MXPA00002106A - Polynucleotide encoding a polypeptide having heparanase activity and expression of same in transduced cells - Google Patents

Abstract

A polynucleotide (hpa) encoding a polypeptide having heparanase activity, vectors including same, transduced cells expressing heparanase and a recombinant protein having heparanase activity.

Description

A POLYCINUCLEOTIDE THAT CODIFIES A POLYPEPTIDE THAT HAS HEPARANASE ACTIVITY AND THE EXPRESSION OF THE SAME IN TRANSDUCED CELLS FIELD AND BACKGROUND OF THE INVENTION The present invention relates to a polynucleotide, hereinafter referred to as hpa, which encodes a polypeptide having heparanase activity, vectors including the same and transducer cells that express heparanase. The invention also relates to a recombinant protein having heparanase activity. Heparan sulfate proteoglycans: Heparan sulfate proteoglycans (HSPGs) are omnipresent macromolecules associated with the cell surface and extracellular matrix (ECM) of a wide range of cells of vertebrate tissues. and invertebrates (1-4). The basic HSPG structure includes a protein core to which several linear heparan sulfate chains are covalently linked. These polysaccharide chains are typically composed of repeating hexuronic disaccharide and D-glucosamine units which are substituted to a varying extent with portions of N- and O-linked sulfate and N-linked acetyl groups (1-4). Studies in the intervention of ECM molecules in cell junctions, growth and differentiation revealed a central role of HSPG in embryonic morphogenesis, * - £ $ Hhr '«W- #% * angiogenesis, consequence of exonson and tissue repair (1-5). HSPG are prominent components of blood vessels (3). In long blood vessels they are mostly concentrated in the intimate and internal environment, while in the capillaries they are mainly found in the subendothelial-based membrane where they support the proliferation and migration of endothelial cells and stabilize the structure of the capillary wall. The ability of HSPG to interact with ECM macromolecules such as collagen, laminin and fibronectin, and with different binding sites in plasma membranes suggests a key role for this proteoglycan in the self-assembly and insolubility of ECM components, as well as in cell adhesion and locomotion. The separation of the chains of heparan sulfate (HS) can therefore result in the degradation of subendothelial ECM and therefore can play a decisive role in the extravasation of cells that transport blood cells. HS catabolism is observed in inflammation, wound repair, diabetes and cancer metastasis, suggesting that enzymes that degrade HS play important roles in pathological processes. Heparanase activity has been described in activated immune system cells and highly metastatic cancer cells (6-8), but research has been hampered by the lack of biological tools to explore potential causative roles of heparanase in disease conditions. f fscív Involvement of Heparanase in Invasiveness and Tumor Cell Metastasis. The tumor cells that circulate detained in the capillary beds of different organs must invade the endothelial cell by coating and degrading its underlying base membrane (BM) to invade the extravascular tissues where they metastasize (9, 10). ). Metastatic tumor cells often bind to or near the intercellular connections between adjacent endothelial cells. Such union of the metastatic cells is followed by the rupture of the connections, the retraction of the endothelial cell borders and migration through the break in the endothelium towards the exposed underlying BM (9). Once located between the endothelial cells and the BM, the invading cells must degrade the subendothelial glycoproteins and proteoglycans of BM to migrate out of the vascular compartment. Several cellular enzymes (eg, collagenase IV, plasminogen activator, cathepsin B, elastase, etc.) are thought to be involved in the degradation of BM (10). Among these enzymes is an endo-β-D-glucuronidase (heparanase) that separates HS to specific intrachain sites (6, 8, 11). The expression of an HS degrading heparanase was found to correlate with the metastatic potential of mouse lymphoma cells (11), fibrosarcoma and melanoma (8). in addition, elevated levels of heparanase were detected in sera from animals producing metastatic tumor and melanoma patients (8) and in tumor biopsies from cancer patients (12). The control of cell proliferation and tumor progression by the local microenvironment, focusing on the interaction of cells with the extracellular matrix (ECM) produced by cultured vascular and corneal endothelial cells, was previously investigated by the present inventors. This carefully cultivated NDE resembles the subendothelium in vivo in its morphological appearance and molecular composition. It contains collagens (mostly type III and IV, with small amounts of types I and V), proteoglycans (mostly proteoglycans of heparan sulfate and dermatan sulfate, with small amounts of chondroitin sulfate proteoglycans), laminin, fibronectin, entactin and elastin (13, 14). The ability of the cells to degrade HS in the cultured ECM was studied to allow the cells to interact with a metabolically labeled ECM of sulfate, followed by gel filtration (Sepharose 6B) analysis of degradation products released in the culture medium (11). ). While the intact HSPG are eluted immediately to the empty volume of the column (Kav <; 0.2, Mr ~ 0.5 x106), fragments of marked degradation of HS side chains are eluted more towards the V, from the column (0.5 <kav <0.8, Mr = 5-7x103) (11). The effect of heparanase inhibition of several non-anticoagulant heparin species that could be of potential use avoiding the extravasation of blood-carrying cells was also investigated by the present inventors. Heparanase inhibition was best achieved by heparin species containing 16 or more sugar units and having sulphate groups at both N and O positions. While desulption O suppresses heparin heparanase inhibition effect, O-sulphated, heparin N-acetylated retains a high inhibitory activity, provides that the N-substituted molecules have a molecular size of approximately 4.00 daltons or more (7). The treatment of experimental animals with heparanase inhibitors (eg, non-anticoagulant species of heparin) markedly reduced (> 90%) the incidence of lung metastases induced by B16 melanoma, Lewis lung carcinoma and mammary adenocarcinoma cells (7, 8, 16). Heparin fractions with high and low affinity for anti-thrombin III exhibited a comparable high anti-metastatic activity, indicating that heparanase that inhibits heparin activity, instead of its anticoagulant activity, plays a role in the anti-metastatic properties of the polysaccharide (7). Heparanase activity in the urine of cancer patients: In an attempt to further explain the involvement of heparanase in tumor progression and its relevance to human cancer, urine samples for heparanase activity were screened (16a). Heparanase activity was detected in the urine of some, but not all cancer patients. High levels of heparanase activity were determined in the urine of patients with aggressive metastatic disease and there was no detectable activity in the urine of healthy donors. Heparanase activity was also found in the urine of 20% of patients with normal insulin-dependent diabetes mellitus and microalbuminúrícos (IDDM, as its acronym in English), more similarly due to diabetic nephropathy, the most important single disorder leads to the renal failure in adults. Possible involvement of heparanase in tumor angiogenesis: Fibroblast growth factors are a family of structurally related polypeptides characterized by high affinity to heparin (17). They are highly mitogenic for vascular endothelial cells and are among the most potent inducers of neovascularization (17, 18). The basic fibroblast growth factor (bFGF) has been extracted from the subendothelial ECM produced in vitro (19) and from corneal base membranes (20), suggesting that the ECM can serve as a container for bFGF. Immunohistochemical staining revealed the location of bFGF in base membranes of various tissues and blood vessels (21). Despite the presence in all sites of bFGF in normal tissues, the endothelial cell proliferation in these tissues is usually very low, suggesting that bFGF is somehow sequestered from its site of action. Studies on the interaction of bFGF with ECM revealed that bFGF binds HSPG in the ECM and can be released in an active form by HS degradation enzymes (15, 20, 22). It was shown that the activity of heparanase expressed by platelets, mast cells, neutrophils and lymphoma cells is involved in the release of bFGF activity from ECM and base membranes (23), suggesting that heparanase activity may not only function in cell migration and invasion, but may also provoke an indirect neovascular response. These results suggest that the HSPG ECM provides a natural storage reservoir for bFGF and possibly other factors promoting the growth of bound heparin (24, 25). The displacement of bFGF from its storage within the base membranes and ECMs can therefore provide a novel mechanism for the induction of neovascularization in normal and pathological situations. Recent studies indicate that heparin and HS are involved in the binding of bFGF to high affinity cell surface receptors and signal cell bFGF (26, 27). In addition, the HS size required for the optimal effect was similar to that of HS fragments released by heparanase (28). Similar results were obtained with the vascular endothelial cell growth factor (VEGF) (29), suggesting the operation of a double receptor mechanism involving HS in the cellular interaction with the growth factors binding heparin. It is therefore proposed that the restriction of endothelial cell growth factors in ECM prevents its systemic action in the vascular endothelium, thus maintaining a very low ratio of inverted endothelial cells and vessel growth. dr ' On the other hand, the release of bFGF from storage in ECM as a complex with the HS fragment can produce localized endothelial cell proliferation and neovascularization in the process such as wound healing, inflammation and tumor development (24, 25). Expression of heparanase by cells of the immune system: The activity of heparanase correlates with the ability of activated cells of the immune system to leave the circulation and produce the inflammatory and autoimmune responses. The interaction of platelets, granulocytes, T and B lymphocytes, macrophages and barley cells with subendothelial ECM is associated with the degradation of HS by a specific heparanase activity (6). The enzyme is released from intracellular compartments (eg, lysosomes, specific granules, etc.), in response to various activation signals (eg, thrombin, calcium ionophore, immune complexes, antigens, mitogens, etc.), suggesting its regulated involvement in inflammation and cellular immunity. Some of the observations regarding the heparanase enzyme were reviewed in reference No. 6 and are listed hereinafter: First, a protcolytic activity (plasminogen activator) and heparanase participates synergistically in sequential degradation of the HSPG ECM by inflammatory leukocytes and cells malignant Second, a large proportion of heparanase platelets exist in a latent form, probably as a complex with chondroitin sulfate. The latent enzyme is activated by the tumor factor or factors derived from the cell and can then facilitate cellular invasion through the endote or vascular process of tumor metastasis. Third, the release of the heparanase platelet from granules a is induced by strong stimulation (ie, thrombin), but not in response to platelet activation in ECM. Fourth, neutrophil heparanase is preferable and easily released in response to activation of the threshold and incubation of cells in ECM. Fifth, the contact of neutrophils with ECM inhibits the release of harmful enzymes (proteases, lysozyme) and oxygen radicals, but not enzymes (heparanase, gelatinase) that can allow diapedesis. This protective role of the subendothelial ECM was observed when the cells were stimulated with soluble factors but not with phagocytosatable stimulants Sixth, intracellular heparanase is secreted in minutes after exposure of T cell lines for specific antigens. Seventh, mitogens (Con A, LPS) induce heparanase synthesis and secretion by normal T and B lymphocytes maintained in vitro. The heparanase of the T lymphocyte is also induced by immunization with antigen in vivo.

Eighth, heparanase activity is expressed by pre-B lymphomas and B-lymphomas, but not by normal resting plasmacytomas and B lymphocytes. Ninth, the heparanase activity is expressed by activated macrophages during incubation with ECM, but there is little or no release of the enzymes in the incubation medium. Similar results were obtained with human myeloid leukemia cells induced to differentiate mature macrophages. Tenth, the hypersensitivity of T cells mediated by the type of delay and experimental autoimmunity are suppressed by low doses of heparanase inhibiting non-anticoagulant heparin species (30). Eleventh, the heparanase activity expressed by platelets, neutrophils, and metastatic tumor cells releases the active bFGF from ECM and base membranes. The release of bFGF from storage in ECM can produce a localized neovascular response in processes such as wound healing, inflammation and tumor development. Twelfth, among the breakdown products of the ECM generated by heparanase is a tri-sulfated disaccharide that can inhibit the T cell mediated by inflammation in vivo (31) This inhibition was associated with an inhibitory effect of the disaccharide on the production of biologically active TNFα by activated T cells in vitro (31).

Other potential therapeutic applications: Apart from its involvement in tumor cell metastasis, inflammation and autoimmunity, mammalian heparanase can be applied to modulate: bioavailability of growth factors by binding heparin (15); cellular responses to growth factors by binding heparin (eg, bFGF, VEGF) and cytokines (IL-8) (31a, 29); the cellular interaction with plasma lipoproteins (32); cellular susceptibility for certain viral infections and some bacteria and protozoa (33, 33a, 33b); and disintegration of amyloid plaques (34). Heparanase can thus provide utility for conditions such as wound healing, angiogenesis, restenosis, atherosclerosis, inflammation, neurodegenerative diseases and viral infections. Mammalian heparanase can be used to neutralize plasma heparin, as a potential protamine replacement. Anti-heparanase antibodies can be applied for immunodetection and diagnosis of autoimmune lesions, micrometastases, and renal failure in biopsy specimens, plasma samples, and body fluids. Common use in basic research is expected. The identification of the hpa gene encoding the enzyme heparanase will allow the production of a recombinant enzyme in heterologous expression systems. The availability of the recombinant protein will pave the form to solve the structure function of the related protein "ká * and will provide a tool for the development of new inhibitors. Viral infection: The presence of heparan sulfate on cell surfaces has been shown to be the main requirement for the binding of Herpes Simplex virus (33) and Dengue virus (33a) to cells and for subsequent infection of cells. The removal of heparan sulfate from the cell surface by heparanase can therefore abolish virus infection. In fact, treatment of cells with bacterial heperitinase (degrading heparan sulfate) or heparinase (degrading heparan) reduces the binding of two animal-related herpesvirus to cells and will interpret cells at least partially resistant to virus infection (33). ). There are some indications that cell surface heparan sulfate is also involved in HIV infection (33b). Neurodegenerative diseases: Heparan sulfate proteoglycans were identified in the amyloid plaques of the Prion protein of the Genstmann-Straussler syndrome, Creutzfeldt-Jakob disease and Scrape (34). Heparanase can disintegrate these amyloid plaques that are also thought to play a role in the pathogenesis of Alzheimer's disease. Restenosis and Atherosclerosis: The proliferation of arterial smooth muscle cells (SMC) in response to endothelial damage and accumulation of lipoprotein-rich cholesterol are basic cases in the pathogenesis of atherosclerosis and restenosis (35). Apart from its involvement in the proliferation of SMC (ie, low affinity receptors for growth factors binding heparin), HS is also involved in lipoprotein binding, retention and support (36). It was shown that HSPG and lipoprotein lipase participate in a novel catabolic pathway that can allow substantial cellular and interstitial accumulation of lipoprotein-rich cholesterol (32). The last trajectory is expected to be highly atherogenic due to the promotional accumulation of apoB and apoE rich lipoproteins (ie, LDL, VLD, chylomicrons), independent of the subsequent food inhibition by cellular sterol content. The removal of SMC HS by heparanase is therefore expected to inhibit the proliferation of SMC and lipid accumulation and thus may interrupt the progression of restenosis and atherosclerosis. There is thus a broad recognized need for, and it could be highly advantageous to have a polynucleotide encoding a polypeptide having heparanase activity, vectors including the same, transducing cells expressing heparanase and a recombinant protein having heparanase activity.

BRIEF DESCRIPTION OF THE INVENTION According to the present invention, there is provided a polynucleotide, hereinafter referred to as hpa, hpa cDNA or hpa gene, which encodes a polypeptide having activity of i-4-J ~ * Z ?,.? < heparanase, vectors that include fa same, transducer cells that express heparanase and a recombinant protein that has heparanase activity. The cloning of the human hpa gene encoding heperase, and the expression of recombinant heparanase by transfected host cells is reported. A purified heparanase isolation preparation of human hepatoma cells were subjected to tryptic digestion and microsequencing. The sequence YGPDVGQPR (IDENTITY SEQUENCE NO: 8) revealed was used to screen EST databases for homology to the corresponding subsequent translated DNA sequence. Two intimately related EST sequences were identified and were later found to be identical. Both clones contained a 1020 bp insert including an open reading frame of 973 bp followed by a 27 bp 3 'untranslated region and a Poly A residue. The initial translation site was not identified. Cloning of the lost 5 'end of hpa was performed by PCR and DNA amplification of placental Marathon RACE cDNA composed using primers selected according to the sequence of EST clones and the linkers of the compound. A 900 bp PCR fragment, partially translapping with the EST clones encoding 3 'identified were obtained. The bound cDNA fragment (hpa), 1721 bp long (SEQUENCE OF IDENTITY NO: 9), contained an open reading frame encoding a 543 amino acid polypeptide (SEQUENCE OF IDENTITY NO: 10) with a calculated molecular weight of 61,192 daltons . Cloning of an extended 5 'sequence was allowed from the human SK-hepl cell line by PCR amplification using the Marathon RACE. The extended 5 'sequence of the SK-hep1 hpa cDNA was assembled with the hpa cDNA sequence isolated from the human placenta (SEQUENCE OF IDENTITY NO: 9). The assembled sequence contained an open reading frame, IDENTITY SEQUENCES nos. 13 and 15, which encode, as shown in IDENTITY SEQUENCES nos. 14 and 15, a polypeptide of 592 amino acids with a calculated molecular weight of 66,407 daltons. The ability of the hpa gene product for the catalytic degradation of heparan sulfate in an in vitro assay was examined by expressing the complete open reading frame of hpa in insect cells, using the Baculovirus expression system. Extracts and conditioned media from cells infected with viruses containing the hpa gene, demonstrated a high level of heparan sulfate degradation activity both towards HSPG derived from soluble ECM and intact ECM. This degradation activity was inhibited by heparin, which is another heparanase substrate. Cells infected with a similar construct that do not contain the hpa gene did not have such activity, nor uninfected cells. The capacity of the heparanase expressed from the extended 5 'clone to heparin was demonstrated in the mammalian expression system. The expression pattern of hpa RNA in various tissues and cell lines was investigated using RT-PCR. It was found to be expressed only in tissues and cells previously known to have heparanase activity. A panel of monochromosomal / CHO and human / mouse somatic cell hybrids were used to localize the human heparanase gene to human chromosome 4. The newly isolated heparanase sequence can be used to identify a chromosome region by harboring a human heparanase gene on a disseminated chromosome. According to the additional features in the preferred embodiments of the invention described below, a polynucleotide fragment including a polynucleotide sequence encoding a polypeptide having a heparanase catalytic activity is provided. In accordance with yet further features in the described preferred embodiments, the polynucleotide fragment includes nucleotides 63-1691 of the NO. 9 IDENTITY SEQUENCE or nucleotides 139-1869 of the NO. 13 IDENTITY SEQUENCE, which encodes the heparanase enzyme. complete human 3U According to still further features in the described preferred embodiments, a polynucleotide fragment is provided which includes a polynucleotide sequence capable of hybridizing with hpa cDNA, especially with nucleotides 1-721 of the SEQUENCE OF IDENTITY NO: 9. According to the Still further features in the described preferred embodiments the polynucleotide sequence encoding the polypeptide having heparanase activity shares at least 60% homology, preferably at least 70% homology, more preferably at least 80% homology, more preferably at least 90% homology with NOS IDENTIFICATION SEQUENCES: 9 or 13. According to still further features in the described preferred embodiments the polynucleotide fragment according to the present invention includes a portion (fragment) of the SEQUENCES OF IDENTITY NOS 9 or 13. For example, such fragments could include nucleotides 63-721 of the SEQUENCE OF IDENTITY NO: 9, and / or a segment of the SEQUENCE OF IDENTITY NO: 9, which encodes a polypeptide having the catalytic activity heparanase. According to still further features in the preferred embodiments described, the polypeptide encoded by the polynucleotide fragment includes a sequence of amino acid as established in the IDENTITY SEQUENCES NOS: 10 or 14 or a functional part thereof. According to still further features in the described preferred embodiments the polynucleotide sequence encoding a polypeptide having heparanase activity, which starts from at least 60% homology, preferably at least 70% homology, more preferably at least 80% homology, more preferably at least 90% homology with IDENTITY SEQUENCES NOS: 10 or 14. According to still further features in the described preferred embodiments the polynucleotide fragment encoding a polypeptide having heparanase activity , which can therefore be allelic, species and / or induced variant of the amino acid sequence established in IDENTITY SEQUENCES US: 10 or 14. It will be understood that any such variants can also be considered a homolog. According to still further features in the described preferred embodiments, a braided polynucleotide fragment is provided which includes a polynucleotide sequence complementary to at least a portion of a polynucleotide braid that encodes a polypeptide having heparanase catalytic activity as described above.

