KR20230025984A - Development of HRM markers and use thereof for discrimination of high-temperature tolerant Pyogo mushroom cultivar - Google Patents

Abstract

The present invention relates to a CAPS marker composition for identifying Lentinula edodes varieties with high temperature resistance and uses thereof, and specifically, to a method for quickly identifying varieties with high temperature resistance such as Sanmaru 1 and Sanmaru 2, and varieties without high temperature resistance such as Sanjo 501, Sanjo 502, and Gyunheung 135 by using CAPS markers derived from high temperature resistant varieties-specific SNPs selected through genome reanalysis technology.

Description

CAPS marker composition and use thereof for discrimination of high-temperature tolerant Pyogo mushroom cultivar}

The present invention relates to a CAPS marker composition for identifying shiitake mushroom varieties having high temperature resistance characteristics and its use.

The present invention relates to CAPS markers for identifying shiitake varieties with high temperature tolerance and their use, and relates to varieties with high temperature resistance, such as Sanmaru 1 and Sanmaru 2, and varieties without high temperature resistance, such as Sanjo 501 and Sanjo. It relates to a method for quickly discriminating No. 502 and No. 135 Kyunheung using CAPS markers derived from high-temperature tolerant varieties-specific SNPs selected through genome reanalysis technology.

Shiitake ( Lentinula edodes ) is a white decaying fungus that occurs in dead trees of broad-leaved trees, and is well known for its rich nutrition and pharmacological efficacy, and is a valuable mushroom that can also be used for effective bio-conversion of agricultural waste. Currently, it is the most produced in the world and accounts for about 98% of domestic forest mushroom production in 2019, with a production value of about 201.8 billion won, so its economic value is also high.

Shiitake is a typical basidiomycete with developmental stages of mononucleated mycelium, dinuclear mycelium, vigor, and fruiting body. Significant changes are observed during the development of mononuclear hyphae into dinucleated hyphae, formation of primordia, and maturation into fruiting bodies. In this process, cell and tissue differentiation occurs and loose undifferentiated hyphae change into dense multi-hyphae structures.

Temperature is an environmental factor that has a decisive effect on the growth and development, yield and quality of shiitake mushrooms. Shiitake mushroom mycelia show optimal growth at 24-27 ℃ temperature conditions and die at temperatures above 38 ℃. Although shiitake mushrooms are known to form fruiting bodies at medium and low temperatures, summer temperatures in major shiitake mushroom production areas far exceed 25 ℃. High temperatures in summer reduce the viability of shiitake mushroom hyphae, which leads to yield and quality deterioration when logs or sawdust media are infected with other pathogens and rotten parts occur.

High temperatures can increase fluidity and decrease permeability by altering the function of the plasma membrane structure by destroying the integrity of the cell wall and damaging the cell membrane. It has been reported that para-aminobenzoic acid (PABA) synthase and nitric oxide reduce oxidative damage induced by high-temperature stress by reducing reactive oxygen species (ROS), and catalase, trehalose, and heat shock protein (HSP) in edible fungi. ), and calcium-calmodulin is known to play an important role in regulating the response to high-temperature stress.

Single nucleotide polymorphism (SNP) is a variation of a single nucleotide sequence that is highly abundant throughout the genome. With the development of next generation sequencing technology, it has become possible to discover a large amount of SNPs in a short period of time, and SNPs are widely used as molecular markers due to their low analysis cost compared to other markers. One of the traditional SNP genotyping methods, cleaved amplified polymorphic sequence (CAPS), detects a restriction enzyme recognition site generated or removed due to DNA sequence mutation and uses it as a marker. It is based on electrophoresis. Differences between varieties can be distinguished according to the presence or absence of restriction enzyme digestion of PCR amplification products, and the analysis process is simple, and the results are stable and clear.

In general, shiitake mushroom varieties are divided into three types: low-temperature, medium-temperature, and high-temperature, depending on the time of mushroom generation. Sanjo 501 and Sanjo 502 developed by the Forestry Mushroom Research Center of the National Forestry Cooperative Federation, and Gyunheung 135, a Japanese cultivar, is known as a low-temperature cultivar. The main temperatures of fruiting bodies of Sanjo 501, Sanjo 502, and Gyunheung 135 are 7~18℃, 8~20℃, and 7~15℃, respectively.

The present inventors analyzed the genome sequences of high-temperature tolerant shiitake mushroom varieties Sanmaru 1 and Sanmaru 2, and Sanjo 501, Sanjo 502, and Gyunheung 135, which do not have high temperature tolerance, to discover high-temperature tolerance specific SNPs and CAPS using them markers were developed. The present invention was completed by confirming that the high-temperature resistant shiitake mushroom varieties could be effectively distinguished by amplifying the marker sequences in the above 5 strains using each primer pair and then treating them with restriction enzymes.

KR 10-2019-0008461

The present invention relates to a CAPS marker and its use for identifying shiitake mushroom varieties with high temperature tolerance characteristics, and to provide a kit capable of quickly and accurately discriminating shiitake mushroom varieties with high temperature tolerance characteristics. The PCR product of the shiitake mushroom variety having high temperature resistance using a primer that specifically binds to the shiitake mushroom nucleotide sequence of the present invention is characterized by being distinguished from other shiitake mushroom varieties by restriction enzyme treatment.

The present invention is a single nucleotide polymorphism site at the 148th nucleotide position of SEQ ID NO: 1; a single nucleotide polymorphism site at nucleotide position 232 of SEQ ID NO: 4; a single nucleotide polymorphism site at nucleotide position 215 of SEQ ID NO: 7; a single nucleotide polymorphism site at the 142nd nucleotide position of SEQ ID NO: 10; a single nucleotide polymorphism site at nucleotide positions 133 and 182 of SEQ ID NO: 13; a single nucleotide polymorphism site at nucleotide position 183 of SEQ ID NO: 16; a single nucleotide polymorphism site at 78th nucleotide position, 93rd nucleotide position and 94th nucleotide position of SEQ ID NO: 19; Or a single nucleotide polymorphism site at the 55th nucleotide position of SEQ ID NO: 22; provides a biomarker composition for identifying high-temperature resistant shiitake varieties, including an agent capable of detecting.

