MX2008002369A - Chemically modified short interfering nucleic acid molecules that mediate rna interference. - Google Patents

Abstract

The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC), including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules and are useful, for example, in providing compositions to prevent, inhibit, or reduce diseases, traits and conditions that are associated with gene expression or activity in a subject or organism.

Description

SHORT MOLECULES OF NUCLEIC ACIDS OF INTERFERENCE CHEMICALLY MODIFIED ACTORS OF MEDIATORS OF THE INTERFERENCE OF THE RIBONUCLEIC ACID This patent application is a continuation in part of the United States patent application No. 11 / 299,254, filed December 8, 2005, which is a continuation in part of United States patent application No. 11 / 234,730, filed on September 23, 2005, which is a continuation in part of United States patent application No. 11 / 205,646, filed August 17, 2005, which is a continuation in part of United States patent application No. 11 / 098,303, filed April 4, 2005, which is a continuation in part of United States patent application No. 10 / 923,536, filed August 20, 2004, which is a continuation in part of the international patent application No. PCT / US04 / 16390, filed May 24, 2004, which is a continuation in part of United States patent application No. 10 / 826,966, filed April 16, 2004, which is a continuation in part of the patent application of Es United States Patent No. 10 / 757,803, filed January 14, 2004, which is a continuation in part of United States patent application No. 10 / 720,448, filed on November 24, 2003, which is a continuation in part of the U.S. Patent Application No. 10 / 693,059, filed October 23, 2003, which is a continuation in part of United States patent application No. 10 / 444,853, filed May 23, 2003, which is a continuation in part of the international patent application nJ PCT / US03 / 05346, filed on February 20, 2003, and a continuation in part of the international patent application nJ PCT / US03 / 05028, filed on February 20, 2003, which Both claim the priority right of United States Provisional Patent Application No. 60 / 358,580 filed on February 20, 2002, United States Provisional Patent Application No. 60 / 363,124 filed on March 11, 2002, the application for patent provided United States Patent No. 60 / 386,782 filed June 6, 2002, United States Provisional Patent Application No. 60 / 406,784 filed August 29, 2002, United States Provisional Patent Application No. 60 / 408,378 filed on September 5, 2002, U.S. Provisional Patent Application No. 60 / 409,293 filed September 9, 2002, and U.S. Provisional Patent Application No. 60 / 440,129 filed January 15, 2003. This application for patent is also a continuation in part of the international patent application nJ PCT / US04 / 13456, filed on April 30, 2004, which is a continuation in part of the United States patent application nJ 10 / 780,447, filed 13 February 2004, which is a continuation in part of the United States patent application No. 10 / 427,160, filed on April 30, 2003, which is a continuation in part of the international patent application nJ. PCT / US02 / 15876 filed May 17, 2002, which claims the right of priority of United States Provisional Patent Application No. JJ 60 / 292,217, filed May 18, 2001, United States Provisional Patent Application nJ 60 / 362,016, filed March 6, 2002, U.S. Provisional Patent Application No. 60 / 306,883, filed July 20, 2001, and U.S. Provisional Patent Application No. 60/311, 865, filed on August 13, 2001. This patent application is also a continuation in part of the United States patent application No. 10 / 727,780 filed on December 3, 2003. This patent application is also a continuation in part of the application Patent No. PCT / US05 / 04270, filed February 9, 2005, which claims the right of priority of the United States provisional patent application No. 60/543, 480, filed on February 10, 2004. This patent application is also a partial continuation of United States patent application No. 11 / 353,630, filed on February 14, 2006, which claims the right of priority of the patent. United States Provisional Patent Application No. 60 / 652,787 filed February 14, 2005, United States Provisional Patent Application No. 60 / 678,531 filed May 6, 2005, United States Provisional Patent Application No. 60 / 703,946, filed July 29, 2005, and U.S. Provisional Patent Application No. 60 / 737,024, filed November 15, 2005. The present patent application claims the priority right of all patent applications filed with the patent. list, which are hereby incorporated by reference in their entirety, including the drawings.

FIELD OF THE INVENTION The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases, and conditions that respond to the modulation of gene expression and / or activity. The present invention also relates to compounds, compositions, and methods related to traits, diseases and conditions that respond to the modulation of the expression and / or activity of genes involved in the routes of gene expression or other cellular processes acting as mediators of the maintenance or development of said traits, diseases and conditions. Specifically, the invention relates to double-stranded nucleic acid molecules that include short nucleic acid molecules, such as short interfering nucleic acid (siNA) molecules, short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro -RNA (miRNA), and short hairpin RNA (shRNA) with the capacity to act as mediators of RNA interference (RNAi) against gene expression, including cocktails of said short nucleic acid molecules and lipid nanoparticle formulations (LNP) ) of said short nucleic acid molecules. The present invention also relates to short nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous microRNA (miRNA) (e.g., miRNA inhibitors) or Endogenous short interfering RNA (siRNA), (eg, siRNA inhibitors) or that may inhibit the function of RISC (eg, inhibitors of RISC), to modulate gene expression by interfering with the regulatory function of said endogenous RNAs or proteins associated with said endogenous RNAs (e.g., RISC), which include cocktails of said short nucleic acid molecules and lipid nanoparticle (LNP) formulations of said short nucleic acid molecules. Said short nucleic acid molecules are useful, for example, to provide compositions for preventing, inhibiting, or reducing various diseases, traits and conditions that are associated with gene expression or activity in a subject or organism.

BACKGROUND OF THE INVENTION The following is a description of the relevant technique related to RNAi. The description is provided solely for the understanding of the following invention. The summary is not an admission that any part of the work described below is prior art of the claimed invention. RNA interference refers to the process of silencing of posttranscriptional genes in animals mediated by short interfering RNAs (siRNA) (Zamore et al., 2000, Cell, 101, 25-33; Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999, Science, 286, 950-951; Lin et al., 1999, Nature, 402, 128-129; Sharp, 1999, Genes &Dev., 13: 139-141; and Strauss, 1999, Science, 286, 886). The corresponding process in plants (Heifetz et al., PCT International Patent Publication No. WO 99/61631) is usually referred to as posttranscriptional gene silencing or silencing of RNA and is also referred to as repression in fungi. It is believed that the process of posttranscriptional gene silencing is a cellular defense mechanism conserved evolutionarily to avoid the expression of exogenous genes and is usually shared by diverse flora and phyla (Fire et al., 1999, Trends genet., 15, 358). Said protection against exogenous gene expression may have evolved in response to the production of double-stranded RNAs (dsRNA) derived from a viral infection or from the random integration of transposon elements in a host genome by a cellular response that specifically destroys the RNA single-stranded homolog or viral genomic RNA. The presence of dsRNA in cells triggers the response of RNAi through a mechanism that has not yet been fully characterized. This mechanism seems to be different from other known mechanisms involving ribonucleases specific for double-stranded RNA, such as the response of interferons that causes dsRNA-mediated activation of protein kinase PKR and 2, 5'-oligoadenylate synthetase that causes excision not specific, mRNA for ribonuclease L (see, for example, United States patents NJ 6,107,094; 5,898,031; Clemens et al., 1997, J. Interferon & Cytokine Res., 17, 503-524; Adah et al., 2001, Curr. Med. Chem., 8, 1189). The presence of long dsRNA in the cells stimulates the activity of a ribonuclease enzyme III called Dicer (Bass, 2000, Cell, 101, 235; Zamore et al., 2000, Cell, 101, 25-33; et al., 2000, Nature, 404, 293). Dicer is involved in the processing of dsRNA by producing short stretches of dsRNA known as short interfering RNAs (siRNA) (Zamore et al., 2000, Cell, 101, 25-33; Bass, 2000, Cell, 101, 235; Berstein et al., 2001, Nature, 409, 363). Short interfering RNAs derived from Dicer activity are usually from about 21 to about 23 nucleotides in length and comprise double-stranded molecules of approximately 19 base pairs (Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al., 2001, Genes Dev., 15, 188). Dicer has also been implicated in the cleavage of short temporal RNAs of 21 and 22 nucleotides (stRNA) from the precursor RNA of conserved structure that are involved in the control of translation (Hutvagner et al., 2001, Science, 293, 834). . The RNAi response also has a complex of endonucleases, usually called RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNA having a sequence complementary to the non-coding strand of the double-stranded siRNA molecule. Cleavage of the target RNA occurs in the middle of the region complementary to the non-coding strand of the double-stranded siRNA molecule (Elbashir et al., 2001, Genes Dev., 15, 188). RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans Bahramian and Zarbl, 1999, Molecular and Cellular Biology, 19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mammalian systems. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494 and Tuschl et al., PCT International Patent Publication No. WO 01/75164, describe the RNAi induced by the introduction of synthetic double-stranded molecules of 21 nucleotides in cultured mammalian cells. which include human embryonic kidney cells and HeLa cells. Recent studies in Drosophila embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877 and Tuschl et al., PCT International Patent Publication No. WO 01/75164) have revealed certain requirements as to length, structure , chemical composition and sequence of the siRNAs that are essential to mediate an effective RNAi activity. These studies have shown that the double-stranded siRNA molecules of 21 nucleotides are more active when they contain dinucleotide plasters at the 3 'end. In addition, the complete substitution of one or both strands of siRNA with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides suppresses the RNAi activity, while it was demonstrated that the replacement of the hanging nucleotides of the 3 'end of siRNA with 2'-deoxy nuclei (2'-H) was tolerated. It was also shown that sequences with a single mismatch at the center of the double-stranded siRNA molecule suppresses RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5 'end of the siRNA leader sequence instead of the 3' end of the leader sequence (Elbashir et al., 2001, EMBO J., 20, 6877). Other studies have indicated that a 5'-phosphate in the complementary target strand of a double-stranded siRNA molecule is necessary for siRNA activity and that ATP is used to maintain the 5'-phosphate moiety in the siRNA (Nykanen et al., 2001, Cell, 107, 309). Studies have shown that replacement of the nucleotide pendant segments of the 3 'end of a double-stranded 21-meric siRNA molecule that has two nucleotide 3' overlays with deoxyribonucleotides does not have an adverse effect on the RNAi activity. It has been reported that the substitution of up to four nucleotides at each end of the siRNA with deoxyribonucleotides is well tolerated, whereas complete substitution with deoxyribonucleotides causes the lack of RNAi activity (Elbashir et al., 2001, EMBO J., 20, 6877 and Tuschl et al., PCT International Patent Publication No. WO 01/75164). In addition, Elbashir et al., Reference above, also report that replacement of siRNA with 2'-O-methyl nucleotides completely suppresses RNAi activity. Li et al., PCT International Patent Publication No. WO 00/44914, and Beach et al., PCT International Patent Publication No. WO 01/68836 suggest preliminarily that the siRNA may include modifications or in the phosphate-sugar backbone. or in the nucleoside to induce at least one of a nitrogen or sulfur heteroatom, however, neither of the two patent applications postulates to what extent such modifications would be tolerated in the siRNA molecules, nor does it provide any guidance or examples of said siRNA modified. Kreutzer et al., Canadian Patent Application No. 2,359,180, also disclose certain chemical modifications for use in dsRNA constructs to counteract the activation of PKR protein kinase dependent double-stranded RNA, specifically the 2'-amino or 2'-nucleotides. O-methyl, and the nucleotides that contain a methylene bridge in 2'-O or 4'-C. However, Kreutzer et al. Similarly provide no examples or guidance on the extent to which these modifications would be tolerated in dsRNA molecules. Parrish et al., 2000, Molecular Cell, 6, 1077-1087, analyzed certain chemical modifications directed to the unc-22 gene in C. elegans using long transcripts (>; 25 nt) of siRNA. The authors describe the introduction of thiophosphate residues in these siRNA transcripts by incorporating nucleotide analogs with thiophosphate with T7 and T3 RNA polymerase and observed that the RNAs with two bases modified with phosphorothioate also showed substantial decreases in efficacy as RNAi . In addition, Parrish et al. Reported that the modification with phosphorothioate of more than two residues greatly destabilized RNAs in vitro in such a way that interference activities could not be observed by assays. Id. At 1081. The authors also analyzed certain modifications at the 2 'position of the nucleotide sugar in the long transcripts of siRNA and found that substitution of ribonucleotides by deoxynucleotides produced a substantial decrease in interference activity, especially in the case of substitutions. from a uridine to thymine and / or cytidine to deoxycytidine. Id. In addition, the authors analyzed certain modifications of bases, which included the substitution in the coding and non-coding strands of the siRNA, 4-thiouracil, 5-bromouracil, 5-iodouracil and 3- (aminoalyl) uracil for uracil, and inosine by guanosine. Although it appeared that the replacement of 4-thiouracil and 5-bromouracil was tolerated, Parrish reported that inosine produced a substantial increase in interference activity when incorporated into either of the two strands. Parrish also reported that the incorporation of 5-iodouracil and 3- (aminoalyl) uracil in the non-coding strand caused a substantial decrease in RNAi activity as well. The use of longer dsRNAs has been described. For example, Beach et al., PCT International Patent Publication No. WO 01/68836, describe specific methods for attenuating gene expression using endogenously derived dsRNA. Tuschl et al., PCT International Patent Publication No. WO 01/75164, describe an in vitro Drosophila RNAi system and the use of siRNA-specific molecules for certain functional genomic applications and certain therapeutic applications; although Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be used to cure genetic diseases or a viral infection due to the danger of activating the response of interferons. Li et al., PCT International Patent Publication No. WO 00/44914, describe the use of long dsRNAs (141 bp-488 bp) of enzymatic synthesis or expressed from vectors to attenuate the expression of certain target genes. Zernicka-Goetz et al., PCT International Patent Publication No. WO 01/36646, describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain long dsRNAs (550 bp-714 bp) of enzymatic synthesis or expressed from of vectors. Fire et al., PCT International Patent Publication No. WO 99/32619, describe particular methods for introducing certain long dsRNA molecules into cells for use in the inhibition of gene expression in nematodes. Plaetinck et al., PCT International Patent Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype to a cell using specific long molecules of dsRNA. Mello et al., PCT International Patent Publication No. WO 01/29058, describe the identification of specific genes involved in RNAi mediated by dsRNA. Pachuck et al., PCT International Patent Publication No. WO 00/63364, disclose certain constructs of long dsRNAs (at least 200 nucleotides). Deschamps Depaillette et al., PCT International Patent Publication No. WO 99/07409, describe specific compositions constituted by particular dsRNA molecules combined with certain antiviral agents. Waterhouse et al., PCT International Patent Publication No. 99/53050 and 1998, PNAS, 95, 13959-13964, describe certain methods for decreasing the phenotypic expression of a nucleic acid in plant cells using certain dsRNAs. Driscoll and cois., PCT International Patent Publication No. WO 01/49844, describe specific constructs for the expression of DNA to be used to facilitate gene silencing in target organisms. Others have written about various RNAi systems and gene silencing. For example, Parrish et al., 2000, Molecular Cell, 6, 1077-1087, describe chemically modified dsRNA constructs directed to the unc-22 gene of C. elegans. Grossniklaus, PCT International Patent Publication No. WO 01/38551, describes certain methods for regulating gene expression of polycomb in plants using certain dsRNAs. Churikov et al., PCT International Patent Publication No. WO 01/42443, describe certain methods for modifying the genetic characteristics of an organism using certain dsRNAs. Cogoni et al., PCT International Patent Publication No. WO 01/53475, describe certain methods for isolating a Neurospora silencing gene and its uses. Reed et al., PCT International Patent Publication No. WO 01/68836, describe certain methods for gene silencing in plants. Honer et al., PCT International Patent Publication No. WO 01/70944, describe certain methods of screening drugs using transgenic nematodes as models of Parkinson's disease using certain dsRNAs. Deak et al., PCT International Patent Publication No. WO 01/72774, describe certain gene products derived from Drosophila that may be related to RNAi in Drosophila. Arndt et al., PCT International Patent Publication No. WO 01/92513 describe certain methods for mediating gene suppression through the use of factors that enhance RNAi. Tuschl et al., PCT International Patent Publication No. WO 02/44321, describe certain synthetic constructs of siRNA. Pachuk et al., PCT International Patent Publication No. WO 00/63364, and Satishchandran et al., PCT International Patent Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain long dsRNAs. (more than 250 bp) expressed in vectors. Echeverri et al., PCT International Patent Publication No. WO 02/38805, describe certain C. elegans genes identified by RNAi. Kreutzer et al., International Patent Publications NJ WO 02/055692, WO 02/055693, and EP 1144623 B1 describe certain methods for inhibiting gene expression using dsRNA. Graham et al., International Patent Publications No. WO 99/49029 and WO 01/70949, and AU 4037501 describe certain siRNA molecules expressed in vectors. Fire et al., US Pat. No. 6,506,559, describe certain methods for inhibiting gene expression in vitro using certain constructs of long dsRNAs (299 bp-1033 bp) that mediate the RNAi. Martínez et al., 2002, Cell, 110, 563-574, describe certain single-chain siRNA constructs, which include certain 5'-phosphorylated single-chain siRNAs that act as mediators of RNA interference in Hela cells. Harborth et al., 2003, Antisense & Nucleic Acid Drug Development, 13, 83-105, describe certain siRNA molecules chemically and structurally modified. Chiu and Rana 2003, RNA, 9, 1034-1048, describe certain siRNA molecules chemically and structurally modified. Woolf et al., PCT International Patent Publication No. WO 03/064626 and WO 03/064625 disclose certain chemically modified siRNA constructs. Hornung and cois. 2005, Nature Medicine, 11, 263-270, describe the potent specific induction of IFN-alpha sequence by short interfering RNA in plamacytoid dendritic cells through TLR7. Judge and cois, 2005, Nature Biotechnology, published oniine: on March 20, 2005, describe the sequence dependent stimulation of the mammalian innate immune response by synthetic siRNA. Yuki et al., PCT International Patent Publication No. WO 05/049821 and WO 04/048566, describe certain methods for designing short interfering RNA sequences and certain short interfering RNA sequences with optimized activity. Saigo et al., U.S. Patent Application Publication No. US20040539332, describe certain methods for designing oligonucleotide or polynucleotide sequences, including short interfering RNA sequences, to achieve RNA interference. Tei et al., PCT International Patent Publication No. WO 03/044188, describe certain methods for inhibiting the expression of a target gene, which comprise transfecting an individual cell, tissue or organism with a double-stranded polynucleotide comprising DNA and RNA having a nucleotide sequence substantially identical to at least one partial nucleotide sequence of the target gene. Mattick, 2005, Science, 309, 1527-1528; Claverie, 2005, Science, 309, 1529-1530; Sethupathy et al., 2006, RNA, 12, 192-197; and Czech, 2006 NEJM, 354, 11: 1194-1195; Hutvagner et al., US 20050227256, and Tuschl et al., US 20050182005, all describe non-coding molecules that can inhibit miRNA function by steric blocking and all are incorporated by reference in their entirety.

BRIEF DESCRIPTION OF THE INVENTION This invention relates to compounds, compositions, and methods useful for modulating the expression of genes, such as genes associated with the development or maintenance of diseases, traits and conditions that are related to gene expression or activity, by RNA interference ( RNAi), using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of one or more genes involved in the pathways of gene expression and / or activity by RNA interference (RNAi) using short nucleic acid molecules . In particular, the present invention features short nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) and methods that are used to modulate the expression of genes and / or other genes involved in the routes of gene expression and / or activity. The present invention also relates to short nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous microRNA (miRNA) (e.g., miRNA inhibitors) or Endogenous short interfering RNA (siRNA), (for example, siRNA inhibitors) or that can inhibit RISC function (for example, inhibitors of RISC), to modulate gene expression by interfering with the regulatory function of said endogenous RNAs or proteins associated with said endogenous RNAs (e.g., RISC). Said molecules are collectively referred to herein as RNAi inhibitors. A siNA or RNAi inhibitor of the invention can be unmodified or chemically modified. A siNA or RNAi inhibitor of the present invention can be chemically synthesized, expressed from a vector or synthesized enzymatically. The present invention also presents various chemically modified synthetic short interfering nucleic acid (siNA) molecules with the ability to modulate target expression or gene activity in cells by RNA interference (RNAi). The present invention also presents various short chemically modified synthetic nucleic acid (siNA) molecules capable of modulating the activity of RNAi in cells by interacting with miRNA, siRNA, or RISC, and therefore regulating by decreasing or inhibiting interference of RNA (RNAi), by inhibition of translation, or translational silencing in a cell or organism. The use of siNA and / or chemically modified RNAi inhibitors improves various properties of native siNA molecules and / or RNAi inhibitors through increased resistance to nuclease degradation in vivo and / or through improved cellular uptake . In addition, unlike previously published studies, the siNA molecules of the invention having multiple chemical modifications, including completely modified siNA, maintain their RNAi activity. Therefore, the applicant teaches in this document chemically modified siRNA (generally referred to herein as siNA) that maintains or enhances native siRNA activity. The siNA molecules of the present invention provide reagents and methods useful for a variety of therapeutic, prophylactic, veterinary, diagnostic, target validation, genomic discovery, genetic engineering and pharmacogenomics applications. In one embodiment, the invention features one or more siNA molecules and / or RNAi inhibitors and methods that independently or in combination modulate the expression of target genes that encode proteins, such as proteins that are associated with the maintenance and / or development of diseases. , traits, disorders, and / or conditions as described herein or known by other means in the art, such as genes encoding sequences comprising the sequences with the GenBank access nJ that is reflected in the provisional patent application US Pat. No. 60 / 363,124, USSN 10 / 923,536, and PCT / US03 / 05028 all of which are incorporated by reference herein, hereinafter generally referred to as "objective" sequences. The following description of the various aspects and embodiments of the invention is provided by reference to exemplary target genes referred to herein as "target genes". The present invention also relates to compounds, compositions, and methods related to traits, diseases and conditions that respond to the modulation of the expression and / or activity of genes involved in the routes of gene expression or other cellular processes acting as mediators of the maintenance or development of said traits, diseases and conditions. However, said reference is intended to be exemplary only and the various aspects and embodiments of the invention also relate to other genes expressing alternative target genes, such as target mutant genes, splice variants of target genes, target gene variants between species or between subjects, and other target route genes that are described herein or known by other means in the art. Such additional genes can be analyzed to determine target sites using the methods described herein for the target genes and exemplary sequences herein. Thus, the modulation and effects of said modulation of the other genes can be performed as described herein. In other words, the terms "target" and "target gene" as defined herein below and cited in the embodiments described, are intended to encompass the genes associated with the development and / or maintenance of diseases, traits and conditions of the present document, such as genes encoding polypeptides, regulatory polynucleotides (e.g., miRNA and siRNA), mutant genes and splice variants of genes, as well as other genes involved in the routes of gene expression and / or activity . Thus, each of the embodiments described herein with reference to the term "target" are applicable to all protein, peptide, polypeptide, and / or polynucleotide molecules encompassed by the term "target", as define that term in this document. Taken together, said target genes are also referred to herein as "target" sequences in general. In one embodiment, the invention features a composition comprising two or more different siNA molecules and / or RNAi inhibitors of the invention (eg, siNA, double-stranded molecule siNA, or multifunctional siNA or any combination thereof) directed to different polynucleotide targets, such as different regions of an RNA or target DNA (e.g., two different target sites as provided herein or any combination of objective or target routes) or both coding and non-coding targets. Said sets of siNA molecules can provide a greater therapeutic effect. In one embodiment, the invention features a set of two or more different siNA molecules of the invention (eg, siNA, siNA for double-stranded molecule formation, or multifunctional siNA or any combination thereof) having specificity for different polynucleotide targets , such as different target RNA or DNA regions (eg, two different target sites in the present document or any combination of objective or objective routes) or both coding and non-coding targets, wherein the set comprises siNA molecules directed to approximately 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different targets. Due to the potential for sequence variability in the genome between different organisms or different subjects, the selection of siNA molecules for broad therapeutic applications will likely involve the conserved regions of the gene. In one embodiment, the present invention relates to siNA molecules and / or RNAi inhibitors that target conserved regions of the genome or regions that are conserved between different targets. The siNA molecules and / or the RNAi inhibitors designed to target conserved regions of various targets allow efficient inhibition of the expression of target genes in various patient populations. In one embodiment, the invention features a double-stranded nucleic acid molecule, such as a siNA molecule, wherein one of the strands comprises a nucleotide sequence that is complementary to a predetermined nucleotide sequence in a target nucleic acid molecule, or a portion of it. The predetermined nucleotide sequence can be a target nucleotide sequence, such as a sequence that is described herein or known in the art. In another embodiment, the predetermined nucleotide sequence is an objective sequence or target route sequence as is known in the art. In one embodiment, the invention features a double stranded interference nucleic acid (siNA) molecule that downregulates the expression of a target gene or directs the cleavage of an objective RNA, wherein said siNA molecule comprises about 15 to approximately 28 base pairs. In one embodiment, the invention features a double stranded interference nucleic acid (siNA) molecule that directs the cleavage of a target RNA, wherein said siNA molecule comprises from about 15 to about 28 base pairs. In one embodiment, the invention features a short-stranded nucleic acid (siNA) double-stranded molecule that directs the cleavage of a target RNA by RNA interference (RNAi), wherein the siNA double-stranded molecule comprises a first strand and a second strand, each strand of the siNA molecule has from about 18 to about 28 (eg, about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28) nucleotides in length, the first strand of the siNA molecule comprises a nucleotide sequence having sufficient complementarity with the target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference, and the second strand of said siNA molecule comprises the sequence of nucleotides that is complementary to the first strand. In a specific embodiment, for example, each strand of the siNA molecule has from about 18 to about 27 nucleotides in length. In one embodiment, the invention features a short-stranded nucleic acid (siNA) double-stranded molecule that directs the cleavage of a target RNA by RNA interference (RNAi), wherein the siNA double-stranded molecule comprises a first strand and a second strand, each strand of the siNA molecule has from about 18 to about 23 (eg, about 18, 19, 20, 21, 22, 23) nucleotides in length, the first strand of the siNA molecule comprises a sequence of nucleotides that have sufficient complementarity with the target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference, and the second strand of said siNA molecule comprises the nucleotide sequence that is complementary to the first strand. In one embodiment, the invention features a short-acting nucleic acid (siNA) nucleic acid molecule synthesized chemically that directs the cleavage of a target RNA by RNA interference (RNAi), wherein each strand of the siNA molecule is from about 18 to about 28 nucleotides in length; and a strand of the siNA molecule comprises a nucleotide sequence having sufficient complementarity with the target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference. In one embodiment, the invention features a chemically synthesized double-stranded interference (nucleic acid) nucleic acid molecule (siNA) that directs the cleavage of a target RNA by RNA interference (RNAi), wherein each strand of the siNA molecule has approximately 18 to about 23 nucleotides in length; and a strand of the siNA molecule comprises a nucleotide sequence having sufficient complementarity with the target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference. In one embodiment, the invention features a siNA molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, for example, in which the target gene or RNA comprises a protein-coding sequence. In one embodiment, the invention features a siNA molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, for example, in which the target gene or RNA comprises a non-coding sequence or regulatory elements. involved in the expression of the target gene (for example, RNA, miRNA, stRNA etc. not coding). In one embodiment, a siNA of the invention is used to inhibit the expression of target genes or of a family of target genes, in which sequences of genes or gene families share homology between the sequences. Said homologous sequences can be identified as is known in the art, for example using sequence alignment. The siNA molecules can be designed to target said homologous sequences, for example using perfectly complementary sequences or incorporating non-canonical base pairs, for example mismatches and / or unstable base pairs, which can provide additional target sequences. In cases where mismatches are identified, non-canonical base pairs (eg, mismatches and / or unstable bases) can be used to generate siNA molecules that target more than one gene sequence. In a non-limiting example, non-canonical base pairs such as UU and CC base pairs are used to generate siNA molecules that have the ability to target sequences to differentiate between polynucleotide targets that share homology between the sequences. As such, an advantage of the use of the siNAs of the invention is that a single siNA can be designed that includes a nucleic acid sequence that is complementary to the nucleotide sequence conserved among the homologous genes. In this strategy, a single siNA can be used to inhibit the expression of more than one gene instead of using more than one siNA molecule to target the different genes. In one embodiment, the invention features a siNA molecule having RNAi activity against a target RNA (e.g., coding or non-coding RNA), wherein the siNA molecule comprises a sequence complementary to any RNA sequence, such as the sequences having the GenBank access nJ shown in PCT / US03 / 05028, the United States provisional patent application nJ 60 / 363,124, and / or USSN 10 / 923,536, all of which are incorporated by reference to this document. In another embodiment, the invention features a siNA molecule having RNAi activity against a target RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having a sequence encoding variants, for example other mutant genes that are know in the art that they are associated with the maintenance and / or development of diseases, traits, disorders, and / or conditions that are described herein or known by other means in the art. The chemical modifications shown in Table I or which are described by other means in the present document can be applied to any siNA construction of the invention. In another modality, a siNA molecule of the invention includes a nucleotide sequence that can interact with the nucleotide sequence of a target gene and thus act as a mediator of the silencing of the expression of the target gene, for example, in which the siNA mediates in the regulation of the expression of the target gene by cellular processes that modulate the structure of the chromatin or methylation patterns of the target gene and prevent the transcription of the target gene. In one embodiment, the siNA molecules of the invention are used to regulate by decreasing or inhibiting the expression of proteins that arise due to polymorphisms of the aplotypes that are associated with a trait, disease or condition of a subject or organism. The analysis of genes, or of protein or RNA levels, can be used to identify subjects with said polymorphisms or subjects at risk of developing the traits, conditions, or diseases described herein. These subjects can be subjected to treatment, for example, treatment with siNA molecules of the invention and any other composition useful in the treatment of diseases related to the expression of the target gene. As such, the analysis of protein or RNA levels can be used to determine the type of treatment and the course of treatment to treat a subject. The control of protein or RNA levels can be used to predict the outcome of treatment and to determine the efficacy of compounds and compositions that modulate the level and / or activity of certain proteins associated with a trait, disorder, condition, or disease. In one embodiment of the invention, a siNA molecule comprises a non-coding strand comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof encoding a target protein. The siNA further comprises a coding strand, wherein said coding strand comprises a nucleotide sequence of a target gene or a portion thereof. In another embodiment, a siNA molecule comprises a non-coding region comprising a nucleotide sequence that is complementary to a nucleotide sequence encoding a target protein or a portion thereof. The siNA molecule further comprises a coding region, wherein said coding region comprises a nucleotide sequence of a target gene or a portion thereof. In another embodiment, the invention features a siNA molecule comprising a nucleotide sequence, for example, a nucleotide sequence in the non-coding region of the siNA molecule that is complementary to a nucleotide sequence or sequence portion of a gene objective. In another embodiment, the invention features a siNA molecule comprising a region, e.g., the non-coding region of the siNA construct, complementary to a sequence comprising a sequence of a target gene or a portion thereof. In one embodiment, the coding region or coding strand of a siNA molecule of the invention is complementary to that portion of the non-coding region or non-coding strand of the siNA molecule that is complementary to a target polynucleotide sequence. In still another embodiment, the invention features a siNA molecule comprising a sequence, for example, the non-coding sequence of the siNA construct, complementary to a sequence or sequence portion comprising the sequence represented by the access nJ of GenBank shown in PCT / US03 / 05028, U.S. Provisional Patent Application No. 60 / 363,124, and / or USSN 10 / 923,536, all of which are incorporated by reference herein. The chemical modifications of Table I and which are described herein can be applied to any siNA construction of the invention. The LNP formulations described in Table IV can be applied to any siNA molecule or combination of siNA molecules herein. In one embodiment of the invention a siNA molecule comprises a non-coding strand having from about 15 to about 30 (e.g., approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides, in which the non-coding strand is complementary to an RNA sequence target or a portion thereof, and wherein said siNA further comprises a coding strand having from about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides, and wherein said coding strand and said non-coding strand are different nucleotide sequences where at least about 15 nucleotides of each strand are complementary to the other strand. In one embodiment, a siNA molecule of the invention (eg, a double-stranded nucleic acid molecule) comprises a non-coding (guiding) strand having from about 15 to about 30 (e.g., about 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides that are complementary to a target RNA sequence or a portion thereof. In one embodiment, at least 15 nucleotides (eg, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides) of an RNA sequence targets are complementary to the non-coding strand (leader) of a siNA molecule of the invention. In one embodiment, a siNA molecule of the invention (eg, a double-stranded nucleic acid molecule) comprises a coding (transient) strand having from about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides comprising a sequence of a target RNA or a portion thereof. In one embodiment, at least 15 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides of a sequence of Target RNAs comprise the coding (transient) strand of a siNA molecule of the invention. In another embodiment of the invention, a siNA molecule of the invention comprises a non-coding region having from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29 or 30) nucleotides, wherein the non-coding region is complementary to a target DNA sequence, and wherein said siNA further comprises a coding region having from about 15 to about 30. (for example, approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides, wherein said coding region and said non-coding region they are comprised in a linear molecule where the coding region comprises at least about 15 nucleotides that are complementary to the non-coding region.

In one embodiment, a siNA molecule of the invention has RNAi activity that modulates the expression of RNA encoded by a gene. Because genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of genes by selecting sequences that are shared among different targets or alternatively that are unique to a specific objective. Therefore, in one embodiment, the siNA molecule can be designed to target conserved regions of target polynucleotide sequences that exhibit homology between various gene variants so that they target a class of genes with a siNA molecule. Accordingly, in one embodiment, the siNA molecule of the invention modulates the expression of one or more isoforms of the target gene or its variants in a subject or organism. In another embodiment, the siNA molecule can be designed to target a sequence that is unique to a specific polynucleotide sequence (e.g., a single isoform of the target gene or single nucleotide polymorphism (SNP)) due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity. In one embodiment, the nucleic acid molecules of the invention that mediate the RNA silencing gene silencing response are double-stranded nucleic acid molecules. In another embodiment, the siNA molecules of the invention are comprised of double-stranded nucleic acid molecules containing from about 15 to about 30 base pairs between oligonucleotides comprising from about 15 to about 30 (e.g., about 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides. In yet another embodiment, the siNA molecules of the invention comprise double-stranded nucleic acid molecules with hanging ends of about 1 to about 3 (eg, about 1, 2 or 3) nucleotides, eg, about 21 nucleotides in double-stranded molecules with approximately 19 base pairs and mononucleotide, dinucleotide, or trinucleotide haircuts at the 3 'end. In yet another embodiment, the siNA molecules of the invention comprise double-stranded nucleic acid molecules with blunt ends, in which both ends are blunt or, alternatively where one end is blunt. In one embodiment, a double-stranded nucleic acid molecule (eg, siNA) comprises nucleotide or non-nucleotide overlays. By "drapery" is meant a terminal portion of the nucleotide sequence that does not have paired bases between the two strands of a double-stranded nucleic acid molecule (see for example Figures 5A-5C). In one embodiment, a double-stranded nucleic acid molecule of the invention may comprise nucleotide or non-nucleotide shells at the 3 'end of one or both strands of the double-stranded nucleic acid molecule. For example, a double-stranded nucleic acid molecule of the invention may comprise a nucleotide or non-nucleotide shell at the 3 'end of the leader strand or the strand / non-coding region, the 3' end of the strand or strand / region encoding, or both of the guide strand or strand / non-coding region as of the strand or strand / coding region of the double-stranded nucleic acid molecule. In another embodiment, the nucleotide overlay portion of a double-stranded nucleic acid molecule (siNA) of the invention comprises nucleotides with 2'-O-methyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'- deoxy-2'-fluoroarabino (FANA), 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, universal base, acyclic or with 5-C- methyl. In another embodiment, the non-nucleotide cuffing portion of a double-stranded nucleic acid molecule (siNA) of the invention comprises non-glyceryl nucleotides, abasic or inverted abiotic deoxy. In one embodiment, the nucleotides comprising the hanging portions of a double-stranded nucleic acid molecule (eg, siNA) of the invention correspond to the nucleotides comprising the target sequence of polynucleotides of the siNA molecule. Accordingly, in such embodiments, the nucleotides comprising the hanging portion of a siNA molecule of the invention comprise a sequence that is based on the target polynucleotide sequence in which the nucleotides comprising the hanging portion of the guide strand or the strand / non-coding region of a siNA molecule of the invention can be complementary to the nucleotides of the target sequence of polynucleotides and nucleotides comprising the hanging portion of the transient strand or the strand / coding region of a molecule of siNA of the invention which may comprise the nucleotides of the target polynucleotide sequence. Said nucleotide plasters comprise the sequence that would result from processing with Dicer a native dsRNA to produce siRNA. In one embodiment, the nucleotides comprising the hanging portion of a double-stranded nucleic acid molecule (eg, siNA) of the invention are complementary to the target polynucleotide sequence and optionally are chemically modified as described herein. As such, in one embodiment, the nucleotides comprising the hanging portion of the leader strand or strand / non-coding region of a siNA molecule of the invention can be complementary to the nucleotides of the target polynucleotide sequence, i.e. those positions of nucleotides in the target polynucleotide sequence that are complementary to the nucleotide positions of the leader nucleotides of the leader strand or strand / non-coding region of a siNA molecule. In another embodiment, the nucleotides comprising the hanging portion of the transient strand or strand / coding region of a siNA molecule of the invention may comprise the nucleotides of the sequence of polynucleotide overlays, ie those nucleotide positions of the sequence of target polynucleotides corresponding to the same nucleotide positions of the hanging nucleotides of the transient strand or strand / coding region of a siNA molecule. In one embodiment, the drapery comprises a drapery of two nucleotides (e.g., 3'-GA; 3'-GU; 3'-GG; 3'GC; 3'-CA; 3'-CU; 3'-CG; 3'CC; 3'-AU; 3'-UU; 3'-UG; 3'UC; 3'-AA; 3'-AU; 3'-AG; 3'-AC; 3'-TA; 3'-TU; 3'-TG; 3'-TC; 3'-in; 3'-UT; 3'-GT; 3'-CT) which is complementary to a portion of the target polynucleotide sequence. In one embodiment, the drapery comprises a draping of two nucleotides (eg, 3'-GA; 3'-GU; 3'-GG; 3'GC; 3'-CA; 3'-CU; 3'-CG; 3'CC; 3'-AU; 3'-UU; 3'-UG; 3'UC; 3'-AA; 3'-AU; 3'-AG; 3'-AC; 3'-TA; 3 ' -TU; 3'-TG; 3'-TC; 3'-en; 3'-UT; 3'-GT; 3'-CT) which is not complementary to a portion of the target polynucleotide sequence. In another embodiment, the nucleotides of the coating of a siNA molecule of the invention are 2'-O-methyl, 2'-deoxy-2'-fluoroarabino nucleotides, and / or 2'-deoxy-2'-nucleotides. fluoro. In another embodiment, the hanging nucleotides of a siNA molecule of the invention are 2'-O-methyl nucleotides in the case where the hanging nucleotides are nucleotides with purines and / or 2'-deoxy-2 nucleotides. '-fluoro or 2'-deoxy-2'-fluoroarabino nucleotides in the case where the hanging nucleotides are nucleotides with pyrimidines. In another embodiment, the purine nucleotide (when present) in a curtain of a siNA molecule of the invention is a 2'-O-methyl nucleotide. In another embodiment, the pyrimidine nucleotide (when present) in a curtain of a siNA molecule of the invention is a 2'-deoxy-2'-fluoro or 2'-deoxy-2'-fluoroarabino nucleotide. In one embodiment, the nucleotides comprising the hanging portion of a double-stranded nucleic acid molecule (eg, siNA) of the invention are not complementary to the target polynucleotide sequence and optionally are chemically modified as described herein. . In one embodiment, the drapery comprises a 3'-UU drapery that is not complementary to a portion of the target polynucleotide sequence. In another embodiment, the nucleotides comprising the suspension portion of a siNA molecule of the invention are 2'-O-methyl, 2'-deoxy-2'-fluoroarabino nucleotides, and / or 2'-deoxy nucleotides. -2'-fluoro. In one embodiment, the double-stranded nucleic molecule (eg, siNA) of the invention comprises a hanging of two or three nucleotides, in which the nucleotides of the curtains are the same or different. In one embodiment, the double-stranded nucleic molecule (e.g., siNA) of the invention comprises a two or three nucleotide skin, wherein the nucleotides of the skin are the same or different and in which one or more nucleotides of the skin are chemically modified in the base, sugar and / or phosphate skeleton. In one embodiment, the invention features one or more chemically modified siNA constructs having specificity for target nucleic acid molecules, such as DNA, or RNA encoding a protein or non-coding RNA associated with the expression of target genes. In one embodiment, the invention features an RNA-based siNA molecule (eg, a siNA comprising 2'-OH nucleotides) having specificity for nucleic acid molecules that include one or more chemical modifications as described in FIG. present document. Non-limiting examples of such chemical modifications include without limitation internucleotide bonds of phosphothioate, 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, 4'-thio ribonucleotides, 2'-nucleotides O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides (see for example USSN 10/981, 966 filed November 5, 2004, which is incorporated by reference to the present document), "universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, 2'-deoxy-2'-fluoroarabino (FANA, see for example Dowler et al., 2006, Nucleic Acid Research, 34, 1669-1675) and incorporation of terminal glyceryl and / or inverted deoxyabasic moieties. These chemical modifications, when used in various siNA constructs, (eg, RNA-based siNA constructs), they have been shown to preserve the RNAi activity in cells while at the same time increasing the serum stability of these compounds. In one embodiment, a siNA molecule of the invention comprises the chemical modifications described herein (eg, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, 4'-thio ribonucleotides, nucleotides of 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides, LNA) in the internal positions of the siNA molecule. By "internal position" is meant the paired base positions of a double-stranded siNA molecule. In one embodiment, a siNA molecule of the invention comprises modified nucleotides while maintaining the ability to mediate RNAi. The modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, toxicity, immune response, and / or bioavailability. For example, a siNA molecule of the invention can comprise modified nucleotides in a percentage of the total number of nucleotides present in the siNA molecule. As such, a siNA molecule of the invention may generally comprise from about 5% to about 100% modified nucleotides (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides). For example, in one embodiment, between about 5% and about 100% (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides) of the nucleotide positions in a siNA molecule of the invention comprise a modification of the nucleic acid sugar, such as a modification of 2'-sugar, for example, 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro, 2'-deoxy-2'-fluoroarabino nucleotides, 2'-O-methoxyethyl nucleotides, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides, or 2'-deoxy nucleotides. In another embodiment, between about 5% and about 100% (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides) of the nucleotide positions in a siNA molecule of the invention comprise a modification of the base of the nucleic acid, such as modifications of inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribotimine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), or propyne. In another embodiment, between about 5% and about 100% (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides) of the nucleotide positions in a siNA molecule of the invention comprise a modification in the skeleton of the nucleic acid, such as a modification of the backbone that Formula I has in the present document. In another embodiment, between about 5% and about 100% (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides) of the nucleotide positions in a siNA molecule of the invention comprise a modification in the sugar, base, or backbone of the nucleic acid or any combination thereof (eg, any combination of the sugar, base, skeletal or non-nucleic acid modifications herein). In a modality, a siNA molecule of the invention comprises at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% 85%, 90%, 95% or 100% of modified nucleotides. The actual percentage of the modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single-stranded, the percentage modification can be based on the total number of nucleotides present in the single-stranded siNA molecules. Likewise, if the siNA molecule is double-stranded, the percentage modification can be based on the total number of nucleotides present in the coding strand, in the non-coding strand, or both in the coding strand and in the non-coding strand. A siNA molecule of the invention may comprise modified nucleotides at various locations within the siNA molecule. In one embodiment, a double-stranded siNA molecule of the invention comprises modified nucleotides at the positions of paired internal bases within the siNA double-stranded molecule. For example, the internal positions may comprise positions of about 3 to about 19 nucleotides from the 5 'end of the strand or coding or non-coding region of a 21 nucleotide siNA double-stranded molecule having 19 base pairs and 3' overlays. of two nucleotides. In another embodiment, a double-stranded siNA molecule of the invention comprises modified nucleotides at the positions of unpaired internal bases or coatings of the siNA molecule. By "without paired bases" is meant that the nucleotides are not paired by bases between the coding strand or coding region and the non-coding strand or non-coding region or the siNA molecule. The hanging nucleotides may be complementary or paired by bases in a corresponding target polynucleotide sequence (see for example Figure 5C). For example, the hanging positions may comprise positions of about 20 to about 21 nucleotides from the 5 'end of the strand or coding or non-coding region of a 21-nucleotide siNA double-stranded molecule having 19 base pairs and 3-fold overlays. 'of two nucleotides. In another embodiment, a double-stranded siNA molecule of the invention comprises nucleotides modified at the terminal positions of the siNA molecule. For example, said terminal regions include the 3 'position, the 5' position, for the 3 'and 5' positions of the strand or coding and / or non-coding region of the siNA molecule. In another embodiment, a double-stranded siNA molecule of the invention comprises nucleotides modified in the internal paired positions, without paired bases or hanging regions and / or end regions or any combination thereof. One aspect of the invention features a double stranded interference nucleic acid (siNA) molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA. In one embodiment, the double-stranded siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is approximately 21 nucleotides in length. In one embodiment, the double-stranded siNA molecule does not contain any ribonucleotide. In another embodiment, the double-stranded siNA molecule comprises one or more ribonucleotides. In one embodiment, each strand of the siNA double-stranded molecule independently comprises from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29 or 30) nucleotides, wherein each strand comprises from about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides that are complementary to the nucleotides of the other strand. In one embodiment, one of the strands of the siNA double-stranded molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the target gene, and the second strand of the siNA double-stranded molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the target gene or to a portion thereof. In another embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, comprising a non-coding region, wherein the The non-coding region comprises a nucleotide sequence that is complementary to a nucleotide sequence of the target gene or a portion thereof, and a coding region, wherein the coding region comprises a nucleotide sequence substantially similar to the nucleotide sequence of the target gene or a portion of it. In one embodiment, the non-coding region and the coding region independently comprise from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides, wherein the non-coding region comprises from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides that are complementary to nucleotides of the coding region. In another embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, comprising a coding region and a non-coding region, wherein the non-coding region comprises a nucleotide sequence that is complementary to an RNA nucleotide sequence encoded by the target gene or a portion thereof and the coding region comprises a nucleotide sequence that is complementary to the non-coding region . In one embodiment, a siNA molecule of the invention comprises blunt ends, i.e., ends that do not include hanging nucleotides. For example, a siNA-molecule comprising modifications described herein (eg, comprising nucleotides having Formulas I-VII or constructs of siNA comprising "Estab 00" - "Estab 36" or "Estab. 3F "-" Estab 36F "(Table I) or any combination thereof) and / or any length that is described herein may comprise blunt ends or non-nucleotide ends under hanging. In one embodiment, any siNA molecule of the invention may comprise one or more blunt ends, i.e. where a blunt end does not have any nucleotide in a cuff. In one embodiment, the blunt-ended siNA molecule has a number of base pairs equal to the number of nucleotides present in each strand of the siNA molecule. In another embodiment, the siNA molecule comprises a blunt end, for example in which the 5 'end of the non-coding strand and the 3' end of the coding strand do not have nucleotides in place. In another example, the siNA molecule comprises a blunt end, for example, in which the 3 'end of the non-coding strand and the 5' end of the coding strand do not have nucleotides in hanging. In another example, a siNA molecule comprises blunt ends, for example, in which the 3 'end of the non-coding strand and the 5' end of the coding strand as well as the 5 'end of the non-coding strand and the 3 'end of the coding strand do not have nucleotides in hanging. A blunt-ended molecule of siNA may comprise, for example, from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29 or 30 nucleotides). Other nucleotides present in a blunt-ended siNA molecule can comprise, for example, mismatches, bumps, loops, or unstable base pairs to modulate the activity of the siNA molecule to mediate RNA interference. By "blunt ends" we want symmetrical or extreme ends of a double-stranded molecule of siNA that do not have nucleotides in hanging. The strands of a double-stranded molecule of siNA are aligned with each other without hanging nucleotides at the ends. For example, a blunt-ended siNA construct comprises nucleotides at the ends that are complementary between the coding and non-coding regions of the siNA molecule. In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, in which the siNA molecule is assembled from of two separate oligonucleotide fragments in which one fragment comprises the coding region and the second fragment comprises the non-coding region of the siNA molecule. The coding region can be connected to the non-coding region by a linker molecule, such as a polynucleotide linkage or a non-polynucleotide linkage. In one embodiment, a double-stranded nucleic acid molecule (e.g., siNA) of the invention comprises ribonucleotides at positions that maintain or enhance the activity of RNAi. In one embodiment, the ribonucleotides are present in the coding strand or coding region of the siNA molecule, which can provide RNAi activity by allowing cleavage of the coding strand or coding region by an enzyme within RISC (eg, ribonucleotides present in the position of the transient strand, the coding strand, or the cleavage of the coding region, such as position 9 of the transient strand of a double-stranded 19-base pair molecule, which is cleaved from the RISC by an AGO2 enzyme, see , for example, Matranga et al, 2005, Cell, 123: 1-114 and Rand et al, 2005, Cell, 123: 621-629). In another embodiment, one or more (eg, 1, 2, 3, 4 or 5) of the nucleotides of the 5 'end of the leader strand or of the guide region (also known as the non-coding strand or non-coding region) of the SiNA molecule are ribonucleotides. In one embodiment, a double-stranded nucleic acid molecule (e.g., siNA) of the invention comprises one or more ribonucleotides at positions of the passenger strand or transient region (also known as a coding strand or coding region) that allows cleavage of the strand. Passenger region or passenger region by an enzyme in the RISC complex, (for example, ribonucleotides present in a passenger-strand position, such as position 9 of the passenger strand of a double-stranded 19-base pair molecule that is cleaved in the RISC, see, for example, Matranga et al., 2005, Cell, 123: 1-114 and Rand et al., 2005, Cell, 123: 621-629). In one embodiment, a siNA molecule of the invention contains at least 2, 3, 4, 5, or more chemical modifications which may be the same or different. In one embodiment, a siNA molecule of the invention contains at least 2, 3, 4, 5, or more different chemical modifications. In one embodiment, a siNA molecule of the invention is a double-stranded short interfering nucleic acid (siNA), wherein the double-stranded nucleic acid molecule comprises from about 15 to about 30 (eg, about 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) base pairs, and in which one or more (for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) of the nucleotide positions in each strand of the siNA molecule comprises a chemical modification. In another embodiment, the siNA contains at least 2, 3, 4, 5, or more different chemical modifications. In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates the expression of a target gene or that directs the cleavage of an objective RNA, wherein the siNA molecule comprises about 15 at about 30 (for example about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) base pairs, and wherein each strand of the siNA molecule comprises one or more chemical modifications. In a modality, each strand of the siNA double-stranded molecule comprises at least two (eg, 2, 3, 4, 5, or more) different chemical modifications, eg, different modifications of nucleotides, sugars, bases or skeleton. In another embodiment, one of the strands of the siNA double-stranded molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion thereof, and the second strand of the siNA double-stranded molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the target gene. In another embodiment, one of the strands of the siNA double-stranded molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion thereof, and the second strand of the siNA double-stranded molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the target gene. In another embodiment, each strand of the siNA molecule comprises from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides, and each strand comprises at least about 15 to about 30 (for example about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides that are complementary to the nucleotides of the other strand. The target gene may comprise, for example, sequences referred to herein or incorporated herein by reference. The gene may comprise, for example, sequences named according to the GenBank accession number in the present document. In one embodiment, each strand of a siNA double-stranded molecule of the invention comprises a different chemical modification pattern, such as any modification pattern of "Estab 00" - "Estab 36" or "Estab 3F" - "Estab 36F" ( Table I) of this document or any combination thereof. Non-limiting examples of coding and non-coding strands of said siNA molecules having various modification patterns are shown in Table II and Figures 3A-3F and 4A-4F. In one embodiment, a siNA molecule of the invention does not comprise ribonucleotides. In another embodiment, a siNA molecule of the invention comprises one or more ribonucleotides (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more ribonucleotides). In one embodiment, a siNA molecule of the invention comprises a non-coding region comprising a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion thereof, and the siNA further comprises a coding region that it comprises a nucleotide sequence substantially similar to the nucleotide sequence of the target gene or a portion thereof. In another embodiment, the non-coding region and the coding region each comprise from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29 or 30) nucleotides and the non-coding region comprises at least about 15 to about 30 (for example about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides that are complementary to the nucleotides of the coding region. In one embodiment, each strand of the siNA double-stranded molecule comprises at least two (eg, 2, 3, 4, 5, or more) different chemical modifications, eg, different modifications of nucleotides, sugars, bases or backbone. The target gene may comprise, for example, sequences referred to herein or incorporated herein by reference. In another embodiment, the siNA is a double-stranded nucleic acid molecule, wherein each of the two strands of the siNA molecule independently comprises from about 15 to about 40 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides, and where one of the strands of the siNA molecule comprises at least about 15 (for example about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 or more) nucleotides that are complementary to the nucleic acid sequence of the target gene or a portion thereof. In one embodiment, a siNA molecule of the invention comprises a coding region and a non-coding region, wherein the non-coding region comprises a nucleotide sequence that is complementary to an RNA nucleotide sequence encoded by a target gene, or a portion thereof, and the coding region comprises a nucleotide sequence that is complementary to the non-coding region. In one embodiment, the siNA molecule is assembled from two different oligonucleotide fragments, wherein one fragment comprises the coding region and the second fragment comprises the non-coding region of the siNA molecule. In another embodiment, the coding region is connected to the non-coding region by a linker molecule. In another embodiment, the coding region is connected to the non-coding region by a linker molecule, such as a nucleotide or non-polynucleotide linkage. In one embodiment, each strand of the siNA double-stranded molecule comprises at least two (eg, 2, 3, 4, 5, or more) different chemical modifications, eg, different modifications of nucleotides, sugars, bases or backbone. The target gene may comprise, for example, sequences referred to herein or incorporated herein by reference. In one embodiment, a siNA molecule of the invention comprises one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more) modifications of 2'-deoxy-2'-fluoro pyrimidine (e.g., where one or more or all of the pyrimidine (e.g., U or C) positions of the siNA are modified with 2'-deoxy-2'-fluoro nucleotides). In one embodiment, modifications of 2'-deoxy-2'-fluoro pyrimidine are present in the coding strand. In one embodiment, modifications of 2'-deoxy-2'-fluoro pyrimidine are present in the non-coding strand. In one embodiment, modifications of 2'-deoxy-2'-fluoro pyrimidine are present in both the coding strand and the non-coding strand of the siNA molecule. In one embodiment, a siNA molecule of the invention comprises one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more) 2'-O-methyl purine modifications (eg, where one or more or all of the purine positions (eg, A or G) of the siNA are modified with 2 'nucleotides -O-methyl). In one embodiment, modifications of 2'-O-methyl purine are present in the coding strand. In one embodiment, modifications of 2'-O-methyl purine are present in the non-coding strand. In one embodiment, modifications of 2'-O-methyl purine are present in both the coding strand and the non-coding strand of the siNA molecule. In one embodiment, a siNA molecule of the invention comprises one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more) 2'-deoxy purine modifications (eg, where one or more or all of the purine positions (eg, A or G) of the siNA are modified with 2'-deoxy nucleotides) . In one embodiment, modifications of 2'-deoxy purine are present in the coding strand. In one embodiment, modifications of 2'-deoxy purine are present in the non-coding strand. In one embodiment, modifications of 2'-deoxy purine are present in both the coding strand and the non-coding strand of the siNA molecule. In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that down-retes the expression of a target gene or that directs the excision of a target RNA, comprising a coding region and a non-coding region, wherein the non-coding region comprises a nucleotide sequence that is complementary to an RNA nucleotide sequence encoded by the target gene or a portion thereof and the coding region comprises a nucleotide sequence that is complementary to the non-coding region and wherein the siNA molecule has one or more pyrimidine and / or purine nucleotides. In one embodiment, each strand of the siNA double-stranded molecule comprises at least two (eg, 2, 3, 4, 5, or more) different chemical modifications, eg, different modifications of nucleotides, sugars, bases or backbone. In one embodiment, the pyrimidine nucleotides in the coding region are 2'-O-methyl pyrimidine nucleotides or 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the coding region are 2 'nucleotides. -deoxy purine. In another embodiment, the pyrimidine nucleotides of the coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the coding region are 2'-O-methyl purine nucleotides. In another embodiment, the pyrimidine nucleotides of the coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the coding region are 2'-deoxy purine nucleotides. In one embodiment, the pyrimidine nucleotides of the non-coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides present in the non-coding region are 2'-O-methyl or 2'- nucleotides. deoxy purine. In another embodiment of any of the siNA molecules described above, any nucleotides present in a non-complementary region of the coding strand (e.g., overhang region) are 2'-deoxy region.

In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, in which the siNA molecule is assembled from of two separate oligonucleotide fragments wherein one fragment comprises the coding region and the second fragment comprises the non-coding region of the siNA molecule, and wherein the fragment comprising the coding region includes a terminal cap moiety at the 5 'end , the 3 'end, or both of the 5' and 3 'ends of the fragment. In one embodiment, the terminal cap moiety is an inverted deoxyabasic moiety or a glyceryl moiety. In one embodiment, each of the two fragments of the siNA molecule independently comprises from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29 or 30) nucleotides. In another embodiment, each of the two fragments of the siNA molecule independently comprises from about 15 to about 40 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39 or 40) nucleotides. In a non-limiting example, each of the two fragments of the siNA molecule comprises approximately 21 nucleotides. In one embodiment, the invention features a siNA molecule comprising at l one modified nucleotide, wherein the modified nucleotide is a 2'-deoxy-2'-fluoro, 2'-deoxy-2'-fluoroarabino nucleotide, nucleotide of 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy nucleotide or 2'-O-difluoromethoxy-ethoxy nucleotide or any other modified nucleoside / nucleotide described herein and in USSN 10 / 981, 966, presented November 5, 2004, which is incorporated by reference to this document. In one embodiment, the invention features a siNA molecule comprising at l two (eg, 2, 3, 4, 5, 6, 7, 8, 9J0, or more) modified nucleotides, wherein the modified nucleotide is selected of the group consisting of 2'-deoxy-2'-fluoro nucleotide, 2'-deoxy-2'-fluoroarabino nucleotide, 2'-O-trifluoromethyl nucleotide, 2'-O-ethyl-trifluoromethoxy nucleotide or nucleotide of 2'-O-difluoromethoxy-ethoxy or any other modified nucleoside / nucleotide that is described herein and in USSN 10/981, 966, filed November 5, 2004, which is incorporated by reference herein. The modified nucleotide / nucleoside may be the same or different. The siNA can be, for example, from about 15 to about 40 nucleotides in length. In one embodiment, all pyrimidine nucleotides present in the siNA are nucleotides of 2'-deoxy-2'-fluoro, 2'-deoxy-2'-fluoroarabino, 2'-O-trifluoromethyl, 2'-O-ethyl- trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy, 4'-thio pyrimidine. In one embodiment, the modified siNA nucleotides include at l one nucleotide of 2'-deoxy-2'-fluoro cytidine or 2'-deoxy-2'-fluoro uridine. In another embodiment, modified siNA nucleotides include at l one nucleotide of 2'-deoxy-2'-fluoro cytidine and at l one of 2'-deoxy-2'-fluoro uridine. In one embodiment, all of the uridine nucleotides present in the siNA are 2'-deoxy-2'-fluoro uridine nucleotides. In one embodiment, all of the cytidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro cytidine nucleotides. In one embodiment, all adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro adenosine nucleotides. In one embodiment, all of the guanosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro guanosine nucleotides. The siNA may further comprise at l one modified internucleotide linkage, such as a phosphorothioate linkage. In one embodiment, the 2'-deoxy-2'-fluoro nucleotides are present in specifically selected siNA sites that are sensitive to cleavage by ribonucls, such as locations that have pyrimidine nucleotides. In one embodiment, the invention features a method of increasing the stability of a siNA molecule against cleavage by ribonucleases comprising introducing at least one modified nucleotide into the siNA molecule, wherein the modified nucleotide is a 2 'nucleotide. -deoxy-2'-fluoro. In one embodiment, all pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In one embodiment, the modified siNA nucleotides include at least one nucleotide of 2'-deoxy-2'-fluoro cytidine or 2'-deoxy-2'-fluoro uridine. In another embodiment, the modified siNA nucleotides include at least one 2'-fluoro cytidine nucleotide and at least one of 2'-deoxy-2'-fluoro uridine. In one embodiment, all of the uridine nucleotides present in the siNA are 2'-deoxy-2'-fluoro uridine nucleotides. In one embodiment, all of the cytidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro cytidine nucleotides. In one embodiment, all adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro adenosine nucleotides. In one embodiment, all of the guanosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro guanosine nucleotides. The siNA may further comprise at least one modified internucleotide linkage, such as a phosphorothioate linkage. In one embodiment, the 2'-deoxy-2'-fluoro nucleotides are present in specifically selected siNA sites that are sensitive to cleavage by ribonucleases, such as locations that have pyrimidine nucleotides. In one embodiment, the invention features a method of increasing the stability of a siNA molecule against cleavage by ribonucleases comprising introducing at least one modified nucleotide into the siNA molecule, wherein the modified nucleotide is a 2 'nucleotide. -deoxy-2'-fluoroarabino. In one embodiment, all pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoroarabino pyrimidine nucleotides. In one embodiment, modified siNA nucleotides include at least one nucleotide of 2'-deoxy-2'-fluoroarabino cytidine or 2'-deoxy-2'-fluoro uridine. In another embodiment, modified siNA nucleotides include at least one 2'-fluoro cytidine nucleotide and at least one of 2'-deoxy-2'-fluoroarabino uridine. In one embodiment, all the uridine nucleotides present in the siNA are 2'-deoxy-2'-fluoroarabino uridine nucleotides. In one embodiment, all of the cytidine nucleotides present in the siNA are 2'-deoxy-2'-fluoroarabino cytidine nucleotides. In one embodiment, all adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoroarabino adenosine nucleotides. In one embodiment, all guanosine nucleotides present in the siNA are 2'-deoxy-2'-fluoroarabino guanosine nucleotides. The siNA may further comprise at least one modified internucleotide linkage, such as a phosphorothioate linkage. In one embodiment, the 2'-deoxy-2'-fluoroarabino nucleotides are present in specifically selected siNA sites that are sensitive to cleavage by ribonucleases, such as sites that have pyrimidine nucleotides. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that down-regulates the expression of a target gene or that directs cleavage of a target RNA, comprising a coding region and a non-coding region, wherein the non-coding region comprises a nucleotide sequence that is complementary to an RNA nucleotide sequence encoded by the target gene or a portion thereof and the coding region comprises a nucleotide sequence that is complementary to the non-coding region and wherein the purine nucleotides present in the non-coding region comprise 2'-deoxy-purine nucleotides. In an alternative modality, the purine nucleotides present in the non-coding region comprise 2'-O-methyl purine nucleotides. In any of the above embodiments, the non-coding region can comprise an internucleotide linkage of phosphorothioate at the 3 'end of the non-coding region.

