leu Gly Glu Arg Leu 370 375 380 Wing Lys Gln Lys lie Glu Asp His Leu Leu Ser Ser Gly Lys Phe Met 385 390 395 400 Tyr Leu Glu Gly Asn Wing Asp Ser Wing Met Ser 405 410 < 210 > 4 < 211 > 386 < 212 > PRT < 213 > Homo sapiens < 400 > 4 Met Gly Leu Trp Gly Gln Ser Val Pro Thr Ala Ser Ser Ala Arg Ala 1 5 10 15 Gly Arg Tyr Pro Gly Wing Arg Thr Wing Being Gly Thr Arg Pro Trp Leu 20 25 30 Leu Asp Pro Lys lie Leu Lys Phe Val Val Phe lie Val Wing Val Leu 35 40 45 Leu Pro Val Arg Val Asp Ser Wing Thr lie Pro Arg Gln Asp Glu Val 50 55 60 Pro Gln Gln Thr Val Wing Pro Gln Gln Gln Arg Arg Ser Leu Lys Glu 65 70 75 80 Glu Glu Cys Pro Wing Gly Ser His Arg Ser Glu Tyr Thr Gly Wing Cys 85 90 95 LIST OF SEQUENCES (Continued) Asn Pro Cys Thr Glu Gly Val Asp Tyr Thr lie Wing Ser Asn Asn Leu 100 105 110 Pro Ser Cys Leu Leu Cys Thr Val Cys Lys Ser Gly Gln Thr Asn Lys 115 120 125 Be Ser Cys Thr Thr Thr Arg Asp Thr Val Cys Gln Cys Glu Lys Gly 130 135 140 Ser Phe Gln Asp Lys Asn Ser Pro Glu Met Cys Arg Thr Cys Arg Thr 145 150 155 160 Gly Cys Pro Arg Gly Met Val Lys Val Ser Asn Cys Thr Pro Arg Ser 165 170 175 Asp Lie Lys Cys Lys Asn Glu Ser Ala Ala Ser Ser Thr Gly Lys Thr 180 185 190 Pro Wing Wing Glu Glu Thr Val Thr Thr lie Leu Gly Met Leu Wing Ser 195 200 205 Pro Tyr His Tyr Leu lie lie lie Val Val Leu Val lie lie Leu Ala 210 215 220 Val Val Val Val Gly Phe Ser Cys Arg Lys Lys Phe lie Ser Tyr Leu 225 230 235 240 Lys Gly Lie Cys Ser Gly Gly Gly Gly Pro Glu Arg Val His Arg 245 250 255 Val Leu Phe Arg Arg Arg Ser Cys Pro Ser Arg Val Pro Gly Wing Glu 260 265 270 Asp Asn Wing Arg Asn Glu Thr Leu Ser Asn Arg Tyr Leu Gln Pro Thr 275 280 285 Gln Val Ser Glu Gln Glu lie Gln Gly Gln Glu Leu Wing Glu Leu Thr 290 295 300 Gly Val Thr Val Glu Pro Pro Glu Pro Gln Arg Leu Leu Glu Gln 305 310 315 320 Wing Glu Wing Glu Gly Cys Gln Arg Arg Arg Leu Leu Val Pro Val Asn 325 330 335 Asp Ala Asp Be Ala Asp lie Be Thr Leu Leu Asp Ala Be Ala Thr 340 345 350 LIST OF SEQUENCES (Continued) Leu Glu Glu Gly His Wing Lys Glu Thr lie Gln Asp Gln Leu Val Gly 355 360 365 Ser Glu Lys Leu Phe Tyr Glu Glu Asp Glu Wing Gly Ser Wing Ser 370 375 380 Cys Leu 385 < 210 > 5 < 211 > 401 < 212 > PRT < 213 > Homo sapiens < 400 > 5 Met Asn Lys Leu Leu Cys Cys Ala Leu Val Phe Leu Asp lie Ser lie 1 5 10 15 Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp 20 25 30 Glu Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr 35 40 45 Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys Ala Pro 50 55 60 Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys 65 70 75 80 Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Tyr Val Lys Gln Glu 85 90 95 Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr 100 105 110 Leu Glu lie Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe 115 120 125 Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg 130 135 140 Cys Pro Asp Gly Phe Phe Ser Asn Glu Thr Ser Ser Lys Wing Pro Cys 145 150 155 160 Arg Lys His Thr Asn Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys 165 170 175 LIST OF SEQUENCES (Continued) Gly Asn Wing Thr His Asp Asn lie Cys Ser Gly Asn Ser Glu Ser Thr 180 185 190 Gln Lys Cys Gly lie Asp Val Thr Leu Cys Glu Glu Wing Phe Phe Arg 195 200 205 Phe Wing Val Pro Thr Lys Phe Thr Pro Asn Trp Leu Ser Val Leu Val 210 215 220 Asp Asn Leu Pro Gly Thr Lys Val Asn Wing Glu Ser Val Glu Arg lie 225 230 235 240 Lys Arg Gln His Being Being Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu 245 250 255 Trp Lys His Gln Asn Lys Asp Gln Asp lie Val Lys Lys lie lie Gln 260 265 270 Asp lie Asp Leu Cys Glu Asn Ser Val Gln Arg His lie Gly His Wing 275 280 285 Asn Leu Thr Phe Glu Gln Leu Arg Ser Leu Met Glu Ser Leu Pro Gly 290 295 300 Lys Lys Val Gly Wing Glu Asp lie Glu Lys Thr lie Lys Wing Cys Lys 305 310 315 320 Pro Ser Asp Gln lie Leu Lys Leu Leu Ser Leu Trp Arg lie Lys Asn 325 330 335 Gly Asp Gln Asp Thr Leu Lys Gly Leu Met His Wing Leu Lys His Ser 340 345 350 Lys Thr Tyr His Phe Pro Lys Thr Val Thr Gln Ser Leu Lys Thr 355 360 365 lie Arg Phe Leu His Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu 370 375 380 Phe Leu Glu Met lie Gly Asn Gln Val Gln Ser Val Lys lie Ser Cys 385 390 395 400 Leu LIST OF SEQUENCES (Continued) < 210 > 6 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful to amplify the VH and VL domains < 400 > 6 caggtgcagc tggtgcagtc tgg 23 < 210 > 7 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 7 caggtcaact taagggagtc tgg 23 < 210 > 8 < 211 > 23 < 212 > DNA < 213 > Sequence artif < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 8 gaggtgcagc tggtggagtc tgg 23 < 210 > 9 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 9 caggtgcagc tgcaggagtc ggg 23 LIST OF SEQUENCES (Continued) < 210 > 10 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 10 gaggtgcagc tgttgcagtc tgc 23 < 210 > 11 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 11 caggtacagc tgcagcagtc agg 23 < 210 > 12 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 12 tgaggagacg gtgaccaggg tgcc 24 < 210 > 13 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 13 tgaagagacg gtgaccattg tccc 24 LIST OF SEQUENCES (Continued) < 210 > 14 < 211 > 24 < 212 > DNA < 213 > Artificial sequence 220 > 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 14 tgaggagacg gtgaccaggg ttcc 24 < 210 > 15 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 15 tgaggagacg gtgaccgtgg tccc 24 < 210 > 1S < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 16 gacatccaga tgacccagtc tcc 23 < 210 > 17 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 17 gatgttgtga tgactcagtc tcc 23 LIST OF SEQUENCES (Continued) < 210 > 18 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 18 gatattgtga tgactcagtc tcc < 210 > 19 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 19 gaaattgtgt tgacgcagtc tcc < 210 > 20 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > . PCR primer useful for amplifying the VH and VL domains < 400 > 20 gacatcgtga tgacccagtc tcc < 210 > 21 < 211 > 23 < 12 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 21 gaaacgacac tcacgcagtc tcc LIST OF SEQUENCES (Continued) < 210 > 22 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 22 gaaattgtgc tgactcagtc tcc 23 < 210 > 23 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 23 cagtctgtgt tgacgcagcc gcc 23 < 210 > 24 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 24 cagtctgccc tgactcagcc tgc 23 < 210 > 25 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 25 tcctatgtgc tgactcagcc acc 23 LIST OF SEQUENCES (Continued) < 210 > 25 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the H and VL domains < 400 > 26 tcttctgagc tgactcagga ccc 23 < 210 > 27 < 211 > 23 < 12 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 27 