KR20200089645A - A composition for treating cancer - Google Patents

Abstract

Disclosed is a proportionally mixed anti-cancer composition comprising TGF-β2-targeting anti-sense oligonucleotides (5′-CGGCATGTCTATTTTGTA-3′) and an immune checkpoint inhibitor.

Description

Composition for treating cancer

The present invention relates to a pharmaceutical composition for anticancer. More specifically, the present invention provides TGF-β2 targeting anti-sense oligonucleotide 5'-CGGCATGTCTATTTTGTA-3' (hereinafter TGF-β2 targeting anti-sense oligonucleotide having this sequence "TASO") It refers to a pharmaceutical composition for anti-cancer, especially a solid cancer treatment, comprising an immune checkpoint inhibitor and an immune checkpoint inhibitor.

Since the existing cytotoxic anti-cancer agent has a problem of attacking not only cancer cells but also normal cells, the targeted treatment anti-cancer drugs have become the mainstay of the development of anti-cancer drugs to improve these problems. It is known that the targeted treatment anticancer agent selectively attacks only specific target factors during the carcinogenic process and does not attack normal cells, so the pain to the patient is less than that of the existing cytotoxic anticancer agent.

However, these targeted treatment anti-cancer agents have also been found to suffer from resistance after administration. In order to overcome the shortcomings of these targeted treatment anticancer drugs and prolong survival through chemotherapy, immunocancer drugs are emerging as the core of the development of anticancer drugs.

However, the response rate is emerging as a problem in the rapidly growing market for immune checkpoint inhibitors. For example, Roche-Genentech's PD-L1 family of anti-cancer drugs, tecentriq (commonly known as Atezolizumab), is known to have a drug response rate of only 20% in clinical practice.

The present invention is to improve the drug response rate of the immune checkpoint inhibitor to provide an anti-cancer agent composition that enhances the anti-cancer effect.

U.S. Patent No. 9,402,899

The present invention is to improve the anticancer effect by improving the drug response rate of the immune checkpoint inhibitor, a TGF-β2 inhibitor TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') (TASO) and an immune checkpoint inhibitor It is for treating cancer by a combination administration of.

In order to solve the above problems, the present invention provides a combination composition for anticancer comprising a TGF-β inhibitor and an immune checkpoint inhibitor.

Specifically, the present invention provides a combination composition for anti-cancer comprising a TGF-β inhibitor TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') and an immune checkpoint inhibitor.

The expression of TGF-β in the tumor performs a comprehensive immune suppression function.

Immune checkpoints such as PD-1 and PD-L1 are responsible for some of the comprehensive immunosuppressions, and thus, to the immune checkpoints of PD-1 and PD-L1 without removing TGF-β. Attempts to restore immune function by using an anti-cancer drug as an anti-cancer agent work only partially, but do not fully restore the cell death function of the immune system.

TGF-β2 targeting anti-sense oligonucleotide 5'-CGGCATGTCTATTTTGTA-3' (SEQ ID NO: 1) is a known synthetic 18-mer phosphorothioate antisense oligonucleotide specially designed for targeting human TGF-β2, TGF -β inhibitor.

In the present invention, the anti-cancer effect is significantly enhanced by the combination administration of a TGF-β inhibitor and an immune checkpoint inhibitor.

The anticancer agent composition according to the present invention significantly enhances the anticancer effect.

1 shows the results of quantitative analysis and relative qualitative analysis of TGF-β2 mRNA.
Figure 2 shows the results of quantitative analysis of TGF-β2 protein secreted from various cancer cell lines.
3 to 7 show the results of the growth inhibition analysis of various cancer cell lines according to TASO alone treatment.
8 to 17 are graphs showing amounts of PD-L1 protein and antibody control IgG expressed on the surface of various solid cancer cell lines.
18 to 21 show the cell death effect by combination administration of kitruda and TASO in breast cancer cell line, skin cancer cell line, lung cancer cell line, and colon cancer cell line, respectively.
22 and 23 show the cell death effect by administration of honey and TASO in breast cancer cell line and skin cancer cell line, respectively.
24 and 25 show the results of measuring the tumor size of skin cancer and the tumor size of breast cancer in humanized NSG mice, respectively.

The present invention relates to a combination composition for anticancer comprising a TGF-β inhibitor and an immune checkpoint inhibitor.