Alternatively, in any of the above embodiments, the non-coding region may comprise a glyceryl modification at the 3 'end of the non-coding region. In another embodiment of any of the siNA molecules described above, any nucleotides present in a non-complementary region of the non-coding strand (e.g., overhang region) are 2'-deoxy region. In one embodiment, the non-coding region of a siNA molecule of the invention comprises a sequence complementary to a portion of an endogenous transcript having a unique sequence for an allele related to a particular disease or feature in a subject or organism, said sequence to a single nucleotide polymorphism (SNP) associated with the specific allele of the disease or trait. As such, the non-coding region of a siNA molecule of the invention may comprise a sequence complementary to sequences that are unique to a particular allele to provide specificity in the mediation of selective RNAi against the allele related to the disease, condition or trait. In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that down-regulates the expression of a target gene or that directs the cleavage of a target RNA, in which the siNA molecule is assembled from of two separate oligonucleotide fragments in which one fragment comprises the coding region and the second fragment comprises the non-coding region of the siNA molecule. In one embodiment, each strand of the siNA double-stranded molecule is approximately 21 nucleotides in length where approximately 19 nucleotides of each fragment of the siNA molecule are paired with the complementary nucleotides of the other fragment of the siNA molecule, wherein minus two nucleotides of the 3 'end of each fragment of the siNA molecule are not paired to the nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double-stranded nucleic acid molecule, where each strand is approximately 19 nucleotides long and where the nucleotides of each fragment of the siNA molecule are paired with the complementary nucleotides of the other fragment of the molecule of siNA forming at least about 15 (e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends. In one embodiment, each of the two nucleotides at the 3 'end of each fragment of the siNA molecule is a 2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymine. In one embodiment, each of the two nucleotides at the 3 'end of each fragment of the siNA molecule is a 2'-O-methyl pyrimidine nucleotide, such as a 2'-O-methyl uridine, cytidine or thymine. In another embodiment, all nucleotides of each fragment of the siNA molecule are paired with the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double-stranded nucleic acid molecule of about 19 to about 25 base pairs having a coding region and a non-coding region, wherein about 19 nucleotides of the non-coding region are paired with the sequence of nucleotides or with a portion thereof of the RNA encoded by the target gene. In another embodiment, approximately 21 nucleotides of the non-coding region are paired with the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In any of the above embodiments, the 5 'end of the fragment comprising said non-coding region optionally may include a phosphate group. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that inhibits the expression of a target RNA sequence., wherein the siNA molecule does not contain any ribonucleotide and wherein each strand of the siNA double-stranded molecule has from about 15 to about 30 nucleotides. In one embodiment, the siNA molecule is 21 nucleotides in length. Examples of siNA constructs that do not contain ribonucleotides are the combinations of the stabilization structures shown in Table I in any combination of coding / non-coding structures, such as Stab 7/8, Stab 7/11, Stab 8/8 , Estab 18/8, Estab 18/11, Estab 12/13, Estab 7/13, Estab 18/13, Estab 7/19, Estab 8/19, Estab 18/19, Estab 7/20, Estab 8/20 , Estab 18/20, Estab 7/32, Estab 8/32, or Estab 18/32 (for example, any siNA that has Estab 7, 8, 11, 12, 13, 14, 15, 17, 18, 19, 20 or 32 coding or non-coding strands or any combination thereof). In this document, the numerical Stab structures can include both 2'-fluoro and 2'-OCF3 versions of the structures shown in Table I. For example, "Estab 7/8" refers to both 7/8 as to Estab 7F / 8F etc. In one embodiment, the invention features a chemically synthesized double-stranded RNA molecule that directs the cleavage of a target RNA by RNA interference, wherein each strand of said RNA molecule is from about 15 to about 30 nucleotides in length; a strand of the RNA molecule comprises a nucleotide sequence having sufficient complementarity with the target RNA for the RNA molecule to direct the cleavage of the target RNA by RNA interference; and wherein at least one strand of the RNA molecule optionally comprises one or more chemically modified nucleotides that are described herein, such as without limitation the deoxynucleotides, 2'-O-methyl nucleotides, 2'-nucleotides, and deoxy-2'-fluoro, 2'-deoxy-2'-fluoroarabino nucleotides, 2'-O-methoxyethyl nucleotides, 4'-thio nucleotides, 2'-O-trifluoromethyl nucleotides, 2'-O nucleotides -ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy nucleotides, etc. or any combination thereof. In one embodiment, an objective RNA of the invention comprises a sequence encoding a protein. In one embodiment, the target RNA of the invention comprises a non-coding RNA sequence (eg, miRNA, snRNA, siRNA etc.), see for example Mattick, 2005, Science, 309, 1527-1528; Claverie, 2005, Science, 309, 1529-1530; Sethupathy et al., 2006, RNA, 12, 192-197; and Czech, 2006 NEJM, 354, 11: 1194-1195. In one embodiment, the invention features a medicament comprising a siNA molecule of the invention. In one embodiment, the invention features an active principle comprising a siNA molecule of the invention. In one embodiment, the invention features the use of a short-stranded nucleic acid (siNA) double-stranded molecule to inhibit, down-regulate, or reduce the expression of a target gene, wherein the siNA molecule comprises one or more modifications Chemicals and each strand of the double-stranded siNA is independently from about 15 to about 30 or more (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more) nucleotides in length. In one embodiment, the siNA molecule of the invention is a double-stranded nucleic acid molecule comprising one or more chemical modifications, wherein each of the two fragments of the siNA molecule independently comprises from about 15 to about 40 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39 or 40) nucleotides and wherein one of the strands comprises at least 15 nucleotides that are complementary to an RNA nucleotide sequence that encodes an objective or a portion thereof. In a non-limiting example, each of the two fragments of the siNA molecule comprises approximately 21 nucleotides. In another embodiment, the siNA molecule is a double-stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is approximately 21 nucleotides in length and where approximately 19 nucleotides of each fragment of the siNA molecule are paired with the nucleotides complementary to the other fragment of the siNA molecule, wherein at least two nucleotides of the 3 'end of each fragment of the siNA molecule are not paired to the nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double-stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is approximately 19 nucleotides in length and where the nucleotides of each fragment of the siNA molecule are paired with the nucleotides complementary to the other fragment of the siNA molecule forming at least about 15 (eg, 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends. In one embodiment, each of the two nucleotides at the 3 'end of each fragment of the siNA molecule is a 2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymine. In one embodiment, each of the two nucleotides at the 3 'end of each fragment of the siNA molecule is a 2'-O-methyl pyrimidine nucleotide, such as a 2'-O-methyl uridine, cytidine or thymine. In another embodiment, all nucleotides of each fragment of the siNA molecule are paired with the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double-stranded nucleic acid molecule of about 19 to about 25 base pairs having a coding region and comprising one or more chemical modifications and a non-coding region, wherein about 19 nucleotides of the region are not encoding are paired with the nucleotide sequence or with a portion thereof of the RNA encoded by the target gene. In another embodiment, approximately 21 nucleotides of the non-coding region are paired with the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In any of the above embodiments, the 5 'end of the fragment comprising said non-coding region optionally may include a phosphate group. In one embodiment, the invention features the use of a short-acting nucleic acid (siNA) double-stranded molecule that inhibits, down-regulates, or reduces the expression of a target gene, wherein one of the strands of the double-stranded molecule of siNA is a non-coding strand comprising a nucleotide sequence that is complementary to a target RNA nucleotide sequence or a portion thereof, the other strand is a coding strand comprising a nucleotide sequence that is complementary to a sequence of nucleotides of the non-coding strand. In one embodiment, each strand has at least two (eg, 2, 3, 4, 5, or more) chemical modifications, which may be the same or different, such as modifications of nucleotides, sugars, bases, or skeleton. In one embodiment, a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, a majority of the purine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that inhibits, down-regulates, or reduces the expression of a target gene, in which one of the strands of the siNA double-stranded molecule is a non-coding strand comprising a nucleotide sequence that is complementary to a target RNA nucleotide sequence or a portion thereof, wherein the other strand is a coding strand comprising a nucleotide sequence that is complementary to a sequence of nucleotides of the non-coding strand. In one embodiment, each strand has at least two (eg, 2, 3, 4, 5, or more) chemical modifications, which may be the same or different, such as modifications of nucleotides, sugars, bases, or skeleton. In one embodiment, a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, a majority of the purine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, the invention features a short-acting nucleic acid (siNA) double-stranded molecule that inhibits, down-regulates, or reduces the expression of a target gene, in which one of the strands of the siNA double-stranded molecule is a non-coding strand comprising a nucleotide sequence that is complementary to a target RNA nucleotide sequence that encodes a protein or portion thereof, the other strand is a coding strand comprising a nucleotide sequence that is complementary to a sequence of nucleotides of the non-coding strand and in which a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a modification in the sugar. In one embodiment, each strand of the siNA molecule comprises from about 15 to about 30 or more (e.g., approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more) nucleotides, wherein each strand comprises at least about 15 nucleotides that they are complementary to the nucleotides of the other strand. In one embodiment, the siNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the non-coding strand of the siNA molecule and a second fragment comprises the nucleotide sequence of the coding region of the siNA molecule. In one embodiment, the coding strand is connected to the non-coding strand by a linker molecule, such as a polynucleotide linkage or a non-polynucleotide linkage. In a further embodiment, the pyrimidine nucleotides present in the coding strand are 2'-deoxy-2'-fluoro-pyrimidine nucleotides and the purine nucleotides present in the coding region are 2'-deoxy-purine nucleotides. In a further embodiment, the pyrimidine nucleotides present in the coding strand are 2'-deoxy-2'-fluoro-pyrimidine nucleotides and the purine nucleotides present in the coding region are 2'-O-methyl purine nucleotides. In yet another embodiment, the pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine nucleotides present in the non-coding strand are 2'-deoxy purine nucleotides. In another embodiment, the non-coding strand comprises one or more nucleotides of 2'-deoxy-2'-fluoro-pyrimidine and one or more nucleotides of 2'-O-methyl purine. In another embodiment, the pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine nucleotides present in the non-coding strand are 2'-O-methyl purine nucleotides. In a further embodiment the coding strand comprises a 3 'end and a 5' end, in which a terminal cap moiety (eg, an inverted deoxyabasic moiety or inverted deoxy nucleotide moiety such as inverted thymine) is present at the 5 'end , the 3 'end, or both of the 5' and 3 'ends of the coding strand. In another embodiment, the non-coding strand comprises an internucleotide linkage of phosphorothioate at the 3 'end of the non-coding strand. In another embodiment, the non-coding strand comprises a glyceryl modification at the 3 'end. In another embodiment, the 5 'end of the non-coding strand optionally includes a phosphate group. In any of the embodiments described above of a short-stranded nucleic acid (siNA) double-stranded molecule that inhibits the expression of a target gene, wherein a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar, each of the two strands of the siNA molecule can comprise from about 15 to about 30 or more (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29 or 30 or more) nucleotides. In one embodiment, from about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more ) nucleotides of each strand of the siNA molecule are paired with the complementary nucleotides of the other strand of the siNA molecule. In another embodiment, from about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more ) nucleotides of each strand of the siNA molecule are paired with the complementary nucleotides of the other strand of the siNA molecule, in which at least two nucleotides of the 3 'end of each strand of the siNA molecule are not paired to the nucleotides of the other strand of the siNA molecule. In another embodiment, each of the two nucleotides at the 3 'end of each fragment of the siNA molecule is a 2'-deoxy-pyrimidine., such as 2'-deoxy-thymine. In one embodiment, each strand of the siNA molecule is paired to the complementary nucleotides of the other strand of the siNA molecule. In one embodiment, from about 15 to about 30 (for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides of the The non-coding strand is paired with the nucleotide sequence of the target RNA or a portion thereof. In one embodiment, from about 18 to about 25 (for example, about 18, 19, 20, 21, 22, 23, 24 or 25) nucleotides of the non-coding strand are paired with the nucleotide sequence of the target RNA or a portion thereof. Of the same. In one embodiment, the invention features a double stranded interference nucleic acid (siNA) molecule that inhibits the expression of a target gene, wherein one of the strands of the siNA double-stranded molecule is a non-coding strand comprising a sequence of nucleotides that is complementary to a nucleotide sequence of target RNA or to a portion thereof, the other strand is a coding strand comprising a nucleotide sequence that is complementary to a nucleotide sequence of the non-coding strand. In one embodiment, each strand has at least two (eg, 2, 3, 4, 5, or more) different chemical modifications, such as modifications of nucleotides, sugars, bases or skeleton. In one embodiment, a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, a majority of the purine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar. In one embodiment, the 5 'end of the non-coding strand optionally includes a phosphate group. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that inhibits the expression of a target gene, wherein one of the strands of the siNA double-stranded molecule is a non-coding strand comprising the sequence of nucleotides that is complementary to a nucleotide sequence of target RNA or to a portion thereof, the other strand is a coding strand comprising the nucleotide sequence which is complementary to a nucleotide sequence of the non-coding strand and in which a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar, and wherein the nucleotide sequence or a portion thereof of the non-coding strand is complementary to a nucleotide sequence of the region untranslated or a portion thereof of the target RNA. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) that inhibits the expression of a target gene, wherein one of the strands of the siNA double-stranded molecule is a non-coding strand comprising the sequence of nucleotides that is complementary to a nucleotide sequence of target RNA or a portion thereof, wherein the other strand is a coding strand comprising the nucleotide sequence that is complementary to a nucleotide sequence of the non-coding strand, wherein a majority of the pyrimidine nucleotides present in the siNA double-stranded molecule comprises a modification in the sugar, and wherein the nucleotide sequence of the non-coding strand is complementary to a nucleotide sequence of the target RNA or a portion thereof of the same one that is present in the target RNA.

In one embodiment, the invention features a composition comprising a siNA molecule of the invention and a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features two or more different siNA molecules of the invention (eg, siNA molecules that target different regions of the target RNA or siNA molecules that target the RNA of the SREBP1 pathway) and a pharmaceutically acceptable carrier or diluent. In a non-limiting example, the introduction of chemically modified nucleotides into the nucleic acid molecules provides a powerful tool for overcoming the potential limitations of in vivo stability and bioavailability inherent in native RNA molecules that are administered exogenously. For example, the use of chemically modified nucleic acid molecules may allow a lower dose of a particular nucleic acid molecule for a given therapeutic effect since the chemically modified nucleic acid molecules tend to have a longer half-life in serum. In addition, certain chemical modifications may improve the bioavailability of the nucleic acid molecules by targeting particular cells or tissues and / or enhancing the cellular uptake of the nucleic acid molecule. Therefore, even if the activity of a chemically modified nucleic acid molecule compared with that of a native nucleic acid molecule is reduced, for example, when compared to a nucleic acid molecule entirely formed by RNA, the overall activity of the modified nucleic acid molecule may be superior to that of the native molecule due to better stability and / or administration of the molecule. In contrast to the unmodified native siNA, the chemically modified siNA can also minimize the possibility of activating interferon activity or immunostimulation in humans. These properties therefore improve the capacity of the native siRNA or siRNA with minimal modifications to mediate the RNAi in various in vitro and in vivo environments, including use for both research and therapeutic applications. The applicant describes herein chemically modified siNA molecules with improved RNAi activity compared to unmodified or minimally modified siRNA molecules. The unmodified or minimally modified siNA motifs described herein provide the ability to maintain the RNAi activity that is substantially similar to unmodified or minimally modified siRNA (see for example Elbashir et al., 2001, EMBO J. , 20: 6877-6888) while at the same time providing resistance to nucleases and pharmacokinetic properties suitable for use in therapeutic applications. In any of the modalities of siNA molecules that are described herein, the non-coding region of a siNA molecule of the invention may comprise a phosphorothioate internucleotide linkage at the 3 'end of said non-coding region. In any of the embodiments of siNA molecules described herein, the non-coding region may comprise from about one to about five phosphothioate internucleotide linkages at the 5"end of said non-coding region. siNA molecules that are described herein, the nucleotide shells of the 3 'end of a siNA molecule of the invention may comprise ribonucleotides or deoxyribonucleotides that are chemically modified in a sugar, base, or nucleic acid backbone. In the embodiments of siNA molecules that are described herein, the nucleotide splices of the 3 'end may comprise one or more universal base ribonucleotides, in any of the modalities of siNA molecules described herein., the nucleotide plasters of the 3 'end may comprise one or more acyclic nucleotides. One embodiment of the invention provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention so as to allow expression of the nucleic acid molecule. Another embodiment of the invention provides a mammalian cell comprising said expression vector. The mammalian cell can be a human cell. The siNA molecule of the expression vector may comprise a coding region and a non-coding region. The non-coding region may comprise a sequence complementary to an RNA or DNA sequence encoding a target and the coding region may comprise a sequence complementary to the non-coding region. The siNA molecule can comprise two different strands that have complementary coding and non-coding regions. The siNA molecule may comprise a single strand having complementary coding and non-coding regions. In one embodiment, the invention features a short-acting nucleic acid (siNA) molecule chemically modified with the ability to mediate RNA interference (RNAi) within a cell or an in vitro reconstituted system, wherein the modification Chemistry comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising an internucleotide bond with modified backbone having Formula I: w wherein each R1 and R2 is independently any nucleotide, non-nucleotide, or polynucleotide which may be natural or chemically modified and which may be included in the structure of the siNA molecule or serve as the binding point to the siNA molecule, each X and Y is independently O, S, N, alkyl, or substituted alkyl, each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or acetyl and that W, X, Y, and Z are optionally not all O. In another embodiment, a modification of the backbone of the invention comprises an internucleotide linkage phosphonoacetate and / or thiophosphonoacetate (see for example Sheehan et al., 2003, Nucleic Acid Research , 31, 4109-4118). Chemically modified internucleotide bonds having the Formula I, for example, wherein any Z, W, X, and / or Y independently comprise a sulfur atom, may be present in one or both of the oligonucleotide strands of the siNA double-stranded molecule , for example, in the coding strand, the non-coding strand, or both strands. The siNA molecules of the invention may comprise one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically modified internucleotide linkages having Formula I in the 3 'end, the 5' end, or both 3 'and 5' ends of the coding strand, the non-coding strand, or both strands. For example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically modified internucleotide linkages having Formula I in the 5 'end of the coding strand, the non-coding strand, or both strands. In another non-limiting example, a siNA molecule of the exemplary invention may comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine nucleotides with chemically modified internucleotide linkages having the Formula I in the coding strand, the non-coding strand, or both strands. In yet another non-limiting example, a siNA molecule of the exemplary invention may comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides of purine with chemically modified internucleotide linkages having the Formula I in the coding strand, the non-coding strand, or both strands. In another embodiment, a siNA molecule of the invention having internucleotide linkage (s) of Formula I also comprises a chemically modified nucleotide or non-nucleotide having any of Formulas I-VI I. In one embodiment, the invention presents a short-acting nucleic acid (siNA) molecule chemically modified with the ability to mediate the interference of RNA (RNAi) within a cell or an in vitro reconstituted system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having the Formula I: wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCH3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, amino acid, aminoacyl, ONH2, O-aminoalkyl, O-amino acid, O- aminoacyl, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, or a group having any of Formulas I, II, III, IV, V, VI and / or VII, any of which may be included in the structure of the SiNA molecule or serve as a binding point to the siNA molecule; R9 is O, S, CH2, S = O, CHF, or CF2, and B is a nucleoside base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-natural base which may be complementary or non-complementary to a target RNA or a non-nucleoside base such as phenyl, naphthyl, -nitropyrrole, 5-nitroindole, nebularin, pyridone, pyridinone, or any other non-natural universal base which may be complementary or non-complementary to an objective RNA. In one embodiment, R3 and / or R7 comprise a conjugate moiety and a linker (e.g., a polynucleotide or non-polynucleotide linkage such as described herein or known by other means in the art). Non-limiting examples of conjugated moieties include ligands for cellular receptors, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; steroids, and polyamines, such as PEI, spermine or spermidine. In one embodiment, a nucleotide of the invention having Formula II is a 2'-deoxy-2'-fluoro nucleotide. In one embodiment, a nucleotide of the invention having Formula II is a 2'-O-methyl nucleotide. In one embodiment, a nucleotide of the invention having Formula II is a 2'-deoxy nucleotide. The nucleotide or non-nucleotide chemically modified from the Formula II may be present in one or both oligonucleotide strands of the siNA double-stranded molecule, for example in the coding strand, the non-coding strand, or both strands. The siNA molecules of the invention may comprise one or more chemically modified nucleotides or non-nucleotides of Formula II at the 3 'end, the 5' end, or both 3 'and 5' ends of the coding strand, the non-coding strand , or both threads. For example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (eg, about 1, 2, 3, 4, 5, or more) chemically modified nucleotides or non-nucleotides of Formula II in the 5 'end of the coding strand, the non-coding strand, or both strands. In another non-limiting example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (eg, about 1, 2, 3, 4, 5, or more) nucleotides or non-nucleotides chemically modified from the Formula II at the 3 'end of the coding strand, the non-coding strand, or both strands. In one embodiment, the invention features a short-acting nucleic acid (siNA) molecule chemically modified with the ability to mediate RNA interference (RNAi) within a cell or an in vitro reconstituted system, wherein the modification Chemistry comprises one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having the Formula II: wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCH3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, amino acid, aminoacyl, ONH2, O-aminoalkyl, O-amino acid, O- aminoacyl, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, or a group having any of Formulas I, II, III, IV, V, VI and / or VII, any of which may be included in the structure of the SiNA molecule or serve as a binding point to the siNA molecule; R9 is O, S, CH2, S = O, CHF, or CF2, and B is a nucleoside base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-natural base which can be used to be complementary or non-complementary to a target RNA or a non-nucleoside base such as phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularin, pyridone, pyridinone, or any other unnatural universal base which may be complementary or non-complementary to an objective RNA. In one embodiment, R3 and / or R7 comprise a conjugate moiety and a linker (e.g., a polynucleotide or non-polynucleotide linkage such as described herein or known by other means in the art). Non-limiting examples of conjugated moieties include ligands for cellular receptors, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; spheroids, and polyamines, such as PEI, spermine or spermidine. The chemically modified nucleotide or non-nucleotide of Formula III may be present in one or both of the oligonucleotide strands of the siNA double-stranded molecule, for example in the coding strand, the non-coding strand, or both strands. The siNA molecules of the invention may comprise one or more chemically modified nucleotides or non-nucleotides of Formula III at the 3 'end, the 5 'end, or both 3' and 5 'ends of the coding strand, the non-coding strand, or both strands. For example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) modified nucleotide (s) or non-nucleotide (s) (s) chemically of Formula III at the 5 'end of the coding strand, the non-coding strand, or both strands. In another non-limiting example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (eg, about 1, 2, 3, 4, 5, or more) nucleotides or non-nucleotides chemically modified from the Formula III at the 3 'end of the coding strand, the non-coding strand, or both strands. In another embodiment, a siNA molecule of the invention comprises a nucleotide having the Formula II or III, wherein the nucleotide having the Formula II or III is in an inverted configuration. For example, the nucleotide having the Formula II or III is connected to the siNA construct in a 3'-3 ', 3'-2', 2'-3 ', or 5'-5' configuration, such as the 3 'end, the 5' end, or both 3 'and 5' ends of one or both siNA strands. In one embodiment, the invention features a short-acting nucleic acid molecule (siNA) chemically modified with the ability to mediate RNA interference (RNAi) within a cell or in vitro reconstituted system, in which chemical modification it comprises a phosphate group at the 5 'end of Formula IV: wherein each X and Y is independently O, S, N, alkyl, substituted alkyl, or alkylhalo; wherein each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, alkylhalo, or acetyl; and wherein W, X, Y and Z are optionally not all O and Y acts as the point of attachment to the siNA molecule. In one embodiment, the invention features a siNA molecule having a phosphate group at the 5 'end having Formula IV in the complementary target strand, for example, a strand complementary to a target RNA, in which the siNA molecule it comprises a siNA molecule all of RNA. In another embodiment, the invention features a siNA molecule having a 5 'end phosphate group having Formula IV in the complementary target strand wherein the siNA molecule also comprises nucleotide shells of about 1 to about 3 (per example, about 1, 2 or 3) nucleotides at the 3 'end having from about 1 to about 4 (eg, about 1, 2, 3, 4) deoxyribonucleotides at the 3' end of one or both strands. In another embodiment, a phosphate group at the 5 'end having Formula IV is present in the objective complementary strand of a siNA molecule of the invention, for example a siNA molecule having chemical modifications having any of Formulas I -VI I. In one embodiment, the invention features a short-acting nucleic acid molecule (siNA) chemically modified with the ability to mediate the interference of RNA (RNAi) within a cell or system reconstituted in vitro, in the that the chemical modification comprises one or more internucleotide phosphothioate linkages. For example, in a non-limiting example, the invention features a short interfering nucleic acid (siNA) chemically modified having approximately 1, 2, 3, 4, 5, 6, 7, 8 or more internucleotide phosphothioate linkages in a strand. of the siNA. In still another embodiment, the invention features a chemically modified short interfering nucleic acid (siNA) that individually has about 1, 2, 3, 4, 5, 6, 7, 8 or more internucleotide phosphothioate linkages in both siNA strands. Phosphothioate internucleotide linkages may be present in one or both oligonucleotide strands of the siNA double-stranded molecule, for example in the coding strand, the non-coding strand, or both strands. The siNA molecules of the invention may comprise one or more internucleotide phosphothioate linkages at the 3 'end, the 5' end, or both 3 'and 5' ends of the coding strand, the non-coding strand, or both strands. For example, a siNA molecule of the exemplary invention may comprise from about 1 to about 5 or more (eg, about 1, 2, 3, 4, 5, or more) consecutive phosphothioate internucleotide linkages at the 5 'end of the coding strand, the non-coding strand, or both strands. In another non-limiting example, a siNA molecule of the exemplary invention may comprise one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) internucleotide linkages of pyrimidine phosphothioate in the coding strand, the non-coding strand, or both strands. In yet another non-limiting example, a siNA molecule of the exemplary invention may comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) internucleotide linkages of purine phosphothioate in the coding strand, the non-coding strand, or both strands. Each strand of the siNA double-stranded molecule can have one or more chemical modifications in such a way that each strand comprises a different pattern of chemical modifications. Various non-limiting examples of modification schemes that could give rise to different patterns of modifications are provided herein. In a modality, the invention features a siNA molecule, wherein the coding strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more internucleotide phosphothioate linkages , and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy -2'-fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy and / or about one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified nucleotides of universal bases, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the coding strand; and wherein the non-coding strand comprises from about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more internucleotide phosphothioate linkages, and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2 '-fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides of modified universal bases, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the strand non-coding In another embodiment, one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the coding and / or non-coding strand of siNA are modified chemically with nucleotides of 2'-deoxy, 2'-O-methyl, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or 2 ' -deoxy-2'-fluoro, one or more being present, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphothioate internucleotide bonds and / or a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends, in the same or a different strand. In another embodiment, the invention features a siNA molecule, wherein the coding strand comprises from about 1 to about 5, specifically about 1, 2, 3, 4, or 5 internucleotide phosphothioate linkages, and / or one or more (eg, about 1, 2, 3, 4, 5, or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, 2'-O-trifluoromethyl, 2 ' -O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (eg, about 1, 2, 3, 4, 5, or more) universal base nucleotides modified, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the coding strand; and wherein the non-coding strand comprises from about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more internucleotide phosphothioate linkages, and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, 2'-O-trifluoromethyl , 2'-0-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified universal base nucleotides, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the non-coding strand. In another embodiment, one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the coding and / or non-coding strand of siNA are modified chemically with 2'-deoxy, 2'-O-methyl, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or 2'-nucleotides -deoxy-2'-fluoro, from about 1 to about 5 or more, for example about 1, 2, 3, 4, 5 or more, internucleotide phosphothioate linkages and / or a terminal cap molecule at the 3 'end being present , the 5 'end, or both ends 3' and 5 ', in the same or a different thread. In one embodiment, the invention features a siNA molecule, wherein the non-coding strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and / or about one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl , 2'-deoxy-2'-fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides of universal modified bases, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both ends 'and 5' of the coding strand; and wherein the non-coding strand comprises from about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more internucleotide phosphothioate linkages, and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2 ' -fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (for example, about 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10 or more) nucleotides of modified universal bases, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the strand do not coding In another embodiment, one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the coding and / or non-coding strand of siNA are modified chemically with nucleotides of 2'-deoxy, 2'-O-methyl, 2J-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or 2'- deoxy-2'-fluoro, one or more being present, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, internucleotide bonds of phosphothioate and / or one molecule terminal cap at the 3 'end, the 5' end, or both 3 'and 5' ends, in the same or a different thread. In another embodiment, the invention features a siNA molecule, wherein the non-coding strand comprises from about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more internucleotide phosphothioate linkages, and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2 '-fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides of modified universal bases, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the strand coding and wherein the non-coding strand comprises from about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more internucleotide phosphothioate linkages, and / or one or more (eg, about 1). , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10 or more) modified universal base nucleotides, and optionally a terminal cap molecule at the 3 'end, the 5' end, or both 3 'and 5' ends of the non-coding strand. In another embodiment, one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the coding and / or non-coding strand of siNA are modified chemically with nucleotides of 2'-deoxy, 2'-O-methyl, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy, 4'-thio and / or 2 ' -deoxy-2'-fluoro, from about 1 to about 5, for example about 1, 2, 3, 4, 5 or more, internucleotide phosphothioate linkages and / or a terminal cap molecule at the 3 'end, the 5 'end, or both ends 3' and 5 ', in the same or a different thread. In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified having from about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or more) internucleotide linkages of phosphothioate in each strand of the siNA molecule. In another embodiment, the invention features a siNA molecule comprising 2'-5 'internucleotide linkages. The 2'-5 'internucleotide link (s) may be at the 3' end, the 5 'end, or both 3' and 5 'ends of one or both strands of the siNA sequence. In addition, the 2'-5 'internucleotide link (s) may be present in various different positions within one or both strands of the siNA sequence., for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including all the internucleotide linkages of a pyrimidine nucleotide in one or both strands of the siNA molecule may comprise an internucleotide link 2'-5 ', or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more that include all the internucleotide linkages of a purine nucleotide in one or both strands of the siNA molecule may comprise a 2'-5 'internucleotide linkage. In another embodiment, a chemically modified siNA molecule of the invention comprises a double-stranded molecule having two strands, one or both of which can be chemically modified, wherein each strand is independently from about 15 to about 30 (e.g. approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides in length, wherein the double-stranded molecule has from about 15 to about 30 (for example, approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) base pairs, and wherein the chemical modification comprises a structure having any of Formulas I-VI I. For example, an exemplary chemically modified siNA molecule of the invention comprises a double-stranded molecule having two strands, one or both of which may be chemically modified with a chemical modification having any of Formulas I-VII or any combination thereof, wherein each strand is constituted by approximately 21 nucleotides, each having 1 nucleotide ligation of 2 nucleotides at the 3 'end and in which the double-stranded molecule is approximately 19 base pairs. In another embodiment, a siNA molecule of the invention comprises a single-stranded hairpin structure, wherein the siNA has from about 36 to about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length ranging from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) base pairs, and wherein the siNA may include a chemical modification comprising a structure having any of Formulas I-VII or any combination thereof. For example, an exemplary chemically modified siNA molecule of the invention comprises a linear oligonucleotide having from about 42 to about 50 (eg, about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides which is chemically modified with a chemical modification having any of Formulas I-VII or any combination thereof, wherein the linear oligonucleotide forms a hairpin structure having from about 19 to about 21 (e.g., 19, 20 or 21) base pairs and a nucleotide ligation of 2 nucleotides at the 3 'end. In another embodiment, a linear hairpin siNA molecule of the invention contains a loop-in-stem motif, in which the loop portion of the siNA molecule is biodegradable. For example, a linear hairpin siNA molecule of the invention is designed in such a way that degradation of the loop portion of the siNA molecule in vivo can generate a double stranded siNA molecule with 3 'endcuts, such as nucleotide hangings at the 3 'end comprising approximately 2 nucleotides. In another embodiment, a siNA molecule of the invention comprises a hairpin structure, wherein the siNA has from about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides in length ranging from about 3 to about 25 (per example, approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) pairs of bases, and in which the siNA may include one or more chemical modifications comprising a structure having any of Formulas I-VII or any combination thereof. For example, an exemplary chemically modified siNA molecule of the invention comprises a linear oligonucleotide having from about 25 to about 35 (eg, about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides that is chemically modified with one or more chemical modifications having any of Formulas I-VII or any combination thereof, wherein the linear oligonucleotide forms a hairpin structure having from about 3 to about 25 ( for example, approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) base pairs and a phosphate group at the 5 'end which may be chemically modified as described herein (for example a phosphate group at the 5' end having the Formula IV). In another modality, a linear hairpin siNA molecule of the invention contains a loop-in-stem motif, in which the loop portion of the siNA molecule is biodegradable. In one embodiment, a linear hairpin siNA molecule of the invention comprises a loop portion comprising a non-polynucleotide linkage. In another embodiment, a siNA molecule of the invention comprises an asymmetric hairpin structure, wherein the siNA has from about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32 , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides in length ranging from about 3 to about 25 ( for example, approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) base pairs, and wherein the siNA may include one or more chemical modifications comprising a structure having any of Formulas I-VII or any combination thereof. For example, an exemplary chemically modified siNA molecule of the invention comprises a linear oligonucleotide having from about 25 to about 35 (eg, about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides that is chemically modified with one or more chemical modifications having any of Formulas I-VII or any combination thereof, wherein the linear oligonucleotide forms an asymmetric hairpin structure having from about 3 to about 25 (for example, approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 ) base pairs and a phosphate group at the 5 'end which may be chemically modified as described herein (for example a phosphate group at the 5' end having Formula IV). In another embodiment, a linear hairpin siNA molecule of the invention contains a loop-in-stem motif, in which the loop portion of the siNA molecule is biodegradable. In another embodiment, an asymmetric hairpin siNA molecule of the invention comprises a loop portion comprising a non-polynucleotide linkage.

In another embodiment, a siNA molecule of the invention comprises an asymmetric double-stranded structure having different polynucleotide strands comprising coding and non-coding regions, wherein the non-coding region has from about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides in length, wherein the coding region has from about 3 to about 25 (e.g. , approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) nucleotides of length, wherein the coding region and the non-coding region have at least 3 complementary nucleotides, and wherein the siNA may include one or more chemical modifications comprising a structure having any of the formulas l-VII or any combination of the same. For example, an exemplary chemically modified siNA molecule of the invention comprises an asymmetric double-stranded structure having different polynucleotide strands comprising coding and non-coding regions, wherein the non-coding region has from about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) nucleotides in length and wherein the coding region has from about 3 to about 15 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, or 15) nucleotides in length, wherein the coding region and the non-coding region have at least 3 complementary nucleotides, and wherein the siNA may include one or more chemical modifications comprising a structure having any of Formulas I-VII or any combination thereof. In another embodiment, the asymmetric siNA double-stranded molecule may also have a 5 'end phosphate group that may be chemically modified as described herein (eg a 5' end phosphate group having Formula IV ). In another embodiment, a siNA molecule of the invention comprises a circular nucleic acid molecule, wherein the siNA has from about 38 to about 70 (eg, about 38, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 ) base pairs, and wherein the siNA may include a chemical modification, comprising a structure having any of Formulas I-VII or any combination thereof. For example, an exemplary chemically modified siNA molecule of the invention comprises a circular oligonucleotide having from about 42 to about 50 (eg, about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides which is chemically modified with a chemical modification having any of Formulas I-VII or any combination thereof, wherein the circular oligonucleotide forms a weighted structure having approximately 19 base pairs and 2 loops. In another embodiment, a siNA dumbbell molecule of the invention contains two loop motifs, in which one or both loop portions of the siNA molecule is biodegradable. For example, a circular siNA molecule of the invention is designed in such a way that degradation of the loop portions of the siNA molecule in vivo can generate a double stranded siNA molecule with 3 'endcuts, such as nucleotide draperies. at the 3 'end comprising approximately 2 nucleotides. In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) abbasic moiety, e.g., a compound that has the Formula V: wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCH3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N- alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ON02, NO2, N3, NH2, aminoalkyl, amino acid, aminoacyl, ONH2, O-aminoalkyl, O-amino acid, O-aminoacyl, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, or a group having any of Formulas I, II, III, IV, V, VI and / or VII, any of which may be included in the structure of the siNA molecule or serve as a point of attachment to the siNA molecule; R9 is O, S, CH2, S = O, CHF, or CF2. In one embodiment, R3 and / or R7 comprise a conjugate moiety and a linker (e.g., a polynucleotide or non-polynucleotide linkage such as described herein or known by other means in the art). Non-limiting examples of conjugated moieties include ligands for cellular receptors, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; steroids, and polyamines, such as PEI, spermine or spermidine. In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) inverted abbasic moiety, for example a compound that has Formula VI: wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3 , OCH 3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl -SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, amino acid, aminoacyl, ONH2, O-aminoalkyl, O-amino acid , O-aminoacyl, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, or a group having any of Formulas I, II, III, IV, V, VI and / or VII, any of which may be included in the structure of the siNA molecule or serve as a point of attachment to the siNA molecule; R9 is O, S, CH2, S = O, CHF, or CF2, and any of R2, R3, R8 or R13 can serve as binding sites to the siNA molecule of the invention. In one embodiment, R3 and / or R7 comprise a conjugate moiety and a linker (e.g., a polynucleotide or non-polynucleotide linkage such as described herein or known by other means in the art). Non-limiting examples of conjugated moieties include ligands for cellular receptors, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; steroids, and polyamines, such as PEI, spermine or spermidine.

In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) substituted polyalkyl moieties, e.g. a compound that has the Formula VII: wherein each n is independently an integer from 1 to 12, each R1, R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCH3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, amino acid, aminoacyl, ONH2, O-aminoalkyl, O-amino acid, O- aminoacyl, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, or a group having any of Formulas I, II, III, IV, V, VI and / or VII, any of which may be included in the structure of the SiNA molecule or serve as a binding point to the siNA molecule. In one embodiment, R3 and / or R1 comprise a conjugated moiety and a linker (e.g., a polynucleotide or non-polynucleotide linkage as described herein or known by other means in the art). Non-limiting examples of conjugated moieties include ligands for cellular receptors, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; steroids, and polyamines, such as PEI, spermine or spermidine. With "zip code" sequences is meant any peptide or protein sequence that is involved in transport mediated by cellular topogenic signaling (see, for example, Ray et al 2004, Science, 306 (1501): 1505). Each nucleotide within the siNA double-stranded molecule can independently have a chemical modification comprising the structure of any of Formulas I-VI II. Thus, in one embodiment, one or more nucleotide positions of a siNA molecule of the invention comprise a chemical modification having the structure of any of Formulas I-VII or any other modification of the present document. In a modality, each nucleotide position of a siNA molecule of the invention comprises a chemical modification having the structure of any of Formulas I-VII or any other modification of the present document. In one embodiment, one or more nucleotide positions of one or both strands of a siNA double-stranded molecule of the invention comprises a chemical modification having the structure of any of Formulas 1-VII or any other modification of the present document. In one embodiment, each nucleotide position of one or both strands of a siNA double-stranded molecule of the invention comprises a chemical modification having the structure of any of Formulas I-VII or any other modification of the present document. In another embodiment, the invention features a compound having the Formula VII, wherein R 1 and R 2 are hydroxyl groups (OH), n = 1, and R 3 comprises O and is the point of attachment to the 3 'end, to the terminus 5. ', or both 3' and 5 'ends of one or both strands of a siNA double-stranded molecule of the invention or a single-stranded siNA molecule of the invention. This modification is referred to herein as "glyceryl" (for example, modification 6 in Figure 10). In another embodiment, a chemically modified nucleoside or non-nucleoside (e.g. a moiety having any of Formulas V, VI or VII) of the invention is at the 3 'end, the 5"end, or both 3' and 5 'ends. For example, the chemically modified nucleoside or non-nucleoside (for example, a moiety having Formula V, VI or VII) may be present at the 3 'end, the 5' end, or both 3 'and 5' ends of the non-coding strand, the coding strand, or both non-coding and coding strands of the siNA molecule In one embodiment, the chemically modified nucleoside or non-nucleoside (eg, a moiety that has Formula V, VI or VII) is present at the 5 'end and the 3' end of the coding strand and the 3 'end of the non-coding strand of a double-stranded siNA molecule of the invention. or chemically modified non-nucleoside (for example, a res Formula V, VI or VII) is present in the terminal position of the 5 'end and the 3"end of the coding strand and the 3' end of the non-coding strand of a siNA double-stranded molecule of the invention. In one embodiment, the chemically modified nucleoside or non-nucleoside (eg, a moiety having Formula V, VI or VII) is present at the two terminal positions of the 5 'end and the 3' end of the coding strand and the terminus 3 'of the non-coding strand of a double-stranded siNA molecule of the invention. In one embodiment, the chemically modified nucleoside or non-nucleoside (eg, a moiety having Formula V, VI or VII) is present in the penultimate position of the 5 'end and the 3' end of the coding strand and the 3 'end. of the non-coding strand of a double-stranded siNA molecule of the invention. In addition, a moiety having the Formula VII may be present at the 3"end or the 5 'end of a hairpin siNA molecule as described herein In another embodiment, a siNA molecule of the invention comprises an abasic residue having the Formula V or VI, wherein the abasic residue having the Formula VI or VI is connected to the siNA construct in a 3'-3 ', 3'-2', 2'-3 configuration ', or 5'-5', such as at the 3 'end, the 5' end, or both 3 'and 5' ends of one or both strands of siNA In one embodiment, a siNA molecule of the invention comprises one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides of blocked nucleic acid (LNA), for example, at the 5 'end, the 3 'end, at both 5' and 3 'ends, or any combination thereof, of the siNA molecule In one embodiment, a siNA molecule of the invention comprises one or more (e.g., approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) 4'-thio nucleotides, for example, at the 5 'end, at the 3' end, at both 5 'and 3' ends, or any combination thereof, of the siNA molecule. In another embodiment, a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example, at the 5 'end, at the end 3 ', at both 5' and 3 'ends, or any combination thereof, of the siNA molecule. In one embodiment, a short interfering nucleic acid molecule (siNA) ccally modified of the invention comprises a coding strand or coding region having one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) ccal modifications in 2'-O-alkyl (for example 2'-O-methyl), 2'-deoxy-2'-fluoro, 2'-deoxy, FANA, or abasic or any combination thereof. In one embodiment, a short interfering nucleic acid molecule (siNA) ccally modified of the invention comprises a non-coding strand or non-coding region having one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) modifications 2'-O-alkyl (for example 2'-O-methyl), 2'-deoxy-2'-fluoro, 2'-deoxy, FANA, or abasic or any combination thereof. In one embodiment, a short interfering nucleic acid (siNA) molecule of the invention comprises a coding strand or coding region and a non-coding strand or non-coding region, each of which has one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30 or more) ccal modifications 2'-O-alkyl (for example 2'-O-methyl), 2'-deoxy-2'-fluoro, 2'-deoxy, FANA, or abasic or any combination of t In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) ccally modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the encoding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (eg, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternatively a plurality (ie more of one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) ccally modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the region encoding are FANA pyrimidine nucleotides (eg, wherein all pyrimidine nucleotides are FANA pyrimidine nucleotides or alternatively a plurality (ie, more than one) pyrimidine nucleotides are FANA pyrimidine nucleotides). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) ccally modified of the invention comprising a non-coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the "non-coding region" are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternatively a plurality (i.e. more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides). In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule ccally modified of the invention comprising a coding region and a non-coding region, wherein any (eg, one or more or all) nucleotides of pyrimidine present in the coding region and the non-coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (eg, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternatively a plurality (ie, more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides).

In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a coding region, wherein any (eg, one or more or all) purine nucleotides present in the region encoding are 2'-deoxy purine nucleotides (eg, in which all purine nucleotides are 2'-deoxy purine nucleotides or alternatively a plurality (ie more than one) of purine nucleotides are nucleotides of 2 '-deoxy purine). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a non-coding region, wherein any (eg, one or more or all) of the purine nucleotides present in the "non-coding region" are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternatively a plurality (ie, more than one) nucleotides of pyrimidine are 2'-O-methyl purine nucleotides). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the region encoding are 2'-deoxy-2'-fluoro pyrimidine nucleotides (eg, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and in which any (e.g., one or more or all) purine nucleotides present in the coding region are 2'- nucleotides. deoxy purine (for example, in which all purine nucleotides are 2'-deoxy purine nucleotides or alternatively a plurality (ie more than one) of purine nucleotides are 2'-deoxy purine nucleotides). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the region encoding are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine nucleotides (e.g. wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy- nucleotides ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl nucleotides -trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and in which any (eg, one or more or all) purine nucleotides present in the coding region are nucleotides two of 2'-deoxy purine (eg, in which all purine nucleotides are 2'-deoxy purine nucleotides or alternatively a plurality (ie more than one) of purine nucleotides are 2'-nucleotides deoxy purine), wherein any nucleotides comprising a nucleotide shell at the 3 'end that are present in said coding region are 2'-deoxy nucleotides. In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the region encoding are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine nucleotides (e.g. which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro nucleotides, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and in which any (eg, one or more or all) nucleotides of Purine present in the coding region are 2'-O-methyl purine nucleotides (eg, in which all the purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality (ie more than one) of purine nucleotides are 2'-O-methyl, 4'-thio nucleotides , 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the region encoding are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine nucleotides (e.g. that all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy nucleotides pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), in which any (eg, one or more or all) purine nucleotides present in the coding region are 2'-O-methyl nucleotides , 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine (for example, in which all the purine nucleotides are 2'- nucleotides) O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality (ie more than one) of nucleotides of purine are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine), and in which any nucleotides comprising a nucleotide shell at the 3 'end that are present in said coding region are 2'-deoxy nucleotides. In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a non-coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the "non-coding region" are nucleotides of 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine (e.g. , wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy nucleotides -ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl- trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and in which any (eg, one or more or all) purine nucleotides present in the non-coding region are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2, -O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy-purine (eg, in which all the nucleotides of purine are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine nucleotides or alternatively a plurality (ie more than one) of purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine nucleotides ). In one embodiment, the invention features a chemically modified short interfering nucleic acid (siNA) molecule of the invention comprising a non-coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the non-coding region are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2-nucleotides, '-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine (eg, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2' nucleotides) -O-trifluoromethyl, 2'-O-ethyltrifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'- fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), in which any (eg, one or more or all) nucleotides of purine present in the non-coding region are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine (for example, in which all purine nucleotides are 2'-O nucleotides) -methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality (ie more than one) of nucleotides of purine are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine), and in which any nucleotides which comprise a nucleotide shell at the 3 'end which are present in said non-coding region are 2'-deoxy nucleotides. In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a non-coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the "non-coding region" are nucleotides of 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine (e.g. , wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy nucleotides -ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are nucleotides of 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O- ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and in which any (eg, one or more or all) purine nucleotides present in the non-coding region are 2'-deoxy purine nucleotides (eg, in which all purine nucleotides are 2'-deoxy purine nucleotides or alternatively a plurality (ie, more than one) of purine nucleotides are 2'-nucleotides deoxy purine). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprising a non-coding region, wherein any (eg, one or more or all) pyrimidine nucleotides present in the Non-coding region are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine nucleotides (by example, wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O- nucleotides. difluoromethoxy-ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl -trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and in which any (eg, one or more or all) purine nucleotides present in the non-coding region are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine (eg, in which all purine nucleotides) are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine nucleotides or alternatively a plurality (i.e. more than one) of purine nucleotides are 2'-O-methyl nucleotides, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine). In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) chemically modified of the invention capable of mediating RNA interference (RNAi) within a cell or in vitro reconstituted system comprising a region encoding, wherein one or more pyrimidine nucleotides present in the coding region are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy nucleotides, or 2'-O-difluoromethoxy-ethoxy pyrimidine (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'- nucleotides) O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio nucleotides , 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and one or more purine nucleotides present s in the coding region are 2'-deoxy purine nucleotides (eg, in which all purine nucleotides are 2'-deoxy purine nucleotides or alternatively a plurality (ie, more than one) purine nucleotides are 2'-deoxy purine nucleotides), and a non-coding region, wherein one or more pyrimidine nucleotides present in the non-coding region are 2'-deoxy-2'-fluoro, 4'-thio, 2 nucleotides, '-O-trifluoromethyl, 2'-0-ethyltrifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine (for example, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro nucleotides, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine or alternatively a plurality (ie more than one) of pyrimidine nucleotides are nucleotides of 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and one or more nucleotides of pur ina present in the non-coding region are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine (by example, wherein all purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy nucleotides purine or alternatively a plurality (ie more than one) of purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyltrifluoromethoxy nucleotides, or 2'-O-difluoromethoxy-ethoxy purine). The coding region and / or the non-coding region can have a modification in the terminal cap, such as any modification described herein or shown in Figure 10, which is optionally present at the 3 'end, the 5 'end, or both 3' and 5 'ends of the coding and / or non-coding sequence. The coding and / or non-coding region optionally may further comprise a nucleotide shell at the 3 'end having from about 1 to about 4 (eg, about 1, 2, 3 or 4) 2'-deoxynucleotides. The hanging nucleotides may further comprise one or more (eg, about 1, 2, 3, 4 or more) internucleotide linkages of phosphorothioate, phosphonoacetate, and / or thiophosphonoacetate. Non-limiting examples of these chemically modified siNA are shown in Figures 3A-3F and 4A-4F and Table II herein. In any of these described embodiments, the purine nucleotides present in the coding region are alternatively 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy nucleotides, or 2'-O-difluoromethoxy-ethoxy purine (eg, wherein all purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl nucleotides -trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality of purine nucleotides are 2'-O-methyl nucleotides, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine) and one or more purine nucleotides present in the non-coding region are nucleotides of '-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine (eg, wherein all purine nucleotides are nucleotides of 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality (ie more of one) of purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine nucleotides). Also, in any of these embodiments, one or more purine nucleotides present in the coding region are alternatively purine ribonucleotides (eg, in which all purine nucleotides are purine ribonucleotides or alternatively a plurality (eg. are more than one) of purine nucleotides are purine ribonucleotides) and any purine nucleotides present in the non-coding region are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'- nucleotides; O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy-purine (for example, wherein all purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O- nucleotides) trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine or alternatively a plurality (ie more than one) of purine nucleotides are 2'-O-methyl, 4 'nucleotides -thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy purine). Additionally, in any of these embodiments, one or more purine nucleotides present in the coding region and / or present in the non-coding region are alternatively selected from the group consisting of 2'-deoxy nucleotides, nucleic acid nucleotides. blocked (LNA), 2'-methoxyethyl nucleotides, 4'-thio nucleotides, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides and 2'-O-methyl nucleotides (eg, in which all purine nucleotides are selected from the group consisting of 2'-deoxy nucleotides, blocked nucleic acid nucleotides (LNA), 2'-methoxyethyl nucleotides, nucleotides of 4'-thio, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides and 2'-O-methyl nucleotides or alternatively a plurality (ie more than one) of purine nucleotides are selected from the group consisting of 2'-deoxy nucleotides, blocked nucleic acid nucleotides (LNA), 2'-methoxyethyl nucleotides, 4'-thio nucleotides, 2'-O-trifluoromethyl nucleotides, nucleotides of 2, -O- ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy nucleotides and 2'-O-methyl nucleotides). In another embodiment, any modified nucleotides present in the siNA molecules of the invention, preferably in the non-coding strand of the siNA molecules of the invention, but also optionally in the coding strand and / or both in the non-coding strand as coding , comprise modified nucleotides that have properties or characteristics similar to natural ribonucleotides. For example, the invention features siNA molecules that include modified nucleotides having a Northern conformation (eg, Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984) alternatively known as configuration of "ribo type" or "A shape helix". Thus, the chemically modified nucleotides present in the siNA molecules of the invention, preferably in the non-coding strand of the siNA molecules of the invention, but also optionally in the coding strand and / or both in the coding strand as the non-coding strand, they are resistant to degradation by nucleases while at the same time maintaining the ability to mediate RNAi. Non-limiting examples of nucleotides having a northern configuration include blocked nucleic acid nucleotides (LNA) (e.g., nucleotides of 2'-O, 4'-C-methylene- (D-ribofuranosyl)); 2'-methoxyethoxy nucleotides (MOE); 2'-methyl-t-o-ethyl nucleotides, 2'-deoxy-2'-fluoro, 2'-deoxy-2'-chloro nucleotide nucleotides, 2'-azido nucleotides, 2'-O- nucleotides trifluoromethyl, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides, 4'-thio nucleotides and 2'-O-methyl nucleotides. In one embodiment, the coding strand of a double-stranded siNA molecule of the invention comprises a terminal cap moiety, (see for example Figure 10) such as an inverted deoxyabasic moiety, at the 3 'end, 5' end, or both. the 3 'end 5' of the coding strand. In one embodiment, the invention features a short-acting nucleic acid molecule (siNA) chemically modified with the ability to mediate RNA interference (RNAi) within a cell or in vitro reconstituted system, in which chemical modification comprises a conjugate covalently linked to the chemically modified siNA molecule. Non-limiting examples of conjugates contemplated by the invention include conjugates and ligands that are described in Vargeese et al., USSN 10 / 427,160, filed April 30, 2003, which is incorporated by reference herein in its entirety, including the drawings. In another embodiment, the conjugate is covalently linked to the siNA molecule chemically modified by a chemically modified linker. In one embodiment, the conjugated molecule is attached to the 3 'end of the coding strand, the non-coding strand, or both strands of the chemically modified siNA molecule. In another embodiment, the conjugated molecule is attached to the 5 'end of the coding strand, the non-coding strand, or both strands of the chemically modified siNA molecule. In yet another embodiment, the conjugated molecule is attached to either the 3 'end or the 5' end of the coding strand, the non-coding strand, or both strands of the chemically modified siNA molecule, or any combination thereof. In one embodiment, a conjugated molecule of the invention comprises a molecule that facilitates the administration of a chemically modified siNA molecule to a biological system, such as a cell. In another embodiment, the conjugated molecule bound to the chemically modified siNA molecule is a ligand for a cellular receptor, such as peptides derived from natural protein ligands; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; steroids, and polyamines, such as PEI, spermine or spermidine. Examples of specific conjugated molecules contemplated by the present invention that can be bound to chemically modified siNA molecules are described in Vargeese et al., U.S. with nJ of series 10/201, 394, presented on July 22, 2002, which is incorporated by reference to this document. The type of conjugates used and the magnitude of the conjugation of the siNA molecules of the invention can be evaluated to determine improvements in the pharmacokinetic profiles, bioavailability, and / or stability of the siNA constructs while at the same time maintaining the siNA's ability to act as a mediator of RNAi activity. Thus, a person skilled in the art can screen siNA constructs that are modified with various conjugates to determine whether the conjugated siNA complex possesses improved properties while maintaining the ability to mediate RNAi, for example in animal models as it is. known generally in the art. In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule of the invention, wherein the siNA further comprises a nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkage that binds the siNA coding region to the non-coding region of the siNA. In one embodiment, a nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkage is used, for example, to bind a conjugate residue to the siNA. In one embodiment, a linker nucleotide of the invention can be a >linker; 2 nucleotides in length, for example approximately 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length. In another embodiment, the linker nucleotide can be a nucleic acid aptamer. By "aptamer" or "nucleic acid aptamer" as used herein is meant a nucleic acid molecule that specifically binds to a target molecule in which the nucleic acid molecule has a sequence comprising a sequence recognized by the target molecule in its natural environment. Alternatively, an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid. The target molecule can be any molecule of interest. For example, the aptamer can be used to bind to a ligand binding domain of a protein, thus preventing the interaction of the natural ligand with the protein. This is a non-limiting example and those skilled in the art will recognize that other modalities can easily be generated using techniques generally known in the art. (See, for example, Gold et al., 1995, Annu., Rev. Biochem., 64, 763, Brody and Gold, 2000, J. Biotechnol., 74, 5, Sun, 2000, Curr. Opin. Mol. 2, 100, Kusser, 2000, J. Biotechnol., 74, 27, Hermann and Patel, 2000, Science, 287, 820, and Jayasena, 1999, Clinical Chemistry, 45, 1628.) Still in another modality, a The non-polynucleotide linkage of the invention comprises an abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (for example polyethylene glycols such as those having between 2 and 100 ethylene glycol units). Specific examples include those which describe Seela and Kaiser, Nucleic Acid Res. 1990, 18: 6353 and Nucleic Acid Res. 1987, 75: 3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 773: 6324; Richardson and Schepartz, J. Am. Chem. Soc. 1991, 773: 5109; Ma et al., Nucleic Acid Res .. 1993, 27: 2585 and Biochemistry 1993, 32: 1751; Durand et al., Nucleic Acid Res .. 1990, 78: 6353; McCurdy et al., Nucleosides & Nucleotides 1991, 70: 287; Jschke and cois., Tetrahedron Lett. 1993, 34: 301; Ono et al., Biochemistry 1991, 30: 9914; Arnold et al., International Patent Publication No. WO 89/02439; Usman et al., International Patent Publication No. WO 95/06731; Dudycz et al., International Patent Publication No. WO 95/11910 and Ferentz and Verdine, J. Am. Chem. Soc. 1991, 773: 4000, all are hereby incorporated by reference herein. A "non-nucleotide" group further means any group or compound that can be incorporated into a nucleic acid strand in place of one or more nucleotide units, which include sugar and / or phosphate substitutions, and allows the remaining bases to show their enzymatic activity. The group or compound may be abasic because it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine, for example in the C1 position of the sugar. In one embodiment, the invention features a short interfering nucleic acid molecule (siNA) capable of mediating RNA interference (RNAi) within a cell or in vitro reconstituted system, wherein one or both of the The siNA molecule that binds from two different oligonucleotides does not comprise any ribonucleotides. For example, a siNA molecule can be assembled from a single nucleotide where the coding and non-coding regions of the siNA comprise different oligonucleotides that do not have ribonucleotides (for example, nucleotides having a 2'-OH group) present in the oligonucleotides. In another example, a siNA molecule can be assembled from a single oligonucleotide wherein the coding and non-coding regions of the siNA are linked or made circular by a polynucleotide or non-polynucleotide linkage as described herein., wherein the oligonucleotide does not have any ribonucleotides (e.g., nucleotides having a 2'-OH group) present in the oligonucleotide. The Applicant has surprisingly found that the presence of ribonucleotides (eg, nucleotides having a 2'-hydroxyl group) in the siNA molecule is neither necessary nor essential for maintaining the RNAi activity. Thus, in one embodiment, all positions of the siNA may include chemically modified nucleotides and / or non-nucleotides such as nucleotides and / or non-nucleotides having the Formula I, II, III, IV, V, VI, or VII or any combination of them in a magnitude in which the ability of the siNA molecule to maintain the activity of RNAi in a cell is maintained. In one embodiment, a siNA molecule of the invention is a single-stranded siNA molecule that mediates the activity of RNAi in an in vitro reconstituted cell or system comprising a single-stranded polynucleotide having complementarity to a target nucleic acid sequence. In another embodiment, the single-stranded siNA molecule of the invention comprises a phosphate group at the 5 'end. In another embodiment, the single-stranded siNA molecule of the invention comprises a phosphate group at the 5 'end and a phosphate group at the 3' end (eg, a 2 ', 3'-cyclic phosphate). In another embodiment, the single-stranded siNA molecule of the invention comprises from about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides.