cacgttatac tgactcaacc gcc 23 < 210 > 28 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 28 caggctgtgc tcactcagcc gtc 23 < 210 > 29 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 29 aattttatgc tgactcagcc cea 23 LIST OF SEQUENCES (Continued) c210 > 30 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 30 acgtttgatt tccaccttgg tccc 24 < 210 > 31 < 211 > 24 < 212 > DNA < 213 > Artifi sequence 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 31 acgtttgatc tccagcttgg tccc 24 < 210 > 32 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 32 acgtttgata tccactttgg tccc 24 < 210 > 33 < 211 > 24 < 12 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 33 acgtttgatc tccaccttgg tccc 24 < 210 > 34 < 211 > 24 < 212 > DNA LIST OF SEQUENCES (Continued) < 213 > Artificial sequence < 220 > < 223 > PCR primer useful to amplify the VH and VL domains < 400 > 34 acgtttaatc tccagtcgtg tccc 24 < 210 > 35 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful to amplify the VH and VL domains < 400 > 35 cagtctgtgt tgacgcagcc gcc 23 < 210 > 36 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 36 cagtctgccc tgactcagcc tgc 23 < 210 > 37 < 211 > 23 < 212 > DNA < 213 > Artificial sequence 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 37 tcctatgtgc tgactcagcc acc 23 < 210 > 38 < 211 > 23 < 212 > DNA < 213 > Artificial sequence LIST OF SEQUENCES (Continued) < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 38 tcttctgagc tgactcagga ccc 23 < 210 > 39 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 39 cacgttatac tgactcaacc gcc 23 < 210 > 40 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 40 caggctgtgc tcactcagcc gtc 23 < 210 > 41 < 211 > 23 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > PCR primer useful for amplifying the VH and VL domains < 400 > 41 aattttatgc tgactcagcc cea 23 < 210 > 42 < 211 > 244 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM005G08 LIST OF SEQUENCES (Continued) < 400 > 42 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Glu Arg Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Gly Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly lie Asn Trp Asn Gly Gly Ser Thr Gly Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Val Thr lie Ser Arg Asp Asn Wing Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Lys Lie Leu Gly Wing Gly Arg Gly Trp Tyr Phe Asp Leu Trp Gly 100 105 110 Lys Gly Thr Thr Val Thr Val Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Glu Leu Thr Gln Asp Pro Wing 130 135 140 Val Ser Val Ala Leu Gly Gln Thr Val Arg lie Thr Cys Gln Gly Asp 145 150 155 160 Ser Leu Arg Ser Tyr Tyr Wing Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175 Wing Pro Val Leu Val lie Tyr Gly Lys Asn Asn Arg Pro Ser Gly lie 180 185 190 Pro Asp Arg Phe Ser Gly Ser Ser Gly Asn Thr Wing Ser Leu Thr 195 200 205 lie Thr Gly Wing Gln Wing Glu Asp Glu Wing Asp Tyr Tyr Cys Asn Ser 210 215 220 Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu 225 230 235 240 Thr Val Leu Gly LIST OF SEQUENCES (Continued) < 210 > 43 < 211 > 245 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM005A08 < 400 > 43 Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Be Ser Tyr 20 25 30 Wing Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr His Cys 85 90 95 Wing Arg Gly Gly Tyr Being Ser Being Arg Wing Wing Tyr Asp lie Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Gly Ser Gly Ser Gly Gly Thr Gln Asp Pro 130 135 140 Wing Val Ser Val Wing Leu Gly Gln Thr Val Arg lie Thr Cys Gln Gly 145 150 155 160 Asp Ser Leu Arg Ser Tyr Tyr Wing Ser Trp Tyr Gln Gln Lys Pro Gly 165 170 175 Gln Ala Pro Val Leu Val lie Tyr Gly Lys Asn Asn Arg Pro Ser Gly 180 185 190 lie Pro Asp Arg Phe Ser Gly Ser Ser Gly Asn Thr Wing Ser Leu 195 200 205 Thr lie Thr Gly Wing Gln Wing Glu Asp Glu Wing Asp Tyr Tyr Cys Asn 210 215 220 LIST OF SEQUENCES (Continued) Being Arg Asp Being Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys 225 230 235 240 Leu Thr Val Leu Gly 245 < 210 > 44 < 211 > 246 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM014C10 < 400 > 44 Gln Val Gln Leu Val Gln Ser Gly Wing Glu Val Lys Lys Pro Gly Wing 1 5 10 15 Ser Val Lys lie Ser Cys Glu Gly Ser Gly Tyr Thr Phe Asn Ser Tyr 20 25 30 Thr Leu His Trp Leu Arg Gln Wing Pro Gly Gln Arg Leu Glu Trp Met 35 40 45 Gly Arg lie Asn Wing Gly Asn Gly Asn Thr Lys Tyr Ser Gln Asn Phe 50 55 60 Gln Gly Arg Leu Ser lie Thr Arg Asp Thr Ser Wing Thr Thr Wing Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Wing Arg Val Phe Thr Tyr Ser Phe Gly Met Asp Val Trp Gly Arg Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Leu Thr Gln Pro Pro Ser 130 135 140 Wing Ser Gly Thr Pro Gly Gln Arg Val Thr lie Ser Cys Ser Gly Gly 145 150 155 160 Gly Ser Asn lie Gly Arg Asn Ser Val Ser Trp Tyr Gln Gln Leu Pro 165 170 175 Gly Thr Ala Pro Lys Leu lie Leu Tyr Ser Asn Asn Gln Arg Pro Ser 180 185 190 LIST OF SEQUENCES (Continued) Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Wing Ser 195 200 205 Leu Ala lie Ser Gly Leu Arg Ser Glu Asp Glu Wing Leu Tyr Tyr Cys 210 215 220 Wing Wing Trp Asp Asp Ser Leu Ser Gly Gly Val Phe Gly Gly Gly Thr 225 230 235 240 Lys Leu Thr Val Leu Gly 245 < 210 > 45 < 211 > 244 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM029B01 < 400 > 45 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Be Ser Tyr 20 25 30 Wing Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Lys Val His Arg Pro Gly Arg Ser Gly Tyr Phe Asp Tyr Trp Gly 100 105 110 Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Glu Leu Thr Gln Asp Pro Wing 130 135 140 Val Ser Val Ala Leu Gly Gln Thr Val Arg lie Thr Cys Gln Gly Asp 145 150 155 160 LIST OF SEQUENCES (Continued) Ser Leu Arg Ser Tyr Tyr Wing Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175 Wing Pro Val Leu Val lie Tyr Gly Lys Asn Asn Arg Pro Ser Gly lie 180 185 190 Pro Asp Arg Phe Ser Gly Ser Ser Gly Asn Thr Wing Ser Leu Thr 195 200 205 lie Thr Gly Wing Gln Wing Glu Asp Glu Wing Asp Tyr Tyr Cys Asn Ser 210 215 220 Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu 225 230 235 240 Thr Val Leu Gly < 210 > 46 < 211 > 235 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv C 033D06 < 400 > 46 Gln Val Gln Leu Gln Gln Ser Gly Wing Glu Val Lys Lys Pro Gly Wing 1 5 10 15 Ser Val Arg Val Ser Cys Gln Wing Ser Gly Tyr Ser Leu Ser Glu Tyr 20 25 30 Tyr lie His Trp Val Arg Gln Wing Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Leu Asn Pro Asn Ser Gly Val Thr Asp Tyr Wing Gln Lys Phe 50 55 60 Gln Gly Arg Val Ser Met Thr Arg Asp Thr Ser lie Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Phe Asn Asp Thr Wing Val Tyr Phe Cys 85 90 95 Wing Arg Gly Asn Gly Asp Tyr Trp Gly Lys Gly Thr Leu Val Thr Val 100 105 110 Ser Pro Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 