Specifically, the present invention relates to a combination composition for anti-cancer comprising a TGF-β inhibitor TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') and an immune checkpoint inhibitor.

Inhibitors that can be used in the present invention include PD-L1 antibody Tecentriq (common name Atezolizumab), Impinze (common name Duvalumab), PD-1 antibody Keytruda (common name pembrolizumab), Opdivo (common name nivolumab), CTLA-4 antibody Yervoy (common name ipilimumab) and the like can be used Can.

The TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') and immune checkpoint inhibitor of the anticancer composition of the present invention may be administered simultaneously, sequentially, or separately.

In addition, the present invention relates to a composition for anti-cancer containing TASO and co-administered with an immune checkpoint inhibitor.

In addition, the present invention relates to an anti-cancer composition for use in combination with TASO, containing an immune checkpoint inhibitor.

In the composition of the present invention, the immune checkpoint inhibitor is a PD-1 antibody or a PD-L1 antibody (e.g., pembrolizumab, nivolumab, atezolizumab or duvalumab, etc.), or a CTLA-4 antibody (e.g. , Ipilimumab, etc.).

The composition of the present invention can be used to treat solid cancer such as breast cancer (especially triple negative breast cancer (estrogen, progesterone, breast cancer negative for HER2)), colorectal cancer, pancreatic cancer, lung cancer or melanoma.

Hereinafter, the present invention will be described in detail based on examples. However, the following examples are only for illustrating the present invention, and the spirit or scope of the present invention is not limited thereto.

In order to confirm the anti-cancer effect of the composition according to the present invention against solid cancer, in a mouse solid cancer model, in combination with a TGF-β inhibitor targeting TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') Experiments were conducted to confirm the anti-cancer effects of in-vitro and in-vivo.

To this end, TGF-β mRNA expression was confirmed in various solid cancer cell lines, protein secretion was confirmed, and TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') treatment was performed in various solid cancer cell lines. Inhibition of TGF-β2 secretion by apoptosis and apoptosis effect, PD-L1 expression in various solid cancer cell lines, and TGF-β2 targeting anti-sense oligonucleotide in solid cancer cell lines with high TGF-β expression (5' -CGGCATGTCTATTTTGTA-3') alone and in combination treatment with peripheral blood mononuclear cells (PBMC) co-cultured with Keytruda (PD-1 antibody) or Yervoy (CTLA-4 antibody) The cancer cell death effect was confirmed.

When the composition of the present invention is administered, the TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') and the immune checkpoint inhibitor may be administered sequentially or simultaneously, or may be administered in combination by individually administered methods. Therefore, when administering the composition of the present invention, each component is simultaneously present in a therapeutically effective amount in vivo, thereby synergistic with each other.

The composition of the present invention may be administered to the human body by oral administration or parenteral administration (for example, injection).

Experimental Example 1: Quantitative and relative qualitative analysis of TGF-β2 mRNA level for various carcinomas

1) Cell culture

As shown in Table 1 below, depending on the cell type, RPMI 1640 (10% FBS, Antibiotic-Antimycotic, HEPES), DMEM (10% FBS, Antibiotic-Antimycotic), Alpha-MEM (10% FBS, Antibiotic-Antimycotic) or McCoy's 5A ( A medium such as 10% FBS, Antibiotic-Antimycotic) was used, and the cells were cultured in a 37°C, CO ₂ 5.0% environment.

2) TGF-β2 mRNA expression analysis

RNA was purified using RNA prep kit (Qiagen) in each of the cell lines 1x10 ⁷ of Table 1 above, and then 1 μg of purified RNA was used as a template, and TGF-β2 (GCGAAGGCAGCAATTATGCTG) specific primer (specific primer) ) Using the RT-premix (Bioneer) cDNA synthesis kit, cDNA was synthesized at 37° C. for 1 hour.

PCR was performed on 10 μl of cDNA using only F-primer of TGF-β2 F (ATCGATGGCACCTCCACATATG), R (GCGAAGGCAGCAATTATGCTG) (Denaturation 95° C. 1 min, Annealing 57° C. 1 min, Extension 72° C. 1 min, 35 cycles and Final Extension 72°C 5 min). Thereafter, the mRNA expression for TGF-β2 on the cells was confirmed using the band intensity of TGF-β2 compared to the PCR results for GAPDH.

1 shows the results of quantitative analysis and relative crystallization of TGF-β2 mRNA.