According to still further features in the described preferred embodiments, a vector is provided that includes a polynucleotide sequence that encodes a polypeptide having heparanase catalytic activity. The vector can be of any suitable type including, but not limited to a phage, virus, plasmid, phagemid, cosmid, baramide or even an artificial chromosome. The polynucleotide sequence encoding a polypeptide having heparanase catalytic activity can include any of the polynucleotide fragments described above. According to still further features in the described preferred embodiments, a host cell is provided that includes an exogenous polynucleotide fragment that includes a polynucleotide sequence that encodes a polypeptide having heparanase catalytic activity. The exogenous polynucleotide fragment can be any of the fragments described above. The host cell may be of any type such as prokaryotic cell, eukaryotic cell, a cell line, or a cell as a portion of a multicellular organism (e.g., cells or a transgenic organism). According to still further features in the described preferred embodiments, a recombinant protein including a polypeptide having heparanase catalytic activity is provided.

According to still further features in the described preferred embodiments, a pharmaceutical composition is provided which comprises as an active ingredient a recombinant protein having heparanase catalytic activity. According to still further features in the described preferred embodiments, a medical device comprising a medical device is provided which contains, as an active ingredient, a recombinant protein having heparanase catalytic activity. According to still further features in the described preferred embodiments, a heparanase overexpression system is provided which comprises a heparanase catalytic activity that overexpresses the cell. According to still further features in the described preferred embodiments, a method is provided for identifying a chromosome region that hosts a human heparanase gene in a disseminated chromosome comprising the steps of (a) hybridizing the disseminated chromosome with a polynucleotide probe. marked that encodes heparanase; (b) wash the disseminated chromosome, so that excess removal of the probe does not hybridize; and (c) searching for signals associated with the hybridized labeled polynucleotide probe, wherein the detected signals are indicative of a chromosome region that hosts a human heparanase gene.

The present invention can be used to develop new drugs to inhibit tumor cell metastasis, inflammation and autoimmunity. The identification of the hpa gene encoding the heparanase enzyme allows the production of a recombinant enzyme in heterologous expression systems.

BRIEF DESCRIPTION OF THE DRAWINGS The invention described herein, by way of example only, with reference to the accompanying drawings, wherein: Figure 1 presents a nucleotide sequence and amino acid sequence deduced from hpa cDNA. A single nucleotide difference at position 799 (A to T) between the EST (Expressed Tag Sequence) and amplified PCR of cDNA (reverse transcribed RNA) and the resulting amino acid substitution (Tyr to Phe) are indicated before and follow the unit replaced, respectively. The cysteine residues and the consensus pli-adenylation sequence are underlined. The asterisk denotes the TGA stop codon. Figure 2 demonstrates the degradation of the substrate HSFP labeled soluble sulfate by lysates of High Five cells infected with pFhpa2 virus. Lysates from High Five cells that were infected with pF /? Pa2 (&) virus or control pF2 virus (D) were incubated (18 hours, 37 ° C) with soluble HSPG derived from sulfate labeled ECM (peak 1). The incubation medium was then subjected to gel filtration on Sepharose 6B. HS degradation fragments of low molecular weight (peak II) were produced only during incubation with infected pF /? Pa2 cells, but had no degradation of the HSPG substrate (>) by lysates of pF2 infected cells. A. Peak I B. Peak II C. Fraction D. Label sulfate material, cpm Figures 3a-b demonstrate degradation of HSPG substrate labeled soluble sulfate by the culture medium of infected cells pFhpa2 and pF? Pa4. The culture medium of High Five cells infected with pFhpa2 (3a) or pFhpa? (3b) (&), or control virus (D) were incubated (18 hours, 37 ° C) with soluble HSPG derived from ECM labeled sulfate (peak 1, O). The incubation media were then subjected to gel filtration on Sepharose 6B. The fragments of degradation of HS of low molecular weight (peak II) were produced only during incubation with the hpa gene containing virus. There was no degradation of the HSPG substrate by the culture medium of cells infected with control virus. A. Peak I B. Peak II C. Fraction D. Material sulphate labeled, cpm '= *** :? f ** "'Figure 4 presents fractionation of heparanase activity size expressed by infected cells pFhpa2 The culture medium of infected High Five cells pFhpa2 was applied on a 50 kDa cut-off membrane Heparanase activity (peak substrate conversion I (O) in fragments of HS degradation of peak II) was found in the high (>50 kDa) (&), but not low (<50 kDa) (or) molecular weight compartment. A. Peak I B. Peak II C. Fraction D. Label sulfate material, cpm Figures 5a-b demonstrated the effect of heparin on heparanase activity expressed by infected High Five cells pFhpa2 and pF? Pa4. The culture medium of infected High Five cells pFhpa2 (5a) and pFhpaA (5b) were incubated (18 hours, 37 ° C with soluble HSPG derived from ECM labeled sulfate (peak I, O) in the absence (&) or presence (?) of 10 μg / ml heparin The production of low molecular weight HS degradation fragments was completely abolished in the presence of heparin, a potent inhibitor of heparanase activity (6, 7). -b showed degradation of intact ECM labeled by sulfate by infected virus of High Five and Sf21 cells High Five cells (6a) and Sf21 (6b) were placed in sulfate-labeled ECM and infected (48 hours, 28 ° C) with pFhpaA (&) or control pF1 virus (D) The uninfected (R) control Sf21 cells were placed in the labeled ECM as well The pH of the culture medium was adjusted to 6.0 - 6.2 5 followed by 24 hours of incubation at 37 ° C. The labeled sulfate material released in the incubation medium was gel filtration on Sepharose 6B. The fragments of HS degradation were produced only by cells infected with hpa-containing virus. Figures 7a-b demonstrated degradation of intact ECM labeled by sulfate by virus-infected cells. High Five (7a) and Sf21 (7b) cells were placed in the labeled sulfate ECM and infected (48 hours, 28 ° C) with pFhpaA (&) or control virus pF1 (D). Control Sf21 cells not infected (R) were placed in ECM labeled as well. The pH of the culture medium was adjusted to 6.0-6.2, followed by 48 hours of incubation at 28 ° C. The labeled degradation fragments of sulfates released in the incubation medium were analyzed by gel filtration on Sepharose 6B. The fragments of degradation of HS were produced only by cells infected with hpa-containing viruses. A. Peak I B. Peak II C. Fraction D. Material sulphate labeled, cpm .. • --- Figures 8a-b demonstrated degradation of intact ECM labeled sulfate by the culture medium of infected cells pFhpaA. Culture media of high five (8a) and Sf21 (8b) cells, which were infected with pFhpaA (&) virus or pF1 control (D) were incubated (48 hours, 37 ° C, pH 6.0) with ECM labeling sulfate intact. The ECM was also incubated with the culture medium of uninfected (R) control Sf21 cells. The labeled sulfate material released into the reaction mixture was subjected to gel filtration analysis. The activity of heparanase was detected only in the culture medium of infected cells pF? Pa4. A. Peak I B. Peak II C. Fraction D. Label sulfate material, cpm Figures 9a-b demonstrated the effect of heparin or heparanase activity on the culture medium of infected cells pFhpaA. The sulfate-labeled ECM was incubated (24 hours, 37 ° C, pH 6.0) with infected culture medium of High Five infected pFhpaA cells (9a) and Sf21 (9b) in the absence (&) or presence (V) of 10 μg. / ml of heparin. The labeled sulfate material released into the incubation medium was subjected to gel filtration on Sepharose 6B. Heparanase activity (production of HS peak II degradation fragments) was completely inhibited in the presence of heparin.

; J.il, a- A. Peak I B. Peak II C. Fraction D. Material labeled sulfate, cpm Figures 10a-b demonstrated purification of recombinant heparanase in heparin-Sepharose. The culture medium of Sf21 cells infected with pFhpaA virus was subjected to heparin-Sepharose chromatography. The elution of fractions was carried out with a gradient of 0.35 - 2 M NaCl (< 7). The heparanase activity in the eluted fractions is demonstrated in Figure 10a (&). Fractions 15-28 were subjected to 15% SDS-polyacrylamide gel electrophoresis followed by silver nitrate staining. A correlation is shown between a larger protein band (MW approximately 63,000) in fractions 19-24 and heparanase activity. A. Concentration of NaCl, M B. Release of sulphate, cpm C. Release of sulphate, cpm D. Fraction E. Concentration of NaCl, M AA. Heparin-avidogel BB. Fraction Figures 11a-b demonstrated purification of recombinant heparanase on a Superdex 75 gel filtration column. The active fractions eluted from heparin-Sepharose (Figure 10a) were stagnant, concentrated and applied to the Superdex 75 FPLC column. The fractions were collected and the aliquots of each fraction were tested by heparanase activity (C, Figure 11a) and analyzed by SDS-polyacrylamide gel electrophoresis followed by silver nitrate staining (Figure 11b). A correlation is seen between the appearance of a major protein band (MW approximately 63,000) in fractions 4-7 and heparanase activity. B. Sulfate release, cpm C. Sulfate release, cpm D. Volume, ml AA. Filtration of Gel BB. Fraction Figures 12a-e demonstrated hpa gene expression by RT-PCR with total RNA from human embryonic tissues (12a), human extra-embryonic tissues (12b) and cell lines from different origins (12c-3). The RT-PCR products using specific hpa primers (I), GAPDH (II) domestic gene primers and control reactions without reverse transcriptase showed absence of genomic DNA or other contamination in the RNA samples (III). The molecular weight marker VI of M-DNA (Boehringer Mannheim). For 12a; line 1 - neutrophil cells (adult), line 2 - muscle, line 3 - thymus, line 4 - heart, line 5 - adrenal. For 12b; line 1 - kidney, line 2 - placenta (8 weeks), line 3 - placenta (11 weeks), lines 4-7 - mol (complete hydratidiform mole), line 8 - cytotrophoblast cells (freshly isolated), line 9 - cells of cytotrophoblasts (1.5 hours in vitro), line 10 - cytotrophoblast cells (6 hours, in vitro), line 11 - cytotrophoblast cells (18 hours, in vitro), line 12 - cytotrophoblast cells (48 hours, in vitro) . For 12c, line 1 - JAR vesicle cell line, line 2 - NCITT testicular tumor cell line, line 3 - human hepatoma cell line SW-480, line 4 - HTR (cytotrophoblasts transformed by SV40), line 5 - cell line hepatocellular carcinoma HPTLP-I, line 6 - vesicle carcinoma cell line EJ-28. For 12d; line 1 - human hepatoma cell line SK-hep-1, line 2 - DAMI human megakaryocytic cell line, line 3 - DAMI + PMA cell line, line 4 - CHRF + PMA cell line, line 5 - CHRF cell line. For 12e: line 1 - bovine ABAE aortic endothelial cells, line 2 - 1063 human ovarian cell line, line 3 - human breast carcinoma cell line MDA435, line 4 - human breast carcinoma cell line MDA231. Figure 13 presents a comparison between the nucleotide sequences of the human hpa and a fragment of mouse cDNA EST (SEQUENCE OF IDENTITY NO: 12) which is 80% homologous to the 3 'end (initiating nucleotide 1066 of SEQUENCE OF IDENTITY NO: 9) of the human hpa. The termination codons are underlined A-human B-mouse Figure 14 demonstrates the chromosomal location of the hpa gene. DNA PCR products derived from somatic cell hybrids and hamster, mouse and human genomic DNA were separated on 0.7% agarose gel followed by enlargement with hpa-specific primers. Line 1 - lambda DNA digested with ßsfEII, line 2 - control without DNA, lines 3 - 29, products of PCR enlargement. Lines 3-5 - human genomic DNA, mouse and hamster, respectively. Lines 6-29 human somatic cell hybrids monochromosomal representing chromosomes 1-22 and X and Y, respectively. Line 30 - lambda DNA digested with SsfEII An enlargement product of approximately 2.8 Kb is observed only in lines 5 and 9, representing human genomic DNA and DNA derived from cell hybrid carrying human chromosome 4, respectively. These results demonstrated that the hpa gene is located in the human chromosome 4.

DESCRIPTION OF THE PREFERRED MODALITIES The present invention is of a polynucleotide, hereinafter subsequently referred to interchangeably as hpa, hpa cDNA or hpa gene, which encodes a polypeptide having heparanase activity, vectors including the same, transducing cells expressing heparanase and a recombinant protein that has heparanase activity. Before explaining at least one embodiment of the invention in detail, it will be understood that the invention is not limited in its application to the details of the construction and arrangement of the components set forth in the following description or illustrated in the drawings. The invention is capable of other modalities or of being practiced or carried out in various ways. Also, it will be understood that the phraseology and terminology used herein is for the purpose of description and should not be considered as limiting. The present invention can be used to develop treatments for various diseases, to develop diagnostic assays for those diseases and to provide new tools for basic research especially in the fields of medicine and biology. Specifically, the present invention can be used to develop new drugs to inhibit tumor cell metastasis, inflammation and autoimmunity. The identification of the hpa gene encoding the heparanase enzyme allows the production of a recombinant enzyme in heterologous expression systems. In addition, the present invention can be used to modulate the bioavailability of growth factors by binding heparin, cellular responses to growth factors linking heparin (eg, bFGF, VEGF) and cytokines (IL-8), cellular interaction with plasma lipoproteins , cellular susceptibility to viral, protozoal and some bacterial infections, and disintegration of neurodegenerative plaques. Recombinant heparanase is thus a potential treatment for wound healing, angiogenesis, restenosis, atherosclerosis, inflammation, degenerative diseases (such as, for example, Genstmann-Straussier syndrome, Creutzfeldt-Jakob disease, Scrape and Alzheimer's disease) and certain infections by viruses and some bacteria and protozoa. Recombinant heparanase can be used to neutralize plasma heparin, as a potential protamine replacement. As used herein, the term "modulated" includes substantially inhibiting, slowly or reversing the progression of a disease, substantially lessening clinical symptoms of a disease or condition, or substantially preventing the appearance of clinical symptoms of a disease or condition. A "modulator" therefore includes an agent that can modulate a disease or condition. The modulation of viral, protozoal and bacterial infections includes any effect that substantially interrupts, prevents or reduces any viral, bacterial or protozoal activity and / or life cycle stage of the virus, bacterium or protozoan, or that reduces or prevents virus infection , . ^, - i * a »« bacteria or protozoa in a subject, such as a human or minor animal. As used herein, the term "wound" includes any damage to any portion of a subject's body including, but not limited to, acute conditions such as thermal burns, chemical burns, radiation burns, burns caused by excessive exposure to the ultraviolet radiation such as sunburn, damage to body tissues such as the perineum as a result of labor and delivery, including prolonged damage during medical procedures such as episiotomies, trauma-induced injuries, including cuts, those prolonged car injuries and other mechanical accidents, and those caused by bullets, knives and other weapons, and post-surgical damage, as well as chronic conditions such as sore throat, ulcers, conditions related to diabetes and poor circulation, and all types of acne, etc. Anti-heparanase antibodies, raised against the recombinant enzyme, could be useful for immunodetection and diagnosis of metastatic, autoimmune lesions and renal failure in biopsy specimens, plasma samples, and body fluids. Such antibodies can also serve as neutralizing agents for heparanase activity. The cloning of the human hpa gene encoding heparanase and expressing recombinant heparanase by cells A ^? transfected is here reported. This is the first mammalian heparanase gene to be cloned. A purified preparation of heparanase isolated from human hepatoma cells was subjected to tryptic digestion and microsequencing. The sequence YGPDVGQPR (IDENTITY SEQUENCE NO: 8) revealed was used to screen the EST databases by homology to the corresponding subsequent translated DNA sequences. Two intimately related EST sequences were identified and were later found to be identical. Both clones contained a 1020 bp insert including an open reading frame of 973 bp followed by a 3 'untranslated region of 27 bp and a Poly A residue, while a translation start site was not identified. Cloning of the lost 5 'end was performed by DNA amplification of placental DNA from the Marathon RACE cDNA using primers selected according to the sequence of EST clones and the linkers of the compound. A 900 bp PCR fragment, partially translapping with the EST clones encoding 3 'identified were obtained. The bound cDNA fragment (hpa), 1721 bp long (SEQUENCE OF IDENTITY NO: 9), contained an open reading frame encoding, as shown in Figure 1 and the SEQUENCE OF IDENTITY NO: 11, a polypeptide of 543 amino acids (IDENTITY SEQUENCE NO: 10) with a calculated molecular weight of 61,192 daltons. A single nucleotide difference at position 799 (A to T) between the EST clones and the amplified PCR cDNA was observed. This difference results in the substitution of single amino acid (Tyr to Phe) (Figure 1). In addition, published EST sequences contain an unidentified nucleotide, which follows DNA sequencing or both of the EST clones were resolved in two nucleotides (G and C to positions 1630 and 1631 in the IDENTITY SEQUENCE NO: 9, respectively ). The ability of the hpa gel product to catalyze the degradation of heparan sulfate in an in vitro assay was examined by expression of the entire open reading frame in insect cells, using the Baculovirus expression system. The extracts and conditioned media of cells infected with viruses containing the hpa gene, demonstrated a high level of degradation activity of heparan sulfate both towards HSPG derived from soluble ECM and intact ECM, which was inhibited by heparin, in both the infected cells with a similar construction that did not contain the hpa gene did not have such activity, nor uninfected cells. The expression pattern of hpa RNA in various tissues and cell lines was investigated using RT-PCR. It was found to be expressed only in tissues and cells previously known to have heparanase activity.