115 120 125 LIST OF SEQUENCES (Continued! Be Ser Glu Leu Thr Gln Asp Pro Wing Val Ser Val Wing Leu Gly Gln 130 135 140 Thr Val Arg lie Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Thr 145 150 155 160 Asn Trp Phe Gln Gln Lys Pro Gly Gln Ala Pro Leu Leu Val Val Tyr 165 170 175 Wing Lys Asn Lys Arg Pro Ser Gly lie Pro Asp Arg Phe Ser Gly Ser 180 185 190 Ser Ser Gly Asn Thr Wing Ser Leu Thr lie Thr Gly Wing Gln Wing Glu 195 200 205 Asp Glu Wing Asp Tyr Tyr Cys His Ser Arg Asp Ser Ser Gly Trp Val 210 215 220 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 225 230 235 < 210 > 47 < 211 > 245 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM013A11 < 400 > 47 Gln Val Gln Leu Val Gln Ser Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Ser Pro Asp 20 25 30 Wing and His Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Val lie Ser Phe Asp Gly Ser Gln Thr Phe Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Gln Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Pro Ala Arg Phe Phe Pro Leu His Phe Asp Lie Trp Gly 100 105 110 LIST OF SEQUENCES (Continued) Arg Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu Thr Gln 130 135 140 Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg lie Thr Cys 145 150 155 160 Gln Gly Asp Ser Leu Arg Thr His Tyr Wing Ser Trp Tyr His Gln Arg 155 170 175 Pro Gly Arg Wing Pro Val Leu Val Asn Tyr Pro Lys Asp Ser Arg Pro 180 185 190 Ser Gly Lie Pro Asp Arg Phe Ser Gly Ser Ser Gly Asn Thr Wing 195 200 205 Ser Leu Thr lie lie Gly Ala Gln Ala Wing Asp Glu Gly Asp Tyr Tyr 210 215 220 Cys Gln Ser Arg Asp Ser Ser Gly Val Leu Phe Gly Gly Gly Thr Lys 225 230 235 240 Val Thr Val Leu Gly 245 < 210 > 48 < 211 > 247 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM013F04 < 400 > 48 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Wing Wing Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Trp Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Wing Asn lie Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Wing Lys Asn Ser Leu Tyr 65 70 75 80 LIST OF SEQUENCES (Continued) Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Arg Asp Phe Ser Gly Tyr Gly Asp Tyr Leu Asp Tyr Trp Gly Lys 100 105 110 Gly Thr Leu Val Thr Val Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser Ala Leu Thr Gln Pro Pro 130 135 140 Ser Wing Ser Gly Ser Pro Gly Gln Ser Val Thr lie Ser Cys Thr Gly 145 150 155 ISO Thr Ser Ser Asp lie Gly Asn Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175 His Pro Gly Lys Wing Pro Lys Leu Met Lie Tyr Glu Val Asn Glu Arg 180 185 190 Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205 Wing Ser Leu Thr Val Ser Gly Leu Arg Pro Glu Asp Glu Wing Asp Tyr 210 215 220 Tyr Cys Ser Ser Tyr Wing Gly Asn Asn Wing Val lie Phe Gly Gly Gly 225 230 235 240 Thr Gln Leu Thr Val Leu Gly 245 < 210 > 49 < 211 > 255 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM088F10 < 400 > 49 Gln Val Gln Leu Val Gln Ser Gly Wing Glu Val Lys Lys Pro Gly Wing 1 5 10 15 Ser Val Lys Val Ser Cys Lys Wing Ser Gly Tyr Thr Phe Thr Thr His 20 25 30 Wing Met His Trp Val Arg Gln Wing Pro Gly Gln Ser Leu Glu Trp Met 35 40 45 LIST OF SEQUENCES (Continued) Gly Trp lie Asn Thr Gly Asn Gly Asn Thr Lys Tyr Ser Gln Ser Phe 50 55 60 Gln Gly Arg Val Ser lie Thr Arg Asp Thr Ser Wing Asn Thr Wing Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Arg Ala Ser Arg Asp Ser Gly Tyr Tyr Tyr Val Pro Pro Gly 100 105 110 Asp Phe Phe Asp Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala 130 135 140 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 145 150 155 160 Ser lie Thr lie Ser Cys Thr Gly Ser Arg Ser Asp lie Gly Gly Tyr 165 170 175 Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Wing Pro Lys Leu 180 185 190 Leu lie Tyr Asp Val Tyr Asn Arg Pro Ser Gly lie Ser Asp His -Phe 195 200 205 Ser Gly Ser Lys Ser Asp Asn Thr Ala Ser Leu Thr lie Ser Gly Leu 210 215 220 Gln Ser Glu Asp Asp Wing Asp Tyr Tyr Cys Ser Ser Tyr Wing Gly Tyr 225 230 235 240 His Thr Trp lie Phe Gly Gly Gly Thr Lys Val Thr Val Leu Gly 245 250 255 < 210 > 50 < 211 > 248 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv C 084A02 < 400 > 50 Glu Val Gln Leu Val Gln Ser Gly Wing Glu Val Lys Lys Pro Gly Wing 1 5 10 15 LIST OF SEQUENCES (Continued) Ser Val Lys Leu Ser Cys Lys Wing Ser Gly Tyr Thr Leu Val Asn Tyr 20 25 30 Phe Met His Trp Val Arg Gln Wing Pro Gly Gln Gly Pro Glu Trp Met 35 40 45 Gly Met lie Asn Pro Ser Gly Gly Thr Thr Lys Asn Arg Gln Lys Phe 50 55 60 Gln Asp Arg Val Thr Met Thr Arg Asp Thr Ser Thr Arg Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Gly Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Thr Asp Phe Lys Gly Thr Asp lie Leu Phe Arg Asp Trp Gly Arg 100 105 110 Gly Thr Leu Val Thr Val Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Leu Thr Gln Pro Pro 130 135 140 Ser Wing Ser Gly Thr Pro Gly Gln Arg Val Ser lie Ser Cys Ser Gly 145 150 155 160 Being Being Asn lie Gly Being Asn Thr Val lie Trp Tyr Gln Gln Leu 165 170 175 Pro Gly Thr Wing Pro Lys Leu Leu Met Tyr Ser As Asp Arg Arg Pro 180 185 190 Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Wing 195 200 205 Ser Leu Ala lie Ser Gly Leu Gln Ser Glu Asp Glu Wing Asp Tyr Tyr 210 215 220 Cys Wing Thr Trp Asp Asp Ser Leu Asn Gly His Tyr Val Phe Gly Thr 225 230 235 240 Gly Thr Lys Leu Thr Val Leu Gly 245 < 210 > 51 < 211 > 243 < 212 > PRT < 213 > Artificial sequence < 220 > LIST OF SEQUENCES (Continued) < 223 > scFv C 087C06 < 400 > 51 Gln Met Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Be Asp Tyr 20 25 30 Tyr Met Ser Trp lie Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Arg Gly Gly Be Thr Phe Asp lie Trp Gly Arg Gly Thr Met Val 100 105 110 Thr Val Ser Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 115 120 125 Gly Gly Ser Ala Gln Pro Val Leu Thr Gln Pro Pro Be Wing Ser Gly 130 135 140 Thr Pro Gly Gln Arg Val Thr lie Ser Cly Ser Gly Ser Asn Ser Asn 145 150 155 160 lie Gly Ser Arg Pro Val Asn Trp Tyr Gln Gln Leu Pro Gly Thr Wing 165 170 175 Pro Lys Leu Leu lie Gln Gly Asn Asn Gln Arg Pro Ser Gly Val Pro 180 185 190 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala lie 195 200 205 Ser Gly Leu Gln Ser Glu Asp Glu Wing Asp Tyr Tyr Cys Ala Ala Trp 210 215 220 Asp Asp Ser Leu Thr Gly Tyr Val Phe Gly Pro Gly Thr Lys Leu Thr 225 230 235 240 Val Leu Gly LIST OF SEQUENCES (Continued) < 210 > 52 < 211 > 240 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > SCFv CM055A01 < 400 > 52 Gln Met Gln Leu Val Gln Ser Gly Gly Wing Val Val Gln Pro Gly Arg 1 5 10 15 Being Leu Arg Leu Being Cys Wing Wing Being Gly Phe Thr Phe Being Being Tyr 20 25 30 Gly Met His Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Wing Val lie Ser Tyr Asp Gly Ser lie