In one embodiment of the present invention, the "agent capable of detecting a single nucleotide polymorphism (SNP) marker" is a primer set that specifically binds to a polynucleotide sequence containing a single nucleotide polymorphism (SNP) marker. to, but is not limited thereto.

In one embodiment of the present invention, the "primer set" is a primer set of SEQ ID NO: 2 and SEQ ID NO: 3; Primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Primer sets of SEQ ID NO: 8 and SEQ ID NO: 9; Primer sets of SEQ ID NO: 11 and SEQ ID NO: 12; Primer sets of SEQ ID NO: 14 and SEQ ID NO: 15; Primer sets of SEQ ID NO: 17 and SEQ ID NO: 18; Primer sets of SEQ ID NO: 20 and SEQ ID NO: 21; Or a primer set of SEQ ID NO: 23 and SEQ ID NO: 24, but is not limited thereto.

In addition, the present invention provides a kit for determining high-temperature resistant shiitake mushroom varieties comprising the composition.

In one embodiment of the present invention, the “kit” further includes reagents and restriction enzymes for performing an amplification reaction, but is not limited thereto.

In one embodiment of the present invention, the “restriction enzyme” is characterized in that it is selected from the group consisting of Hpa II, ScrF I, Alu I, Bgl II, Nla III and Hae III, but is not limited thereto.

In addition, the present invention provides (a) separating nucleic acid molecules from a specimen sample, and

(b) identifying a single nucleotide polymorphism (SNP) marker at position 148 of SEQ ID NO: 1 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 232 of SEQ ID NO: 4 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 215 of SEQ ID NO: 7 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 142 of SEQ ID NO: 10 from the isolated nucleic acid molecule; identifying single nucleotide polymorphism (SNP) markers at positions 133 and 182 of SEQ ID NO: 13 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 183 of SEQ ID NO: 16 from the isolated nucleic acid molecule; identifying single nucleotide polymorphism (SNP) markers at positions 78, 93, and 94 of SEQ ID NO: 19 from the isolated nucleic acid molecule; or identifying a single nucleotide polymorphism (SNP) marker at position 55 of SEQ ID NO: 22 from the isolated nucleic acid molecule; It provides a high temperature resistant shiitake mushroom variety discrimination method comprising a.

In one embodiment of the present invention, the "step (b)" is PCR using the isolated nucleic acid molecule as a template and a primer set that specifically binds to a polynucleotide sequence containing a single nucleotide polymorphism (SNP) marker. After amplifying the target sequence by performing, it is characterized in that it is made through a process of detecting the result by treating the amplification product with a restriction enzyme, but is not limited thereto.

In one embodiment of the present invention, the "primer set" is a primer set of SEQ ID NO: 2 and 3; Primer sets of SEQ ID NOs: 5 and 6; Primer sets of SEQ ID NOs: 8 and 9; Primer sets of SEQ ID NOs: 11 and 12; Primer sets of SEQ ID NOs: 14 and 15; Primer sets of SEQ ID NOs: 17 and 18; Primer sets of SEQ ID NOs: 20 and 21; Or a primer set of SEQ ID NOs: 23 and 24, but is not limited thereto.

In one embodiment of the present invention, the “restriction enzyme” is characterized in that it is selected from the group consisting of Hpa II, ScrF I, Alu I, Bgl II, Nla III and Hae III, but is not limited thereto.

In one embodiment of the present invention, the "size of the result" is 5 bp, 89 bp and 145 bp; 304 bp; 112 bp and 214 bp; 329 bp; 179 bp and 216 bp; 36 bp and 156 bp; Or 53 bp, 54 bp and 252 bp are characterized in that they are identified as high-temperature resistant shiitake mushrooms, but are not limited thereto.

The present invention is to provide a kit composition capable of discriminating shiitake mushroom varieties having high temperature resistance characteristics. It is characterized in that shiitake mushroom varieties with high temperature resistance and varieties without resistance can be selected using primers and restriction enzymes that specifically bind to shiitake mushroom nucleotide sequences.

1 is a diagram showing the results of electrophoresis after treating amplification products obtained from five types of shiitake mushrooms with restriction enzymes.

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following implementation examples are presented as examples of the present invention, and if it is determined that a detailed description of a well-known technology or configuration may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the description of the claims described later and equivalent scopes interpreted therefrom.

In addition, the terminology used in this specification is a term used to appropriately express a preferred embodiment of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the contents throughout this specification. Throughout the specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.

In one aspect, the present invention provides a single nucleotide polymorphism site at the 148th nucleotide position of SEQ ID NO: 1; a single nucleotide polymorphism site at nucleotide position 232 of SEQ ID NO: 4; a single nucleotide polymorphism site at nucleotide position 215 of SEQ ID NO: 7; a single nucleotide polymorphism site at the 142nd nucleotide position of SEQ ID NO: 10; a single nucleotide polymorphism site at nucleotide positions 133 and 182 of SEQ ID NO: 13; a single nucleotide polymorphism site at nucleotide position 183 of SEQ ID NO: 16; a single nucleotide polymorphism site at 78th nucleotide position, 93rd nucleotide position and 94th nucleotide position of SEQ ID NO: 19; Or, it relates to a biomarker composition for identifying high-temperature resistant shiitake mushroom varieties, including an agent capable of detecting a single nucleotide polymorphism at the 55th nucleotide position of SEQ ID NO: 22.