Cloning and the extended 5 'sequence was allowed from the human SK-hep1 cell line by PCR amplification using the Marathon RACE. The extended 5 'sequence of the hpa SK-hep1 cDNA was assembled with the hpa cDNA sequence isolated from the human placenta (SEQUENCE OF IDENTITY NO: 9). The assembly sequence contained an open reading frame, IDENTITY SEQUENCES NOS. 13 and 15, which encode, as shown in IDENTITY SEQUENCES NOS: 14 and 15, a polypeptide of 592 amino acids, with a calculated molecular weight of 66,407 daltons. This open reading frame was shown to direct the expression of catalytically active heparanase in a mammalian cell expression system. The heparanase expressed was detectable by anti heparanase antibodies in Western blot analysis. A panel of human monochromosomal / CHO and human somatic mouse hybrids was used to locate the human heparanase gene to human chromosome 4. The newly isolated heparanase sequence can therefore be used to identify a chromosome region that hosts a human heparanase gene on a chromosome extension. Thus, according to the present invention, a polynucleotide fragment (either DNA or RNA) is provided., either a single strand or double strand) including a polynucleotide sequence encoding a polypeptide having a heparanase catalytic activity. The term "heparanase catalytic activity" or its equivalent term "heparanase activity" both mention a mammalian endoglycosidase hydrolyzing activity that is specific for heparan or proteoglycan substrates of heparan sulfate, as opposed to the activity of bacterial enzymes ( heparinase, I, II and III) that degrade heparin or heparan sulfate by means of ß elimination (37). In a preferred embodiment of the invention, the polynucleotide fragment includes nucleotides 63-1691 of the SEQUENCE OF IDENTITY NO: 9, or nucleotides 139-1869 of the SEQUENCE OF IDENTITY NO: 13, which encodes the complete human heparanase enzyme. However, the scope of the present invention does not limit human heparanase since this is the first description of an open reading frame (ORF) that encodes any mammalian heparanase. Using the hpa cDNA, parts thereof or synthetic oligonucleotides designed according to their sequence will allow one of ordinary skill in the art to identify genomic and / or cDNA clones that include homologous sequences from other mammalian species. The present invention is therefore further directed to a polynucleotide fragment that includes a polynucleotide sequence capable of hybridising (base pairs under either stringent or permitted hybridization conditions, as for example described in Sambrook, J., Fritsch, EF Maníatis, T. (1989) Molecular Cloning, A. Laboratory Manual Cold Spring Harbor Laboratory Press, New York), with hpa cDNA, especially with nucleotides 1-721 of the IDENTITY SEQUENCE NO: 9. In fact, any polynucleotide sequence which encodes a polypeptide having heparanase activity and whose parts of at least 60% homology, preferably at least 70% homology, more preferably at least 80% homology, more preferably at least 90% homology to the SEQUENCES OF IDENTITY NO: 9 or 13 is within the scope of the present invention. The polynucleotide fragment according to the present invention may include any part of the NOS: 9 or 13 IDENTITY SEQUENCES. For example, it may include nucleotides 63-721 of the NO. 9 IDENTITY SEQUENCE, which is a novel sequence. However, it can include any segment of IDENTITY SEQUENCES nos: 9 or 13, which encode a polypeptide having the catalytic activity of heparanase. When the phrase "encodes a polypeptide having heparanase catalytic activity" is used herein and in the following claims section it refers to the ability to direct the synthesis of a polypeptide which, if required for its activity, follows the post modifications. -translational, such as but not limited to, proteolysis (e.g., removal of signal peptide and of a pro or preprotein sequence), modification of methionine, glycosylation, alkylation, (e.g., methylation), acetylation, etc. it is catalytically active in the degradation of for example, ECM and HS associated with the cell surface. In a preferred embodiment of the invention the polypeptide encoding the polynucleotide fragment includes an amino acid sequence as set forth in NOS IDENTITY SEQUENCES. 10 or 14 or a functional part thereof, that is, a portion that hosts the catalytic activity of the heparanase. However, any polynucleotide fragment encoding a polypeptide having heparanase activity is within the scope of the present invention. Therefore, the polypeptide can be allelic, species and / or induce variants of the amino acid sequence set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14, or a functional part thereof. In fact, any polynucleotide sequence that encodes a polypeptide having heparanase activity, which parts of at least 60% homology, preferably at least 70% homology, more preferably at least 80% homology, more preferably at least 90% homology to NOS IDENTIFICATION SEQUENCES: 10 or 14 it is within the scope of the present invention.

The invention is also directed to provide a single-stranded polynucleotide fragment that includes a polynucleotide sequence complementary to at least a portion of a polynucleotide strand that encodes a polypeptide having heparanase catalytic activity as described above. The term "complementary" as used herein refers to the ability of base pairs. The one-stranded polynucleotide fragment can be DNA or ANR or even includes nucleotide analogues (eg, thioated nucleotides) this can be a synthetic oligonucleotide or manufactured for transducer host cells, this can be of any desired length with specific base pairs yet provided (eg, 8 to 10, preferably more, long nucleotides) and may include mismatches that do not hamper base pairs. The invention is further directed to provide a vector that includes a polynucleotide sequence encoding a polypeptide having heparanase catalytic activity. The vector can be of any type. This can be a phage that infects bacteria or viruses that infect eukaryotic cells. It can also be a plasmid, phagemid, cosmid, bacmid or an artificial chromosome. The polynucleotide sequence encoding a polypeptide having a heparanase catalytic activity can include any of the polynucleotide fragments described above.

The invention is further directed to provide a host cell that includes an exogenous polynucleotide fragment encoding a polypeptide having heparanase catalytic activity. The exogenous polynucleotide fragment can be any of the fragments described above. The host cell can be of any type. This can be a prokaryotic cell, a eukaryotic cell, a cell line, or a cell as a portion of an organism. The exogenous polynucleotide fragment may be permanently or transiently present in the cell. In other words, transducer cells obtained following stable or transient transfection, transformation or transduction are all within the scope of the present invention. The term "exogenous" as used herein refers to the fact that the polynucleotide fragment is extremely introduced into the cell. Here it can be present in a single of any number of copies, it can be integrated in one or more chromosomes to any location or be present as an extrachromosomal material. The invention is further directed to provide a heparanase overexpression system that includes a heparanase catalytic activity that overexpresses the cell. The cell can be a transient host cell or stably transfected or transformed with any suitable vector that includes a polynucleotide sequence encoding a ^^^ m A polypeptide having heparanase activity and a suitable promoter and increased sequences to direct overexpression of heparanase. However, the overexpressed cell can also be a product of an insertion (eg, by homologous recombination) of a promoter and / or increase the downstream sequence to the endogenous heparanase gene of the expressing cell, which will direct overexpression of the gene endogenous. The term "overexpression" as used herein in the following specification and claims refers to a level of expression that is greater than a basal level of expression typically characterizing a given cell under other identical conditions. The invention is further directed to provide a recombinant protein including a polypeptide having heparanase catalytic activity. The recombinant protein can be purified by any conventional protein purification process closed to homogeneity and / or mixed with additives. The recombinant protein can be manufactured using any of the cells described above. The recombinant protein can be in any form. This may be in a crystallized form, a form of dehydrated powder or in a solution. The recombinant protein may be useful in obtaining pure heparanase, which in turn may be useful in eliciting antibodies, anti-heparanase, either poly- or monoclonal antibodies, and as an active screening ff in anti-heparanase inhibitors. or drugs screening trials or system. The invention is further directed to provide a pharmaceutical composition which includes as an active ingredient a recombinant protein having heparanase catalytic activity. Formulations for topical administration may include, but are not limited to, lotions, ointments, gels, creams, suppositories, drops, liquids, sprays and powders. Conventional pharmaceutical, aqueous carriers, powders or oily bases, thickeners and the like may be necessary or desired.

Coated condoms, stents, active pads, and other medical devices may also be useful. In fact the scope of the present invention includes any medical equipment such as a medical device that contains an active ingredient, a recombinant protein, which has heparanase catalytic activity. Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, tablets, capsules or tablets. Thickeners, diluents, flavorings, dispersion aids, emulsifiers or binders may be desirable. Formulations for parenteral administration may include, but are not limited to, sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. The dosage is dependent on the severity and sensitivity of the condition to be treated, but will usually be one or more doses per day, with the course of treatment lasting from several days to several months or until a cure is effected or a decrease in the condition of disease is achieved. Persons ordinarily skilled in the art can easily determine optimal dosages, dosing methodologies and repetition ratios. In addition according to the present invention, a method of identifying a chromosome region that hosts a human heparanase gene in a chromosome propagation is provided, the method is executed by implementing the following method steps, wherein in a first step the propagation of the chromosome (either the interphase or metaphase spread) is hybridized with a labeled polynucleotide probe that encodes heparanase. The label is preferably a fluorescent label. In a second stage according to the scattered chromosome method is washed, so that the excess of the non-hybridized probe is removed. Finally, the signals associated with the hybridized labeled polynucleotide probe are penetrated by, wherein the signals detected are indicative of a region of chromosome that hosts the human heparanase gene. One of ordinary skill in the art would know how to use the sequences described herein in the proper labeling reaction and how to use labeled probes to detect, using in situ hybridization, a region of a chromosome that hosts a human heparanase gene. The reference is now made to the following examples, which together with the foregoing descriptions, illustrate the invention in a non-limiting manner.

EXAMPLES The following protocols and experimental details are mentioned in the following Examples: Heparanase purification and characterization of a human placental and hepatoma cell line: A human hepatoma cell line (Sk-hep-1) was chosen as a source for the purification of a heparanase derived from the human tumor. The purification was essentially as described in U.S. Patent No. 5,362,641 to Fuks, which is incorporated for reference as if it were here fully established. Briefly, 500 liters, 5x1011 cells were developed in the suspension and the heparanase enzyme was purified approximately 240,000 times by applying the following steps: (i) cation exchange (CM-Sephadex), chromatography performed at pH 6.0, 0.3 - 1.4 M gradient NaCI; (ii) cation exchange (CM-Sephadex) chromatography performed at pH 7.4 in the presence of 0.1% CHAPS, 0.3-1.1 M NaCI gradient, (iii) chromatography performed on heparin-Sepharose at pH 7.4 in the presence of 0.1% or from CHAPS, 0.35-1.1 M NaCI gradient; (iv) chromatography performed on ConA-Sepharose at pH 6.0 in buffer containing 0.1% CHAPS and 1M NaCl, elution with 0.25 M-α-methyl mannoside; and (v) HPLC cation exchange (Mono-S) chromatography performed at pH 7.4 in the presence of 0.1% CHAPS, 0.25-1 M NaCl gradient. The active fractions were stagnant, precipitated with TCA and the precipitate subjected to electrophoresis in SDS polyacrylamide gel and / or tritic digestion and reverse phase HPLC. The tryptic peptides of the purified protein were separated by reverse phase HPLC (column C8) and homogeneous peaks were subjected to amino acid sequence analysis. The purified enzyme was applied to reverse phase HPLC and subjected to N-terminal amino acid sequencing using the amino acid sequencer (Applied Biosystems). Cells: The cultures of bovine corneal endothelial cells (BCECs) were stabilized from portholes as previously described (19)., 38). The stock cultures were maintained in DMEM (1 g glucose / liter) supplemented with 10% newborn calf serum and 5% FCS. bFGF (1 ng / ml) was added on another day during the active cell growth phase (13, 14). Preparation of discs coated with ECM: BCECs (second to fifth passage) were laminated in 4-well plates at an initial density of 2 x 10 5 cells / ml, and cultured in sulfate-free Fisher medium plus 5% dextran T-40 during 12 days. Na235SO4 (25 μCi / ml) were added on day 1 and 5 after germination and the cultures were incubated with the label without medium change. The subenelial ECM was exposed by dissolving (5 minutes, room temperature) the cell layer with PBS containing 0.5% Triton X-100 and 20 mM NH4OH, followed by four washes with PBS. The ECM remained intact, free of debris and firmly attached to the entire area of the tissue culture disc (19, 22). To prepare soluble sulfate labeled proteoglycans (peak I material), the ECM was digested with trypsin (25 μg / ml, 6 hours, 37 ° C), the digestion was concentrated by reverse dialysis and the concentrated material was applied to a column of Sepharose 6B gel filtration. The resulting high molecular weight material (Kav <; 0.2, peak I) was collected. More than 80%) of the labeled material was shown to be composed of heparan sulfate proteoglycans (11, 39). Heparanase Activity: Cells (1 x 106/35-mm disk), cell lysates or conditioned media were incubated in the upper portion of the 35S labeled ECM (18 hours, 37 ° C) in the presence of phosphate buffer. mM (pH 6.2). The cell lysates and conditioned media were also incubated with peak I material labeled with sulfate (10-20 μl). The incubation medium was collected, centrifuged (18,000 x g, 4 ° C, 3 minutes) and labeled sulfate material analyzed by gel filtration on Sepharose CL-6B column (0.9 x 30 cm). The fractions (0.2 ml) were eluted with PBS at a flow rate of 5 ml / hours and counted for radioactivity using Bio-fluor scintillation fluid. The excluded volume (V0) was labeled by the blue dextran and the total included volume (Vt) by phenol red. The last one was shown to comigrate with free sulfate (7, 11, 23). The fragments of degradation of HS side chains were eluted from Sepharose 6B to 0.5 < Kav < 0.8 (peak II) (7, 11, 23). Intimately intact HSPGs released from ECM by trypsin - and, to a lesser extent, during incubation with PBS alone - were eluted immediately at V0 (Kav <0.2, peak I). The recoveries of labeled material applied in the columns vary from 85 to 95% in different experiments (11). Each experiment was performed at least three times and the variation of the elution positions (Kav values) did not exceed +/- 15%. Cloning of hpa cDNA: The cDNA clones 257548 and 260138 were obtained from the I.M. G. G. Consortium (2130 Memorial Parkway SW, Hunstville, AL 35801). The cDNAs were originally cloned into EcoRI and Nofl cloning sites in the plasmid vector pT3T7D-Pac. Although these clones are reported to be somewhat different, DNA sequencing showed that these clones are identical to one another. Marathon RACE (rapid enlargement of cDNA ends) human placenta (poly-A) composed of cDNA was a donation from Prof. Yossi Shiloh of Tel Aviv University. This compound is a free vector, as this includes reverse transcribed cDNA fragments to which the double stranded, partially simple adapters are joined on both sides. The construction of the specific compound employed is described in reference 39a. The enlargement of the hp3 PCR fragment was performed according to the protocol provided by the Clontech laboratories. The template used for enlargement was a sample taken from the previous compound. The primers used for the enlargement were: First stage: 5 'primer: API: 5'- CCATCCTAATACGACTCACTATAGGG C-3', IDENTITY SEQUENCE NO: 1; primer 37 HPL229: 5'- GTAGTGATGCCATGTAACTGAATC-3 ', SEQUENCE OF IDENTITY NO. 2. Second step: 5 'nested primer AP2: 5'-ACTCACTATAGGGCTCGAGCG GC-3', IDENTITY SEQUENCE NO: 3, nested 3 'primer: HPL171: 5'-GCATCTTAGCCGTCT TTCTTCG-3', IDENTITY SEQUENCE NO: 4: The HPL229 and HL171 were selected according to the sequence of EST clones. They include nucleotides 933-956 and 876-897 of the SEQUENCE OF IDENTITY NO: 9, respectively. The PCR program was 94 ° C - 4 minutes, followed by 30 cycles of 94 ° C - 40 seconds, 62 ° C - 1 minute, 72 ° C - 2.5 minutes. Enlargement was done with Expand High Fidelity (Boehringer Mannheim). The PCR product that resulted in approximately 900 bp hp3 was digested with Bfr \ and PvuW. Clone 257548 (phpa) was digested with EcoRI, followed by final filling and was then digested further with Bfr. Therefore the Pvull-Brf fragment of the hp3 PCR product was cloned into the truncated end-Bfr end of the phpa clone "\ which results in having the complete cDNA cloned into the pT3T7-pac vector, designated phpa2. : Sequence determinations were performed with the specific vector and gene-specific primers, using an automatic DNA sequencer (Applied Biosystems, model 373A). Each nucleotide was interpreted from at least two independent primers. Computerized sequence analysis: Database penetrations for sequence similarities were performed using the Blast network service. The analysis and alignment of DNA sequence and protein sequences were performed using the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin. RT-PCR: The RNA was prepared using TRI reagent (Molecular research center Inc.), according to the manufacturer's instructions. 1.25 μg were taken for the reverse transcription reaction using MuMLV reverse transcriptase (Gibco BRL) and Oligo primer (dT) 15, SEQUENCE OF IDENTITY NO. 5, (Promega). Enlargement of the first resulting strand cDNA was performed with Taq polymerase (Promega). The following primers were used: HPU-355: 5'-TTCGATCCCAAGAAGGAATCAAC-3 'IDENTITY SEQUENCE NO: 6, nucleotides 372-394 in the IDENTITY SEQUENCE NO: 9 or 11. HPL-229: 5'-GTAGTGATGCCATGTAACTGAATC-3 \ IDENTITY SEQUENCE NO: 7, nucleotides 933-956 in the IDENTITY SEQUENCE NO: 9 or 11. The PCR program: 94 ° C - 4 minutes, followed by 30 cycles of 94 ° C - 40 seconds, 62 ° C - 1 minute, 72 ° C - 1 minute. Expression of recombinant heparanase in insect cells: Cells, insect lines High Five and Sf21 were maintained as monolayer cultures in SF900II-SFM medium (GibcoBRL). Recombinant baculovirus: The recombinant virus containing the hpa gene was constructed using the Bac to Bac system (GibcoBRL). The pFastBac transfer vector was digested with Sal \ and Notl and ligated with a 1.7 kb fragment of phpa2 digested with Xho \ y? / Ofl. The resulting plasmid was designated pFasihpa2. An identical plasmid designated pFasfhpa4 was prepared as a duplicate and both independently served for further experimentation. The recombinant bacmid was generated according to the manufacturer's instructions with pFasthpa2, pFasthpaA and pFastBac. The latter served as a negative control. The recombinant bacmid DNAs were transfected into Sf21 insect cells. Five days after transfection, the recombinant viruses were harvested and used to infect High Five insect cells, 3 x 106 cells in T-25 flasks. The cells were harvested 2-3 days after infection, 4 x 106 cells were centrifuged and resuspended in a reaction buffer containing 20 mM phosphate-citrate buffer, 50 mM NaCl. The cells undergo three cycles of freezing and thawing and lysates were stored at -80 ° C. The conditioned medium was stored at 4 ° C. Partial purification of recombinant heparanase: The partial purification of recombinant heparanase was performed by column chromatography and heparin-Sepharose followed by gel filtration on Superdex 75 column. The culture medium (150 ml) of Sf21 cells infected with pFhpa4 virus was subjected to Heparin-Sepharose chromatography. Elution of 1 ml of fractions was performed with 0.35 - 2 M gradient NaCI in the presence of 0.1% CHAPS and 1 mM DTT in 10 mM sodium acetate buffer, pH 5.0. A sample of 25 μl of each fraction was tested for heparanase activity. The heparanase activity was eluted to the range of 0.65-1.1 M NaCl (fractions 18-26, Figure 10a). 5 μl of each fraction was subjected to 15% SDS-polyacrylamide gel electrophoresis followed by silver nitrate staining. The active fractions eluted from heparin-Sepharose (Figure 10a) were stagnated and concentrated (x6) in YM3 cut membrane. 0.5 ml of the concentrated material was applied in 30 ml of Superdex 75 FPLC column equilibrated with 10 mM sodium acetate buffer, pH 5.0, containing 0.8 M NaCl, 1 mM DTT and 0.1% CHAPS. The fractions (0.56 ml) were collected at a flow rate of 0.75 ml / minutes. The aliquots of each fraction were tested for heparanase activity and subjected to SDS-polyacrylamide gel electrophoresis followed by silver nitrate staining (Figure 11b).