Lys Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Arg Glu Arg Leu Arg Gly Leu Asp Pro Trp Gly Gln Gly Thr Met 100 105 110 Val Thr Val Ser Ser Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Leu Thr Gln Asp Pro Wing Val Ser Val Ala 130 135 140 Leu Gly Gln Thr Val Arg lie Thr Cys Gln Gly Asp Ser Leu Arg Ser 145 150 155 160 Tyr Tyr Wing Ser Trp Tyr Gln Gln Lys Pro Gly Gln Wing Pro Val Leu 165 170 175 Val lie Tyr Gly Lys Asn Asn Arg Pro Ser Gly lie Pro Asp Arg Phe 180 185 190 Ser Gly Ser Ser Gly Asn Thr Wing Ser Leu Thr lie Thr Gly Wing 195 200 205 Gln Wing Glu Asp Glu Wing Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser 210 215 220 LIST OF SEQUENCES (Continued) Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 225 230 235 240 < 210 > 53 < 211 > 243 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > SCFv CM08! Cll < 400 > 53 Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Be Pro Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser lie Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Wing Arg Gly Wing Ser Gly Pro Asp Tyr Trp Gly Arg Gly Thr Met Val 100 105 110 Thr Val Ser Ser Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Wing Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Wing 130 135 140 Wing Pro Gly Gln Lys Val Thr lie Ser Cys Ser Gly Ser Thr Ser Asn 145 150 155 160 lie Gly Asn Asn Tyr Val Ser Trp Tyr Gln Gln Val Pro Gly Thr Wing 165 170 175 Pro Lys Leu Leu lie Tyr Asp Asn Asn Lys Arg Pro Ser Gly lie Pro 180 185 190 Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly lie 195 200 205 LIST OF SEQUENCES (Continued) Thr Gly Leu Gln Thr Gly Asp Glu Wing Asp Tyr Tyr Cys Gly Thr Trp 210 215 220 Asp Ser Ser Leu Ser Ala Leu Val Phe Gly Gly Gly Thr Lys Val Thr 225 230 235 240 Val Leu Gly < 210 > 54 < 211 > 253 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM089A03 < 400 > 54 Gln Val Gln Leu Gln Gln Ser Gly Wing Glu Val Lys Thr Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Wing Ser Gly Gly Thr Phe Arg Asn Asn 20 25 30 Ala lie Ser Trp Val Arg Gln Wing Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Phe lie Pro Lys Phe Gly Thr Thr Asn His Wing Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Wing Asp Asp Ser Thr Asn Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Wing Arg Gly Gly Wing Tyr Cys Gly Gly Gly Arg Cys Tyr Leu Tyr Gly 100 105 110 Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Be Wing Gln Wing 130 135 140 Val Val lie Gln Glu Pro Ser Leu Thr Val Ser Pro Gly Gly Thr Val 145 150 155 160 Thr Leu Thr Cys Gly Ser Ser Thr Gly Wing Val Thr Ser Gly His Tyr 165 170 175 LIST OF SEQUENCES (Continued) Pro Tyr Trp Phe Gln Gln Lys Pro Gly Gln Wing Pro Arg Thr Leu lie 180 185 190 Tyr Asp Thr Ser Asn Lys Arg Ser Trp Thr Pro Wing Arg Phe Ser Gly 195 200 205 Ser Leu Leu Gly Gly Lys Ala Wing Leu Thr Leu Ser Gly Ala Gln Pro 210 215 220 Glu Asp Glu Ala Glu Tyr Tyr Cys Leu Val Ser Tyr Ser Gly Ser Leu 225 230 235 240 Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245 250 < 210 > 55 < 211 > 243 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > scFv CM075A01 < 400 > 55 Glu Val Gln Leu Leu Glu Be Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Be Leu Arg Leu Be Cys Wing Wing Be Gly Phe Thr Phe Be Ser Tyr 20 25 30 Wing Met Ser Trp Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Wing Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Val Lys Gly Wing Trp Leu Asp Tyr Trp Gly Arg Gly Thr Met Val Thr 100 105 110 Val Ser Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Ala Leu Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu 130 135 140 LIST OF SEQUENCES (Continued) Ser Pro Gly Lys Thr Val Thr lie Ser Cys Thr Gly Ser Ser Gly Ser 145 150 155 ISO Val Ala Arg Asn Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Wing 165 170 175 Pro Thr lie Val lie Tyr Glu Asp Asn Arg Arg Pro Ser Gly Val Pro 180 185 190 Gly Arg Phe Ser Gly Ser lie Asp Arg Ser Ser Asn Ser Wing Ser Leu 195 200 205 Thr lie Ser Gly Leu Gln Thr Glu Asp Glu Wing Asp Tyr Tyr Cys Gln 210 215 220 Ser Tyr Asn Tyr Asn Thr Trp Val Phe Gly Gly Gly Thr Lys Leu Thr 225 230 235 240 Val Leu Gly < 210 > 56 < 211 > 247 < 212 > PRT '< 213 > Artificial sequence < 220 > < 223 > scFv CM059H03 < 400 > 56 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Arg Wing Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Gly lie Thr Trp Val Arg Gln Wing Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp lie Be Wing Tyr Asn Gly Lys Thr Asn Tyr Val Gln Glu Leu 50 55 60 Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Thr Ser Leu Arg Ser Asp Asp Thr Wing Val Tyr Tyr Cys 85 90 95 Wing Arg Arg Gly Asn Asn Tyr Arg Phe Gly Tyr Phe Asp Phe Trp Gly 100 105 110 LIST OF SEQUENCES (Continued) Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Glu Thr Thr Leu Thr Gln 130 135 140 Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Wing Thr Leu Ser 145 150 155 ISO Cys Arg Ala Ser Gln Ser lie Be Ser Asn Leu Wing Trp Tyr Gln 165 170 175 Gln Lys Pro Gly Arg Wing Pro Arg Leu Leu lie Tyr Gly Wing Being 180 180 190 Arg Ala lie Gly lie Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr 195 200 205 Asp Phe Thr Leu Thr lie Ser Arg Leu Glu Wing Glu Asp Phe Wing Val 210 215 220 Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro lie Thr Phe Gly Gln Gly 225 230 235 240 Thr Arg Leu Glu lie Lys Arg 245 < 210 > 57 < 211 > 732 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM005G08 < 400 > 57 gaggtgcagc tggtgcagtc tgggggaggt gtggaacggc cgggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatggca tgagctgggt ccgccaagct 120 ccagggaagg ggctggagtg ggtctctggt attaattgga atggtggtag cacaggatat 180 gcagactctg tgaagggccg agtcaccatc tccagagaca acgccaagaa ctccctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtat attactgtgc gaaaatcctg 300 ggtgccggac ggggctggta cttcgatctc tgggggaagg ggaccacggt caccgtctcg 360 agtggtggag gcggttcagg cggaggtggc agcggcggtg gcggatcgtc tgagctgact 420 caggaccctg ggccttggga ctgtgtctgt cagacagtca ggatcacatg ccaaggagac 480 agcctcagaa gctattatgc aagctggtac cagcagaagc caggacaggc ccctgtactt 540 gtaaaaacaa gtcatctatg ccggccctca gggatcccag accgattctc tggctccagc 600 tcaggaaaca cagcttcctt gaccatcact ggggctcagg cggaagatga ggctgactat 660 tactgtaact cccgggacag cagtggtaac catgtggtat tcggcggagg gaccaagctg gt accgtcctag 720 732 SEQUENCE LISTING (Continued) < 210 > 58 < 211 > 735 < 212 > ADU < 213 > Artificial sequence DNA encoding scFv CM005A08 < 400 > 58 gaggtgcagc tggtggagac cgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtct atcactgtgc gagagggggt 300 tatagcagca gccggtccgc tgcttatgat atctggggcc agggcaccct ggtcaccgtc 360 tcttcaggtg gaggcggttc aggcggaggt ggcagcggcg gtggcggatc gtctgagctg 420 actcaggacc ctgctgtgtc tgtggccttg ggacagacgg tcaggatcac atgccaagga 480 gacagcctca gaagctatta