In yet another embodiment, the single-stranded siNA molecule of the invention comprises one or more chemically modified nucleotides or non-nucleotides that are described herein. For example, all positions in the siNA molecule can include chemically modified nucleotides such as nucleotides having any of Formulas I-VII, or any combination thereof in a quantity that maintains the ability of the siNA molecule to maintain the activity of RNAi in a cell. In one embodiment, a siNA molecule of the invention is a single-stranded siNA molecule that mediates the activity of RNAi or that alternatively modulates the activity of RNAi in a cell or in vitro reconstituted system comprising a single-stranded polynucleotide that has complementarity with a target nucleic acid sequence, wherein one or more pyrimidine nucleotides present in the siNA are nucleotides of 2, -deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2 ' -0-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine (for example, in which all pyrimidine nucleotides are 2'-deoxy-2'-fluoro, 4'-thio, 2'- nucleotides) O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy-pyrimidine or alternatively a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro nucleotides, 4'- thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy pyrimidine), and wherein The purine nucleotides present in the non-coding region are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2, -O-ethyl-trifluoromethoxy, or 2'-O-difluoromethoxy-ethoxy nucleotides. purine (eg, in which all purine nucleotides are 2'-O-methyl, 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, or 2'-O- nucleotides) difluoromethoxy-ethoxy purine or alternatively a plurality of purine nucleotides are nucleotides of 2'-O-methyl, 4'-thio, 2'-0-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, or 2'-O -difluoromethoxy-ethoxy purine), and a terminal cap modification, such as any modification described herein or shown in Figure 10, which is optionally present at the 3 'end, the 5' end, or both 3 'and 5' ends of the non-coding sequence. The siNA optionally further comprises from about 1 to about 4 or more (eg, about 1, 2, 3, 4 or more) terminal 2'-deoxy nucleotides at the 3 'end of the siNA molecule, wherein the terminal nucleotides may further comprise one or more (eg, 1, 2, 3, 4 or more) internucleotide linkages phosphorothioate, phosphonoacetate, and / or thiophosphonoacetate, and wherein the siNA optionally further comprises a terminal phosphate group, such as a phosphate group at the 5 'end. In any of these embodiments, any purine nucleotides present in the non-coding region are alternatively 2'-deoxy purine nucleotides (eg, wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternatively, a plurality of purine nucleotides are 2'-deoxy purine nucleotides). Also, in any of these embodiments, any purine nucleotides present in the siNA (ie, purine nucleotides present in the coding and / or non-coding region) can alternatively be nucleated nucleic acid nucleotides (LNA) (e.g. , wherein all purine nucleotides are LNA nucleotides or alternatively a plurality of purine nucleotides are LNA nucleotides). Also, in any of these embodiments, any purine nucleotides present in the siNA are alternatively 2'-methoxyethyl purine nucleotides (eg, in which all purine nucleotides are 2'-methoxyethyl purine nucleotides or alternatively a plurality of purine nucleotides are 2'-methoxyethyl purine nucleotides). In another modality, any modified nucleotides present in the single-stranded siNA molecules of the invention comprise modified nucleotides having properties or characteristics similar to natural ribonucleotides. For example, the invention features siNA molecules that include modified nucleotides having a Northern conformation (eg, Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984). Thus, the chemically modified nucleotides present in the single-stranded siNA molecules of the invention are preferably resistant to degradation by nucleases while at the same time maintaining the ability to mediate RNAi. In one embodiment, a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprises a coding strand or coding region having two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) single-chain molecule 2'- O-alkyl (for example 2'-O-methyl) or any combination thereof. In another embodiment, the 2'-O-alkyl modification is in an alternating position in the coding strand or siNA coding region, such as position 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 , 21 etc. or the position 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 etc. In one embodiment, a short interfering nucleic acid molecule (siNA) chemically modified of the invention comprises a non-coding strand or non-coding region having two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more) single chain molecules 2 '-O-alkyl (for example 2'-O-methyl) or any combination thereof. In another embodiment, the 2'-O-alkyl modification is in an alternating position in the non-coding strand or non-coding region of the siNA, such as position 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21 etc. or the position 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 etc. In one embodiment, a short interfering nucleic acid (siNA) molecule of the invention comprises a coding strand or coding region and a non-coding strand or non-coding region, each of which has two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30 or more) chemical modifications 2'-O-alkyl (for example 2'-O-methyl), 2'-deoxy-2'-fluoro, 2'-deoxy, or abasic or any combination thereof same. In another embodiment, the 2'-O-alkyl modification is in an alternating position in the coding strand or siNA coding region, such as in position 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 etc. or in the position 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 etc. In another embodiment, the 2'-O-alkyl modification is in an alternating position in the non-coding strand or non-coding region of the siNA, such as position 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 etc. or the position 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 etc. In one embodiment, a siNA molecule of the invention comprises chemically modified nucleotides or non-nucleotides (eg, having any of Formulas I-VII, such as 2'-deoxy, 2'-deoxy-2'-fluoro nucleotides). , 4'-thio, 2'-O-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy or 2'-O-methyl) in the alternating positions in one or more strands or regions of the siNA molecule. For example, such chemical modifications can be introduced in one of every two positions of an RNA-based siNA molecule, which is initiated either in the first or in the second nucleotide from the 3 'end or the 5' end of the siNA . In a non-limiting example, a double-stranded siNA molecule of the invention is presented in which each strand of the siNA is 21 nucleotides in length, in which positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 of each strand are chemically modified (for example, with compounds having any of Formulas I-VII, such as 2'-deoxy nucleotides, '-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy or 2'-O-methyl). In another non-limiting example, a double-stranded siNA molecule of the invention is presented in which each strand of the siNA is 21 nucleotides in length in which the positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 of each strand are chemically modified (eg, with compounds having any of Formulas I-VII, such as 2'-deoxy, 2'-deoxy-2'-fluoro, 4'-thio nucleotides, 2'-O-trifluoromethyl, 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy or 2'-O-methyl). In one embodiment, a strand of the siNA double-stranded molecule comprises chemical modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 and chemical modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21. Said siNA molecules may further comprise terminal cap moieties and / or modifications in the backbone as described herein. In one embodiment, a siNA molecule of the invention comprises the following feature: if the purine nucleotides are present at the 5"end (e.g., at any of the terminal nucleotide positions 1, 2, 3, 4, 5, or 6 from the 5 'end) of the non-coding strand or non-coding region (otherwise called guiding sequence or guiding strand) of the siNA molecule then said purine nucleosides are ribonucleotides In another embodiment, the purine ribonucleotides, when present, they are paired with nucleotides of the coding strand or coding region (otherwise called the transient strand) of the siNA molecule.These purine ribonucleotides may be present in a siNA stabilization motif that otherwise comprises modified nucleotides. In one embodiment, a siNA molecule of the invention comprises the following characteristic: if the pyrimidine nucleotides are present at the end 5 '(for example, at any of the terminal nucleotide positions 1, 2, 3, 4, 5, or 6 from the 5' end) of the non-coding strand or non-coding region (otherwise called leader or strand sequence) guide) of the siNA molecule then said pyrimidine nucleosides are ribonucleotides. In another embodiment, the pyrimidine ribonucleotides, when present, are paired with nucleotides of the coding strand or coding region (otherwise called the transient strand) of the siNA molecule. Said pyrimidine ribonucleotides may be present in a siNA stabilization motif that otherwise comprises modified nucleotides. In one embodiment, a siNA molecule of the invention comprises the following characteristic: if the pyrimidine nucleotides are present at the 5 'end (for example, at any of the terminal nucleotide positions 1, 2, 3, 4, 5, or 6 from the 5 'end) of the non-coding strand or non-coding region (otherwise called leader sequence or leader strand) of the siNA molecule then said pyrimidine nucleosides are modified nucleotides. In another embodiment, the modified pyrimidine nucleotides, when present, are paired with nucleotides of the coding strand or coding region (otherwise called the transient strand) of the siNA molecule. Non-limiting examples of modified pyrimidine nucleotides include those having any of Formulas I-VII, such as 2'-deoxy, 2'-deoxy-2'-fluoro, 4'-thio, 2'-O-trifluoromethyl nucleotides , 2'-O-ethyl-trifluoromethoxy, 2'-O-difluoromethoxy-ethoxy or 2'-O-methyl. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SI: B NX3 (N) X2 B -3 ' B (N) X 1 NX 4 [N] X 5 -5 'SI wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides in which any purine nucleotides when present are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides, are independently 2'-O-methyl, 2'-deoxyribonucleotide nucleotides or a combination of 2 '- deoxyribonucleotides and 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure Sil: B NX3 (N)? 2 B -3 ' B (N) X 1 NX 4 [N] X 5 -5 'Sil wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides in which any purine nucleotides when present are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is a whole number of about 9 to about 30; X4 is a whole number of approximately 11 to approximately 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer of approximately 1 at about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the strand do not encoding (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the strand do not coding (lower strand) other than purine nucleotides at the [N] positions of the nucleotides, they are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are ribonucleotides; any purine nucleotides present in the coding strand (strand superior) are ribonucleotides; Y (c) any nucleotides (N) are optionally nucleotides of 2'-O-methyl, 2'-deoxy-2'-fluoro, or deoxyribonucleotides.

In one embodiment, the invention presents a molecule double-stranded nucleic acid having the structure Slll: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 'SII in which each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides in which any purine nucleotides when present are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are ribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SIV: B NX3 (N) X2 B -3 ' B (N) X 1 NX 4 [N] X 5 -5 'SIV wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides in which any purine nucleotides when present are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are deoxyribonucleotides; Y (c) any nucleotides (N) are optionally nucleotides of 2'-O-methyl, 2'-deoxy-2'-fluoro, or deoxyribonucleotides.

In one embodiment, the invention presents a molecule double-stranded nucleic acid having the SV structure: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 'SV wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides in which any purine nucleotides when present are ribonucleotides; X1 and X2 are independently integers of about 0 to about 4; X3 is a whole number of about 9 to about 30; X4 is a whole number of approximately 11 to approximately 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer of approximately 1 at about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the strand do not encoding (lower strand) are nucleotides having a ribo-like configuration (eg, Northern or helical configuration of Form A); any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are nucleotides having a ribo-like configuration (eg, Northern or helical form A configuration); any purine nucleotides present in the coding strand (upper strand) are 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SVI: B NX3 (N) X2 B -3 ' B (N) X 1 NX 4 [N] X 5 -5 'SVI wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides comprising a sequence that causes the 5 'end of the non-coding strand (lower strand) to be less thermally stable than the 5' end of the coding strand (upper strand); X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides, are independently 2'-O-methyl, 2'-deoxyribonucleotide nucleotides or a combination of 2 '- deoxyribonucleotides and 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of. 2'-deoxyribonucleotides and 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SVII: B NX3 (N) X2 B -3 ' B (N) X1 NX4 5 'SVII wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or overlapping bases; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30; NX3 is complementary to NX4, and any nucleotides (N) are 2'-O-methyl and / or 2'-deoxy-2'-fluoro nucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SVIII: B NX7 - [N] X6-NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 'SVIII in which each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides comprising a sequence that causes the 5 'end of the non-coding strand (lower strand) to be less thermally stable than the 5' end of the coding strand (upper strand); [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 15; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; X6 is an integer from about 1 to about 4; X7 is an integer from about 9 to about 15; NX7, NX6, and NX3 are complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides, are independently 2'-O-methyl, 2'-deoxyribonucleotide nucleotides or a combination of 2 '- deoxyribonucleotides and 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides other than nucleotides [N]; any purine nucleotides present in the coding strand (upper strand) are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides other than nucleotides [ ? /]; and 5 (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SIX: B NX3 (N) X2 B -3 'io B (N) X1 NX4 [N] X5 -5' SIX wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides, are independently 2'-O-methyl, 2'-deoxyribonucleotide nucleotides or a combination of 2 '- deoxyribonucleotides and 2'-0-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SX: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 'SX in which each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are ribonucleotides; any purine nucleotides present in the coding strand (upper strand) are ribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the SXI structure: B NX3 (N) X2 B -3 ' B (N) X 1 NX4 [N] X5 -5 'SXI wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-f luoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are ribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the SXII structure: B NX3 (N) X2 B -3 ' B (N) X] NX4 [N] X5 -5 'SXII wherein each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand (upper strand) are deoxyribonucleotides; and (c) any nucleotides (N) are optionally nucleotides of 2'-O-methyl, 2'-deoxy-2'-fluoro, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SXIII: B NX3 (N) X2 B -3 'B () X] NX4 [N] X5 -5' SXIII in which each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; NX3 is complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are nucleotides having a ribo-like configuration (eg, Northern or helical form A configuration); any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are nucleotides having a ribo-like configuration (eg, Northern or helical form A configuration); any purine nucleotides present in the coding strand (upper strand) are 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. In one embodiment, the invention features a double-stranded nucleic acid molecule having the structure SXIV: B NX7 - [? T |? 6 _ NX3 (N) X2 B -3 ' B (N) X1 -NX4; [N]? S -5 'SXIV in which each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 15; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is between 17-36; X5 is an integer from about 1 to about 6; X6 is an integer from about 1 to about 4; X7 is an integer from about 9 to about 15; NX7, NX6, and NX3 are complementary to NX4 and NX5, and (a) any pyrimidine nucleotides present in the non-coding strand (lower strand) are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand (lower strand) other than the purine nucleotides at the [N] positions of the nucleotides, are independently 2'-O-methyl, 2'-deoxyribonucleotide nucleotides or a combination of 2 '- deoxyribonucleotides and 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand (upper strand) are 2'-deoxy-2'-fluoro nucleotides other than nucleotides [? / j; any purine nucleotides present in the coding strand (upper strand) are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides other than nucleotides [ N]; and (c) any nucleotides (N) are optionally nucleotides of 2'-O-methyl, 2'-deoxy-2'-fluoro, or deoxyribonucleotides. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises a terminal phosphate group at the end 5 'of the non-coding strand or non-coding region of the nucleic acid molecule. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises X5 = 1, 2 or 3; each X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 6 30. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV , SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises X5 = 1; each X1 and X2 = 2; X3 = 19, and X4 = 18. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVM. SVIII, SIX, SX, SXII, SXIII, or SXIV comprises X5 = 2; each X1 and X2 = 2; X3 = 19, and X4 = 17 In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises X5 = 3; each X1 and X2 = 2; X3 = 19, and X4 = 16. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises B at the 3 'and 5' ends of the coding strand or coding region. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises B at the 3 'end of the non-coding strand or non-coding region. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises B at the 3 'ends and 5 'of the coding strand or coding region and B at the 3' end of the non-coding strand or non-coding region. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV further comprises one or more internucleotide bonds of phosphothioate in the first (N) terminus of the 3 'end of the coding strand, non-coding strand, or both in the coding strand and the non-coding strand of the nucleic acid molecule. For example, a double-stranded nucleic acid molecule can comprise X1 and / or X2 = 2 having nucleotide positions in hanging with an internucleotide linkage of phosphorothioate, for example, (NsN) where "s" denotes phosphorothioate.

In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises (N) nucleotides that are nucleotides of 2'-O-methyl. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises (N) nucleotides which are 2'-deoxy nucleotides. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises (N) nucleotides in the strand non-coding (lower strand) which are complementary to nucleotides in a target polynucleotide sequence having complementarity with the N and [N] nucleotides of the non-coding (lower) strand. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises (N) nucleotides in the strand encoding (upper strand) comprising a contiguous nucleotide sequence of about 15 to about 30 nucleotides of a target polynucleotide sequence. In a modality, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV comprises (N) nucleotides in the coding strand (strand top) comprising a nucleotide sequence corresponding to a target sequence of polynucleotides having complementarity with the non-coding (lower) strand such that the sequence of contiguous nucleotides (N) and N of the coding strand comprises the nucleotide sequence of the target nucleic acid sequence. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SVIII or SXIV comprises B only at the 5 'end of the (higher) coding strand of the double-stranded nucleic acid molecule. In one embodiment, a double-stranded nucleic acid molecule having any of the structures SI, Sil, Slll, SIV, SV, SVI, SVII, SVIII, SIX, SX, SXII, SXIII, or SXIV further comprises a terminal nucleotide without a partner in the 5 'end of the non-coding strand (lower). The nucleotide without partner is not complementary to the coding strand (superior). In one embodiment, the unpaired terminal nucleotide is complementary to an objective polynucleotide sequence that has complementarity with the N and [N] nucleotides of the non-coding (lower) strand. In another embodiment, the unpaired terminal nucleotide is not complementary to an objective polynucleotide sequence having complementarity with the N and [N] nucleotides of the non-coding (lower) strand. In one embodiment, a double-stranded nucleic acid molecule having any of the SVIII or SXIV structures comprises X6 = 1 and X3 = 10.

In one embodiment, a double-stranded nucleic acid molecule having any of the structures SVIII or SXIV comprises X6 = 2 and X3 = 9. In one embodiment, the invention features a composition comprising a siNA molecule or double-stranded nucleic acid molecule or RNAi inhibitor formulated in the form of any one of the formulations LNP-051; LNP-053; LNP-054; LNP-069; LNP-073; LNP-077; LNP-080; LNP-082; LNP-083; LNP-060; LNP-061; LNP-086; LNP-097; LNP-098; LNP-099; LNP-100; LNP-101; LNP-102; LNP-103; or LNP-104 (see table IV). In one embodiment, the invention features a composition comprising a first double-stranded nucleic acid and a second double-stranded nucleic acid molecule each having a first strand and a second strand that are complementary to each other, wherein the second strand of the first double-stranded nucleic acid molecule comprises the sequence complementary to a first target sequence and the second strand of the second double-stranded nucleic acid molecule comprises the sequence complementary to a second target sequence or target route. In one embodiment, the composition further comprises a cationic lipid, a neutral lipid, and a polyethylene glycol conjugate. In one embodiment, the composition further comprises a cationic lipid, a neutral lipid, a polyethylene glycol conjugate, and a cholesterol. In one embodiment, the composition further comprises a conjugate of polyethylene glycol, a cholesterol, and a surfactant. In one embodiment, the cationic lipid is selected from the group consisting of CLinDMA, pCLinDMA, eCLinDMA, DMOBA, and DMLBA. In one embodiment, the neutral lipid is selected from the group consisting of DSPC, DOBA, and cholesterol. In one embodiment, the polyethylene glycol conjugate is selected from the group consisting of a PEG-dimyristoyl glycerol and PEG-cholesterol. In one embodiment, the PEG is 2KPEG. In one embodiment, the surfactant is selected from the group consisting of palmityl alcohol, stearyl alcohol, oleyl alcohol and linoleyl alcohol. In one embodiment, the cationic lipid is CLinDMA, the neutral lipid is DSPC, the polyethylene glycol conjugate is 2KPEG-DMG, cholesterol is cholesterol, and the surfactant is linoleyl alcohol. In one embodiment, CLinDMA, DSPC, 2KPEG-DMG, cholesterol, and linoleyl alcohol are present in a molar ratio of 43: 38: 10: 2: 7 respectively. In any of the embodiments herein, the siNA molecule of the invention modulates the expression of one or more targets by RNA interference or inhibition of RNA interference. In one embodiment, the RNA interference is LA-mediated RISC cleavage of the target (eg, siRNA-mediated RNA interference). In one embodiment, RNA interference is the inhibition of target translation (e.g. RNA interference mediated by miRNA). In one embodiment, RNA interference is the inhibition of transcription of the target (eg, silencing of the translation mediated by miRNA). In one embodiment, RNA interference occurs in the cytoplasm. In one embodiment, RNA interference occurs in the nucleus.

In any of the embodiments herein, the siNA molecule of the invention modulates the expression of one or more targets by inhibiting an endogenous target RNA, such as a mRNA, siRNA, endogenous miRNA or, alternatively, through of inhibition of RISC. In one embodiment, the invention features one or more inhibitors of RNAi that modulate the expression of one or more target genes by inhibition of miRNA, inhibition of siRNA, or inhibition of RISC. In one embodiment, an RNAi inhibitor of the invention is a siNA molecule as described herein that has one or more strands that are complementary to one or more molecules of miRNA or target siRNA. In one embodiment, the RNAi inhibitor of the invention is a non-coding molecule that is complementary to a miRNA or target siRNA molecule or a portion thereof. A non-coding RNAi inhibitor of the invention can be from about 10 to about 40 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 , 35, 36, 37, 38, 39 or 40 nucleotides in length). A non-coding RNAi inhibitor of the invention may comprise one or more modified nucleotides or non-nucleotides as described herein (see for example the molecules having any of Formulas I-VII herein or any combination thereof). the same). In one embodiment, a non-coding RNAi inhibitor of the invention may comprise one or more or all of the 2'-O-methyl nucleotides. In one embodiment, a non-coding RNAi inhibitor of the invention may comprise one or more or all of the 2'-deoxy-2'-fluoro nucleotides. In one embodiment, a non-coding RNAi inhibitor of the invention may comprise one or more or all of the 2'-O-methoxy-ethyl nucleotides (also known as 2'-methoxyethoxy or MOE). In one embodiment, a non-coding RNAi inhibitor of the invention may comprise one or more or all of the internucleotide phosphothioate linkages. In one embodiment, a non-coding RNAi inhibitor of the invention may comprise a terminal cap moiety at the 3 'end, the 5' end, or both 5 'and 3' ends of the non-coding RNAi inhibitor. In one embodiment, an RNAi inhibitor of the invention is a nucleic acid aptamer that has binding affinity for RISC, such as an adjustable aptamer (see for example An et al., 2006, RNA, 12: 710-716). An aptamer RNAi inhibitor of the invention can be from about 10 to about 50 nucleotides in length (eg, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length). An RNAi aptamer inhibitor of the invention may comprise one or more modified nucleotides or non-nucleotides as described herein (see for example the molecules having any of Formulas I-VII herein or any combination thereof). same). In one embodiment, an aptamer RNAi inhibitor of the invention may comprise one or more or all of the 2'-O-methyl nucleotides. In one embodiment, an aptamer RNAi inhibitor of the invention may comprise one or more or all of the 2'-deoxy-2'-fluoro nucleotides. In one embodiment, an aptamer RNAi inhibitor of the invention may comprise one or more or all of the 2'-O-methoxy-ethyl nucleotides (also known as 2'-methoxyethoxy or MOE). In one embodiment, an aptamer RNAi inhibitor of the invention may comprise one or more or all of the internucleotide phosphothioate linkages. In one embodiment, an aptamer RNAi inhibitor or the invention may comprise a terminal cap moiety at the 3 'end, the 5' end, or both 5 'and 3' ends of the RNAi aptamer inhibitor. In one embodiment, the invention features a method for modulating the expression of a target gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which may be chemically modified or unmodified, wherein one of the siNA strands comprises a sequence complementary to the RNA of the target gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the cell. In one embodiment, the invention features a method for modulating the expression of a target gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which may be chemically modified or unmodified, wherein one of the siNA strands comprises a sequence complementary to the RNA of the target gene and wherein the sequence of the siNA coding strand comprises a sequence identical or substantially similar to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the cell. In another embodiment, the invention features a method for modulating the expression of more than one target gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which may be chemically modified or unmodified, in the that one of the siNA strands comprises a sequence complementary to the RNA of the target genes; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the cell. In another embodiment, the invention features a method for modulating the expression of two or more target genes within a cell comprising: (a) synthesizing one or more siNA molecules of the invention, which may be chemically modified or unmodified , wherein the siNA strands comprise sequences complementary to the RNA of the target genes and in which the sequences of the siNA coding strand comprise sequences identical or substantially similar to the sequences of the target RNAs; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the cell.

In another embodiment, the invention features a method for modulating the expression of more than one target gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which may be chemically modified or unmodified, in wherein one of the siNA strands comprises a sequence complementary to the RNA of the target gene and wherein the sequence of the siNA coding strand comprises a sequence identical or substantially similar to the sequences of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the cell. In another embodiment, the invention features a method for modulating the expression of a target gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which may be chemically modified or unmodified, wherein one of the siNA strands comprises a sequence complementary to the RNA of the target gene, wherein the sequence of the siNA coding strand comprises a sequence identical or substantially similar to the target RNA sequences; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the cell. In one embodiment, the siNA molecules of the invention are used as reagents in ex vivo applications. For example, reactive siNAs are introduced into tissue or cells that are transplanted to a subject for a therapeutic effect. Cells and / or tissue may be derived from an organism or subject that later receives the explant, or may be derived from another organism or subject prior to transplantation. The siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are capable of performing a function when transplanted in vivo. In one embodiment, certain target cells are removed from a patient. These extracted cells are contacted with siNA directed to a specific nucleotide sequence inside the cells under conditions suitable for the uptake of the siNA by these cells (for example using administration reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the administration of siNA to cells). The cells are then reintroduced into the same patient or other patients. In one embodiment, the invention features a method of modulating the expression of a target gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, in which one of the strands of siNA comprises a sequence complementary to the RNA of the target gene; and (b) introducing the siNA molecule into a tissue explant cell derived from a particular organism under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism from which the tissue was derived or into another organism under conditions suitable to modulate (eg, inhibit) the expression of the target gene in that organism. In one embodiment, the invention features a method of modulating the expression of a target gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, in which one of the strands of siNA comprises a sequence complementary to the RNA of the target gene and wherein the sequence of the coding strand of the siNA comprises a sequence identical or substantially similar to the sequence of the target RNA; and (b) introducing the siNA molecule into a tissue explant cell derived from a particular organism under conditions suitable for modulation (e.g., inhibit) the expression of the target gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism from which the tissue was derived or into another organism under conditions suitable to modulate (eg, inhibit) the expression of the target gene in that organism. In another embodiment, the invention features a method of modulating the expression of more than one target gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which may be chemically modified, in which one of the SiNA strands comprise a sequence complementary to the RNA of the target genes; and (b) introducing the siNA molecules into a tissue explant cell derived from a particular organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism from which the tissue was derived or into another organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in that organism. In one embodiment, the invention features a method of modulating the expression of a target gene in a subject or organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, in which one of the strands of siNA comprises a sequence complementary to the RNA of the target gene; and (b) introducing the siNA molecule into the subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the subject or organism. The level of target protein or RNA can be determined using various methods known in the art. In another embodiment, the invention features a method of modulating the expression of more than one target gene in a subject or organism comprising: (a) synthesizing siNA molecules of the invention, which may be chemically modified, in which one of the siNA strands comprise a sequence complementary to the RNA of the target genes; and (b) introducing the siNA molecules into the subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the subject or organism. The level of target protein or RNA can be determined as is known in the art.

In one embodiment, the invention features a method for modulating the expression of a target gene within a cell, comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, wherein the siNA it comprises a single-stranded sequence that has complementarity with the RNA of the target gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the cell. In another embodiment, the invention features a method for modulating the expression of more than one target gene within a cell, comprising: (a) synthesizing siNA molecules of the invention, which can be chemically modified, wherein the siNA comprises a single-stranded sequence having complementarity with the RNA of the target gene; and (b) contacting the cell in vitro or in vivo with the siNA molecule under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the cell. In one embodiment, the invention features a method of modulating the expression of a target gene in a tissue explant ((e.g., any organ, tissue or cell that can be transplanted from one organism to another or back into the same organism from which the organ, tissue or cell is derived) comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, wherein the siNA comprises a single-stranded sequence having complementarity with the RNA of the target gene; (b) contacting a tissue explant cell derived from a particular subject or organism with the siNA molecule under conditions suitable for modulating (eg, inhibiting) the expression of the target gene in the tissue explant. the method further comprises introducing the tissue explant again into the subject or organism from which the tissue was derived or into another subject or organism under conditions suitable for modulating (eg, example, inhibit) the expression of the target gene in that subject or organism. In another embodiment, the invention features a method of modulating the expression of more than one target gene in a tissue explant (e.g., any organ, tissue or cell that can be transplanted from one organism to another or back to the same organism). which organ, tissue or cell is derived) comprising: (a) synthesizing siNA molecules of the invention, which may be chemically modified, wherein the siNA comprises a single-stranded sequence having complementarity with the RNA of the target gene; and (b) introducing the siNA molecules into a tissue explant cell derived from a particular subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant again into the subject or organism from which the tissue was derived or into another subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in that subject or organism. In one embodiment, the invention features a method of modulating the expression of a target gene in a subject or organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, wherein the siNA comprises a single-stranded sequence that has complementarity with the RNA of the target gene; and (b) introducing the siNA molecule into the subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the subject or organism. In another embodiment, the invention features a method of modulating the expression of more than one target gene in a subject or organism comprising: (a) synthesizing siNA molecules of the invention, which may be chemically modified, in which the siNA comprises a single-stranded sequence that has complementarity with the RNA of the target gene; and (b) introducing the siNA molecules into the subject or organism under conditions suitable to modulate (e.g., inhibit) the expression of the target genes in the subject or organism. In one embodiment, the invention features a method of modulating the expression of a target gene in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate (e.g., inhibit) the expression of the target gene in the subject or organism. In one embodiment, the invention features a method of treating or preventing a disease, disorder, trait or condition related to gene expression or activity in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism. The reduction of gene expression and thus the reduction of the respective protein / RNA level alleviates, to some degree, the symptoms of the disease, disorder, trait or condition. In one embodiment, the invention features a method of treating or preventing cancer in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the target gene in the subject or organism through which the treatment or prevention of cancer can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cancer cells and tissues. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of cancer in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of cancer in a subject or organism. In one embodiment, the invention features a method of treating or preventing a proliferative disease or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the target gene. in the subject or organism whereby the treatment or prevention of the proliferative disease or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the proliferative disease. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the disease or proliferative condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or proliferative conditions in a subject or organism.

In one embodiment, the invention features a method for treating or preventing rejection of transplants and / or tissues (rejection of allografts) in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of rejection of transplants and / or tissues (rejection of allografts) can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in rejection of transplants and / or tissues (allograft rejection). ). In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of rejection of transplants and / or tissues (rejection of allografts) in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of transplant and / or tissue rejection (rejection of allografts) in a subject or organism.

In one embodiment, the invention features a method for treating or preventing an autoimmune disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the autoimmune disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the autoimmune disease, disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the autoimmune disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or autoimmune conditions in a subject or organism.

In one embodiment, the invention features a method of treating or preventing an infectious disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under suitable conditions to modulate the expression of the target gene in the subject or organism whereby the treatment or prevention of the infectious disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the disease., disorder, trait or infectious condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the infectious disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of infectious diseases, traits or conditions in a subject or organism.

In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Adefovir Dipivoxil combined with a siNA molecule of the invention; wherein the Adefovir Dipivoxil and the siNA molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and the siNA molecule. In one embodiment, a siNA molecule of the invention is formulated in the form of a composition that is disclosed in U.S. Provisional Patent Application No. 60 / 678,531 and related U.S. Provisional Patent Application No. 60 / 703,946, filed on July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.), all of which are incorporated by reference herein in their entirety. Such siNA formulations are generally referred to as "nucleic acid lipid particles" (LNP). In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, which comprises administering to the subject Lamivudine (3TC) combined with a siNA molecule of the invention; wherein Lamivudine (3TC) and siNA are administered under conditions suitable for reducing or inhibiting the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Lamivudine (3TC) and the siNA. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Adefovir Dipivoxil and Lamivudine (3TC) combined with a siNA molecule of the invention; wherein Adefovir Dipivoxil and Lamivudine (3TC) and the siNA molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and Lamivudine (3TC) and the siNA molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Adefovir Dipivoxil combined with a double-stranded molecule of chemically synthesized nucleic acid; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; and wherein Adefovir Dipivoxil and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and the molecule double-stranded nucleic acid. In a modality, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition described in United States Provisional Patent Application No. 60 / 678,531 and United States Provisional Patent Application No. 60 / 703,946. related, filed on July 29, 2005, and United States provisional patent application No. 60 / 737,024, filed on November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Lamivudine (3TC) combined with a double-stranded molecule of chemically synthesized nucleic acid.; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; and wherein Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable for reducing or inhibiting the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Lamivudine (3TC) ) and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, which comprises administering to the subject Adefovir Dipivoxil and Lamivudine (3TC) combined with a double-stranded nucleic acid molecule synthesized chemically wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; and wherein Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with the Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Adefovir Dipivoxil combined with a double-stranded molecule of chemically synthesized nucleic acid; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a chemical modification; and (f) at least two of the chemical modifications are different from each other, and wherein Adefovir Dipivoxil and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and the double-stranded nucleic acid molecule. In a modality, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition described in United States Provisional Patent Application No. 60 / 678,531 and United States Provisional Patent Application No. 60 / 703,946. related, filed on July 29, 2005, and United States provisional patent application No. 60 / 737,024, filed on November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Lamivudine (3TC) combined with a double-stranded molecule of chemically synthesized nucleic acid.; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a chemical modification; and (f) at least two of the chemical modifications are different from each other, and wherein Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus ( HBV) in the subject compared to a subject not treated with Lamivudine (3TC) and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, which comprises administering to the subject Adefovir Dipivoxil and Lamivudine (3TC) combined with a double-stranded nucleic acid molecule synthesized chemically wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a chemical modification; and (f) at least two of the chemical modifications are different from each other, and wherein Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of Hepatitis B (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method for treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Adefovir Dipivoxil combined with a double-stranded molecule of chemically synthesized nucleic acid; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a modification in the sugar; and (f) at least two of the modifications of the sugars are different from each other, and wherein the Adefovir Dipivoxil and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus ( HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, comprising administering to the subject Lamivudine (3TC) combined with a double-stranded molecule of chemically synthesized nucleic acid; wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a modification in the sugar; and (f) at least two of the modifications of the sugars are different from each other, and wherein the Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis virus B (HBV) in the subject compared to a subject not treated with Lamivudine (3TC) and the double-stranded nucleic acid molecule. In one embodiment, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and the United States Provisional Patent Application No. 60 / 703,946 related, filed July 29, 2005, and United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005 (Vargeese et al.). In one embodiment, the invention features a method of treating or preventing infection with hepatitis B virus (HBV) in a subject, which comprises administering to the subject Adefovir Dipivoxil and Lamivudine (3TC) combined with a double-stranded nucleic acid molecule synthesized chemically wherein (a) the double-stranded nucleic acid molecule comprises a coding strand and a non-coding strand; (b) each strand of the double-stranded nucleic acid molecule is from 15 to 28 nucleotides in length; (c) at least 15 nucleotides of the coding strand are complementary to the non-coding strand (d) the non-coding strand of the double-stranded nucleic acid molecule has complementarity with a target hepatitis B virus (HBV) RNA; (e) at least 20% of the internal nucleotides of each strand of the double-stranded nucleic acid molecule are modified nucleosides having a modification in the sugar; and (f) at least two of the modifications of sugars are different from each other, and wherein Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule are administered under conditions suitable to reduce or inhibit the level of hepatitis B virus (HBV) in the subject compared to a subject not treated with Adefovir Dipivoxil and Lamivudine (3TC) and the double-stranded nucleic acid molecule. In a modality, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition described in United States Provisional Patent Application No. 60 / 678,531 and United States Provisional Patent Application No. 60 / 703,946. related, filed on July 29, 2005, and United States provisional patent application No. 60 / 737,024, filed on November 15, 2005 (Vargeese et al.).

In one embodiment, the invention features a composition comprising Adefovir Dipivoxil and one or more double-stranded nucleic acid molecules or siNA molecules of the invention in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a composition comprising Adefovir Dipivoxil, Lamivudine, and one or more double-stranded nucleic acid molecules or siNA molecules of the invention in a pharmaceutically acceptable carrier or diluent. In one embodiment, the invention features a method for treating or preventing a disease, disorder, trait or condition related to aging in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under suitable conditions to modulate the expression of the target gene in the subject or organism whereby the treatment or prevention of the disease, disorder, trait or condition related to aging can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the disease, disorder, trait or condition related to the aging. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the disease, disorder, trait or condition related to aging in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or conditions related to aging in a subject or organism. In one embodiment, the invention features a method for treating or preventing a neurological or neurodegenerative disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under suitable conditions for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the neurological, neurodegenerative disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the neurological, neurodegenerative disease, disorder, trait or condition. . In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the neurological or neurodegenerative disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or neurological or neurodegenerative conditions in a subject or organism. In a modality, the invention presents a method for treating or preventing a respiratory disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the gene target in the subject or organism whereby the treatment or prevention of the respiratory disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the respiratory disease, disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the respiratory disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or respiratory conditions in a subject or organism. In one embodiment, the invention features a method for treating or preventing an eye disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the target gene in the subject or organism whereby the treatment or prevention of the ocular disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the eye disease, disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the eye disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or ocular conditions in a subject or organism. In one embodiment, the invention features a method for treating or preventing a dermatological disease, disorder, trait or condition in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the target gene in the subject or organism whereby the treatment or prevention of the dermatological disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues involved in the dermatological disease, disorder, trait or condition. In a modality, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in maintenance or development of the disease, disorder, trait or dermatological condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or dermatological conditions in a subject or organism. In one embodiment, the invention features a method of treating or preventing a liver disease, disorder, trait or condition (eg, hepatitis, HCV, HBV, diabetes, cirrhosis, hepatocellular carcinoma, etc.) in a subject or organism comprising putting in contact the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the liver disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as liver cells and tissues involved in the liver disease, disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the liver disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or liver disorders in a subject or organism. In one embodiment, the invention features a method of treating or preventing a kidney disease, disorder, trait or condition (eg, polycystic kidney disease, etc.) in a subject or organism comprising contacting the subject or organism with a molecule of siNA of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the kidney disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as renal cells and tissues involved in the kidney disease, disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the kidney disease, disorder, trait or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for the treatment or prevention of diseases, traits, disorders or renal affections in a subject or organism. In one embodiment, the invention features a method for treating or preventing an auditory disease, disorder, trait or condition (e.g., hearing loss, deafness, etc.) in a subject or organism comprising contacting the subject or organism with a The siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the auditory disease, disorder, trait or condition can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, such as cells and tissues of the ear, inner ear or middle ear, involved in the disease , hearing disorder, trait or condition. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous or subcutaneous administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the disease, disorder, trait or auditory condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as known in the art for the treatment or prevention of diseases, traits, disorders or auditory conditions in a subject or organism. In one embodiment, the invention features a method for treating or preventing one or more diseases, traits, or metabolic conditions in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the disease (s), trait (s), or metabolic condition (s) can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous, intramuscular, subcutaneous or Gl administration of siNA) to relevant tissues or cells, such as tissues or cells involved in the maintenance or development of the metabolic disease, trait or condition in a subject or organism (e.g., tissue or liver, pancreatic, small intestine or adipose cells). The siNA molecule of the invention can be formulated or conjugated as described herein or as known by other means in the art to target appropriate tissues or cells in the subject or organism (e.g., tissue or liver cells, pancreatic, small bowel or adipose). The siNA molecule can be combined with other treatments and therapeutic modalities as known in the art for the treatment or prevention of metabolic diseases, traits or conditions in a subject or organism. In one embodiment, the metabolic disease is selected from the group consisting of hypercholesterolemia, hyperlipaemia, dyslipidemia, diabetes (e.g., type I and / or type II diabetes), insulin resistance, obesity, or related conditions, including but not limited to: without limitation to sleep apnea, hiatus hernia, reflux esophagitis, osteoarthritis, gout, cancers associated with weight gain, gallstones, kidney stones, pulmonary hypertension, infertility, cardiovascular disease, higher than normal weight, and lipid levels, uric acid levels or oxalate levels higher than normal. In one embodiment, the invention features a method for treating or preventing one or more diseases, traits, or metabolic conditions in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating (for example, inhibiting) the expression of an inhibitor of gene expression in the subject or organism. In one embodiment, the inhibitor of gene expression is a miRNA. In one embodiment, the invention features a method for treating or preventing one or more diseases, features, or cardiovascular conditions in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating the expression of the target gene in the subject or organism whereby the treatment or prevention of the disease (s), trait (s), or cardiovascular condition (s) can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, for example, liver, pancreatic, small intestine or adipose tissues or cells. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous, intramuscular, subcutaneous or Gl administration of siNA) to relevant tissues or cells, such as tissues. or cells involved in the maintenance or development of the cardiovascular disease, trait, or condition in a subject or organism. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as known in the art for the treatment or prevention of cardiovascular diseases, traits or conditions in a subject or organism. In one modality, cardiovascular disease is selected from the group consisting of hypertension, coronary thrombosis, stroke, lipid syndromes, hyperglycemia, hypertriglyceridemia, hyperlipidemia, ischemia, congestive heart failure, and myocardial infarction. In one embodiment, the invention features a method for treating or preventing one or more diseases, features, or cardiovascular conditions in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable for modulating (for example, inhibiting) the expression of an inhibitor of gene expression in the subject or organism. In one embodiment, the inhibitor of gene expression is a miRNA. In one embodiment, the invention features a method for weight loss in a subject or organism comprising contacting the subject or organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the target gene in the subject or organism through which weight loss can be achieved. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by local administration to relevant tissues or cells, for example, liver, pancreatic, small intestine or adipose tissues or cells. In one embodiment, the invention features contacting the subject or organism with a siNA molecule of the invention by systemic administration (such as by intravenous, intramuscular, subcutaneous or Gl administration of siNA) to relevant tissues or cells. The siNA molecule of the invention can be formulated or conjugated as described herein or as is known by other means in the art to target appropriate tissues or cells in the subject or organism. The siNA molecule can be combined with other treatments and therapeutic modalities as is known in the art for weight loss in a subject or organism. In a modality, the siNA molecule or double-stranded nucleic acid molecule of the invention is formulated in the form of a composition described in United States Provisional Patent Application No. 60 / 678,531 and United States Provisional Patent Application No. 60 / 703,946. related, filed on July 29, 2005, United States provisional patent application No. 60 / 737,024, filed on November 15, 2005, and USSN 11 / 353,630, filed on February 14, 2006 (Vargeese et al. .). In any of the methods of the present document to modulate the expression of one or more targets or to treat or prevent diseases, traits, conditions, or phenotypes in a cell, subject, or organism, the siNA molecule of the invention modulates the expression of one or more targets by RNA interference. In one embodiment, RNA interference is RISC-mediated cleavage of the target (eg, RNA interference mediated by siRNA). In one embodiment, RNA interference is the inhibition of target translation (e.g. RNA interference mediated by miRNA). In one embodiment, RNA interference is the inhibition of transcription of the target (eg, silencing of the translation mediated by miRNA). In one embodiment, RNA interference occurs in the cytoplasm. In one embodiment, RNA interference occurs in the nucleus. In any of the methods of treatment of the invention, the siNA can be administered to the subject in the form of a course of treatment, for example administration at various time intervals, such as once a day during the course of treatment, once every two days. days during the course of treatment, once every three days during the course of treatment, once every four days during the course of treatment, once every five days during the course of treatment, once every six days during the course of treatment , once a week during the course of treatment, once every two weeks during the course of treatment, once a month during the course of treatment, etc. In one embodiment, the treatment session is once every 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 weeks. In one embodiment, the treatment batch has from about one to about 52 weeks or more (for example, indefinitely). In one embodiment, the treatment batch has from about one to about 48 months or more (for example, indefinitely). In one embodiment, a treatment batch involves an initial treatment bout, such as once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks during a fixed interval (e.g. 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x or more) followed by a batch of maintenance treatment, such as once every 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, or more weeks during an additional fixed interval (for example, 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x or more). In any of the methods of treatment of the invention, the siNA can be administered to the subject systemically as described herein or by other means known in the art, either alone or in combination with additional therapies described in the present document or as is known in the art. Systemic administration may include, for example, pulmonary (inhalation, nebulization, etc.) intravenous, subcutaneous, intramuscular, catheterization, nasopharyngeal, transdermal, or oral / gastrointestinal administration as is generally known in the art. In one embodiment, in any of the methods of treatment or prevention of the invention, the siNA can be administered to the subject locally or to local tissues as described herein or by other means known in the art, either only in monotherapy or combined with additional therapies as is known in the art. The local administration can include, for example, inhalation, nebulization, catheterization, implant, direct injection, dermal / transdermal application, by endoprosthesis, ear drops, eye drops or administration to the portal vein to the relevant tissues, or any other technique, method or procedure of local administration, as is generally known in the art. In one embodiment, the invention features a method for administering siNA molecules and compositions of the invention to the inner ear comprising contacting the siNA with cells, tissues, or structures of the inner ear, under conditions suitable for administration. In one embodiment, the administration comprises methods and devices as described in U.S. Patents NJ 5,421, 818, 5,476,446, 5,474,529, 6,045,528, 6,440,102, 6,685,697, 6,120,484; and 5,572,594; all of which are incorporated by reference herein and the teachings of Silverstein, 1999, Ear Nose Throat J., 78, 595-8, 600; and Jackson and Silverstein, 2002, Otolaryngol Clin North Am., 35, 639-53, and adapted to use the siNA molecules of the invention. In another embodiment, the invention features a method of modulating the expression of more than one target gene in a subject or organism comprising contacting the subject or organism with one or more siNA molecules of the invention under conditions suitable for modulating (eg, example, inhibit) the expression of the target genes in the subject or organism. The siNA molecules of the invention can be designed to down regulate or inhibit the expression of the target gene by directing the RNAi from a variety of nucleic acid molecules. In one embodiment, the siNA molecules of the invention are used to target them against various DNAs that correspond to a target gene, for example by heterochromatic silencing or inhibition of transcription. In one embodiment, the siNA molecules of the invention are used to direct them against various RNAs that correspond to a target gene, for example by cleavage of the target RNA or translation inhibition. Non-limiting examples of such RNAs include messenger RNA (mRNA), non-coding RNA (ncRNA) or regulatory elements (see for example Mattick, 2005, Science, 309, 1527-1528 and Claverie, 2005, Science, 309, 1529-1530) which include miRNA and other short RNAs, alternative splice variants of RNA of the target gene (s), posttranscriptionally modified target gene (s), target gene (s) pre-mRNA, and / or template templates. RNA If the alternative splicing produces a family of transcripts that are distinguished using appropriate exons, the present invention can be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish between the functions of the members of the gene family. . For example, a protein containing a transmembrane domain with alternative splicing can be expressed both in the membrane-bound and secreted form. The use of the invention to target the exon containing the transmembrane domain can be used to determine the consequences on the function of the pharmaceutical direction of the membrane-bound protein form compared to the secreted form. Non-limiting examples of applications of the invention referred to the direction of these RNA molecules include therapeutic pharmaceutical applications, cosmetic applications, veterinary applications, drug discovery applications, molecular diagnostics and applications of gene functions, and gene mapping using for example polymorphism mapping single nucleotide with siNA molecules of the invention. Such applications can be implemented using known gene sequences or from partial sequences available from an expressed sequence marker (EST). In another embodiment, the siNA molecules of the invention are used to target conserved sequences corresponding to a gene family or gene families such as gene families having homologous sequences. Thus, siNA molecules that target multiple genes or target RNA can provide a greater therapeutic effect. In one embodiment, the invention presents the direction (cleavage or inhibition of the expression or function) of more than one sequence of a target gene using a single siNA molecule, directing the conserved sequences of the target gene. In one embodiment, siNA molecules can be used to characterize gene function pathways in a variety of applications. For example, the present invention can be used to inhibit the activity of the target gene (s) in a pathway to determine the function of the non-characterized gene (s) in the analysis of gene function, analysis of the mRNA function or analysis of the translation. The invention can be used to determine potential target gene pathways involved in various diseases and conditions for pharmaceutical development. The invention can be used to understand the gene expression pathways involved, for example in the diseases, disorders, features and conditions of the present document or known by other means in the art. In one embodiment, the siNA molecule (s) and / or the methods of the invention are used to down-regulate the expression of gene (s) encoding RNAs named by their GenBank accession number, eg, target genes that encode RNA sequence (s) referred to herein by GenBank accession number, eg, GenBank access nJ as described in United States Provisional Patent Application No. 60 / 363,124, USSN 10 / 923,536 and PCT / US03 / 05028, all of which are incorporated by reference herein. In one embodiment, the invention features a method comprising: (a) generating a collection of siNA constructs having a predetermined complexity; and (b) assaying the siNA constructs of (a) above, under conditions suitable for determining the target RNAi sites within the target RNA sequence. In one embodiment, the siNA molecules of (a) have strands of a fixed length, for example, approximately 23 nucleotides in length. In another embodiment, the siNA molecules of (a) are of different length, for example they have strands of about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides in length. In one embodiment, the assay may comprise an siNA test reconstituted in vitro siNA as described herein. In another embodiment, the assay can comprise a cell culture system in which the target RNA is expressed. In another embodiment, fragments of target RNA are analyzed to determine detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays to determine the most suitable target site (s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and / or transcription for in vitro systems, and by cell expression in the in vivo systems. In one embodiment, the invention features a method comprising: (a) generating a random collection of siNA constructs having a predetermined complexity, such as of ^. where N represents the number of paired nucleotides in each of the siNA strand construction (for example for a siNA construct having coding and non-coding strands of 21 nucleotides with 19 base pairs, the complexity would be 4 ^ 9); and (b) evaluating the siNA constructs of (a) above, under conditions suitable for determining the target sites of the RNAi within the target RNA sequence. In another embodiment, the siNA molecules of (a) have strands of a fixed length, for example, approximately 23 nucleotides in length. In yet another embodiment, the siNA molecules of (a) are of different length, for example they have strands of about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29 or 30) nucleotides in length. In one embodiment, the assay may comprise an siNA test reconstituted in vitro siNA as described in Example 6 herein. In another embodiment, the assay can comprise a cell culture system in which the target RNA is expressed. In another embodiment, fragments of target RNA are analyzed to determine detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays to determine the most suitable target site (s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and / or transcription for in vitro systems, and by cell expression in the in vivo systems. In another embodiment, the invention features a method comprising: (a) analyzing the sequence of an objective RNA encoded by a target gene; (b) synthesizing one or more sets of siNA molecules having a sequence complementary to one or more regions of the RNA of (a); and (c) testing the siNA molecules of (b) under conditions suitable for determining the RNAi targets within the target RNA sequence. In one embodiment, the siNA molecules of (b) have strands of a fixed length, for example, approximately 23 nucleotides in length.

In another embodiment, the siNA molecules of (b) are of different length, for example they have strands of about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) nucleotides in length. In one embodiment, the assay may comprise an siNA test reconstituted in vitro siNA as described herein. In another embodiment, the assay can comprise a cell culture system in which the target RNA is expressed. Target RNA fragments are analyzed to determine detectable cleavage levels, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays to determine the most suitable target site (s) within the target RNA sequence . The target RNA sequence can be obtained as is known in the art, for example, by cloning and / or transcription for in vitro systems, and by expression in the in vivo systems. By "target site" is meant a sequence within a target RNA that is the "target" of the cleavage mediated by a siNA construct that contains sequences within its non-coding region that are complementary to the target sequence . By "detectable cleavage level" is meant cleavage of target RNA (and formation of RNA cleaved products) to a sufficient degree to discern the cleavage products of the background RNAs produced by random degradation of the target RNA. The production of the cleavage products from 1-5% of the target RNA is sufficient to detect on the background for most detection methods. In one embodiment, the invention features a composition comprising a siNA molecule of the invention, which may be chemically modified, in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a pharmaceutical composition comprising siNA molecules of the invention, which may be chemically modified, directed to one or more genes in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a method for diagnosing a disease, trait or condition in a subject which comprises administering to the subject a composition of the invention under conditions suitable for the diagnosis of the disease, trait or condition in the subject. In another embodiment, the invention features a method for treating or preventing a disease, trait or condition, such as diseases, traits, conditions, or metabolic and / or cardiovascular disorders in a subject, which comprises administering to the subject a composition of the invention in suitable conditions for the treatment or prevention of the disease, trait or condition in the subject, alone or together with another or other therapeutic compounds. In another embodiment, the invention features a method for validating a target gene, comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, wherein one of the siNA strands includes a sequence complementary to the RNA of a target gene; (b) introducing the siNA molecule into a cell, tissue, subject, or organism under conditions suitable for modulating the expression of the target gene in the cell, tissue, subject, or organism; and (c) determining the function of the gene by an assay to determine any phenotypic change in the cell, tissue, subject, or organism. In another embodiment, the invention features a method for validating an objective comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically modified, wherein one of the siNA strands includes a sequence complementary to the RNA of an objective gene; (b) introducing the siNA molecule into a biological system under conditions suitable for modulating expression of the target gene in the biological system; and (c) determining the function of the gene by an assay to determine any phenotypic change in the biological system. With "biological system" is meant, material, in purified or unpurified form, from biological sources including, but not limited to, a human or animal, in which the system comprises the necessary components for the RNAi activity. The term "biological system" includes, for example, a cell, tissue, subject, or organism, or extract thereof. The term "biological system" also includes reconstituted RNAi systems that can be used in an in vitro environment. By "phenotypic change" is meant any detectable change to a cell that occurs in response to contact or treatment with a nucleic acid molecule of the invention (eg, siNA). Such detectable changes include, but are not limited to, changes in shape, size, proliferation, mobility, protein expression or RNA expression or other physical or chemical changes that can be assayed by methods known in the art. Detectable changes can also include the expression of control genes / molecules such as green fluorescent protein (GFP) or various labels that are used to identify an expressed protein or any other cellular component that can be assayed. In one embodiment, the invention features a kit containing a siNA molecule of the invention, which can be chemically modified, which can be used to modulate the expression of a target gene in a biological system, including, for example, a cell , tissue, subject, or organism. In another embodiment, the invention features a kit containing more than one siNA molecule of the invention, which can be chemically modified, which can be used to modulate the expression of more than one target gene in a biological system, including, for example , in a cell, tissue, subject, or organism. In one embodiment, the invention features a cell that contains one or more siNA molecules of the invention, which may be chemically modified. In another embodiment, the cell containing a siNA molecule of the invention is a mammalian cell. In yet another embodiment, the cell containing a siNA molecule of the invention is a human cell.

In one embodiment, the synthesis of a siNA molecule of the invention, which may be chemically modified, comprises: (a) synthesis of two complementary strands of the siNA molecule; (b) hybridization of the two complementary strands under suitable conditions to obtain a double-stranded molecule of siNA. In another embodiment, the synthesis of the two complementary strands of the siNA molecule is by solid phase oligonucleotide synthesis. In yet another embodiment, the synthesis of the two complementary strands of the siNA molecule is by oligonucleotide synthesis in solid phase in tandem. In one embodiment, the invention features a method for synthesizing a siNA double-stranded molecule comprising: (a) synthesizing a first strand of oligonucleotide sequence from the siNA molecule, wherein the first strand of the oligonucleotide sequence comprises one molecule cleavable linker that can be used as a framework for the synthesis of the second strand of the oligonucleotide sequence of the siNA; (b) synthesizing the second strand of the siNA oligonucleotide sequence in the framework of the first strand of the oligonucleotide sequence, wherein the second strand of the oligonucleotide sequence further comprises a chemical moiety that can be used to purify the molecule double-stranded siNA; (c) cleaving the linker molecule from (a) under conditions suitable for hybridizing the two siNA oligonucleotide strands and forming a stable double-stranded molecule; and (d) purifying the double-stranded siNA molecule using the chemical moiety of the second strand of the oligonucleotide sequence. In one embodiment, cleavage of the linker molecule in (c) above occurs during deprotection of the oligonucleotide, for example, under conditions of hydrolysis using an alkylamine base such as methylamine. In one embodiment, the synthesis process comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a linker of succinyl, using the solid support as a framework. The cleavable linker of (a) which is used as a scaffold to synthesize the second strand may comprise a reactivity similar to that of the linker derived on solid support, such that the cleavage of the derivatized linker on solid support and of the cleavable linker of (a) ) occurs concomitantly. In another embodiment, the chemical moiety of (b) that can be used to isolate the bound oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group, which can be employed in a trityl synthesis strategy as described herein. . In yet another embodiment, the chemical moiety, such as a dimethoxytrityl group, is removed during purification, for example, using acidic conditions. In a further embodiment, the method for synthesis of siNA is a synthesis in phase of solution or synthesis in hybrid phase in which both strands of the double-stranded molecule of siNA are synthesized in tandem using a cleavable linker attached to the first sequence acting as frame for synthesis of the second sequence. Cleavage of the linker under conditions suitable for hybridization of the strands separated from the siNA sequence causes the formation of the double-stranded siNA molecule. In another embodiment, the invention features a method for synthesizing a siNA double-stranded molecule comprising: (a) synthesizing a strand of an oligonucleotide sequence of the siNA molecule, wherein the sequence comprises a cleavable linker molecule that can be used as framework for the synthesis of another oligonucleotide sequence; (b) synthesizing a second oligonucleotide sequence having complementarity with the first strand of the frame sequence of (a), wherein the second sequence comprises the other strand of the siNA double-stranded molecule and wherein the second sequence comprises in addition a chemical residue that can be used to isolate the linked oligonucleotide sequence; (c) purifying the product of (b) using the chemical moiety of the second strand of the oligonucleotide sequence under suitable conditions to isolate the full length sequence comprising both siNA oligonucleotide strands connected by the cleavable linker and under conditions suitable for that the two siNA oligonucleotide strands hybridize and form a stable double-stranded molecule. In one embodiment, cleavage of the linker molecule in (c) above occurs during deprotection of the oligonucleotide, for example, under hydrolysis conditions. In another embodiment, the cleavage of the linker molecule in (c) above occurs after deprotection of the oligonucleotide. In another embodiment, the synthesis process comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a framework. The scissile linker of (a) which is used as a scaffold to synthesize the second strand may comprise a similar reactivity or reactivity different from that of the linker derived on solid support, such that the cleavage of the linker derived on solid support and the linker The cleavage of (a) occurs either concomitantly or sequentially. In one embodiment, the chemical moiety of (b) that can be used to isolate the linked oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group. In another embodiment, the invention features a method for synthesizing a siNA double-stranded molecule in a single synthetic process comprising: (a) synthesizing an oligonucleotide having a first and a second sequence, wherein the first sequence is complementary to the second sequence, and the first oligonucleotide sequence is linked to the second sequence by a cleavable linker, and in which a protecting group remains at the 5 'end, for example, a 5'-O-dimethoxytrityl group (5'-O- DMT) in the oligonucleotide having the second sequence; (b) deprotecting the oligonucleotide whereby deprotection causes cleavage of the linker linking the two oligonucleotide sequences; and (c) purifying the product of (b) under conditions suitable for isolating the siNA double-stranded molecule, for example using a trityl synthesis strategy as described herein. In another embodiment, the method of synthesizing siNA molecules of the invention comprises the teachings of Scaringe et al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6.1 11.086, which are incorporated by reference herein in their entirety. In one embodiment, the invention features siNA constructs that act as RNAi mediators against a target polynucleotide (e.g., RNA or target DNA), wherein the siNA construct comprises one or more chemical modifications, e.g., one or more chemical modifications having any of the formulas l-VII or any combination thereof which increases the resistance to nucleases of the siNA construction. In another embodiment, the invention features a method for generating siNA molecules with enhanced nuclease resistance comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and (b) ) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules that have higher resistance to nucleases. In another embodiment, the invention features a method for generating siNA molecules with improved toxicological profiles (e.g., having attenuated or non-immunostimulatory properties) comprising (a) introducing nucleotides having any of Formulas I-VII (e.g. motifs of siNA referred to in Table I) or any combination thereof in a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved toxicological profiles. In another embodiment, the invention features a method for generating siNA formulations with improved toxicological profiles (eg, having attenuated or non-immunostimulatory properties) comprising (a) generating a siNA formulation comprising a siNA molecule of the invention and an administration vehicle or administration particle as described herein or by other means known in the art, and (b) assaying the siNA formulation of step (a) under conditions suitable for isolating siNA formulations having improved toxicological profiles. In another embodiment, the invention features a method for generating siNA molecules that do not stimulate an interferon response (eg, no interferon response or an attenuated interferon response) in a cell, subject, or organism, comprising (a) introducing nucleotides having any of Formulas I-VII (eg, the siNA motifs referred to in Table I) or any combination thereof into a siNA molecule, and (b) assaying the molecule of siNA from step (a) under suitable conditions to isolate siNA molecules that do not stimulate an interferon response. In another embodiment, the invention features a method for generating siNA formulations that do not stimulate an interferon response (e.g., no interferon response or an attenuated interferon response) comprising (a) generating a siNA formulation comprising a molecule of siNA of the invention and a delivery vehicle or administration particle as described herein or by other means known in the art, and (b) assaying the siNA formulation of step (a) under conditions suitable for isolate siNA formulations that do not stimulate an interferon response. In one embodiment, interferon comprises interferon alpha. In another embodiment, the invention features a method for generating siNA molecules that do not stimulate an inflammatory or proinflammatory cytokine response (e.g., no cytokine response or attenuated cytokine response) in a cell, subject, or organism, comprising (a) introducing nucleotides having any of Formulas I-VII (eg, siNA motifs referred to in Table I) or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules that do not stimulate a cytokine response. In one embodiment, the cytokine comprises an interleukin such as interleukin-6 (IL-6) and / or tumor necrosis factor alpha (TNF-a). In another embodiment, the invention features a method for generating siNA formulations that do not stimulate an inflammatory or proinflammatory cytokine response (eg, no cytokine response or an attenuated cytokine response) comprising (a) generating a siNA formulation that comprises a siNA molecule of the invention and an administration vehicle or delivery particle as described herein or by other means known in the art, and (b) assaying the siNA formulation of step (a) in suitable conditions for isolating siNA formulations that do not stimulate a cytokine response. In one embodiment, the cytokine comprises an interleukin such as interleukin-6 (IL-6) and / or tumor necrosis factor alpha (TNF-a). In another embodiment, the invention features a method for generating siNA molecules that do not stimulate a Toll-like receptor (TLR) response (e.g., no TLR response or an attenuated TLR response) in a cell, subject, or organism , comprising (a) introducing nucleotides having any of Formulas I-VII (e.g., siNA motifs referred to in Table I) or any combination thereof in a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules. that do not stimulate a TLR response. In one embodiment, the TLR comprises TLR3, TLR7, TLR8 and / or TLR9. In another embodiment, the invention features a method for generating siNA formulations that do not stimulate a Toll-like receptor (TLR) response (eg, no TLR response or an attenuated TLR response) comprising (a) generating a formulation of siNA comprising a siNA molecule of the invention and a delivery vehicle or administration particle as described herein or by other means known in the art, and (b) assaying the siNA formulation of the step ( a) under conditions suitable for isolating siNA formulations that do not stimulate a TLR response. In one embodiment, the TLR comprises TLR3, TLR7, TLR8 and / or TLR9. In one embodiment, the invention features a chemically synthesized double-stranded interference (nucleic acid) nucleic acid (siNA) molecule that directs the cleavage of a target RNA by RNA interference (RNAi), wherein: (a) each strand of said molecule siNA has from about 18 to about 38 nucleotides in length; (b) a strand of said siNA molecule comprises the nucleotide sequence having sufficient complementarity with said target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference; and (c) wherein the nucleotide positions within said siNA molecule are chemically modified to reduce the immunostimulatory properties of the siNA molecule to a level below that corresponding to an unmodified siRNA molecule. It is said that said siNA molecules have an improved toxicological profile compared to an unmodified or minimally modified siNA. With "improved toxicological profile", it is meant that the chemically modified or formulated siNA construct shows less toxicity in a cell, subject, or organism compared to an unmodified or unformulated siNA, or with a siNA molecule having fewer modifications or modifications that are less effective in conferring improved toxicology. Said siNA molecules are also considered to have an "enhanced RNAi activity". In a non-limiting example, siNA molecules and formulations with improved toxicological profiles are associated with minor immunostimulatory properties, such as reduced, reduced or attenuated immunostimulatory response in a cell, subject, or organism compared to an unmodified or unchanged siNA formulate, or with a siNA molecule that has fewer modifications or modifications that are less effective in conferring improved toxicology. Said improved toxicological profile is characterized an abrogated or reduced immunostimulation, such as reduction or abrogation of the induction of interferons (e.g., interferon alpha), inflammatory cytokines (e.g., interleukins such as IL-6, and / or TNF-alpha) , and / or Toll-type receivers (for example, TLR-3, TLR-7, TLR-8, and / or TLR-9). In one embodiment, a siNA molecule or a formulation with an improved toxicological profile does not comprise ribonucleotides. In one embodiment, a siNA molecule or formulation with an improved toxicological profile comprises less than 5 ribonucleotides (eg, 1, 2, 3 or 4 ribonucleotides). In one embodiment, a siNA molecule or a formulation with an improved toxicological profile comprises Estab 7, Estab 8, Estab 11, Estab 12, Estab 13, Estab 16, Estab 17, Estab 18, Estab 19, Estab 20, Estab 23, Stab 24, Stab 25, Stab 26, Stab 27, Stab 28, Stab 29, Stab 30, Stab 31, Stab 32, Stab 33, Stab 34, Stab 35, Stab 36 or any combination thereof (see Table I) . In the present document, the numerical Stab structures include both 2'-fluoro and 2'-OCF3 versions of the structures shown in table I. For example, "Estab 7/8" refers to both Estab 7 / 8 as to Estab 7F / 8F etc. In one embodiment, a siNA molecule or a formulation with an improved toxicological profile comprises a siNA molecule of the invention and a formulation as described in United States Patent Application Publication No. 20030077829, which is incorporated by reference to present document in its entirety including the drawings. In one embodiment, the level of immunostimulatory response associated with a given siNA molecule can be measured as described herein or as known by other means in the art, for example by determining the level of PKR / interferon response, proliferation, activation of B lymphocytes and / or production of cytokines in assays to quantify the immunostimulatory response of particular siNA molecules (see, for example, Leifer et al., 2003, J Immunother, 26, 313-9; United States No. 5,968,909, which is incorporated in its entirety by reference). In one embodiment, the lowest immunostimulatory response is between about 10% and about 100% compared to an unmodified or minimally modified siRNA molecule, for example, approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% reduction in the immunostimulatory response. In one embodiment, the immunostimulatory response associated with a siNA molecule can be modulated by the degree of chemical modification. For example, a siNA molecule having between about 10% and about 100%, for example, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. % or at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the nucleotide positions in the modified siNA molecule can be selected to have a corresponding degree of immunostimulation properties as described herein. In one embodiment, the degree of reduced immunostimulatory response is selected for optimized RNAi activity. For example, it may be preferred to maintain a certain degree of immunostimulation to treat a viral infection, where a reduction of less than 100% of the immunostimulation may be preferred for maximal antiviral activity (eg, a reduction in immunostimulation of approximately 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, or 90%) while inhibition of the expression of an endogenous target gene with siNA molecules having minimal immunostimulation properties can be preferred to avoid non-specific toxicity or effects external to the target (eg, a reduction in immunostimulation of about 90% to about 100%). In one embodiment, the invention features a chemically synthesized double-stranded siNA molecule that directs the cleavage of a target RNA by RNA interference (RNAi), wherein: (a) each strand of said siNA molecule has from about 18 to about 38 nucleotides in length; (b) a strand of said siNA molecule comprises the nucleotide sequence having sufficient complementarity with said target RNA for the siNA molecule to direct cleavage of the target RNA by RNA interference; and (c) wherein one or more nucleotides within said siNA molecule are chemically modified to reduce the immunostimulatory properties of the siNA molecule at a level below that corresponding to an unmodified siNA molecule. In one embodiment, each strand comprises at least about 18 nucleotides that are complementary to the nucleotides of the other strand. In another embodiment, the siNA molecule comprising nucleotides modified to reduce the immunostimulation properties of the siNA molecule comprises a non-coding region having a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion of the same and further comprises a coding region, wherein said coding region comprises a nucleotide sequence substantially similar to the nucleotide sequence of said target gene or portion thereof. In one embodiment thereof, the non-coding region and the coding region comprise from about 18 to about 38 nucleotides, wherein said non-coding region comprises at least about 18 nucleotides that are complementary to the nucleotides of the coding region. In one embodiment thereof, the pyrimidine nucleotides of the coding region are 2'-O-methyl pyrimidine nucleotides. In another embodiment thereof, the purine nucleotides in the coding region are 2'-deoxy purine nucleotides. In yet another embodiment thereof, the pyrimidine nucleotides present in the coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In another embodiment thereof, the pyrimidine nucleotides of said non-coding region are 2'-deoxy-2'-fluoro pyrimidine nucleotides. In yet another embodiment thereof, the purine nucleotides of said non-coding region are 2'-O-methyl purine nucleotides. In still another embodiment thereof, the purine nucleotides present in said non-coding region comprise 2'-deoxy purine nucleotides. In another embodiment, the non-coding region comprises an internucleotide linkage of phosphorothioate at the 3 'end of said non-coding region. In another embodiment, the non-coding region comprises a glyceryl modification at a 3 'end of said non-coding region. In other embodiments, the siNA molecule comprising the nucleotides modified to reduce the immunostimulation properties of the siNA molecule may comprise any of the structural features of the siNA molecules described herein. In other embodiments, the siNA molecule comprising the nucleotides modified to reduce the immunostimulation properties of the siNA molecule can comprise any of the chemical modifications of the siNA molecules that are described herein. In one embodiment, the invention features a method for generating a chemically synthesized double-stranded siNA molecule having chemically modified nucleotides to reduce the immunostimulation properties of the siNA molecule, comprising (a) introducing one or more modified nucleotides into the siNA, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating a siNA molecule having minor immunostimulation properties compared to a corresponding siNA molecule having unmodified nucleotides. Each strand of the siNA molecule is from about 18 to about 38 nucleotides in length. A strand of the siNA molecule comprises the nucleotide sequence having sufficient complementarity with the target RNA for the siNA molecule to direct the direct cleavage of the target RNA by RNA interference. In a modality, the reduced properties of immunostimulation comprise an abrogated or reduced induction of inflammatory or proinflammatory cytokines, such as interleukin-6 (IL-6) or tumor necrosis factor alpha (TNF-a), in response to the siNA that is introduced into a cell, tissue, or organism. In another embodiment, the reduced immunostimulation properties comprise an abrogated or reduced induction of Toll-like receptors (TLRs), such as TLR3, TLR7, TLR8 or TLR9, in response to the siNA being introduced into a cell, tissue, or organism . In another embodiment, the reduced immunostimulation properties comprise an abrogated or reduced induction of the interferons, such as interferon alpha, in response to the siNA being introduced into a cell, tissue, or organism.