EXAMPLE 1 Cloning of hpa gene The purified fraction of heparanase isolated from human hepatoma cells (SK-hep-1) were subjected to tryptic digestion and microsequencing. The EST databases (Expressed Tag Sequence) were screened by homology to the reverse of the translated DNA sequences corresponding to the peptides obtained. Two sequences of ESTs (Nos. Of accesses N41349 and N45367) contained a DNA sequence encoding the peptide YGPDVGQPR (SEQUENCE OF IDENTITY NO: 8).

These two sequences were derived from clones 257548 and 260138 (I. M. A. G.E Consortium) prepared from a placental cDNA library from 8 to 9 weeks (Soares). Both clones that were found to be identical contained a 1020 bp insert including an open reading frame (ORF) of 973 bp followed by a 3 'untranslated region of 27 bp and a Poly A residue.

No translation start site (AUG) was identified at the 5 'end of these clones. Cloning of the 5 'end loss was performed by PCR DNA amplification of Marathon RACE placenta of the cDNA compound. A fragment of 900 bp (designated hp3), partially overlapping with the EST clones encoding 3 'identified was obtained. The fragment of cDNA attached, 1721 bp long (SEQUENCE OF IDENTITY NO: 9), contained an open reading frame that encodes, as shown in Figure 1, and SEQUENCE OF IDENTITY NO: 11, a polypeptide of 543 amino acids (SEQUENCE OF IDENTITY NO: 10) with a calculated molecular weight of 61,192 daltons. The 3 'end of the partial cDNA inserts contained in clones 257548 and 260138 initiated to a nucleotide G721 of the SEQUENCE OF IDENTITY NO: 9 and FIGURE 1. As shown further in FIG. 1, there is a sequence discrepancy between the clones of EST and the amplified PCR sequence, visualizing an amino acid substitution of Tyr246 in the EST to Phe246 in the amplified cDNA. The nucleotide sequence of the amplified PCR cDNA fragment was verified from two independent enlargement products. The new gene was designated hpa. r-rm srMiMimm As set forth above, the 3 'end of the partial cDNA inserts contained in EST clones 257548 and 260138 initiated at nucleotides 721 hpa (SEQUENCE OF IDENTITY NO: 9). The ability of hpa cDNA to form stable secondary structures, such as stem structures and loops are similar to be formed involving the expansion of nucleotides at the vicinity of position 721 was investigated using computer modeling. It was found that the structure of stem and loop are similar to be formed involving nucleotides 698-724 (SEQUENCE OF IDENTITY NO: 9). In addition, a high GC content, above 70%, characterizes the 5 'end region of the hpa gene, as compared to approximately only 40% in the 3' region. These conclusions may explain the immature completion and therefore the lack of 5 'ends in EST clones. To examine the ability of the hpa gene product to catalyze the degradation of heparan sulfate in an in vitro assay, the complete open reading frame was expressed in insect cells, using the Baculovirus expression system. Cell extracts, infected with viruses containing the hpa gene, demonstrated a high level of degradation activity of heparan sulfate, while cells infected with a similar construct that does not contain the hpa gene did not have such activity, nor cells not infected. These results are further demonstrated in the following Examples.

EXAMPLE 2 Degradation of HSPG derived from soluble ECM Monolayer cultures of High Five cells were infected (72 h, 28 ° C) with recombinant Baculovirus containing the pFast? Pa plasmid or with control virus containing an insert-free plasmid. The cells were harvested and used in heparanase reaction buffer for three cycles of freezing and thawing. The cell Msa3Uts were then incubated (18 h, 37 ° C) with labeled sulfate, HSPG derived from ECM (peak I), followed by gel filtration analysis (Sepharose 6B) of the reaction mixture. As shown in Figure 2, the substrate only includes at least completely high molecular weight material (Mr) eluted next to V0 (peak I, reactions 5-20 Kav <0.35). A similar parental elution was obtained when the HSPG substrate was incubated with lysates from cells that were infected with control virus. In contrast, incubation of the HSPG substrate with lysates of cells infected with the hpa containing virus resulted in a complete conversion of the Mr substrate into labeled degradation fragments of Mr low (peak II, fractions 22-35, 0.5 <Kav <; 0.75). Fragments eluted in peak II were shown to be degradation products of heparan sulfate, as were (i) 5- to 6-fold smaller than the intact heparan sulfate side chains (Kav approximately 0.33) released from ECM by treatment with either alkaline borohydride or papain; and (ii) resistant to further digestion with papain or crondroitinase ABC, and susceptible to deamination by nitrous acid (6)., eleven). Normal results (not shown) were obtained with Sf21 cells. Again, the activity of heparanase was detected in cells infected with hpa containing virus (pFhpa), but not with control virus (pF). This result obtained with two independently generated recombinant viruses. The control lysates of uninfected High Five cells failed to degrade the HSPG substrate. In subsequent experiments, the labeled HSPG substrate was incubated with medium conditioned by infected High Five or Sf21 cells. As shown in Figures 3a-3b, the heparanase activity, reflected by the conversion of the elevated I Mr peak substrate into the low Mr II peak representing the HS degradation fragments, was found in the culture medium of infected cells. with the virus pFhpa2 or pFhpaA, but not with the virus control pF1 or pF2. No heparanase activity was detected in the culture medium of uninfected control High Five or Sf21 cells. The medium from cells infected with the pFhpaA virus was passed through a 50 kDa cut membrane to obtain a crude estimate of the molecular weight of the recombinant heparanase enzyme. As demonstrated in Figure 4, all enzymatic activity was retained in the upper compartment and there was no activity in the flow through the material (<50 kDa). This result is consistent with the expected molecular weight of the hpa gene product. To further characterize the hpa product the inhibitory effect of heparin, a potent inhibitor of heparanase-mediated HS degradation (40) was examined. As demonstrated in Figures 5a-b, the conversion of the peak I substrate to the HS II degradation fragments of peak II was completely abolished in the presence of heparin. Completely, these results indicated that the heparanase enzyme is expressed in an active form by insect cells infected with Baculovirus containing the newly identified human hpa gene.

EXAMPLE 3 Degradation of HSPG in intact ECM 20 Next, the ability of infected insect cells intact to degrade HS in the intact, naturally produced ECM was investigated. For this purpose, High Five or Sf21 cells were seeded in the sulfate-labeled ECM metabolically followed by infection (48 h, 28 ° C) with either the pFr? Pa4 or control pF2 viruses. The pH of the medium was then & et adjusted to pH 6.2-64 and additional cells incubated with the labeled ECM for another 48 hours at 28 ° C or 24 hours at 37 ° C The labeled sulfate material released into the incubation medium was analyzed by gel filtration in Sepharose 6B. As shown in Figures 6a-b and 7a-b, incubation of the ECM with cells infected with the control virus pF2 resulted in a constant release of labeled material consisting at least completely (> 90%) of high Mr fragments. (peak I) eluted with or, next to V0. It is previously shown that a proteolytic activity resides in the ECM itself and / or expressed by cells is responsible for the release of elevated Mr material (6). These intimately intact HSPGs provide a soluble substrate for subsequent degradation for heparase, as also indicated by the relatively large amount of peak I material accumulated when the enzyme heparanase is inhibited by heparin (6, 7, 12, Figure 9). On the other side, incubation of the labeled ECM with cells infected with the pF? Pa4 virus results in the release of 60-70%) of the radioactivity associated with ECM in the form of labeled fragments of low Mr sulfate (peak II, 0.5 <Kav <0.75) with respect to whether the infected cells were incubated with the ECM at 28 ° C or 37 ° C. Sf21 or High Five uninfected control cells intact failed to degrade side chains of HS ECM.

In subsequent experiments, as shown in Figures 8a-b, High Five and Sf21 cells were infected (96 h, 28 ° C) with pF? Pa4 virus or pF1 control and the culture medium incubated with sulfate labeled ECM. The low HS Mr degradation fragments were released from the ECM only until incubation with medium conditioned by pFhpaA infected cells. As shown in Figure 9, the production of these fragments was abolished in the presence of heparin. No heparanase activity was detected in the control culture medium, without infected cells. These results indicated that the heparanase enzyme expressed by cells infected with the pF? Pa4 virus is capable of degrading HS when it is composed of other macromolecular constituents (ie, fibronectin, laminin, collagen) of an intact naturally occurring ECM, in a form similar to that reported for highly metastatic tumor cells, or activated cells of the immune system (6, 7).

EXAMPLE 4 Purification of recombinant heparanase The recombinant heparanase was partially purified from the medium of infected Sf21 cells pF? Heparin-Sepharose (Figure 10a) followed by gel filtration of the staked activated fractions on a FPLC Superdex 75 column (Figure 11a). A protein of approximately 63 kDa was observed, the amount of which, as detected by silver-stained SDS-polyacrylamide gel electrophoresis, correlated with the heparanase activity in the relevant column fractions (Figures 10b and 11b, respectively). This protein was not detected in the culture medium of cells infected with the control virus pF1 and was subjected to a similar fractionation in heparin-Sepharose (not shown).

EXAMPLE 5 Expression of the hpa gene in various cell, organ and tissue types With reference now to Figures 12a-3, RT-PCR was applied to evaluate hpa gene expression by various cell types and tissues. For this purpose, the total RNA was transcribed and amplified in reverse. The expected 585 bp long cDNA was carefully demonstrated in human kidney, placenta (8 and 11 weeks) and molar tissues, as well as in freshly isolated and short terminated (1.5-48 h) cultured human placenta cytotrophoblast cells (Figure 12a) all known to express a high heparanase activity (41). The hpa transcript was also expressed by normal human neutrophils (Figure 12b). In contrast, there was no detectable expression of hpa mRNA in embryonic human muscle tissue, thymus, heart and adrenal gland (Figure 12b). The hpa gene was expressed in several, but not all, human bladder carcinoma cell lines (Figure 12c), SK hepatoma (SK-hep-1), ovarian carcinoma (OV 1063), breast carcinoma (435 , 231), human melanoma and megacapocytic cell lines (DAMI, CHRF) (Figures 12d-e). The expression pattern described above of the hpa transcript was determined to be in a very good correlation with levels of heparanase activity determined in various tissues and cell types (not shown).

EXAMPLE 6 hpa homologous genes The EST databases were screened for sequences homologous to the hpa gene. Three ESTs of mice were identified (Accession No. Aa177901, mouse spleen, mouse skin Aa067997, mouse embryo Aa47943), mounted on a 824 bp cDNA fragment containing a partial open reading frame (missing the 5 'end) and 629 bp and a 3' untranslated region of 195 bp (IDENTITY SEQUENCE NO 12). As shown in Figure 13, the region it encodes is 80% similar to the 3 'end of the hpa cDNA sequence. These ESTs are probably cDNA fragments of the homologous mouse hpa that codes for mouse heparanase Investigating for the consensus protein domains revealed an amino-terminus homolog between heparanase and several precursor proteins such as Procollagen precursor Alpha 1, protein tyrosine kinase-RYK , Fibulin-1, Insulin- similar to the protein that binds the growth factor and several others. The amino terminus is highly hydrophobic and contains a potential trans-membrane domain. The homology to know peptide signal sequences suggests that it could function as a signal peptide localizing protein.

EXAMPLE 7 Isolation of an extended 5 'end of hpa cDNA from human SK-hep1 cell line The 5' end of hpa cDNA was isolated from the human SK-hep1 cell line by PCR amplification using Marthon RACE (rapid amplification of cDNA ends) (Clonthech). Total RNA was prepared from SK-hep1 cells using the TRI reagent (Molecular research center Inc.) according to the manufacturer's instructions. Poly a + RNA was isolated using mRNA separator equipment (Clonetech). The SK-hep1 cDNA compound Marahton RACE was constructed according to the manufacturer's recommendations. The first rounding of enlargement was carried out using a specific primer AP1: 5'-CCATCCTAATACG ACTCACTATAGGGC-3 ', IDENTITY SEQUENCE NO: 1, and specific antisense primer hpa hpl-629; 5'- CCCCAGGAGCAGCAGCATCAG-3 ', SEQUENCE OF IDENTITY NO: 17, corresponding to nucleotides 119-99 of the SEQUENCE OF IDENTITY NO: 9. The resulting PCR product was subjected to a second rounding of enlargement using a specific adapter nested primer AP2: 5'-ACTCACTATAGGGCTCGAGCGGC-3 ', SEQUENCE OF IDENTITY NO: 3, and antisense specific nested primer hpl-666, 5'-AGGCTTCGAGCGCAGCAGCAT-3' IDENTITY SEQUENCE NO: 18, corresponding to nucleotides 83-63 of the SEQUENCE OF IDENTITY NO: 9. The PCR program was as follows: a warm start of 94 ° C for 1 minute, followed by 30 cycles of 90 ° C -30 seconds, 68 ° C - 4 minutes. The resulting 300 bp DNA fragment was extracted from an agarose gel and cloned into the pGEM-T Easy vector (Promega). The resulting recombinant plasmid was designed pHPSKL The nucleotide sequence of the pHPSKI insert was determined and was found to contain 62 nucleotides from the 5 'end of the hpa cDNA placenta (SEQUENCE OF IDENTITY NO: 9) and 178 nucleotides countercurrent, the first 178 nucleotides of IDENTITY SEQUENCES NOS: 13 and 1 5. A discrepancy of the nucleotide alone was identified between the SK-hep1 cDNA and the cDNA placenta. The "T" derivative at position 9 of the cDNA placenta (SEQUENCE OF IDENTITY NO: 9) is replaced by a "C" derivative to the corresponding position 187 of the SK-hep1 cDNA (SEQUENCE OF IDENTITY NO: 13). The discrepancy is similar to, due to a mutation of the 5 'end of the placenta of the cDNA clone as confirmed by the sequence analysis of several additional cDNA clones isolated from placenta, which like the SK-hep1 cDNA contain C in the position 9 of the IDENTITY SEQUENCE NO: 9. The extended 5 'sequence of the hpa SK-hep1 cDNA was assembled with the hpa cDNA sequence isolated from the human placenta (SEQUENCE OF IDENTITY NO: 9). The assembled sequence contains an open reading frame that encodes, as shown in IDENTITY SEQUENCES NOS: 14 and 15, a polypeptide of 592 amino acids with a calculated molecular weight of 66,407 daltons. The open reading frame is flanked by 93 bp in the 5 'untranslated region (UTR).

EXAMPLE 8 Isolation of the hpa genomic countercurrent region The countercurrent region of the hpa gene was isolated using the Genome Walker (Clontech) equipment according to the manufacturer's recommendations. The kit includes five samples of human genomic DNA, each digested with a different restriction endonuclease creating truncated ends: EcoRV, Seal, Dral, PvuW and Sspl. The truncated-end DNA fragments are ligated to partially alone braiding adapters. The genomic DNA samples were subjected to PCR enlargement using the specific adapter primer and a gene specific primer.

Enlargement was done with Expand High Fidelity (Boehringer Mannheim). A first rounding of enlargement was performed using the primer api: 5'-GTAATACGACTCACTATAGGGC-3 \ IDENTITY SEQUENCE NO: 19, and the specific antisense primer hpa hpl-666: 5'-AGGCTTCGAGCGCAGCAGCAT-3 'IDENTITY SEQUENCE NO: 18, corresponding to nucleotides 83-63 of the IDENTITY SEQUENCE NO: 9. The PCR program was as follows: a hot start of 94 ° C - 3 minutes, followed by 36 cycles of 94 ° C - 40 seconds, 67 ° C - 4 minutes The PCR products of the first enlargement were diluted 1:50. One μl of the diluted sample was used as a template for a second enlargement using a nested adapter specific primer ap2: 5'- ACTATAGGGCACGCGTGGT-3 '. IDENTITY SEQUENCE NO: 20, and specific antisense primer hpa hpl-690, 5'- CTTGGGCTCACC TGGCTGCTC-3 ', SEQUENCE OF IDENTITY NO: 21, corresponding to nucleotides 62-42 of the SEQUENCE OF IDENTITY NO. 9. The resulting enlargement products were analyzed using agarose gel electrophoresis. Five different PCR products were obtained from five enlargement reactions. A DNA fragment of approximately 750 bp that was obtained from the digested Sspl DNA sample was extracted gel. The purified fragment was ligated into the plasmid vector pGEM-T Easy (Promega). The resulting recombinant plasmid was designated pGHP6095 and the nucleotide sequence of the hpa insert was determined. A partial sequence of 594 nucleotides is shown in the IDENTITY SEQUENCE NO: 16. The last nucleotide in the IDENTITY SEQUENCE NO: 13 corresponds to nucleotide 93 in the IDENTITY SEQUENCE NO: 13. The DNA sequence in the IDENTITY SEQUENCE NO: 16 contains the 5 'region of the hpa cDNA and 501 nucleotides of the genomic countercurrent region that are predicted to contain the promoter region of the hpa gene.