tgcaagctgg taccagcaga agccaggaca ggcccctgta 540 atggtaaaaa cttgtcatct caaccggccc "tcagggatcc cagaccgatt ctctggctcc 600 agctcaggaa acacagcttc cttgaccatc actggggctc aggcggaaga tgaggctgac 660 actcccggga tattactgta cagcagtggt aaccatgtgg tattcggcgg agggaccaag ctgaccgtcc taggt 720 735 < 210 > 59 < 211 > 738 < 212 > DNA < 213 > Artificial sequence DNA encoding scFv CM014C10 < 4O0 > 59 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaagatt 60 tcctgcgagg gttctggata caccttcaat agttacactc tccattggtt gcgccaggcc 120 cccggacaga ggcttgagtg gatgggacgg atcaacgctg gcaatggtaa cacaaaatat 180 tcacagaact tccagggcag actcagcatt accagggaca catccgcgac cacagcctac 240 atggagttga gcagcctgag atctgaagac acgggtgttt attactgtgc gagggtcttc 300 acctactctt tcggaatgga cgtctggggc agaggaaccc tggtcaccgt ctcgagtgga 360 ggcggcggtt caggcggagg tggctctggc ggtggcggaa gtgcacagtc tgtgctgact 420 cagccaccct cagcgtctgg gacccccggg cagagggtca ccatctcttg ttctggaggc 480 tcggaaggaa ggttccaata ttctgtgtcc tggtaccagc aactcccagg gacggccccc 540 aaactcatct tgtatagcaa taatcagcgg ccctcagggg tccctgaccg attctctggc 600 tccaagtctg gcacgtcagc atccctggcc atcagtggac tccggtccga ggatgaggct 660 ctttattact gtgcagcatg ggatgacagc ctgagtggtg gcgtgttcgg cg acc ag aagctgaccg tcctaggt 720 738 < 210 > 60 < 211 > 732 LIST OF SEQUENCES (Continued) < 212 > DNA < 213 Artificial sequence < 220 > < 223 > DNA encoding scFv CM029B01 < 400 > 60 caggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagtccac 300 ggagtggtta aggccaggga ttttgactac tggggccggg gtaccctggt caccgtctcc 360 tcaggtggag gcggttcagg cggaggtggc agcggcggtg gcggatcgtc tgagctgact 420 ctgtgtctgt caggaccctg ggccttggga cagacagtca ggatcacatg ccaaggagac 480 agcctcagaa gctattatgc aagctggtac cagcagaagc caggacaggc ccctgtactt 540 gtaaaaacaa gtcatctatg ccggccctca gggatcccag accgattctc tggctccagc 600 tcaggaaaca cagcttcctt gaccatcact ggggctcagg cggaagatga ggctgactat 660 tactgtaact cccgggacag cagtggtaac catgtggtat tcggcggagg gaccaagctg 720 accgtcctag ge 732 < 210 > 61 < 211 > 705 < 212 > DNA < 213 > Artificial sequence DNA encoding scFv CM033D06 < 400 > 61 caggtacagc tgcagcagtc aggggccgag gtgaagaagc ctggggcctc agtgagggtc 60 tcctgccagg cctctggata cagcctcagc gaatactata tccactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatggggtgg ctgaatccta acagtggtgt cacagactac 180 gcacagaagt ttcagggccg cgtctccatg accagggaca cgtcaatcag tacagcctac 240 atggaactga gtagtctgac ttttaacgac acggccgtct atttctgtgc gcggggtaat 300 ggcgactact ggggcaaagg aaccctggtc accgtctccc caggtggagg cggttcaggc 360 ggaggtggca gcggcggtgg cggatcgtct gagctgactc aggaccctgc tgtgtctgtg 420 gccttgggac agacagtcag gatcacttgc caaggagaca gtctcagaag ctattacaca 480 aactggttcc ageagaagee aggacagg c cctctacttg tcgtctatgc taaaaataag 540 cggccctcag ggateccaga ccgattctct ggctccagct caggaaacac agetteettg 600 accatcactg gggctcaggc ggaagatgag gctgactatt actgtcattc ccgggacagc 660 agtggttggS tSJttcSSJCSS agggaccaag ctgaccgtcc taggt 705 < 210 > 62 < 211 > 735 < 212 > DNA < 213 > Artificial sequence < 220 > LIST OF SEQUENCES (Continued) < 223 > DNA encoding scFv CM013A11 < 400 > 62 caggtccagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt cctgacgcca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg gatgggagtt atttcgtttg atggaagcca aacattctac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attcccagaa tacactgtat 240 ctgcaaatga acagcctgag atctgatgac acggctgtct attactgtgc gagagccccc 300 gcgcgttttt ttcctcttca ctttgacatc tggggccggg ggacaatggt caccgtctcg 360 agtggaggcg gcggttcagg cggaggtggc tctggcggtg gcggaagtgc actttcttct 420 gagctgactc aggaccctgc tgtgtctgtg gccttgggac agacagtccg gatcacctgc 480 cagggggaca gcctcagaac gcattatgca agctggtacc accagaggcc agggcgggcc 540 cctgtccttg tcaactatcc taaagacagt cggccctcgg ggatcccaga ccgattttct 600 ggctccagct caggcaacac agcttctttg accatcattg gggctcaggc ggcagatgag 660 ggtgactact attgtcagtc acgggacagc agtggtgttc ttttcggcgg agggaccaag gtcaccgtcc taggt 720 735 < 210 > 63 < 211 > 741 < 12 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM013F04 < 400 > 63 gaggtgcagc tggtggagtc cgggggaggc ttggtccagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagt agctattgga tgagctgggt ccgccaggct 120 ccagggaaag ggctggagtg ggtggccaac ataaagcaag atggaagtga gaaatactat 180 gtggactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagggatttt 300 tctggctacg gtgactactt ggactactgg ggcaagggca ccctggtcac cgtctcgagt 360 ggaggcggcg gttcaggcgg aggtggctct ggcggtggcg gaagtgcaca atctgccctg 420 actcagcctc cctccgcgtc cggatctcct ggacagtcag tcaccatctc ctgcactggc 480 accagcagtg acattggtaa ttataactat gtctcctggt accaacaaca cccaggcaaa 540 gcccccaaac tcatgattta tgaagtcaat gagcggccct caggggtccc tgatcgcttc 600 agtctggcaa tctggctcca cacggcctcc ctgaccgtct ctgggctccg gcctgaggat 660 gaggctgatt attactgcag ctcatatgca ggcaacaacg ccgtaatttt cggcggaggg acccagctca ccgtcctagg 720 t 741 < 210 > 64 < 211 > 765 < 12 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM088F10 LIST OF SEQUENCES (Continued) < 400 > 64 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg cttctggata caccttcact acccatgcta tgcattgggt gcgccaggcc 120 cccggacaaa gccttgagtg gatgggatgg atcaacactg gcaatggtaa cacaaaatat 180 tcacagagtt tccagggcag agtcagcatt accagagaca catccgcgaa cacagcctac 240 gcagccttaa atggaattga atctgaagac acggctatgt attactgtgc gagggctagt 300 gtggttatta cgtgatagta ctacgttccc cccggcgatt tttttgatat ctggggccaa 360 ggcaccctgg tcaccgtctc gagtggaggc ggcggttcag gcggaggtgg ctctggcggt 420 ggcggaagtg cacagtctgc cctgactcag cctgcctccg tgtctgggtc tcctggacag 480 tcgatcacca tctcctgcac tggaagcaga agtgacattg gtggttataa ctttgtctcc 540 tggtaccaac aacacccagg caaagccccc aaactcctga tctatgatgt ctataatcgg 600 tttctgatca ccctcaggaa cttctctggc tccaagtctg acaacacggc ctccctgacc 660 atctctggcc tccagtctga ggacgacgct gattattact gcagttcata tgcaggctac 720 cacacctgga ttttcggcgg ggggaccaag gtcaccgtcc taggt 765 < 210 > 65 < 211 > 744 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM084A02 < 400 > 65 gaggtccagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaactt 60 tcctgcaagg catctggata cacccttgtc aactacttta tgcactgggt acgacaggcc 120 cctggacaag ggcctgagtg gatgggaatg atcaacccta gtggtggtac tacaaagaac 180 agacagaagt tccaggacag agtcaccatg accagggaca cgtccacgag aacagtctat 240 atggagttga gtggtctgac atctgaagac acggccgtct attactgtgc gaccgacttt 300 aaggggaccg atattctctt ccgggactgg ggccggggca ccctggtcac cgtctcgagt 360 gg 9gc99c9 gttcaggcgg aggtggctct ggcggtggcg gaagtgcaca gtctgtgttg 420 acgcagccgc cctccgcgtc tgggaccccc gggcagaggg tctccatctc ttgttctggc 480 agcagctcca atatcggaag taatactgtc atctggtacc agcaactccc aggaacggcc 540 cccaaactcc tcatgtatag taatgatcgc cggccctcag gggtccctga ccgattctct 600 ggctccaagt ctggcacctc agcctccctg gccatcagtg ggctccagtc tgaggatgag 660 gctgattatt actgtgcaac atgggatgac agcctgaatg gccattatgt