In one embodiment of the present invention, the agent capable of detecting the single nucleotide polymorphism (SNP) marker is a primer set that specifically binds to a polynucleotide sequence containing the single nucleotide polymorphism (SNP) marker. .

In one embodiment of the present invention, the primer set is a primer set of SEQ ID NO: 2 and SEQ ID NO: 3; Primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Primer sets of SEQ ID NO: 8 and SEQ ID NO: 9; Primer sets of SEQ ID NO: 11 and SEQ ID NO: 12; Primer sets of SEQ ID NO: 14 and SEQ ID NO: 15; Primer sets of SEQ ID NO: 17 and SEQ ID NO: 18; Primer sets of SEQ ID NO: 20 and SEQ ID NO: 21; or a primer set of SEQ ID NO: 23 and SEQ ID NO: 24.

As used herein, the term “single nucleotide polymorphism (SNP)” is a genetic disorder that occurs when a single nucleotide (A, T, C, or G) in the genome differs between members of a species or between paired chromosomes of an individual. Diversity of DNA sequences. A single base may be changed (replaced), removed (deleted), or added (inserted) to a polynucleotide sequence. SNPs can cause changes in the translational frame. A single nucleotide polymorphism can be involved in the coding sequence of a gene, in a non-coding region of a gene or in intergenic regions between genes. SNPs in the coding sequence of a gene do not necessarily cause changes in the amino acid sequence of the target protein due to degeneracy of the genetic code. SNPs that form the same polypeptide sequence are said to be synonymous (also called silent mutations), and SNPs that form different polypeptide sequences are said to be non-synonymous. Non-synonymous SNPs can be missense or nonsense, with missense changes giving rise to other amino acids while nonsense changes form immature stop codons. SNPs present in non-protein-coding regions can lead to gene silencing, transcription factor binding or non-coding RNA sequences.

As used herein, the term "agent capable of detecting a single nucleotide polymorphism (SNP) marker" refers to an agent used in a method for identifying a corresponding SNP contained in a sample, preferably RT-PCR or competitive RT. -Used in methods such as PCR (Competitive RT-PCR), Real-time RT-PCR, RPA; RNase protection assay, Northern blotting, and gene chip analysis It may be a primer, probe or antibody capable of specifically binding to a target gene.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming a base pair with a complementary template, and a starting point for copying the template strand. Refers to a short nucleic acid sequence that functions as a point. The appropriate length of the primer may vary depending on the purpose of use, but is generally composed of 15 to 30 bases. The primer sequence need not be perfectly complementary to the template, but must be sufficiently complementary to hybridize with the template. A primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to several hundreds of bases as short as possible to form a specific binding with a gene or mRNA, oligonucleotide It can be manufactured in the form of a probe, single stranded DNA probe, double stranded DNA probe, RNA probe, etc., and can be labeled for easier detection.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more homologues of a natural nucleotide, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phossotriesters, phosphoramidates, carbamates, etc.) or to charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

As the primer or probe used in the present invention, a sequence perfectly complementary to the sequence containing the SNP may be used, but a sequence substantially complementary within a range that does not interfere with specific hybridization is used. may also be used. Specifically, the probe used in the present invention includes a sequence capable of hybridizing to a sequence containing 10-30 consecutive nucleotide residues including the SNP of the present invention. More specifically, the 3'-end or 5'-end of the probe has a base complementary to the SNP base. In general, since the stability of a duplex formed by hybridization tends to be determined by the matching of the sequence at the end, in a probe having a base complementary to the SNP base at the 3'-end or 5'-end, the end If the parts do not hybridize, these duplexes can be disassembled under stringent conditions.

Suitable conditions for hybridization are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). Stringent conditions used for hybridization can be determined by controlling the presence of compounds such as temperature, ionic strength (buffer concentration) and organic solvent. These stringent conditions may be determined differently depending on the sequences to be hybridized.

As used herein, the term "complementary" means that a primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under predetermined annealing or hybridization conditions, substantially complementary and completely complementary ( It has a meaning that encompasses all things that are perfectly complementary, and specifically means that it is completely complementary. In this specification, the term "substantially complementary sequence" used in relation to a primer sequence refers not only to a completely identical sequence, but also to a sequence that is partially matched to a sequence to be compared within the range of being able to anneal to a specific sequence and act as a primer. It is meant to include sequences that are inconsistent.

In one aspect, it relates to a kit for determining high-temperature resistant shiitake mushroom varieties comprising the composition.

In one embodiment of the present invention, the kit further includes reagents and restriction enzymes for carrying out the amplification reaction.

In one embodiment of the present invention, the restriction enzyme is characterized in that it is selected from the group consisting of Hpa II, ScrF I, Alu I, Bgl II, Nla III and Hae III.

The kit for determining the high-temperature resistant shiitake mushroom varieties may be performed by a gene amplification method.

The term "amplification" described herein while describing a gene amplification kit means a reaction for amplifying a nucleic acid molecule.

A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), the method of Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR) ( 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP439,182), transcription-mediated amplification (TMA, WO 88/10315), self-maintained nucleotide sequence Self-sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR), U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence-based amplification sequence based amplification (NASBA), US Pat. Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21, 22) and loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications.

When the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents required for PCR amplification, such as buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

The primer used in the present invention is hybridized or annealed to one site of the template to form a double-stranded structure. Conditions of nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization , A Practical Approach, IRL Press, Washington, D.C. (1985).

A variety of DNA polymerases can be used for the amplification of the present invention, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase obtained from various bacterial species, which include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). include

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with components necessary for the reaction in excess. An excess of components required for the amplification reaction means an amount to the extent that the amplification reaction is not substantially limited by the concentration of the components. It is required to provide cofactors such as Mg2+, dATP, dCTP, dGTP and dTTP to the reaction mixture in such a way that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants. In the present invention, annealing is performed under stringent conditions enabling specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary depending on environmental variables.