In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the binding affinity between the coding strands. and non-coding for the construction of siNA. In another embodiment, the invention features a method for generating siNA molecules with higher binding affinity between the coding and non-coding strands of the siNA molecule comprising (a) introducing nucleotides having any of Formulas I-VII or any combination of them in a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having higher binding affinity between the coding and non-coding strands of the siNA molecule. . In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the binding affinity between the strand not coding for the construction of siNA and a complementary RNA sequence from the interior of a cell. In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the binding affinity between the strand not coding for the construction of siNA and a DNA sequence complementary to the interior of a cell. In another embodiment, the invention features a method for generating siNA molecules with higher binding affinity between the non-coding strand of the siNA molecule and a complementary sequence of the target RNA comprising (a) introducing nucleotides having any of the formulas. -VII or any combination thereof in a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having higher binding affinity between the non-coding strand of the siNA molecule and a sequence complementary to the target RNA. In another embodiment, the invention features a method for generating siNA molecules with higher binding affinity between the non-coding strand of the siNA molecule and a complementary sequence of the target DNA comprising (a) introducing nucleotides having any of the formulas -VII or any combination thereof in a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having higher binding affinity between the non-coding strand of the siNA molecule and a complementary sequence of the target DNA. In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase. with the ability to generate additional endogenous siNA molecules that exhibit sequence homology with the chemically modified siNA construct. In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase. with the ability to generate additional endogenous siNA molecules that exhibit sequence homology with the chemically modified siNA construct comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules that exhibit homology between the sequences with the chemically modified siNA molecule. In one embodiment, the invention features chemically modified siNA constructs that mediate RNAi against an objective polynucleotide in a cell, in which chemical modifications do not significantly affect the interaction of siNA with an RNA molecule, a molecule of DNA and / or target proteins or other factors that are essential for the RNAi in a way that would increase the efficiency of the RNAi mediated by said siNA constructs. In another embodiment, the invention features a method for generating siNA molecules with an improved specificity of RNAi against polynucleotide targets comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a molecule of siNA, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having enhanced RNAi specificity. In one embodiment, the improved specificity comprises having lower external effects to the target compared to an unmodified siNA molecule. For example, the introduction of terminal cap moieties at the 3 'end, 5' end, or both at the 3 'and 5' ends of the strand or coding region of a siNA molecule of the invention can direct the siNA to have a better specificity preventing the coding strand or coding region from acting as a template for the RNAi activity against a corresponding target that has complementarity with the coding strand or coding region. In another embodiment, the invention features a method for generating siNA molecules with enhanced RNAi activity against a polynucleotide target comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a molecule of siNA, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having enhanced RNAi activity. In still another embodiment, the invention features a method for generating siNA molecules with enhanced activity of RNAi against a target RNA comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having enhanced RNAi activity against the target RNA. In still another embodiment, the invention features a method for generating siNA molecules with enhanced RNAi activity against a target DNA comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having enhanced RNAi activity against the target DNA. In one embodiment, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the cellular uptake of the siNA construct , such as conjugation with siNA cholesterol. In another embodiment, the invention features a method for generating siNA molecules against a target polynucleotide with improved cellular uptake comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved cellular uptake. In a modality, the invention features siNA constructs that mediate RNAi against an objective polynucleotide, wherein the siNA construct comprises one or more chemical modifications described herein that increases the bioavailability of the siNA construct, for example, linking the polymer conjugates such as polyethylene glycol or equivalent conjugates that improve the pharmacokinetics of the siNA construction, or by binding conjugates that target specific tissue types or cell types in vivo. Non-limiting examples of said conjugates are described in Vargeese et al., U.S. with nJ of series 10/201, 394 that is incorporated by reference to the present document. In one embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing a conjugate into the structure of a siNA molecule, and (b) assaying the siNA molecule from the step ( a) under conditions suitable for isolating siNA molecules that have improved bioavailability. Such conjugates may include ligands for cellular receptors, such as peptides derived from natural protein ligands.; protein localization sequences, including cellular zip code sequences; antibodies; nucleic acid aptamers; vitamins and other cofactors, such as folate and N-acetylgalactosamine; polymers, such as polyethylene glycol (PEG); phospholipids; cholesterol; cholesterol derivatives, polyamines, such as spermine or spermidine; and others. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein said second sequence is chemically modified so that it can not act as a leader sequence to efficiently mediate RNA interference and / or be recognized by cellular proteins that facilitate RNAi. In one embodiment, the first nucleotide sequence of the siNA is chemically modified as described herein. In one embodiment, the first nucleotide sequence of the siNA is unmodified (e.g., it is all RNA). In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein the second sequence is designed or modified in such a way that it prevents its access to the RNAi pathway as a leader sequence or as a sequence that is complementary to a target nucleic acid sequence (eg, RNA). In one embodiment, the first nucleotide sequence of the siNA is chemically modified as described herein. In one embodiment, the first nucleotide sequence of the siNA is unmodified (e.g., it is all RNA). It is expected that said design or modifications improve the siNA activity and / or improve the specificity of the siNA molecules of the invention. It is also to be expected that these modifications minimize any effects external to the objective and / or associated toxicity. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein said second sequence is unable to act as a leader sequence to mediate RNA interference. In one embodiment, the first nucleotide sequence of the siNA is chemically modified as described herein. In one embodiment, the first nucleotide sequence of the siNA is unmodified (e.g., it is all RNA). In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein said second sequence does not have a 5'-hydroxyl (5'-OH) or 5'-phosphate group at the end. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein said second sequence comprises a terminal cap moiety at the 5 'end of said second sequence. In one embodiment, the terminal cap moiety comprises an inverted abasic nucleic acid, deoxyabasic inverted moiety, a group shown in Figure 10, an alkyl or cycloalkyl group, a heterocycle., or any other group that avoids the RNAi activity in which the second sequence acts as a guiding sequence or template for the RNAi. In one embodiment, the invention features a double stranded nucleic acid interference molecule (siNA) comprising a first nucleotide sequence complementary to a target RNA sequence or a portion thereof, and a second sequence having complementarity with said first sequence, wherein said second sequence comprises a terminal cap moiety at the 5 'end and at the 3' end of said second sequence. In one embodiment, each terminal cap moiety comprises, individually, an inverted abasic, inverted deoxyabasic nucleotide residue, a group shown in Figure 10, an alkyl or cycloalkyl group, a heterocycle, or any other group that prevents the activity of RNAi. wherein the second sequence acts as a guiding sequence or template for the RNAi. In one embodiment, the invention features a method for generating siNA molecules of the invention with improved specificity by down regulating or inhibiting the expression of a target nucleic acid (e.g., a DNA or RNA such as a gene or its corresponding RNA), which comprises (a) introducing one or more chemical modifications into the structure of a siNA molecule, and (b) testing the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved specificity. In another embodiment, the chemical modification that is used to improve the specificity comprises terminal cap modifications at the 5 'end, the 3' end, or both 5 'and 3' ends of the siNA molecule. The terminal cap modifications may comprise, for example, structures shown in Figure 10 (e.g., inverted deoxyabasic moieties) or any other chemical modification that causes a portion of the siNA molecule (e.g., the coding strand) to be incapable. to mediate the interference of RNA against a nucleic acid sequence external to the target. In a non-limiting example, a siNA molecule is designed such that only the non-coding sequence of the siNA molecule can serve as a leader sequence for the RISC-mediated degradation of a corresponding target RNA sequence. This can be achieved by making the siNA coding sequence inactive by introducing chemical modifications to the coding strand which prevent recognition of the coding strand as a guide sequence by the RNAi apparatus. In one embodiment, said chemical modifications comprise any chemical group at the 5 'end of the siNA coding strand, or any other group acting to render the coding strand inactive as a guiding sequence for mediating RNA interference. These modifications, for example, can produce a molecule in which the 5 'end of the coding strand no longer has a free d-hydroxyl group (5'-OH) or a free 5'-phosphate group (e.g., phosphate) , diphosphate, triphosphate, cyclic phosphate etc.). Non-limiting examples of said siNA constructions are described herein, such as the "Estab 9/10", "Estab 7/8", "Estab 7/19", "Estab 17/22", "Estab 7/19" structures. / 24"," Estab 24/25", and" Estab 24/26"(for example, any siNA that has the coding strands Estab 7, 9, 17, 23 or 24) and its variants (see table I) in that the 5 'end and the 3' end of the siNA coding strand do not comprise a hydroxyl group or a phosphate group. In this document, the numerical Stab structures include both 2'-fluoro and 2'-OCF3 versions of the structures shown in Table I.

For example, "Estab 7/8" refers to both Estab 7/8 and Estab 7F / 8F etc. In one embodiment, the invention features a method for generating siNA molecules of the invention with improved specificity by down regulating or inhibiting the expression of a target nucleic acid (e.g., a DNA or RNA such as a gene or its corresponding RNA), which comprises introducing one or more chemical modifications into the structure of a siNA molecule that prevents a strand or portion of the siNA molecule from acting as a template or leader sequence for the RNAi activity. In one embodiment, the inactive strand or coding region of the siNA molecule is the coding strand or coding region of the siNA molecule, i.e. the strand or region of the siNA that does not exhibit complementarity with the target nucleic acid sequence. In one embodiment, said chemical modifications comprise any chemical group at the 5 'end of the strand or siNA coding region that does not comprise a 5'-hydroxyl (5'-OH) or 5'-phosphate group, or any other group that acts making the coding strand or coding region inactive as a guiding sequence for mediating RNA interference. Non-limiting examples of said siNA constructions are described herein, such as the "Estab 9/10", "Estab 7/8", "Estab 7/19", "Estab 17/22", "Estab 7/19" structures. / 24"," Estab 24/25", and" Estab 24/26"(for example, any siNA that has the coding strands Estab 7, 9, 17, 23 or 24) and its variants (see table I) in that the 5 'end and the 3' end of the siNA coding strand do not comprise a hydroxyl group or a phosphate group. In the present document, the numerical Stab structures include both 2'-fluoro and 2'-OCF3 versions of the structures shown in table I. For example, "Estab 7/8" refers to both Estab 7 / 8 as to Estab 7F / 8F etc. In one embodiment, the invention features a method for screening siNA molecules that are active in mediating RNA interference against an objective nucleic acid sequence comprising (a) generating a plurality of unmodified siNA molecules, (b) screening the siNA molecules of step (a) under conditions suitable for isolating siNA molecules that are active in mediating RNA interference against the target nucleic acid sequence, and (c) introducing chemical modifications (e.g., chemical modifications such as those described herein or by other means known in the art) in the siNA active molecules of (b). In one embodiment, the method further comprises reciribating the chemically modified siNA molecules of step (c) under conditions suitable for isolating the chemically modified siNA molecules that are active to mediate the interference of the RNA against the target nucleic acid sequence. In one embodiment, the invention features a method for screening chemically modified siNA molecules that are active in mediating RNA interference against an objective nucleic acid sequence comprising (a) generating a plurality of chemically modified siNA molecules (eg, example siNA molecules as described herein or known by other means in the art), and (b) screen the siNA molecules of step (a) under conditions suitable for isolating chemically modified siNA molecules that are active in the mediation of RNA interference against the target nucleic acid sequence. The term "ligand" refers to any compound or molecule, such as a drug, peptide, hormone, or neurotransmitter, that has the ability to interact with another compound, such as a receptor, directly or indirectly. The receptor that interacts with a ligand may be present on the surface of a cell or alternatively it may be an intercellular receptor. The interaction of the ligand with the receptor can cause a biochemical reaction, or it can simply be a physical interaction or association. In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing an excipient formulation into a siNA molecule, and (b) assaying the siNA molecule from step (a) under conditions suitable for isolating siNA molecules that have improved bioavailability. Such excipients include polymers such as cyclodextrins, lipids, cationic lipids, polyamines, phospholipids, nanoparticles, receptors, ligands, and others. In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing nucleotides having any of Formulas I-VII or any combination thereof into a siNA molecule, and ( b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability. In another embodiment, polyethylene glycol (PEG) can be covalently linked to siNA compounds of the present invention. The bound PEG may be of any molecular weight, preferably from about 100 to about 50,000 daltons (Da). The present invention can be used alone or as a component of a kit having at least one of the reagents necessary to perform the in vitro or in vivo introduction of RNA to analyze samples and / or subjects. For example, preferred components of the kit include a siNA molecule of the invention and a vehicle that promotes the introduction of the siNA into cells of interest as described herein (e.g., using lipids and other known transfection methods). the technique, see for example Beigelman et al, US 6,395,713). The kit can be used for the validation of targets, such as for determining gene function and / or activity, or in drug optimization, and drug discovery (see for example Usman et al., USSN 60 / 402,996) . Said kit may also include instructions to allow the user of the kit to practice the invention. The term "short interfering nucleic acid", "siNA", "short interfering RNA", "siRNA", "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", or "short nucleic acid molecule" Chemically Modified Interference "as used herein refers to any nucleic acid molecule capable of inhibiting or down-regulating gene expression or viral replication mediating RNA interference by" RNAi "or gene silencing of a specific mode of sequence. These terms may refer to both individual nucleic acid molecules, to a plurality of said nucleic acid molecules, or to sets of said nucleic acid molecules. The siNA can be a double-stranded nucleic acid molecule comprising self-complementary coding and non-coding regions, wherein the non-coding region comprises the nucleotide sequence that is complementary to a nucleotide sequence of a target nucleic acid molecule or a portion of the same and the coding region having the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the coding strand and the other is the non-coding strand, in which the non-coding and coding strands are self-complementary (i.e., each strand comprises the nucleotide sequence that is complementary to a nucleotide sequence of the other strand; such as when the non-coding strand and the coding strand form a double-stranded molecule or double-stranded structure, for example in which the double-stranded region has from about 15 to about 30, for example, about 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the non-coding strand comprises the nucleotide sequence which is complementary to a nucleotide sequence of a target nucleic acid molecule or a portion thereof and the coding strand comprises the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (eg, from about 15 to about 25 or more nucleotides of the siNA molecule are complementary to the target nucleic acid or a portion thereof). Alternatively, the siNA is assembled from a single oligonucleotide, where the self-complementary coding and non-coding regions of the siNA are linked by a linker (s) with nucleic acid base or not. The siNA can be a polynucleotide with a secondary structure of double-stranded molecule, asymmetric double-stranded molecule, hairpin or asymmetric fork, having self-complementary coding and non-coding regions, in which the non-coding region comprises the nucleotide sequence that is complementary to a sequence nucleotides of a different target nucleic acid molecule or a portion thereof and the coding region having the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be a single-stranded circular polynucleotide having two or more loop structures and a stem comprising self-complementary coding and non-coding regions, wherein the non-coding region comprises the nucleotide sequence that is complementary to a nucleotide sequence of a target nucleic acid molecule or a portion thereof and the coding region having the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed or in vivo or in vitro generating an active siNA molecule capable of mediating the RNAi. The siNA may also comprise a single-stranded polynucleotide having a nucleotide sequence complementary to a nucleotide sequence of a target nucleic acid molecule or a portion thereof (eg, wherein said siNA molecule does not require the presence within the the siNA molecule of the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single-stranded polynucleotide may further comprise a terminal phosphate group, such as a 5'-phosphate (see for example, Martínez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568), or 5 ', 3'-diphosphate. In certain embodiments, the siNA molecule of the invention comprises separate coding and non-coding sequences or regions, wherein the coding and non-coding regions are covalently linked by nucleotide or non-nucleotide linker molecules as is known in the art, or Alternative forms are non-covalently bound by ionic interactions, hydrogen bonds, van der waals interactions, hydrophobic interactions and / or stacking interactions. In certain embodiments, the siNA molecules of the invention comprise a nucleotide sequence that is complementary to a nucleotide sequence of a target gene. In another embodiment, the siNA molecule of the invention interacts with a nucleotide sequence of a target gene in a manner that causes inhibition of the expression of the target gene. As used herein, siNA molecules do not have to be limited to molecules that contain only RNA, but also comprise chemically modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules of the invention lack nucleotides containing 2'-hydroxy (2'-OH). The applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2'-hydroxy group to mediate the RNAi and thus, the short interfering nucleic acid molecules of the invention optionally do not include some ribonucleotide ( for example, nucleotides having a 2'-OH group). Said siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support the RNAi however may have a linked linker or linkers or other groups, moieties or linked or associated chains containing one or more nucleotides with groups 2'-OH. Optionally, the siNA molecules may comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The short molecules of modified interference nucleic acids of the invention can also be referred to as modified short oligonucleotides of interference "siMON." As used herein, the term "siNA" is intended to be equivalent to other terms that are used to describe nucleic acid molecules that are capable of mediating sequence-specific RNAi, eg, short interfering RNA (siRNA). , Double-stranded RNA (dsRNA), micro-RNA (miRNA), short-hairpin RNA (shRNA), short interference oligonucleotide, short interfering nucleic acid, short-modified modified oligonucleotide, chemically modified siRNA, post-transcriptional RNA silencing (ptgsRNA) ), and others. Non-limiting examples of siNA molecules of the invention are shown in Figures 3A-3F, 4A-4F and 5A-5C, and Table II of this document. Said siNA molecules are different from other nucleic acid technologies known in the art that act as mediators of the inhibition of gene expression, such as ribozymes, non-coding oligonucleotides, formation of three-dimensional molecules, aptamers, chimera 2.5-A , or simulated oligonucleotides. By "RNA interference" or "RNAi" is meant a biological process of inhibiting or regulating by decreasing gene expression in a cell as is generally known in the art and which is mediated by short nucleic acid molecules of interference, see for example Zamore and Haley 2005, Science, 309, 1519-1524; Vaughn and Martienssen, 2005, Science, 309, 1525-1526; Zamore et al., 2000, Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., PCT International Patent Publication No. WO 00/44895; Zernicka-Goetz et al., PCT International Patent Publication No. WO 01/36646; Fire, PCT International Patent Publication No. WO 99/32619; Plaetinck et al., PCT International Patent Publication No. WO 00/01846; Mello and Fire, PCT International Patent Publication No. WO 01/29058; Deschamps-Depaillette, PCT International Patent Publication No. WO 99/07409; and Li et al., PCT International Patent Publication No. WO 00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, gene & Dev., 16, 1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831). In addition, as used herein, the term "RNAi" is intended to be equivalent to other terms that are used to describe sequence-specific RNA interference, such as posttranslational gene silencing, translation inhibition, transcription inhibition. , or epigenetics. For example, the siNA molecules of the invention can be used to silence genes epigenetically both at the posttranscriptional level and at the pretranscriptional level. In a non-limiting example, the epigenetic modulation of gene expression by siNA molecules of the invention can be produced from the siNA-mediated modification of the chromatin structure or methylation patterns to alter gene expression (see, for example, example, Verdel et al., 2004, Science, 303, 672-676, Pal-Bhadra et al., 2004, Science, 303, 669-672, Allshire, 2002, Science, 297, 1818-1819, Volpe et al., 2002 , Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). In another non-limiting example, the modulation of gene expression by siNA molecules of the invention can occur through siNA mediated RNA cleavage (either coding or non-coding RNA) by RISC, or alternatively, by inhibition of the translation as is known in the art. In another embodiment, the modulation of gene expression by the siNA molecules of the invention can be produced by the inhibition of transcription (see for example Janowski et al., 2005, Nature Chemical Biology, 1, 216-222). In one embodiment, a siNA molecule of the invention is an oligonucleotide that forms a double-stranded molecule "DFO", (see for example Figures 11A-11 D and 12 and Vaish et al., USSN 10 / 727,780 filed on 3 December 2003 and PCT international patent application nJ US04 / 16390, filed on May 24, 2004). In one embodiment, a siNA molecule of the invention is a multifunctional siNA, (see for example Figures 13A-13B and 25 and Jadhav et al., USSN 60 / 543,480 filed February 10, 2004 and PCT international application nJ US04 / 16390, filed on May 24, 2004). In one embodiment, the multifunctional siNA of the invention may comprise the sequence direction, eg, two or more target RNA regions (see for example target sequences in Tables II and III). In one embodiment, the multifunctional siNA of the invention may comprise directing the sequence to one or more different targets, which include coding regions and non-coding regions of SREBP1. By "asymmetric fork" as used herein is meant a linear siNA molecule comprising a non-coding region, a loop portion which may comprise nucleotides or non-nucleotides, and a coding region comprising fewer nucleotides than the non-coding region to such an extent that the coding region has sufficient complementary nucleotides to form base pairs with the non-coding region and form a loop double-stranded molecule. For example, an asymmetric siNA hairpin molecule of the invention may comprise a non-coding region that is of sufficient length to mediate the RNAi of a cellular system or in vitro (eg, from about 15 to about 30, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides) and a loop region comprising from about 4 to about 12 (e.g., about 4.5, 6, 7, 8, 9, 10, 11 or 12) nucleotides, and a coding region having from about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) nucleotides that are complementary to the non-coding region. The asymmetric siNA hairpin molecule may also comprise a phosphate group at the 5 'end which may be chemically modified. The loop portion of the asymmetric siNA hairpin molecule may comprise nucleotides, non-nucleotides, linker molecules or conjugated molecules as described herein. By "asymmetric double-stranded molecule" as used herein is meant a siNA molecule having two separate strands comprising a coding region and a non-coding region, wherein the coding region comprises fewer nucleotides than the non-coding region. encoding to such an extent that the coding region has sufficient complementary nucleotides to form base pairs with the non-coding region and form a double-stranded molecule. For example, an asymmetric siNA molecule of the invention may comprise a non-coding region having sufficient length to mediate the RNAi of a cellular system or in vitro (eg, from about 15 to about 30, or about 15, 16). , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides) and a coding region having from about 3 to about 25 (e.g., about 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) nucleotides that are complementary to the region non-coding By "RNAi inhibitor" is meant any molecule that can down regulate, reduce or inhibit the RNA interference function or activity in a cell or organism. An RNAi inhibitor can down-regulate, reduce or inhibit RNAi (eg, cleavage of a target polynucleotide, inhibition of translation, or RNAi-mediated translational silencing) by interacting or interfering with the function of any component of the RNAi. RNAi pathway, which includes protein components such as RISC, or nucleic acid components such as miRNA or siRNA. An RNAi inhibitor can be a siNA molecule, a non-coding molecule, an aptamer, or a short molecule that interacts or interferes with the function of RISC, a miRNA, or a siRNA or any other component of the RNAi pathway in a cell or organism. By inhibiting RNAi (e.g., cleavage of an objective polynucleotide, translation inhibition, or RNAi-mediated translational silencing), an RNAi inhibitor of the invention can be used to modulate (e.g., regulate by augmentation or down-regulate) ) the expression of a target gene. In one embodiment, an RNA inhibitor of the invention is used to upregulate gene expression by interfering (for example, reducing or avoiding) regulation by inhibition or inhibition of endogenous gene expression through translation inhibition, silencing translational, or RISC-mediated cleavage of a polynucleotide (e.g., mRNA). By interfering with the mechanisms of repression, silencing, or inhibition of endogenous gene expression, the RNAi inhibitors of the invention can therefore be used to upregulate gene expression for the treatment of diseases, traits, or conditions that result from a loss of function. In one embodiment, the term "RNAi inhibitor" is used in place of the term "siNA" in the various embodiments herein, for example, with the effect of increasing gene expression for the treatment of diseases, traits, and / or conditions of loss of function. By "aptamer" or "nucleic acid aptamer" as used herein is meant a polynucleotide that specifically binds to a target molecule in which the nucleic acid molecule has a sequence that is different from the sequence recognized by the target molecule in its natural environment. Alternatively, an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid. The target molecule can be any molecule of interest. For example, the aptamer can be used to bind to a ligand binding domain of a protein, thus preventing the interaction of the natural ligand with the protein. This is a non-limiting example and those skilled in the art will recognize that other modalities can easily be generated using techniques generally known in the art, see for example Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol. Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical Chemistry, 45, 1628. The aptamer molecules of the invention can be chemically modified as is generally known in the art or as described herein. The term "non-coding nucleic acid", as used herein, refers to a nucleic acid molecule that binds a target RNA through interactions between RNA-RNA or RNA-DNA or RNA-PNA (Protein nucleic acid; Egholm et al., 1993 Nature 365, 566) and alters the activity of the target RNA (for a review, see Stein and Cheng, 1993 Science 261, 1004 and Woolf et al., U.S. Patent No. 5,849,902) by steric interaction or by recognition of targets mediated by RNase H. Usually, the non-coding molecules are complementary to an objective sequence in a single contiguous sequence of the non-coding molecule. However, in certain embodiments, a non-coding molecule can be bound to a substrate in such a way that the substrate molecule forms a loop, and / or a non-coding molecule can be linked in such a way that the non-coding molecule forms a loop. Thus, the non-coding molecule can be complementary to two (or even more) non-contiguous substrate sequences or two (or even more) non-contiguous sequence portions of a non-coding molecule can be complementary to an objective sequence or both. For a review of current non-coding strategies, see Schmajuk et al., 1999, J. Biol. Chem., 274, 21783-21789, Delihas et al., 1997, Nature, 15, 751-753, Stein et al. , 1997, non-coding NA Drug Dev., 7, 151, Crooke, 2000, Methods Enzymol., 313, 3-45; Crooke, 1998, Biotech. Genet Eng. Rev., 15, 121-157, Crooke, 1997, Ad. Pharmacol., 40, 1-49. In addition, non-coding or non-coding DNA modified with 2'-MOE and other modifications as known in the art can be used to target RNA by the interactions between DNA-RNA, thereby activating RNase H, which digests the target RNA in the molecule double-stranded The non-coding oligonucleotides can comprise one or more RNase-H activating regions, which have the ability to activate cleavage by RNAse H of a target RNA. The non-coding DNA can be chemically synthesized or expressed by the use of a single-stranded DNA expression vector or its equivalent. The non-coding molecules of the invention can be chemically modified as is generally known in the art or as described herein. By "modular" it is meant that the expression of the gene, or the level of an RNA molecule or equivalent RNA molecules that encode one or more proteins or subunits of proteins, or the activity of one or more proteins or subunits of proteins is regulates by increase or is regulated by decrease, in such a way that the expression, level or activity is higher or lower than that observed in the absence of the modulator. For example, the term "modular" may mean "inhibit," but the use of the word "modular" is not limited to this definition. By "inhibit", "regulate by decrease", or "reduce", it is meant that the expression of the gene, or level of RNA molecules or equivalents of RNA molecules that encode one or more proteins or subunits of proteins, or the activity of one or more proteins or subunits of proteins, is reduced below that observed in the absence of the nucleic acid molecules (eg, siNA) of the invention. In one embodiment, the inhibition, down regulation or reduction with a siNA molecule is lower than the level observed in the presence of an inactive or attenuated molecule. In another embodiment, the inhibition, down regulation, or reduction with siNA molecules is lower than the level observed in the presence, for example, of a siNA molecule with a matched sequence or with mismatches. In another embodiment, the inhibition, down regulation, or reduction of gene expression with a nucleic acid molecule of the present invention is greater in the presence of the nucleic acid molecule than in its absence. In one embodiment, inhibition, down regulation or reduction of gene expression is associated with post-translational silencing, such as RNAi-mediated cleavage of a target nucleic acid molecule (e.g. RNA) or translation inhibition. In one embodiment, inhibition, down regulation, or reduction of gene expression is associated with pretranscriptional silencing, such as by alterations in DNA methylation patterns and the structure of DNA chromatin. By "regulate by increase", or "promote", it is meant that the expression of the gene, or level of RNA molecules or equivalents of RNA molecules that encode one or more proteins or subunits of proteins, or the activity of one or more proteins or subunits of proteins, is increased above that which is observed in the absence of the nucleic acid molecules (eg, siNA) of the invention. In one embodiment, the regulation by increase or promotion of gene expression with a siNA molecule is higher than the level observed in the presence of an inactive or attenuated molecule. In another embodiment, the regulation by augmentation or promotion of gene expression with a siNA molecule is higher than the level observed in the presence, for example, of a siNA molecule with a matted sequence or with mismatches. In another embodiment, the regulation by augmentation or promotion of gene expression with a nucleic acid molecule of the present invention is greater in the presence of the nucleic acid molecule than in its absence. In one embodiment, upregulation or promotion of gene expression is associated with the inhibition of RNA-mediated gene silencing, such as RNAi-mediated silencing or silencing of a coding or non-coding RNA target that down-regulates, inhibits , or silence the expression of the gene of interest to regulate by increase. Down regulation of gene expression, for example, can be induced by a coding RNA or its encoded protein, such as through negative feedback or antagonistic effects. Down regulation of gene expression can be induced, for example, by a non-coding RNA that exerts regulatory control for a gene of interest, for example by silencing the expression of the gene by translation inhibition, chromatin structure, methylation, RNA cleavage mediated by RISC or translation inhibition. Thus, inhibition or down regulation of targets that down-regulate, suppress or silence a gene of interest can be used to regulate by augmentation or promote expression of the gene of interest for therapeutic use. In one embodiment, an RNAi inhibitor of the invention is used to upregulate gene expression by inhibiting RNAi or gene silencing. For example, an RNAi inhibitor of the invention can be used to treat diseases and conditions of loss of function by increasing gene expression, such as in cases of haplotic failure in which an allele of a particular gene harbors a mutation ( for example, a mutation in the reading frame, of altered or meaningless sense) that causes the loss of a function of the protein encoded by the mutant allele. In such cases, the RNAi inhibitor can be used to upregulate the expression of the protein encoded by the wild type or functional allele, thereby correcting the haploinsufficiency by compensating for the mutant or null allele. In another embodiment, a siNA molecule of the invention is used to down regulate the expression of a toxic increase in the function of an allele while an RNAi inhibitor of the invention is used concomitantly to upregulate the expression of the wild type or functional allele, such as in the treatment of diseases, traits, or conditions of this document or by other means known in the art (see, for example, Rhodes et al., 2004, PNAS USA, 101: 1147-11152 and Meisler et al., 2005; The Journal of Clinical Investigation, 115: 2010-2017). By "gene", or "objective gene" or "target" DNA, is meant a nucleic acid encoding an RNA, for example, nucleic acid sequences including, but not limited to, structural genes encoding a polypeptide. A target gene or gene can also encode a functional RNA (fRNA) or a non-coding RNA (ncRNA), such as short temporal RNA (stRNA), microRNA (miRNA), short nuclear RNA (snRNA), short interfering RNA ( siRNA), short nucleolar RNA (snRNA), ribosomal RNA (rRNA), transfer RNA (tRNA) and its precursor RNAs. Such non-coding RNAs can serve as target nucleic acid molecules for siNA mediated RNA interference to modulate the activity of fRNA or ncRNAs involved in cellular functional or regulatory processes. The aberrant activity of fRNA or ncRNA that causes a disease can therefore be modulated by the siNA molecules of the invention. The siNA molecules directed to fRNA and ncRNA can also be used to manipulate or alter the genotype or phenotype of a subject, organism or cell, intervening in cellular processes such as genetic sealing, transcription, translation, or nucleic acid processing (e.g. transamination, methylation etc.). The target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes from a pathogen, for example a virus, which is present in the cell after its infection. The cell containing the target gene can be derived or contained in any organism, for example a plant, animal, protozoan, virus, bacterium or fungus. Non-limiting examples of plants include monocots, dicots, or gymnosperms. Non-limiting examples of animals include vertebrates or invertebrates. Non-limiting examples of fungi include molds or yeasts. For a review, see for example Snyder and Gerstein of 2003, Science, 300, 258-260. "Non-canonical base pair" means any pair of bases other than Watson-Crick bases, such as mismatches and / or faltering base pairs, which include erroneous pairings by f lip, single hydrogen bond mismatches , trans-type mismatches, three-base interactions and four-base interactions. Non-limiting examples of such non-canonical base pairs include, but are not limited to, base pairs with inverse Hoogsteen in AC, hesitation in AC, inverse Hoogsteen in AU, hesitation in GU, N7 amino in AA, 2-carbonyl-amino (H1 ) -N3-amino (H2) in CC, break in GA, 4-carbonyl-amino in UC, imino-carbonyl in UU, reverse hesitation in AC, Hoogsteen in AU, Watson Crick inverse in AU, Watson Crick inverse in CG, N3-amino-amino N3 in GC, N1-amino symmetric in AA, N7-amino symmetric in AA, N7-N1 amino-carbonyl in GA, carbonyl-amino N7-N1 in GA +, N1-carbonyl symmetric in GG, N3- symmetric amino in GG, symmetric carbonyl-amino in CC, symmetrical N3-amino in CC, symmetric 2-carbonyl-imino in UU, symmetric 4-carbonyl-imino in UU, amino-N3 in AA, N1-amino in AA, amino 2-carbonyl in AC, N3-amino in AC, N7-amino in AC, amino-4-carbonyl in AU, N1-imino in AU, N3-imino in AU, N7-imino in AU, carbonyl-amino in CC, amino-N1 in GA, amino-N7 in GA, carbonyl-amino in GA, N3-amino in GA, amino-N3 in GC, carbonyl-amino in GC, N3-amino in GC, N7-amino in GC, amino-N7 in GC, carbonyl-imino in GG, N7-amino in GG, amino-2-carbonyl in GU, carbonyl-imino in GU, imino-2-carbonyl in GU, N7-imino in GU, imino-2-carbonyl in psiU, 4-carbonyl-amino in UC, imino-carbonyl in UC, imino-4-carbonyl in UU, C2-H-N3 in AC, carbonyl-C2-H in GA, imino-4-carbonyl 2 carbonyl-C5-H in UU, amino (A) N3 (C) -carbonyl in AC, imino aminocarbonyl in GC, imino-2-carbonyl amino-2-carbonyl in Gpsi, and imino amino-2-carbonyl in GU. By "target" as used herein is meant any target protein, peptide, or polypeptide such as those encoded by GenBank access nJs that are described herein and / or in the patent application U.S. Provisional No. 60 / 363,124, USSN 10 / 923,536 and / or PCT / US03 / 05028, which are incorporated by reference herein. The term "target" also refers to nucleic acid sequences or target polynucleotide sequences that encode any target protein, peptide, or polypeptide, such as proteins, peptides, or polypeptides encoded by sequences having the GenBank access nJs that are shown in this document and / or in United States Provisional Patent Application No. 60 / 363,124, USSN 10 / 923,536 and / or USSN PCT / US03 / 05028. The target of interest may include target polynucleotide sequences, such as target DNA or target RNA. The term "target" is also intended to include other sequences, such as different isoforms, target mutant genes, splice variants of target polynucleotides, target polymorphisms, and non-coding polynucleotide sequences (e.g., ncRNA, miRNA, stRNA) or other regulators such as those described in this document. Therefore, in various embodiments of the invention, a double-stranded nucleic acid molecule of the invention (eg, siNA) having complementarity with a target RNA can be used to inhibit or down-regulate the activity of miRNA or other ncRNA. In one embodiment, the inhibition of miRNA or ncRNA activity can be used to down regulate or inhibit gene expression (e.g., target genes that are described herein or known by other means in the art) which is dependent on the activity of miRNA or ncRNA. In another embodiment, the inhibition of miRNA or ncRNA activity by the double-stranded nucleic acid molecules of the invention (eg, siNA) having complementarity with the miRNA or ncRNA can be used to upregulate or promote the expression of the target gene ( for example, target genes that are described herein or known by other means in the art) where the expression of said genes is down-regulated, suppressed or silenced by the miRNA or ncRNA. Such an increase in gene expression can be used to treat diseases and conditions associated with a loss of function or haploinsufficiency that are generally known in the art (eg, muscular dystrophies, cystic fibrosis or neurological diseases and conditions described herein). document such as epilepsy, which includes severe myoclonic epilepsy of childhood or Dravet syndrome). By "objective route" is meant any objective involved in the expression routes or gene activity. For example, any target may have target routes that may include genes upstream, downstream or modifier genes in a biological pathway. These target route genes may provide additive or synergistic effects in the treatment of diseases, conditions, and features of the present document. In one embodiment, the target is any target RNA or a portion thereof. In one embodiment, the target is any target DNA or a portion thereof. In one embodiment, the goal is any target mRNA or a portion thereof. In one embodiment, the target is any target miRNA or a portion thereof. In one embodiment, the target is any target siRNA or a portion thereof. In one modality, the goal is any target stRNA or a portion thereof. In one modality, the objective is an objective and or objective route or a portion of it. In a modality, the objective is any (eg, one or more) of the target sequences described herein and / or in the United States Provisional Patent Application No. 60 / 363,124, USSN 10 / 923,536 and / or PCT / US03 / 05028, or a portion thereof. In one embodiment, the objective is any (eg, one or more) of the target sequences shown in Table II or a portion thereof. In another embodiment, the target is a siRNA, miRNA, or stRNA that corresponds to any (eg, one or more) target sequence, upper strand, or lower strand that is shown in table II or a portion thereof. In another embodiment, the target is any siRNA, miRNA, or stRNA that corresponds to any (eg, one or more) sequence corresponding to a sequence of this document or that is described in the United States Provisional Patent Application No. 60 / 363,124, USSN 10 / 923,536 and / or PCT / US03 / 05028. By "homologous sequence" is meant a nucleotide sequence shared by one or more polynucleotide sequences, such as genes, gene transcripts and / or non-coding polynucleotides. For example, a homologous sequence can be a nucleotide sequence shared by two or more genes encoding related but different proteins, such as different members of a gene family, different epitopes of the protein, different isoforms of proteins or completely divergent genes, such as as a cytokine and its corresponding receptors. A homologous sequence may be a sequence of nucleotides shared by two or more non-coding polynucleotides, such as non-coding DNA or RNA, regulatory sequences, introns, and sites of transcriptional control or regulation. Homologous sequences may also include conserved regions of the sequence, shared by more than one polynucleotide sequence. The homology does not have to be a perfect homology (eg, 100%), since partially homologous sequences are also contemplated in the present invention (eg, 99%, 98%, 97%, 96%, 95%, 94 %, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, etc.). By "conserved region of a sequence" is meant that a nucleotide sequence of one or more regions of a polynucleotide does not vary significantly between generations or from a biological system, subject, or organism to another biological system, subject, or organism . The polynucleotide can include both coding and non-coding DNA and RNA. By "coding region" is meant a nucleotide sequence of a siNA molecule that has complementarity with a non-coding region of the siNA molecule. In addition, the coding region of a siNA molecule can comprise a nucleic acid sequence having homology to a target nucleic acid sequence. In one embodiment, the coding region of the siNA molecule is called the coding strand or transient strand. By "non-coding region" is meant a nucleotide sequence of a siNA molecule that has complementarity with a target nucleic acid sequence. In addition, the non-coding region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity with a coding region of the siNA molecule. In one embodiment, the non-coding region of the siNA molecule is referred to as the non-coding strand or leader strand. By "target nucleic acid" or "target polynucleotide" is meant any nucleic acid sequence (e.g., any target and / or target route sequence) whose expression or activity is to be modulated. The target nucleic acid can be DNA or RNA. In one embodiment, a target nucleic acid of the invention is RNA or target DNA.

By "complementarity" is meant that a nucleic acid can form hydrogen bond (s) with another nucleic acid sequence either by the traditional Watson-Crick or by other non-traditional types as described herein. In one embodiment, a double-stranded nucleic acid molecule of the invention, such as a siNA molecule, wherein each strand is between 15 and 30 nucleotides in length, comprises between about 10% and about 100% (e.g. %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of complementarity between the two strands of the double-stranded nucleic acid molecule. In another embodiment, a double-stranded nucleic acid molecule of the invention, such as a siNA molecule, where one strand is the coding strand and the other strand is the non-coding strand, wherein each strand has between 15 and 30 nucleotides of length, comprises between at least about 10% and about 100% (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% ) of complementarity between the nucleotide sequence in the non-coding strand of the double-stranded nucleic acid molecule and the nucleotide sequence of its corresponding target nucleic acid molecule, such as a target RNA or target mRNA or viral RNA. In one embodiment, a double-stranded nucleic acid molecule of the invention, such as a siNA molecule, wherein one strand comprises the nucleotide sequence that is referred to as the coding region and the other strand comprises a nucleotide sequence that is referred to as the non-coding region , wherein each strand is between 15 and 30 nucleotides in length, comprises between about 10% and about 100% (e.g., about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of complementarity between the coding region and the non-coding region of the double-stranded nucleic acid molecule. In reference to the nucleic acid molecules of the present invention, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to be produced, for example, the RNAi activity. The determination of free binding energies for nucleic acid molecules is well known in the art (see, for example, Turner et al., 1987, CSH Symp. Quant. Biol. Lll pages 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA 83: 9373-9377; Turner et al., 1987, J. Am. Chem. Soc. 109: 3783-3785). A percentage of complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., pairing of Watson-Crick bases) with a second nucleic acid sequence (e.g., 5, 6, 7). , 8, 9 or 10 nucleotides of a total of 10 nucleotides in the first oligonucleotide that is paired with a second nucleic acid sequence having 10 nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100% of complementarity respectively). In one embodiment, a siNA molecule of the invention has a perfect complementarity between the coding strand or coding region and the non-coding strand or non-coding region of the siNA molecule. In one embodiment, a siNA molecule of the invention is perfectly complementary to a corresponding target nucleic acid molecule. "Perfectly complementary" means that all contiguous residues of a nucleic acid sequence will form hydrogen bonds with the same number of contiguous residues of a second nucleic acid sequence. In one embodiment, a siNA molecule of the invention comprises from about 15 to about 30 or more (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24. 25, 26, 27 , 28, 29 or 30 or more) nucleotides that are complementary to one or more target nucleic acid molecules or a portion thereof. In a modality, a siNA molecule of the invention has partial complementarity (ie, less than 100% complementarity) between the coding strand or coding region and the non-coding strand or non-coding region of the siNA molecule or between the non-coding strand or non-coding region of the siNA molecule and a corresponding target nucleic acid molecule. For example, partial complementarity can include various mismatches or unmatched nucleotides (eg, 1, 2, 3, 4, 5 or more mismatches or unmatched nucleotides) in the structure of the siNA that can produce bumps, loops, or hangings that occur between the coding strand or coding region and the non-coding strand or non-coding region of the siNA molecule or between the non-coding strand or non-coding region of the siNA molecule and a corresponding target nucleic acid molecule.

In one embodiment, a double-stranded nucleic acid molecule of the invention, such as the siNA molecule, has perfect complementarity between the coding strand or coding region and the non-coding strand or non-coding region of the nucleic acid molecule. In one embodiment, the double-stranded nucleic acid molecule of the invention, such as the siNA molecule, is perfectly complementary to a corresponding target nucleic acid molecule. In one embodiment, the double-stranded nucleic acid molecule of the invention, such as the siNA molecule, has partial complementarity (ie, less than 100% complementarity) between the coding strand or coding region and the non-coding strand or non-coding region. encoding the double-stranded nucleic acid molecule or between the non-coding strand or non-coding region of the nucleic acid molecule and a corresponding target nucleic acid molecule. For example, partial complementarity may include various mismatches or unmatched nucleotides (eg, 1, 2, 3, 4, 5 or more unpaired mismatches or nucleotides, such as nucleotide bumps) in the bi-chain nucleic acid molecule , structure that can produce protuberances, loops, or hangings that occur between the coding strand or coding region and the non-coding strand or non-coding region of the double-stranded nucleic acid molecule or between the non-coding strand or non-coding region of the molecule double-stranded nucleic acid and a corresponding target nucleic acid molecule.

In one embodiment, the double-stranded nucleic acid molecule of the invention is a microRNA (miRNA). By "microRNA" or "miRNA" is meant a short double-stranded RNA that regulates the expression of target messenger RNAs either by mRNA cleavage, repression / translation inhibition or heterochromatic silencing (see for example Ambros, 2004, Nature, 431, 350-355; Bartelde 2004, Cell, 116, 281-297; Cullende 2004, Virus Research., 102, 3-9; He et al., 2004, Nat. Rev. Genet., 5, 522-531; Ying et al., 2004, gene, 342, 25-28; and Sethupathy et al., 2006, RNA, 12: 192-197). In one embodiment, the microRNA of the invention has partial complementarity (ie less than 100% complementarity) between the coding strand or coding region and the non-coding strand or non-coding region of the miRNA molecule or between the strand not encoding or non-coding region of the miRNA and a corresponding target nucleic acid molecule. For example, partial complementarity may include various mismatches or unpaired nucleotides (eg, 1, 2, 3, 4, 5 or more mismatches or unpaired nucleotides, such as protrusions of nucleotides) in the double-stranded nucleic acid molecule , structure that can produce protuberances, loops, or hangings that occur between the coding strand or coding region and the non-coding strand or non-coding region of the miRNA or between the non-coding strand or non-coding region of the miRNA and a molecule of corresponding target nucleic acid.

In one embodiment, the siNA molecules of the invention are used which down-regulate or reduce the expression of the target gene to prevent or treat diseases, disorders, conditions, or traits in a subject or organism as described herein or known by other means in the art. By "proliferative disease" or "cancer" as used herein is meant, any disease, condition, trait, genotype or phenotype characterized by unregulated cell growth or replication as is known in the art; which includes leukemias, for example, acute myelogenous leukemia (AML), chronic myelogenous leukemia (CML), acute lymphocytic leukemia (ALL), and chronic lymphocytic leukemia, AIDS-related cancers such as Kaposi's sarcoma; breast cancers; bone cancers such as osteosarcoma, chondrosarcomas, Ewing's sarcoma, fibrosarcomas, giant cell tumors, adamantinomas, and chordomas; brain cancers such as meningiomas, glioblastomas, lower grade astrocytomas, oligodendrocytomas, pituitary tumors, schwannomas, and metastatic brain cancers; cancers of the head and neck which include various lymphomas such as lymphoma of the cerebral cortex cells, non-Hodgkin's lymphoma, adenoma, squamous cell carcinoma, laryngeal carcinoma, gallbladder and choledococcal cancers, retinal cancers such as retinoblastoma, esophageal cancers, gastric cancers, multiple myeloma, ovarian cancer, uterine cancer, thyroid cancer, testicular cancer, endometrial cancer, melanoma, colorectal cancer, lung cancer, bladder cancer, prostate cancer, cancer lung (which includes non-amychocytic lung carcinoma), pancreatic cancer, sarcomas, Wilms tumor, cervical cancer, head and neck cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma, adenocarcinoma vesicle, parathyroid adenocarcinoma, endometrial sarcoma, cancers resistant to multiple drugs; and proliferative diseases and conditions, such as neovascularization associated with tumor angiogenesis, macular degeneration (eg, wet / dry AMD), neovascularization of the cornea, diabetic retinopathy, neovascular glaucoma, myopic degeneration and other diseases and proliferative conditions such as restenosis and polycystic kidney disease, and any other cancer or proliferative disease, condition, trait, genotype or phenotype that can respond to the modulation of gene expression related to the disease in a cell or tissue, alone or in combination with other therapies. By "inflammatory disease" or "inflammatory condition" as used herein is meant any disease, condition, trait, genotype or phenotype characterized by an inflammatory or allergic process as is known in the art, such as inflammation, acute inflammation, chronic inflammation, respiratory disease, atherosclerosis, psoriasis, dermatitis, restenosis, asthma, allergic rhinitis, atopic dermatitis, septic shock, rheumatoid arthritis, inflammatory bowel disease, pelvic inflammatory disease, pain, inflammatory eye disease, celiac disease, syndrome of Leigh, deficiency of glycerol kinase, familial eosinophilia (FE), autosomal recessive spastic ataxia, inflammatory disease of the larynx; tuberculosis, chronic coleocistitis, bronchiectasis, silicosis and other pneumoconiosis, and any other disease, inflammatory condition, trait, genotype or phenotype that may respond to the modulation of gene expression related to the disease in a cell or tissue, alone or in combination with other therapies By "autoimmune disease" or "autoimmune condition" as used herein is meant, any disease, condition, trait, genotype or phenotype characterized by autoimmunity as is known in the art, such as multiple sclerosis, diabetes mellitus, lupus, celiac disease, Crohn's disease, ulcerative colitis, Guillain-Barre syndrome, scleroderma, Goodpasture syndrome, Wegener's granulomatosis, autoimmune epilepsy, Rasmussen's encephalitis, primary biliary sclerosis, sclerosing cholangitis, autoimmune hepatitis, Addison's disease , Hashimoto's thyroiditis, fibromyalgia, Menier's syndrome; transplant rejection (eg, prevention of allograft rejection) pernicious anemia, rheumatoid arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's syndrome, lupus erythematosus, multiple sclerosis, myasthenia gravis, Reiter's syndrome, Grave's disease and any other disease, an autoimmune condition, trait, genotype or phenotype that can respond to the modulation of gene expression related to the disease in a cell or tissue, alone or combined with other therapies. By "infectious disease" is meant any disease, condition, trait, genotype or phenotype associated with an infectious agent, such as a virus, bacteria, fungus, prion or parasite. Non-limiting examples of various viral genes that can be targeted by siNA molecules of the invention include hepatitis virus (HCV, eg, GenBank access nJ: D11168, D50483.1, L38318 and S82227), hepatitis virus B (HBV, for example access nJ of GenBank AF100308.1), human immunodeficiency virus type 1 (HIV-1, for example access nJ from GenBank U51188), human immunodeficiency virus type 2 (HIV-2, for example GenBank access nJ X60667), West Nile virus (WNV for example GenBank access nJ NC_001563), cytomegalovirus (CMV for example GenBank access nJ NC_001347), respiratory syncytial virus (RSV for example access nJ from GenBank NC 001781), influenza virus (for example access nJ from GenBank AF037412, rhinovirus (for example, GenBank access nJ: D00239, X02316, X01087, L24917, M16248, K02121, X01087), papillomavirus (for example nJ from GenBank access NC 001353), Herpes simplex virus (HSV for example) the GenBank access nJ NC 001345), and other viruses such as HTLV (for example access nJ of GenBank AJ430458). Due to the high variability between the sequences of many viral genomes, the selection of siNA molecules for broad therapeutic applications would probably involve the conserved regions of the viral genome. Non-limiting examples of conserved regions of the viral genomes include but are not limited 5 'non-coding regions (NCR), 3' non-coding regions (NCR) and / or internal ribosome entry sites (IRES). SiNA molecules designed against conserved regions of various genomes will allow effective inhibition of viral replication in diverse patient populations and can ensure the efficacy of siNA molecules against quasi-viral species that evolve due to mutations in the unconserved regions of the viral genome . Non-limiting examples of bacterial infections include actinomycosis, anthrax, aspergillosis, bacteremia, infections and bacterial mycoses, Bartonella infections, botulism, brucellosis, Burkholderia infections, Campylobacter infections, candidiasis, cat scratch disease, Chlamydia infections, cholera, Clostridium infections, coccidioidomycosis, cross infection, cytococcosis, dermatomycosis, dermatomycosis, diphtheria, ehrlichiosis, Escherichia coli infections, fasciitis, necrosis, Fusobacterium infections, gangrene, gram negative bacteria infections, gram positive bacteria infections, histoplasmosis, impetigo, Klebsiella infections, legionellosis, leprosy, leptospirosis, Listeria infections, Lyme disease, maduromycosis, melioidosis, Mycobacterium infections, Mycoplasma infections, mycosis, Nocardia infections, onychomycosis, ornithosis, plague, pneumococcal infections, Pseudo infections monkeys, Q fever, rat bite fever, recurrent fever, rheumatic fever, Rickettsia infections, Rocky Mountain spotted fever, Salmonella infections, scarlet fever, typhus, septicemia, bacterial sexually transmitted diseases, bacterial skin diseases Staphylococcal infections, streptococcal infections, tetanus, diseases borne by ticks, tuberculosis, tularemia, typhoid fever, typhoid, epidemics transmitted by lice, Vibrio infections, treponematosis, Yersinia infections, zoonoses, and zygomycosis. Non-limiting examples of fungal infections include aspergillosis, blastomycosis, coccidioidomycosis, cryptococcosis, fungal infections of the nails of the hands and feet, fungal sinusitis, histoplasmosis, histoplasmosis, mucormycosis, fungal infection of the nails, paracoccidioidomycosis, sporotrichosis, valley fever (coccidioidomycosis), and mold allergy. By "neurological disease" is meant any disease, disorder, or condition affecting the central or peripheral nervous system, including ADHD, AIDS - Neurological complications, absence of Septum Pellucidum, acquired epileptiform aphasia, acute disseminated encephalomyelitis, adrenoleukodystrophy, agenesis of the Corpus Callosum, agnosia, Aicardi syndrome, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis, anencephaly, aneurysm, Angeman syndrome, angiomatosis, anoxia, aphasia, apraxia, arachnoid cysts, arachnoiditis, malformation of Arnold-Chiari, arteriovenous malformation, aspartame, Asperger syndrome, ataxia telangiectasia, ataxia, attention deficit hyperactivity disorder, autism, autonomic dysfunction, dorsalgia, Barth syndrome, Batten's disease, Behcet's disease, Bell's palsy, benign essential blepharospasm, benign focal amyotrophy, h benign intracranial hypertension, Bernhardt-Roth syndrome, Binswanger's disease, blepharospasm, Bloch-Sulzberger syndrome, brachial plexus lesions at birth, brachial plexus injuries, Bradbury-Eggleston syndrome, cerebral aneurysm, brain injury, brain tumors and of the spinal cord, Brown-Sequard syndrome, bulboespinal muscular atrophy, Canavan's disease, carpal tunnel syndrome, causalgia, cavernomas, cavernous angioma, cavernous malformation, central cervical cord syndrome, central cord syndrome, central pain syndrome, cephalic disorders, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral Beriberi, cerebral gigantism, cerebral hypoxia, cerebral palsy, brain-oculo-facio-skeletal syndrome, Charcot-Marie-Tooth disorder, Chiari malformation , chorea, choreoacanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne type II syndrome, Coffin Lowry syndrome, coma, including persistent vegetative state, complex regional pain syndrome, congenital facial dysplegia, congenital myasthenia, congenital myopathy, vascular malformations congenital cavernosa, corticobasal degeneration, cranial arteritis, craniosynostosis, Creutzfeldt-Jakob disease, accumulated traumatic disorders, Cushing's syndrome, inclusion disease of cytomegalic bodies (CIBD), cytomegalovirus infection, eye and foot syndrome, Dandy's syndrome Walquer, Dawson's disease, De Morsier's syndrome, Dejerine-Klumpke's palsy, dementia due to multiple infarctions, subcortical dementia, dementia with Lewy bodies, dermatomyositis, developmental dyspraxia, Devic's syndrome, diabetic neuropathy, diffuse sclerosis, Dravet's syndrome , disautonymy, dysgraphia, dyslexia, dysphagia, dyspraxia, dys nias, early infantile epileptic encephalopathy, Empty Sella syndrome, lethargic encephalitis, encephalitis and meningitis, encephaloceles, encephalopathy, encephalotrigémica angiomatosis, epilepsy, Erb's palsy, Erb-Duchenne and Dejerine-Klumpke palsy, Fabry's disease, Fahr's syndrome, fainting, familial dysautonomia, family hemangioma, basal ganglia calcification, familial idiopathy, familial spastic paralysis, febrile seizures (eg, FSGS and GEFS plus), Fisher syndrome, childhood Floppy syndrome, Friedreich's ataxia, Gaucher's disease, Gerstmann syndrome, Gerstmann-Straussler-Scheinker disease, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, Guillain-Barre syndrome, HTLV-1-associated myelopathy, Hallervorden-Spatz disease , cranial injury, headache, continuous hemicrania, hemifacial spasm, hemiplegia alterans , hereditary neuropathies, hereditary spastic paraplegia, polyneuritic heritable, herpes zoster oticus, Herpes Zoster, Hirayama syndrome, holoprosencephaly, Huntington's disease, hydranencephaly, hydrocephalus with normal pressure, hydrocephalus, hydromyelia, hypercortisolism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, myositis of inclusion of bodies, incontinence pigmenti, hypotonia of infancy, storage disease of phytalic acid of infancy, childhood Refsum disease, spasms in infancy, inflammatory myopathy, intestinal lipodystrophy, intracranial cysts, intracranial hypertension, Isaac, Joubert syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsbourne syndrome, Kleine-Levin syndrome, Klippel Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüver-Bucy syndrome, Korsakoff amnestic syndrome , Krabbe disease, Kugelberg-Welander disease, Kuru, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffner Syndrome, Lateral Femoral Cutaneous Nerve Compression, Lateral Spinal Syndrome, Learning Disabilities, Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome, Leukodystrophy, Syndrome Levine-Critchley, dementia with Lewy bodies, lissencephaly, cloistered syndrome, Lou Gehrig's disease, neurological sequelae of lupus, neurological complications of Lyme disease, Machado-Joseph's disease, macroencephaly, megaencephaly, Melkersson-Rosenthal syndrome, meningitis, Menkes disease, meralgia paresthetica, metachromatic leukodystrophy, microcephaly, migraine, Miller Fisher syndrome, mini-stroke, mitochondrial myopathies, Mobius syndrome, monomelic amyotrophy, motor neuron diseases, Moyamoya disease, mucolipidosis, mucopolysaccharidosis, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, atrophy multisystemic with orthostatic hypotension, multisystemic atrophy, muscular dystrophy, myasthenia congenita, myasthenia gravis, myelinclastic diffuse sclerosis, childhood myoclonic encephalopathy, myoclonus, congenital myopathy, thyrotoxic myopathy, myopathy, congenital myotonia, myotonia, narcolepsy, neuroacanthocytosis, neurodegeneration with cerebral accumulation of iron, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological manifestations of Pompe disease, neuromyelitis optics, neuromyotonia, neuronal ceroid lipofuscinosis, neuronal migration disorders, hereditary neuropathy, neurosarcoidosis, neurotoxicity, cavernous nevus, Niemann's disease Pick, O'Sullivan-McLeod syndrome, occipital neuralgia, occult spinal dysraphism sequence, Ohtahara syndrome, olivopontocerebellar atrophy, myoclonus opsoclonus, orthostatic hypotension, excessive use syndrome, chronic pain, paraneoplastic omes, paresthesia, Parkinson's disease, congenital parmiotony, paroxysmal choreoathetosis, paroxysmal hemicrania, Parry-Romberg, Pelizaeusmerozbacher disease, Pena Shokeir II syndrome, perineural cysts, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, generalized disorders of development, phytanic acid storage disease, Pick disease, piriformis syndrome, pituitary tumors, polymyositis, Pompe disease, porencephaly, post-polio syndrome, postherpetic neuralgia, postinfectious encephalomyelitis, postural hypotension, postural orthostatic tachycardia syndrome, postural tachycardia syndrome, primary lateral sclerosis, prion diseases, progressive hemifacial atrophy, progressive locomotor ataxia, progressive multifocal leukoencephalopathy, progressive sclerosing polydystrophy, progressive supranuclear palsy, pseudotumor cereb ral, pyridoxine-dependent seizure disorders that respond to pyridoxine, Ramsay Hunt syndrome type I, Ramsay Hunt syndrome type II, Rasmussen encephalitis and other autoimmune epilepsies, reflex sympathetic dystrophy syndrome, Refsum disease - childhood Refsum disease, repetitive kinetic disorders, repetitive stress injuries, restless legs syndrome, associated myelopathy a retrovirus, Rett syndrome, Reye syndrome, Riley-day syndrome, SUNCT headache, cysts in the sacral nerve root, San Vito dance, salivary gland disease, Sandhoff's disease, Schilder's disease, schizoencephaly, disorders of attacks, septo-optic dysplasia, severe myoclonic epilepsy of childhood (SMEI), battered child syndrome, zoster, Shy-Drager syndrome, Sjogren's syndrome, sleep apnea, sleeping sickness, Soto syndrome, spasms, spine bifida, spinal cord infarct, spinal cord injury, spinal cord tumors, spinal muscular atrophy, spinocerebellar atrophy, yes Steele-Richardson-Olszewski syndrome, Stiff-Person syndrome, striatonigral degeneration, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subcortical atherosclerotic encephalopathy, swallowing disorders, Sydenham chorea, syncope, syphilitic spinal sclerosis, siringohydromielia, syringomyelia , systemic lupus erythematosus, tabes dorsalis, tardive dyskinesia, Tarlov cysts, Tay-Sachs disease, temporal arteritis, anchored spinal cord syndrome, Thomsen's disease, thoracic opening syndrome, thyrotoxic myopathy, painful tic, Todd's palsy , Tourette's syndrome, transient ischemic attack, transmissible spongiform encephalopathies, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraparesis, tuberous sclerosis, erectile vascular tumor, vasculitis that includes temporal arteritis, Von Econome disease, disease of Von Hippel-Lindau (VHL), enf Von Reckiinghausen syndrome, Wallenberg syndrome, Werdnig-Hoffman disease, Wernicke-Korsakoff syndrome, West syndrome, Whipple's disease, Williams syndrome, Wilson's disease, spinal and bulbar muscular atrophy linked to the X chromosome, and Zellweger With "respiratory disease" is meant any disease or condition affecting the respiratory tract, such as asthma, chronic obstructive pulmonary disease or "COPD", allergic rhinitis, sinusitis, pulmonary vasoconstriction, inflammation, allergies, impaired respiration, dyspnoea syndrome, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, and any other disease, condition, trait, genotype, or respiratory phenotype that can respond to the modulation of gene expression related to the disease in a cell or tissue, alone or in combination with other therapies .