cttcggaact 720 gggaccaagc tgaccgtcct AGGT 744 < 210 > 66 < 211 > 729 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM087C06 < 400 > 66 cagatgcagc tggtgcagtc tgggggaggc ttggtcaagc ctggagggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt gactactaca tgagctggat ccgccaggct 120 LIST OF SEQUENCES (Continued) ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagtctgag agccgaggac acggctgtgt attactgtgc aagaggagga 300 tccacttttg atatctgggg ccgggggaca atggtcaccg tctcgagtgg aggcggcggt 360 tcaggcggag gtggctctgg cggtggcgga agtgcacagc ctgtgctgac tcagccaccc 420 tcagcgtctg ggacccccgg gcagagggtc accatctctt gttctggaag caactccaac 480 ggcctgtaaa atcggaagca ttggtaccag cagctcccag gaacggcccc caaactcctc 540 attcaaggta acaatcagcg gccctcaggg gtccctgacc gattctctgg ctccaagtct 600 ggcacctcag cctccctggc catcagtggg ctccagtctg aggatgaggc tgattattac 660 tgtgcagctt gggatgacag cctgactggt tatgtcttcg gacctgggac caagctgacc 720 gtcctaggt 729 < 210 > 67 < 211 > 720 < 212 > DNA < 213 > Artificial sequence DNA encoding scFv CM055A01 < 400 > 67 cagatgcagc tggtgcagtc tgggggagcc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cttctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtat taaatactat 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtgt attactgtgc gagagaacgg 300 ttacggggcc tcgacccctg gggccagggg acaatggtca ccgtctcgag tggtggaggc 360 ggttcaggcg gaggtggcag cggcggtggc ggatcgtctg agctgactca ggaccctgct 420 gtgtctgtgg ccttgggaca gacagtcagg atcacatgcc aaggagacag cctcagaagc 480 tattatgcaa gctggtacca. gcagaagcca ggacaggccc ctgtactcgt catctatggt 540 aaaaacaacc ggccctcagg gatcccagac cgattctctg gctccagctc aggaaacaca 600 gcttccttga ccatcactgg ggctcaggcg gaagatgagg ctgactatta ctgtaactcc 660 cgggacagca gtggtaacca tgtggtattc ggcggaggga ccaagctgac cgtcctaggt 720 < 210 > 68 < 211 > 729 < 212 > DNA < 213 > Artificial sequence '< 220 > < 223 > DNA encoding scFv CM085C11 < 400 > 68 gaggtgcagc tggtggagac cgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc ccctattaca tgagctgggt ccgccaggct 120 ccagggaagg ggctagagtg ggtctcagct attagtggta gtggtggtag tatatactac 180 gcagactccg tgaagggccg gttcaccatc attccaagaa tccagagaca cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccctat attactgtgc gagaggggca 300 tctggccctg actactgggg cagagggaca atggtcaccg tctcgagtgg aggcggcggt 360 SEQUENCE LISTING (Continued) tcaggcggag gtggctctgg cggtggcgga agtgcacagt ctgtgttgac gcagccgccc 420 tcagtgtctg cggccccagg acagaaggtc accatctcct gctctggaag cacctccaac 480 attgggaata attatgtatc ctggtaccag caggtcccag gaacagcccc caaactcctc 540 atttatgaca ataataagcg accctcaggg attcctgacc gattctctgg ctccaagtct 600 ggcacgtcag ccaccctggg catcaccggg ctccagactg gggacgaggc cgattattac 660 tgcggaacat gggatagtag cctgagtgct ctggtattcg gcggagggac caaggtcacc gtcctaggt 720 729 < 210 > 69 < 211 > 759 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM089A03 < 400 > 69 caggtacagc tgcagcagtc aggggctgag gtgaagaccc ctgggtcctc ggtgaaagtc 60 tcctgcaagg cttctggagg caccttcagg aacaacgcta tcagctgggt gcgacaggcc 120 cctggacaag gccttgagtg gatgggaggg ttcatcccta agtttggaac aacaaaccac 180 gcacagaagt tccagggcag agtcacgatg accgcggacg actccacgaa cacagtctac 240 atggaactga gcagtctgag atctgaggac acggccgtgt attattgtgc gagggggggc 300 gcatattgtg gtggtggtag atgctatctt tacggtatgg acgtctgggg ccagggaacc 360 ctggtcaccg tctcgagtgg aggcggcggt tcaggcggag gtggctctgg cggtggcgga 420 agtgcacagg ctgtggtgat ccaggagccc tcactgactg tgtccccagg agggacagtc 480 actctcacct gtggctccag cactggagct gtcaccagtg gtcattatcc ctactggttc 540 cagcagaagc ctggccaagc ccccaggaca ctgatttatg acacaagtaa taaacgctcc 600 tggacccctg cccggttctc aggctccctc cttgggggca aagctgccct gaccctttcg 660 ggtgcgcagc ctgaggatga ggctgaatat tactgcttgg tctcctatag tggttctctt 720 gtggtattcg gcggagggac caagctgacc gtcctaggt 759 < 210 > 70 < 211 > 729 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM075A01 < 400 > 70 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtgt attactgtgt caaaggagct 300 tggcttgact actggggccg ggggacaatg gtcaccgtct cgagtggagg cggcggttca 360 ggcggaggtg gctctggcgg tggcggaagt gcacttaatt ttatgctgac tcagccccac 420 tctgtgtcgg agtctccggg gaagacggta accatctcct gcaccggcag cagtggcagt 480 gttgccagaa actatgtgca gtggtaccaa cagcgcccgg gcagtgcccc caccattgtt 540 LIST OF SEQUENCES (Continued) atttatgagg ataaccgaag accctctggg gtccctggtc ggttctctgg ctccatcgac 600 aggtcctcca attctgcctc cctcaccatc tcaggactgc agactgagga cgaggctgac 660 tactactgtc agtcttataa ttacaacact tgggtgttcg gcggagggac caagctgacc 720 gtcctaggt 729 < 210 > 71 < 211 > 741 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > DNA encoding scFv CM059H03 < 400 > 71 gaagtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaggg cttctggtta cacctttacc agctacggta tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcagcgctt acaatggaaa gacaaactat 180 gtacaggagc tccagggcag agtcaccatg accacagaca catccacgag cacagtctac 240 atggagctga cgagcctgag atctgacgac acggccgtat attactgtgc gagacgggga 300 ggttcggtta aacaactata ttttgacttc tggggccagg gcaccctggt caccgtctcg 360 agtggaggcg gc GTTC gg c99aggtggc tctggcggtg gcggaagtgc acttgaaacg 420 acactcacgc agtctccagg caccctgtct ttgtctccag gggaaagagc caccctctcc 480 tgcagggcca gtcagagtat tagtagcagt aacttagcct ggtaccagca gaaacctggc 540 cgggctccca ggctcctcat ctatggtgcg tccagcaggg ccattggcat cccagacagg 600 ttcagtggca gtgggtctgg gacagacttc actctcacca tcagcagact ggaggctgaa 660 gattttgcag tgtattactg tcagcagtat ggtagctctc cgatcacctt cggccaaggg acacgactgg agattaaacg 720 t 741 < 210 > 72 < 211 > 281 < 212 > PRT < 213 > Homo sapiens < 400 > 72 Met Ala and Met Glu Val Gln Gly Gly Pro Ser Leu Gly Gln Thr Cys 1 5 10 15 Val Leu lie Val lie Phe Thr Val Leu Leu Gln Ser Leu Cys Val Wing 20 25 30 Val Thr Tyr Val Tyr Phe Thr Asn Glu Leu Lys Gln Met Gln Asp Lys 35 40 45 Tyr Ser Lys Ser Gly lie Wing Cys Phe Leu Lys Glu Asp Asp Ser Tyr 50 55 60 Trp Asp Pro Asn Asp Glu Glu Be Met Asn Ser Pro Cys Trp Gln Val 65 70 75 80 Lys Trp Gln Leu Arg Gln Leu Val Arg Lys Met lie Leu Arg Thr Ser 85 90 95 LIST OF SEQUENCES (Continued ^ Glu Glu Thr lie Ser Thr Val Gln Glu Lys Gln Gln Asn lie Ser Pro 100 105 110 Leu Val Arg Glu Arg Gly Pro Gln Arg Val Wing Wing His lie Thr Gly 115 120 125 Thr Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn Ser Lys Asn Glu 130 135 140 Lys Wing Leu Gly Arg Lys lie Asn Ser Trp Glu Ser Ser Arg Ser Gly 145 '150 155 160 His Ser Phe Leu Ser Asn Leu His Leu Arg Asn Gly Glu Leu Val lie 165 170 175 His Glu Lys Gly Phe Tyr Tyr lie Tyr Ser Gln Thr Tyr Phe Arg Phe 180 185 190 Gln Glu Glu lie Lys Glu Asn Thr Lys Asn Asp Lys Gln and Val Gln 195 200 205 Tyr lie Tyr Lys Tyr Thr Ser Tyr Pro Asp Pro lie Leu Leu Met Lys 210 215 220 Ser Wing Arg Asn Ser Cys Trp Ser Lys Asp Wing Glu Tyr Gly Leu Tyr 225 230 235 240 Ser lie Tyr Gln Gly Gly lie Phe Glu Leu Lys Glu Asn Asp Arg lie 245 250 255 Phe Val Ser Val Thr Asn Glu His Leu lie Asp Net Asp His Glu Ala 260 265 270 Be Phe Phe Gly Ala Phe Leu Val Gly 275 280