EXAMPLE 9 Expression of 592 amino acids of the HPA polypeptide in a human 293 cell line The open reading frame of 592 amino acids (IDENTITY SEQUENCES NOS: 13 and 15) was constructed by ligation of 110 bp corresponding to the 5 'end of the hpa SK cDNA -hep1 with the cDNA placenta. More specifically the Marathon RACE-PCR enlargement product of the hpa DNA placenta was digested with Sacl and a fragment of approximately 1 kb was ligated into the Sacl-digested plasmid pGHP6905. The resulting plasmid was digested with Earl and AatW. The truncated Earl ends were blunted and an Earl / blunt fragment - / \ afll approximately 280 bp was isolated. This fragment was ligated with pFast? Pa digested with EcoRI which was truncated end using the Klenow fragment and further digested with AatW. The resulting plasmid contained an 1827 bp insert including an open reading frame of 1776 bp, 31 bp of 3 'UTR and 21 bp of 5' UTR. This plasmid was designated pFastL? Pa. A mammalian expression vector was constructed to drive the expression of the heparanase polypeptide of 592 amino acids in human cells. The hpa cDNA was imposed from pFastL? Pa with SssHIl and? / Ofl. The resulting 1850 bp SssHI1-? / Ofl fragment was ligated to a mammalian expression vector pSI (Promega) digested with Mlu \ and? / Ofl. The resulting recombinant plasmid pSlftpaMct2 was transfected into 293 human embryonic kidney cell line. Passive heparanase expression of 592 amino acids was examined by Western blot analysis and enzyme activity was tested using the gel change assay. Both of these procedures are described in length in U.S. Patent Application No. 09/071, 739, filed May 1, 1998, which is incorporated for reference as if it were fully set forth herein. Cells were harvested 3 days after infection. The harvested cells were re-suspended in lysis buffer containing 150 mM NaCl, 50 mM Tris pH 7.5, 1% Triton X-100, 1 mM PMSF and protease inhibitor cocktail (Boehringer Mannheim). 40 μg of the protein extract samples were used for separation on an SDS-PAGE. The proteins were transferred onto a PVDF Hybond-P membrane (Amersham). The membrane was incubated with a polyclonal purified affinity anti heparanase antibody, as described in US Patent Application No. 09 / 071,739. A larger group of approximately 50 kDa was observed in the transfected cells as well as a smaller group of approximately 65 kDa. A similar pattern was observed in the extracts of cells transfected with pShpa as demonstrated in US Patent Application No. 09 / 071,739. These two groups probably represent two forms of the recombinant heparanase protein produced by the transfected cells. The 65 kDa protein probably represents a heparanase precursor, while the 50 kDa protein is suggested here to be in the processed or mature form. The catalytic activity of the recombinant protein expressed in the transfected pSftpaMet2 cells was tested by gel change assay. Cell extracts from transfected cells and transfected fake cells were incubated overnight with heparin (6 μg in each reaction) at 37 ° C, in the presence of 20 mM phosphate buffer.

IÉfiE2íK = S £ a.é; citrate pH 5.4, 1 mM CaCl2, 1 mM DTT and 50 mM NaCl. The reaction mixtures were then separated on a 10% polyacrylamide gel. The catalytic activity of the recombinant heparanase was carefully demonstrated by a rapid migration of the heparin molecules incubated with the transfected cell extract as compared to the control. Rapid migration indicates the disappearance of high molecular weight heparin molecules and the generation of low molecular weight degradation products.

EXAMPLE 10 Chromosomal Location of the hpa Gene Chromosomal mapping of the hpa gene was performed using a panel of human monochromosomal / CHO and human / mouse somatic hybrids, obtained from the UK HGMP Resource Center (Cambridge, England). 40 ng of each of the somatic cell hybrid DNA samples were subjected to PCR amplification using the primers hpa: hpu565 5'-AGCTCTGTAGATGTGC TATACAC-3", SEQUENCE OF IDENTITY NO: 22, corresponding to nucleotides 564-586 of the IDENTITY SEQUENCE NO: 9 and an antisense primer hp 171 5'- GCATCTTAGCCGTCTTTCTTCG-3 ', IDENTITY SEQUENCE NO: 23, corresponding to nucleotides 897-876 of the SEQUENCE OF IDENTITY NO: 9.

The PCR program was as follows: a warm start of 94 ° C - 3 minutes, followed by 7 cycles of 94 ° C - 45 seconds, 66 ° C - 1 minute, 68 ° C - 5 minutes, followed by 30 cycles of 94 ° C - 45 seconds, 62 ° C - 1 minute, 68 ° C - 5 minutes, and a final extension of 10 minutes at 72 ° C C. The reactions were performed with Expand long PCR (Boehringer Mannheim). The resulting enlargement products were analyzed using agarose gel electrophoresis. As shown in Figure 14, a single group of approximately 2.8 Kb was obtained from chromosome 4, as well as from the human genomic control DNA. An enlargement product of 2.8 kb is expected based on the enlargement of the genomic hpa clone (data not shown). No enlargement product was obtained either in the hamster and mouse DNA control samples or in somatic hybrids of another human chromosome. Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to cover all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

LIST OF REFERENCES QUOTED BEFORE MENTIONED BY THE NUMBERS 1. Wight, T.N., Kinsella, M.G., and Qwarnstromn, E.E. (1992). The role of proteoglycans in cell adhesion, migration and prolifcration. Curr. Opin. Cell Biol., 4, 793-801. 2. Jackson, R.L., Busch, S.J., and Cardin, A.L (1991). Glycosaminoglycans: molecular properties, protein interactions and role in physiological processes. Physiol. Rev., 71, 481-539. 3. Wight, T.N. (1989). Cell biology of arterial proteoglycans. Arteriosclerosis, 9, 1-20. 4. Kjcllcn, L., and Lindabl, U. (1991). Proteoglycans: structures and interactions. Annu. Rev. Biochem., 60, 443-475. 5. Ruoslahti, E., and Yamaguchi, Y. (1991). Proteoglycans as modulators of growth factor activities. Cell, 64, 867-869. 6. Vlodavsky, 1., Eldor, A., Haimovitz-Friedman, A., Malzner, Y., Ishai-Michaeli, R., Levi, E., Bashkin, P., Leader, O., Naparstck, Y. , Cohen, IR, and Fuks, Z. (I992). Expression of bcparanase by platelets and circulating cells of the immune system: Possiblc involvement in diapedesis and extravasation. Invasion & Metastasis, 12, 112-127. 7. Vlodavsky, I., Mohsen, M., Leader, O., Ishai-Michaeli, R., Ekre, H.-P., Svahn, CM, Vigoda, M., and Peretz., T. (1995) . inhibition of tumor metastasis by hcparanase inhibiting spocics of heparin. Invasion & Metastasis, 14, 290-302. 8. Nakajima, M., Irimura, T., and Nicolson, G.L. (1988). Heparanase end tumor metastasis. J. Cell. Biochem., 36,157-167. 9. Nicolson, G.L. (1988). Organ specificity of tumor metastasis: Role of preferential adhesion, invasion and growth of malignant cells at specific secondary sites. Cancer Met, Rev., 7, 143-188. 10 Liotta, L.A., Rao, C.N., and Barsky, S.H. (1983). Tumor invasion and the extracellular matrix. Lab. Invest., 49, 639-649. 11. Vlodavsky, I., Fuks, Z., Bar-Ner, M., Ariav, Y., and Schirrmacher, V. (1983). Lymphoma cell mediated degradation of sulfatcd protokglycas in the subendothelial extracellular matrix: Relationship to tumor cell metastasis. Cancer Res., 43, 2704-2711. 12. Vlodavsky, I., Ishai-Michacli, R., Bar-Ner, M., Fridman, R, Horowitz, A.T., Fuks, Z. and Biran, S. (1988). Involvement of heparanase in tumor metastasis and angiogenesis. Is. J Med., 24, 464-470. 13. Vlodavsky, I., Liu, G.M., and Gospodarowicz D. (1980). Morphological appearance, growth behavior and migratory activity of human tumor cells maintained on extracellular matrix vs. plastic Cell, 19, 607-616. 14. Gospodarowicz, D., Delgado, D., and Vlodavsky, I. (1980). Permissive effect of the extracellular matrix on cell proliferation in-vitro. Proc. Nati Acad. Sci. USA., 77, 4094-4098. 15. Bashkin, P., Doctrow, S., Klagsbrun, M., Svahn, C.M., Folkman, J., and Vlodavsky, I. (1989). Basic fibroblast growth factor binds to subendothelial extracellular matrix and s released by heparitinase and heparin-like molecules. Biochemistry, 28, 1737-1743. 16. Parish, C.R, Coombe, D.R., Jakobsen, K.B., and Underwood, P.A. (1987). Evidence that sulphated polysaccharides inhibits tumor metastasis by blocking tumor cell-derived heparanase. Int. J. Cancer, A0, 511-517. 16a. Vlodavsky, 1., Hua-Quan Miao., Benezra, M., Leader, O., Bar-Shavit, R., Schmidt, A., and Peretz, T. (1997) Involvement of the extracellular matrix, heparan sulfate proteoglycans and heparan sulfate degrading enzymes in angiogenesis and metastasis. In Tumor Angiogenesis. Eds. EC. Lewis, R. Bicknell & N. Ferrars. Oxford University Press, Oxford UK, pp. 125-140. 17. Burgcss, W.H., and Maciag, T. (1989). The heparin-binding (fibroblast) growth factor family of proteins. Annu. Rev.

Biochem., 58, 575-606. 18. Folkman, J., and Klagsbrun, M. (1987). Angiogenic factors. Science, 235, 442-447. 19. Vlodavsky, I., Folkman, J., Sullivan, R., Pridman, R., Ishai-Michaclli, R., Sasse, J., and Klagsbrun, M. (1987).

Endothclial coM-dcrived basic fibroblast growth factor: Synthesis and deposition into subendothelial extracellular matrix. Proc. Nati Acad :. Sel. USA, 84, 2292-2296. 20. Folkman, J., Klagsbrun, M., Sassc, J., Wadzinski, M., Ingber, D., and VIodavsky, I. (1980). A heparin-binding angiogenic protein - basic fibroblast growth factor - is stored within basement membrane. Am. J. Pathol., 130, 393-400. 21. Cardón-Cardo, C, VIodavsky, I., Haimovitz-Friedman, A., Hicklin, D., and Fuks, Z. (1990). Expression of basic fibroblast growth factor in normal human tissues. Lab. Invest., 63, 832-840. 22. Ishai-Michaeli, R., Svahn, C.-M., Chajek-Shaul, T., Korner, G., Ekrc, H.-P., and. VIodavsky, I. (1992). Importance of size and sulfation of heparin in case of basic fibroblast factor from the vascular endothelium and cxtracellular matrix. Biochemistry, 31, 2080-2088. 23. Ishai-Michaeli, R., Eldor, A., and VIodavsky, I. (1990). Heparanase activity expressed by platelets, neutrophils and lymphoma cells releases active fibroblast growth factor from extracellular matrix. Cell Reg., 1, 833-842, 24. VIodavsky, I., Bar-Shavit, R., 1 shai-Michaeli, R., Bashkin, P., and Fuks, Z. (1991). Extracellular sequestration and reléase of fibroblast growth factor: a regulatory, mechanism? Trends Biochem. , Sci., 16, 268-271.

. VIodavsky, I., Bar-Shavit, R., Korner, G., and Fuks, Z. (1993). Extracellular matrix-bound growth factors, enzymes and plasma proteins. In Basement membranes: Cellular and molecular aspects (eds D.H. Rohrbach and R. Timpl), pp327-343. Academic press Inc., Orlando, Fl. 26. Yayon, A., Klagsbrun, M., Esko, J.D., Ledor, P., and Ornitz, D.M. (1991). Cell surface, heparin-liko molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell, 64, 841-848. 27. Spivak-Kroizman, T., Lemmon, M.A., Dikic, I., Ladbury, J.E., Pinchasi, D., Huang, J., Jaye, M., Crumley, G., Schlessinger, J., and Lax, I. (1994). Heparin-induced oligomerization of FGF molecules is responsible for FGP receptor dimerization, activation, and cell proliferation. Cell, 79, 1015-1024. 28. Ornitz, D.M., Hcrr, A.B., Nilsson, M., West, a., J., Svahn, C.-M., and Waksman, G. (I995). FGF binding and FGF receptor activation by synthetic heparan-derived di- and trisaccharides. Science, 268, 432-436. 29. Gitay-Goren, H., Soker, S., VIodavsky, I., and Neufeld, G. (1992). Cell surfacc associated heparin-like molecules are required for the binding of vascular endothelial growth factor (VLGF) to its cell} surface receptors. J. Biol. Chem., 267, 6093-61098.

. Leader, O., Baharav, E., Mekori, Y., Miller, T., Naparstek, Y., VIodavsky, I., and Cohen, I.R. (1989). Suppression of experimental autoimmune diseases and prolongation of allograft survival by treatment of animals with heparinoid inhibitors of T lymphocyte heparanase. J. Clin. Invest., 83, 752-756. 31. Leader, O., Cahalon, L., Gilat, D., Hershkovitz, R., Siegel, D., Margalit, R., Shoscyov, O., and Cohn, I.R. (nineteen ninety five). A disaccharide that inhibits tumor necrosis factor a is formed from the extracellular matrix by the enzyme heparanase. Proc. Nafl Acad. .Sci. USA., 92, 5037-5041. 31a. Rapraeger A., Krufka, A., and Olwin, B.R. (1991).

Requirement of heparan sulfate for bFGF-mediated fibroblast growth and myoblast differentiation. Science, 252, 1705-1 70B. 32. Eisenberg, S., Schayck, E., Olivecrona, T., and VIodavsky, I. (1992). Lipoprotin lipase enhances binding of lipoproteins to heparan sulfate on cell surfaces and extracellular matrix. J. Clin. Invest., 90, 2013-2021. 33. Shieh, M-T., Wundunn, D., Montgomery, R.I., Esko, J.D., and Spear, P.G. J. (1992-) Cell surface receptors for herpes simplex virus are heparan sulfate proteoglycans.