The amplified nucleotide sequence of the marker of the present invention is treated with a restriction enzyme and the size of the product is compared to distinguish shiitake mushroom varieties. For example, the size of the marker of the present invention is investigated by subjecting the amplification reaction product described above to gel electrophoresis, and observing and analyzing a band formed as a result.

As used herein, the term "CAPS (cleaved amplified polymorphic sequence) marker" refers to a SNP located at a restriction enzyme site among single nucleotide polymorphisms (SNPs). In the case of using CAPS markers, PCR amplification with primers specific to the locus, followed by digestion with restriction enzymes, can analyze polymorphisms.

In one aspect, the present invention provides (a) isolating a nucleic acid molecule from a specimen sample, and (b) identifying a single nucleotide polymorphism (SNP) marker at position 148 of SEQ ID NO: 1 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 232 of SEQ ID NO: 4 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 215 of SEQ ID NO: 7 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 142 of SEQ ID NO: 10 from the isolated nucleic acid molecule; identifying single nucleotide polymorphism (SNP) markers at positions 133 and 182 of SEQ ID NO: 13 from the isolated nucleic acid molecule; identifying a single nucleotide polymorphism (SNP) marker at position 183 of SEQ ID NO: 16 from the isolated nucleic acid molecule; identifying single nucleotide polymorphism (SNP) markers at positions 78, 93, and 94 of SEQ ID NO: 19 from the isolated nucleic acid molecule; Or, it relates to a method for determining a high-temperature resistant shiitake mushroom variety, comprising the step of identifying a single nucleotide polymorphism (SNP) marker at position 55 of SEQ ID NO: 22 from the isolated nucleic acid molecule.

Since the method of the present invention uses the same method, primers, and/or restriction enzymes as the above kit, descriptions of common contents between the two are omitted in order to avoid excessive complexity in the present specification.

<Example 1> Confirmation of SNPs in high-temperature resistant shiitake mushrooms through sequencing

In order to select SNPs specific to high-temperature resistant shiitake mushroom varieties, genomic DNA of Sanmaru 1, Sanmaru 2, Sanjo 501, Sanjo 502, and Gyunheung 135 strains were resequencing and based on the standard genome B17 of shiitake mushroom Sequences were aligned and compared. The DNA extraction method is as follows.

Shiitake mushroom mycelium cultured in PDB medium for about 10 days was filtered through Miraclos, washed with PBS buffer (NaCl 135mM, KCl 2.7mM, Na2HPO4 4.3mM, KH2PO4 1.4mM), and dried with a kitchen towel. The dried mycelium was frozen in liquid nitrogen, ground finely in a mortar, and genomic DNA was extracted using the GeneAll® GenEx™ Plant kit. Add 500ul of PL buffer to the mycelia transferred to the tube, heat at 65 ° C for 10 minutes, and mix well using a pipette. After centrifugation at 13000 rpm for 1 minute, the supernatant is separated and transferred to a new tube. Then, PP buffer is added by 1/3 of the supernatant and mixed well using a vortexer. After standing on ice for 5 minutes, centrifuged at 13000 rpm for 5 minutes. Separate the supernatant and transfer it to a new tube, add the same amount of PCI (phenol : chloroform : isoamylalcohol = 25 : 24 : 1), and mix by inverting. After centrifugation at 13000 rpm for 10 minutes, the supernatant was separated and transferred to a new tube, and the same amount of isopropanol was added and mixed by inversion. After leaving on ice for 10 minutes, centrifuged at 13000 rpm for 1 minute. After removing the supernatant, add 1 ml of 70% ethanol to slightly float the DNA pellet and centrifuge at 13000 rpm for 1 minute. After removing the supernatant, centrifuge once more for 1 minute at 13000 rpm. After removing all remaining ethanol and drying the DNA pellet at room temperature for 5 minutes, 100ul of RE buffer was added to dissolve the DNA pellet.

Through sequence comparison, SNPs specifically present in Sanmaru 1 and Sanmaru 2 were selected (Table 1).

#CHROM POS High-temperature Effect GENE Desc Marker Sensitive Tolerant Scaffold17 188726 A G missense GENE00389 hypothetical protein BOTBODRAFT_177780 RL-LE-306 Scaffold8 297628 G A synonymous GENE03306 ataxin-10-like protein RL-LE-307 Scaffold8 320954 T C missense slc16a10 GENE03317.1 RL-LE-310 Scaffold8 321470 C T missense slc16a10 GENE03317.1 RL-LE-311 Scaffold8 330914 G A synonymous GENE03321 GENE03321.1 RL-LE-312 Scaffold8 330963 A G intron variant Scaffold8 338459 T C missense GENE03324 - RL-LE-314 Scaffold8 342161 T G missense GENE03326 rho guanine nucleotide exchange factor scd1 RL-LE-316 Scaffold8 342176 A T missense Scaffold8 342177 C T missense Scaffold8 362766 T C missense MNS3 Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 RL-LE-319

<Example 2> Shiitake mushroom nucleotide sequence and primer production

A total of 11 selected SNPs included 8 missense SNPs, 2 synonymous SNPs, and 1 SNP in an intron region. A flanking sequence was extracted centering on each SNP, and primers capable of amplifying marker sequences were created considering the positions of the SNPs. dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html) was used to identify restriction enzymes specific to the marker sequence, and based on the availability and cost of restriction enzymes to be used for CAPS marker development. Restriction enzymes were selected (Table 2).