Claims (1)

1. NOVELTY OF THE INVENTION CLAIMS 1. An isolated antibody or fragment thereof comprising a first amino acid sequence at least 95% identical to a second amino acid sequence selected from the group consisting of: (a) the amino acid sequence of VHCDR1, VHCDR2 or VHCDR3 of any of SEQ ID NOs: 42-56; and (b) the amino acid sequence of VLCDR1, VLCDR2 or VLCDR3 of any of SEQ ID NOs: 42-56; wherein said antibody or fragment thereof binds immunospecifically to TR7. 2. The antibody or fragment thereof according to claim 1, further characterized in that the second amino acid sequence consists of the amino acid sequence of a VHCDR3 of any of SEQ ID NOs: 42-56. 3. The antibody or fragment thereof according to claim 1, further characterized in that it binds preferably to TR7 with respect to its ability to bind to TR1, TR5, TR4 and TR 0. 4.- The antibody or fragment thereof according to claim 1, further characterized by binding to TR7 expressed on the surface of a cell. 5. An isolated antibody or fragment thereof comprising: (a) an amino acid sequence that is at least 90% identical to a VH domain of any of SEQ ID NOs: 42-56; (b) an amino acid sequence that is at least 90% identical to a VL domain of any of SEQ ID NOs: 42-56; or (c) both (a) and (b); wherein said antibody or fragment thereof binds immunospecifically to TR7. 6. The antibody or fragment thereof according to claim 5, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 42 and the VL domain has the amino acid sequence of the VL domain of SEQ ID NO: 42 7. The antibody or fragment thereof according to claim 5, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 50 and the VL domain has the amino acid sequence of the VL domain of SEQ. ID NO: 50 8. The antibody or fragment thereof according to claim 5, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 56 and the VL domain has the amino acid sequence of the VL domain of SEQ. ID NO: 56 9. The antibody or fragment thereof according to claim 5, further characterized in that it binds preferentially to TR7 with respect to its ability to bind to TR1, TR5, TR4 and TR 0. 10. - The antibody or fragment thereof according to claim 5, further characterized by binding to TR7 expressed on the surface of a cell. 11. The antibody or fragment thereof according to claim 5, further characterized in that it comprises: (a) the amino acid sequence of a VH domain of any of SEQ ID NOs: 42-56; (b) the amino acid sequence of a VL domain of any of SEQ ID NOs: 42-56; (c) both (a) and (b); wherein said antibody or fragment thereof binds immunospecifically to TR7. 12. The antibody or fragment thereof according to claim 1, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 42 and the VL domain has the amino acid sequence of the VL domain of SEQ ID NO: 42 13. The antibody or fragment thereof according to claim 1, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 50 and the VL domain has the amino acid sequence of the VL domain of SEQ ID NO: 50 14. The antibody or fragment thereof according to claim 11, further characterized in that the VH domain has the amino acid sequence of the VH domain of SEQ ID NO: 56 and the VL domain has the amino acid sequence of the VL domain of SEQ. ID NO: 56 15. The antibody or fragment thereof according to claim 1, further characterized in that it binds preferentially to TR7 with respect to its ability to bind to TR1, TR4, TR5 and TR10. 16. The antibody or fragment thereof according to claim 1, further characterized in that it binds to TR7 expressed on the surface of a cell. 17. The antibody or fragment thereof according to claim 5, further characterized in that it is selected from the group consisting of: (a) a complete innnunoglobulin molecule; (b) a scFv; (c) a monoclonal antibody; (d) a human antibody; (e) a chimeric antibody; (f) a humanized antibody; (g) a Fab fragment; (h) a Fab1 fragment; (i) an F (ab ') 2; (j) an Fv; and (k) an Fv linked by disulfide. 18. The antibody or fragment thereof according to claim 5, further characterized in that it comprises a constant domain of heavy chain immunoglobulin selected from the group consisting of: (a) a constant domain of human IgM; (b) a constant domain of human Ig1; (c) a constant domain of human IgG2; (d) a constant domain of human IgG3; (e) a constant domain of human IgG4; and (f) a constant domain of human IgA. 19. The antibody or fragment thereof according to claim 5, further characterized in that it comprises a constant domain of light chain immunoglobulin selected from the group consisting of: (a) a constant human Ig kappa domain; and (b) a constant domain of human lambda Ig. 20. The antibody or fragment thereof according to claim 5, further characterized in that it has a dissociation constant (KQ) selected from the group consisting of: (a) a dissociation constant (KD) between 10"7 M ( inclusive) and 10"8 M; and (b) a dissociation constant (KD) between 10 ~ 8 M (inclusive) and 10"9 M. 21. The antibody or fragment thereof according to claim 5, further characterized by having a dissociation constant ( KD) less than or equal to 10"9 M. 22. The antibody or fragment thereof according to claim 21, further characterized by having a KD between 10" 9 M (inclusive) and 10"10 M. 23. - The antibody or fragment thereof according to claim 21, further characterized by having a KD between 10"10 M (inclusive) and 10"11 M. 24.-The antibody or fragment thereof according to claim 21, further characterized because it has a KD between 10" 11 M (inclusive) and 10"12 M. 25.- The antibody or fragment thereof according to claim 5, further characterized in that it is conjugated to a detectable label 26. The antibody or fragment thereof according to claim 25, further characterized in that the detectable label is a radiolabel. The antibody or fragment thereof according to claim 26, further characterized in that the radiolabel is 125 I, 131 I, 111 | N 90Y) 99TC) 177LU 65HO OR 153SM 28. The antibody or fragment thereof according to claim 25, further characterized in that the detectable label is an enzyme, a fluorescent label, a luminescent label or a bioluminescent label. 29. The antibody or fragment thereof according to claim 5, further characterized in that the antibody or fragment thereof is biotinylated. 30. The antibody or fragment thereof according to claim 5, further characterized in that it is conjugated with a therapeutic or cytotoxic agent. 