Biol., 116, 1273-1281. 33a. Chen, Y., Maguire, T., Hilcman, R.E., Fromm, J.R., Esko, J.D., Linhardt, R.J., and Marks, R.M. (1997). Dengue virus nfectivity depends on envelope protein binding to target cell heparan sulfate. Nature Medicine 3, 866-871. 33b. Putnak, J.R., Kancsa-Thasan, N., and Innis, B.L. (1997). A putative cellular, receptor for dengue viruses. Nature 5 Medicine 3, 828-829. 34. Narindrasorasak, S., Lowery, D., Gonzalez-DcWhitt, P., Poorman, R.A., Greenberg, B., Kisilevsky, R. (1991). High affinity interactions between the Alzheimer's beta-amyloid precursor protein and the basement membrane form of theparan sulfate protcoglycan. J. Biol. Chem., 266, 12878-83. 35. Ross, R. (1993). The pathogenesis of atheroselerosis: a perspective for the 1990s. Nature (Lond.)., 362; 801-809. 36. Zhong-Shcng, J., Walter, J., Brecht, R., Miranda, 15 D., Mahmood Hussain, M., Innerarity, T.L. and Mahley, W.R. (1993). Role of heparan sulfate proteoglycans in the binding and uptake of apolipoprotein E-enriched remnant lipoproteins by cultured cells. J. Biol. Chem., 268, 10160-IOI67. 37. Ernst, S., Langer, R., Cooney, Ch.L., and 20 Sasisekharan, R. (1995). Enzymatic degradation of glycosaminoglycans. Critical Reviews in Biochemistry and Molecular Biology, 30 (5), 387-444. 38. Gospodarowicz, D., Mescher, AL., Birdwell, CR. (1977). Stimulation of corneal endothelial cell proliferation in ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ by fibroblast and epidermal growth factors. Exp Eye Res 25, 75-89. 39. Haimovitz-Friedman, A., Falcone, D.J., Eldor, A., Schirrmacher, V., VIodavsky, I., and Fuks, Z. (1991) Activation of platelet heparitinase by tumor cell-derived factors. Blood, 78, 789-796. 39a. Savitsky, K., Platzer, M., Uziel, T., Gilad, S., Sartiel, A, Rosental, A., Elroy-Stein, O., Siloh, Y. and Rotman, G. (1997). Ataxia-tclangiectasia: stural diversity of untranslated sequences suggests complex post-translational regulation of ATM gene expression. Nucleic Acids Res. 25 (9), 1678-1684. 40. Bar-Ner, M., Eldor, A., Wasserman, L., Matzner, Y., and VIodavsky, I. (1987). Inhibition of heparanasc mediated degradation of extracellular matrix heparan sulfate by modified and non-anticoagulant heparin .species. Blood, 70, 551-557. 41. Goshen, R., Hochberg, A., Korner, G., Levi, E, Ishai-Michacli, R., Elkin, M., de Grot, N., and VIodavsky, I, (1996). Purification and characterization of placental heparanase and its expression by cultured cytotrophoblasts. Mol. Human Reprod. 2, 679-684.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: Iris Pecker, Israel VIodavsky and Elena Feinstein (ii) TITLE OF THE INVENTION: POLYNUCLEOTIDE THAT CODIFIES A POLYPEPTIDE THAT HAS HEPARANASE ACTIVITY AND EXPRESSION THEREOF IN TRANSDUCTIVE CELLS (ii) NUMBER OF SEQUENCES : 23 (ii) DIRECT ADDRESSES (A) RECIPIENT: Mark M. Friedman with Robert Sheinbein (B) STREET: 2940 Birchtree Lane (C) CITY: Silver Spring (D) STATE: Maryland (E) COUNTRY: States United States (F) POSTAL CODE: 20906 (v) COMPUTER READING FORM: (A) TYPE OF MEDIA: 1.44 megabyte, microdisc 3.5" (B) COMPUTER: Twinhead * Slimnote-890TX (C) OPERATING SYSTEM: MS DOS version 6.2 Windows version 3.11 (D) SOFTWARE: Word for Windows version 2.0 converted to an ASCI file (vi) CURRENT REQUEST DATA: (A) NUMBER OF APPLICATION: (B) DATE OF SUBMISSION: (C) CLASSIFICATION (vii) PREVIOUS APPLICATION DATA: (A) APPLICATION NUMBER: 08 / 922,170 (B) DATE OF SUBMISSION: September 2, 1997 (viii) INFORMATION OF THE AGENT / APPORTER: (A) NAME: Friedman, Mark M. (B) REGISTRATION NUMBER: 33,883 (C) REFERENCE NUMBER / RECORD: 910/1 (ix) TELECOMMUNICATION INFORMATION: (A) PHONE: 972-3-5625553 (B) TELEFAX: 972-3-5625554 (C) TELEX: (2) INFORMATION FOR SEC. ID. NO: 1 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 1 CCATCCTAAT ACGACTCACT ATAGGGC 27 (2) INFORMATION FOR SEC. ID. NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 2 GTAGTGATGC CATGTAACTG AATC 24 (2) INFORMATION FOR SEC. ID. NO: 3 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 3 ACTCACTATA GGGCTCGAGC CGC 23 (2) INFORMATION FOR SEC. ID. NO: 4 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF t SEQUENCE: SEC. ID. NO: 4 GCATCTTAGC CGTCTTTCTT CG 22 (2) INFORMATION FOR THE ID SECT. NO: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 5 TTTTTTTTTT TTTTT 15 (2) INFORMATION FOR SEC. ID. NO: 6 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 6 TTCGATCCCA AGAAGGAATC AAC 23 (2) INFORMATION FOR SEC. ID. NO: 7 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 7 GTAGTGATGC CATGTAACTG AATC 24 (2) INFORMATION FOR SEC. ID. NO: 8 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 8 Tyr Gly Pro Asp Val Gly Gln Pro Arg 5 9 (2) INFORMATION FOR SEC. ID. NO: 9 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1721 (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. NO: 9 CT? OACCT? T CGACrCTCCC CT6CGCCÚCA GCTCCCGCCG GGA5CAGCCA GGTGACCCC? 60 AGATGCTCCT GCGC GAAG CCTÚCGCTGC CGCCGCCGCT OATGCTGCTG CTCCTGGGGC \ 20 CGCTGOG C CCTCTCCCCT GGCGCCCTGC CCCGACCTGC GCAAGCACAG G? CGTCGTGG LSSO ACCTßGACTT cTJCACCCAQ G? CCCGCTGC ACCTCGTGAG CCCCTCGTTC CTßTCCCTCA 240 CCAUGACGC CAACCTGGCC ACGGACCCGC GGTTCCTCAT CCCCTGGfiT 1CTCCAAAGC 300 TTCGTACCTT GGCCAÚAGGC TTCTCTCCTO CGTACCTGAO GGGTCCTGGC ACCAAGACAG 360 ? ACGTCCTAAT TTTCGATCCC AAGAAGOAAT CA CCTTTGA GAGAAGr T CTOGCAAT 420 CTCAACTCAA CCAOOATATT TOCAAAIATO GATCCATCC rcCTGATGIG GA & GAG ?? GT 4A0 lACCGTtGEA ATCGCCCTAC C GGAGCAAT TOCTACTCCG AGAACACTAC CAOAAAAAQT TC 540 ?? GMCAG CACCTACTCA AGAAG.CTCTO TAGATGTGCT ATACACTTTT GCAAACTOCT 60FL CAGGACTCGA C GGATCT T??? CGCCGA? ATG CÚTGAGTAAG AACAGCAGA7 TTÚCWJTGOA ¿0 ACAGÍTCTAA TDCTCAGTTC CTCCTGMCT ACTGCtCTTC CAAGGCi-jTA? AACATTTCTT 720 QßGAACf GG CAATGA? CC? AACAGTTTCC TtAAGAADGC TCAHUTIC ATC? A1GGGT 780 CGC? GTGAGG ACAAßATTAT ATTCAATTÚC ATAAACíTCr AAßAAAGTCC ACCTrCAAAA £ 40? TGCAA? ACT CTTOGGCCT OATGTTßDTC AGCCTCGAAG AAAQACQGCT AAGATGCTGA 900 ACACCTTCCG GAAGGCTGGT GGAßA? QTG? TTCATTCAGT TACATGGCA CACT? CMTT 060 GGA? TQQACQ GACTBCTACC AGGQAAGATT TTCTAAACCC TGATCTAGTG GACATT? TA 1020 WCATCTG? ACITA ITCAOCTCC TTQ? GAfiC? C GAGGCCT &GC AA5AAGC7C7 10S0 QGTTACGAGA AAAAGCTCT GCATATGGAG GCGG? GCCCC CT? 6CTA1CC GACACC1TTU 1140 CAGC.TfiGt.TT TATGTGGCTG GATA? ATIGG GCCTGTCAGC CCGAAGGGGA AT? GA? GTGG 1200 rCATG? GG A AGT? TTCm CGAQCAGG? A ACT? CCAGTG A6TGGATGA? AACTTCCATC 1H0 C7T ACCTG? TTA? GCCTA ICTCtiCTGT TCAAGAAATT CQ1GGGCACC AADGTGTTAA 1320 TGGCAAQCGT GCAAGGTTA AAGAGAABGA AGCTTCGADT ATACC? CAG TCCACA? CA 1560 CGCACAAGCC AAGCTAG? AA AA € GAGAIT TAACrCTGrA TGCCAGAAAC CTCCAGAACQ H CI GCACCAAGTA C7TOCGGTTA CCCTATCCTG T? CTA? CAA GCAACTGGAl AMIACCpC 1500 GAAG? CCT? GGGACCTCAT DOA? TACTTr CCAAATCTC1 CCAACTCAAT GGTCTAACTt- 1S60 7? MGATGD1 l & ATCAICAA ACCTTCCCAC CpiAATGfiA AAMCCTCTC CGGCCAGGAA 1620 GICTCACTOCC CT CCCACCT ITCGCATAIA G? TTTTTOT GATAGAAAT GCC? A? GGTG 16B0 crof-pccAl CTGAAAATAA AATATA? TAG recreates D? CG G 1721 (2) INFORMATION FOR SEC. ID. NO: 10 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 543 (B) TYPE: amino acid (C) CHAIN FORM "simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. NO: 10 ^^^ gUU Mel l eu Leu Are Sister Lyß Pro Ala Pro Leg Pro Pro Leu Het Leu Leu 5 10 15 Leu Leu Gly Pro Leu Cly P ro Leu Sar Pro CLy Wing Leu Pro Arg Pro 20 25 30 Al to Gln Ale Gln Asp Val Val Asp Leu Asp Phe Ph «Thr Cl n Glu Pro 35 40 65 Leu Ki, Leu val Ser Pf u be Phe Leu Ser Val rhr l ie Ap Wing Aip SO SS 60 Leu Al a Thr? Sp pro Arg Pht Leu He eu Leu Cly Ser Pro Ly * Leu 65 70 TS? Q Ar? Thr Leu Alo Arn Cly Leu Sor Pro Ala lyr Leu Arg Phe Cl Gly ßS 90? Tfir Lyo Thr Atp Phe Leu l l t Phe Aßp Pro Lyt Ly? Glu Ser Thr Ptie 100 IOS 1) r) Glu Qlu Arg Ser tyr Trp Din Ser Qln Val? Sn Glp Aip l ie Cya Lyi 115 IZO 1-ZS lyr Gly Ser He pro Pro A * p Val Glu Glu Lys Leu Ai or Leu Gtu Trp 130 1 »UO Pro Tyr" Glp Glu Glp Leu Leu Leu Arg Glu Illa Tyr Glp Lya Ly * Pho 145 150 155 160 Lys Asn Ser Thr Tyr S »r Arg Ser Sar Val Aap Val Leu Tyr Trir Phe 165 170 175 Al * Asn Cya Ser Gly Leu Aap Leu I I * Phe Gly Leu Asn Ala Leu l «u 100 1» 190 Arg Ihr Wing Aip Leu Glp I rp Asn Sar Sar Atn Wing Clp Leu Leu Leu 195 200 20 Asp Tyr Cya Sor Ser Lya Gl and lyr Asn II c Ser Trp Qlu Leu Gly? Sp 210 215 ZZ0 Glu Pro Atn «ar Phe Leu Lya Lya Wing Asp He Phe Ha Asn Gly Ser 225 230 235 240 GLp Leu Gly Glu Aep Tyr I l «Gln Leu W Lya Leu Leu Arg Ly * Mr 245» 0 ZS5 Thr Phe ly »Asn Ala ly * Leu Tyr Gly Pro Asp Val CLy Glrt Pro Arg 260 265 270 Arg Lyc Thr AU Lyc Met Leu Lys Ser Phe Leu Ly. Wing Gly Oly aLu 275 2B0 285 Vil t H e Asp Ser VMI Thr Trp Hi »His Tyr Tyr leu Atn Gly Arg Thr 29. 29. 100 Wing Thr Arg Glu Aßp Ph» Leu sn Pro tp val Lou Atp lie phe Ue 305 310 315 320 ier Ser Val cip ly * Vol Phe Gln Val val Glu Ser Ihr Arg Pro Úly J2.1 »330 335 Lyc Lyt Val I rp le »f.« V CLu I hr Ser Ser Ala lyr Gly GLy CH? Alo 340 34! > J > ( Piti Leo leu Ser? Tp lhr Phir Ala Alo Cly P > m Mel Trp LCu Atp Ly- SS5 JW 365 Lew C.l? leu S.i? l u Arg Mirt Cl and He D (u Vi l Val Kct AGIJ n Vol §6 IV 570 375 380 Plio Phe Gly Ala Gly Asn fyr His Leu Val? Cp Glu? Sn PJie A &p Pro 3 &5 390 400 Leu Pro A $ p Tyr Trp LCU Ser Leu Lou Phe Lys Lys Leu Val GLy Thr 405 410 415 Lys Val Uu Net AU Ser Val Gln Gly Ser Lya Arg Arg Lyt The »Arg 420 425 430 Val Tyr L * u Híß cy < Thr? &N Thr? Cp? Sn Pro Ara TVr Lyc Giu GLy < 3S 440 445? Sp Leu Tíir Le "Tyr Ala He A * t? Leu (lys Asn Val Thr Lys T? R Leu 450" 55 460 Arg Leu Pto lyr Pro Phe Ser Aen Ly »Gln Val Aap Ly * Tyr Leu Leu 465 470 475 4fl0 Ara Pro Leu Gly Pro His Gty Leu Leu Ser Lye Ser Val Glr. Lau Ain 45 490 495 Uly Leu Thr Leu Lye Met Val Asp? Sp Gln Thr Lau? To fro Leu Met 500 503 510 Glu l.ys Pro Leu Ar & Pro Gly Ser Ser Leu Gly Leu Pro AU Phe Ser 515 520 525 Tyr Ser Plie Phe Vallee Arg Aip AU Lyt V C Ala Wing Cys I U 535 535 540 543 (2) INFORMATION FOR SEC. ID. NO 11 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH. 1718 (B) TYPE: nucleic acid (C) CHAIN FORM: double 3 * 7 (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 11 CT AC ccr pc GAC 14 TCT CCG CTG CGC GGC ACC TGG CGG CGG GAC CAG CCA GGT GAG CCC AAG 62 ATG CTG CIO CGC TCG AAG CCT GCG CTG CCO CCG CCG CTG ATG CTG CTG no Hat leu Leu Arg Ger lys Pro Ala Leu Pro Pro pro Leu Ka. The? Lau 5 10? 5 CTC CTG BGG CCG CTQ GGT CCC CTC TCC CCT GGC GCC CTG CCC CGA CCT 15d Lau Leu Gly Pro Leu Cly Pro Leu Ser Po úly Ala? Pro Ars Pro 20 '25 30 GCG CA BCA CAG GAC GTC CTG GAC CTG GAC TTC TTC ACC CAG GAG CCG 206 Ala GLn Ala tiln A «? Vol V »(Aap Lau Asp Phe Phe Thr Glp Glu Pro 35 40 45 CTG CAC CTG GTG AGC CCC TCG TTC CTG TCC GTC ACC ATT OAC GCC AAC 254 Lau Híß Leu Val Ser Pro Ser Pire Leu Ser Y« l Thr Ue Aap Ala Ain 50 55 60 CTG GCC ACT GAC CCG CGG TTC CTC ATC CIC CTG GGT TCT CCA AAG CTT 02 Leu Ala Thr A * p Pro? Rg Phe Leu II? Í? Leu cly Sar Pro Lys Leu 65 70 n 80 CGG ACC GTG CCC AGA GGC? G rcr CCT OCB TAC CTCÍ AGG J? GGT CGC 350 Aro Thr Leu Wing Arg Gly Leu Ser Pre Aln ryr Leu Arg Phe cly úly 85 90 95 ACC AAG ACÁ GAC TTC CtA ATT TTC UA? ccc AAC? R GAA TCA ACC T? 395 Thr Lyt Thr Aß Ph »uu Ha Pha Atp Pro ys Lyc Glu S« r Thr Ph * 100 105 11 (1 GAA GAG AGA ACT TAC TGC CAA ICT CAA GTC AAC CAG GAT ATT TGC AAA 446 GC «Glu Arg Ser Tyr Trμ Gl S r Cln Val Air. F.lp Aip lie C.? * Ly * 115 120 125 GAT COA TCC ATC CCT CCT GAG for GAG GAG AAC TGA coa p. «AA TGG W lyr Bíy Ser l ie Pro Pro Asp Vnl Clu Blu Lys leu? Rg Leu «lo Trp 1» 1SS 140 CCC IAC CAG GAG CAÁ l? ß CTA C1C CGA GAA CAC TAC CAG AAA AAC TIC 542 Pro lyr Gln olu Gln lau tu Liu Are <-lu Hls Tyr Gtn ly »Lya Phe H. 150 1S5 160 AAG AAC AGC ACC TAC ICA AG? AGC TCT GTA GAT CTG CTA TAC ACT TTT 59 l Lya AS? Bar Tlir Tyr Car Aro Ser Ser Val? Sp Val lau lyr Thr Ph * 16b 170 175 6CA AAC TGr 1 A GGA CTC CAC TTC ATC TtT OGC CTA A? T GC? TTA TTA * 5? Ala? Sn Lyi Ser 01 / leu Asp L «ul ie Phe G (and Leu?» N Ala Leu Uu 180 185 WO AO? ACÁ GCA CAÍ TG CAG IGG AAC ACT TCT AAT CC? CAG TTG CIC CTG «6 Are Thr the At lu Gln Trp Ain Ser Ser Aso AU t.Vn Leu Leu Leu 195 200 2 < tt CAC IAC tc? C? Rec AAG GGS TAT? AC TG TCT TGG GA? CÍA < iGC AAT 73 *? Sp lyr Cys Ser Ser lys Cly lyr Asn lio Ser Irf Clu Leu Gly Asn 210 21. 220 MA CCT AAC AGÍ TTC CTT AAG AAG GCT GAI ATI ITC ATC AAT GGG TCG 782 Gli / Pl or Acn Ser rito Leu Lys Lys Ais Aip [le Phe 1 le? Tn Qly Ser? 7S 230 235 2 «a CAC TIA GGA GAA GAT TAI AIT CAA TTG CAI AAA CTT CTA AOA AAG TCC 030 Gln Leu Gly Glu Asp Tyr 1 Lc 01n Leu Hi * ly * Leu Leu? Rg Lys Ser 245 2S0 255 ACC TTC AAA AAT GCA AAA CIC TAI CCl CCT GAT GTT SGT CAG CCT CGA B78 Thr Phe Lys Asn Wing Lya Leu Tyr Gly Pro? Sp Val Gly Qln Pro Arg 260 265 270 ACÁ AAS ACG CCT AAG ATG CTG A? G ACC TTC dfi AAG GCT CBT GGA C? A 926 Arg Lys Thr All lys Nl Leu Lya Ser Pha Leu Lys Wing Gly Cly Glu 275 2ß0 285 GTí ATT QAT TCA GTT HAL 100 CAT CAC TAC TAT TTG AAT GGA CCG ACT 97 * Val lie Aßp Ser Val Thr Trp KU Hl »lyr Tyr Leu Asn Gly Ara T (? R 290 295 300 OCT ACC AGI GAA G? T TTT CIA AAC CCT G? T OTA TTO GAC ATT TIT ATT 1CI19 Ais Thr Are Olu Asp Ptic Leu Acn Pro Aep Val leu Asp lie Phe (the 505 310 315 320 TCA TCT GTß CAA AAA ILO TTC CAG GTE GTT Mß AGC ACC AOC CCT GGC 1067 Ser Ser Val Bln lya Val Pha Cln Val Val Clu Ser Thr Are Pro Gly? 25 530 335 ? A «AAG er TßG TTA CCA CAA AC AC TCT GCA TAI GGA GGC OÚA GCG 1115 Lya Lyc V« l Trp Lou Gly Glu Thr ter ter Ats Tyr Sly Qly Oly Ata 340 345 350 ccc GTO CTA rec GAC ACC GTT GCA SCT GGC T? ATO TGG ere UAT AAA ?? J Pro Leu Leu Ser Asp Thr Phe Wing Ale Gly Phe «t Tro Leu Aap Lys 35S 360 365 rrc GGC CTG ICA CCC CGA ATG GGA ATA CA UTG GTC ATG? OG CA OTA 1211 Leu Gly Leu Ser Ata Arg Het Gly He «lis Val Vil Het Al a Gln Val J? > 375 SAO TTG TGI CGA GGA COA? AC TAC CAI TJA GTC GAT G? A AAC TGC GAT CCT l? So hr Phe Cly? Qly Asn lyr Hit Leu Val Asp ß (u A-n Pe? * P Pro 30S J90 3 »400 TGA C I GAT GAT TCC CIA TCI CTT ere TTC A? G AAA TT, .I. GCC ACC Mar LKJ PÍ O Asp Tyr Trμ leu ier Leu leu Phe Ly. i? s l eu val Cty Thr 405 41 (1 415 AA6 GIG HA ATG bCA AGC GTG CAA GGT TCA AAC AGA AC-AAG CTT CCA 1315 l ys Vil Leu Mr. A l - Ste V4 l (j (t? Uly Ser l ys Arg Aro Lyc Luu Arg VI 420 425 430 GTA TAC CTT CA7? GC ACÁ AAC ACT GAC AAT CCA AGG TAT AAA GAA GGA 1403 Vil Tyr lau HU cyt Thr A «fi Thr Atp Am Pro Arg Tyr tys Glu Gly 3 440 445 GAT TTA ACT CTG GAT GCC ATA MC CTC CAI A? C GTC ACC AAG TAC TTG 1451 ? s Leu Ttir Leu Tyr Ala lia? tn Lau H? E Aßn V? l Thr lya Tyr u 450 455 460 CÃ-G UA CCC TA »ccr TGT TCT AAC? AG CAÁ GTG GAT AAA TAC CTT CTA 1499 ? rg Leu Pro lyr Pro P-ho Ser Aßn lya Glii Val? ap lye Tyr Leu L u 465 ro 475 480 AGA CCT TTG CGA CCT CAT CGA TTA C? TCC AAA TCT GTC CATC CTC A? T 1W7 Ar «Pra l.au t Pro K. * Cly Leu Leu Ser Lys Ser Val Glp Leu Aßn 48b 490 495 GGT CTA ACT CTA AAG ATC GTG CAT G? T CAA ACC TTG CCA CCT TTA ATG 1595 Gly httu Thc L «U lys M« t val Atp Acμ Gln Thr leu Pio pro Leu Het oo 505 510 G? A? AA GCT TTC TCA 164S GlU v »Ata Phe Ser TAT AGT GTG TTT GTG ATA AG? AAT GCC AAA GTT GCT GCT TGC ATC TGA 1691 Tyr Str Pha PJiß Val lie? Rg Aßn Wing Ly * Val Wing Ma Cys. { íe 530 535 MO 54.3 AAA TAA AAT ATA CTA CTC CTG? C? CTC ma (2) INFORMATION FOR SEC. ID. DO NOT. 12 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 824 (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: double (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 12 CTGGCA? GA? GGTCTGGTTG GGAGAG? CG? GCTCAGCTTA CGGTGGCGGT GCACCC TGC 60 TGTCCAACAC CTHGCAGC? GGCTTTATGT GGCTGGATAA ATGGCGCCGÚ TC? GCGG? GA TGGGCAT I20? GA AGTCGTGATG AGGCAGGTGT TCTTCGGAGC AGGC O ?? CTAC CACTTAGTGG ATGAAAACTT TGAGCCTTTA CCTGATTACT GGCTCTCTCT TCTGTTCAAG AA? CTGGTAG GTCCCAGGGT 240 GTT? CTGTCA AG? GTGA? AC GCCCAGACAG GAGCAAACrC C6? GTGTATC 300 TCCACTGC? C TAACGTCTAT C ? GCCACGAT ATCAGGAAGG AGATCTA? CT CTUTATGTCC 360? 