By "ocular disease" as used herein is meant, any disease, condition, trait, genotype or phenotype of the eye and related structures as known in the art, such as cystic edema, asteroid hyalosis, myopia pathological and posterior staphyloma, toxocariasis (ocular larva migrans), retinal vein occlusion, posterior vitreous detachment, reticular pull by traction, epiretinal membrane, diabetic retinopathy, matrix degeneration, retinal vein occlusion, retinal artery occlusion, macular degeneration (eg, macular degeneration related to aging such as wet AMD or dry AMD), toxoplasmosis, choroidal melanoma, acquired retinoschisis, Hollenhorst's plague, idiopathic central serous chorioretinopathy, macular hole, presumed ocular histoplasmosis syndrome, macroaneurysm retinal, tetinitis pigmentosa, retinal detachment, hypertensive retinopathy, detachment of the retinal pigmented epithelium (RPE), papilloflebitis, ocular ischemic syndrome, Coats disease, Leber iliary aneurysm, conjunctival neoplasms, allergic conjunctivitis, seasonal conjunctivitis, acute bacterial conjunctivitis, allergic conjunctivitis and seasonal keratoconjunctivitis, viral conjunctivitis, bacterial conjunctivitis, conjunctivitis due to chlamydia and gonococci, laceration of the conjunctiva, episcleritis, scleritis, pingueculitis, pterygium, upper limbic keratoconjunctivitis (SLK of Theodore), toxic conjunctivitis, conjunctivitis with pseudomembrane, conjunctivitis of the giant papillary, marginal degeneration of Terrien, keratitis by acanthamoeba, fungal keratitis, filamentous keratitis, bacterial keratitis, dry keratitis / dry eye syndrome, bacterial keratitis, herpes simplex keratitis, sterile corneal infiltrations, flictenulosis, corneal abrasion & recurrent corneal erosion, foreign body in the cornea, chemical burns, epithelial basal membrane dystrophy (EBMD), keratopathy by superficial puncture of Thygeson, corneal laceration, nodular degeneration of Salzmann, Fuchs endothelial dystrophy, subluxation of the lens of the Crystalline, Ciliary-Block glaucoma, primary open angle glaucoma, pigmentary dispersion syndrome and pigmentary glaucoma, pseudoexfoliation syndrome and pseudoesfoliative glaucoma, anterior uveitis, primary open angle glaucoma, uveitis glaucoma and galucomatocyclic crisis, pigmentary dispersion syndrome & amp;; pigmentary glaucoma, acute angle closure glaucoma, anterior uveitis, hyphema, angle recession glaucoma, lenticular induced glaucoma, pseudoexfoliation syndrome and pseudoexfoliation glaucoma, Axenfeld-Rieger syndrome, neovascular glaucoma, pars planitis, choroidal rupture, syndrome of Duane retraction, toxic / nutritional optic neuropathy, aberrant cranial nerve regeneration III, intracranial mass lesions, fistula of the cavernous sinuses of the carotids, anterior ischemic optic neuropathy, edema of the optic discs and papilledema, paralysis of the par lll of cranial nerves, paralysis of the IV pair of cranial nerves, paralysis of the cranial nerve VI pair, ciliary nerve paralysis of the cranial nerves (facial nerve), Horner syndrome, internuclear ophthalmoplegia, cranial hypoplasia of the optic nerve, optic fossa, tonic pupil , Drusen cranial of the optic nerve, demyelinating optic neuropathy (neuritis opti ca, retrobulbar optic neuritis), amaurosis fugax and transient ischemic attack, pseudotumor cerebri, pituitary adenoma, molluscum contagiosum, canaliculitis, wart and papilloma, pediculosis, pyrithiasis, blepharitis, hordeolum, presellic cellulitis, chalazion, basal cell carcinoma, herpes ophthalmic zoster, pediculosis and pyrithiasis, open fracture, chronic epiphora, dacryocystitis, herpes simplex blepharitis, orbital cellulitis, senile entropion and squamous cell carcinoma. By "dermatological disease" is meant any disease or condition of the skin, dermis, or any of its substructures such as hair, follicles, etc. Diseases, disorders, conditions, and dermatological features can include psoriasis, ectopic dermatitis, skin cancers such as melanoma and basal cell carcinoma, hair loss, hair removal, pigmentation disorders, and any other disease, condition, or trait. associated with the skin, dermis, or their structures. By "auditory disease" is meant any disease or condition of the auditory system, which includes the ear, such as the inner ear, the middle ear, the outer ear, the auditory nerve and any of its substructures. Diseases, disorders, conditions, and auditory features may include hearing loss, deafness, tinnitus, Meniere's disease, vertigo, balance and kinetic disorders, and any other disease, condition, or trait associated with the ear or its structures.

By "metabolic disease" is meant any disease or condition that affects the metabolic pathways as is known in the art. Metabolic disease can cause an abnormal metabolic process, either congenital due to an inherited enzymatic abnormality (congenital metabolic errors) or acquired due to an endocrine organ disease or insufficiency of a metabolically important organ such as the liver. In one embodiment, the metabolic disease includes hyperlipidemia, hypercholesterolemia, cardiovascular disease, atherosclerosis, hypertension, diabetes (e.g., type I and / or type II diabetes), insulin resistance, and / or obesity. By "cardiovascular disease" is meant a disease or condition affecting the heart and vasculature, including, but not limited to, coronary heart disease (CHD), cerebrovascular disease (CVD), aortic stenosis, peripheral vascular disease, atherosclerosis, arteriesclerosis, myocardial infarction (heart attack), cerebrovascular diseases (stroke), transient ischemic attacks (TIA), angina (stable and unstable), atrial fibrillation, arrhythmia, valve disease, congestive heart failure, hypercholesterolemia, hyperlipoproteinemia type I, type II hyperlipoproteinemia, type III hyperlipoproteinemia, type IV hyperlipoproteinemia, type V hyperlipoproteinemia, secondary hypertriglyceridemia, and familial lecitin cholesterol acyltransferase deficiency.

In one embodiment of the present invention, each sequence of a siNA molecule of the invention independently has from about 15 to about 30 nucleotides in length, in specific embodiments about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In another embodiment, the double-stranded siNA molecules of the invention independently comprise from about 15 to about 30 base pairs (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30). In another embodiment, one or more strands of the siNA molecule of the invention independently comprises from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) that are complementary to a target nucleic acid molecule. In yet another embodiment, the siNA molecules of the invention comprising fork or circular structures are from about 35 to about 55 (eg, about 35, 40, 45, 50 or 55) nucleotides in length, or from about 38 to about 44 (e.g., about 38, 39, 40, 41, 42, 43 or 44) nucleotides in length and comprise from about 15 to about 25 (e.g., about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or 25) base pairs. The exemplary siNA molecules of the invention are shown in Table II and / or Figures 3A-3F and 4A-4F.

As used herein, "cell" is used in its usual biological sense and does not refer to a complete multicellular organism, for example, it does not specifically refer to a human being. The cells may be present in an organism, for example, birds, plants and mammals such as humans, cows, sheep, apes, monkeys, pigs, dogs and cats. The cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell). The origin of the cell can be somatic or germinal, totipontent or pluripotent, divisible or not. The cell can also be derived or it can comprise a gamete or embryo, a stem cell or a differentiated cell. The cell may be an isolated cell, a purified cell, or a substantially purified cell as generally recognized in the art. The siNA molecules of the invention are added directly, or can form complexes with cationic lipids, enter into liposomes, or administer by other means to the target cells or tissues. The nucleic acid or nucleic acid complexes can be administered locally to the relevant tissues ex vivo, or in vivo by local administration to the lung, incorporated or not to biopolymers. In particular embodiments, the nucleic acid molecules of the invention comprise sequences shown in Table II and / or in Figures 3A-3F and 4A-4F. Examples of said nucleic acid molecules consist essentially of sequences that are defined in these tables and figures. In addition, the chemically modified constructs described in Table I and the lipid nanoparticle (LNP) formulations shown in Table IV can be applied to any siNA sequence or group of siNA sequences of the invention. In another aspect, the invention provides mammalian cells that contain one or more siNA molecules of this invention. The one or more siNA molecules can be directed independently to the same site or to different sites within an objective polynucleotide of the invention. By "RNA" is meant a molecule comprising at least one ribonucleotide residue. By "ribonucleotide" is meant a nucleotide with a hydroxyl group at the 2 'position of a β-D-ribofuranose residue. The terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from natural RNA by addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations may include the addition of non-nucleotide material, such as to the (s) end (s) of the siNA or internally, for example in one or more nucleotides of the RNA. The nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, such as non-natural nucleotides or nucleotides or deoxynucleotides chemically synthesized. These altered RNAs can be referred to as analogues or analogs of natural RNA.

By "subject" is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. "Subject" also refers to an organism to which the nucleic acid molecules of the invention can be administered. A subject can be a mammal or mammalian cells, which includes a human or human cell. In one embodiment, the subject is a baby (for example, subjects who are less than 1 month old, or 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, or 12 months). In one modality, the subject is a child (for example, 1, 2, 3, 4, 5 or 6 years old). In one embodiment, the subject is an elder (for example, anyone with an age of about 65 years). By "chemical modification" as used herein is meant any modification of the chemical structure of the nucleotides that differs from the nucleotides of siRNA or native RNA. The term "chemical modification" encompasses the addition, substitution, or modification of nucleosides and nucleotides of native siRNA or RNA with modified nucleosides and nucleotides as described herein or as known by other means in the art. Non-limiting examples of such chemical modifications include without limitation compositions having any of Formulas I, II, III, IV, V, VI, or VII of the present document, internucleotide linkages of phosphothioate, 2'-deoxyribonucleotides, 2'-O- methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, 4'-thio ribonucleotides, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides (see for example USSN 10/981, 966 filed November 5, 2004, which is incorporated by reference herein), FANA, "universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, incorporation of terminal glyceryl and / or inverted deoxyabasic moieties, or a modification having any of Formulas I-VII of this document. In one embodiment, the nucleic acid molecules of the invention (eg, dsRNA, siNA etc.) are partially modified (eg, modified about 5%, 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) with chemical modifications. In another embodiment, the nucleic acid molecules of the invention (eg, dsRNA, siNA etc.) are completely modified (eg, modified by approximately 100%) with chemical modifications. The term "phosphorothioate" as used herein refers to an internucleotide linkage having Formula I, wherein Z and / or W comprise a sulfur atom. Therefore, the term phosphorothioate refers to internucleotide linkages of both phosphorothioate and phosphorodithioate. The term "phosphonoacetate" as used herein refers to an internucleotide linkage having Formula I, wherein Z and / or W comprise a protected acetyl or acetyl group. The term "thiophosphonoacetate" as used herein refers to an internucleotide linkage having the Formula I, wherein Z comprises an acetyl or protected acetyl group and W comprises a sulfur atom or alternatively W comprises a acetyl or protected acetyl group and Z comprises a sulfur atom. The term "universal base" as used herein refers to nucleotide base analogs that form base pairs with each of the natural DNA / RNA bases with little discrimination between them. Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole such as known in the art (see for example Loakes, 2001, Nucleic Acid Research, 29, 2437-2447). The term "aciche nucleotide" as used herein refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (C1, C2, C3, C4, or C5), are independently or in a combined form absent from the nucleotide. The nucleic acid molecules of the present invention, individually, or in combination or together with other drugs, can be used to prevent or treat diseases, disorders, conditions, and features described herein or known by other means in the art, in a subject or organism. In one embodiment, the siNA molecules of the invention can be administered to a subject or can be administered to other appropriate cells apparent to those skilled in the art, individually or in combination with one or more drugs under conditions suitable for treatment. In a further embodiment, the siNA molecules can be used in combination with other known treatments to prevent or treat diseases, disorders, or conditions in a subject or organism. For example, the molecules described could be used in combination with one or more compounds, treatments, or methods known to prevent or treat diseases, disorders, conditions, and features described herein in a subject or organism as is known in the art. The technique. In one embodiment, the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention, in a manner that allows expression of the siNA molecule. For example, the vector may contain sequence (s) encoding both strands of a siNA molecule comprising a double-stranded molecule. The vector may also contain sequence (s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule. Non-limiting examples of said expression vectors are described in Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, oniine doi publication: 10.1038 / nm725.

In another embodiment, the invention features a mammalian cell, e.g., human cell, that includes an expression vector of the invention. In yet another embodiment, the expression vector of the invention comprises a sequence for a siNA molecule that has complementarity with an RNA molecule referred to by the GenBank access nJ, for example the GenBank access nJ which are described herein or in U.S. Provisional Patent Application No. 60 / 363,124, USSN 10 / 923,536 and / or PCT / US03 / 05028. In one embodiment, an expression vector of the invention comprises a nucleic acid sequence encoding two or more siNA molecules, which may be the same or different. In another aspect of the invention, the siNA molecules that interact with target RNA molecules and down-regulate the gene encoding the target RNA molecules (e.g. target RNA molecules referred to by the access nJ of GenBank in the present document) are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be plasmids or viral DNA vectors. Viral vectors expressing siNA can be constructed based, but not limited, on adeno-associated viruses, retroviruses, adenoviruses, or alphaviruses. Recombinant vectors capable of expressing siNA molecules can be administered as described herein, and persist in target cells. Alternatively, viral vectors that provide transient expression of the siNA molecules can be used. Such vectors can be administered repeatedly if necessary. Once expressed, siNA molecules bind and down regulate gene function or expression by RNA interference (RNAi). The administration of vectors expressing siNA can be systemic, such as by intravenous or intramuscular administration, by administration to explanted target cells of a subject followed by reintroduction into the subject, or by any other means that could allow their introduction into the desired target cells . By "vectors" is meant any nucleic acid and / or virus-based technique that is used to deliver a desired nucleic acid. Other features and advantages of the invention will be obvious from the following description of the preferred embodiments thereof and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a mass spectrum by MALDI-TOF of a purified siNA double-stranded molecule synthesized by a method of the invention. The two peaks shown correspond to the predicted mass of the separated strands of the siNA sequence. This result demonstrates that the siNA double-stranded molecule generated from tandem synthesis can be purified as a single entity using a simple trityl purification methodology. Figure 2 shows a proposed non-limiting mechanistic representation of the degradation of the target RNA involved in the RNAi. Double-stranded RNA (dsRNA), which is generated by RNA-dependent RNA polymerase (RdRP) of the exogenous single-stranded RNA, for example viral, transposon or exogenous RNA, activates the DICER enzyme (Plasterk, 2002, Science, 296, 1263-1265 ) which in turn generates double-stranded siNA molecules. Alternatively, synthetic siNA or expressed directly in a cell can be introduced by appropriate means. An active siNA complex is formed that recognizes a target RNA, causing the degradation of target RNA by the endonuclease complex and RISC or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and produce additional siNA molecules, thereby amplifying the RNAi response. Figures 3A-3F show non-limiting examples of chemically modified siNA constructs of the present invention. In the figure, N represents any nucleotide (adenosine, guanosine, cytosine, uridine, or optionally thymine, for example, thymine may be substituted in the hanging regions which are marked by parentheses (NN). Various modifications are shown for the coding and non-coding strands of the siNA constructs The nucleotide (NN) positions can be chemically modified as described herein (eg, 2'-O-methyl, 2'-deoxy-2'-fluoro etc.) and can be derived from A corresponding target nucleic acid sequence or not (see for example Figure 5C) In addition, the sequences shown in Figures 3A-3F may optionally include a ribonucleotide in the 9th position from the 5 'end of the coding strand or 11a position based on the 5 'end of the leader strand counting 11 nucleotide positions from the 5' end of the leader strand (see Figure 5C) Figure 3A: the coding strand comprises 21 nucleotides in which the two nucleotides of the 3 'end are optionally paired and in which all the nucleotides present are ribonucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein document. The non-coding strand comprises 21 nucleotides, which optionally have a glyceryl residue at the 3 'end in which the two 3' end nucleotides are optionally complementary to the target RNA sequence, and in which all nucleotides present are ribonucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein, which is designated "s", optionally connects the nucleotides (N N) of the non-coding strand. Figure 3B: the coding strand comprises 21 nucleotides in which the two nucleotides of the 3 'end are optionally paired and in which all the pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all the Purine nucleotides that may be present are modified 2'-O-methyl nucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The non-coding strand comprises 21 nucleotides, optionally has a glyceryl residue at the 3 'end and wherein the two nucleotides of the 3' end are optionally complementary to the target RNA sequence, and wherein all the pyrimidine nucleotides that can be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are modified 2'-O-methyl nucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, bases universal, or other chemical modifications described in this document. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein, which is designated "s", optionally connects the nucleotides (N N) of the coding and non-coding strand.

Figure 3C: the coding strand comprises 21 nucleotides having 5"and 3 'terminal cap moieties in which the two nucleotides of the 3' end are optionally paired and in which all the pyrimidine nucleotides that may be present are nucleotides of 2 '-O-methyl or 2'-deoxy-2'-fluoro modified except for nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.The non-coding strand comprises 21 nucleotides , optionally has a glyceryl residue at the 3 'end and wherein the two nucleotides of the 3' end are optionally complementary to the target RNA sequence, and wherein all the pyrimidine nucleotides that may be present are 2 'nucleotides -deoxy-2'-fluoro modified except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described in this document. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein, which is designated "s", optionally connects the nucleotides (N N) of the non-coding strand. Figure 3D: the coding strand comprises 21 nucleotides having 5 'and 3' terminal cap moieties in which the two nucleotides of the 3 'end are optionally paired and in which all the pyrimidine nucleotides that may be present are nucleotides of 2 '-deoxy-2'-fluoro modified except for nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and in which and all purine nucleotides that may be present are 2'-deoxy nucleotides. The non-coding strand comprises 21 nucleotides, optionally has a glyceryl residue at the 3 'end and wherein the two nucleotides of the 3' end are optionally complementary to the target RNA sequence, in which all the pyrimidine nucleotides that can be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are modified 2'-O-methyl nucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases , or other chemical modifications described in this document. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein, which is designated "s", optionally connects the nucleotides (N N) of the non-coding strand. Figure 3E: the coding strand comprises 21 nucleotides having 5 'and 3' terminal cap moieties in which the two nucleotides of the 3 'end are optionally paired and in which all the pyrimidine nucleotides that may be present are nucleotides of 2 '-deoxy-2'-fluoro modified except for nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The non-coding strand comprises 21 nucleotides, optionally has a glyceryl residue at the 3 'end and wherein the two nucleotides of the 3' end are optionally complementary to the target RNA sequence, and wherein all the pyrimidine nucleotides that can be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are modified 2'-O-methyl nucleotides except nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, bases universal, or other chemical modifications described in this document. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein., which is designated "s", optionally connects the nucleotides (N N) of the non-coding strand. Figure 3F: the coding strand comprises 21 nucleotides having 5 'and 3' terminal cap moieties in which the two nucleotides of the 3 'end are optionally paired and in which all the pyrimidine nucleotides that may be present are nucleotides of 2 '-deoxy-2'-fluoro modified except for nucleotides (NN), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and in which and all purine nucleotides that may be present are 2'-deoxy nucleotides. The non-coding strand comprises 21 nucleotides, optionally has a glyceryl residue at the 3 'end and wherein the two nucleotides at the 3' end are optionally complementary to the target RNA sequence, and have an internucleotide phosphorothioate link at the end 3 'and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-deoxy nucleotides except nucleotides (NN) ), which may comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate linkage, phosphorodithioate or other modified internucleotide linkage as described herein, which is designated "s", optionally connects the nucleotides (N N) of the non-coding strand. The non-coding strand of A-F constructs comprises a sequence complementary to any target nucleic acid sequence of the invention. In addition, when there is a glyceryl residue (L) at the 3 'end of the non-coding strand for any construction shown in Figures 3A-3F, the modified internucleotide linkage is optional. Figures 4A-4F show non-limiting examples of specific chemically modified siNA sequences of the invention. A-F applies the chemical modifications described in Figures 3A-3F to an exemplary siNA sequence. Such chemical modifications can be applied to any siNA sequence for any purpose. In addition, the sequences shown in Figure 5 may optionally include a ribonucleotide at the 9th position from the 5 'end of the coding strand or the 11th position based on the 5' end of the leader strand counting 11 nucleotide positions from of the 5 'end of the guide strand (see Figure 5C). In addition, the sequences shown in Figures 4A-4F can optionally include terminal ribonucleotides up to about 4 positions at the 5 'end of the non-coding strand (eg, about 1, 2, 3 or 4 terminal ribonucleotides at the 5-terminal end). 'of the non-coding strand). Figures 5A-5C show non-limiting examples of different siNA constructs of the invention. The examples shown in Figure 5A (constructions 1, 2, and 3) have 19 representative base pairs; however, the different embodiments of the invention include any number of base pairs that are described herein. The regions between square brackets represent nucleotide draperies, for example, comprising approximately 1, 2, 3 or 4 nucleotides in length, preferably approximately 2 nucleotides. Constructs 1 and 2 can be used independently to obtain RNAi activity. The construct 2 may comprise a polynucleotide or non-polynucleotide linkage, which may optionally be designed as a biodegradable linker. In one embodiment, the loop structure shown in construct 2 may comprise a biodegradable linker that results in the formation of construct 1 in vivo and / or in vitro. In another example, construction 3 can be used to generate construction 2 under the same principle in which a linker is used to generate the active siNA 2 construct in vivo and / or in vitro, which optionally can use another biodegradable linker to generate the active construction of siNA 1 in vivo and / or in vitro. Thus, the stability and / or activity of the siNA constructs can be modulated based on the design of the siNA construct for in vitro or in vitro use. The examples shown in Figure 5B represent different variations of the double-stranded nucleic acid molecule of the invention, such as microRNAs, which may include hangings, protuberances, loops, and stems with loops caused by partial complementarity. Said motifs having protuberances, loops, and stems with loops are generally characteristic of the miRNA. The protuberances, loops, and stems with loops can be produced by any degree of partial complementarity, such as mismatches or protrusions of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides in one or both strands of the double-stranded nucleic acid molecule of the invention. The example shown in Figure 5C depicts a model double-stranded nucleic acid molecule of the invention comprising a double-stranded 19-base pair molecule of two 21-nucleotide sequences having 3 'dinucleotide scaffolds. The upper strand (1) represents the coding strand (transient strand), the middle strand (2) represents the non-coding strand (leader strand), and the lower strand (3) represents an objective sequence of polynucleotides. Dinucleotide (NN) draperies may comprise sequences derived from the target polynucleotide. For example, the 3 '- (NN) sequence in the leader strand may be complementary to the 5' - [NN] sequence of an objective polynucleotide. In addition, the 5 '- (NN) sequence of the transient strand may comprise the same sequence as the 5' - [NN] sequence of the target polynucleotide sequence. In other embodiments, the hangings (NN) are not derived from the target polynucleotide sequence, for example where the 3 '- (NN) sequence in the leader strand is not complementary to the 5' - [NN] sequence of the target polynucleotide and the 5 '- (NN) sequence of the transient strand may comprise a sequence different from the 5' - [NN] sequence of the target polynucleotide sequence. In additional embodiments, any nucleotides (NN) are chemically modified, for example, with modifications 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or others herein. In addition, the transient strand may comprise a ribonucleotide N position of the transient strand. For the 21-double-stranded double molecule of representative 19 base pairs shown, the N position can have 9 nucleotides from the 3 'end of the transient strand. However, in double-stranded molecules of different length, the N-position is determined based on the 5 'end of the leader strand by counting 11 nucleotide positions from the 5' end of the leader strand and choosing the corresponding matched nucleotide of the passing strand. . Cleavage by Ago2 occurs between positions 10 and 11 as indicated by the arrow. In additional modalities, there are two ribonucleotides, NN, at positions 10 and 11 based on the 5 'end of the leader strand counting 10 and 11 nucleotide positions from the 5' end of the leader strand and choosing the corresponding pitted nucleotides of the transient strand. In this figure, the guide strand is complementary to the target sequence and the transient strand is complementary to the guide strand. The paired nucleotides (NN) in the leader strand can be complementary to the nucleotides [NN] in the target sequence. Paired nucleotides (NN) in the transient strand may comprise nucleotides [NN] in the target sequence. The N position of the transient strand may comprise a ribonucleotide. For the double 21 of the representative base pair 19, the N position is 9 nucleotides in the form of the 3 'end of the transient strand. However, in doubles having different lengths, the N position is determined based on the 5 'end of the leader strand by counting 11 nucleotide positions in the form of the 5' terminus of the leader strand and collecting the corresponding bastard nucleotide at the 5 'end. the passing thread. The cleavage by Ago2 is carried out between positions 10 and 11 as indicated by the arrow. Representative nucleotide 2 pendants are shown, but may vary, for example, from 0 to about 4 nucleotides. B = terminal cover that may be present or absent. This generalized motif can be applied to all S00-34 chemicals herein.

Figures 6A-6C is a diagrammatic representation of a scheme that is used to generate an expression cassette to generate hairpin siNA constructs. Figure 6A: A DNA oligomer is synthesized with a sequence with a 5 'restriction site (R1) followed by a region having an identical sequence (siNA coding region) to a predetermined target sequence, wherein the coding region it comprises, for example, about 19, 20, 21 or 22 nucleotides (N) in length, followed by a looped sequence of defined sequence (X), comprising, for example, from about 3 to about 10 nucleotides. Figure 6B: The synthetic construct is then extended by DNA polymerase generating a hairpin structure having a self-complementary sequence that will produce a siNA transcript having specificity for an objective sequence and having self-complementary coding and non-coding regions. Figure 6C: The construct is heated (for example to about 95 ° C) to linearize the sequence, thus allowing the extension of a second strand of complementary DNA using a primer for the 3 'restriction sequence of the first strand. The double-stranded DNA is then inserted into a suitable vector for expression in cells. The construct can be designed in such a way that a nucleotide coating at the 3 'end of the transcript is produced, for example, by designing restriction sites and / or using a poly-U cap region as described in Paul et al., 2002, Nature Biotechnology, 29, 505-508. Figures 7A-7C are a diagrammatic representation of a scheme that is used to generate an expression cassette to generate double-stranded siNA constructs. Figure 7A: A DNA oligomer with a sequence with a 5 'restriction site (R1) is synthesized followed by a region having an identical sequence (siNA coding region) to a predetermined target sequence, wherein the coding region it comprises, for example, about 19, 20, 21 or 22 nucleotides (N) in length, followed by a 3 'restriction site (R2) which is adjacent to a looped sequence of defined sequence (X). Figure 7B: The synthetic construct is then extended by the DNA polymerase generating a hairpin structure having a self-complementary sequence. Figure 7C: The construction is processed by restriction enzymes specific for R1 and R2 generating a double-stranded DNA that is then inserted into an appropriate vector for expression in cells. The transcription cassette is designed in such a way that an U6 promoter region flanks each side of the dsDNA that generates the coding and non-coding strands separated from the siNA. Termination sequences in poly T can be added to generate U-couplings in the resulting transcript.

Figures 8A-8E are a diagrammatic representation of a method that is used to determine the target sites for U-mediated RNAi in a particular target nucleic acid sequence, such as messenger RNA. Figure 8A: a set of siNA oligonucleotides is synthesized in which the non-coding region of the siNA constructs has complementarity with target sites along the target nucleic acid sequence, and wherein the coding region comprises the complementary sequence to the non-coding region of the siNA. Figure 8B &C: (Figure 8B) the sequences are pooled and inserted into vectors such that (Figure 8C) the transfection of a vector into the cells produces the expression of the siNA. Figure 8D: the cells are separated based on the phenotypic change that is associated with the modulation of the target nucleic acid sequence. Figure 8E: the siNA is isolated from the separated cells and sequenced to identify efficient target sites in the target nucleic acid sequence. Figure 9 shows a non-limiting example of a strategy that is used to identify chemically modified siNA constructs of the invention that are nuclease resistant while maintaining the ability to mediate RNAi activity. Chemical modifications are introduced into the siNA construction based on well-designed design parameters (eg introduction of 2 'modifications)., modifications of bases, modifications of the base, modifications in the terminal cap, etc.). The modified construct is analyzed in an appropriate system (for example human serum to determine nuclease resistance, which is shown, or an animal model to determine PK administration parameters). In parallel, the siNA construct is analyzed to determine RNAi activity, for example in a cell culture system such as a luciferase control assay). The siNA constructs that possess a particular characteristic while maintaining the RNAi activity are then identified and can be modified and tested again. This same strategy can be used to identify siNA-conjugated molecules with improved pharmacokinetic profiles, administration, and RNAi activity. Figure 10 shows non-limiting examples of phosphorylated siNA molecules of the invention, including linear and double-stranded molecule constructions and their asymmetric derivatives. Figure 11A shows a non-limiting example of methodology that is used to design self-complementary DFO constructs using palindrome and / or repeat nucleic acid sequences that are identified in a target nucleic acid sequence, (i) A palindrome or repeated sequence is identified in a target nucleic acid sequence at the 5 'end (eg with a length of 14 to 24 nucleotides) (dotted portion), (ii) A sequence is designed that is complementary to the target nucleic acid sequence and the palindrome sequence above of (i), (iii) A reverse repeated sequence of the non-palindromic / repeated portion of the complementary sequence of (ii) is attached to the 3 'end of the complementary sequence to generate a self-complementary DFO molecule comprising the sequence complementary to the target nucleic acid, (iv) The DFO molecule can self-assemble into a double-stranded oligonucleotide. Self-assemble the complementary strands to form a double construction. Figure 11 B shows a non-limiting representative example of an oligonucleotide sequence that forms double-stranded molecule (i) Identify the target nucleic acid sequence (eg, with a length of 14 to 24 nucleotides) containing the palindromic / repeated sequence in the 5 'end (dotted portion), (ii) Design a sequence complementary to the previous target nucleic acid sequence of (i), (ii) Add a reverse sequence of the non-palindromic complementary sequence from (ii) to the 3 rd end 'of the complementry sequence. (iv) Self-assembly of complementary self-threads to form a double construction (truncated ends). Figure 11C shows a non-limiting example of the self-assembling scheme of a representative double-stranded molecule that forms a sequence of oligonucleotides. Figure 11 D shows a non-limiting example of the self-assembly scheme of a representative double-stranded molecule that forms an oligonucleotide sequence followed by interaction with a target nucleic acid sequence that produces gene expression modulation.

Figure 12 shows a non-limiting example of the design of self-complementary DFO constructs using palindrome and / or repeated nucleic acid sequences that are incorporated into DFO constructs having a sequence complementary to any target nucleic acid sequence of interest. The incorporation of these palindromes / repeated sequences allows to design the DFO constructions that form double-stranded molecules in which each strand has the capacity to mediate the modulation of the expression of the target gene, for example by RNAi. Therefore, this figure presents the following: Identification of the target nucleic acid sequence (eg length of 14 to 24 oligonucleotides). Design of the complementary sequence and use of the modified nucleotides (shown as X, Y) that interact with a portion of the target sequence and result in the formation of a palindromic / repeated sequence (eg, 2 to 12 nucleotides) in the 3 'end (dotted portion). Aggregation of the reverse sequence of the complementry region at the 3 'end of the palindromic / repeated sequence. Hybridization of complementary self strands to form a double siNA construct. First, the target sequence is identified. A complementary sequence is then generated in which nucleotide or non-nucleotide modifications (designated X or Y) are introduced into the complementary sequence that generates an artificial palindrome (designated XYXYXY in the Figure). A reverse repeated sequence of the non-palindromic / repeat portion of the sequence complementary to the 3 'end of the complementary sequence is attached to generate a self-complementary DFO comprising the sequence complementary to the target nucleic acid. DFO can self-assemble into a double-stranded oligonucleotide. Figures 13A and 13B show non-limiting examples of multifunctional siNA molecules of the invention comprising two separate polynucleotide sequences each having the ability to mediate RNAi-directed cleavage of different target nucleic acid sequences. Figure 13A shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first and second complementary regions are located at the 3 'ends of each polynucleotide sequence in the multifunctional siNA. Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. Figure 13B shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first and second complementary regions are located at the 5 'ends of each polynucleotide sequence in the multifunctional siNA. Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. Figures 14A and 14B show non-limiting examples of multifunctional siNA molecules of the invention comprising a single polynucleotide sequence with different regions each capable of mediating RNAi-directed cleavage of different target nucleic acid sequences. Figure 14A shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the second complementary region is located at the 3 'end of each polynucleotide sequence in the multifunctional siNA. Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. Figure 14B shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first complementary region is located at the 5 'end of each polynucleotide sequence in the multifunctional siNA. Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. In one embodiment, these multifunctional siNA constructs are processed in vivo or in vitro to generate multifunctional siNA constructs as shown in Figures 13A and 13B. Figures 15A and 15B show non-limiting examples of multifunctional siNA molecules of the invention comprising two different polynucleotide sequences each having the ability to mediate RNAi-directed cleavage of different target nucleic acid sequences and in which the construction of The multifunctional siNA further comprises a self-complementary, palindrome, or repeated region, thus allowing shorter bifunctional siNA constructs that can act as mediators of RNA interference against different target nucleic acid sequences. Figure 15A shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first and second complementary regions are located at the 3"ends of each polynucleotide sequence of the multifunctional siNA, and wherein the first and second complementary regions further comprise a self-complementary, palindrome, or The dotted portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences Figure 15B shows an example non-limiting of a molecule of s multifunctional iNA having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first and second complementary regions are located at the 5 'ends of each polynucleotide sequence in the multifunctional siNA, and wherein the first and second complementary regions further comprise a self-complementary, palindrome, or repeated region. Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences.

Figures 16B and 16B show non-limiting examples of multifunctional siNA molecules of the invention comprising a single polynucleotide sequence comprising different regions each having the ability to mediate RNAi-directed cleavage of different target nucleic acid sequences and in the that the multifunctional siNA construct further comprises a self-complementary, palindrome, or repeated region, thus allowing shorter bifunctional siNA constructs that can mediate RNA interference against different target nucleic acid sequences. Figure 16A shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the first complementary region is located at the 3 'end of each polynucleotide sequence in the multifunctional siNA, and wherein the first and second complementary regions further comprise a self-complementary, palindrome, or repeated region . Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. Figure 16B shows a non-limiting example of a multifunctional siNA molecule having a first region that is complementary to a first target nucleic acid sequence (complementary region 1) and a second region that is complementary to a second target nucleic acid sequence (complementary region 2), wherein the second complementary region is located at the 5 'end of each polynucleotide sequence in the multifunctional siNA, and wherein the first and second complementary regions further comprise a self-complementary, palindrome, or repeated region . Dashed-line portions of each polynucleotide sequence of the multifunctional siNA construct have complementarity with respect to corresponding portions of the siNA double-stranded molecule, but have no complementarity with the target nucleic acid sequences. In one embodiment, these multifunctional siNA constructs are processed in vivo or in vitro to generate multifunctional siNA constructs as shown in Figures 15A and 15B. Figure 17 shows a non-limiting example of how the multifunctional siNA molecules of the invention can be targeted against two different target nucleic acid molecules, such as different RNA molecules that encode different proteins (e.g., any of the objects of this document ), for example, a cytokine and its corresponding receptor, different viral strains, a virus and a protein involved in viral infection or replication, or different proteins involved in a common or divergent biological pathway that is involved in the maintenance or progression of the disease. Each strand of the multifunctional siNA construct comprises a region that has complementarity with different target nucleic acid molecules. The multifunctional siNA molecule is designed such that each strand of the siNA can be used by the RISC complex to initiate cleavage mediated by RNA interference from its corresponding target. These design parameters may include destabilization of each end of the siNA construct (see for example Schwarz et al., 2003, Cell, 115, 199-208). Such destabilization can be achieved for example by using guanosine-cytidine base pairs, alternating base pairs (e.g., hesitations), or chemically modified nucleotides destabilizing at terminal nucleotide positions as is known in the art. Figure 18 shows a non-limiting example of how the multifunctional siNA molecules of the invention can be targeted against two different target nucleic acid sequences in the same target nucleic acid molecule, such as alternate coding regions of an RNA, coding and non-coding regions of an RNA, or alternating splice variant regions of an RNA. Each strand of the multifunctional siNA construct comprises a region that has complementarity with the different regions of the target nucleic acid molecule. The multifunctional siNA molecule is designed such that each strand of the siNA can be used by the RISC complex to initiate cleavage mediated by RNA interference from its corresponding target region. These design parameters may include destabilization of each end of the siNA construct (see for example Schwarz et al., 2003, Cell, 115, 199-208). Such destabilization can be achieved for example by using guanosine-cytidine base pairs, alternating base pairs (e.g., hesitations), or chemically modified nucleotides destabilizing at terminal nucleotide positions as is known in the art. Figures 19A-19H show non-limiting examples of anchored multifunctional siNA constructs of the invention. In the examples shown, a linker (eg, polynucleotide or non-polynucleotide linkage) connects two siNA regions (eg, two coding regions, two non-coding regions, or alternatively one coding and one non-coding. encoding (or coding and non-coding) separate corresponding to a first target sequence and a second target sequence to their corresponding coding and / or non-coding sequences in the multifunctional siNA.In addition, various conjugates, ligands, aptamers, polymers or molecules can bind control to the binding region for administration and / or selective or improved pharmacokinetic properties In these figures S = coding, AS = non-coding The linker region can be a nucleotide or non-nucleotide linker, and can optionally be decorated, for example, with conjugated polymers or aptamers, as for delivery purposes Figure 20 m shows a non-limiting example of various multifunctional siNA designs based on dendrimers.

Figure 21 shows a non-limiting example of various supramolecular multifunctional siNA designs. Figure 22 shows a non-limiting example of a multifunctional siNA design made possible by Dicer using a 30 nucleotide siNA precursor construct. A 30-base pair double-stranded molecule is cleaved by Dicer in 22 and 8 base pair products from each end (the 8 bp fragments are not shown). For an easier presentation the draperies that are generated by Dicer are not displayed - but can be compensated. Three directed sequences are shown. The identity of the superimposed required sequence is indicated by gray boxes. The N s of the parental siNA of 30 bp are the suggested sites for 2'-OH positions to allow excision by Dicer if analyzed in stabilized structures. Note that the processing of a double-stranded molecule 30mera by the RNase Ill Dicer does not provide a precise 22 + 8 cleavage, but rather produces a series of very similar products (the main site being 22 + 8). Therefore, processing through Dicer will provide a series of active siNAs. Figure 23 shows a non-limiting example of a multifunctional siNA design made possible by Dicer using a 40 nucleotide siNA precursor construct. A double-stranded molecule of 40 base pairs is cleaved by Dicer in products of 22 base pairs from each end. For an easier presentation the draperies that are generated by Dicer are not displayed - but can be compensated. Four directed sequences are shown. Target sequences that exhibit homology are included in boxes. The design format can be extended to larger RNAs. If the chemically stabilized siNA binds to Dicer, then strategically located ribonucleotide bonds can allow the design of cleavage products that allow for a more extensive repertoire of multifunctional designs. For example cleavage products that are not limited to the Dicer pattern of about 22 nucleotides can allow multifunctional siNA constructs with a match in target sequence identity ranging from, for example, from about 3 to about 15 nucleotides. Figure 24 shows a non-limiting example of a further construction of multifunctional siNA designs of the invention. In one example, a conjugate, ligand, aptamer, label, or other moiety binds to a region of the multifunctional siNA to allow for an improved administration or pharmacokinetic profile. Figure 25 shows a non-limiting example of an additional construction of multifunctional siNA designs of the invention. In one example, a conjugate, ligand, aptamer, label, or other moiety binds to a region of the multifunctional siNA to allow for an improved administration or pharmacokinetic profile. Figure 26 shows a non-limiting example of inhibition of HBV S antigen (HBsAg) in vitro using various DNA constructs having selected modification patterns including ribonucleotides at selected positions and targeting site 262 of the HBV RNA. Figure 27 shows a non-limiting example of inhibition of HBV S antigen (HBsAg) in vitro using various siNA constructs having selected modification patterns including ribonucleotides at selected positions and targeting site 263 of HBV RNA. Figure 28 shows a non-limiting example of inhibition of HBV S antigen (HBsAg) in vitro using various siNA constructs having selected modification patterns including ribonucleotides at selected positions and targeting site 1583 of the HBV RNA. Figure 29 shows a non-limiting example of dose-dependent inhibition of HBsAg S antigen (HBsAg) in vitro using two different constructs of DNA having patterns of selected modifications that include ribonucleotides at selected positions and that are directed to site 1583 of the HBV RNA. Figure 30 shows a non-limiting example of dose-dependent inhibition of HBV S antigen (HBsAg) in vitro using two different siNA constructs having selected modification patterns including ribonucleotides at selected positions and directed to site 1583 HBV RNA. Figure 31 shows a non-limiting example of inhibition of HBV S antigen (HBsAg) in vitro using various siNA constructs having selected modification patterns including ribonucleotides at selected positions and targeting sites 262 and 263 of RNA HBV. Figure 32 shows a non-limiting example of dose-dependent inhibition of HCV RNA expression in vitro using the siNA constructs Stab 25 and Stab 29 directed to RNA from sites 327, 282, and 304. Figure 33 shows a non-limiting example of the in vivo inhibition of HBV DNA in mice using the siNA molecules of the invention formulated in LNP-086 and LNP-061 with different coating groups. Active siNA constructs in LNP-086 and LNP-061 were evaluated in comparison with PBS control, with inverted control groups. As shown in the figure, siNA constructs with 2'-O-methyl coatings provide potent activity against HBV in this model. Figures 34A and 34B show a non-limiting example of the HBV263M-LNP-086 mediated reduction of serum levels of HBV DNA in vivo in mice replicating HBV that were treated with doses of 0.3, 1, or 3 mg / kg / day for three days compared to groups of siNA or control PBS. Serum HBV DNA levels were equivalent in the control siNA and PBS treated groups, demonstrating the sequence specificity of activity against HBV and the absence of non-specific lipid effects. Figure 35 shows a non-limiting example of the HBV263M-LNP-086-mediated reduction of serum HBsAg levels of HBV in vivo in mice replicating HBV that were treated with doses of 0.3, 1, or 3 mg / kg / day for three days compared to groups of control siNA or PBS. Serum control HBsAg levels were equivalent in the control siNA and PBS treated groups, demonstrating the sequence specificity of activity against HBV and the absence of nonspecific effects of lipids. Figure 36 shows a non-limiting example of the duration of siNA-mediated reductions of HBV levels in a mouse model of HBV infection. Mice with replicating HBV were treated with HBV263M-LNP-086 or HBV263Minv-LNP-086 at a dose of 3 mg / kg / day for three days, followed by analysis of serum HBV titers on days 3, 7, and 14 after of the last dose. As shown in the figure, the activity against HBV was persistent, observing a still significant activity on day 7 (reduction of 2.0 loglO) and day 14 (reduction of 1.5 loglO). Figure 37 shows a non-limiting example of liver-specific HBV RNA cleavage mediated by the active HBV263M-LNP-086 formulation in a mouse model of HBV infection. Mice with replicating HBV were treated with doses of HBV263M-LNP-086 at 0.3, 1, 3, 10 mg / kg / day or HBV263invM-LNP control at 10 mg / kg for three days, and RNA levels were determined of HBV 3 days after the last dose. Dose-dependent reduction of hepatic HBV RNA was observed, with decreases of 90%, 66.5%, 18%, and 4% that were observed in the treatment groups with 10, 3, 1, and 0.3 mg / kg of HBV263M -LNP respectively compared to the control with HBV263invM-LNP-086 at 10 mg / kg. Figure 38 shows a non-limiting example of the demonstration that hepatic HBV RNA reduction is due to an RNAi-mediated cleavage of HBV RNA. Rapid amplification analysis of the 5 'ends of cDNA (RACE) was used to detect cleavage of HBV RNA at the intended site. Mice with replicating HBV were treated with HBV263M-LNP-086 or HBV263Minv-LNP-086 in a dose of 3 mg / kg / d for 3 days. The animals were sacrificed at 3, 7, or 14 days of the last dose, and the total liver RNA was isolated. It was expected that the binding of an adapter sequence to the free 5 'ends of the RNA population and the subsequent RT-PCR with adapter and specific HBV primers would give a 145 bp PCR product if the HBV RNA had been splits in the intended target site. As shown in the figure, the expected amplification product was observed in the samples treated with active siNA in HBV263 at each time, but not in the samples treated with the HBV263 control. The PCR products were then subcloned and sequenced, confirming the correct binding between the adapter sequence and the predicted siNA cleavage site in HBV263. This result establishes that the reduction in HBV RNA that is observed in the liver was due to a specific cleavage mediated by RNAi of the HBV RNA in the liver. further, the detection of the cleavage products of HBV RNA on days 7 and 14 show that the duration of the activity of the siNA against HBV is due to a continuous cleavage of the HBV RNA. Figure 39 shows a non-limiting example of the pharmacokinetic properties of HBV263M-LNP-086 as determined in mice after a single dose of 3 mg / kg. A method was used to detect HBV263M siNA in plasma and liver as a function of time. HBV263M was rapidly removed from the plasma with an elimination T1 2 of approximately 1.7 h. However, HBV263M was detected in the liver during the entire sampling period of 14 d and presented a T? 2 elimination of 4 days. A maximum concentration of 31.3 ± 17.8 ng / mg (mean ± standard deviation) was observed in the liver in 1 hour and corresponded to 65 ± 32% of the dose of siNA. At 14 days, 1.4 ± 0.7% of the dose remained intact in the liver. The prolonged activity against HBV mediated by siNA observed in the model in mice shows a good correlation with this prolonged residence time of the siNA in the liver.

Non-limiting examples of terminal phosphate groups chemically modified of the invention or any other modifications in this EXAMPLE OF CONJUGATE OF CHOLESTEROL A non-limiting example of a phosphoramidite linked to cholesterol that can be used to synthesize siNA molecules conjugated with cholesterol of the invention HEAD CODIFICANTE C48H86N3? 8P Exact mass' 863.62 Molecular weight 864 19 C, 66 71; H, 10 03; N, 4 86; O, 14 81; P, 3.38 An example is shown with the remaining cholesterol linked to the 5 'end of the coding strand of a siNA molecule.

DETAILED DESCRIPTION OF THE INVENTION Mechanism of action of the nucleic acid molecules of the invention The following description describes the proposed mechanism for RNA interference mediated by short interfering RNA as currently known and is not intended to be limiting and is not admitted to be prior art . The applicant demonstrates in the present document that chemically modified short interfering nucleic acids possess a similar or improved ability to mediate RNAi than siRNA molecules and are expected to possess improved stability and activity in vivo; therefore, it is not intended that this description be limited only to siRNA and may apply to siNA as a whole. With "enhanced ability to mediate RNAi" or "enhanced RNAi activity" we want to include the RNAi activity measured in vitro and / or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and of the stability of the siNA of the invention. In this invention, the product of these activities can be increased in vitro and / or in vivo compared to an all-RNA siRNA or a siNA containing a plurality of ribonucleotides. In some cases, the activity or stability of the siNA molecule may be less (i.e., less than ten times), but the total activity of the siNA molecule is improved in vitro and / or in vivo.

RNA interference refers to the process of post-transcriptional gene silencing of sequence in animals mediated by short interfering RNAs (siRNA) (Fire et al., 1998, Nature, 391, 806). The corresponding process in plants is usually called posttranscriptional gene silencing or silencing of RNA and is also called repression in fungi. It is believed that the process of posttranscriptional gene silencing is an evolutionarily conserved cellular defense mechanism to avoid the expression of exogenous genes that is usually shared by different flora and phyla (Fire et al., 1999, Trends genet., 15, 358). Said protection against exogenous gene expression may have evolved in response to the production of double-stranded RNAs (dsRNA) derived from a viral infection or from the random integration of transposon elements in a host genome by a cellular response that specifically destroys the RNA single-stranded homolog or viral genomic RNA. The presence of dsRNA in the cells triggers the response of the RNAi through a mechanism that has yet to be completely characterized. This mechanism seems to be different from the response to interferons caused by the dsRNA-mediated activation of PKR protein kinase and 2 ', 5'-oligoadenylate synthetase that causes a non-specific cleavage of mRNA by ribonuclease L. The presence of long dsRNAs in cells stimulates the activity of a ribonuclease enzyme III called Dicer. Dicer is involved in the processing of dsRNA to short stretches of dsRNA known as short interfering RNAs (siRNA) (Berstein et al., 2001, Nature, 409, 363). The short interfering RNAs derived by Dicer activity are usually from about 21 to about 23 nucleotides in length and comprise double-stranded molecules of about 19 base pairs. Dicer has also been implicated in the cleavage of short temporal RNAs of 21 and 22 nucleotides (stRNA) from the precursor RNA of conserved structure that are involved in the control of translation (Hutvagner et al., 2001, Science, 293, 834). The response of the RNAi also has a complex of endonucleases containing an siRNA, usually called an RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNA having a sequence homologous to the siRNA. Cleavage of the target RNA occurs in the middle of the region complementary to the leader sequence of the double-stranded siRNA molecule (Elbashir et al., 2001, Genes Dev., 15, 188). In addition, RNA interference may also involve gene silencing mediated by short RNA (eg, miRNA or miRNA), presumably through cellular mechanisms that regulate the structure of chromatin and thus prevent transcription of the target gene sequences ( see for example Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). Thus, the siNA molecules of the invention can be used to mediate gene silencing by interaction with RNA transcripts or alternatively by interaction with particular gene sequences, wherein said interaction produces gene silencing either at the transcriptional or posttranscriptional level. RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi induced by the introduction of synthetic double-stranded molecules of 21 nucleotides in cultured mammalian cells that include human embryonic kidney cells and HeLa cells. Recent studies in Drosophila embryonic lysates have revealed certain requirements regarding the length, structure, chemical composition and sequence of the siRNAs that are essential for mediating effective RNAi activity. These studies have shown that the double-stranded siRNA molecules of 21 nucleotides are more active when they contain two 2-nucleotide plasters at the 3 'end. In addition, the substitution of one or both strands of siRNA with 2'-deoxy or 2'-O-methyl nucleotides suppresses the RNAi activity, while the replacement of the 3'-terminal siRNA nucleotides with deoxy nucleotides was demonstrated It was tolerated. It was also shown that sequences with mismatches in the center of the double-stranded siRNA molecule suppress the activity of RNAi. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5 'end of the siRNA instead of the 3' end of the leader sequence (Elbashir et al., 2001, EMBO J. , 20, 6877). Other studies have indicated that a 5'-phosphate in the complementary target strand of a double-stranded siRNA molecule is necessary for siRNA activity and that ATP is used to maintain the 5'-phosphate moiety in the siRNA (Nykanen et al., 2001, Cell, 107, 309); however, siRNA molecules lacking a 5'-phosphate are active when introduced exogenously, suggesting that the d-phosphorylation of siRNA constructs can be produced in vivo.

Oligonucleotides forming double-stranded molecules (DFO) of the invention In one embodiment, the invention features siNA molecules comprising oligonucleotides that form double-stranded molecules (DFO) that can self-assemble into double-stranded oligonucleotides. The oligonucleotides forming double-stranded molecules of the invention can be chemically synthesized or expressed through units and / or transcription vectors. The DFO molecules of the present invention provide reagents and methods useful for a variety of therapeutic, diagnostic, agricultural, veterinary, target validation, genomic discovery, genetic engineering and pharmacogenomics applications. The applicant demonstrates in the present document that certain oligonucleotides, referred to herein, for convenience but not limitation, oligonucleotides that form double-stranded molecules or DFO molecules, are potent mediators of the sequence-specific regulation of gene expression. The oligonucleotides of the invention are different from other nucleic acid sequences known in the art (eg, siRNA, miRNA, stRNA, shRNA, non-coding oligonucleotides, etc.) because they represent a class of linear polynucleotide sequences that are designed to self-assemble forming double-stranded oligonucleotides, wherein each strand of the double-stranded oligonucleotides comprises a nucleotide sequence that is complementary to a target nucleic acid molecule. The nucleic acid molecules of the invention can thus self-assemble into functional double-stranded molecules in which each strand of the double-stranded molecule comprises the same polynucleotide sequence and each strand comprises a nucleotide sequence that is complementary to a target nucleic acid molecule. Generally, double-stranded oligonucleotides are formed by assembling two different oligonucleotide sequences where the sequence of oligonucleotides of a strand is complementary to the sequence of oligonucleotides of the second strand; said double-stranded oligonucleotides are assembled from two different oligonucleotides or from a single molecule that folds to form a double-stranded structure, often referred to in the field as a hairpin-loop structure (for example, shRNA or short RNA in hairpin). These double-stranded oligonucleotides known in the art all have a common characteristic since each strand of the double-stranded molecule has a different nucleotide sequence. Applicants, unlike double-stranded nucleic acid molecules known in the art, have developed a novel, potentially cost-effective and simplified method of forming a double-stranded nucleic acid molecule from a single-stranded or linear oligonucleotide. The two strands of the double-stranded oligonucleotide that is formed according to the present invention have the same nucleotide sequence and are covalently bound together. Such double-stranded oligonucleotide molecules can be easily joined postsynthetically by methods and reagents known in the art and are within the scope of the invention. In one embodiment, the single-stranded oligonucleotide of the invention (the oligonucleotide forming a double-stranded molecule) that forms a double-stranded oligonucleotide comprises a first region and a second region, wherein the second region includes a nucleotide sequence that is an inverted repeat of the sequence of nucleotides of the first region, or a portion thereof, such that the single-stranded oligonucleotide self-assembles into a double-stranded oligonucleotide molecule in which the nucleotide sequence of a strand of the double-stranded molecule is the same as the sequence of nucleotides of the second strand. Non-limiting examples of said oligonucleotide forming a double-stranded molecule are illustrated in Figures 11A-11 D and 12. These oligonucleotides that form double-stranded molecules (DFO) can optionally include certain palindromes or repeated sequences where said palindromes or repeated sequences are present between the first region and the second region of the DFO. In a modality, the invention features an oligonucleotide forming a double-stranded molecule (DFO), wherein DFO comprises a double-stranded molecule that forms a self-complementary nucleic acid sequence having a nucleotide sequence complementary to a target nucleic acid sequence. The DFO molecule may comprise a single self-complementary sequence or a double-stranded molecule produced by the assembly of said self-complementary sequences. In one embodiment, an oligonucleotide forming a double-stranded molecule (DFO) of the invention comprises a first region and a second region, wherein the second region comprises a nucleotide sequence comprising an inverted repeat of the nucleotide sequence of the first region such that the DFO molecule can be assembled into a double-stranded oligonucleotide. Such double-stranded oligonucleotides can act as a short interfering nucleic acid (siNA) to modulate gene expression. Each strand of the double-stranded oligonucleotide formed by DFO molecules of the invention may comprise a region of a nucleotide sequence that is complementary to the same nucleotide sequence of a target nucleic acid molecule (e.g., target RNA).