31. The antibody or fragment thereof according to claim 30, further characterized in that the therapeutic or cytotoxic agent is selected from the group consisting of: (a) an antimetaboite; (b) an alkylating agent; (c) an antibiotic; (d) a growth factor; (e) a cytokine; (f) an anti-angiogenic agent; (g) an antimitotic agent; (h) an anthracycline; (i) toxin; and (j) an apoptotic agent. 32. The antibody or fragment thereof according to claim 5, further characterized in that it is adhered to a solid support. 33.- The antibody or fragment thereof according to claim 5, further characterized in that it binds immunospecifically to TR7 in a Western blot. 34. The antibody or fragment thereof according to claim 5, further characterized in that it binds immunospecifically to TR7 in an ELISA. 35.- An isolated cell that produces the antibody or fragment thereof that is claimed in claim 11. 36.- The antibody or fragment thereof according to claim 5, further characterized in that it does not inhibit the ability of TRAIL to bind to TR7. 37 - The antibody or fragment thereof according to claim 5, further characterized in that it is an agonist of TR7. 38.- The antibody or fragment thereof according to claim 5, further characterized because it stimulates the apoptosis of cells expressing TR7. 39. The antibody or fragment thereof according to claim 38, further characterized in that it further stimulates apoptosis of cells expressing TR7 than an equal concentration of TRAIL polypeptide that stimulates apoptosis of cells expressing TR7. 40. The antibody or fragment thereof according to claim 38, further characterized by stimulating apoptosis of cells expressing TR7 equally well in the presence or in the absence of antibody crosslinking reagents. 41. - The antibody or fragment thereof according to claim 38, further characterized in that it is not hepatotoxic. 42. The antibody or fragment thereof according to claim 5, further characterized by positively regulating the expression of the TRAIL receptor. 43. The antibody or fragment thereof according to claim 5, further characterized in that it inhibits the binding of TRAIL to TR7. 44. The antibody or fragment thereof according to claim 5, further characterized in that it is a TR7 antagonist. 45. The antibody or fragment thereof according to claim 5, further characterized by inhibiting the apoptosis of cells expressing TR7. 46. - The antibody or fragment thereof according to claim 5, further characterized by negatively regulating the expression of the TRAIL receptor. 47. An antibody or fragment thereof that binds to the same epitope of a TR7 polypeptide as an antibody as claimed in claim 11 or a fragment thereof. 48. An antibody or fragment thereof that binds to the same epitope of a TR7 polypeptide as an antibody as claimed in claim 12 or a fragment thereof. 49.- An antibody or fragment thereof that binds to the same epitope of a TR7 polypeptide as an antibody as claimed in claim 13 or a fragment thereof. 50.- An antibody or fragment thereof that binds to the same epitope of a TR7 polypeptide as an antibody as claimed in claim 14 or a fragment thereof. 51. The antibody or fragment thereof according to claim 5, further characterized in that it is in a pharmaceutically acceptable vehicle. 52. The use of the antibody or fragment thereof according to claim 5 or a composition containing said antibody or fragment thereof, for the preparation of a medicament for treating, preventing or alleviating a cancer in an animal. 53. The use as claimed in claim 52, wherein the animal is a human. 54. - The use as claimed in claim 52, wherein the cancer is colon cancer. 55. - The use as claimed in claim 52, wherein the cancer is breast cancer. 56. - The use as claimed in claim 52, wherein the cancer is uterine cancer. 57. - The use as claimed in claim 52, wherein the cancer is pancreatic cancer. 58.- The use as claimed in claim 52, wherein the cancer is lung cancer. 59. The use as claimed in claim 52, wherein the cancer is gastrointestinal cancer. 60. - The use as claimed in claim 52, wherein the cancer is Ka osi sarcoma. 61. - The use as claimed in claim 52, wherein the cancer is a cancer of the central nervous system. 62.- The use as claimed in claim 61, wherein the cancer of the central nervous system is a medulloblastoma. 63. - The use as claimed in claim 61, wherein the cancer of the central nervous system is a neuroblastoma. 64. - The use as claimed in claim 61, wherein the cancer of the central nervous system is a glioblastoma. 65. The use as claimed in claim 52, wherein the medicament is administrable in combination with a chemotherapeutic agent. 66. - The use as claimed in claim 65, wherein the chemotherapeutic agent is selected from the group consisting of: (a) irinotecan; (b) paclitaxel (TAXOL®); and (c) gemcitabine. 67. - The use of the antibody or fragment thereof according to claim 5, or a composition containing said antibody or a portion thereof for the preparation of a medicament for treating, preventing or alleviating a disease or disorder selected from the group that consists of: (a) graft-versus-host disease (GVHD); (b) AIDS; and (c) a neurodegenerative disorder, in an animal. 68. - The use as claimed in claim 67, wherein the animal is a human. 69. - The use of the antibody or fragment thereof according to claim 5, or a composition containing said antibody or fragment thereof for the preparation of a medicament for destroying or inhibiting the growth of TR7 expressing cells, in an animal . 70. A method for detecting the expression of a TR7 polypeptide comprising: (a) determining the expression of a TR7 polypeptide in a biological sample from an individual using the antibody claimed in claim 5 or fragment thereof; and (b) comparing the level of TR7 polypeptide with a standard level of a TRAIL receptor polypeptide. 71. A method for detecting, diagnosing, predicting or monitoring cancers and other hyperproliferative disorders, comprising: (a) determining the expression of a TR7 polypeptide in a biological sample of an individual using the antibody claimed in claim 5 or a fragment of it; and (b) comparing the level of TR7 polypeptide with a standard level of TR7 polypeptide. 72. - A kit comprising the antibody or fragment thereof claimed in claim 5. 73. The equipment according to claim 72, further characterized in that it comprises a control antibody. 74. The equipment according to claim 72, further characterized in that the antibody or fragment thereof is coupled or conjugated to a detectable label. 75. - The antibody expressed by the ATCC deposit cell line PTA-4 78. 76. - The antibody expressed by the cell line of the ATCC deposit PTA-4539. 77. - The antibody expressed by the ATCC deposit cell line PTA-4376. 78. - The antibody expressed by the ATCC deposit cell line PTA-4547.