Primer name Sequence (5'-3') Product size (bp) Restriction enzyme Digested fragment size High-temperature
sensitive High-temperature
tolerant RL-LE-306F GGTAACAGTCGTCAGGTGAAAG 239 HpaII (+) 5/234 5/89/145 RL-LE-306R CTCCGGGATCAAAGGTTACTAC RL-LE-307F GAACCTAGCTAGACTGACGCAT 304 ScrFI (-) 74/230 304 RL-LE-307R GATAGATAGTCATACGGCCCTC RL-LE-310F ATTCGACTCTCTCTCTTCCTCC 326 AluI (+) 326 112/214 RL-LE-310R CTTCTTGTCCACTCTGAGTTCC RL-LE-311F GACTAGCAACAGGTTACCTCTCC 330 AluI (-) 141/189 330 RL-LE-311R CCTATACCACGAGAGAAGAGTAGG RL-LE-312F GACAGCCTACATGGTGATGAG 329 BglII (-) 132/197 329 RL-LE-312R CTAGTGTCAAGAATGCACTCCC RL-LE-314F GGGATACTACTTCTCTCCAACG 395 BglII (+) 395 179/216 RL-LE-314R CTACCGGACGACTGAACTTCT RL-LE-316F CTACACGCCTAGCTCAGAAGTT 192 NlaIII (-) 36/61/95 36/156 RL-LE-316R CTAACAGCTCTAGGATAGGCAGAC RL-LE-319F CTAAAACCCTTACCCTGTCCC 359 HaeIII (+) 107/252 53/54/252 RL-LE-319R GAGACGGTGATAAGATACCTCG

<Example 3> Identification of shiitake mushroom varieties with high temperature tolerance using the kit

RL-LE-306 amplified from a high-temperature tolerant shiitake mushroom variety was cleaved by HpaII restriction enzyme and divided into bands of 5 bp, 89 bp, and 145 bp in size, whereas in the case of a high-temperature resistant shiitake mushroom variety, 5 bp, It was divided into bands with a size of 234 bp. In the case of RL-LE-307, when treated with the restriction enzyme ScrFI, a band of 304 bp that was not cleaved by the restriction enzyme in high temperature resistant shiitake mushroom varieties, and 74 bp and 230 bp bands in shiitake mushroom varieties without high temperature tolerance. Two bands were observed with Marker sequences RL-LE-310 and RL-LE-311 are classified by treatment with restriction enzyme AluI. In the case of RL-LE-310, two bands of 112 bp and 214 bp in high-temperature resistant shiitake mushroom varieties, high-temperature resistance Shiitake mushroom cultivars without this showed a band with a size of 326 bp that was not cleaved by the restriction enzyme. In addition, in the case of RL-LE-311 amplified from high temperature tolerant shiitake mushroom varieties, a 329 bp band that was not cleaved by restriction enzyme was observed, and 2 bands with sizes of 141, bp and 189 bp were observed in shiitake mushroom varieties without high temperature tolerance. Two bands were observed. In the case of RL-LE-312 and RL-LE-214 marker sequences, they are distinguished using BglII restriction enzyme. , showed two bands with a size of 197 bp, and a band with a size of 329 bp in the high-temperature tolerant shiitake variety. In the case of RL-LE-314, only the amplification products of shiitake mushroom varieties with high temperature tolerance were cut, and two bands of 179 bp and 216 bp in size were observed. A band with a size of 395 bp was observed. In the case of the marker sequence RL-LE-316, one of the two restriction enzyme NlaIII recognition sites present in the marker sequence was lost by a SNP specific to a high-temperature resistant variety, resulting in two bands of 36 bp and 156 bp in size when treated with the restriction enzyme , and in the case of varieties without high temperature tolerance, three bands with sizes of 36 bp, 61 bp, and 195 bp were shown. In the case of RL-LE-319, one more HaeIII recognition site was created within the marker sequence by a SNP specific to a high-temperature resistant variety, and three bands of 53 bp, 54 bp, and 252 bp were observed. In this case, two bands with sizes of 107 bp and 252 bp were observed.

As a result, Figure 2 shows the results of electrophoresis after treating the amplification products obtained from the five strains with restriction enzymes using the prepared primer sequences. Using the developed 8 CAPS markers, it can be confirmed that Sanmaru 1 and Sanmaru 2, which are high-temperature tolerant shiitake cultivars, are distinguished from those of Sanjo 501, Sanjo 502, and Gyunheung 135, which are not high-temperature tolerant.