In one embodiment, the invention features a single-stranded DFO that can be assembled into a double-stranded oligonucleotide. The Applicant has surprisingly found a single-stranded oligonucleotide with self-complementary nucleotide regions can be easily assembled into constructions of double-stranded oligonucleotide molecules. Said DFOs can be assembled producing double-stranded molecules that can inhibit gene expression in a specific sequence manner. The DFO molecules of the invention comprise a first region with a nucleotide sequence that is complementary to the nucleotide sequence of a second region and where the sequence of the first region is complementary to a target nucleic acid (e.g., RNA). DFO can form a double-stranded oligonucleotide in which a portion of each strand of the double-stranded oligonucleotide comprises a sequence complementary to a target nucleic acid sequence. In one embodiment, the invention features a double-stranded oligonucleotide, wherein the two strands of the double-stranded oligonucleotide are not covalently linked to each other, and wherein each strand of the double-stranded oligonucleotide comprises a nucleotide sequence that is complementary to the same nucleotide sequence of a target nucleic acid molecule or a portion thereof (e.g., target RNA). In another embodiment, the two strands of the double-stranded oligonucleotide share an identical nucleotide sequence of at least about 15, preferably at least about 16, 17, 18, 19, 20 or 21 nucleotides. In one embodiment, a DFO molecule of the invention comprises a structure having the Formula DFO-I: 5'-pX Z X'-3 'wherein Z comprises a palindrome or repeated nucleic acid sequence optionally with one or more modified nucleotides (eg, nucleotide with a modified base, such as 2-amino purine, 2-amino-1,6-dihydro purine or a universal base), for example having a length from about 2 to about 24 nucleotides in even numbers (eg, about 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 or 24 nucleotides), X represents a nucleic acid sequence, for example with a length of about 1 to about 21 nucleotides (for example, approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) , X 'comprises a nucleic acid sequence, for example with a length of about 1 to about 21 nucleotides (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) having nucleotide sequence complementarity with a sequence X or a portion thereof, p comprises a terminal phosphate group which may be present or absent, and wherein the sequence X and Z, independently or together, comprise a nucleotide sequence that is complementary to a target nucleic acid sequence or a portion thereof and is of sufficient length to interact (eg, form base pairs with the target nucleic acid sequence or a portion thereof (e.g., target RNA). For example, X independently may comprise a sequence of about 12 to about 21 or more (eg, about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more) nucleotides in length which is complementary to a nucleotide sequence in a target RNA or a portion thereof. In another non-limiting example, the length of the nucleotide sequence of X and Z together, when X is present, ie complementary to the target or to a portion thereof (eg, target RNA) has from about 12 to about 21 or more nucleotides (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more). In yet another non-limiting example, when X is absent, the length of the Z nucleotide sequence that is complementary to the target or a portion thereof has from about 12 to about 24 or more nucleotides (e.g., approximately 12, 14, 16, 18, 20, 22, 24, or more). In one embodiment X, Z and X 'are independently oligonucleotides, wherein X and / or Z comprise a nucleotide sequence of sufficient length to interact (eg, form base pairs with a nucleotide sequence in the target or a portion of the In one embodiment, the lengths of the oligonucleotides X and X 'are identical, in another embodiment, the lengths of the oligonucleotides X and X' are not identical, in another embodiment, the lengths of the oligonucleotides X and X 'are identical. oligonucleotides X and Z, or Z and X ', or X, Z and X' are identical or different When a sequence is described in this specification as having "sufficient" length to interact (i.e., form base pairs) with another sequence, it is meant that the length is such that the number of bonds (eg, hydrogen bonds) that are formed between the two sequences is sufficient to allow the two sequences to form a double-stranded molecule under the conditions It is of interest. Such conditions can be in vitro (for example, for diagnostic or assay purposes) or in v / Vo (for example, for therapeutic purposes). It is a simple and routine way to determine such lengths. In one embodiment, the invention features a double-stranded oligonucleotide construct having the Formula DFO-I (a): 5'-pX Z X'-3 '3'-X' Z Xp-5 'wherein Z comprises a palindrome or repeated nucleic acid sequence or a palindrome or repeat-type sequence of nucleic acid with one or more modified nucleotides (for example, nucleotides with a modified base, such as 2-amino purine, 2-amino-1,6-dihydro purine or a universal base), for example having a length of from about 2 to about 24 nucleotides in even numbers (eg. example, approximately 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 nucleotides), X represents a nucleic acid sequence, for example with a length of about 1 to about 21 nucleotides ( for example, approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides), X ' it comprises a nucleic acid sequence, for example with a length of about 1 to about 21 nucleotides (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) having nucleotide sequence complementarity with an X sequence or a portion thereof, p comprises a terminal phosphate group which may be present or absent, and wherein each X and Z independently comprise a nucleotide sequence that is complementary to a target nucleic acid sequence or a portion thereof (eg, target RNA) and is of sufficient length to interact with the target nucleic acid sequence of a portion of the same (for example, target RNA). For example, the sequence X independently can comprise a sequence of about 12 to about 21 or more nucleotides (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more) in length which is complementary to a nucleotide sequence of an objective or a portion thereof (eg, target RNA). In another non-limiting example, the length of the nucleotide sequence of X and Z together (when X is present) ie complementary to the target or to a portion thereof has from about 12 to about 21 or more nucleotides (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more). In yet another non-limiting example, when X is absent, the length of the Z nucleotide sequence that is complementary to the target or a portion thereof is from about 12 to about 24 or more nucleotides (e.g., about 12, 14). , 16, 18, 20, 22, 24 or more). In one embodiment X, Z and X 'are independently oligonucleotides, wherein X and / or Z comprise a nucleotide sequence of sufficient length to interact (eg, form base pairs with a nucleotide sequence in the target or a portion of the In one embodiment, the lengths of the oligonucleotides X and X 'are identical, in another embodiment, the lengths of the oligonucleotides X and X' are not identical, in another embodiment, the lengths of the oligonucleotides X and X 'are identical. oligonucleotides X and Z, or Z and X ', or X, Z and X' are identical or different In one embodiment, the double-stranded oligonucleotide construct of Formula I (a) includes one or more, specifically 1, 2 , 3 or 4, erroneous pairings, insofar as said mismatches do not significantly decrease the ability of the double-stranded oligonucleotide to inhibit the expression of the target gene In one embodiment, a DFO molecule of the invention comprises a structure having the Formula DFO-II: 5'-pX Xf-3f wherein each X and X 'are independently oligonucleotides with a length of about 12 nucleotides to about 21 nucleotides, wherein X comprises, for example, a nucleic acid sequence with a length of about 12 to about 21 nucleotides (eg, about 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides), X 'comprises a nucleic acid sequence, for example with a length of about 12 to about 21 nucleotides (e.g., approximately 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) having nucleotide sequence complementarity with an X sequence or a portion thereof, p comprises a terminal phosphate group which may be present or absent, and wherein X comprises a nucleotide sequence that is complementary to a target nucleic acid sequence (e.g., target RNA) or a portion thereof and is of sufficient length to interact (e.g. bases with the target nucleic acid sequence or a portion thereof In one embodiment, the length of the oligonucleotides X and X 'is identical In another embodiment, the length of the oligonucleotides X and X' is not identical. embodiment, the length of oligonucleotides X and X 'is sufficient to form a relatively stable double-stranded oligonucleotide In one embodiment, the invention features a double-stranded oligonucleotide construct having the Formula DFO-11 (a ): 5f-pX X'-3f 3'-X 'Xp-51 wherein each X and X' are independently oligonucleotides with a length of about 12 nucleotides to about 21 nucleotides, wherein X comprises a nucleic acid sequence , for example with a length of about 12 to about 21 nucleotides (for example, about 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides), X 'comprises a nucleic acid sequence, example with a length of about 12 to about 21 nucleotides (eg, about 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) having nucleotide sequence complementarity with an X sequence or a portion thereof, p comprises a terminal phosphate group that may be present or absent, and wherein X comprises the nucleotide sequence that is complementary to a target nucleic acid sequence or a portion thereof (e.g., target RNA) and it is of sufficient length to interact (e.g., form base pairs with the target nucleic acid sequence (e.g., target RNA) or a portion thereof. In one embodiment, the lengths of oligonucleotides X and X 'are identical. In another embodiment, the lengths of oligonucleotides X and X 'are not identical. In one embodiment, the lengths of the X and X 'oligonucleotides are sufficient to form a relatively stable double-stranded oligonucleotide. In one embodiment, the double-stranded oligonucleotide construct of Formula II (a) includes one or more, specifically 1, 2, 3 or 4, mismatches, insofar as such mismatches do not significantly decrease the capacity of the double-stranded oligonucleotide of inhibiting the expression of the target gene. In one embodiment, the invention features a DFO molecule having the Formula DFO-I (b): 5'-pZ-3 'wherein Z comprises a palindrome or repeated nucleic acid sequence which optionally includes one or more non-standard nucleotides or modified (eg, nucleotide with a modified base, such as 2-amino purine or a universal base) that can facilitate the formation of base pairs with other nucleotides. Z may be, for example, of sufficient length to interact (eg, form base pairs with the nucleotide sequence of a target nucleic acid molecule (e.g., target RNA), preferably at least 12 nucleotides in length, specific form of about 12 to about 24 nucleotides (eg, about 12, 14, 16, 18, 20, 22 or 24 nucleotides) p represents a terminal phosphate group which may be present or absent. DFO having any of the Formulas DFO-I, DFO-I (a), DFO-I (b), DFO-ll (a) or DFO-II may comprise chemical modifications as described herein without limitation, such as, for example, nucleotides having any of Formulas I-VI I, stabilization structures as described in Table I, or any other combination of modified nucleotides and non-nucleotides as described in the various embodiments herein. In one embodiment, the palindrome or repeated sequence or modified nucleotide (eg, nucleotide with a modified base, such as 2-amino purine or a universal base) in Z of the DFO constructs having the Formula DFO-I, DFO- I (a) and DFO-I (b), comprises chemically modified nucleotides that are capable of interacting with a portion of the target nucleic acid sequence (eg, analogs with modified bases that can form Watson Crick base pairs or pairs of bases other than Watson Crick). In one embodiment, a DFO molecule of the invention, for example a DFO having the Formula DFO-I or DFO-II, comprises from about 15 to about 40 nucleotides (e.g., about 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides). In one embodiment, a DFO molecule of the invention comprises one or more chemical modifications. In a non-limiting example, the introduction of chemically modified nucleotides and / or non-nucleotides into nucleic acid molecules of the invention provides a powerful tool to overcome the potential limitations of in vivo stability and bioavailability inherent in unmodified RNA molecules that are they administer exogenously. For example, the use of chemically modified nucleic acid molecules can allow a lower dose of a particular nucleic acid molecule for a given therapeutic effect since the chemically modified nucleic acid molecules tend to have a longer half-life in serum or in cells or tissues. Furthermore, certain chemical modifications can improve the bioavailability and / or potency of the nucleic acid molecules not only by improving the half-life but also by facilitating the targeting of nucleic acid molecules to particular organs, cells or tissues and / or improving the cellular uptake of the nucleic acids. nucleic acid molecules. Therefore, even if the activity of a chemically modified nucleic acid molecule in vitro is reduced compared to a native / unmodified nucleic acid molecule, for example when compared to an unmodified RNA molecule, the total activity of the Modified nucleic acid molecule may be larger than that of the native or unmodified nucleic acid molecule due to improved stability, potency, duration of effect, bioavailability and / or administration of the molecule.

Multifunctional or multi-targeting siNA molecules of the invention In one embodiment, the invention features siNA molecules comprising multifunctional short interfering nucleic acid molecules (multifunctional siNA) that modulate the expression of one or more target genes in a biological system, such as a cell, tissue, or organism. The multifunctional interference multifunctional nucleic acid (multifunctional siNA) molecules of the invention can be targeted against more than one region of the target nucleic acid sequence or can be targeted against target sequences of more than one different target nucleic acid molecule (e.g. sequences of target RNA and / or target route and / or target DNA). The multifunctional siNA molecules of the invention can be chemically synthesized or expressed through units and / or transcription vectors. The multifunctional siNA molecules of the present invention provide reagents and methods of use for a variety of human, therapeutic, diagnostic, agricultural, veterinary, target validation, genomic discovery, genetic engineering and pharmacogenomics applications. The Applicant hereby demonstrates that certain oligonucleotides, herein referred to, for convenience but not limitation, short-nucleic acid molecules of multifunctional interference or multifunctional siNA, are potent mediators of specific sequence regulation of the gene expression. The multifunctional siNA molecules of the invention are different from other nucleic acid sequences known in the art (eg, siRNA, miRNA, stRNA, shRNA, non-coding oligonucleotides, etc.) because they represent a class of polynucleotide molecules that are designed from such that each strand of the multifunctional siNA construct comprises a nucleotide sequence that is complementary to a different nucleic acid sequence in one or more target nucleic acid molecules. A single multifunctional siNA molecule (generally a double-stranded molecule) of the invention can thus be targeted to more than one (e.g., 2, 3, 4, 5, or more) different target nucleic acid molecules. The nucleic acid molecules of the invention can also be targeted against more than one (e.g., 2, 3, 4, 5, or more) region of the same target nucleic acid sequence. Thus, the multifunctional siNA molecules of the invention are useful for regulating by decreasing or inhibiting the expression of one or more target nucleic acid molecules. By reducing or inhibiting the expression of more than one target nucleic acid molecule with a multifunctional siNA construct, the multifunctional siNA molecules of the invention represent a class of potent therapeutic agents that can provide simultaneous inhibition of multiple targets in a related pathway. with the disease (for example, angiogenic). Such simultaneous inhibition can provide synergistic therapeutic treatment strategies without the need to separate preclinical and clinical development efforts or a complex regulatory authorization process. The use of multifunctional siNA molecules that target against more than one region of a target nucleic acid molecule (e.g., RNA or target DNA) is expected to provide potent inhibition of gene expression. For example, a single multifunctional siNA construct of the invention can be directed against both conserved regions and variables of a target nucleic acid molecule (e.g., target RNA or DNA), thereby allowing down regulation or inhibition, for example, of different isoforms or target variants to optimize therapeutic efficacy and minimize toxicity, or allow targeting against both the coding and non-coding regions of the target nucleic acid molecule. Generally, the double-stranded oligonucleotides are formed by the assembly of two different oligonucleotides where the oligonucleotide sequence of a strand is complementary to the oligonucleotide sequence of the second strand; said double-stranded oligonucleotides are assembled from two different oligonucleotides (e.g., siRNA). Alternatively, a double-stranded molecule can be formed from a single molecule that folds on itself (e.g., shRNA or short RNA in hairpin). It is known in the art that these double-stranded oligonucleotides act as mediators of RNA interference and all have a common feature in which only one region of the nucleotide sequence (leader sequence or non-coding sequence) has complementarity with an acid sequence. nucleic acid, and the other strand (coding sequence) comprises the nucleotide sequence that is homologous to the target nucleic acid sequence. Generally, the non-coding sequence is retained in the active RISC complex and guides RISC to the target sequence of nucleotides by forming base pairs complementary to the non-coding sequence with the target sequence to act as mediator of RNA interference sequence specific. It is known in the art that in some cell culture systems, certain types of unmodified siRNA may exhibit effects "external to the target". The proposed hypothesis is that this effect external to the target involves the participation of the unmodified sequence in place of the non-coding sequence of the siRNA in the RISC complex (see for example Schwarz et al., 2003, Cell, 115, 199-208) . In this case, it is believed that the coding sequence directs the RISC complex to a sequence (sequence external to the target) that is different from the target sequence that was intended, causing the inhibition of the sequence external to the target. In these double-stranded nucleic acid molecules, each strand is complementary to a different target nucleic acid sequence. However, the external objectives that are affected by these dsRNAs are not entirely predictable and are not specific. Applicants, unlike double-stranded nucleic acid molecules known in the art, have developed a novel, potentially cost-effective and simplified method of down-regulating or inhibiting the expression of more than one target nucleic acid sequence using a single siNA construct. multifunctional The multifunctional siNA molecules of the invention are designed to be double-stranded or partially double-stranded, such that a portion of each strand or region of the multifunctional siNA is complementary to a chosen target nucleic acid sequence. Thus, the multifunctional siNA molecules of the invention are not limited to targeting sequences that are complementary to each other, but to any two target nucleic acid sequences. The multifunctional siNA molecules of the invention are designed such that each strand or region of the multifunctional siNA molecule, which is complementary to a given target nucleic acid sequence, is of suitable length (eg, from about 16 to about 28 nucleotides in length, preferably from about 18 to about 28 nucleotides in length) to mediate the interference of the RNA against the target nucleic acid sequence. The complementarity between the target nucleic acid sequence and a multifunctional siNA region or region should be sufficient (at least about 8 base pairs) for the cleavage of the target nucleic acid sequence by RNA interference. It is expected that the multifunctional siNA of the invention minimizes the effects external to the target that are observed with certain siRNA sequences, such as those described in Schwarz et al., Reference above. It has been reported that dsRNAs of length between 29 base pairs and 36 base pairs (Tuschl et al., PCT International Patent Publication No. WO 02/44321) do not act as mediators of RNAi. One reason why these dsRNAs are inactive may be the lack of turnover or dissociation of the strand that interacts with the target RNA sequence, in such a way that the RISC complex does not have the capacity to interact efficiently with multiple copies of the target RNA, producing a significant decrease in the power and efficiency of the RNAi process. The Applicant has surprisingly found that the multifunctional siNAs of the invention can overcome this barrier and have the ability to enhance the efficiency and potency of the RNAi process. Thus, in certain embodiments of the invention, multifunctional siNAs with a length of about 29 to about 36 base pairs can be designed such that, a portion of each strand of the multifunctional siNA molecule comprises a region of the nucleotide sequence that is complementary to an objective nucleic acid of sufficient length to mediate the efficacy of RNAi (eg, from about 15 to about 23 base pairs) and a region of a nucleotide sequence that is not complementary to the target nucleic acid. By having both complementary and non-complementary portions in each strand of the multifunctional siNA, the multifunctional siNA can mediate the interference of the RNA against a target nucleic acid sequence without being prohibitive for replacement or dissociation (for example, when the length of each strand is too large to mediate the RNAi against the respective target nucleic acid sequence). In addition, the design of the multifunctional siNA molecules of the invention with overlapping internal regions allows the multifunctional siNA molecules to have a favorable (smaller) size to mediate RNA interference and the size that is suitable for use as a therapeutic agent. (for example, wherein each strand is independently from about 18 to about 28 nucleotides in length). In Figures 13A and 13B through Figure 22, non-limiting examples are illustrated. In one embodiment, a multifunctional siNA molecule of the invention comprises a first region and a second region, wherein the first multifunctional siNA region comprises a nucleotide sequence complementary to a nucleic acid sequence of a first target nucleic acid molecule, and the second multifunctional siNA region comprises the nucleic acid sequence complementary to a nucleic acid sequence of a second target nucleic acid molecule. In one embodiment, a multifunctional siNA molecule of the invention comprises a first region and a second region, wherein the first multifunctional siNA region comprises the nucleotide sequence complementary to a nucleic acid sequence of the first region of a nucleic acid molecule target, and the second region of the multifunctional siNA comprises the nucleotide sequence complementary to a nucleic acid sequence of a second region of the target nucleic acid molecule. In another embodiment, the first region and the second region of the multifunctional siNA may comprise different nucleic acid sequences that share some degree of complementarity (eg, from about 1 to about 10 complementary nucleotides). In certain embodiments, multifunctional siNA constructs comprising different nucleic acid sequences can be easily ligated postsynthetically by methods and reagents known in the art and such ligated constructions are within the scope of the invention. Alternatively, the first region and the second region of the multifunctional siNA may comprise a single nucleic acid sequence that has some degree of self-complementarity, such as in a hairpin or stem and loop structure. Non-limiting examples of said multi-functional double-stranded and hairpin interference nucleic acids are illustrated in Figures 13A-13B and 14A-14B respectively. These multifunctional short interfering nucleic acids (multifunctional siNA) may optionally include a certain overlapping nucleotide sequence where said overlapping nucleotide sequence is present between the first region and the second multifunctional siNA region (see for example Figures 15A-15B and 16A- 16B). In a modality, the invention features a multifunctional short interfering nucleic acid molecule (multifunctional siNA), wherein each strand of the multifunctional siNA independently comprises a first nucleic acid sequence region that is complementary to a different target nucleic acid sequence and the second nucleotide sequence region that is not complementary to the target sequence. The target nucleic acid sequence of each strand is in the same target nucleic acid molecule or different target nucleic acid molecules. In another embodiment, the multifunctional siNA comprises two strands, wherein: (a) the first strand comprises a region that has sequence complementarity with a target nucleic acid sequence (complementary region 1) and a region that does not have sequence complementarity with the nucleotide target sequence (non-complementary region 1); (b) the second multifunctional siNA strand comprises a region having sequence complementarity with a target nucleic acid sequence that is different from the nucleotide target sequence complementary to the nucleotide sequence of the first strand (complementary region 2), and a region that does not have sequence complementarity with the nucleotide target sequence of complementary region 2 (non-complementary region 2); (c) the complementary region 1 of the first strand comprises a sequence of nucleotides that is complementary to a sequence of nucleotides in the non-complementary region 2 of the second strand and the complementary region 2 of the second strand comprises a sequence of nucleotides that is complementary to a nucleotide sequence in the non-complementary region 1 of the first strand. The target nucleic acid sequence of the complementary region 1 and of the complementary region 2 is in the same target nucleic acid molecule or different target nucleic acid molecules. In another embodiment, the multifunctional siNA comprises two strands, wherein: (a) the first strand comprises a region that has sequence complementarity with a target nucleic acid sequence derived from a gene (eg, a first gene) (complementary region 1) ) and a region that does not have sequence complementarity with the nucleotide target sequence of complementary region 1 (non-complementary region 1); (b) the second strand of the multifunctional siNA comprises a region having sequence complementarity with a target nucleic acid sequence derived from a gene (eg, a second gene) that is different from the gene from complementary region 1 (complementary region 2) ), and a region that does not have sequence complementarity with the nucleotide target sequence of complementary region 2 (non-complementary region 2); (c) the complementary region 1 of the first strand comprises a nucleotide sequence that is complementary to a nucleotide sequence of the non-complementary region 2 of the second strand and the complementary region 2 of the second strand comprises a nucleotide sequence that is complementary to a nucleotide sequence of the non-complementary region 1 of the first strand. In another embodiment, the multifunctional siNA comprises two strands, wherein: (a) the first strand comprises a region having sequence complementarity with a target nucleic acid sequence derived from a gene (eg, gene) (complementary region 1) and a region that does not have sequence complementarity with the nucleotide target sequence of complementary region 1 (non-complementary region 1); (b) the second strand of the multifunctional siNA comprises a region having sequence complementarity with a target nucleic acid sequence different from the target nucleic acid sequence of the complementary region 1 (complementary region 2), with the proviso that However, the target nucleic acid sequence for the complementary region 1 and the target nucleic acid sequence for the complementary region 2 both are derived from the same gene, and a region that does not have sequence complementarity with the nucleotide target sequence of the region complementary 2 (non-complementary region 2); (c) the complementary region 1 of the first strand comprises a nucleotide sequence that is complementary to a nucleotide sequence of the non-complementary region 2 of the second strand and the complementary region 2 of the second strand comprises a nucleotide sequence that is complementary to a nucleotide sequence of the non-complementary region 1 of the first strand. In one embodiment, the invention features a multifunctional short interfering nucleic acid molecule (multifunctional siNA), wherein the multifunctional siNA comprises two complementary nucleic acid sequences in which the first sequence comprises a first region having a complementary nucleotide sequence. to a nucleotide sequence of a first target nucleic acid molecule, and wherein the second sequence comprises a first region having a nucleotide sequence complementary to a different nucleotide sequence of the same target nucleic acid molecule. Preferably, the first region of the first sequence is also complementary to the nucleotide sequence of the second region of the second sequence, and where the first region of the second sequence is complementary to the nucleotide sequence of the second region of the first sequence . In one embodiment, the invention features a multifunctional short interfering nucleic acid molecule (multifunctional siNA), wherein the multifunctional siNA comprises two complementary nucleic acid sequences in which the first sequence comprises a first region having a complementary nucleotide sequence. to a nucleotide sequence of a first target nucleic acid molecule, and wherein the second sequence comprises a first region having a nucleotide sequence complementary to a nucleotide sequence different from a second target nucleic acid molecule. Preferably, the first region of the first sequence is also complementary to the nucleotide sequence of the second region of the second sequence, and where the first region of the second sequence is complementary to the nucleotide sequence of the second region of the first sequence . In one embodiment, the invention features a multifunctional siNA molecule comprising a first region and a second region, wherein the first region comprises a nucleic acid sequence having from about 18 to about 28 nucleotides complementary to a nucleic acid sequence of a nucleic acid sequence. first target nucleic acid molecule, and the second region comprises the nucleotide sequence having from about 18 to about 28 nucleotides complementary to a different nucleic acid sequence from a second target nucleic acid molecule. In one embodiment, the invention features a multifunctional siNA molecule comprising a first region and a second region, wherein the first region comprises a nucleic acid sequence having from about 18 to about 28 nucleotides complementary to a nucleic acid sequence of a nucleic acid sequence. target nucleic acid molecule, and the second region comprises the nucleotide sequence having from about 18 to about 28 nucleotides complementary to a different nucleic acid sequence from the same target nucleic acid molecule. In one embodiment, the invention features a double-stranded multifunctional interference nucleic acid molecule (multifunctional siNA), wherein a multifunctional siNA strand comprises a first region having a nucleotide sequence complementary to a first target nucleic acid sequence, and the second strand comprises a first region having a nucleotide sequence complementary to a second target nucleic acid sequence. The first and second target nucleic acid sequences may be present in different target nucleic acid molecules or may be different regions of the same target nucleic acid molecule. Thus, the multifunctional siNA molecules of the invention can be used to target the expression of different genes, splice variants of the same gene, both to mutant and conserved regions of one or more gene transcripts, or both the coding and non-coding sequences of the gene. same or different genes or gene transcripts. In one embodiment, a target nucleic acid molecule of the invention encodes a single protein. In another embodiment, an objective nucleic acid molecule encodes more than one protein (eg, 1, 2, 3, 4, 5 or more proteins). Thus, a multifunctional siNA construct of the invention can be used to down regulate or inhibit the expression of various proteins. For example, a multifunctional siNA molecule comprising a region of a strand having nucleotide sequence complementarity with a first target nucleic acid sequence derived from a target, and the second strand comprising a region with nucleotide sequence complementarity with a second sequence of target nucleic acid present in target nucleic acid molecules of genes encoding two proteins (eg, two different proteins), which can be used to down-regulate, inhibit, or terminate a particular biological pathway by targeting multiple target genes of the route. In one embodiment the invention takes advantage of the conserved nucleotide sequences present in different gene variants. When designing multifunctional siNAs in a manner in which one strand includes a sequence that is complementary to one or more target nucleic acid sequences that are conserved among various members of the target gene family and the other strand optionally includes a sequence that is complementary to a nucleic acid sequence of a target route, it is possible to selectively and efficiently inhibit a target gene from a biological pathway related to the disease using a single multifunctional siNA. In one embodiment, a short multifunctional interference nucleic acid (multifunctional siNA) of the invention comprises a first region and a second region, wherein the first region comprises the nucleotide sequence complementary to a first target RNA of a first target and the second region comprises the nucleotide sequence complementary to a second target RNA of a second target. In one embodiment, the first and second regions may comprise nucleotide sequences complementary to shared or conserved RNA sequences from different target sites of the same target sequence or shared by different target sequences. In one embodiment, a double-stranded multifunctional siNA molecule of the invention comprises a structure having the Formula MF-I: 5'-p-X Z X'-3 '3'-Y' Z Y-p-5 ' wherein each 5'-p-XZX'-3 'and 5'-p-YZY'-3' are independently an oligonucleotide with a length of from about 20 nucleotides to about 300 nucleotides, preferably from about 20 to about 200 nucleotides, from about 20 to about 100 nucleotides, from about 20 to about 40 nucleotides, from about 20 to about 40 nucleotides, from about 24 to about 38 nucleotides, or from about 26 to about 38 nucleotides; XZ comprises a nucleic acid sequence that is complementary to a first target nucleic acid sequence; YZ is an oligonucleotide comprising the nucleic acid sequence that is complementary to a second target nucleic acid sequence; Z comprises the nucleotide sequence with a length of about 1 to about 24 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides) that is self-complementary; X comprises the nucleotide sequence with a length of about 1 to about 100 nucleotides, preferably about 1 to about 21 nucleotides (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) which is complementary to a sequence of nucleotides present in the Y 'region; And it comprises the nucleotide sequence with a length of about 1 to about 100 nucleotides, preferably about 1 to about 21 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) which is complementary to a sequence of nucleotides present in the X 'region; each p comprises a terminal phosphate group which independently is present or absent; each XZ and YZ is independently of sufficient length to interact stably (ie, form base pairs) with the first and second target nucleic acid sequences, respectively, or a portion thereof. For example, each sequence X and Y independently can comprise a sequence of about 12 to about 21 or more nucleotides in length (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more) which is complementary to a target nucleotide sequence in different target nucleic acid molecules, such as target RNA or a portion thereof. In another non-limiting example, the length of the nucleotide sequence of X and Z together that is complementary to the first target nucleic acid sequence or to a portion thereof has from about 12 to about 21 or more nucleotides (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more). In another non-limiting example, the length of the nucleotide sequence of Y and Z together that is complementary to the first target nucleic acid sequence or to a portion thereof has from about 12 to about 21 or more nucleotides (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more). In one embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in the same target nucleic acid molecule (e.g., target RNA or target RNA route). In another embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in different target nucleic acid molecules (e.g., target RNA and target path RNA). In one embodiment, Z comprises a palindrome or a repeated sequence. In one embodiment, the lengths of oligonucleotides X and X 'are identical. In another embodiment, the lengths of oligonucleotides X and X 'are not identical. In one embodiment, the lengths of oligonucleotides Y and Y 'are identical. In another modality, the lengths of the oligonucleotides Y and Y 'are not identical. In one embodiment, the double-stranded oligonucleotide construct of Formula I (a) includes one or more, specifically 1, 2, 3 or 4, mismatches, insofar as such mismatches do not significantly decrease the capacity of the double-stranded oligonucleotide of inhibiting the expression of the target gene. In one embodiment, a multifunctional siNA molecule of the invention comprises a structure having the Formula MF-II: 5'-pX X'-3 '3'-Y' Yp-5 'wherein each 5'-p-XX'-3' and 5'-p-YY'-3 'are independently an oligonucleotide with a length from about 20 nucleotides to about 300 nucleotides, preferably from about 20 to about 200 nucleotides, from about 20 to about 100 nucleotides, from about 20 to about 40 nucleotides, from about 20 to about 40 nucleotides, from about 24 to about 38 nucleotides, or from about 26 to about 38 nucleotides; X comprises a nucleic acid sequence that is complementary to a first target nucleic acid sequence; Y is an oligonucleotide comprising the nucleic acid sequence that is complementary to a second target nucleic acid sequence; X comprises a nucleotide sequence with a length of from about 1 to about 100 nucleotides, preferably from about 1 to about 21 nucleotides (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) which is complementary to a sequence of nucleotides present in the Y 'region; And it comprises the nucleotide sequence with a length of about 1 to about 100 nucleotides, preferably about 1 to about 21 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides) which is complementary to a sequence of nucleotides present in the X 'region; each p comprises a terminal phosphate group that is independently present or absent; each X and Y independently are of sufficient length to interact stably (i.e., form base pairs) with the first and second target nucleic acid sequences, respectively, or a portion thereof. For example, each sequence X and Y independently can comprise a sequence of about 12 to about 21 or more nucleotides in length (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more) which is complementary to a target nucleotide sequence in different target nucleic acid molecules, such as target RNA or a portion thereof. In one embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in the same target nucleic acid molecule (e.g., target RNA or target RNA route). In another embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in different target nucleic acid molecules (e.g., target RNA and target path RNA). In one embodiment, Z comprises a palindrome or a repeated sequence. In one embodiment, the lengths of oligonucleotides X and X "are identical In another embodiment, the lengths of oligonucleotides X and X 'are not identical, In one embodiment, the lengths of oligonucleotides Y and Y' are identical. In another embodiment, the lengths of the Y and Y 'oligonucleotides are not identical In one embodiment, the double-stranded oligonucleotide construct of Formula I (a) includes one or more, specifically 1, 2, 3 or 4, mismatches , as long as such mismatches do not significantly decrease the ability of the double-stranded oligonucleotide to inhibit the expression of the target gene In one embodiment, a multifunctional siNA molecule of the invention comprises a structure having the formula MF-III: XX 'Y 'VY wherein each X, X', Y, and Y 'is independently an oligonucleotide with a length from about 15 nucleotides to about 50 nucleotides, preferably from approximately 18 to about 40 nucleotides, or from about 19 to about 23 nucleotides; X comprises the nucleotide sequence which is complementary to a sequence of nucleotides present in the Y 'region; X 'comprises the nucleotide sequence which is complementary to a sequence of nucleotides present in the Y region; each X and X 'is independently of sufficient length to interact stably (ie, form base pairs) with a first and a second target nucleic acid sequence, respectively, or a portion thereof; W represents a polynucleotide or non-polynucleotide linkage connecting the Y 'and Y sequences; and the multifunctional siNA directs cleavage of the first and second target sequences by RNA interference. In one embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in the same target nucleic acid molecule (e.g., target RNA or target RNA route). In another embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in different target nucleic acid molecules (e.g., target RNA and target path RNA). In one embodiment, the W region connects the 3 'end of the Y' sequence to the 3 'end of the + Y sequence. In one embodiment, the W region connects the 3' end of the Y 'sequence to the 5' end. of the + Y sequence. In one embodiment, the W region connects the 5 'end of the Y' sequence to the 5 'end of the + Y sequence. In one embodiment, the W region connects the 5' end of the Y sequence. 'with the 3"end of the + sequence Y. In one embodiment, there is a terminal phosphate group at the 5' end of the sequence X. In one embodiment, there is a terminal phosphate group at the 5 'end of the sequence X' In one embodiment, there is a terminal phosphate group at the 5 'end of the Y sequence. In one embodiment, there is a terminal phosphate group at the 5' end of the sequence Y '. In one embodiment, W connects the Y sequences and And 'by a biodegradable linker In one embodiment, W further comprises a conjugate, marker, aptamer, ligand, lipid, or polymer. The multifunctional siNA of the invention comprises a structure having the Formula MF-IV: X X1 Yf-WY wherein each X, X ', Y, and Y' is independently an oligonucleotide with a length of about 15 nucleotides to about 50 nucleotides, preferably from about 18 to about 40 nucleotides, or from about 19 to about 23 nucleotides; X comprises the nucleotide sequence that is complementary to a sequence of nucleotides present in the Y 'region; X 'comprises the nucleotide sequence which is complementary to a sequence of nucleotides present in the Y region; each Y and Y 'is independently of sufficient length to interact stably (ie, form base pairs) with a first and a second target nucleic acid sequence, respectively, or a portion thereof; W represents a polynucleotide or non-polynucleotide linkage connecting the Y 'and Y sequences; and the multifunctional siNA directs cleavage of the first and second target sequences by RNA interference. In one embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in the same target nucleic acid molecule. In another embodiment, the first target nucleic acid sequence and the second target nucleic acid sequence are present in different target nucleic acid molecules. In one embodiment, the W region connects the 3 'end of the Y' sequence to the 3 'end of the + Y sequence. In one embodiment, the W region connects the 3' end of the Y 'sequence to the 5' end. of the + Y sequence. In one embodiment, the W region connects the 5 'end of the Y' sequence to the 5 'end of the + Y sequence. In one embodiment, the W region connects the 5' end of the Y sequence. 'with the 3' end of the + Y sequence. In one embodiment, there is a terminal phosphate group at the 5 'end of the X sequence., there is a terminal phosphate group at the 5 'end of the sequence X'. In one embodiment, there is a terminal phosphate group at the 5 'end of the Y sequence. In one embodiment, there is a terminal phosphate group at the 5' end of the Y 'sequence. In one embodiment, W connects the Y and Y 'sequences by means of a biodegradable linker. In one embodiment, W further comprises a conjugate, label, aptamer, ligand, lipid, or polymer. In one embodiment, a multifunctional siNA molecule of the invention comprises a structure having the Formula MF-V: X Xf Y'-W-Y wherein each X, X ', Y, and Y' is independently an oligonucleotide with a length of about 15 nucleotides to about 50 nucleotides, preferably about 18 to about 40 nucleotides, or about 19 to about 23 nucleotides; X comprises the nucleotide sequence that is complementary to a sequence of nucleotides present in the Y 'region; X 'comprises the nucleotide sequence which is complementary to a sequence of nucleotides present in the Y region; each X, X ', Y and Y' is independently of sufficient length to interact stably (i.e., form base pairs) with a first, second, third or fourth target nucleic acid sequence, respectively, or a portion of the same; W represents a polynucleotide or non-polynucleotide linkage connecting the Y 'and Y sequences; and the multifunctional siNA directs cleavage of the first, second, third and / or fourth target sequences by RNA interference. In one embodiment, the first, second, third and fourth target nucleic acid sequences are all present in the same target nucleic acid molecule (e.g., target RNA or target path RNA). In another embodiment, the first, second, third and fourth target nucleic acid sequences independently are present in different target nucleic acid molecules (e.g., target RNA and target path RNA). In one embodiment, the W region connects the 3 'end of the Y' sequence to the 3 'end of the + Y sequence. In one embodiment, the W region connects the 3' end of the Y 'sequence to the 5' end. of the + Y sequence. In one embodiment, the W region connects the 5 'end of the Y' sequence to the 5 'end of the + Y sequence. In one embodiment, the W region connects the 5' end of the Y sequence. 'with the 3' end of the + sequence Y. In one embodiment, there is a terminal phosphate group at the 5 'end of the sequence X. In one embodiment, there is a terminal phosphate group at the 5' end of the sequence X ' . In one embodiment, there is a terminal phosphate group at the 5 'end of the Y sequence. In one embodiment, there is a terminal phosphate group at the 5' end of the Y 'sequence. In one embodiment, W connects the Y and Y 'sequences by means of a biodegradable linker. In one embodiment, W further comprises a conjugate, label, aptamer, ligand, lipid, or polymer. In one embodiment, the X and Y regions of the multifunctional siNA molecule of the invention (eg, having any of the formulas MF-I-MF-V), are complementary to different target nucleic acid sequences which are portions of the same target nucleic acid molecule. In one embodiment, said target nucleic acid sequences are in different locations in the coding region of an RNA transcript. In one embodiment, said target nucleic acid sequences comprise coding and non-coding regions of the same RNA transcript. In one embodiment, said target nucleic acid sequences comprise regions transcribed with alternative spikes or precursors of said transcripts with alternative spikes. In one embodiment, a multifunctional siNA molecule having any of the Formulas MF-I-MF-V may comprise chemical modifications as described herein without limitation, such as, for example, nucleotides having any of the Formulas I-VII as described herein, stabilization structures as described in Table I, or any other combination of modified nucleotides and non-nucleotides as described in the various embodiments of the present document. In one embodiment, the palindrome or repeated sequence or modified nucleotide (eg, nucleotide with a modified base, such as 2-amino purine or universal base) in Z of the multifunctional siNA constructs having the Formula MF-I or MF -II, comprises chemically modified nucleotides that are capable of interacting with a portion of the target nucleic acid sequence (eg, analogs with modified bases that can form Watson Crick base pairs or base pairs other than Watson Crick). In one embodiment, a multifunctional siNA molecule of the invention, for example each strand of a multifunctional siNA having MF-I -MF-V, independently comprises from about 15 to about 40 nucleotides (e.g., about 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides). In one embodiment, a multifunctional siNA molecule of the invention comprises one or more chemical modifications. In a non-limiting example, the introduction of chemically modified nucleotides and / or non-nucleotides into nucleic acid molecules of the invention provides a powerful tool to overcome the potential limitations of in vivo stability and bioavailability inherent in unmodified RNA molecules that are they administer exogenously. For example, the use of chemically modified nucleic acid molecules may allow a lower dose of a particular nucleic acid molecule for a given therapeutic effect since the chemically modified nucleic acid molecules tend to have a longer half-life in serum or in cells or tissues. Furthermore, certain chemical modifications can improve the bioavailability and / or potency of the nucleic acid molecules not only by improving the half-life but also by facilitating the targeting of nucleic acid molecules to particular organs, cells or tissues and / or improving the cellular uptake of the nucleic acids. nucleic acid molecules. Therefore, even if the activity of a chemically modified nucleic acid molecule in vitro is reduced compared to a native / unmodified nucleic acid molecule, for example when compared to an unmodified RNA molecule, the total activity of the Modified nucleic acid molecule may be larger than that of the native or unmodified nucleic acid molecule due to improved stability, potency, duration of effect, bioavailability and / or administration of the molecule. In another embodiment, the invention features multifunctional siNAs, wherein the multifunctional siNAs are assembled from two separate double-stranded siNAs, with one end of each coding strand anchored to the end of the coding strand of the other siNA molecule, such that the two non-coding siNA strands hybridize to their corresponding coding strand which are anchored together at one end (see Figures 19A-19D). The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In one embodiment, the invention features a multifunctional siNA, wherein the multifunctional siNA is assembled from two separate double-stranded siNAs, with the 5 'end of a siNA coding strand anchored to the 5' end of the coding strand of the other siNA molecule, such that the 5 'ends of the two siNA non-coding strands hybridize to their corresponding coding strand which are anchored together at one end, from the back (in opposite directions) to each other (see Figure 19 (A)). The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In one embodiment, the invention features a multi-functional siNA, wherein the multifunctional siNA is assembled from two separate double-stranded siNAs, with the 3 'end of a strand encoding the siNA anchored to the 3' end of the coding strand of the other siNA molecule, such that the 5 'ends of the two siNA non-coding strands hybridize to their corresponding coding strand that are anchored together at one end, looking at each other (see Figure 19 (B)). The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein.

In one embodiment, the invention features a multifunctional siNA, wherein the mififunctional siNA is assembled from two separate double-stranded siNAs, with the 5 'end of a siNA coding strand anchored to the 3' end of the coding strand of the other siNA molecule, such that the 5 'ends of the one of the two non-coding siNA strands hybridize to their corresponding coding strand which are anchored together at one end, facing the 3' end of the other strand not coding (see Figures 19A-19H). The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In one embodiment, the invention features a multifunctional siNA, wherein the multifunctional siNA is assembled from two separate double-stranded siNAs, with the 5 'end of a non-coding strand of the siNA anchored to the 3' end of the non-coding strand of the other siNA molecule, such that the 5 'ends of the one of the siNA coding strands hybridize to their corresponding non-coding strand which are anchored together at one end, facing the 3' end of the other strand coding (see Figure 19 (GH)). In one embodiment, the link between the 5 'end of the first non-coding strand and the 3' end of the second non-coding strand is designed in such a way that it can be easily cleaved (eg, a biodegradable linker) such that the 5 'end of each non-coding strand of the multifunctional siNA has a free 5' end suitable to mediate the cleavage of the target RNA which is based on RNA interference. The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In one embodiment, the invention features a multifunctional siNA, wherein the multifunctional siNA is assembled from two separate double-stranded siNAs, with the 5 'end of a non-coding strand of the siNA anchored to the 5' end of the non-coding strand of the other siNA molecule, such that the 3 'ends of the one of the siNA coding strands hybridize to their corresponding non-coding strand which are anchored together at one end, facing the 3' end of the other strand coding (see Figure 22 (E)). In one embodiment, the link between the 5 'end of the first non-coding strand and the 5' end of the second non-coding strand is designed in such a way that it can be easily cleaved (eg, a biodegradable linker) such that the 5 'end of each non-coding strand of the multifunctional siNA has a free 5' end suitable to mediate the cleavage of the target RNA which is based on RNA interference. The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In one embodiment, the invention features a multifunctional siNA, wherein the multifunctional siNA is assembled from two separate double-stranded siNAs, with the 3 'end of a non-coding strand of the siNA anchored to the 3' end of the non-coding strand of the other siNA molecule, such that the 5 'ends of the one of the siNA coding strands hybridize to their corresponding non-coding strand that are anchored together at one end, facing the 3' end of the other strand coding (see Figure 22 (F)). In one embodiment, the link between the 5 'end of the first non-coding strand and the 5' end of the second non-coding strand is designed in such a way that it can be easily cleaved (eg, a biodegradable linker) such that the 5 'end of each non-coding strand of the multifunctional siNA has a free 5' end suitable to mediate the cleavage of the target RNA which is based on RNA interference. The linkers or linkers can be linkers with nucleotide or non-nucleotide bases as is generally known in the art and as described herein. In any of the previous modalities, a first target nucleic acid sequence or a second target nucleic acid sequence can independently comprise target RNA or DNA or a portion thereof. In one embodiment, the first target nucleic acid sequence is an objective RNA or DNA or a portion thereof and the second target nucleic acid sequence is an objective RNA or DNA or a portion thereof. In one embodiment, the first target nucleic acid sequence is an objective RNA or DNA or a portion thereof and the second target nucleic acid sequence is to another target RNA or DNA or a portion thereof.

Synthesis of nucleic acid molecules The synthesis of nucleic acids of more than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. In this invention, short nucleic acid motifs are preferably used ("short" refers to nucleic acid motifs of no more than 100 nucleotides in length, preferably no longer than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length, eg, individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) for exogenous administration. The simple structure of these molecules increases the ability of the nucleic acid to invade the target regions of the structure of the protein and / or RNA. Exemplary molecules of the present invention are chemically synthesized and it is possible to synthesize others in a similar manner. Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) are synthesized using protocols known in the art, for example as described in Caruthers et al., 1992, Methods in Enzymology 211, 3-19, Thompson et al., PCT International Patent Publication No. WO 99/54459, Wincott et al., 1995, Nucleic Acid Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio., 1A, 59, Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, United States Patent No. 6,001, 311. All of these references are incorporated herein by reference. Oligonucleotide synthesis employs customary nucleic acid coupling and protecting groups, such as dimethoxytrityl at the 5 'end, and phosphoramidites at the 3' end. In a non-limiting example, small-scale syntheses are performed on a synthesizer 394 from Applied Biosystems, Inc. using a 0.2 μmol scale protocol with a coupling step of 2.5 min. for the 2'-O-methylated nucleotides and a coupling step of 45 seconds for the 2'-deoxy nucleotides or for the 2'-deoxy-2'-fluoro nucleotides. Table III summarizes the amounts and contact times of the reagents used in the synthesis cycle. Alternatively, the synthesis at 0.2 μmol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, CA) with minimal cycle modification. A 33-fold excess (60 μL of 0.11 M = 6.6 μmol) of 2'-O-methyl phosphoramidite and a 105-fold excess of S-ethyl-tetrazole (60 μL of 0.25 M = 15 μmol) may be used in each cycle of coupling of 2'-O-methyl residues relative to polymer-bound 5'-hydroxyl. A 22-fold excess (40 μl of 0.11 M = 4.4 μmol) of deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40 μl of 0.25 M = 10 μmol) can be used in each coupling cycle of relative deoxytes at 5'-hydroxyl bound to polymer. The average coupling yields in the synthesizer 394 of Applied Biosystems, Inc. determined by colorimetric quantification of the triphenyl fractions, are usually 97.5-99%. Other reagents for oligonucleotide synthesis for synthesizer 394 from Applied Biosystems, Inc. include the following: the detritylation solution is 3% TCA in methylene chloride (ABI); the introduction of the cap is carried out with 16% of? / - methyl imidazole in THF (ABI) and 10% acetic anhydride / 10% of 2,6-lutidine in THF (ABI); and the detritylation solution is 16.9 mM L2, 49 mM pyridine, 9% water in THF (PerSeptive Biosystems, Inc.). Synthetic grade acetonitrile from Burdick & Jackson directly from the reagent bottle. The solution of S-ethyltetrazole (0.25 M in acetonitrile) is prepared from the solid obtained from American International Chemical, Inc. Alternatively, for the introduction of the phosphorothioate linkages, Beaucage reagent (1,1-dioxide) is used. 3H-1, 2-benzodithiol-3-one, 0.05 M in acetonitrile). The deprotection of the DNA-based oligonucleotides is carried out in the following manner: the trityl oligoribonucleotide on polymer-bound is transferred to a 4 ml glass vial with a screw cap and suspended in a 40% aqueous methylamine solution ( 1 ml) at 65 ° C for 10 minutes. After cooling to -20 ° C, the supernatant is removed from the polymeric support. The support is washed three times with 1.0 ml of EtOH: MeCN: H2O / 3: 1: 1, vortexed and then the supernatant is added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder. In one embodiment, the nucleic acid molecules of the invention are synthesized, deprotected and analyzed according to procedures described in US 6,995,259, US 6,686,463, US 6,673,918, US 6,649,751, US 6,989,442, and USSN 10 / 190,359. , all of which are incorporated by reference to the present document in its entirety.

The synthesis procedure that is used for the RNA that includes certain siNA molecules of the invention follows the procedure described in Usman et al., 1987, J. Am. Chem. Soc, 109, 7845; Scaringe et al., 1990, Nucleic Acid Res .., 18, 5433; and Wincott et al., 1995, Nucleic Acid Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol. Bio., 74, 59, and employs customary nucleic acid coupling and protecting groups, such as dimethoxytrityl at the 5 'end, and phosphoramidites at the 3' end. In a non-limiting example, small-scale synthesis is performed on a synthesizer 394 from Applied Biosystems, Inc. using a 0.2 μmol scale protocol with a coupling step of 7.5 min. for the alkylsilyl protected nucleotides and a 2.5 minute coupling step for the 2'-O-methylated nucleotides. Table III summarizes the amounts and contact times of the reagents used in the synthesis cycle. Alternatively, the synthesis at 0.2 μmol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, CA) with minimal cycle modification. A 33-fold excess (60 μL of 0.11 M = 6.6 μmol) of 2'-0-methyl phosphoramidite and a 75-fold excess of S-ethyl-tetrazole (60 μL of 0.25 M = 15 μmol) may be used in each cycle of coupling of 2'-0-methyl residues relative to 5'-hydroxyl linked to polymer. An excess of 66 times (120 μl of 0.11 M = 13.2 μmol) of alkylsilyl-protected phosphoramidite (rribo) and a 150-fold excess of S-ethyl tetrazole (120 μl of 0.25 M = 30 μmol) may be used in each cycle. coupling ribo residues relative to 5'-hydroxyl bound to polymer. The average coupling yields in the synthesizer 394 of Applied Biosystems, Inc. determined by colorimetric quantification of trityl fractions, are usually 97.5-99%. Other reagents for oligonucleotide synthesis for synthesizer 394 from Applied Biosystems, Inc. include the following: the detritylation solution is 3% TCA in methylene chloride (ABI); the introduction of the cap is carried out with 16% of? / - methyl imidazole in THF (ABI) and 10% acetic anhydride / 10% of 2,6-lutidine in THF (ABI); the detritylation solution is 16.9 mM L2, 49 mM pyridine, 9% water in THF (PerSeptive Biosystems, Inc.). Synthetic grade acetonitrile from Burdick & Jackson directly from the reagent bottle. The solution of S-ethyltetrazole (0.25 M in acetonitrile) is prepared from the solid obtained from American International Chemical, Inc. Alternatively, for the introduction of the phosphorothioate linkages, Beaucage reagent (1,1-dioxide) is used. 3H-1, 2-benzodithiol-3-one, 0.05 M in acetonitrile). The deprotection of the RNA is carried out using a single container or two container protocol. For the two-vessel protocol, the trityl-bonded oligoribonucleotide on polymer is transferred to a 4 ml glass vial with a screw cap and suspended in a 40% aqueous methylamine solution (1 ml) at 65 ° C for 10 min. .. After cooling to -20 ° C, the supernatant is removed from the polymeric support. The support is washed three times with 1.0 ml of EtOH: MeCN: H2O / 3: 1: 1, vortexed and then the supernatant is added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder. The base-deprotected oligoribonucleotide is resuspended in anhydrous TEA / HF / NMP solution (300 μl of a 1.5 ml solution of N-methylpyrrolidinone, 750 μl of TEA and 1 ml of TEA * 3HF providing a 1.4 M HF concentration) and heat to 65 ° C. After 1.5 h, the oligomer is inactivated with 1.5 M NH 4 HCO 3. In one embodiment, the nucleic acid molecules of the invention are synthesized, deprotected and analyzed according to procedures described in US 6,995,259, US 6,686,463, US 6,673,918, US 6,649, 751, US 6,989,442, and USSN 10 / 190,359, all of which are incorporated by reference herein in their entirety. Alternatively, for the single container protocol, the trityl oligoribonucleotide on polymer-bound trityl is transferred to a 4 ml glass vial with a screw cap and suspended in a solution of 33% ethanolic methylamine / 1/1 DMSO ( 0.8 ml) at 65 ° C for 15 minutes. The vial is brought to room temperature, TEA-3HF (0.1 ml) is added and the vial is heated at 65 ° C for 15 minutes. The sample is cooled to -20 ° C and then quenched with 1.5 M NH4HCO3. For the purification of the oligomers on trityl, the inactivated NH4HCO3 solution is loaded into a cartridge containing C-18 which has been prewashed with acetonitrile followed by TEAA 50 mM. After washing the cartridge loaded with water, the RNA is detritylated with 0.5% TFA for 13 minutes. After the cartridge is washed again with water, the salt exchange is carried out with 1 M NaCl and washed with water again. Then the oligonucleotide is diluted with 30% acetonitrile. The average yields of the coupling by stages are usually from >98% (Wincott et al., 1995 Nucleic Acid Res. 23, 2677-2684). Persons of ordinary skill in the art will recognize that the synthesis scale can be adapted to be greater or less than the example described above that includes but is not limited to a 96-well format. Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and linked post-synthetically, for example, by binding (Moore et al., 1992, Science 256, 9923; Draper et al., PCT international publication nJ WO 93 / 23569, Shabarova et al., 1991, Nucleic Acid Research 19, 4247, Bellon et al., 1997, Nucleosides &Nucleotides, 16, 951, Bellon et al., 1997, Bioconjugate Chem. 8, 204), or Hybridization after synthesis and / or deprotection. The siNA molecules of the invention can also be synthesized by a tandem synthesis methodology such as described in Example 1 of this document, in which both strands of siNA are synthesized in the form of a single continuous oligonucleotide fragment or strand separated by a cleavable linker that is subsequently cleaved by providing separate siNA fragments or strands that hybridize and allow purification of the siNA double-stranded molecule. The linker can be a polynucleotide linkage or a non-polynucleotide linkage. The siNA tandem synthesis as described herein can be easily adapted to the synthesis in both multi-well and multiple-plate platforms such as 96 wells or similarly larger multi-well platforms. The tandem synthesis of siNA as described herein can also be easily adapted to large-scale synthesis platforms employing batch reactors, synthesis columns and the like. A siNA molecule can also be assembled from two different strands or nucleic acid fragments in which one fragment includes the coding region and the second fragment includes the non-coding region of the RNA molecule. The nucleic acid molecules of the present invention can be extensively modified to enhance stability by modification with nuclease-resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-O- methyl, 2'-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acid Symp. Ser. 31, 163). The siNA constructs can be purified by gel electrophoresis using general procedures or can be purified by high pressure liquid chromatography (HPLC, see Wincott et al., Reference above, the entirety of which is hereby incorporated by reference) and resuspended in water In another aspect of the invention, the siNA molecules of the invention are expressed from transcription units that are inserted into DNA or RNA vectors. The recombinant vectors can be plasmids or viral DNA vectors. Viral vectors expressing siNA can be constructed based, but not limited to, on adeno-associated viruses, retroviruses, adenoviruses, or alphaviruses. Recombinant vectors capable of expressing siNA molecules can be administered as described herein, and persist in target cells. Alternatively, viral vectors that provide transient expression of the siNA molecules can be used.

Optimization of the activity of the nucleic acid molecule of the invention. Chemical synthesis of nucleic acid molecules with modifications (base, sugar and / or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency (see, for example, Eckstein et al., International Patent Publication No. WO 92/07065, Perrault et al., 1990 Nature 344, 565, Pieken et al., 1991, Science 253, 314, Usman and Cedergren, 1992, Trends in Biochem. Sci. 17, 334; Usman et al. International Patent No. WO 93/15187; and Rossi et al., International Patent Publication No. WO 91/03162, Sproat, United States No. 5,334,711, Gold et al., United States Patent No. 6,300,074, and Burgin et al., previous reference, all of which are incorporated by reference to this document). All the above references describe various chemical modifications that can be made to the base, phosphate and / or sugar moieties of the nucleic acid molecules as described herein. Modifications that enhance their efficiency in the cells, and the elimination of the bases of the nucleic acid molecules to shorten the synthesis times of the oligonucleotides and reduce the needs of chemical substances are desirable. There are several examples in the art describing modifications of sugar, base and phosphate that can be introduced into the nucleic acid molecules with significant enhancement of their stability and efficacy as nucleases. For example, oligonucleotides are modified to enhance stability and / or enhance biological activity by modification with nuclease resistant groups, eg, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'- modifications. O-methyl, 2'-O-allyl, 2'-H, at the bases of nucleotides (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acid Symp. Ser. 31, 163; Burgin et al., 1996, Biochemistry, 35, 14090). The modification of the sugars of the nucleic acid molecules has been extensively described in the art (see Eckstein et al., PCT International Patent Publication No. WO 92/07065, Perrault et al., Nature, 1990, 344, 565-568; Pieken et al., Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem, Sci., 1992, 11, 334-339; Usman et al, PCT International Patent Publication No. WO 93/15187; Sproat, U.S. Patent No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., PCT International Publication No. WO 97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., United States Patent No. 5,627,053; Woolf et al., PCT International Patent Publication No. WO 98/13526; Thompson et al., USSN 60 / 082,404, filed April 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopollymers (Nucleic Acid Sciences), 48, 39-55; Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010; all references are hereby incorporated in their entirety by reference to this document). These publications describe general procedures and strategies to determine the location of the incorporation of sugar modifications, base and / or phosphate and the like in the catalysis of unmodulated nucleic acid molecules and are incorporated by reference herein. In view of such teachings, similar modifications can be used as described herein to modify the nucleic acid molecules of modifications of the present invention so long as the siNA capacity of promoting RNAi is not significantly inhibited. the cells. In one embodiment, a nucleic acid molecule of the invention is chemically modified as described in US 20050020521, which is incorporated by reference herein in its entirety.

Although chemical modification of the internucleotide linkages of oligonucleotides with phosphorothioate, phosphorodithioate, and / or 5'-methylphosphonate linkages improves stability, excessive modifications may cause some toxicity or less activity. Therefore, when designing nucleic acid molecules, the amount of these internucleotide linkages should be minimized. The reduction of the concentration of these bonds should reduce the toxicity, producing a greater efficiency and specificity of these molecules. Short interfering nucleic acid (siNA) molecules that have chemical modifications that maintain or enhance activity are provided. That nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Therefore, activity in vitro and / or in vivo should not be significantly reduced. In cases where the objective is modulation, the therapeutic nucleic acid molecules administered exogenously should be optimally stable inside the cells until the translation of the target RNA has been modulated sufficiently to reduce the levels of the protein not desirable. This period of time varies from hours to days depending on the state of illness. Improvements in the chemical synthesis of RNA and DNA (Wincott et al., 1995, Nucleic Acid Res .. 23, 2677; Caruthers et al., 1992, Methods in Enzymology 211, 3-19 (which is incorporated by reference herein). document)) have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their stability against nucleases, as described above. In one embodiment, the nucleic acid molecules of the invention include one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog in which the modifications confer the ability to form hydrogen bonds of both faces, Watson-Crick and Hoogsteen, of a complementary guanine in a double-stranded molecule, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc, 120, 8531-8532. A single substitution of G-clamp analog in an oligonucleotide can produce substantially improved thermal stability and discrimination of mismatches when hybridizing to complementary oligonucleotides. The inclusion of said nucleotides in nucleic acid molecules of the invention produces both higher affinity and specificity against the nucleic acid targets, complementary sequences, or template strands. In another embodiment, the nucleic acid molecules of the invention include one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA "nucleic acid" nucleotides blocked "such as a 2 ', 4'-C methylenembiciclonucleotide (see for example Wengel et al., PCT International Patent Publication No. WO 00/66604 and WO 99/14226). In another embodiment, the invention features conjugates and / or complexes of siNA molecules of the invention. Said conjugates and / or complexes can be used to facilitate the administration of siNA molecules in a biological system, such as a cell. The conjugates and complexes provided by the present invention can confer therapeutic activity by transferring therapeutic compounds through cell membranes, altering the pharmacokinetics and / or modulating the location of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the administration of molecules, including, but not limited to, short molecules, lipids, cholesterol, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, polymers with negative charges and other polymers, for example proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, through cell membranes. In general, the conveyors described are designed to be used either individually or as part of a multicomponent system, with or without degradable linkers. It is expected that these compounds improve the administration and / or localization of nucleic acid molecules of the invention in a number of cell types that originate in different tissues, in the presence or absence of serum (see Sullenger and Cech, United States patent). United n 5,854,038). The conjugates of the molecules described herein can be linked to biologically active molecules by linkers that are biodegradable, such as biodegradable nucleic acid linker molecules. The term "biodegradable linker" as used herein, refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect a molecule to another molecule, eg, a molecule biologically active to a siNA molecule of the invention or the coding and non-coding strands of a siNA molecule of the invention. The biodegradable linker is designed in such a way that its stability can be modulated for a particular purpose, such as administration to a particular tissue or cell type. The stability of a biodegradable linker molecule with nucleic acid base can be modulated using various chemical groups, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically modified nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino , 2'-O-amine, 2'-C-allyl, 2'-O-allyl, and other nucleotides modified enm 2 'or in the base. The biodegradable nucleic acid linker molecule can be a longer dimer, trimer, tetramer, or nucleic acid molecule, eg, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length, or may comprise a single nucleotide with a phosphorus base bond, for example, a phosphoramidate or phosphodiester linkage. The biodegradable linker molecule of nucleic acid can also comprise modifications in the nucleic acid backbone, in the nucleic acid sugar, or in the base of the nucleic acid. The term "biodegradable" as used herein, refers to degradation in a biological system, for example, enzymatic degradation or chemical degradation.

The term "biologically active molecule" as used herein refers to compounds or molecules that are capable of causing or modifying a biological response in a system. Non-limiting examples of biologically active siNA molecules either alone or combined with other molecules contemplated by the present invention include therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutic substances, short molecules, vitamins, cofactors, nucleosides , nucleotides, oligonucleotides, enzymatic nucleic acids, non-coding nucleic acids, oligonucleotides forming three-stranded molecules, chimeras 2.5-A, siNA, dsRNA, alkoxy, aptamers, mock and their analogues. The biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and / or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers. The term "phospholipid" as used herein, refers to a hydrophobic molecule comprising at least one phosphorus group. For example, a phospholipid may comprise a phosphorus-containing group and a saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.

The therapeutic nucleic acid molecules (eg, siNA molecules) that are optimally exogenously administered are stable in the cells until the reverse transcription of the RNA has been modulated sufficiently to reduce the levels of the RNA transcript. Nucleic acid molecules are resistant to nucleases to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules that are described in the present invention and in the art have expanded the ability to modify nucleic acid molecules by introducing modifications in nucleotides to enhance their stability as nucleases as described above. Still in another embodiment, siNA molecules are provided that have chemical modifications that maintain or enhance the enzymatic activity of the proteins involved in the RNAi. Said nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus the activity in vitro and / or in vivo should not be significantly reduced. The use of the nucleic acid-based molecules of the invention will lead to better treatments by achieving the possibility of combination therapies (eg, multiple siNA molecules directed against different genes; nucleic acid molecules coupled to known short molecule modulators; intermittent treatment with combinations of molecules, which include different motifs and / or other chemical or biological molecules). The treatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, non-coding, 2.5-A oligoadenylate, simulated and aptamers. In another aspect a siNA molecule of the invention comprises one or more 5 'and / or 3' cap structures, for example, only in the coding siNA strand, the non-coding siNA strand or both siNA strands. By "cap structure" is meant chemical modifications, which have been incorporated at either end of the oligonucleotide (see, for example, Adamic et al., U.S. Patent No. 5,998,203, which is incorporated by reference herein). These terminal modifications protect the nucleic acid molecule from exodegradation by nucleases, and may aid administration and / or localization within a cell. The cap may be present at the 5 'end (cap at 5) or at the 3' end (3 'cap) or may be present at both ends. In non-limiting examples, the 5 'cap includes, but is not limited to, glyceryl, inverted deoxyabasic moiety (remainder); 4 ', 5'-methylene nucleotide; l- (beta-D-eritrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1, 5-anhydrohexitol nucleotide; L nucleotides; alpha nucleotides; nucleotide with modified bases; phosphorodithioate linkage; freo-pentofuranosyl nucleotide; 3 ', 4'-acyclic dry nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl dnucleotide; 3'-3'-inverted nucleotide residue; 3'-3'-inverted abasic rest; 3'-2'-inverted nucleotide residue; 3'-2'-inverted abasic rest; 1,4-butanediol phosphate; 3'-phosphoramidate; hexyl phosphate; aminohexylphosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate; or bridge or bridge non-bridge methylphosphonate. Non-limiting examples of cap moieties are shown in Figure 10. Non-limiting examples of the 3 'cap include, but are not limited to, glyceryl, inverted deoxyabasic moiety (moiety); 4", 5'-methylene nucleotide; l- (beta-D-eritrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 5'-amino-alkyl phosphate nucleotide; 1,3-diamino-2 propyl phosphate, 3-aminopropyl phosphate, 6-aminohexyl phosphate, 1,2-aminododecyl phosphate, hydroxypropyl phosphate, nucleotide of 5-anhydrohexitol, nucleotides L, nucleotides alpha, nucleotides with modified bases, phosphorodithioate, nucleotide of freo-pentofuranosyl, nucleotide 3 ', 4'-acyclic dry, acyclic 3,4-dihydroxybutyl nucleotide, 3,5-dihydroxypentyl nucleotide, d-inverted nucleotide residue, 5'-5'-inverted abasic residue; phosphoramidate, 5'-phosphorothioate, 1,4-butanediol phosphate, 5'-amino, 5'-phosphoramidate bridge or non-bridge, phosphorothioate and / or phosphorodithioate, bridge or non-bridge methylphosphonate and dies mercapto ( for more details see Beaucage and lyer, 1993, Tetrahedron 49, 1925, which is incorporated by reference to this document).