6AACCTCCA TAATOGCACC AAGCACTTGA AGGTACCGCC TccßiTßirc AßGAAACCAG 420 TGGATCOTA CCTGCTGAAC CCTTCGGGGC CGGATCGATT ACTTTCCAAA TCTGTCCAAC 460 TGA? CGßTC? AATTCTGAAG ATGGTGGATG AGCAGACCCT CCCAGCTTTG ACAGAAAAAC 540 CTCTCCCCGC AGG ?? GTGCA CTAAGCC7CC CTGCCTTTTC CTATQGTTTT TTTGTCATAA 600 GAAATGCCAA AATCGCTGCT TGTATATGAA AATAAMGGC ATACGGTACC CCTGAGACAA 660 A GCCGAGGD GGGTGTTATT CATAAAACAA AACCCTAGTT TAGG GCCCA CCTCCTTGCC TZ GAGTTCCAGA GCTTCGGGAG CGTGGGCTAC ACTTCAGTAT TACATTCAGT GTGGTGTTCT 7 &amp?; CTCTAAGAAG AATACTGCAG GTGGTGAC? G TTAATAGCAC TGTG ?? 4 (2) INFORMATION FOR SEC. ID. NO: 13 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1899 (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 13 GGCAAAGCG? GCAAGG ?? GT AGG? G? GAGC CGCGCAGQCG GGGCGGGGTT GG? .TGGGAG 60 CAC1GGBACG GATGCAßAAG AGGAGTGGCA GGGATGGAGG GCGCAGTGGG AGGCGTGAGG V¿fi AGC? GTAACG GGGCGGAGC? AAGG? G ?? AA GGGCGCTGGG QCTCGCCGGG AGGAAGTGCT ISO AGAGCTCTCR? CTCTCCGCT GCGCGGCACC TGGCGGGGGG AGCAGCCAGG GGAGCCCAA 240 ATCCTGCTGC GCTCGAAGCC iGcacroccG CCDCCÚCTGA GGCTGCTGCT CCTGGGGCCn 30 CTGGGTCCCC TCTCCCCTGG CGCCCTGCCC CGACCTGCGC AAGCACAGCA CGTCGTGGAC 560 cfCGAcrrcí TCACCCAGGA GCCOCGOCAC CTGGTQAGCC ccrccTTCcr GTCCGTCACC 420 ATTQACGCCA ACCTQGCCAC GGACCCCCGG TTCCTCATCC TCCTGGGTTC TCCA? AGCTT 4th CUACCHCG CCAGAGGC? CTCTCCTCCG TACCTGAGGG TTGGTGGCAC CAAGACAGAC 540 TT CTAATTT TCGATCCC? A GAAGCAATC? ACCTGTC? AC AGAG? AGTTÁ CTBGCAATCT 600 CAACTCAACC ACGATATTTG CAAATATCGA TCCATCCCTC CTGAGGGGGA GGAGAACTTA 660 CCC1TGGAAT GQCCCTACCA GGAGCAATTn CACTACGAO A? CACTAO.A GA? ACTTC? = Q VII AAG? ACAGCA CCTAC7CAAG? AGCrcTGT? GATGTGCTAG ACAC7TTTGC A? ACTGCTCA 780 CGACTGGACT T6A7CTTTGU CCTAAATGCG GTA? AAGAA CAGCAGAGTT CCAGGGGAAC ß40 AGTTCTA? 70 CTCAGTTGCT CCTGGACTAC TGCTCTICCA AGGGGTATA? Attrcrt6G 900 GAACTAGGCA ATGAACCTAA CAdpTccp AAGAAGGCTG ATAGIGTCAT AATGGGTCD 960 CAGTTAGGAG AAOATTATA? TCAATTGCAT AAACTTCGAA flAAAGTCCAC CTICAAAAAG 1020 GCAAAACTCT ATGGTCCTGA TGTTGQTCAG CCTCGAAGA? ? GACGGCTAA GAT6CTGAAG 1060 AGCTTCCTGA AGGCTGGGGG AGAAGIGATT GATTCAGTTA CATGGCATCA CTACTATTTG 1140 A? TGGACGGA CTGCTACCAG .6GAAGATTTT CTAAACCCTG ATCTATTGdA CAT? TTA? 1200 TCATCTGTGC A? A? AGTTTr CCAGGTGGTG GAGAGCACCA GGCCT6GCAA GAAGGTCTGG 260 rTAGGAGAAA C ?? ßCTCTGC ATAIGßAGGC GGAGCCCCC TGCTATCCfiA CACCTTGGCA 132D GCTGGCTTT? TGTGGCTGGA TAAATTGGGC CTGTCAGCCC B? TGGGAAT AGA? GTGGTG or ATGAGGCAAG TATTCTTTGG AGCAGG? AAC TACCATTTAG TGGATGAAAA CTTCGATCCT 1440 TT? CCTGA? ATTGGCTATC TCTTCTGTTC AAGAAATTGG TGGGC? CC? A GGTGTTAATG 1500 GCAAGCC CC AACGTTCAAA GAGAAGGAAG CTTCGAGTAT ACCTTCATTG CACAAACACT 1560 GACAATCCAA GGTATAA? GA AGOACAT? A ACTCTGTATG CCATAAACCT CCATAACGTC 1620 ACCAAGTACT TGCGGTTACC CTATCCTT? TCTAACAAGC AAGTGGATAA ATACCTTCTA 16B0 AGACCTTTGG GACCTCATGG ATFACTTGCC AAATCTGTCC AACTCMTGC TC1AACTCTA 1740 AAGATGGTGG ATCATCAAAC CTTGCCACCT TTAATGGAAA AACCTCTCCG GCCAGGAAGT 1800 TCACTÚGGCT GGCC? GCTTG CTCATAGAGT TrTTTTfirGA TAAGAA? GGC CA GGTGCT 1860 ??? C? GCATCG GAAAATAAAA TATACTAGGC CTG? C? CTG 1B99 (2) INFORMATION FOR SEC. ID. NO: 14 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 592 (B) TYPE: amino acid (C) FORM OF THE CHAIN: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO 14 Hat Glu GLy Wing Val Gly Gly V «l? Rg Arg Arg Asn Gly Wing Glu 5 10 15 Glu Arg Arg Lya GLy Arg Trp Gly S r Alo _ and Gly Ser Wing Arg 20 25 30 Ata Leu Asp Ser Pro Lau Are Gly be Trp Arg Gly Gllu Gln Pro 35 40 45 GLy Glu Pro Lyc Kat Lau Lau Arg Ser Lys Pro Ala Lau Pro Pro; ? 5o 55 60 Pro Leu Mat Lau Lau Leu Leu GLy Pro Lee Gly Pro Leu Ser Pro 65 TO 75 Gly Ala Leu Pro Arg Pro Ala Glp Ala G.n Aup Val Val Acp Leu ao 85 90 ? Phe Phe Thr Gln Glll Pro l Tu I (ls Leu Val Ser Pro Ser Ph «95 IDO 105 Leu Ser Val Thr Ha? Sf > To Aan Lou Ala Thr? & p Pro Arg Ph * 110 115 120 Lau Ua Lau Lau Gly $$ r Pro Ly * Lou Arg Thr Leu Ale Are Gly 125 130 135 Leu be Pro Ala Tyr Lau Arg Phß Gly GLy Thr Lys rhr Aap Phe 140 145 150 Leu lie Phe Asp Pro Lya Lys ßlu Ser Thr Phe Glu Glu Arg Ser 155 160 165 Tyr Trp ßln be Gln Val Asn Glp Aap lia Cya Lya Tyr GLy Ser 170 175 1? 0 He Pro Pro Aop Val clu Glu Cya Leu Arg Leu Glu Trp Pro Tyr 185 190 195 filn Glu Gln Lau Leu Arg Glü Hf * Tyr Gln Lya Lys P e Lys 200 205 210 Asn Ser TJir Tyr Sar? R? Sar S * r Val Aap Val Leu Tyr Thr Phs Z15 220 225 Wing Asn Cys Ser Gty Lau Aip Lau MO Phe Gly Leu Asi. Ala Leu 230 235 240 L «Arg Thr Wing A» μ Leu GLn Trp Aon Sar S * A «n Wing Gln leu 245 250 255 Leu Leu Aip Tyr Cyß Ser Sai 'ly * Cly Tyr Aßn lie Ser Trp GLu 260 265 270 i.nu Gly? Sn Glu Pro Asn be Phe Leu Lya l and Alu Ai lie Phe 275 2C0 285 lie Asn Gly Ser Gln Leu Gly Glu Aop Tyr Ha Clp lev Hi * Ly * 290 29! > 300 Lau l «u Arg I. to Ser Thr F'hc Lys Aon Ala Lyr tau Tyr Gly Pra 105 310 315 Asp Val Gty Clp Pro A-rg Arg Lys Thr ALa Lys Met Leu lys Ser 320 325 JJ0 ? h? Leu Lys Ala Gly Gly ulu Val He As Ser v & L rhr Trp HU 335 340 345 VII T His Tyr Tyr t AWi Gly Arg Thr ALa Thr Arg Gl Asp Phe Leu 350 355 340 Aat- Pro Asp Val Leu Aap [le Phe He Ser Ser Val GLn Lyß Val 365 370 375 Phe Gln Val Val G your Ser Thr Arg Pro Gly Lye Ly * Val Trp Leu 3C0 3SS 390 Gly Glu Thr Ser Be Ala Tyr Qly GLy Gly Ala r Uu Leu Ser 395 00 «05 Atp Thr Phe My Wing Gly Phe Het Trp Leu As Lys Leu Gly Leu 4tQ 415 «0 Be A Arg Het GLy Cie Clu Vol Val Het Arg Gln Val Phe Phe 42? 430 435 CUy Ala Gly Asn Tyr His Leu VaL Asp Glu Aart Pht Aip Pro Leu 440 445 450 Pro Aßp Tyr Trp Leu Ser l. «U Leu Phe Lys ly * L« u Val Gly Thr 455 460 465 Lys Vo (Leu Het Alo Ser Val GLn GLy Ser Ly $ vg Arg Lya Leu 470 475 460 Aro Vol Tyr Leu His Cyü Thr A »p Thr? Fif. Afit? Pro Arg lyr Lys 4B5 490 495 Glu Gly As Leu Thr Leu Tyr ALa He Ash Leu His. Asn Val Thr 500 505 510 Ly? Tyr Leu Arg Leu Pro Tyr Pro Phe Ser Asn? .ys Gln Val Asp 515 520 525 Lys Tyr Leu leu Ar $ r Pro Lfiu GLy Pro HU Gly Leu Leu Ser Lye 530 53Í 540 Ser Vat Gln leu Aon Gly Leu Thr Leu Ly * Met Val Asp Asp Gln 545 550 555 Thr Leu Pro Pro Leu Mac Clu tys Pro Leu Arg Pro Gly Ser Ser 560 565 570 Leu Gly Lau Pro Ala Phß Yes Tyr Ser Phß Phe Val He Arg Asn 575 560 585 ALa Lys Val Ato? U cya l ie 590 59? (2) I NFORMATION FOR S EC. FROM I D. NO: 1 5 (i) CHARACTERISTICS OF SEC U ENC IA: (A) ITU LONG D: 1 899 (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 15 GGG 5 AAA GCC AGC AAG GAA OTA GG? GAG AGC CGG GC? GGC GGG GCG GGG 4 * TTG GAT TGG GAG C? G TGG GG GGA TGC AGA AGA GGA GTG GGA GGG 93 ATG. GAG GGC GCA GTG GUCA GGC GTG AGG AGG CGT AAC GBG GCG GAG 136 Met Glu Gly Wing Val Gly Gly Val Arg Arg Arg Asn Gly AU Glu 5 10 15 GAA AGG AG? AAA GGG CGC TGG CGC TCG GCG GGA GGA AGT GCT AGA 183 Glu Arg Arg Lya Gly Arg Trp Gly Ser Wing Gly GLy 5cr Wing Arg 20 25 30 GCT CTC GAC TCT CCG CTG CGC GGC AGC TGG CGG GGG GAG CAG CCA 228 Wing Lau A $ p Ser Pro Leu Arg Gly Sar Trp Arg Gty Glu Gln Pro 25 40 4 & GGT GAG CCC AAC ATG CTG CTG CCC TCG AAG CCT CCG CTG CCG CCG rn cly Gl? Pro and * Ht > r Lou Leu? rg Ser Lys Pro A Leu Pro Pro 50 55 60 CCG CTC ATG CTG CTG CTC CTG GGG CCG CTG GGT CCC CTc TCC CCT 3ia Pro Leu Het Leu Leu Leu Leu fily Pro Leu Gly Pro Leu Ser Pro 65 70 75 GGC CCC CTC CCC CGA CCT GCG CA CA GAC CAG GAC GTc OTO QAC CTG 363 Gl AU n Pro Arg Pro Ala Gln Ala ni? \ Asp Val Val As í.iru 80 «5? 0 CAC Tic TTC ACC CAG GAG CCC CTC CAC CTC CTG AGC CCC TCG TTC 06 Asp Phr Phe Thr Glrx í? Li. Pro leu Hi * l your Val Ser r Ser Phtt 9V IDO 105 CTC TCC C1C ACC ATT GAC GCC AAC CTD Gl ACC G? C CCC MC TTC 453 IX Leu Ser Vol Thr Ue Asp Wing Asn Leu Wing Thr Asp Pro Arg Phe 110 11S 120 CTC ATC CTC CTG GGT TCT CCA AAG CTT C6T ACC TTG CCC ABA GGC 49d Leu Uc Leu lau Gty Ser Pro Lys Leu Arg Thr L u Alo Ar. Cly 125 130 155 TTC TCT CCT QCG TAC CTQ? GG TTT GST «GC ACC AAG ACÁ CAC TTC S43 Leu Ser Pro Wing I read, Arg Che Gly Gly Thl 'Lys Thr Asp Phe UO US SO CTA? TT TTC GAT CCC AAG AAC CA TCA ACC TTT GAA «AG AOA AGÍ 589 Leu lie Phß Asp Pro Lys Lys CLu sar rhr Pho Clu £ (u Are S * r 1SS 160 165 TAC TGG CAT TCT CAÁ CTC? AC CAS GAT ATT TGC AAA TAT GCA TCC 633 Tyr Irp Cln Ser Gtn Val Aßn 6ln Asp ilis cya Lys Tyr Gly Ser 170 173 1ß0 ATC C CCT CAT GTR GAG GAG AAG TTA CGG TTG G? A TGG CCC TAC 67ti He Pro Pro Asp Vai Glu Glu Lya Leu Arg Leu Qlu Trp Pro Tyr 185 190 195 C? G GAS CAA TTG CTA CTC CCA GAA CAC TAC CAI AAA AAG TTC AAG 723 Glit Glu Glp Leu Leu Leu Arg G i Hit Tyr Gln Lys Lys Phs Ly. 200 205 210 A? C «CC ACC TAC ICA AG? AGC TCT GTA'CAT GTG CTA TAC ACI TTT 768 Asn Ser Rlir Tyr Ser Arg Ser Se V? I Asp Vl Leu Tyr Thr plie 215 220 225 GCA MC X6C T? GG? C1G GAC VO ATC ITT CCC CTA ?? T ßCi TTA 813 Wing Acn Cys Ser Gly Leu Asp lev U? Plie Gly Leu Asn Al »Leu 239 235 240 ?? AGA ACÁ «c * OAG TTG CAG GOI AAC AGT TCT AAT GCT CAG TTC that Leu Arg hr Ala? Sp Leu Glrf Trp Asn Ser Ser Asn Ais Oln Leu 245 250 255 CTC CTC CAC TAC TßC TCT TCC AAC GG? T? T A? C ATI TCT TOG d? A 903 Leu Leu Atp lyr cys ser Ser Lys cly Tyr Aen He Ser Trp Glu 260 265 270 CTA GCC AAT GAA CCT AAC AOT TTC CTT ?? O AAQ OCT 8AT ATT TTC 948 Leu Gly Asr. Glu Pro Asn Ser Pha Leu Ly. ly * Ala Asp Ue Phe 275 2SD 235 ATC AAT GGG TCG CAG TTA OCA GAA GAT TAT ATT CAA TTG CAT AAA 993 [le Aírt Gty Ser Oln Leu Gly Qlti Asp Tyr ll «G (n eu Hfs Lys 290 29S 300 CTT CTA ABA AA. TCC ACC TTC AAA AAr fiCA AAA CTC TAT «ST CCT 1IB8 Lau Leu Arg Lys Ser ITir Phß Lyß Asn Ala. Lyß Leu lyr? Ly Pro 305 310 315 GAT GIT &3T CAG CCT CSA AGA AAG ACG GCT AAG ATG CTG AAQ AGC 1083 Asp Val Gly - One Pro Arg Arg L / S Thr ALa Lys Hßt LaU lys Ser 320 325 330 TTC CTG AAG GCT OG! GGA GAA GTG ATT GAT TCA GTT ACÁ TG. CAI 1128 Phe lsu lys Ala Cly oly Glu Val He Asp Ser Val Thr Trp Hl. 335 340 345 C? C TAC TAT TTG AAT GS? CGC ACT CCT ACC? GG GAA GAT TTT CT? 117 * 5 Hli Tyr lyr Leu Asn Gly Arg Thr Ala lhr Are Glu Atp Phe Leu 150 555 360 C CCI G? T G? A TTG? AC AI1 TTI ATT TCA 1CT GTG CA * AAA GTT 1218 Asn Pro Ap Val Leu A «μ He Phe He Ser Ser Vol? Lr > Lys Val 365 370 375 TTC CAC CTG? TG CAO ACC AC. be CCT GGC? »to AAG GTC TGG TTA 1? -»? phr Gln val Val Clu Without Thr? rg Pro Gly Ly- Lys Vil Trp Leu TSO 385? VO GCA GAA AC AGC TCT GCA TAT «QA GGC CGA GCC CCC TTC CTA ICC 130B Gly Clu rhr Ser S # f AU Tyr« lyty Gty AL * ro l «UL * U Mr 395 400 405 GAC ACC TTT GCA GCT GGC TTT ATG TGSE CT «GAT AAA TTG GGC CTG 1353 Atp Thr Phe Al * Al * Gly Ph * Kat Trp Leu Aftp Uyt Leu Gly Leu 410 415 20 TCA GCC CGA ATG GGA AT? ~ «?? GTG OTO ATG A6G CAÁ fiTA TTC TTT T3f > 8 S «r A Arg Ket Gly l ie C-lu Val Val Hßt Are Qln Ve l Ph * The 4» 430 43? OSA GC? GGA AAC TAC C / T IT? CTG C? 7 GAA A? C TTC C? T CCT TlA «3 Gl? Al * Gly Asn Tyr His Leu Val Asp Glu? ÍD l'hc Asp Pro L * u 4 O 445 450 CCT CAT TA7 TCC CTA TCT CTI CTG TTC ?? ß AAA TTG GTG GGC ACC 1488 Pr < ? Asp Tyr Trp Leu Ser Leu Leu Phe ly * Ly »l eu Val G ly Thr 455 460 465 AAG GTG TTA A1G GCA AGC GTG CAA GC! TCA AAG AGA THERE AAG CTT 1533 lys Val Leu Net Al * s r Val Gln Gly 5tr Ly * Arg Arg lyß Leu 470 475 460 CGA CTA TAC CTT CAT T € C ACA AAC ACT GAC AAT CCA AGC TAT AAA 157? Aro Val Tyr Leu Hi * Cys Thr Aon Thr Aip A «n Pro Ar. Tyr lys. 465 490 9 * GAA GCA GAT TTA ACT CTG TAT GCC AlA AAC CTC CAT AAC GTC ACK 1623 Gtu ely Asp Leu Thr Leu Tyr Ata l («Asp Leu My Asn Val Thrr 500 505 SIO AAG TAC TTG CGG TTA CCC TAT CCT TTT TCT AAC AAC CAA GTG GAT 166B ys Fyr Leu Are eu ro Tyr Pro- Phe $ cr Asa ly * Cln Vol? Ip 515 520 S25 AAA TAC CTr CTA AGA CCT TTG GGA CCT CAT GGA TT? CT1 TCC AAA 1713 L c Tyr eu Leu Ara pro Leu Gty Pro Hi? Gty Leu Leu Ser Lys 530 535 540 TCI GTC CAQ CTC AAT G5T CTA ACT CTA A? G ATO GTG GAT CAT CAA 175fi $ r Val Glri Leu Attl Gly Leu Thr l. «U Lyß Hßt Val A« p Asp Sin 545 590 SS5 ACC TTG CCA CCT TTA ATO 6AA AAA CCT CTC CGG CCA GGA AßT TCA 1803 Thr Leu Pro pro Leu Het Glu Ly »Pro Leu Are, Pro GLy Ser Ser 560 565 370 CTG GGC TTG CCA ßCT TTC TCA TAT AGT TTT TTT «Tß ATA ACÁ AAT IC4B L« U Gly Leu Pro Ata Phe Ser Tyr Ser Phe Phe Val II * Are Aan 575 5ß0 Sß5 ' GCC AAA GTT GCT CCT TOC ATC TOA AAA TAA AAT ATA CTA GTC CTG 1BM AL * Lys Val? L * Ala Cys I Le 593 592 AC CTC IBM (2) INFORMATION FOR SEC. ID. NO: 16 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 594 (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 16 ATTACTAIAG GGCA? CCOTÜ GTCGACGGCC CGßacTGGi GTOTCTTAAI G? G? AGT7GA 60 T? / I CA? 7 r rcGdT? OTit. AGCTCT? CC AQCTQCAGFT GAGCOTATGC TGAGÍCCAGA «O TT? TTCAGG CAAAACTAAA ATACCTSAGA A? CtGCCTGC CCAGAGGACA ATCACATlTT 1? 0 GGCTGGCTC? AGI'GACAADC AAGGGTITAT AAGCTAG? TC ÚSAG? GGAAG GGATGA AC 240 TCCATTGGAG CCrTTACTCG AGGQTCAGAG GGA1ACCCGC CGCC? TCU-A ATÜGCATCrG 3011 GCAGTCGG ?? AcocrcCT CCCACGAGAG CGCGCAGAAC ACGGCCGGCA aCAAGCGg 560 TCCMGATGC GX? CCGCTGC TCC CGCQCG TCCICCCCG QGCGCTCCTC C CAGGceTC 420 CCGGGCGCTT GGATCCCGCC CATCTCCGCA CCCTTCAACT GGGrGTGGGT GATfTCGTAA 4β) G1CAACGIGA CCGCCACCCG GCGGAAAGCC AGCAACDAAG TAGGAG? GACJ CCGGQCAGGC MO GGGGCGGGGT T & GATTGGGA GC? GTGGGAC GGArGCAGAA CAGOAGTCGC AÚGf- «¿94 (2) INFORMATION FOR SEC. ID. NO: 17 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC. ID. NO: 17 CCCCAGGAGC AGCAGCATCA G 21 (2) INFORMATION FOR SEC. ID. NO: 18 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 18 AGGCTTCGAG CGCAGCAGCA T 21 (2) INFORMATION FOR SEC. ID. NO: 19 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC. ID. NO 19 GTAATACGAC TCACTATAGG GC 22 (2) INFORMATION FOR SEC. ID. NO: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF SEQUENCE: SEC. ID. DO NOT. 20 ACTATAGGGC ACGCGTGGT 19 (2) INFORMATION FOR SEC. ID. NO: 21 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 21 CTTGGGCTCA CCTGGCTGCT C 21 (2) INFORMATION FOR SEC. ID. NO: 22 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 22 AGCTCTGTAG ATGTGCTATA CAC 23 (2) INFORMATION FOR SEC. ID. NO: 23 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 (B) TYPE: nucleic acid (C) CHAIN FORM: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC. ID. NO: 23 GCATCTTAGC CGTCTTTCTT CG 22