order
number base sequence bp Base sequence of RL-LE-306 One GGTAACAGTCGTCAGGTGAAAGaaactcagagctaaaagcttcacgagcggagccaccaagtaaggcaaaaaaatacttcaaatagttgggtgattgctcgaatgattggaaatgacgcctaaaaggaatggtcttgaatgagtccg---A/G---gagcgaagagtcaattggtttcatgtaaataccctaaaaggagctGACtgcctgtactACtgcctgtactACtgcctgtactACtgcctgtactACTT 239 RL-LE-306F 2 GGTAACAGTCGTCAGGTGAAAG 22 RL-LE-306R 3 CTCCGGGATCAAAGGTTACTAC 22 Base sequence of RL-LE-307
4 GAACCTAGCTAGACTGACGCATaacgagctcagagaatgctgtttcttcctttctttgatactacccgcatcgtctccgtcgtccgagtcatcgccatcccaaaagtaactgtgctgcacgagatctcgccacagcttgtgtatctccgtccacacctcgcctacaccaaactgtattctacagcgcaattgtagttgaggagctagtggattgtatgaaacgacaaacct---G/A---gtttctccatctttgcccagatctccggcaagcgcgtcaagagtttcacaGAGGGCCGTATGACTATCTATC 304 RL-LE-307F 5 GAACCTAGCTAGACTGACGCAT 22 RL-LE-307R 6 GATAGATAGTCATACGGCCCTC 22 Base sequence of RL-LE-310 7 ATTCGACTCTCTCTCTTCCTCCccctcgtagcattgctctacattccctgcatgtcttatctatccgaatggttcaatcgcaagcgtggatttgctaatggcgcagtcttcgccggaacagcagtgggaggcatcctcctccccctcattttaccctcgttattatcctcacatggtcctcccaaaacattgcgaattctatccattgcaacag---T/C---tcttcttattgtacccctgcttcctctaatcaaaggccgtttgcctgaatctcgcatacgagccatgggaccaaccccacggggtcgagGGAACTCAGAGTGGACAAGAAG 326 RL-LE-310F 8 ATTCGACTCTCTCTCTTCCTCC 22 RL-LE-310R 9 CTTCTTGTCCACTCTGAGTTCC 22 Base sequence of RL-LE-311 10 GACTAGCAACAGGTTACCTCTCCgataaaatcaatccctggctcttgggactctcaacattagcctccacatctgcagtaacatttatactttggggtgttttatcatataatctcgctggattgctatcgttcagtttag---C/T---ttacgggatcgttgctggaggctggtcgagcacatggaacgggtttattaagcctttgagcggtaagcagatgttttcatccactggtatcattctaaatattcgattaattccttcaaaccacaagtcaatgatccgaatctctccaccactctttttggagtCCTACTCTTCTCTCGTGGTATAGG 330 RL-LE-311F 11 GACTAGCAACAGGTTACCTCTCC 23 RL-LE-311R 12 CCTATACCACGAGAGAAGAGTAGG 24 Base sequence of RL-LE-312 13 GACAGCCTACATGGTGATGAGaggaaatttacgagtttatgattgtgaacctacattttcgatgtcccgccagtcgtacggtatgagatttgcggtagagacgactacccgcaggcgacctgttttatagaa---G/A---atctactgtgtactgattagatccctgcaatgaccgatgcattgcaat---A/G---cataccagcataaactgtaaaaccgttagagaaaagttgaagccgactttcaacaaagacagcacaccttcatgtgcatacaaccatatccgcccctgagaaaaggcgttgttttgatccaatttGGGAGTGCATTCTTGACACTAG 329 RL-LE-312F 14 GACAGCCTACATGGTGATGAG 21 RL-LE-312R 15 CTAGTGTCAAGAATGCACTCCC 22 Base sequence of RL-LE-314 16 GGGATACTACTTCTCTCCAACGtataggcgtagcagtgtattatttctctccgctgtggccttacaacgtttccactgtggtatccctcgacggtggaaacaatattactgtaaatttgatggatatgagcgctacccccgcaagcgttggttctcccctacagcatcttctgcagcaagat---T/C---tggactcactggactgtccaatagttcacatacgttgagtatgttcgtgttacaaggtctcaattatagtgatccaaatgtcaatgggtatattgtcgtcgatgggttcaagtgtgttcctcccattacttgttcaaattacgatctcatttcggtctcatgtatagcgtgaccattgatgatggagtacaAGAAGTTCAGTCGTCCGGTAG 395 RL-LE-314F 17 GGGATACTACTTCTCTCCAACG 22 RL-LE-314R 18 CTACCGGACGACTGAACTTCT 21 Base sequence of RL-LE-316 19 CTACACGCCTAGCTCAGAAGTTatacaatgaacatgctcttacaaacccaccttgtacgcgcctaaattcagatcta---T/G---tgacacttgtaatg---A/T---C/T---atgtataggaatatgatccttgatataaagcgtgtcatttctggagggcggaatagaagccgaagacaccttgcGTCTGCCTATCCTAGA 192 RL-LE-316F 20 CTACACGCCTAGCTCAGAAGTT 22 RL-LE-316R 21 CTAACAGCTCTAGGATAGGCAGAC 24 Base sequence of RL-LE-319 22 CTAAAACCCTTACCCTGTCCCcaccatcgctttttccagtaaactttgcgaggg---T/C---cgtgtattccatctgcaagcttgccatttcagcaagtattccaatctcggggccaactacatttccactaaggtaaaggtatttagttaatcggaggatggactttgaaactggggggatcacggtaggactggggctggcacccacacttactttgggtttaccccaaaagtggaaacccactaggggttgcgaagacatgatctagcttctcagcaagctcatccgcacgtctaagaaggaggtcgtcttttctaagagcatacgcagacagcagtcctcCGAGGTATCTTATCACCGTCTC 359 RL-LE-319F 23 CTAAAACCCTTACCCTGTCCC 21 RL-LE-319R 24 GAGACGGTGATAAGATACCTCG 22