By the term "non-nucleotides" is meant any "non-nucleotide" group means in addition any group or compound that can be incorporated into a nucleic acid strand instead of one or more nucleotide units, including sugar substitutions and / or phosphate, and allows the remaining bases to show their enzymatic activity. The group or compound is abasic because it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks base at the 1 'position. An "alkyl" group refers to a saturated aliphatic hydrocarbon, including straight chain, branched and cyclic alkyl groups. Preferably, the alkyl group has from 1 to 12 carbons. More preferably, it is a lower alkyl of 1 to 7 carbons, more preferably 1 to 4 carbons. The alkyl group may be substituted or unsubstituted. When substituted, the substituted group (s) is preferably hydroxyl, cyano, alkoxy, = O, = S, NO2 or N (CH3) 2, amino, or SH. The term also includes alkenyl groups which are unsaturated hydrocarbon groups containing at least one carbon-carbon double bond, which includes straight chain, branched chain and cyclic groups. Preferably, the alkenyl group has from 1 to 12 carbons. More preferably, it is a lower alkenyl of 1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group may be substituted or unsubstituted. When substituted, the substituted group (s) is preferably hydroxyl, cyano, alkoxy, = O, = S, NO2, halogen, N (CH3) 2, amino, or SH. The term "alkyl" also includes alkynyl groups which are unsaturated hydrocarbon groups containing at least one carbon-carbon triple bond, which includes straight chain, branched chain and cyclic groups. Preferably, the alkynyl group has from 1 to 12 carbons. More preferably, it is a lower alkynyl of 1 to 7 carbons, more preferably 1 to 4 carbons. The alkynyl group can be substituted or unsubstituted. When substituted, the substituted group (s) is preferably hydroxyl, cyano, alkoxy, = O, = S, NO2 or N (CH3) 2, amino, or SH. Said alkyl groups may also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups. An "aryl" group refers to an aromatic group having at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which may be optionally substituted. Preferred substituents of the aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups. An "alkylaryl" group refers to an alkyl group (as described above) covalently linked to an aryl group (as described above). Carbocyclic aryl groups are groups in which the aromatic ring atoms are all carbon atoms. The carbon atoms are optionally substituted. The heterocyclic aryl groups are groups having 1 to 3 heteroatoms as ring atoms in which the aromatic ring and the rest of the ring atoms are carbon atoms. Suitable heteroatoms include oxygen, sulfur and nitrogen and include furanyl, thienyl, pyridyl, pyrrolyl, N- (lower alkyl) pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted. An "amide" refers to a -C (O) -NH-R, where R is alkyl, aryl, alkylaryl or hydrogen. An "ester" refers to a -C (O) -OR ', where R is alkyl, aryl, alkylaryl or hydrogen. "Nucleotide" as used herein and recognized in the art includes natural (standard) bases, and modifications known in the art. Said bases are generally located in the V position of a sugar moiety of the nucleotide. The nucleotides generally comprise a base, a sugar and a phosphate group. The nucleotides may be unmodified or modified in the sugar, phosphate and / or base moiety (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and others).; see, for example, Usman and McSwiggen, previous reference; Eckstein et al., PCT International Patent Publication No. WO 92/07065; Usman et al., PCT International Patent Publication No. WO 93/15187; Uhlman & Peyman, previous reference, all are hereby incorporated by reference to this document). There are several examples of modified nucleic acid bases known in the art such as summarized by Limbach et al., 1994, Nucleic Acid Res. 22, 2183. Some of the non-limiting examples of base modifications that can be introduced into acid molecules nucleic acids include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g. 5-methylcytidine), 5-alkyluridines (for example, ribotimine), 5-halouridine (for example 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (for example 6-methyluridine), propyne, and others (Burgin et al. ., 1996, Biochemistry, 35, 14090; Uhlman &Peyman, reference above). With "modified bases" in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil in the 1 'position or their equivalents. In one embodiment, the invention features modified siNA molecules, with phosphate modifications in the backbone comprising one or more substitutions phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate. , formacetal, thioformacetal, and / or alkylsilyl. For a review of the oligonucleotide modifications of the skeleton, see Hunziker and Leumann, 1995 Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994, Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39. By "abasic" is meant sugar residues lacking a nucleobase or having a hydrogen atom (H) or other non-nucleobasic chemical group instead of a nucleobase at the 1'-position of the sugar moiety, see for example Adamic et al. ., U.S. Patent No. 5,998,203.

In one embodiment, an abasic moiety of the invention is a ribose, deoxyribose, or dideoxyribose sugar. By "nucleoside sugar" is meant one of the bases adenine, cytosine, guanine, thymine, or uracil bound to the 1 'carbon of β-D-ribofuranose. By "modified nucleoside" is meant any base nucleotide containing a modification in the chemical structure of a base, sugar and / or unmodified nucleotide phosphate. Non-limiting examples of modified nucleotides are shown by Formulas I-VI I and / or other modifications described herein. As regards the 2'-modified nucleotides as described for the present invention, by "amino" is meant 2'-NH 2 or 2'-0-NH 2, which may be modified or unmodified. Such modified groups are described, for example, in Eckstein et al., U.S. Patent No. 5,672,695 and Matulic-Adamic et al., U.S. Patent No. 6,248,878, which both are incorporated by reference in their entirety. Various modifications can be made to a siNA nucleic acid structure to improve the utility of these molecules. Such modifications will improve the useful life, the in vitro half-life, the stability, and the ease of introducing said oligonucleotides at the target site, for example, to improve the penetration of cell membranes and confer the ability to recognize and bind to a cell. objective.

Administration of Nucleic Acid Molecules A siNA molecule of the invention can be adapted to be used to prevent or treat diseases, traits, disorders, and / or conditions described herein or known by other means in the art that are related to gene expression of a target gene or target route, and / or any other trait, disease, disorder or condition that is related to or responsive to the levels of target protein or polynucleotides that are expressed from them in a cell or tissue, alone or combined with other therapies. In one embodiment, the siNA molecules and formulations of the invention or their compositions are administered to a cell, subject, or organism as described herein and as is generally known in the art. In one embodiment, a siNA composition of the invention may comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and / or may be present in pharmaceutically acceptable formulations. Methods for the administration of nucleic acid molecules are described in Akhtar et al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser., 752, 184-192, all of which are incorporated herein by reference. Beigelman et al., U.S. Patent No. 6,395,713 and Sullivan et al., PCT WO 94/02595 further describe the general procedures for the delivery of nucleic acid molecules. These protocols can be used for the administration of virtually any nucleic acid molecule. The nucleic acid molecules can be administered to cells by a variety of methods known to those skilled in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or incorporation in other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins ( see, for example, Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074, Wang et al., PCT international publication No. WO 03/47518 and WO 03/46185), poly (lactic-co-glycolic acid) (PLGA) and PLCA microspheres (see for example U.S. Patent 6,447,796 and U.S. Patent Application Publication nJ US 2002130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, PCT international patent publication No. WO 00/53722). In another embodiment, the nucleic acid molecules of the invention can also be formulated or complexed with polyethylene imine and its derivatives, such as polyethylene imine-polyethylene glycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethylene imine-polyethylene glycol-tri-N derivatives. -acetylgalactosamine (PEI-PEG-triGAL). In one embodiment, the nucleic acid molecules of the invention are formulated as described in United States Patent Application Publication No. 20030077829, which is incorporated by reference herein in its entirety.

In one embodiment, a siNA molecule of the invention is formulated in the form of a composition that is disclosed in United States Provisional Patent Application No. 60 / 678,531 and in United States Provisional Patent Application No. JJ 60 / 703,946, filed July 29, 2005, United States Provisional Patent Application No. 60 / 737,024, filed November 15, 2005, and USSN 11 / 353,630, filed February 14, 2006 (Vargeese et al.) , all of which are incorporated by reference to the present document in its entirety. Such siNA formulations are generally referred to as "nucleic acid lipid particles" (LNP). In one embodiment, a siNA molecule of the invention is formulated with one or more LNP compositions that are described herein in Table IV (see USSN 11 / 353,630, reference above). In one embodiment, the siNA molecules of the invention and their formulations or compositions are administered to lung tissues and cells as described in US 2006/0062758; US 2006/0014289; and US 2004/0077540. In one embodiment, a siNA molecule of the invention forms complexes with membrane-altering agents such as those described in United States Patent Application Publication No. 2001-2007666, which is incorporated by reference herein in its entirety included the drawings. In another embodiment, the agent or agents that alter the membrane and the siNA molecule also form complexes with a cationic lipid or cooperating lipid molecule, such as the lipids described in U.S. Patent No. 6,235,310, which is incorporated by reference to the present document in its entirety including the drawings. In one embodiment, a siNA molecule of the invention forms complex with delivery systems such as described in United States Patent Application Publication No. 2003077829 and PCT International Patent Publication No. WO 00/03683 and WO 02/087541. , all of which are incorporated by reference to the present document in its entirety including the drawings. In one embodiment, a siNA molecule of the invention is complexed with delivery systems as generally described in United States patent application publications nJUS-20050287551; US-20050164220; US-20050191627; US-20050118594; US-20050153919; US-20050085486; and US-20030158133; all of which are incorporated by reference to the present document in its entirety including the drawings. In one embodiment, the nucleic acid molecules of the invention are administered to skeletal tissues (eg, bone, cartilage, tendon, ligament) or metastatic bone tumors by complexing or conjugated with atelocollagen (see for example Takeshita et al. 2005, PNAS, 102, 12177-12182). Therefore, in one embodiment, the present invention features one or more dsiNA molecules in the form of a composition that complexes with atelocollagen. In another embodiment, the present invention features one or more siNA molecules conjugated to atelocollagen via a linker as described herein or known by other means in the art. In one embodiment, the nucleic acid molecules of the invention and their formulations (eg, formulations of double-stranded nucleic acid molecules of the invention in LNP) are administered by pulmonary administration, such as by inhalation of an aerosol or spray-dried formulation. which is administered by an inhalation device or nebulizer, providing rapid local uptake of the nucleic acid molecules in the relevant lung tissues. Particulate solid compositions containing respirable dry particles of micronized nucleic acid compositions can be prepared by grinding dried or lyophilized nucleic acid compositions and then passing the micronized composition through, for example, of a 400 mesh screen to decompose or separate the large agglomerates. A solid particulate composition comprising the nucleic acid compositions of the invention may optionally contain a dispersant which acts to facilitate the formation of an aerosol as well as other therapeutic compounds. A suitable dispersant is lactose, which can be mixed with the nucleic acid compound in any suitable ratio, such as a ratio of 1 to 1 by weight. Aerosols of liquid particles comprising a nucleic acid composition of the invention can be produced by any suitable means, such as with a nebulizer (see for example US 4,501,729). Nebulizers are commercially available devices that transform solutions or suspensions of an active ingredient into a therapeutic aerosol mist either by accelerating a compressed gas, usually air or oxygen, through a narrow venturi or by ultrasonic agitation. Formulations suitable for use in nebulizers comprise the active ingredient in a liquid vehicle in an amount of up to 40% w / w, preferably less than 20% w / w of the formulation. The carrier is usually water or dilute aqueous alcohol solution, preferably prepared isotonic to body fluids by the addition, for example, of sodium chloride or other suitable salts. Optional additives include preservatives, if the formulation is not prepared sterile, for example, methyl hydroxybenzoate, antioxidants, flavors, volatile oils, buffering and emulsifying agents and other formulation surfactants. In the same way aerosols of solid particles comprising the active composition and the surfactant can be produced with any aerosol generator with solid particles. Aerosol generators for administering therapeutic compounds of solid particles to a subject produce respirable particles, as explained above, and generate an aerosol volume containing a predetermined metered dose of a therapeutic composition in an amount suitable for administration to a patient. Humans.

In one embodiment, the fine particle aerosol generator of the invention is an insufflator. Formulations suitable for administration by insufflation include finely ground powders that can be derived by an insufflator. In the insufflator, the powder, for example, a dose dosed thereof effective to perform the treatments described herein, is contained in capsules or cartridges, usually of gelatin or plastic, which are either pierced or opened in in situ and the powder is administered by air that is forced through the device after inhalation or by a manually operated pump. The powder used in the insufflator consists either exclusively of the active principle or of a powder mixture comprising the active ingredient, a suitable powder diluent, such as lactose, and an optional surfactant. The active principle usually comprises from 0.1 to 100 w / w of the formulation. A second type of illustrative aerosol generator comprises a metered dose inhaler. Dosage-dose inhalers are dispensers of pressurized aerosols, which usually contain a suspension formulation or solution of the active ingredient in a liquid propellant. During use, these devices discharge the formulation through a valve adapted to administer a metered volume producing a fine particle spray containing the active ingredient. Suitable propellants include certain chlorofluorocarbon compounds, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane and mixtures thereof. The formulation may additionally contain one or more cosolvents, for example, ethanol, emulsifiers and other formulation surfactants, such as oleic acid or sorbitan trioleate, antioxidants and suitable flavoring agents. Other methods for pulmonary administration are described, for example, in United States patent application nJ 20040037780, and United States patents NJ 6,592,904; 6,582,728; 6,565,885, all of which are incorporated by reference to this document. In one embodiment, the compositions and formulations of siNA and LNP provided herein for use in pulmonary administration further comprise one or more surfactants. Surfactants or surfactant components for improving the uptake of the compositions of the invention include synthetic and natural forms as well as complete and truncated forms of surfactant protein A, surfactant protein B, surfactant protein C, surfactant protein D and surfactant protein E, disaturated phosphatidylcholine ( other than dipalmitoyl), dipalmitoylphosphatidylcholine, phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine; phosphatidic acid, ubiquinones, lysophosphatidylethanolamine, lysophosphatidylcholine, palmitoyl-lysophosphatidylcholine, dehydroepiandrosterone, dolicholes, sulfatidic acid, glycerol-3-phosphate, dihydroxyacetone phosphate, glycerol, glycero-3-phosphocholine, dihydroxyacetone, palmitate, cytidine diphosphate (CDP) diacylglycerol, CDP choline , hill, phosphate hill; as well as natural and artificial laminar bodies which are the natural transport vehicles for the components of surfactant, omega-3 fatty acids, polyene acid, polyethoic acid, lecithin, palmitinic acid, non-ionic block copolymers of ethylene or propylene oxides, polyoxypropylene, monomeric and polymeric polyoxyethylene, monomeric and polymeric poly (vinyl amine) with dextran and / or alkanoyl side chains, Brij 35, Triton X-100 and synthetic surfactants ALEC, Exosurf, Survan and Atovaquone, among others. These surfactants can be used as single elements or as part of a multi-component surfactant in a formulation, or in the form of additions covalently attached to the 5 'and / or 3' ends of the nucleic acid component of a pharmaceutical composition herein. The composition of the present invention can be administered to the respiratory system in the form of a formulation that includes particles of respirable size, for example particles of a size small enough to pass through the nose, mouth and larynx when inhaling and through the bronchi and alveoli of the lungs. In general, respirable particles vary in the range of about 0.5 to 10 micrometers in size. Particles of non-respirable size that are included in the aerosol tend to deposit in the throat and to be swallowed, and therefore the amount of non-respirable particles in the aerosol is minimized. For nasal administration, a particle size in the range of 10-500 μm is preferred to ensure retention in the nasal cavity. In one embodiment, the siNA molecules of the invention and their formulations or compositions are administered to the liver as is generally known in the art (see for example Wen et al., 2004, World J Gastroenterol., 10, 244-9; Murao et al., 2002, Pharm Res., 19, 1808-14; Liu et al, 2003, Gen Ther., 10, 180-7; Hong et al., 2003, J Pharm Pharmacol., 54, 51-8; Herrmann and cois. 2004, Arch Virol., 149, 1611-7; and Matsuno et al, 2003, Gen Ther., 10, 1559-66). In one embodiment, the invention features the use of methods for administering the nucleic acid molecules of the present invention to the central nervous system and / or peripheral nervous system. Experiments have demonstrated the efficient in vivo uptake of nucleic acids by neurons. As an example of the local administration of nucleic acids to nerve cells, Sommer et al., 1998, Antisense Nuc. Acid Drug Dev., 8, 75, describe a study in which a phosphorothioate 15mer nucleic acid molecule non-coding for c-fos is administered to rats by microinjection in the brain. The non-coding molecules labeled with tetramethylrhodamine-isothiocyanate (TRITC) or fluorescein isothiocyanate (FITC) were exclusively taken up by neurons thirty minutes after the injection. In these cells a diffuse cytoplasmic staining and nuclear staining was observed. As an example of the systemic administration of nucleic acids to nerve cells, Epa et al., 2000, Antisense Nuc. Acid Drug Dev., 10, 469, describe an in vivo study in mice in which beta-cyclodextrin-adamantane-oligonucleotide conjugates were used to target the p75 neurotropin receptor in neuronally differentiated PC 12 cells. After a two-week IP administration course, a pronounced uptake of p75 non-coding neurotropin receptor was observed in dorsal root ganglion (DRG) cells. In addition, a down regulation of p75 marked and consistent in DRG neurons was observed. Additional strategies to direct nucleic acid to neurons are described in Broaddus et al., 1998, J. Neurosurg., 88 (4), 734; Karle et al., 1997, Eur. J. Pharmocol., 340 (2/3), 153; Bannai et al., 1998, Brain Research, 784 (1.2), 304; Rajakumar et al., 1997, Synapse, 26 (3), 199; Wu-pong et al., 1999, BioPharm, 12 (1), 32; Bannai et al., 1998, Brain Res. Protocol, 3 (1), 83; Simantov et al., 1996, Neuroscience, 74 (1), 39. The nucleic acid molecules of the invention can therefore be adapted for administration and uptake by cells expressing repeated allelic variants for the modulation of gene expression. of RE. The administration of nucleic acid molecules of the invention, directed to ER, is provided by a variety of different strategies. Traditional strategies for CNS administration that may be used include, but are not limited to, intrathecal and intracerebroventricular administration, implantation of catheters and pumps, direct injection or perfusion at the site of injury or damage, injection into the cerebral arterial system or through chemical opening or osmotic of the hemocerebral barrier. Other strategies may include the use of various transport systems and vehicles, for example through the use of biodegradable polymers and conjugates. In addition, gene therapy strategies may be used, for example, as described in Kaplitt et al., US 6,180,613 and Davidson, WO 04/013280, to express the nucleic acid molecules in the CNS. The administration of nucleic acid molecules of the invention to the CNS is provided by a variety of different strategies. Traditional strategies for CNS administration that may be used include, but are not limited to, intrathecal and intracerebroventricular administration, implantation of catheters and pumps, direct injection or perfusion at the site of injury or damage, injection into the cerebral arterial system or through chemical opening or osmotic of the hemocerebral barrier. Other strategies may include the use of various transport systems and vehicles, for example through the use of biodegradable polymers and conjugates. further, genotherapy strategies may be used, for example as described in Kaplitt et al., US 6,180,613 and Davidson, WO 04/013280, to express the nucleic acid molecules in the CNS. In one embodiment, a compound, molecule, or composition for the treatment of ocular conditions (e.g., macular degeneration, diabetic retinopathy, etc.) is administered to a subject intraocularly or by intraocular means. In another embodiment, a compound, molecule, or composition for the treatment of ocular conditions (eg, macular degeneration, diabetic retinopathy, etc.) is administered to a subject by periocular means or by periocular means (see for example Ahlheim et al. , PCT International Publication No. WO 03/24420). In one embodiment, a siNA molecule and / or formulation or composition thereof is administered to a subject intraocularly or by intraocular means. In another embodiment, a siNA molecule and / or formulation or composition thereof is administered periocularly or by periocular means. General periocular administration provides a less invasive strategy for administering siNA molecules and a formulation or composition thereof to a subject (see for example Ahlheim et al., PCT International Publication No. WO 03/24420). The use of periocular administration also minimizes the risk of retinal detachment, allows more frequent dosing or administration, provides a clinically relevant route of administration for macular degeneration and other optic conditions, and also provides the possibility of using reservoirs (e.g. , implants, pumps or other devices) for the administration of drugs. In one embodiment, the siNA compounds and compositions of the invention are administered locally, for example, by intraocular or periocular means, such as injection, iontophoresis (see, for example, WO 03/043689 and WO 03/030989 ), or implant, approximately every 1-50 weeks (for example, approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, or 50 weeks), alone or in combination with other compounds and / or therapies herein. In one embodiment, the siNA compounds and compositions of the invention are administered systemically (eg, intravenously, subcutaneously, intramuscularly, infusion, pump, implant, etc.) approximately every 1-50 weeks (eg, approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 weeks), alone or in combination with other compounds and / or therapies described herein and / or known by other means in the art. In one embodiment, the invention features the use of methods for administering the nucleic acid molecules of the present invention to hematopoietic cells, including monocytes and lymphocytes. These procedures are described in detail in Hartmann et al., 1998, J. Phamacol. Exp. Ther., 285 (2), 920-928; Kronenwett et al., 1998, Blood, 91 (3), 852-862; Filion and Phillips, 1997, Biochim. Biophys. Acta., 1329 (2), 345-356; Ma and Wei, 1996, Leuk. Res., 20 (11/12), 925-930; and Bongartz et al., 1994, Nucleic Acid Research, 22 (22), 4681-8. Said methods, as described above, include the use of free oligonucleotides, formulations in cationic lipids, formulations in liposomes including pH-sensitive liposomes and immunoliposomes, and bioconjugates that include oligonucleotides conjugated to fusogenic peptides, for the transfection of hematopoietic cells with oligonucleotides. In one embodiment, the siNA molecules and compositions of the invention are administered to the inner ear by contacting the siNA with cells, tissues, or structures of the inner ear such as the cochlea, under conditions suitable for administration. In one embodiment, the administration comprises methods and devices as described in United States patents NJ 5,421, 818, 5,476,446, 5,474,529, 6,045,528, 6,440,102, 6,685,697, 6,120,484; and 5,572,594; all of which are incorporated by reference herein and the teachings of Silverstein, 1999, Ear Nose Throat J., 78, 595-8, 600; and Jackson and Silverstein, 2002, Otolaryngol Clin North Am., 35, 639-53, and adapted to use the siNA molecules of the invention. In one embodiment, the siNA molecules of the invention and the formulations or compositions thereof are administered directly or topically (eg, locally) to the dermis or follicles as generally known in the art ( see for example Brand, 2001, Curr Opin, Mol. Ther., 3, 244-8, Regnier et al., 1998, J. Drug Target, 5, 275-89, Kanikkannan, 2002, BioDrugs, 16, 339- 47; Wraight et al., 2001, Pharmacol. Ther., 90, 89-104; and Preat and Dujardin, 2001, STP PharmaSciences, 11, 57-68). In one embodiment, the siNA molecules of the invention and their formulations or compositions are administered directly or topically using a hydroalcoholic gel formulation comprising an alcohol (e.g., ethanol or isopropanol), water, and optionally including additional agents such as isopropyl myristate and carbomer 980. In one embodiment, a siNA molecule of the invention is administered iontophoretically, for example to a particular organ or compartment (e.g., eye, fundus, heart, liver, kidney). , bladder, prostate, tumor, CNS etc.). Non-limiting examples of iontophoretic administration are described, for example, in WO 03/043689 and WO 03/030989, which are incorporated by reference in their entirety herein. In one embodiment, the siNA compounds and compositions of the invention are administered either systemically or locally approximately every 1-50 weeks (e.g., approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 weeks), alone or in combination with other compounds and / or therapies of the present document. In one embodiment, the siNA compounds and compositions of the invention are administered systemically (eg, intravenously, subcutaneously, intramuscularly, infusion, pump, implant, etc.) approximately approximately every 1-50 weeks (e.g. approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 weeks), alone or in combination with other compounds and / or therapies described herein and / or known by other means in the art. In one embodiment, the delivery systems of the invention include, for example, aqueous and non-aqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and non-aqueous solutions., lotions, aerosols, bases and hydrocarbon powders, and may contain excipients such as solubilizers, permeation enhancers (eg, fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (eg, polycarbophil and polyvinylpyrrolidone) ). In one embodiment, the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer. Examples of liposomes that can be used in this invention include the following: (1) Celifectin, 1: 1.5 (M / M) liposome formulation of the cationic lipid N, NI, NII, NIII-tetramethyl-N, NI, NII, NIII- tetrapalmit-y-spermine and dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); (2) Cytofectin GSV, 2: 1 (M / M) liposome formulation of a cationic lipid and DOPE (Glen Research); (3) DOTAP (N- [1- (2,3-dioleoyloxy) -N, N, N-tri-methyl-ammonium-sulphsulfate) (Boehringer Manheim); and (4) Lipofectamine, 3: 1 (M / M) liposome formulation of the polycathionic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL). In one embodiment, the delivery systems of the invention include patches, tablets, suppositories, pessaries, gels, and creams, and may contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other carriers (eg. example, polyethylene glycol, esters of fatty acids and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid). In one embodiment, the siNA molecules of the invention are formulated or complexed with polyethylene imine (eg, linear or branched PEI) and / or polyethylene imine derivatives, including for example PEI grafted such as galactose PEI, cholesterol PEI, derivatized antibodies PEI, and polyethylene glycol PEI (PEG-PEI) and its derivatives (see for example Ogris et al., 2001, AAPA PharmSci, 3, 1-11, Furgeson et al, 2003, Bioconjugate Chem., 14, 840-847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817, Choi et al., 2001, Bull, Korean Chem. Soc, 22, 46-52, Bettinger et al., 1999, Bioconjugate Chem., 10, 558 -561; Peterson et al., 2002, Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA, 96, 5177-5181; Godbey et al., 1999, Journal of Controlled Relayse, 60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry, 274, 19087-19094; Thomas and Klibanov, 2002, PNAS US A, 99, 14640-14645; and Sagara, US 6,586,524, which are incorporated by reference herein. In one embodiment, a siNA molecule of the invention comprises a bioconjugate, for example a nucleic acid conjugate as described in Vargeese et al., USSN 10 / 427,160, filed April 30, 2003; US 6,528,631; US 6,335,434; US 6, 235,886; US 6,153,737; US 5,214,136; US 5,138,045, all of which are incorporated by reference herein. Thus, the invention features a pharmaceutical composition comprising one or more nucleic acid (s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like. The polynucleotides of the invention can be administered (eg, RNA, DNA or protein) and introduced into a subject by any standard means, with or without stabilizers, buffers and the like, forming a pharmaceutical composition. When it is desired to use a delivery mechanism in liposomes, standard protocols for the formation of liposomes can be followed. The compositions of the present invention may also be formulated and used in the form of creams, gels, sprays, oils and other compositions suitable for topical, dermal or transdermal administration as is known in the art. The present invention also includes pharmaceutically acceptable formulations of the compounds described. These formulations include salts of the above compounds, for example, acid addition salts, for example, hydrochloric, hydrobromic, acetic and benzenesulfonic acid salts. A "composition" or "pharmacological formulation" refers to a composition or formulation in a form suitable for administration, for example, systemic or local administration, to a cell or subject, which includes for example a human being. Suitable forms depend in part on the use or the route of entry, for example oral, transdermal, or by injection. Said forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the nucleic acid with negative charge is to be administered). For example, pharmacological compositions that are injected into the bloodstream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect. In one embodiment, the siNA molecules of the invention are administered to a subject by systemic administration in a pharmaceutically acceptable composition or formulation. By "systemic administration" is meant in vivo systemic absorption or accumulation of drugs in the bloodstream followed by distribution throughout the body. Routes of administration that lead to systemic absorption include, without limitation: intravenous, subcutaneous, portal vein, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular. Each of these routes of administration exposes the siNA molecules of the invention to an accessible diseased tissue (e.g., the lung). It has been shown that the speed of entry of a drug into the circulation is a function of molecular weight or size. The use of a liposome or other vehicle for drugs comprising the compounds of the present invention can potentially localize the drug, for example, in certain types of tissues, such as the tissues of the reticular endothelial system (RES). A formulation in liposomes that can facilitate the association of the drug to the surface of cells, such as lymphocytes and macrophages, is also useful. This strategy can provide improved administration of the drug to the target cells by exploiting the specificity of recognition by the immune system of macrophages and lymphocytes of abnormal cells.

By "pharmaceutically acceptable formulation" or "pharmaceutically acceptable composition" is meant a composition or formulation that allows efficient distribution of the nucleic acid molecules of the present invention to the most suitable physical location for the desired activity. Non-limiting examples of suitable agents for the formulation with the nucleic acid molecules of the present invention include: P-glycoprotein inhibitors (such as Pluronic P85), biodegradable polymers, such as poly (DL-lactide-co-glycolide) microspheres for administration sustained release (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58); and charged nanoparticles, such as those prepared from polybutyl cyanoacrylate. Other non-limiting examples of administration strategies for the nucleic acid molecules of the present invention include the material described in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tiler et al., 1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA., 92, 5592-5596; Boado, 1995, Adv. Drug administration Rev., 15, 73-107; Aldrian-Herrada et al., 1998, Nucleic Acid Res., 26, 4910-4916; and Tiler et al., 1999, PNAS USA., 96, 7053-7058. The invention also features the use of a composition comprising liposomes with surface modifications containing poly (ethylene glycol) lipids (modified with PEG, or prolonged circulation liposomes or stealth liposomes) and nucleic acid molecules of the invention. These formulations offer a method for increasing the accumulation of drugs (eg, siNA) in the target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocyte system (MPS or RES), thus allowing longer blood circulation times and increased tissue exposure for the encapsulated drug (Lasic et al., Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull., 1995, 43, 1005-1011). It has been shown that such liposomes accumulate selectively in tumors, presumably by extravasation and capture in neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276, Oku et al., 1995, Biochim. Acta, 1238, 86-90). Prolonged circulation liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, in particular compared to conventional cationic liposomes known to accumulate in the tissues of MPS (Liu et al., J. Biol. Chem. 1995, 42 , 24864-24870; Choi et al., PCT International Patent Publication No. WO 96/10391; Ansell et al., PCT International Patent Publication No. WO 96/10390; Holland et al., PCT International Patent Publication No. WO 96/10 / 10392). It is also likely that long-circulation liposomes protect drugs from degradation by nucleases to a greater degree than cationic liposomes, based on their ability to prevent accumulation in metabolically aggressive MPS tissues such as the liver and spleen. In one embodiment, a liposome formulation of the invention comprises a double-stranded nucleic acid molecule of the invention (eg, siNA) formulated or complexed with compounds and compositions described in US 6,858,224; 6,534,484; 6,287,591; 6,835,395; 6,586,410; 6,858,225; 6,815,432; US 6,586,001; 6,120,798; US 6,977,223; US 6,998,115; 5,981, 501; 5,976,567; 5,705,385; US 2006/0019912; US 2006/0019258; US 2006/0008909; US 2005/0255153; US 2005/0079212; US 2005/0008689; US 2003/0077829, US 2005/0064595, US 2005/0175682, US 2005/0118253; US 2004/0071654; US 2005/0244504; US 2005/0265961 and US 2003/0077829, all of which are incorporated by reference herein in their entirety. The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro, 1985), which is hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used. A pharmaceutically effective dose is the dose necessary to prevent, inhibit the occurrence or treatment (alleviate a symptom to some degree, preferably all symptoms) of a disease state. The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal being considered, the concurrent medication, and other factors that will recognize the experts in the medical technique. Generally, an amount of between 0.1 mg / kg and 100 mg / kg of body weight / day of active principles is administered depending on the potency of the negatively charged polymer. The nucleic acid molecules of the invention and their formulations can be administered orally, topically, parenterally, by inhalation or spray, or rectally in single-dose formulations containing pharmaceutically acceptable non-toxic carriers, adjuvants and / or vehicles. The term "parenteral" as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like. In addition, a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier is provided. One or more nucleic acid molecules of the invention may be present in association with one in association with one or more non-toxic pharmaceutically acceptable carriers and / or adjuvants and / or vehicles, and other active ingredients if desired. Pharmaceutical compositions containing nucleic acid molecules of the invention may be in a form suitable for oral use, for example, in the form of tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard capsules or soft or syrups or elixirs. Compositions whose purpose is oral use can be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and said compositions can contain one or more sweetening agents, flavoring agents, coloring agents and preservatives to provide pharmaceutically elegant preparations and nice The tablets contain the active ingredient mixed with pharmaceutically acceptable non-toxic excipients which are suitable for the manufacture of tablets. These excipients, for example, can be inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate.; granulation and disintegration agents, for example, corn starch or alginic acid; binding agents, for example starch, gelatin or gum arabic, and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets may not be coated or coated by known techniques. In some cases, the coatings may be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide sustained action over a longer period. For example, a retarder material such as glyceryl monostearate or glyceryl distearate may be employed. Formulations for oral use may also be in the form of hard gelatin capsules, in which the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin or in the form of soft gelatine capsules in the that the active ingredient is mixed with water or an oily medium, for example arachis oil, liquid paraffin or olive oil. Aqueous suspensions contain the active ingredients mixed with excipients suitable for the manufacture of aqueous suspensions. Said excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinyl pyrrolidone, gum tragacanth and gum arabic; the dispersing or wetting agents can be a natural phosphatide, for example lecithin or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long-chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides for example polyethylene sorbitan monooleate . The aqueous suspensions may also contain one or more preservatives, for example ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin.

Aqueous suspensions may be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example, beeswax, hard paraffin or cetyl alcohol. Sweetening and flavoring agents may be added to provide pleasant oral preparations. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid. Dispersible powders and granules suitable for the preparation of an aqueous suspension by the addition of water provide the active ingredient mixed with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing and wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients may also be present, for example sweetening, flavoring and coloring agents. The pharmaceutical compositions of the invention may also be in the form of oil-in-water emulsions. The oil phase may be a vegetable oil or a mineral oil or mixtures thereof. Suitable emulsifying agents can be natural gums, for example gum arabic or tragacanth gum, natural phosphatides, for example soy, lecithin and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products from said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavoring agents. The syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Said formulations may also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oily suspension. This suspension can be formulated according to the known art using the dispersing or wetting agents and the known suspending agents mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example in the form of a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed in the form of solvent or suspension medium. For this purpose any soft fixed oil including synthetic monoglycerides or diglycerides can be employed. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. The nucleic acid molecules of the invention can also be administered in the form of suppositories, for example, for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at the usual temperatures but liquid at the rectal temperature and which therefore melts in the rectum releasing the drug. Such materials include cocoa butter and polyethylene glycols. The nucleic acid molecules of the invention can be administered parenterally in a sterile medium. The drug, depending on the vehicle and the concentration used, can be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle. The dose levels in the order of approximately OJ mg to approximately 140 mg per kilogram of body weight per day are useful in the treatment of the conditions indicated above (from about 0.5 mg to about 7 g per subject per day). The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending on the host treated and the particular mode of administration. Monodose forms generally contain between about 1 mg and about 500 mg of an active ingredient. It is understood that the specific dose level for any particular subject depends on a variety of factors including the activity of the specific compound that is employed., age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, combination of particles and the severity of the particular disease that undergoes therapy. For administration to non-human animals, the composition may also be added to the animal's food or water. It may be convenient to formulate the compositions of the animal's food and water so that the animal ingests a therapeutically appropriate amount of the composition together with its diet. It may also be convenient to present the composition in the form of a premix for addition to food or water. The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the total therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects. In one embodiment, the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types. For example, the asialoglycoprotein receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432) is unique to hepatocytes and binds glycoproteins with branched galactose ends, such as asialoorosomucoids (ASOR) . In another example, the folate receptor is overexpressed in many cancer cells. The binding of said glycoproteins, synthetic glucoconjugates or folates to the receptor occurs with an affinity that depends very much on the degree of branching of the oligosaccharide chain, for example, there are tritemarian structures with higher affinity than the biternary or monothemary chains (Baenziger and Fiete , 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Lee and Lee, 1987, Glycoconjugate J., A, 317-328, obtained this high specificity by using N-acetyl-D-galactosamine as the carbohydrate moiety, which has a higher affinity for the receptor, compared to galactose. This "clipping effect" has also been described for the binding and uptake of glycoproteins or glucoconjugates ending in mannosyl (Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of galactose-based conjugates, galactosamine, or folate to transport exogenous compounds through cell membranes can provide a directed delivery strategy, for example, for the treatment of liver disease, liver cancers or other cancers. The use of bioconjugates can also provide a reduction in the dose of therapeutic compounds necessary for the treatment. In addition, therapeutic bioavbility, pharmacodynamic and pharmacokinetic parameters can be modulated through the use of nucleic acid bioconjugates of the invention. Non-limiting examples of such bioconjugates are described in Vargeese et al., USSN 10/201, 394, filed August 31, 2001; and Matulic-Adamic et al., USSN 60 / 362,016, filed March 6, 2002. Alternatively, certain siNA molecules of the present invention can be expressed inside cells from eukaryotic promoters (e.g., Izant. and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Nati, Acad. Sci., USA 83, 399; Scanlon et al., 1991, Proc. Nati. Acad. Sci. USA, 88, 10591-5, Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15, Dropulic et al., 1992, J. Virol., 66, 1432-41, Weerasinghe et al., 1991, J. Virol., 65, 5531-4; Ojwang et al., 1992, Proc. Nati, Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acid Res., 20, 4581 -9; Sarver et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995, Nucleic Acid Res., 23, 2259; Good et al., 1997, Gene Therapy, 4, 45. The experts in the art they will realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA / RNA vector. The stability of said nucleic acids can be increased by releasing them from the primary transcript by an enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., 1992, Nucleic Acid Symp. Ser., 27, 15-6; Taira et al., 1991, Nucleic Acid Res .., 19, 5125-30; Ventura et al., 1993, Nucleic Acid Res., 21, 3249-55; Chowrira et al., 1994, J. Biol. Chem., 269, 25856. In another aspect of the invention, the RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., 1996, TIG., 12, 510) inserted into DNA or RNA vectors. The recombinant vectors can be plasmids or viral DNA vectors. Viral vectors expressing siNA can be constructed based, but not limited to, on adeno-associated viruses, retroviruses, adenoviruses, or alphaviruses. In another embodiment, pol-lll-based constructs are used to express nucleic acid molecules of the invention (see, for example, Thompson, U.S. Patent Nos. 5,902,880 and 6,146,886). Recombinant vectors capable of expressing siNA molecules can be administered as described above and persist in target cells. Alternatively, viral vectors that provide transient expression of the nucleic acid molecules can be used. Such vectors can be administered repeatedly if necessary. Once expressed, the siNA molecule interacts with the target mRNA and generates an RNAi response. The administration of vectors expressing siNA molecules can be systemic, such as by intravenous or intramuscular administration, by administration to explanted target cells of a subject followed by reintroduction into the subject, or by any other means that could allow its introduction into the desired target cell (for a review see Couture et al., 1996, 77G., 12, 510). In one aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the present invention. The expression vector can encode one or both strands of a siNA double-stranded molecule, or a single self-complementary strand that self-hybridizes to a siNA double-stranded molecule. The nucleic acid sequences encoding the siNA molecules of the present invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, oniine doi publication: 10.1038 / nm725). In another aspect, the invention features an expression vector comprising: a) a transcription initiation region (eg, poly I, II, or III initiation region of eukaryotic); b) a transcription termination region (e.g., eukaryotic termination region pol I, II or III); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the present invention, wherein said sequence is operably linked to said initiation region and said termination region in a manner that allows expression and / or administration of the siNA molecule. The vector optionally may include an open reading frame (ORF) for a protein operably linked at the 5 'end or at the 3"end of the sequence encoding the siNA of the invention, and / or an intron (intervening sequences). The transcription of the sequences of the siNA molecules can be directed from a promoter for RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol lll) of eukaryotic. from the pol II or pol lll promoters are expressed at high levels in all cells, the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc. ) are also present Prokaryotic RNA polymerase promoters are also used, with the proviso that the RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Nati. Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acid Res., 21, 2867-72; Lieber et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol. Cell. Biol., 10, 4529-37). Various investigators have shown that nucleic acid molecules expressed from said promoters can function in mammalian cells (eg Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al. cois., 1992, Proc. Nati, Acad. Sci. USA, 89, 10802-6, Chen et al., 1992, Nucleic Acid Res., 20, 4581-9; Yu et al., 1993, Proc. Nati. Acad Sci. USA, 90, 6340-4, L'Huillier et al., 1992, EMBO J., 11, 4411-8, Lisziewicz et al., 1993, Proc. Nati. Acad. Sci. US A, 90, 8000-4, Thompson et al., 1995, Nucleic Acid Res., 23, 2259; Sullenger &Cech, 1993, Science, 262, 1566). More specifically, transcription units such as those derived from genes encoding U6 short nuclear RNA (snRNA), transfer RNA (tRNA) and VA adenovirus RNA are useful for generating high concentrations of the desired RNA molecules such as siNA in cells (Thompson et al., previous reference; Couture and Stinchcomb, 7996, prior reference; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830; Noonberg et al., United States Patent No. 5,624,803; Good et al., 1997, Gen Ther., A, 45; Beigelman et al., PCT International Patent Publication No. WO 96/18736.The above siNA units can be incorporated into a variety of vectors for introduction into cells. mammal, including but not limited to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Co uture and Stinchcomb, 1996, reference to nte rio? In another aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the siNA molecules of the invention in a manner that allows the expression of that siNA molecule. The expression vector comprises in one embodiment; a) a region of initiation of transcription; b) a region of transcription termination; and c) a nucleic acid sequence encoding at least one strand of the siNA molecule, wherein the sequence is operably linked to the initiation region and the termination region in a manner that allows expression and / or administration of the SiNA molecule. In another embodiment, the expression vector comprises: a) a transcription initiation region; b) a region of transcription termination; c) an open reading frame; and d) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3 'end of the open reading frame and wherein the sequence is operably linked to the initiation region , the open reading frame and the termination region in a way that allows the expression and / or administration of the siNA molecule. In yet another embodiment, the expression vector comprises: a) a transcription initiation region; b) a region of transcription termination; c) an intron; and d) a nucleic acid sequence encoding at least one siNA molecule, wherein the sequence is operably linked to the initiation region, the intron and the termination region in a manner that allows expression and / or administration of the nucleic acid molecule. In another embodiment, the expression vector comprises: a) a transcription initiation region; b) a region of transcription termination; c) an intron; d) an open reading frame; and e) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3 'end of the open reading frame and wherein the sequence is operably linked to the initiation region , the intron, the open reading frame and the termination region in a way that allows the expression and / or administration of the siNA molecule.

EXAMPLES The following are non-limiting examples that show the selection, isolation, synthesis and activity of the nucleic acids of the present invention.

EXAMPLE 1 Tandem synthesis of siNA constructs Exemplary siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl based linker. The tandem synthesis as described herein is followed by a purification process in a step that provides RNAi molecules in high yield. This strategy can be very well applied to the synthesis of siNA to support the screening of high-throughput RNAi, and can easily be adapted to synthesis platforms in multiple columns or multiple wells. After completing a tandem synthesis of an oligo siNA and its complement in which the dimethoxytrityl group of the 5 'end (5'-O-DMT) remains intact (synthesis on trityl), the oligonucleotides are deprotected as described above . After deprotection, the strands of the siNA sequence are allowed to hybridize spontaneously. This hybridization provides a double-stranded molecule in which one strand maintains the 5'-O-DMT group while the complementary strand comprises a terminal 5'-hydroxyl. The newly formed double-stranded molecule behaves as a single molecule during purification by solid-phase extraction (purification on trityl) even if only one molecule has a dimethoxytrityl group. Because the strands form a stable double-stranded molecule, this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is necessary to purify the pair of oligos, for example, using a C18 Synthesis reactions with standard phosphoramidite are used until the introduction of a tandem linker, such as an inverted deoxyabasic succinate or a glyceryl succinate linker (see scheme A) or an equivalent cleavable linker. A non-limiting example of linker coupling conditions that may be used include a hindered base such as diisopropylethylamine (DIPA) and / or DMAP in the presence of an activating reagent such as bromotripyrrolidinophosphonium hexafurinophosphory (PyBrOP). After the linker is coupled, standard synthesis reactions are used to complete the synthesis of the second sequence leaving the terminal 5'-O-DMT intact. After the synthesis, the resulting oligonucleotide is deprotected according to the methods described herein and inactivated with a suitable buffer, for example with 50 mM NaOAc or 1.5 M NH 4 H 2 CO 3. Scheme A shows a non-limiting example of a scheme for the synthesis of siNA molecules. The complementary strands of the siNA sequence, strand 1 and strand 2, are synthesized in tandem and connected by a cleavable linkage, such as a nucleotide succinate or abbasic succinate, which may be the same or different from the cleavable linker used for the synthesis in solid phase on a solid support. The synthesis can be either in solid phase or in solution phase, in the example shown, the synthesis is a solid phase synthesis. The synthesis is performed in such a way that a protecting group, such as a dimethoxytrityl group, remains intact in the terminal nucleotide of the oligonucleotide in tandem. After the cleavage and deprotection of the oligonucleotide, the two strands of the siNA hybridize spontaneously forming a double-stranded molecule of siNA, which allows the purification of the double-stranded molecule using the properties of the siNA protecting group, for example by applying a trityl to the process of purification in which only double-stranded molecules / oligonucleotides are isolated with the terminal protective group.

SCHEME A ?? p.ij?.? - i--. ? -ii-Hi? m ??? n ?? i] - O-R PURIFICATION (DETRITILATION) siRNA BICATENARIO -m -.? .- ??? .. ??. u .si ---.-? .-? .--. ??? = SOLID SUPPORT R = TERMINAL PROTECTION GROUP FOR EXAMPLE: DIMETOXITRITILO (DMT) (1) i? ???? ESCINDIBLE LINKER (FOR EXAMPLE: NUCLEOTIDE SUCCINATE OR DESOXIABASIC SUCCINATE INVESTED) (2) «?????? SLIDING LOCKER (FOR EXAMPLE: NUCLEOTIDE SUCCINATE OR DESOXIABASIC SUCCINATE INVESTED) SUCCINATO LINK GLYCERILIC SUCCINATE LINK INVERTED DESOXIABASIC Purification of the siNA double-stranded molecule can be easily achieved using solid-phase extraction, for example, using a 1G Waters C18 SepPak cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV of H2O, and 2 HP of 50 mM NaOAc. The sample is loaded and then washed with 1 CV of H2O or 50 mM NaOAc. The missed sequences are eluted with 1 CV of 14% ACN (aqueous with 50 mM NaOAc and 50 mM NaCl). The column is then washed, for example with 1 CV of H2O followed by column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) through the column, then adding a second CV of 1% aqueous TFA. to the column and let stand for about 10 minutes. The remainder of the TFA solution is removed and the column washed with H2O followed by 1 CV of 1 M NaCl and more H2O. The double-stranded product siNA molecule is then diluted, for example, using 1 CV of 20% aqueous CAN. Figure 1 provides an example of mass spectrometry analysis by MALDI-TOF of a purified siNA construct in which each peak corresponds to the calculated mass of an individual siNA strand of the siNA double-stranded molecule. The same purified siNA provides three peaks when analyzed by capillary gel electrophoresis (CGE), one peak presumably corresponds to the double-stranded siNA molecule, and two peaks presumably correspond to the separated strands of the siNA sequence. The ion exchange HPLC analysis of the same siNA construct shows only a single peak. Analysis of the purified siNA construct using a luciferase assay as a control described below demonstrated the same RNAi activity as siNA constructs generated from strands of oligonucleotide sequences synthesized separately.

EXAMPLE 2 Identification of potential siNA target sites in any RNA sequence The sequence of a target RNA of interest, such as a human mRNA transcript (e.g., any of the sequences referenced herein by its GenBank accession number), is sieved to determine the target sites , for example using a computer folding algorithm. In a non-limiting example, the sequence of a gene or gene transcript of RNA derived from a database, such as Genbank, is used to generate target siNA that have complementarity with the target. Said sequences can be obtained from a database, or they can be determined experimentally as is known in the art. Target sites are known, for example, target sites that are determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or non-coding molecules, or targets that are known to be associated with a disease, trait or condition such as sites containing mutations or deletions, can be used to design siNA molecules directed to those sites. Various parameters can be used to determine which sites are the most suitable target sites in the target RNA sequence. These parameters include but are not limited to the structure of secondary or tertiary RNA, the composition of nucleotide bases of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence in the RNA transcript. Based on these determinations, any number of target sites of the RNA transcript can be chosen to screen for siNA molecules to determine efficacy, for example using in vitro RNA cleavage assays, cell culture or animal models. In a non-limiting example, from 1 to 1000 target sites of the transcript are chosen based on the size of the siNA construct to be employed. It is possible to develop high throughput screening assays to screen siNA molecules using methods known in the art, such as multiple well or multiple plate assays to determine effective reduction of target gene expression.

EXAMPLE 3 Selection of target sites of siNA molecules in an RNA The following non-limiting steps can be used to perform the selection of siNA directed to a given gene or transcript sequence. 1. The target sequence is analyzed by computer in a list of all fragments or subsequences of a particular length, for example fragments of 23 nucleotides, contained within the target sequence. This step is usually performed using a custom Perl script, but commercial sequence analysis programs such as Oligo, MacVector, or the GCG Wisconsin package can also be employed. 2. In some cases the siNA correspond to more than one target sequence; this would be the case for example to direct different transcripts of the same gene, to direct different transcripts of more than one gene, or to direct both the human gene and the animal homologue. In this case, a list of subsequences of a particular length is generated for each of the objectives, and then the lists are compared to find corresponding sequences in each list. Subsequences are then classified according to the number of target sequences containing the given subsequence; and the goal is to find subsequences that are present in most or all of the target sequences. Alternatively, the classification can identify subsequences that are unique to an objective sequence, such as a mutant target sequence. This strategy would allow the use of siNA to specifically direct the mutant sequence and not perform the expression of the normal sequence. 3. In some cases the subsequences of siNA are absent in one or more sequences although they are present in the desired target sequence; This would be the case if the siNA is directed against a gene with a paralog family member that should not be objective. As in case 2 above, a list of subsequences of a particular length is generated for each of the objectives, and then the lists are compared to find corresponding sequences that are present in the target gene but are absent from the paralog that does not It must be objective. 4. Subsequences of classified siNA can be further analyzed and classified according to GC content. Preference can be given to sites that contain 30-70% GC, and greater preference to sites that contain 40-60% GC. 5. Subsequences of classified siNA can be further analyzed and classified according to the self-folding and internal forks. Weaker internal folds are preferred, strong fork structures should be avoided. 6. The classified siNA subsequences can be further analyzed and classified according to whether they have tracts of GGG or CCC in the sequence. GGG (or even more G) in either strand can make oligonucleotide synthesis problematic and potentially can interfere with RNAi activity, so it should be avoided when better sequences are available. CCC is searched for in the target strand because it will introduce GGG into the non-coding strand. 7. The classified siNA subsequences can be further analyzed and classified according to whether they have the UU dinucleotide (uridine dinucleotide) at the 3 'end of the sequence, and / or AA at the 5' end of the sequence (providing 3 ' UU in the non-coding sequence). These sequences allow the design of siNA molecules with TT thymine dinucleotides at the end. 8. Four or five target sites are selected from the list of ranked sub-sequences as described above. For example, in subsequences that have 23 nucleotides, the 21 nucleotides on the right of each 23rd subsequence are then designed and synthesized for the upper (coding) strand of the siNA double-stranded molecule, while the reverse complement of the 21 nucleotides of each 23-number subsequence are then designed and synthesized by the lower (non-coding) strand of the siNA double-stranded molecule (see Table II). If it is desired to have TT residues at the end for the sequence (as described in paragraph 7), then the two nucleotides of the 3 'end of both the coding and non-coding strands are replaced by TT before synthesizing the oligos. 9. The siNA molecules are screened in an in vitro cell culture, or in an animal model system to identify the most active siNA molecule or the most preferred target site in the target RNA sequence. 10. Other design considerations can be used when selecting target nucleic acid sequences, see, for example, Reynolds and cois. 2004, Nature Biotechnology Advanced Oniine Publication, February 1, 2004, doi: 10.1038 / nbt936 and Ui-Tei et al. 2004, Nucleic Acid Research, 32, doi: 10.1093 / nar / gkh247.

In an alternative strategy, a set of specific siNA constructs of a sequence is used to screen for the target sites in cells expressing target RNA, such as cultured Jurkat, HeLa, A549 or 293T cells. The general strategy used in this case is the one shown in Figures 8A-8E. The cells expressing the target RNA are transferred to the set of siNA constructs and the cells are selected that demonstrate a phenotype associated with the inhibition of the target. The set of siNA constructs can be expressed from transcription cassettes inserted into appropriate vectors (see for example Figures 6A-6C and Figures 7A-7C). The DNA from cells demonstrating a positive phenotypic change (eg, less proliferation, lower levels of target mRNA or lower expression of target proteins) is sequenced to determine the target site (s) of the target RNA sequence. In one embodiment, siNA molecules of the invention are selected using the following methodology. The following guidelines were compiled to predict hyperactive siNAs containing chemical modifications described in this document. These rules emerged from a comparative analysis of hyperactive siNA (> 75% reduction of target mRNA levels) and inactive (<75% reduction of target mRNA levels) against several different targets. A total of 242 siNA sequences were analyzed. Thirty-five siNA of the 242 were grouped in the hyperactive groups and the rest of the siNA in the inactive groups. The hyperactive siNA clearly showed a preference for certain bases at particular nucleotide positions of the siNA sequence. For example, the presence of nucleobases A or U was overwhelming at position 19 of the coding strand in hyperactive siNAs and the opposite was true for inactive siNAs. A pattern of an A / U rich region (3 out of 5 bases of A or U) between positions 15-19 and a G / C rich region between positions 1-5 (3 of the 5 G bases) was also given. or C) of the coding strand in the hyperactive siNA. As shown in Table V, 12 of these patterns that were characteristic of hyperactive siNAs were identified. It should be noted that not all patterns were present in each hyperactive siNA. Thus, to design an algorithm to predict hyperactive siNA, a different score was assigned to each pattern. Depending on the frequency with which these patterns appeared in the hyperactive siNA compared with the inactive siNA, the parameters were assigned to score, with 10 being the highest. If a certain nucleobase is not preferred in one position, then a negative score is assigned. For example, at positions 9 and 13 of the coding strand, a G nucleotide was not preferred in the hyperactive siNAs and therefore they were assigned a score of -3 (minus 3). The differential score for each pattern is given in table V. Pattern nJ 4 was assigned a maximum score of -100. This is mainly to select any sequence containing 4 G or 4 C series as they may be very incompatible for the synthesis and may allow the sequences to autoaggregate, thus leaving the siNA inactive. Using this algorithm, the highest possible score for any siNA is 66. Since there are numerous possible siNA sequences against any given reasonably sized target (-1000 nucleotides), this algorithm is useful for generating hyperactive siNA. In one embodiment, the rules 1-11 shown in Table V are used to generate active siNA molecules of the invention. In another embodiment, the rules 1-12 shown in Table V are used to generate active siNA molecules of the invention.

EXAMPLE 4 Design of the siNA The siNA target sites were chosen to analyze the target sequences and optionally to prioritize the target sites based on the rules presented in Example 3 above, and alternatively based on the folding (the structure of any given sequence that is analyzed to determine the accessibility of the siNA to the target), or by using a collection of siNA molecules as described in Example 3, or alternatively using an in vitro siNA system as described in Example 6 herein document. SiNA molecules were designed that could bind to each target and were selected using the above algorithm and optionally analyzed individually by computer folding to assess whether the siNA molecule can interact with the target sequence. It can be chosen to vary the length of the siNA molecules to optimize the activity. Generally, a number is chosen to be analyzed from complementary nucleotide bases to bind, or otherwise interact, with the target RNA, but the degree of complementarity can be modulated to accommodate the double-stranded siNA molecules or vary the length or composition of the bases. By using such methodology, siNA molecules can be designed to direct them against target sites of any known RNA sequence, for example RNA sequences that correspond to any gene transcript. Target sequences are analyzed to generate targets from which double-stranded siNAs are designed (Table II). To generate synthetic siNA constructs, the algorithm described in Example 3 is used to choose active double-stranded constructions and their chemically modified versions. For example, in Table II, the target sequence is shown, together with the upper strand (coding strand) and lower strand (non-coding strand) of the siNA double-stranded molecule. Multifunctional siNAs are designed by looking for homologous sites between different target sequences (e.g., regions of about 5 to about 15 nucleotides of shared homology) and allowing non-canonical base pairs (e.g., pairing with G: U hesitation) or base pairs with pairing wrong. Chemically modified siNA constructs were designed as described herein (see for example, Table I) to provide nuclease stability for systemic administration in vivo and / or for improved pharmacokinetic properties, localization, and administration to while maintaining the ability to act as mediator of RNAi activity. Chemical modifications are introduced as described herein synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then tested for stability against nucleases in serum and / or cell / tissue extracts (e.g., hepatic extracts). The synthetic siNA constructs are also analyzed in parallel to determine the RNAi activity using an appropriate assay, such as a luciferase control assay as described herein or another suitable assay that can quantify the RNAi activity. Synthetic siNA constructs that both stability against nucleases and RNAi activity can be further modified and reevaluated in stability and activity assays. The chemical modifications of the stabilized active siNA constructs can then be applied to any siNA directing the sequence against any chosen RNA and used, for example, in objective screening assays to choose direct siNA compounds for therapeutic development (see for example the Figure 9).

EXAMPLE 5 Chemical synthesis and purification of siNA The siNA molecules can be designed to interact with various sites of the messenger RNA, for example, target sequences of the RNA sequences as described herein. The sequence of a strand of the siNA (s) molecule is complementary to the sequences of the target sites as described above. The siNA molecules can be chemically synthesized using methods described herein. The inactive siNA molecules that are used as control sequences can be synthesized by altering the sequence of the siNA molecules in such a way that it is not complementary to the target sequence. Generally, siNA constructs can be synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al., US Pat. Nos. 5,804,683, 5,831,071, 5,998,203, 6,117,657, 6,353,098, 6,362,323, 6,437,117, 6,469,158, Scaringe et al, United States patents NJ 6,111, 086, 6,008,400, 6,111, 086 all of which are incorporated by reference herein in their entirety). In a non-limiting example, RNA oligonucleotides are synthesized stepwise using the phosphoramidite reactions as is known in the art. Standard phosphoramidite reactions involve the use of nucleosides comprising any of the groups of 5'-O-dimethoxytrityl, 2'-O-tert-butyldimethylsilyl, 3'-O-2-cyanoethyl N, N-diisopropylphosphoramidite, and exocyclic groups of protection of amine (for example N6-benzoyl adenosine, N4 acetyl cytidine, and N2-isobutyryl guanosine). Alternatively, 2'-O-silyl ethers can be used together with an acid-labile 2-O-orthoester protecting groups in the RNA synthesis as described in the above Scaringe. Different 2 'groups may need different protecting groups, for example the 2'-deoxy-2'-amino nucleosides may use N-phthaloyl protection as described by Usman et al, U.S. Patents 5,631, 360, which is incorporated by reference to this document in its entirety). During solid-phase synthesis, each nucleotide is sequentially added (in the 3'-5 direction) to the oligonucleotide bound to the solid support. The first nucleoside at the 3'-end of the chain is covalently bound to a solid support (eg, controlled pore glass or polystyrene) using various linkers. The precursor nucleotide, a nucleoside phosphoramidite, and the activator combine to cause coupling of the second ribonucleoside phosphoramidite on the 5 'end of the first nucleoside. The support is then washed and all the unreacted 5-hydroxyl groups are introduced with a cap with a reagent cap such as acetic anhydride anhydride providing inactive 5'-acetyl moieties. The trivalent phosphorus bond is then oxidized to the more stable phosphate bond. At the end of the nucleotide addition cycle, the protecting group of 5'-O is cleaved under suitable conditions (for example, acid conditions for the groups with trityl base and fluoride for the groups with silyl base). The cycle is repeated for each subsequent nucleotide. The modification of the synthesis conditions can be used to optimize the coupling efficiency, for example by using different coupling times, which differ in the reagent / phosphoramidite concentrations, which differ in the contact times, which differ in the groups of the supports solids and linkers for solid supports depending on the particular chemical composition of the siNA to be synthesized. The deprotection and purification of the siNA can be carried out as described generally in Usman et al., US 5,831,071, US 6,353,098, US 6,437,117, and Bellon et al., US 6,054,576, US 6,162,909, US 6,303,773, or Scaringe reference above. , which are incorporated by reference in this document in its entirety. further, the deprotection conditions can be modified providing the best possible yield and purity for the siNA constructions. For example, the applicant has observed that oligonucleotides comprising 2'-deoxy-2'-fluoro nucleotides can degrade under inappropriate deprotection conditions. Said oligonucleotides are deprotected using aqueous methylamine at about 35 ° C for 30 minutes. If the 2'-deoxy-2'-fluoro-containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35 ° C for 30 minutes, TEA-HF is added and the reaction is maintained at about 65 ° C during 15 more minutes. Unprotected single-stranded siNA strands are purified by exchange of anions achieving high purity while maintaining high throughput. To form the double-stranded siNA molecule, the single-stranded strands are combined in molar proportions equal to a saline solution to form the double-stranded molecule. The double-stranded molecule siNA is concentrated and desalted by tangential filtration before lyophilization EXAMPLE 6 In vitro RNAi test to evaluate siNA activity An in vitro assay that recapitulates RNAi in a cell-free system is used to evaluate siNA constructs directed against target RNA. The assay comprises the system described by Tuschl et al., 1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000, Cell, 101, 25-33 adapted for use with an objective RNA. A Drosophila extract derived from syncytial blastoderm is used to reconstitute the RNAi activity in vitro. The target RNA is generated by in vitro transcription from an appropriate target expressing the plasmid using T7 RNA polymerase or by chemical synthesis as described herein. The coding and non-coding strands of siNA (for example 20 μM each) are hybridized by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, at pH 7.4, 2 mM magnesium acetate) for 1 minute at 90 ° C followed by 1 hour at 37 ° C, then diluted in lysis buffer (e.g., 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate). Hybridization can be controlled by gel electrophoresis in a 30 mM gel in TBE buffer and stained with ethidium bromide. Drosophila lysate is prepared using zero to two hour old embryos of Oregon R musts on yeast molasses agar that are dehorned and lysed. The lysate is centrifuged and the supernatant is isolated. The assay comprises a reaction mixture containing 50% lysate [vol / vol], RNA (final concentration 10-50 pM) and 10% [vol / vol] lysis buffer containing siNA (final concentration 10 nM) . The reaction mixture also contains 10mM creatine phosphate, 10μg / ml creatine phosphokinase, 100μM GTP, 100μM UTP, 100μM CTP, 500μM ATP, 5mM DTT, 0JU / μl RNasin (Promega), and 100 μM of each amino acid. The final concentration of potassium acetate is adjusted to 100 mM. The reactions are pre-assembled on ice and pre-incubated at 25 ° C for 10 minutes before adding RNA, then incubated at 25 ° C for an additional 60 minutes. The reactions are inactivated with 4 volumes of 1.25 x Passive Lysís buffer (Promega). The cleavage of the target RNA is assayed by objective RNA analysis or other methods known in the art and compared to control reactions in which siNA is omitted from the reaction. Alternatively, internally labeled target RNA is prepared for the assay by in vitro transcription in the presence of [alpha-32p] CTP, passed through a Sephadex G50 column by centrifugal chromatography and used as target RNA without further purification. Optionally, the target RNA is labeled with P at the 5 'end using the T4 polynucleotide kinase enzyme. The assays are performed as described above and the target RNA and the specific RNA cleavage products that are generated by RNAi are visualized on a gel autoradiograph. The percentage of cleavage is determined by band quantification with PHOSPHOR IMAGER® (autoradiography) representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay. In one embodiment, this assay is used to determine the target sites of the target RNA for siNA-mediated siNA cleavage, wherein a plurality of siNA constructs are screened to determine RNAi-mediated cleavage of the target RNA, e.g. analyzing the assay reaction by electrophoresis of labeled target RNA or by northern blotting, as well as by another methodology well known in the art.