Claims (58)

1. A polynucleotide fragment characterized in that it comprises a polynucleotide sequence encoding a polypeptide having a heparanase catalytic activity, wherein the polypeptide shares at least 70% homology with NOS IDENTITY SEQUENCES: 10 or 14, as determined using Failure parameters of a DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

2. The polynucleotide fragment according to claim 1, characterized in that the polynucleotide sequence includes nucleotides 63-1691 of the SEQUENCE OF IDENTITY NO: 9, or nucleotides 139-1869 of the SEQUENCE OF IDENTITY NO: 13.

3. The polynucleotide fragment according to claim 1, characterized in that the polynucleotide sequence includes nucleotides 63-721 of the SEQUENCE OF IDENTITY NO. 9.

4. The polynucleotide fragment according to claim 1, characterized in that the polynucleotide is as set forth in the NO. IDENTIFICATION SEQUENCES. 9 or 13

5. The polynucleotide fragment according to claim 1, characterized in that the polynucleotide sequence includes a segment of the IDENTITY SEQUENCES NOS: 9 or 13, the segment encoding the polypeptide having heparanase catalytic activity.

6. The polynucleotide fragment according to claim 1, characterized in that the polypeptide includes an amino acid sequence as set forth in NOS IDENTITY SEQUENCES. 10 or 14

7. The polynucleotide fragment according to claim 1, characterized in that the polypeptide includes a segment of the NOS IDENTITY SEQUENCES. 10 or 14, the segment hosts the heparanase catalytic activity.

8. The polynucleotide fragment according to claim 1, characterized in that the polynucleotide sequence is selected from the group consisting of double-stranded DNA, single-stranded DNA and RNA.

9. A fragment of polynucleotide comprising a polynucleotide sequence at least 70% homologous with the IDENTITY SEQUENCES NOS: 9 or 13, as determined ^ tfc. 'aií- ^ iSr-'S "ttt2. using the failure parameters of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin, such a polynucleotide sequence that encodes a polypeptide having heparanase catalytic activity.

10. The polynucleotide fragment according to claim 9, characterized in that the sequence of the polynucleotide is as set forth in IDENTITY SEQUENCES NOS: 9 or 13.

11. A vector comprising a polynucleotide sequence encoding a polypeptide having heparanase catalytic activity, wherein the polypeptide that shares at least 70% homology with NOS IDENTITY SEQUENCES: 10 or 14, as determined using the parameters of failure of a DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

12. The vector according to claim 11, characterized in that the sequence of the polynucleotide includes nucleotides 63-1691 of the SEQUENCE OF IDENTITY NO: 9, or nucleotides 139-1869 of the SEQUENCE OF IDENTITY NO: 13.

13. The vector according to claim 11, characterized in that the polynucleotide sequence includes nucleotides 63-721 of the SEQUENCE OF IDENTITY NO: 9.

14. The vector according to claim 11, characterized in that the polynucleotide sequence is as set forth in the NOS IDENTITY SEQUENCES. 9 or 13

15. The vector according to claim 11, characterized in that the polynucleotide sequence includes a segment of the IDENTITY SEQUENCES NOS: 9 or 13, the segment encoding the polypeptide having heparanase catalytic activity.

16. The vector according to claim 11, characterized in that the polypeptide includes an amino acid sequence as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

17. The vector according to claim 11, characterized in that the polypeptide includes a segment of the NOS IDENTITY SEQUENCES. 10 or 14, the segment hosts the catalytic activity of heparanase.

18. The vector according to claim 11, characterized in that the polynucleotide sequence is selected from the group consisting of double-stranded DNA, single-stranded DNA, and RNA.

19. The vector according to claim 11, characterized in that the vector is a baculovirus vector.

20. A vector comprising a polynucleotide sequence at least 70% homologous with the SEQUENCES OF IDENTITY NOS: 9 or 13, as determined using failure parameters of a DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin, the sequence of the polynucleotide encoding a polypeptide having catalytic activity of heparanase.

21. The vector according to claim 20, characterized in that the polynucleotide sequence is as set forth in IDENTITY SEQUENCES NOS: 9 or 13.

22. A host cell comprising an exogenous polynucleotide fragment that includes a polynucleotide sequence encoding a polypeptide having heparanase catalytic activity, wherein the polypeptide shares at least 70% homology with IDENTITY SEQUENCES NOS: 10 or 14, as determined using failure parameters of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

23. The host cell according to claim 22, characterized in that the polynucleotide sequence includes nucleotides 63-1691 of the SEQUENCE OF IDENTITY NO: 9 or nucleotides 139-1869 of the IDENTITY SEQUENCE NO: 13.

24. . The host cell according to claim 22, characterized in that the polynucleotide sequence includes nucleotides 63-721 of the SEQUENCE OF IDENTITY NO: 9.

25. The host cell according to claim 22, characterized in that the polynucleotide sequence is as set forth in the NOS IDENTITY SEQUENCES. 9 or 13

26. The host cell according to claim 22, characterized in that the polynucleotide sequence includes a segment of the IDENTITY SEQUENCES NOS: 9 or 13, the segment encoding the polypeptide having heparanase catalytic activity.

27. The host cell according to claim 22, characterized in that the polypeptide includes an amino acid sequence as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

28. The host cell according to claim 22, characterized in that the polypeptide includes a segment of the NOS IDENTITY SEQUENCES. 10 or 14, the segment hosts the catalytic activity of heparanase.

29. The host cell according to claim 22, characterized in that the polynucleotide sequence is selected from the group consisting of double-stranded DNA, single-stranded DNA, and RNA.

30. The host cell according to claim 22, characterized in that the cell is an insect cell.

31. A host cell comprising a polynucleotide sequence at least 70% homologous with IDENTITY SEQUENCES NOS: 9 or 13, as determined using failure parameters of a DNA sequence analysis software package developed by Genetic Computer Group ( GCG) at the University of Wisconsin, the polynucleotide sequence encoding a polypeptide having heparanase catalytic activity.

32. The host cell according to claim 31, characterized in that the polynucleotide sequence is as set forth in IDENTITY SEQUENCES NOS: 9 or 13.

33. A recombinant protein comprising a polypeptide having heparanase catalytic activity, the polypeptide shares at least 70% homology with IDENTITY SEQUENCES NOS: 10 or 14, as determined using the failure parameters of the analysis software package. DNA sequence developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

34. The recombinant protein according to claim 33, characterized in that the polypeptide includes a segment of the IDENTITY SEQUENCE NOS: 10 or 14.

35. The recombinant protein according to claim 33, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

36. An amino acid sequence as set forth in IDENTITY SEQUENCES NOS: 10 or 14.

37. A homologous amino acid sequence for IDENTITY SEQUENCES NOS: 10 or 14.

38. A pharmaceutical composition comprising, an active ingredient, a recombinant protein that includes a polypeptide having heparanase catalytic activity, the polypeptide shares at least 70% homology with NOS IDENTITY SEQUENCES: 10 or 14, as determined using the Failure parameters of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

39. The pharmaceutical composition according to claim 38, characterized in that the polypeptide includes a segment of the IDENTITY SEQUENCES NOS: 10 or 14.

40. The pharmaceutical composition according to claim 38, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14. , ... z.Zx-¿s s á Í-MSÍ ÍÍÍ;

41. A modulator of growth factors binding heparin, cellular responses to growth factors linking heparin and cytokines, cellular interaction with plasma lipoproteins, cellular susceptibility to viral, protozoal and bacterial infections or disintegration of neurodegenerative plaques comprising, as an active ingredient , a recombinant protein that includes a polypeptide having heparanase catalytic activity, the polypeptide shares at least 70% homology with IDENTITY SEQUENCES NOS: 10 or 14, as determined using the failure parameters of the analysis software package. DNA sequence developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

42. The modulator in accordance with the claim 41, characterized in that the polypeptide includes a segment of IDENTITY SEQUENCES NOS: 10 or 14.

43. The modulator according to claim 41, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

44. A medical team comprising a medical device that contains as an active ingredient, a recombinant protein that includes a polypeptide having heparanase catalytic activity, the polypeptide shares at least 70% homology with IDENTITY SEQUENCES NOS: 10 or 14, as determined using fault parameters of a DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

45. The medical equipment according to claim 44, characterized in that the polypeptide includes a segment of the IDENTITY SEQUENCES NOS: 10 or 14.

46. The medical equipment according to claim 44, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

47. A host cell expressing a recombinant heparanase, wherein the recombinant heparanase shares at least 70% homology with the IDENTITY SEQUENCES NOS: 10 or 14, as determined using the failure parameters of the sequence analysis software package. DNA developed by the Genetic Computer Group (GCG) at the University of Wisconsin. Hl

48. The host cell according to claim 47, characterized in that the polypeptide includes a segment of the NOS IDENTITY SEQUENCES: 10 or 14

49. The host cell according to claim 47, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

50. The host cell according to claim 47, characterized in that the cell is an insect cell.

51. A cell extract or conditioned cell media or a partially purified cellular extract or 15 conditioned cell media comprising an extract or means of the host cell of any of claims 22-32 and 47-50.

52. A heparanase inhibitor screening system, characterized in that it comprises the cell extract or conditioned cell media or the partially purified cell extract or cell media conditioned in accordance with claim 51. , -usases *, and.

53. The screening system for heparanase inhibitors, characterized in that it comprises the recombinant protein according to any of claims 33-35.

54. A heparanase overexpression system comprising a heparanase catalytic activity that overexpresses the cell, wherein the catalytic activity of heparanase is effected by a heparanase that shares at least 70% homology with NOS IDENTITY SEQUENCES. 10 or 14, as determined using the failure parameters of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin.

55. The system according to claim 54, characterized in that the polypeptide includes a segment of the IDENTITY SEQUENCES NOS: 10 or 14.

56. The system according to claim 54, characterized in that the polypeptide is as set forth in NOS IDENTIFICATION SEQUENCES: 10 or 14.

57. A method for identifying a chromosome region that hosts a heparanase gene in a disseminated chromosome comprising the steps of: (a) hybridizing the disseminated chromosome with a polynucleotide probe marked at least 70% homologous with the IDENTITY SEQUENCES NOS: 9 or 13 or a portion thereof, as determined using failure parameters of a DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the University of Wisconsin. (b) washing the chromosome disseminated thereby removing the excess from the unhybridized probe; and (c) searching for the signals associated with the hybridized labeled polynucleotide probe, wherein the detected signals are indicative of a chromosome region that hosts a heparanase gene.

58. A single-stranded polynucleotide fragment comprising a polynucleotide sequence to at least a portion of a polynucleotide strand defined by nucleotides 226 to 721 of SEQUENCE OF IDENTITY NO: 9.