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Development of HRM markers and use thereof for discrimination of high-temperature tolerant Pyogo mushroom cultivar <130> PN2108-393 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 239 <212> DNA <213> artificial sequence <220> <223> RL-LE-306 <400> 1 ggtaacagtc gtcaggtgaa agaaactcag agctaaaagc ttcacgagcg gagccaccaa 60 gtaaggcaaa aaaatacttc aaatagttgg gtgattgctc gaatgattgg aaatgacgcc 120 taaaaggaat ggtcttgaat gagtccgaga gcgaagagtc aattggttca tgtaaatacc 180 ctaaaaggag ctccttgacg gtccactcct tcatgtagta gtaacctttg atcccggag 239 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-306F <400> 2 ggtaacagtc gtcaggtgaa ag 22 <210> 3 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-306R <400> 3 ctccgggatc aaaggttact ac 22 <210> 4 <211> 304 <212> DNA <213> artificial sequence <220> <223> RL-LE-307 <400> 4 gaacctagct agactgacgc ataacgagct cagagaatgc tgtttcttcc tttctttgat 60 actacccgca tcgtctccgt cgtccgagtc atcgccatcc caaaagtaac tgtgctgcac 120 gagatctcgc cacagcttgt gtatctccgt ccacacctcg cctacaccaa actgtattct 180 acagcgcaat tgtagttgag gagctagtgg attgtatgaa acgacaaacc tggtttctcc 240 atctttgccc agatctccgg caagcgcgtc aagagtttca cagagggccg tatgactatc 300 tatc 304 <210> 5 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-307F <400> 5 gaacctagct agactgacgc at 22 <210> 6 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-307R <400> 6 gatagatagt catacggccc tc 22 <210> 7 <211> 326 <212> DNA <213> artificial sequence <220> <223> RL-LE-310 <400> 7 attcgactct ctctcttcct ccccctcgta gcattgctct acattccctg catgtcttat 60 ctatccgaat ggttcaatcg caagcgtgga tttgctaatg gcgcagtctt cgccggaaca 120 gcagtgggag gcatcctcct ccccctcatt ttaccctcgt tattatcctc acatggtcct 180 cccaaaacat tgcgaattct atccattgca acagttcttc ttattgtacc cctgcttcct 240 ctaatcaaag gccgtttgcc tgaatctcgc atacgagcca tgggaccaac cccacggggt 300 cgagggaact cagagtggac aagaag 326 <210> 8 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-310F <400> 8 attcgactct ctctcttcct cc 22 <210> 9 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-310R <400> 9 cttcttgtcc actctgagtt cc 22 <210> 10 <211> 330 <212> DNA <213> artificial sequence <220> <223> RL-LE-311 <400> 10 gactagcaac aggttacctc tccgataaaa tcaatccctg gctcttggga ctctcaacat 60 tagcctccac atctgcagta acatttatac tttggggtgt tttatcatat aatctcgctg 120 gattgctatc gttcagttta gcttacggga tcgttgctgg aggctggtcg agcacatgga 180 acgggtttat taagcctttg agcggtaagc agatgttttc atccactggt atcattctaa 240 atattcgatt aattccttca aaccacaagt caatgatccg aatctctcca ccactctttt 300 tggagtccta ctcttctctc gtggtatagg 330 <210> 11 <211> 23 <212> DNA <213> artificial sequence <220> <223> RL-LE-311F <400> 11 gactagcaac aggttacctc tcc 23 <210> 12 <211> 24 <212> DNA <213> artificial sequence <220> <223> RL-LE-311R <400> 12 cctataccac gagagaagag tagg 24 <210> 13 <211> 329 <212> DNA <213> artificial sequence <220> <223> RL-LE-312 <400> 13 gacagcctac atggtgatga gaggaaattt acgagtttat gattgtgaac ctacattttc 60 gatgtcccgc cagtcgtacg gtatgagatt tgcggtagag acgactaccc gcaggcgacc 120 tgttttatag aagatctact gtgtactgat tagatccctg caatgaccga tgcattgcaa 180 tacataccag cataaactgt aaaaccgtta gagaaaagtt gaagccgact ttcaacaaag 240 acagcacacc ttcatgtgca tacaaccata tccgcccctg agaaaaggcg ttgttttgat 300 ccaatttggg agtgcattct tgacactag 329 <210> 14 <211> 21 <212> DNA <213> artificial sequence <220> <223> RL-LE-312F <400> 14 gacagcctac atggtgatga g 21 <210> 15 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-312R <400> 15 ctagtgtcaa gaatgcactc cc 22 <210> 16 <211> 395 <212> DNA <213> artificial sequence <220> <223> RL-LE-314 <400> 16 gggatactac ttctctccaa cgtataggcg tagcagtgta ttattctct ccgctgtggc 60 cttacaacgt ttccactgtg gtatccctcg acggtggaaa caatattact gtaaatttga 120 tggatatgag cgctaccccc gcaagcgttg gttctcccct acagcatctt ctgcagcaag 180 atttggactc actggactgt ccaatagttc acatacgttg agtatgttcg tgttacaagg 240 tctcaattat agtgatccaa atgtcaatgg gtatattgtc gtcgatgggt tcaagtgtgt 300 tcctcccatt acttgttcaa attacgatct catttcggtc tcatgtatag cgtgaccatt 360 gatgatggag tacaagaagt tcagtcgtcc ggtag 395 <210> 17 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-314F <400> 17 gggatactac ttctctccaa cg 22 <210> 18 <211> 21 <212> DNA <213> artificial sequence <220> <223> RL-LE-314R <400> 18 ctaccggacg actgaacttc t 21 <210> 19 <211> 192 <212> DNA <213> artificial sequence <220> <223> RL-LE-316 <400> 19 ctacacgcct agctcagaag ttatacaatg aacatgctct tacaaaccca ccttgtacgc 60 gcctaaattc agatctattg acacttgtaa tgacatgtat aggaatatga tccttgatat 120 aaagcgtgtc atttctggag ggcggaatag aagccgaaga caccttgcgt ctgcctatcc 180 tagagctgtt ag 192 <210> 20 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-316F <400> 20 ctacacgcct agctcagaag tt 22 <210> 21 <211> 24 <212> DNA <213> artificial sequence <220> <223> RL-LE-316R <400> 21 ctaacagctc taggataggc agac 24 <210> 22 <211> 359 <212> DNA <213> artificial sequence <220> <223> RL-LE-319 <400> 22 ctaaaaccct taccctgtcc ccaccatcgc tttttccagt aaactttgcg agggtcgtgt 60 attccatctg caagcttgcc atttcagcaa gtattccaat ctcggggcca actacatttc 120 cactaaggta aaggtattta gttaatcgga ggatggactt tgaaactggg gggatcacgg 180 taggactggg gctggcaccc acacttactt tgggtttacc ccaaaagtgg aaacccacta 240 ggggttgcga agacatgatc tagcttctca gcaagctcat ccgcacgtct aagaaggagg 300 359 <210> 23 <211> 21 <212> DNA <213> artificial sequence <220> <223> RL-LE-319F <400> 23 ctaaaaccct taccctgtcc c 21 <210> 24 <211> 22 <212> DNA <213> artificial sequence <220> <223> RL-LE-319R <400> 24 gagacggtga taagatacct cg 22