EXAMPLE 7 Inhibition by nucleic acid of target RNA The siNA molecules directed against a target RNA are designed and synthesized as described above. These nucleic acid molecules can be analyzed for cleavage activity in vivo, for example, using the following procedures. The target sequences and the location of the nucleotide in the target RNA are given in Table II. Two formats are used to analyze the efficacy of the siNA directed against any target sequence. First, the reagents are analyzed in cell culture using HepG2 cells, Jurkat, HeLa, A549 or 293T, to determine the magnitude of RNA and protein inhibition. The siNA reagents are selected against the target as described herein. The inhibition of siNA is measured after administration of these reagents by a suitable transfection agent, for example, to HepG2, Jurkat, HeLa, A549 or 293T cells. The relative amounts of target RNA compared to actin are measured using PCR monitoring of the real-time amplification (eg, ABl 7700 TAQMAN®). A comparison is made with a mixture of oligonucleotide sequences prepared against unrelated targets or against a randomized control siNA with the same length and total chemical groups, but randomly substituted in each position. The primary and secondary reagents are selected for the purpose and the optimization is carried out. After choosing an optimal concentration of transfection agent, a batch of RNA inhibition is performed with the directing siNA molecule. In addition, a cell plating format can be used to determine the inhibition of RNA.

Administration of siNA to cells Cells are seeded (e.g., HepG2, Jurkat, HeLa, A549 or 293T), for example, at 1x10 ^ cells per well of a six-well plate in EGM-2 (BioWhittaker) the day before transfection. Syna complexes (final concentration, for example 20 nM) and cationic lipid (for example, formulations in LNP of the present document, or other suitable lipid such as Lipofectamine, at a final concentration of 2 μg / ml) are formed in basal medium EGM (Biowhittaker) at 37 ° C for 30 minutes in polystyrene tubes. After the vortex agitation, the siNA is added forming complexes to each well and incubated during the times indicated. For initial optimization experiments, the cells are seeded eg at 1x10 ^ in 96-well plates and siNA complex is added as described. The efficiency of administration of siNA to the cells is determined using a fluorescent siNA complexed with lipid. The cells in 6-well plates are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. The siNA uptake is visualized using a fluorescence microscope.

TAQMAN® (control of real-time PCR amplification) and quantification of mRNA in Liqhtcvcler Total RNA is prepared from cells after administration of siNA, for example, using Qiagen RNA purification kits for the 6-well assays or Rneasy extraction kits for assays in 96 wells. For the analysis by TAQMAN® (control of the real-time PCR amplification), double-labeled probes are synthesized with the control dye, FAM or JOE, covalently bound to the 5 'end and conjugated TAMRA inactivator dye at the end. 3'. Amplifications are performed by RT-PCR in one step, for example, in an ABI PRISM 7700 sequence detector using 50 μl reactions consisting of 10 μl of total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, buffer Reaction PCR 1X TaqMan (PE-Applied Biosystems), 5.5 mM MgCl2, 300 μM each of dATP, dCTP, dGTP, dTTP, 10U of RNase inhibitor (Promega), 1.25 U of AMPLITAQ GOLD® (DNA polymerase ) (PE-Applied Biosystems) and 10 U of M-MLV Reverse Transcriptase (Promega). The thermal cycling conditions may consist of 30 minutes at 48 ° C, 10 minutes at 95 ° C, followed by 40 cycles of 15 seconds at 95 ° C and 1 minute at 60 ° C. The quantification of mRNA levels is determined relative to patterns generated from total cellular RNA (300, 100, 33, 11 ng / reaction) and normalizing with β-actin or GAPDH mRNA in parallel TAQMAN® reactions (control of the PCR amplification in real time). For each gene of interest, an upper and lower primer and a fluorescent labeled probe are designed. The real-time incorporation of SYBR Green I dye into a specific product of the PCR can be measured in glass capillary tubes using a lightcycler. A pattern curve is generated for each pair of patterns using control cRNA. The values are represented in terms of expression relative to GAPDH in each sample.

Western Blotting Nuclear extracts can be prepared using a standard micropreparation technique (see for example Andrews and Faller, 1991, Nucleic Acid Research, 19, 2499). Protein extracts are prepared from the supernatants, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. The sediments are washed in acetone, dried and resuspended in water. The cellular protein extracts are passed through a 10% Bis-Tris NuPage polyacrylamide gel (nuclear extracts) or 4-12% Tris-Glycine (supernatant extracts) and transferred onto nitrocellulose membranes. The non-specific binding can be blocked by incubation, for example, with 5% skimmed milk for 1 hour followed by primary antibody for 16 hours at 4 ° C. After washing, the secondary antibody is applied, for example (1: 10,000 dilution) for 1 hour at room temperature and the signal is detected with SuperSignal reagent (Pierce).

EXAMPLE 8 Utility models to evaluate regulation by decreasing the expression of the target gene The evaluation of the efficacy of the siNA molecules of the invention in animal models is an important prerequisite for clinical trials in humans. Various animal models of diseases, conditions, or cancer, proliferative, inflammatory, autoimmune, neurological, ocular, respiratory, metabolic, auditory, dermatological, etc. disorders can be adapted. as is known in the art to use for the preclinical evaluation of the efficacy of the nucleic acid compositions the invention to modulate the expression of the target gene towards therapeutic, cosmetic or research use.

EXAMPLE 9 RNAi mediated inhibition of target gene expression In vitro siNA-mediated inhibition of RNA in vitro The siNA constructs are analyzed for efficacy in reducing the expression of target RNA in cells, (e.g., HEKn / HEKa, HeLa, A549, A375 cells). Cells are plated approximately 24 hours before transfection to 96 well plates at 5. 000-7,500 cells / well, 100 μl / well, such that at the time of transfection the cells show a confluence of 70-90%. For transfection, siNAs hybridized with the transfection reagent (Lipofectamine 2000, Invitrogen) are mixed in a volume of 50 μl / well and incubated for 20 minutes at room temperature. The siNA transfection mixtures are added to the cells giving a final siNA concentration of 25 nM in a volume of 150 μl. Each siNA transfection mixture is added to 3 wells for siRNA treatments in triplicate. The cells are incubated at 37 ° for 24 hours in the continuous presence of the siNA transfection mixture. In 24 hours, RNA is prepared from each well of treated cells. First the supernatants are removed and discarded with the transfection mixtures, then the cells are lysed and the RNA is prepared from each well. The expression of the target gene is evaluated after treatment by RT-PCR for the target gene and for a control gene (36B4, a subunit of polymeric RNA) for normalization. The mean of the triplicated data is made and the standard deviations are determined for each treatment. The normalized data are plotted and the percentage reduction of the target mRNA is determined by the active siNAs compared to their respective inverted control siNAs.

EXAMPLE 10 Efficiency of siNA constructs stabilized with one or more ribonucleotides in selected positions Chimeric siNA constructs (see Table II) containing blocks of 6-ribonucleotides were generated either in the coding strand (transient strand) or in the non-coding strand (guide) while maintaining all other chemically modified nucleotides . Inactivation of the target HBV messenger was observed by measuring protein levels (HBsAg) instead of mRNA levels. The presence of a block of ribonucleotides at the 5 'or 3' end either of the coding strand or of the siNA leader showed potent silencing activity, as did the siNA constructs where the ribonucleotide block ends it also had a complementary ribonucleotide in the opposite strand. The data for the siNA constructs of site HBV 262 are shown in Figure 26, siNA constructs of site 263 in Figure 27, and the siNA constructs of site 1583 in Figure 28. The determination of IC50 values in tissue culture revealed that the chimeric siNA containing a block of 6 ribonucleotides at the siNA end positions for sites 262, 263 and 1583 of HBV (see Figures 33 and 34) maintained activity. Additional constructs were evaluated, in which the ribonucleotide content had been reduced to a single ribonucleotide residue at the 5 'end position of the leader strand sequence complementary to HBV site 263 to determine its ability to mediate RNAi. In vitro experiments revealed that a single ribonucleotide residue in the position of the 5 'end of the guide strand maintained the activity of a chemically modified double-stranded siNA molecule (structures 7/23, 7/24 and / or 7/28, see Figure 31). Because a siNA double-stranded molecule containing a single nucleotide moiety at the position of the nucleotide at the 5 'end of the non-coding strand could cleave the target RNA in a catalytic manner, it can further be inferred that the 2'-OH group of the siRNA molecule does not participate directly in the catalytic cleavage of the target RNA. Additional siNA constructs called stabilization structures Estab 7/23, 7/24, 7/25, 7/26, 7/27 and 7/28 (see Table I) were evaluated for their ability to mediate RNAi. The in vitro serum stability of the siNA 7/25 construction revealed that this construct has a half-life of >24 h in human serum. The applicant performed RNAi in vitro cleavage assays using HeLa cell lysate as a source of RISC proteins to evaluate various siNA constructs for their ability to induce cleavage of target RNA. SiNA versus HCV constructs directed to site 304 of the siNA Stab 7/8 configuration were evaluated in the RNAi in vitro cleavage assay (see Table II). Site-specific cleavage of a target RNA at 10 nucleotides from the 5 'end of the leader sequence is diagnostic of RISC-mediated cleavage. In fact, site-specific cleavage of the target RNA was observed in the expected position with siNA against HCV directed to site 304 of the siRNA configuration 7/8. This shows that the completely modified siRNA operates through an RNAi mechanism and that the presence of a 2'-OH group in the siNA is not necessary for RNAi-mediated target RNA cleavage and that the 2'-OH group of the siNA does not participate in the cleavage of the target RNA. As described above, the presence of ribonucleotide residues at the nucleotide positions of the 5 'end of the leader strand produced siRNA with strong activity. The activity of the siRNA constructs in which the first three nucleotides of the leader strand comprising 2'-deoxy-2'-fluoro pyrimidines and purine ribonucleotides were evaluated. This stabilization structure is called Stab 29 (Table I). The siNA worked equally well in both the Estab 7/25 and the Estab 7/29 structures (see Figure 32). Thus, the purine residues when present at the 5 'end nucleotide positions can be maintained as ribonucleotides in the leader strand and the pyrimidine nucleotides in the leader strand can be chemically modified while maintaining strong RNAi activity. To establish that these siNA also function through specific degradation of RNA mediated by RISC, an in vitro RNA assay was used using HeLa cell lysate. Site-specific cleavage of the target RNA at 10 nucleotides from the 5 'end of the leader strand is diagnostic of RISC-mediated cleavage. In fact, site-specific cleavage of the target RNA was observed in the expected position with the three siNAs of the Estab 7/25 and 7/25 configurations. This suggests that these siNA constructs work through an RNAi mechanism.

Materials and methods Synthesis and characterization of oligonucleotides Oligonucleotides siNA were synthesized, they were deprotected and purified as described herein. The integrity and purity of the final compounds was confirmed by standard HPLC, CE and EM methodologies by MALDI OF.

Hybridization of siRNA siNA strands (20 μM each strand) were hybridized in potassium acetate siNA, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate. The hybridization mixture was first heated at 90 ° C for 1 min. and then transferred to 37 ° C for 60 minutes. Hybridization was confirmed by evaluation by non-denaturing PAGE and Tm in 150 mM NaCl.

Serum stability test Oligonucleotides were designed in such a way that standard binding procedures would generate full-length coding or non-coding strands. Prior to ligation, standard kinase procedures with [? -32P] ATP were used to generate an internal 32P marker.

The ligated material was gel purified using denaturing PAGE. Internally labeled coding (or non-coding) strands were added to unlabelled material to achieve a final concentration of 20 μM. The unlabeled complementary strand was present at 35 μM. Hybridization was performed as described above. The formation of double-stranded molecules was confirmed by unmodified PAGE and subsequent visualization in a Molecular Dynamics Phosphoimager (Sunnyvale, CA). Internally labeled double-stranded or single-stranded siRNA was added to human serum to achieve final concentrations of 90% serum (Sigma, St. Louis, MO) and 2 μM double-stranded siRNA with a 1.5 μM excess of the unlabeled single-chain siRNA. The samples were incubated at 37 ° C. The aliquots were extracted at the specified times and inactivated using a five-second digestion with Proteinase K (20 μg) (Amersham, Piscataway, NJ) in 50 mM Tris-HCl at pH 7.8, 2.5 mM EDTA, 2.5% SDS, followed by the addition of 6x the volume of formamide loading buffer (90% formamide, 50 mM EDTA, 0.015% xylene cyanol and bromophenol blue, search oligonucleotide without maracating 20 μM of the same sequence as the radiolabeled strand). The samples were separated by denaturing PAGE and visualized in a Molecular Dynamics Phosphoimager. For the quantification the ImageQuant program (Molecular Dynamics) was used.

Cell culture studies Hepa G2 human hepatoblastoma cell lines were cultured in Eagle's minimal essential medium supplemented with 10% fetal calf serum, 2 mM glutamine, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate and 25 mM Hepes. Replication-competent cDNA was generated by excising and relying the HBV genomic sequences of the psHBV-1 vector. Hep G2 cells (3 x 104 cells / well) were plated in 96-well microtiter plates and incubated overnight. A complex of cationic lipid / DNA / sRNA was formed containing (in final concentrations) cationic lipid (11-15 μg / ml), relined psHBV-1 (4.5 μg / ml) and siRNA (25 nM) in medium increase. After an incubation of 15 min. at 37 ° C, 20 μl of the complex was added to the plated Hep G2 cells in 80 μl of culture medium without antibiotics. The medium was removed from the cells 72 hours after transfection for HBsAg analysis. All transfections were performed in triplicate.

Test of HBsAa by ELISA HBsAg levels were determined using the ELISA kit for HBsAg from Genetic Systems / Bio-Rad (Richmond, VA), according to the manufacturer's instructions. The absorbance of the cells not transfected with the HBsAg vector was used as background noise for the assay, and thus was subtracted from the values of the experimental samples.

EXAMPLE 12 Efficiency of siNA constructs formulated with different hanging groups in a model of chronic HBV infection To evaluate the activity of chemically stabilized siNA nanoparticle compositions (see Vargeese et al., U.S. Provisional Patent Application No. 60 / 678,531 and related U.S. Provisional Patent Application No. 60 / 703,946, filed July 29, 2005, and U.S. Provisional U.S. Patent Application No. 60 / 737,024, filed on June 15, 2005; November 2005, all of which are incorporated by reference to this document), a systemic administration of the formulated siNA composition was carried out (Formulations L-086 and L-061, see Table IV and provisional patent application of United States of America). No. 60 / 737,024, filed November 15, 2005) after hydrodynamic injection (HDI) of the HBV vector into a mouse strain NOD.CB17-Prkdcscid / J (Jackson Laboratory, Bar Harbor, ME). The female mice were 5-6 weeks old and approximately 20 grams at the time of the study. The HBV vector that was used, pWTD, is an end-to-end dimer of the whole VHB genome. For a 20 gram mouse, a total injection of 1.6 ml containing pWTD in saline was injected into the caudal vein in 5 seconds. A total of 0.3 μg of the HBV vector was injected per mouse. To allow recovery of the liver from the alteration caused by HDI, the administration of the formulated siNA compositions was started 6 days after the HDI. Active encapsulated or negative control siRNA was administered at 3 mg / kg / day for three days by standard IV injection. The animals were sacrificed 10 days after the last dose, and serum HBV DNA levels were measured. HBV DNA titers were determined by real-time quantitative PCR and expressed in terms of copy loglO mean / ml (± ETM). Significant reductions in serum HBV DNA were observed (Figure 33) on day 10 in the groups treated with the active formulated siNA composition compared to both the control and PBS control and negative control groups.

Synthesis and characterization of oligonucleotides All RNAs were synthesized as described herein. The complementary strands were annealed in PBS, desalted and lyophilized. The HBV siNA sequences of site 263 are shown below and named according to the numbers of Sima compounds shown in Figure 33. Modified siNAs that were used in vivo are named according to their formulation in LNP, either L-086 or L-061 (see Table IV and United States Provisional Patent Application No. 60 / 737,024, filed on November 15, 2005).

The siNA sequences for active HBV siNA are: coding strand: 5"B GGAcuucucucAAuuuucuTT B 3 '(SEQ ID NO: 60) Compound nJ 33214 non-coding strand: 5 * AGAAAAuuGAGAGAAGuccUU 3' (SEQ ID NJ: 61) Compound nJ 38749 non-coding strand: 5 'AGAAAAuuGAGAGAAGuccAC 3' (SEQ ID NO: 62) Compound nJ 47675 non-coding strand: 5 'AGAAAAuuGAGAGAAGuccTT 3' (SEC ID NJ: 63) Compound nJ 37793 non-coding strand: 5 'AGAAAAuuGAGAGAAGuccTsT 3' (SEQ ID NO: 64) Compound nJ 35092 The siNA sequences for control inverted HBV siNA are: coding strand: 5 'B ucuuuuAAcucucuuc GGTT B 3 '(SEQ ID NO: 65) Compound nJ 33578 non-coding strand: 5' ccuGAAGAGAGuuAAAAGATsT 3 '(SEQ ID NO: 66) Compound nJ 46419 (where lower case = 2'-deoxy-2'-flouro; Uppercase italics = 2'-deoxy; Uppercase underlined = 2'-O-methyl; Uppercase bold = ribonucleotide; T = thymine; B = inverted deoxyabasic; and s = phosphorothioate) HBV DNA analysis Viral DNA was extracted from 50 μl of murine serum using QIAmp 96 DNA Blood kit (Qiagen, Valencia, CA), according to the manufacturer's instructions. The HBV DNA levels were analyzed using an Abl Prism 7000 sequence detector (Applied Biosystems, Foster City, CA). Real-time quantitative PCR was performed using the following primer and probe sequences: direct primer 5'-CCTGTATTCCCATCCCATCGT (SEQ ID NO: 69, HBV nucleotides 2006-2026), reverse primer 5'-TGAGCCAAGAGAAACGGACTG (SEQ ID NO: 70 , HBV nucleotides 2063-2083) and FAM probe 5'-TTCGCA AAATACCTATGGGAGTGGGCC (SEQ ID NO: 71, HBV nucleotides 2035-2062). The vector psHBV-1, which contains the complete HBV genome, was used as a standard curve to calculate the HBV copies per ml of serum.

EXAMPLE 13 Activity of HBV siNA formulated in LNP in a model of HBV infection in mouse The development of therapeutic siRNA (siNA) by systemic administration routes is based both on the chemical modification of RNA to improve physical stability and in the formulations to promote an adequate direction to tissues and cellular uptake. In this example, chemically modified siNA directed to human hepatitis B virus (HBV) was encapsulated in a hepatotrophic lipid-based nanoparticle and demonstrated a reduction of 2.5-3.0 Iog10 of circulating HBV DNA in mice with replicating HBV. In addition, the levels of viral RNA in the liver were reduced in > 90% as a consequence of the cleavage of the target mediated by RISC as determined by RACE analysis. This demonstrates that chemical modification of siNA against HBV is important for non-cytokine-mediated deactivation of viral RNA even with nanoparticle-mediated administration. The nanoparticle formulation provides 65% of the dose of siNA to the liver and the siNA can be detected in the liver 14 days after a single dose. The administration of these siNA formulated to mice by intravenous injection is well tolerated as measured by biochemical tests including AST and ALT levels. These results support the siNA-based therapeutic development against important human liver viral pathogens such as HBV and HCV. As described in the previous examples, a number of active target sites for siNA were identified in the HBV genome in cell culture studies, with a particularly potent siNA starting at nucleotide 5 '263 (HBV263M) in the region S of the HBV RNA. The siNA molecule HBV263 described in Example 12 above has a coding strand consisting of SEQ ID NO: 60 and a non-coding strand constituted by SEQ ID NO: 64. coding strand: 5"B GGAcuucucucAAuuuucuTT B 3 '( SEQ ID NO: 60) Compound nJ 33214 non-coding strand: 5"AGAAAAuuGAGAGAAGuccTsT 3 '(SEC ID NJ: 64) Compound nJ 35092 The work described in this study provides the use of siNA administration technology in novel lipid nanoparticles (LNP) that leads to a greater administration of siNA to the liver, and drastically improves the potency and duration of siNA activity against HBV in vivo, which includes a significant reduction of HBV RNA in the liver. In addition, the reduction of viral RNA is shown to be a direct consequence of excision of the target mediated by siNA.

SINA formulation The LNP formulation used in the study is LNP-086 (see Table IV). The siNA that are incorporated into the lipid nanoparticles with high encapsulation efficiency by mixing siNA in buffer in alcoholic solution of the lipid mixture, followed of a process of diafiltration in stages. The encapsulation efficiency was determined by orthogonal methods using HPLC (anion exchange chromatography and size exclusion chromatography) and RiboGreen assays (measuring the change in fluorescence with and without detergent). Particle size and charge density measurements were performed using a Brookhaven size particle sorter (Holtsville, NY) ZetaPal.

Test of HBsAa by ELISA HBsAg levels were determined using the ELISA kit for HBsAg from Genetic Systems / Bio-Rad (Richmond, VA), according to the manufacturer's instructions. Absorbance of cells not transfected with the HBsAg vector was used as background noise for the assay, and thus was subtracted from the values of the experimental samples.

Mouse model based on the HBV vector To evaluate the activity of chemically stabilized HBsAbs against HBV, systemic administration of the siNA was carried out after the hydrodynamic injection (HDI) of the HBV vector into the mouse strain NOD.CB17- Pr / < dcsc'd / J (Jackson Labs, Bar Harbor, ME). The female mice were 5-6 weeks old and approximately 20 grams at the time of the study. The HBV vector that was used, pWTD, is an end-to-end dimer of the whole VHB genome. For a 20 gram mouse, a total injection of 1.6 ml containing pWTD in saline was injected into the caudal vein in 5 seconds. A total of 0.3 μg of the HBV vector was injected per mouse. The standard systemic administration of the siNA was from 0.3 to 10 mg / kg / day. To allow the recovery of the liver from the alteration caused by HDI, systemic administration was started 6 days after HDI.

HBV DNA analysis Viral DNA was extracted from 50 μl of murine serum using QIAmp 96 DNA Blood kit (Qiagen, Valencia, CA), according to the manufacturer's instructions. The HBV DNA levels were analyzed using an Abl Prism 7000 sequence detector (Applied Biosystems, Foster City, CA). Real-time quantitative PCR was performed using the following primer and probe sequences: direct primer 5'-CCTGTATTCCCATCCCATCGT (SEQ ID NO: 69, HBV nucleotides 2006-2026), reverse primer 5'-TGAGCCAAGAGAAACGGACTG (SEQ ID NO: 70 , HBV nucleotides 2063-2083) and FAM probe d-TTCGCA AAATACCTATGGGAGTGGGCC (SEQ ID NO: 71, HBV nucleotides 2035-2062). The vector psHBV-1, which contains the complete HBV genome, was used as a standard curve to calculate the HBV copies per ml of serum.

Analysis of HBV RNA Total cellular RNA was isolated from approximately 100 mg of mouse hepatic tissue using Tri-Reagent (Sigma, St. Louis MO) according to the manufacturer's instructions. The levels of HBV RNA were quantified and normalized with mouse GAPDH RNA using real time reverse transcription (RT) PCR in a multiple reaction. The relative amounts of both HBV and GAPDH RNA were calculated from a total hepatic RNA standard curve from a mouse injected with HBV (serial dilutions of factor 3 from 300 to 1 ng of RNA per reaction). ). The primers and the HBV probe are described above. The sequences of the primers and the probe for the mouse GAPDH are as follows: direct primer 5'-GCATCTTGGGCTACAC TGAGG (SEQ ID NJ: 72, nucleotides of mGAPDH 855-875), reverse primer 5'-GAAGGTGGAAGAGTGGGAGTTG (SEQ ID NO: 73, nucleotides of mGAPDH 903-925), and VIC probe 5'-ACCAGGTTGTCTCCTGCGACTTCAACAG (SEQ ID NO: 74, nucleotides of mGAPDH 876-913 ). Hepatic HBV RNA levels are expressed in terms of the ratio between HBV RNA and GAPDH.

Enzyme of cleavage of targets by RACE in 5 'RNA analysis was performed according to the protocol of the GeneRacer Kit (Invitrogen, Carlsbad, CA), except that the previous treatment of total RNA was not performed. The total hepatic RNA (5 μg) of animals treated with active and control siNA was ligated to the adapter molecule of GeneRacer. The ligated RNA was reverse transcribed using a specific HBV primer (VSP1: 5'-TGAGCCAAGAGAAACGGACTG, SEQ ID NO: 75). This was followed by PCR amplification using primers complementary to the adapter (GR5'-5'-CGACTGGAGCACGAGGACACTGA, SEQ ID: 76) and HBV (VSP2: 5'-GCATGGTCCCGTACTGGTTGT, SEQ ID NO: 77). The size of the cleavage product (145 bp) was further confirmed by nested PCR using primers (GR5 'nested 5'-GGACACTGACATGGACTGAAGGAGTA, SEQ ID NJ: 78) and (VSP3: 5'CAGACACATCCAGCGATAACCAG, SEQ ID NO: 79) and electrophoresis on PAGE native The amplified product of -145 bp was gel purified, cloned and sequenced to reveal a siNA cleavage site.

Immunostimulation analysis Male CD-1 mice 5 to 6 weeks of age (Charles River, Wilmington, MA) were injected with a single dose of 3 mg / kg of HBV263M-LNP or PBS control by standard intravenous injection into the lateral caudal vein. Animals were sacrificed by inhalation of CO2 followed immediately by blood extraction at 2.5 and 8 hours after administration (n = 5 per time). The blood was collected through the vena cava and processed as a serum for analysis. All cytokines were quantified using ELISA kits in sandwich format according to the manufacturer's instructions. These were murine IL-6, TNF-alpha, IFN-gamma and IFN-alpha (all from R &D Systems, Minneapolis, MN).

Pharmacokinetics Male CD-1 mice were obtained from Charles River (Wilmington, MA) and weighed approximately 30 g at the time of the study. HBV263M-LNP was administered in standard IV bolus form (100-120 μl) at a dose of approximately 3 mg / kg in a lateral caudal vein. The animals were sacrificed at the selected time (2 and 15 min, 1, 3 and 6 hours, and 1, 5, 10 and 14 days after administration) by inhalation of CO2 followed immediately by blood extraction. Blood was collected by cardiac puncture and collected in Microtainer® brand tubes containing EDTA and the plasma was collected. After the blood collection, the animals were perfused with sterile veterinary quality saline solution in the heart. The liver was weighed and a sample (~ 100 mg) was introduced into a pre-weighed homogenization tube and frozen on carbon ice. Quantification of siNA in plasma and in liver samples was performed using a sandwich hybridization assay with a working concentration range of 0.026-6.815 ng / ml for the transient strand and 0.027-6.945 ng / ml for the guide. Liver samples were prepared at a concentration of 100 mg / ml in tissue homogenization buffer (3 M guanidine isothiocyanate, 0.5 M NaCl, 0.1 M Tris pH 7.5, 10 mM EDTA). This mixture was homogenized once in Bio-101 Homogenizer (Savant, Carlsbad, CA) with a speed setting of 6.0 and an operating time of 10 seconds. The homogenized liver solutions were diluted to 10 mg / ml in 1 M GITC buffer (1 M guanidine isothiocyanate, 0.5 M NaCl, 0 J M Tris at pH 7.5, 10 mM EDTA), then used in the assay at an additional dilution (1: 2 to 1:10). The plasma samples were diluted > 25 times in 1 M GITC buffer. Total siNA concentrations were calculated by adding concentrations of the transient and guide strands. WinNonLin Professional (see 3.3) was used to perform the non-compartmentalized pharmacokinetic analysis of the concentration data as a function of time.

Evaluation of toxicity Twenty CD-1 male mice were administered HBV263M-LNP by a single bolus IV injection at a dose of 3 mg / kg (n = 10) or PBS (n = 10). Body weights were measured before a study and before the collection of samples 1 or 14 days after administration. At appropriate times, mice were sacrificed by inhalation of CO2 followed immediately by blood extraction (n = 5 / time) and blood was collected for analysis of serum biochemistry. In addition, liver and spleen weights were taken and the ratio between the organs and body weight was calculated.

Results HBV siNA formulated in LNP The formulation of LNP-086 (see Table IV) was used to encapsulate siNA active against HBV263M with a coding strand constituted by SEQ ID NO: 60 and a non-coding strand constituted by SEQ ID NJ: 64 and a corresponding inverted control formulation of HBV263inv with a coding strand constituted by SEQ ID NO: 65 and an antisense strand constituted by SEQ ID NJ: 66. coding strand: 5 'B ucuuuAAcucucuucAGGTT B 3' (SEQ ID NJ) : 65) Compound nJ 33578 non-coding strand: 5 'ccuGAAGAGAGuuAAAAGATsT 3' (SEC ID NJ: 66) Compound nJ 46419 A procedure was developed to incorporate the siNA to the lipid nanoparticles with high efficiency by simultaneously mixing lipid and siNA solutions, followed by step diafiltration. Using this procedure, the siNA of HBV263M and control HBV263Minv were encapsulated in the formulation LNP-086. The average encapsulation efficiency of siNA was found to be 84 ± 2%, as determined by HPLC and RiboGreen assays. The average particle size was 167 ± 10 nm, with polydispersity of 0.15 ± 0.05. The LNP had a surface positive charge density of 30 ± 2 mV. The chemically modified HBV263M siNA encapsulated with the LNP formulation was initially evaluated to determine activity in a HBV cell culture system. A single treatment of Hep G2 cells replicating HBV with HBV263M-LNP caused a dose-dependent reduction of HBsAg levels, with an IC 50 of 1 nM (no data shown).

In vivo activity of HBV263M encapsulated in LNP To evaluate the in vivo activity of siNA encapsulated in LNP, a murine model of HBV replication was used in which the hydrodynamic injection (HDI) of a vector with competent replication of HBV produces replication viral in the hepatocytes. In this model, HBV replicates in the liver of immunocompromised mice for up to 80 days, producing detectable levels of HBV RNA and antigens in the liver, as well as HBV DNA titers and serum antigens that are similar to the levels that are found in patients with chronic infection.

To evaluate the HBV263M-LNP-086 HBV263M potency and specificity, its activity was compared with the control siNA HBV263invM-LNP-086. Mice with replicating HBV were treated at doses of 0.3, 1, or 3 mg / kg / day for three days, and HBV DNA levels in serum and HBsAg were determined 3 days after the last dose. A dose-dependent reduction was observed in both HBV DNA and serum HBsAg titers. The decrease in HBV DNA titers (Figure 34A) in 3.0 serum was observed. 2.3, and 1.1 loglO (p < 0.0001) and reductions in serum HBsAg levels (Figure 34B) of 2.4, 2.2, and 1.5 loglO (p <0.0001) in the treatment groups with 3, 1, and 0.3 mg / kg, compared to the control groups with siNA or PBS. HBV DNA or serum HBsAg levels were equivalent in the control siNA and PBS treated groups, demonstrating the sequence specificity of activity against HBV and the absence of nonspecific effects of lipids. The duration of siNA-mediated reductions in HBV levels in the mouse model was examined. Mice with replicating HBV were treated with HBV263M-LNP-086 or HBV263Minv-LNP-086 at a dose of 3 mg / kg / day for three days, followed by analysis of serum HBV titers on days 3, 7, and 14 after of the last dose. The figure, the activity against HBV was persistent, observing a still significant activity on day 7 (reduction of 2.0 Iog10) and day 14 (reduction of 1.5 Iog10 (Figure 35)). This prolonged persistence of siNA activity against HBV suggested that infrequent administration of the compound could be effective. The murine model of HBV was used to evaluate the effect of weekly administration. The mice were treated with HBV263M-LNP-086 or HBV263Minv-LNP-086 at 3 mg / kg / day on days 1 and 4 of the first week and then once a week for a further three weeks. Serum HBV DNA titers were determined for days 7, 14, 21, and 28. The groups treated with HBV263M-LNP-086 showed reductions in serum HBV titers compared to the PBS-treated groups of 1.7, 1.7, 1.8, and 1.3 loglO on days 7, 14, 21 , and 28 respectively (Figure 36). These results suggest that reductions in HBV titers can be maintained by the weekly administration of HBV263M-LNP-086.

Specific cleavage of hepatic HBV-mediated hepatic RNA To examine the excision of liver-specific HBV RNA mediated by the active formulation of HBV263M-LNP-086, mice were treated with replicating HBV with doses of HBV263M-LNP-086 at 0.3, 1, 3, 10 mg / kg / day or control HBV263invM-LNP at 10 mg / kg for three days, and HBV RNA levels were determined 3 days after the last dose.

Dose-dependent reduction of hepatic HBV RNA was observed (Figure 37), with decreases of 90%, 66.5%, 18%, and 4% that were observed in the treatment groups with 10, 3, 1, and 0.3 mg / kg of HBV263M-LNP respectively compared to the control with HBV263invM-LNP-086 at 10 mg / kg.

To directly demonstrate that the reduction of hepatic HBV RNA that was observed in the mouse model was due to RNAi-mediated cleavage of HBV RNA, a rapid amplification analysis of the 5 'ends of cDNA (RACE) was used. ) to detect the cleavage of HBV RNA at the intended site. Mice with replicating HBV were treated with HBV263M-LNP-086 or HBV263Minv-LNP-086 in a dose of 3 mg / kg / d for 3 days. The animals were sacrificed at 3, 7, or 14 days of the last dose, and the total liver RNA was isolated. It was expected that the binding of an adapter sequence to the free 5 'ends of the RNA population and the subsequent RT-PCR with adapter and specific HBV primers would give a 145 bp PCR product if the HBV RNA had been splits in the intended target site. As shown in Figure 38, the expected amplification product was observed in the samples treated with active siNA in HBV263 at each time, but not in the samples treated with the HBV263 control. The PCR products were then subcloned and sequenced, confirming the correct binding between the adapter sequence and the predicted siNA cleavage site in HBV263. This result establishes that the reduction in HBV RNA that is observed in the liver was due to a specific cleavage mediated by RNAi of the HBV RNA in the liver. In addition, the detection of cleavage products of HBV RNA on days 7 and 14 show that the duration of the activity of the siNA against HBV is due to a continuous cleavage of the HBV RNA.

Analysis of siNA-induced immunostimulation It has been shown that unmodified synthetic siNA formulated for administration induced the synthesis of inflammatory cytokines and interferons in a sequence-specific manner, both in human peripheral blood mononuclear cells (PBMC) in vitro and in mice in vivo. The potential of the chemically modified siNA HBV263M-LNP-086 to elicit this type of immune response compared to an unmodified version (HBV263R-LNP-086) was investigated. coding strand: 5 'B GGACUUCUCUCAAUUUUCUTT B 3' (SEQ ID NO: 67) Compound nJ 34526 non-coding strand: 5 'AGAAAAUUGAGAGAAGUCCTT 3' (SEQ ID NO: 68) Compound nJ 34527 A dose of 3 mg / kg HBV263M was injected -LNP-086 or HBV263R-LNP-086 to CD-1 mice. The animals were sacrificed at 2.5 or 8 hours after the administration and the blood was collected. To detect peak blood levels, IL-6 and TNF-a were measured at the 2.5-hour time point, while IFN-α levels were measured. and IFN-a were analyzed 8 hours after the injection. In the group treated with HBV263M-LNP-086, the mean level of IL-6 was 33 ± 21 pg / ml, a level not significantly different from the control group with PBS at 13 ± 4 (Table VII). In addition, in the group treated with HBV263M-LNP-086 no induction of TNF-a to IFN-a or IFN-α was observed. On the contrary, a significant induction of the four cytokines was observed in the animals treated with HBV263R-LNP-086 (Table VI). These results show that the modified HBV263M-LNP-086 siNA did not induce cytokines in mice, compared to the very strong response elicited by unmodified siNA HBV263R-LNP-086. The absence of the induction of cytokines by HBV263M-LNP-086 further indicates that the activity against HBV that was observed in the murine model is due to the specific siNA-mediated silencing of HBV gene expression.

Pharmacokinetics of siNA formulated with LNP The pharmacokinetic properties of HBV263M-LNP-086 were determined according to mice after a single dose of 3 mg / kg. A hybridization procedure was used to detect HBV263M siNA in plasma and liver as a function of time (Figure 39). HBV263M was rapidly removed from the plasma with an elimination T1 2 of approximately 1.7 h. However, HBV263M was detected in the liver throughout the sampling period of 14 d and presented a T- | 2 elimination of 4 days. A maximum concentration of 31.3 ± 17.8 ng / mg (mean ± standard deviation) was observed in the liver in 1 hour and corresponded to 65 ± 32% of the dose of siNA. At 14 days, 1.4 ± 0.7% of the dose remained intact in the liver. The prolonged activity against HBV mediated by siNA observed in the model in mice shows a good correlation with this prolonged residence time of the siNA in the liver.

Evaluation of the toxicity of HBV263M-LNP A single-dose study was conducted to determine the potential toxic effects of HBV263M-LNP-086. The administration of HBV263M-LNP-086 was well tolerated by the animals without morbidity or mortality. No changes were observed in body weight or weight ratio of organ and body for the liver and spleen 1 or 14 days after administration of 3 mg / kg of HBV263M-LNP (Table VII). No macroscopic morphological changes were observed in the liver or spleen. In addition, no changes were observed in serum biochemistry that could be attributed to the administration of HBV263M-LNP-086 (Table VIII). Overall, the HBV263 siNA encapsulated in LNP-086 is well tolerated at the dose level that is used to show a significant reduction in viral titers in the HBV model in mice. In this study, we describe the use of a novel lipid formulation for the administration of siNA, demonstrating a significant improvement in the administration of siNA to the liver, which causes greater potency and duration of reductions in HBV valuations in a model in mice with HBV infection. An excellent correlation was observed between the pharmacokinetic characteristics of the siNA formulated in LNP, and the potency and duration of siNA activity in vivo. Three doses at 3 mg / kg / day of HBV263M-LNP-086 reduced serum HBV DNA from 2.5 to 3.0 log 10 compared to control siNA. Treatment with HBV263M-LNP-086 produced a significant duration of activity against HBV with a reduction of 2.0 loglO of serum HBV DNA that was observed on day 7 and a reduction of 1.3 loglO on day 14. This study also shows that the use of chemically modified siRNA encapsulated in the LNP formulation abrogates the induction of siRNA-mediated cytokines in vivo. Taken together, the favorable pharmacokinetic and potency profile of siRNA HBV263M-LNP-086 have created an antiviral compound with potential therapeutic relevance. This formulation effectively administers siRNA to the liver, and can be used for the inactivation of liver targets associated with endogenous diseases.

EXAMPLE 14 Indications Particular conditions and disease states that may be associated with the modulation of gene expression include, but are not limited to, diseases, conditions, or disorders of cancer, proliferative, inflammatory, autoimmune, neurological, ocular, respiratory, metabolic, dermatological, auditory, or hepatic. , renal, infectious, etc. as described herein or known by other means in the art, and any other diseases, conditions or disorders that are related or that respond to the levels of a target (e.g., target protein or target polynucleotide) in a cell or tissue, alone or combined with other therapies.

EXAMPLE 15 Multifunctional siNA inhibition of target RNA expression Multifunctional siNA design Once the target sites for multifunctional siNA constructions have been identified, each strand of the siNA is designed with a complementary region of length, for example, from about 18 to about 28 nucleotides, which is complementary to a different target nucleic acid sequence. Each complementary region is designed with an adjacent flanking region of about 4 to about 22 nucleotides which is not complementary to the target sequence, but which comprises complementarity with the complementary region of the other sequence (see for example Figures 13A and 13B). The fork constructions can be designed in the same way (see for example Figures 14A and 14B). The identification of complementary, palindromic or repeated sequences shared between the different target nucleic acid sequences can be used to shorten the overall length of the multifunctional siNA constructs (see for example Figures 15A-15B and 16A-16B).

In a non-limiting example, three additional categories of multifunctional siNA designs are presented that allow a single siNA molecule to silence multiple targets. The first procedure uses linkers to join a siNA (or a multifunctional siNA) directly. This can allow joining the most potent siNAs without creating a long and continuous stretch of RNA that has the potential to trigger an interferon response. The second method is a dendrimer extension of the multifunctional superimposed or linked design; or alternatively the organization of siNA in a supramolecular format. The third procedure uses helix lengths greater than 30 base pairs. The processing of these siNA by Dicer will reveal new 5 'non-coding active ends. Therefore, long siNAs can be directed against sites that are defined by the original 5 'ends and those defined by the new ends that are created by Dicer. When used in combination with traditional multifunctional siNAs (where the coding and non-coding strands each define a target) the strategy can be used, for example, to target 4 or more sites. /. anchored bifunctional siNA The basic idea is a novel strategy for the design of multifunctional siNA in which two non-coding siNA strands hybridize to a single coding strand. The oligonucleotide of the coding strand contains a linker (eg, a non-nucleotide linker as described herein) and two segments that hybridize to the siNA non-coding strands (see Figure 22). Linkers may optionally also comprise linkers with a nucleotide base. Various advantages and potential variations to this strategy include, but are not limited to: 1.- The two non-coding siNAs are independent. Therefore, the choice of target sites is not constrained by a need to preserve the sequence between two sites. Any two very active siNAs can combine to form a multifunctional siNA. 2 - When combined with target sites having homology, siNA directed against a sequence present in two genes (eg, different isoforms), sequence can be used to direct it to more than two sites. For example, a single multifunctional siNA can be used to target RNA from two different target RNAs. 3. Multifunctional siNAs that use both coding and non-coding strands to target a gene can also be incorporated into an anchored multifuctional design. This leaves open the possibility of addressing against 6 or more sites with a single complex. A.- It may be possible to hybridize more than two non-coding strands of siNA to a single anchored coding strand. 5.- The design avoids long continuous stretches of dsRNA. Therefore, it is less likely to initiate an interferon response. 6. - The linker (or modifications bound thereto, such as conjugates described herein) can improve the pharmacokinetic properties of the complex or improve its incorporation into liposomes. The modifications introduced in the linker should not have the same degree of impact on siNA activity as it would if it were directly linked to the siNA (see for example Figures 27 and 28). 7 '.- The coding strand can be extended beyond the hybridized non-coding strands by providing additional sites for the conjugate binding. 8. The polarity of the complex can be changed in such a way that both 3 'non-coding ends are adjacent to the linker and the 5' ends are distal to the linker or a combination thereof. siNA dendrimers and supramolecules In the dendrimer siNA strategy, the synthesis of siNA is first initiated by synthesizing the dendrimer template followed by binding of the various functional siNAs. In Figure 20 various constructions are represented. The number of functional siNA that can be bound is limited only by the dimensions of the dendrimer that is used.

Supramolecular strategy for multifunctional siNA The supramolecular format simplifies the challenges of dendrimer synthesis. In this format, the siNA strands are synthesized by standard RNA reactions, followed by hybridization of various complementary strands. The synthesis of individual strands contains a non-coding sequence coding for a siNA at the 5 'end followed by a synthetic or nucleic acid linker, such as hexaethylene glycol, which in turn is followed by the coding strand of another siNA in a direction of 5 'to 3'.

Thus, the synthesis of siNA strands can be performed in a standard 3 'to 5' direction. Representative examples of trifunctional and tetrafunctional siNA are depicted in Figure 21. Based on a similar principle, siNA constructs with more functions can be designed as long as efficient hybridization of the various strands is achieved. multifunctional siNA enabled by Dicer Using bioinformatic analysis of multiple targets, stretches of identical sequences shared between different target sequences ranging from about two to about fourteen nucleotides in length can be identified. These identical regions can be designed in the form of larger siNA helices (eg,> 30 base pairs) such that processing by Dicer reveals a non-coding secondary functional site 5 '(see for example Figure 22). For example, when the first 17 nucleotides of a non-coding strand of siNA (for example, strands of 21 nucleotides in a double-stranded molecule with 3'-TT draperies) are complementary to a target RNA, potent silencing at 25 nM was observed. With a complementarity of only 16 nucleotides, 80% silencing was observed in the same format. Incorporation of this property into siNA designs of about 30 to 40 or more base pairs produces additional multifunctional siNA constructs. The example of Figure 22 illustrates how a double-stranded 30-base pair molecule can be targeted to three different sequences after processing by Dicer-RNasalll; these sequences may be in the same mRNA or in different RNAs, such as viral and host factor messages, or multiple points in a given pathway (e.g., inflammatory cascades). In addition, a 40-base pair double-stranded molecule can be combined with a bifunctional tandem design, providing a single double-stranded molecule directed against four target sequences. An even more extensive strategy may include the use of homologous sequences to allow a multifunctional double-stranded molecule to silence five or six targets. The example in Figure 22 demonstrates how this can be achieved. A double-stranded molecule of 30 base pairs is cleaved by Dicer in 22 and 8 base pair products from each end (the 8 bp fragments are not shown). For an easier presentation the draperies that are generated by Dicer are not displayed - but can be compensated. Three directed sequences are shown. The identity of the superimposed required sequence is indicated by gray boxes. The N s of the parental siNA of 30 bp are the suggested sites for 2'-OH positions to allow excision by Dicer if analyzed in stabilized structures. Note that the processing of a double-stranded molecule 30mera by Dicer RNase III does not provide a precise 22 + 8 cleavage, but instead produces a series of closely related products (22 + 8 being the main site). Therefore, processing through Dicer will provide a series of active siNAs. Another non-limiting example is shown in Figure 23. A double-stranded molecule of 40 base pairs is cleaved by Dicer in products of 22 base pairs from each end. For an easier presentation the draperies that are generated by Dicer are not displayed - but can be compensated. The four direction sequences are shown in four colors, blue, light blue and red and orange. The identity of the superimposed required sequence is indicated by gray boxes. The design format can be extended to larger RNAs. If the chemically stabilized siNA binds to Dicer, then strategically located ribonucleotide bonds can allow the design of cleavage products that allow for a more extensive repertoire of multifunctional designs. For example, cleavage products that are not limited to the Dicer pattern of about 22 nucleotides can allow multifunctional siNA constructs with a match in identity between target sequences ranging in the range, for example, from about 3 to about 15 nucleotides.

EXAMPLE 14 Diagnostic Uses The siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, e.g., in clinical, industrial, environmental, agricultural and / or or research. Such diagnostic use of siNA molecules involves the use of reconstituted RNAi systems, for example, using partially purified cell lysates or cell lysates. The siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations in diseased cells or to detect the presence of endogenous or exogenous RNA, for example viral in a cell. The close relationship between the siNA activity and the structure of the target RNA makes it possible to detect mutations in any region of the molecule, which alters the formation of base pairs and the three-dimensional structure of the target RNA. By using multiple siNA molecules that are described in this invention, the nucleotide changes, which are important for the structure and function of RNA in vitro, as well as in cells and tissues, can be mapped. The cleavage of target RNA with siNA molecules can be used to inhibit gene expression and define the role of the specified gene products in the progression of the disease or infection. In this way, other genetic targets can be defined as important mediators of the disease. These experiments will produce a better treatment of disease progression by conferring the possibility of combination therapies (eg, multiple siNA molecules directed against different genes, siNA molecules coupled to known short molecular inhibitors or intermittent treatment with combinations of siNA molecules and / or other chemical or biological molecules). Other in vitro uses of the siNA molecules of this invention are well known in the art, and include detection of the presence of mRNAs associated with a disease, infection, or related condition. Said RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET). In a specific example, the siNA molecules that cleave only wild or mutant forms of the target RNA are used for the assay. The first siNA molecules (ie, those that cleave only the wild-type forms of target RNA) are used to identify the wild-type RNA present in the sample and the second siNA molecules (ie, those that cleave only the mutant forms of target RNA) are used to identify mutant RNA in the sample. As controls for the reaction, the synthetic substrates of both the wild-type and mutant RNA are excised by both siNA molecules to demonstrate the relative efficiencies of siNA in the reactions and the absence of cleavage of the RNA species "that are not objective" . The cleavage products of the synthetic substrates can also serve to generate size markers for the analysis of the wild-type and mutant RNAs in the sample population. Thus, each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined in six reactions. The presence of cleavage products is determined using a RNase protection assay so that the full-length and cleavage fragments of each RNA can be analyzed in a lane of polyacrylamide gel. It is not absolutely necessary to quantify the results to understand the expression of mutant RNAs and the putative risk of the desired phenotypic changes in the target cells. The expression of mRNA whose protein product is involved in the development of the phenotype (ie, related to disease or infection) is adequate to establish the risk. If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels is adequate and decreases the cost of the initial diagnosis. The higher proportions between mutant and wild type correlate with an increased risk regardless of whether the RNA levels are compared qualitatively or quantitatively. All patents and publications mentioned in the specification are indicative of the levels of experience of those skilled in the art to which the invention pertains. All references cited in this description are incorporated by reference with the same effectiveness as if each reference had been incorporated by reference in its entirety individually. A person skilled in the art would readily appreciate that the present invention is well adapted to accomplish the objectives and obtain the purposes and advantages mentioned, as well as those inherent therein. The methods and compositions described herein as currently representative of the preferred embodiments are exemplary and are not intended to be limitations on the scope of the invention. Changes therein and other uses that will occur to those skilled in the art, which are included in the spirit of the invention, are defined by the scope of the claims. It will be readily apparent to a person skilled in the art that substitutions and modifications other than the invention described herein can be made without departing from the scope and spirit of the invention. Thus, said additional embodiments are within the scope of the present invention and the following claims. The present invention teaches a person skilled in the art to analyze various combinations and / or substitutions of chemical modifications described herein to generate constructs with improved activity to mediate RNAi activity. Said improved activity may comprise better stability, better bioavailability, and / or better activation of cellular responses that mediate RNAi. Therefore, the specific embodiments described herein are not limiting and a person skilled in the art can readily appreciate which specific combinations of the modifications described herein can be analyzed without undue experimentation to identify the molecules of siNA with enhanced RNAi activity. The invention described illustratively herein may be practiced in an appropriate manner in the absence of any element or elements, limitation or limitations that are not specifically described herein. Thus, for example, in each case of the present document any of the terms "comprising", "constituted essentially by", and "constituted by" can be substituted by any of the other two terms. The terms and expressions that have been used are used as descriptive and non-limiting terms, and there is no intention in the use of such terms and expressions to exclude any equivalents of the features that are shown and that are described or portions thereof, but it is recognized that various modifications are possible within the scope of the claimed invention. Thus, it should be understood that although the present invention has been specifically described by preferred embodiments, those skilled in the art may resort to optional features, modification and variation of the concepts described herein, and that such modifications and variations it is considered that they are within the scope of this invention as defined by the description and appended claims. In addition, when describing features or aspects of the invention in terms of Markush groups or other groupings of alternatives, those skilled in the art will recognize that the invention is also described by means of them in terms of any individual member or subgroup of members of the Markush group. or another group.

TABLE I Non-limiting examples of stabilization groups for chemically modified siNA constructs Cap = any terminal cap, see for example Figure 10. All Stab groups 00-34 may comprise thymine residues at the 3 'end (TT) All Stab groups 00-34 usually comprise approximately 21 nucleotides, but may vary as described in this document. All groups 00-36 may also include a single ribonucleotide in the coding or non-coding strand of the base pair position 11a of the double-stranded nucleic acid molecule determined from the 5 'end of the non-coding or guiding strand ( see Figure 5C) C = coding strand NC = non-coding strand La * Estab 23 has a single adjacent ribonucleotide at the 3 'end La * Estab 24 and La Estab 28 have a single ribonucleotide at the 5' end La * Estab 25, Stab 26, Stab 27, Stab 35 and Stab 36 have three ribonucleotides at the 5 'end At * Stab 29, Stab 30, Stab 31, Stab 33, and Stab 34 any purine from the first three nucleotide positions from the end 5 'are ribonucleotides p = phosphorothioate linkage tStab 35 has 2'-O-methyl U in the 3' overlays and three ribonucleotides in the 5 'end tStab 36 has 2'-O-methyl overlays that are complementary to the sequence objective (natural hangings les) and three ribonucleotides at the 5 'end. Stabilization chemistries 1-10 show non-limiting examples of different stabilization structures (1-10) which can be used, for example, to stabilize the 3' end of the siNA sequences of the invention, which includes n (1) [3-3 '] - inverted deoxyribose; (2) deoxyribonucleotide; (3) [5'-3 '] - 3'-deoxyribonucleotide; (4) [5'-3 '] - ribonucleotide; (5) [5'-3 '] - 3'-O-methyl ribonucleotide; (6) 3'-glyceryl; (7) [3'-5 '] - 3'-deoxyribonucleotide; (8) [3'-3 ') - deoxyribonucleotide; (9) [5'-2'j-deoxyribonucleotide; and (10) [5-3 '] - dideoxyribonucleotide. In addition to the modified and unmodified backbone structures indicated in the figure, these structures can be combined with different modifications in the backbone as described herein, for example, modifications in the backbone having the Formula I. In addition , the 2'-deoxy nucleotide shown at position 5 'to the terminal modifications shown may be another modified or unmodified nucleotide or non-nucleotide described herein, for example modifications having any of the Formulas l-VII or any combination thereof.

CHEMICALS OF STABILIZATION 1-10 7 8 R = O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl or aralkyl. B = Independently any nucleotide base, either naturally or chemically modified, or optionally H (abásico).

PICTURE do not n O 3 O id o »O o £ o - PICTURE A. Synthesis of Cycler ABl 394 2.5 μmol B. Synthesis of 0.2 μmol Cycler ABl 394 C. Synthesis of Cycler 0.2 μmol in 96 wells • The waiting time does not include contact time during the application. • Tandem synthesis uses the double coupling of the linker molecule TABLE IV Lipid nanoparticle formulations (LNP) Proportion of N / P = ratio between nitrogen and phosphorus between the cathic lipid and the nucleic acid Structure of CLinDMA Structure of pCLinDMA Structure of eCLinDMA Structure of PEG-n-DMG Structure of DMOBA Structure of DMOBA DOBA structure DSPC Cholesterol 2KPEG-Cholesterol 2KPEG-DMG TABLE V Sirna Algorithm that describes the patterns with their relative scores to predict hyperactive siNA.

All the positions provided are for the coding strand of siNA 19mer.

TABLE VI Immunostimulation in CD-1 mice treated with a single injection of 3 mg / kg of siRNA formulated in LNP BLOD - Low detection limit Ol 3BLOQ - Under the limit of quantification The levels of IL-6 and TNF-a were measured at 2.5 hours after injection, while levels of IFN-α were measured. and IFN- were measured at 8 hours after treatment. The values are shown in terms of the mean ± standard deviation, n = 5 TABLE VH Body and organ weights 1 and 14 days after administration of 3 mg / kg HBV263-LNP-086 or PBS in mice I HEARD N > Five animals were sacrificed for each administration group for each time. Body weight was obtained just before euthanasia. The values are shown in terms of the mean ± standard deviation.

TABLE VIII Analytical values in serum 1 and 14 days after administration of 3 mg / kg of HBV263-LNP-086 or PBS in mice CO The values are shown in terms of the mean ± standard deviation, n = 5

Claims (1)

1. NOVELTY OF THE INVENTION CLAIMS 1. - A double-stranded nucleic acid molecule having the SIX structure comprising a coding strand and a non-coding strand: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 'SIX wherein the upper strand is the coding strand and the lower strand is the non-coding strand of the double-stranded nucleic acid molecule; said non-coding strand comprises the sequence complementary to an objective RNA; each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is approximately 17-36; X5 is an integer from about 1 to about 6; and (a) any pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand other than the purine nucleotides at the [N] positions of the nucleotides are independently 2'-O-methyl, 2'-deoxyribonucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand are independently 2'-deoxyribonucleotides, 2'-O-methyl nucleotides or a combination of 2'-deoxyribonucleotides and 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally nucleotides of 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. 2. A double-stranded nucleic acid molecule having the SX structure comprising a coding strand and a non-coding strand: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -51 SX in which the upper strand is the coding strand and the lower strand is the non-coding strand of the double-stranded nucleic acid molecule; said non-coding strand comprises the sequence complementary to an objective RNA; each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is approximately 17-36; X5 is an integer from about 1 to about 6; and (a) any pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand are ribonucleotides; any purine nucleotides present in the coding strand are ribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. 3. A double-stranded nucleic acid molecule having the structure SXI comprising a coding strand and a non-coding strand: B NX3 (N) X2 B -3- B (N) X1 NX4 [N] X5 -5 'SXI in which the upper strand is the coding strand and the lower strand is the non-coding strand of the double-stranded nucleic acid molecule; said non-coding strand comprises the sequence complementary to an objective RNA; each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is approximately 17-36; X5 is an integer from about 1 to about 6; and (a) any pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand are ribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. 4. - A double-stranded nucleic acid molecule having the structure SXII comprising a coding strand and a strand not c B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 ' SXII in which the upper strand is the coding strand and the lower strand is the non-coding strand of the double-stranded nucleic acid molecule; said non-coding strand comprises the sequence complementary to an objective RNA; each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents positions of nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is approximately 17-36; X5 is an integer from about 1 to about 6; and (a) any pyrimidine nucleotides present in the non-coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the non-coding strand other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand are 2'-deoxy-2'-fluoro nucleotides; any purine nucleotides present in the coding strand are deoxyribonucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. 5. A double-stranded nucleic acid molecule having the structure SXIII comprising a coding strand and a non-coding strand: B NX3 (N) X2 B -3 ' B (N) X1 NX4 [N] X5 -5 ' SXIII in which the upper strand is the coding strand and the lower strand is the non-coding strand of the double-stranded nucleic acid molecule; said non-coding strand comprises the sequence complementary to an objective RNA; each N is independently a nucleotide; each B is a terminal cap moiety that may be present or absent; (N) represents nucleotides without paired or hanging bases which may be unmodified or chemically modified; [N] represents nucleotides that are ribonucleotides; X1 and X2 are independently integers from about 0 to about 4; X3 is an integer from about 9 to about 30; X4 is an integer from about 11 to about 30, with the proviso that the sum of X4 and X5 is approximately 17-36; X5 is an integer from about 1 to about 6; and (a) any pyrimidine nucleotides present in the non-coding strand are nucleotides having a ribo, Northern or helix-like configuration in A form; any purine nucleotides present in the non-coding strand other than the purine nucleotides at the [N] positions of the nucleotides are 2'-O-methyl nucleotides; (b) any pyrimidine nucleotides present in the coding strand are nucleotides having a ribo, Northern or helix-like configuration in A form; any purine nucleotides present in the coding strand are 2'-O-methyl nucleotides; and (c) any nucleotides (N) are optionally 2'-O-methyl, 2'-deoxy-2'-fluoro nucleotides, or deoxyribonucleotides. 6. The double-stranded nucleic acid molecule according to claim 1, further characterized in that X5 = 1, 2 or 3; each X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. 1. The double-stranded nucleic acid molecule according to claim 2, further characterized in that X5 = 1, 2 or 3; each X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. 8. The double-stranded nucleic acid molecule according to claim 3, further characterized in that X5 = 1, 2 or 3; each X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. 9. The double-stranded nucleic acid molecule according to claim 4, further characterized in that X5 = 1, 2 or 3; every X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. 10. The double-stranded nucleic acid molecule according to claim 5, further characterized in that X5 = 1, 2 or 3; every X1 and X2 = 1 or 2; X3 = 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and X4 = 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. 11. The double-stranded nucleic acid molecule according to claim 1, further characterized in that B is present at the 3 'and 5' ends of the coding strand and at the 3"end of the non-coding strand. double-stranded nucleic acid molecule according to claim 2, further characterized in that B is present at the 3 'and 5' ends of the coding strand and at the 3 'end of the non-coding strand 13.- The double-stranded molecule of acid nucleic acid according to claim 3, further characterized in that B is present at the 3 'and 5' ends of the coding strand and at the 3 'end of the non-coding strand 14.- The double-stranded nucleic acid molecule according to claim 4, further characterized in that B is present at the 3 'and 5' ends of the coding strand and at the 3 'end of the non-coding strand 15.- The double-stranded nucleic acid molecule according to claim 5, further characterized in that B is present at the 3 'and 5' ends of the coding strand and at the 3 'end of the non-coding strand. 16. The double-stranded nucleic acid molecule according to claim 1, further characterized in that it comprises one or more internucleotide phosphothioate bonds in the first (N) terminal of the end 3 'of the coding strand, of the non-coding strand, or both of the coding strand and of the non-coding strand of the siNA molecule. 17. The double-stranded nucleic acid molecule according to claim 2, further characterized in that it comprises one or more internucleotide phosphothioate bonds in the first (N) terminal of the end 3 'of the coding strand, of the non-coding strand, or both of the coding strand and of the non-coding strand of the siNA molecule. 18. The double-stranded nucleic acid molecule according to claim 3, further characterized in that it comprises one or more internucleotide bonds of phosphothioate in the first (N) terminal of the 3 'end of the coding strand, of the non-coding strand, or both of the coding strand and of the non-coding strand of the siNA molecule. 19. The double-stranded nucleic acid molecule according to claim 4, further characterized in that it comprises one or more internucleotide phosphothioate bonds in the first (N) terminal of the end 3 'of the coding strand, of the non-coding strand, or both of the coding strand and of the non-coding strand of the siNA molecule. 20.- The double-stranded nucleic acid molecule according to claim 5, further characterized in that it comprises one or more internucleotide phosphothioate bonds in the first (N) terminal of the end 3 'of the coding strand, of the non-coding strand, or both of the coding strand and of the non-coding strand of the siNA molecule. 21. The double-stranded nucleic acid molecule according to any of the preceding claims, further characterized in that the target RNA is hepatitis B virus (HBV) RNA. 22. A composition comprising the double-stranded nucleic acid molecule of claim 1 in a pharmaceutically acceptable carrier or diluent. SUMMARY OF THE INVENTION The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases, and conditions that respond to the modulation of gene expression and / or activity.; The present invention also relates to compounds, compositions, and methods related to traits, diseases and conditions that respond to the modulation of the expression and / or activity of genes involved in the routes of gene expression or other cellular processes acting as mediators. of the maintenance or development of said traits, diseases and conditions; specifically, the invention relates to double-stranded nucleic acid molecules that include short nucleic acid molecules, such as short interfering nucleic acid (siNA) molecules, short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro -RNA (miRNA), and short hairpin RNA (shRNA) with the capacity to act as mediators of RNA interference (RNAi) against gene expression, including cocktails of said short nucleic acid molecules and lipid nanoparticle formulations (LNP) ) of said short nucleic acid molecules; The present invention also relates to short nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous microRNA (miRNA) (e.g., miRNA inhibitors) or short RNA of endogenous interference (siRNA), (eg, siRNA inhibitors) or that can inhibit the function of RISC (eg, inhibitors of RISC), to modulate gene expression by interfering with the regulatory function of said endogenous RNA or protein associated with said endogenous RNAs (e.g., RISC), including cocktails of said short nucleic acid molecules and lipid nanoparticle (LNP) formulations of said short nucleic acid molecules; said short nucleic acid molecules are useful, for example, to provide compositions for preventing, inhibiting, or reducing diseases, traits, and conditions that are associated with gene expression or activity in a subject or organism. 6A P08 / 165F