Claims (11)

a single nucleotide polymorphism site at nucleotide position 148 of SEQ ID NO: 1;
a single nucleotide polymorphism site at nucleotide position 232 of SEQ ID NO: 4;
a single nucleotide polymorphism site at nucleotide position 215 of SEQ ID NO: 7;
a single nucleotide polymorphism site at the 142nd nucleotide position of SEQ ID NO: 10;
a single nucleotide polymorphism site at nucleotide positions 133 and 182 of SEQ ID NO: 13;
a single nucleotide polymorphism site at nucleotide position 183 of SEQ ID NO: 16;
a single nucleotide polymorphism site at 78th nucleotide position, 93rd nucleotide position and 94th nucleotide position of SEQ ID NO: 19; or
a single nucleotide polymorphism site at nucleotide position 55 of SEQ ID NO: 22;
A biomarker composition for identifying high-temperature resistant shiitake mushroom varieties, including an agent capable of detecting. According to claim 1,
The preparation capable of detecting the single nucleotide polymorphism (SNP) marker is a biomarker for determining high-temperature resistant shiitake mushroom varieties, characterized in that the primer set specifically binds to a polynucleotide sequence containing a single nucleotide polymorphism (SNP) marker composition. According to claim 2,
The primer set includes primer sets of SEQ ID NO: 2 and SEQ ID NO: 3;
Primer sets of SEQ ID NO: 5 and SEQ ID NO: 6;
Primer sets of SEQ ID NO: 8 and SEQ ID NO: 9;
Primer sets of SEQ ID NO: 11 and SEQ ID NO: 12;
Primer sets of SEQ ID NO: 14 and SEQ ID NO: 15;
Primer sets of SEQ ID NO: 17 and SEQ ID NO: 18;
Primer sets of SEQ ID NO: 20 and SEQ ID NO: 21; or
Characterized in that the primer set of SEQ ID NO: 23 and SEQ ID NO: 24,
A biomarker composition for determining high-temperature resistant shiitake mushroom varieties. A kit for identifying high-temperature resistant shiitake mushroom varieties comprising the composition according to any one of claims 1 to 3. According to claim 4,
The kit further comprises a reagent and a restriction enzyme for performing an amplification reaction. According to claim 5,
The kit, characterized in that the restriction enzyme is selected from the group consisting of Hpa Ⅱ, ScrF I, Alu I, Bgl Ⅱ, Nla Ⅲ and Hae Ⅲ. (a) isolating nucleic acid molecules from the specimen sample, and
(b) identifying a single nucleotide polymorphism (SNP) marker at position 148 of SEQ ID NO: 1 from the isolated nucleic acid molecule;
identifying a single nucleotide polymorphism (SNP) marker at position 232 of SEQ ID NO: 4 from the isolated nucleic acid molecule;
identifying a single nucleotide polymorphism (SNP) marker at position 215 of SEQ ID NO: 7 from the isolated nucleic acid molecule;
identifying a single nucleotide polymorphism (SNP) marker at position 142 of SEQ ID NO: 10 from the isolated nucleic acid molecule;
identifying single nucleotide polymorphism (SNP) markers at positions 133 and 182 of SEQ ID NO: 13 from the isolated nucleic acid molecule;
identifying a single nucleotide polymorphism (SNP) marker at position 183 of SEQ ID NO: 16 from the isolated nucleic acid molecule;
identifying single nucleotide polymorphism (SNP) markers at positions 78, 93, and 94 of SEQ ID NO: 19 from the isolated nucleic acid molecule;
identifying a single nucleotide polymorphism (SNP) marker at position 55 of SEQ ID NO: 22 from the isolated nucleic acid molecule;
Containing, high-temperature resistant shiitake mushroom varieties discrimination method. According to claim 7,
The step (b) amplifies the target sequence by performing PCR using the isolated nucleic acid molecule as a template and using a primer set that specifically binds to a polynucleotide sequence containing a single nucleotide polymorphism (SNP) marker, and then amplifying the target sequence. A method for identifying high-temperature resistant shiitake mushroom varieties, characterized in that the product is treated with a restriction enzyme and the result is detected. According to claim 8,
The primer set includes primer sets of SEQ ID NOs: 2 and 3;
Primer sets of SEQ ID NOs: 5 and 6;
Primer sets of SEQ ID NOs: 8 and 9;
Primer sets of SEQ ID NOs: 11 and 12;
Primer sets of SEQ ID NOs: 14 and 15;
Primer sets of SEQ ID NOs: 17 and 18;
Primer sets of SEQ ID NOs: 20 and 21; or
Characterized in that the primer set of SEQ ID NOs: 23 and 24, a method for determining high-temperature resistant shiitake mushroom varieties. According to claim 8,
Characterized in that the restriction enzyme is selected from the group consisting of Hpa Ⅱ, ScrF I, Alu I, Bgl Ⅱ, Nla Ⅲ and Hae Ⅲ, high temperature resistant shiitake mushroom variety identification method. According to claim 8,
When the size of the result is 5 bp, 89 bp and 145 bp;
304 bp;
112 bp and 214 bp;
329 bp;
179 bp and 216 bp;
36 bp and 156 bp; or
53 bp, 54 bp and 252 bp;
A method for identifying high-temperature resistant shiitake mushroom varieties, characterized in that they are identified as high-temperature resistant shiitake mushrooms.

Images