3) TGF-β2 ELISA quantitative analysis

The day before the experiment, each cell line 2ⅹ10 ⁶ is prepared in a 6-well plate (SPL Lifesciences, Pocheon). On the day of the experiment, TASO was adjusted to an amount such that the final concentrations were 0, 20nM, 40nM, 80nM, and 160nM and placed in a medium without FBS. In another medium without FBS, a transfection reagent Lipofectamine 2000 (Invitrogen, California, USA) was added and stabilized at room temperature for 5 minutes.

The medium mixture containing TASO and the medium containing the transfection reagent were mixed so that the final concentrations of TASO were 0, 20 nM, 40 nM, 80 nM, and 160 nM, and reacted at room temperature for 20 minutes. Subsequently, the cells were dispensed into cell lines prepared the previous day, and cultured for 2 days at 37°C and 5% CO ₂ conditions. After 2 days, only the culture supernatant was recovered and quantified TGF-β2 using Quantikine TGF-β2 ELISA (R&D Systems) kit.

Figure 2 shows the results of quantitative analysis of TGF-β2 protein secreted extracellularly for various cancer cell lines by ELISA.

Experimental Example 2: Cell death effect by TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') alone treatment in various solid cancer cell lines

Cell death was confirmed by TASO alone treatment in various solid cancer cell lines.

1) TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') transfection

Each cell line was seeded as shown in Table 2 below, followed by incubation at 37°C and 5% CO ₂ for 24 hours:

PLATE Seeding density Lipofectamine 2000 Total volume 6well 100,000~200,000 4 μl 2 ml 12well 50,000 2 μl 1 ml 24well 10,000~30,000 1 μl 500 μl 96well 5,000~10,000 0.5 μl 100 μl

TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') is diluted in serum free media to a predetermined concentration (culture A). Lipofectamine 2000 is added to the serum-free culture medium in a predetermined amount under the experimental conditions shown in Table 2 above (culture B). After reacting the culture medium A and the culture medium B at room temperature for 5 minutes, the culture medium A and B are mixed and reacted again at room temperature for 20 minutes. After replacing the cell culture medium with 10% FBS culture medium, a mixture of the culture mediums A and B after the reaction is added to the cell culture medium.

2) Cytotoxicity Assay

For the cytotoxicity analysis, the activity of the cells was measured with an O.D 450nm value using EZCYTOX (purchased from Daeil Lab Service), and the cytotoxicity analysis was performed based on the results.

3 to 7 is a result of analyzing the growth inhibition in cancer cell lines according to TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') alone treatment with EZCYTOX. It can be confirmed that there is a difference in sensitivity to TASO for each cell line.

Experimental Example 3: Experiment to confirm the expression of PD-L1 on the cell surface with a flow cytometer in various solid cancer cell lines

After preparing the 10 kinds of cell lines used for the experiment at 10 ⁵ / 100㎕ PBS per test, by the addition of FITC Mouse Anti-Human CD274 (PD -L1) Clone.MIH1 antibody by 20μl per test of reaction at 4 ℃ 20 bungan . After the reaction, 3 ml of cold PBS was added, and then washing was performed by centrifugation at 2100 RPM for 3 minutes. After discarding all the supernatant, re-suspension with 200 μl of PBS and analyzing the expression of PD-L1 using a FACS instrument.

8 to 17 are graphs showing the amount of PD-L1 protein expressed on the surface of various solid cancer cell lines.

Experimental Example 4: Cell killing effect test by combination of Kitruda and human PBMC with TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') in solid cancer cell lines of lung cancer, breast cancer, skin cancer and colon cancer

1) TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') transfection

The target cell lines are seeded as shown in the table below, and then cultured for 24 hours. (A) TASO is diluted to serum-free media at a desired concentration to prepare culture A. (B) Lipofectamine 2000 is added to a serum-free medium in an amount determined according to the experimental conditions shown in the table below to prepare culture B. After the cultures (A) and (B) were reacted at room temperature for 5 minutes each, (A) and (B) were mixed and reacted again at room temperature for 20 minutes. After replacing the cell culture medium with 10% FBS media, the reaction (A) and (B) are added to the culture medium.

PLATE Seeding density Lipofectamine2000 Total volume 6well 100,000~200,000 4 μl 2 ml 12well 50,000 2 μl 1 ml 24well 10,000~30,000 1 μl 500 μl 96well 3,000~5,000 0.5 μl 100 μl

Incubate for 1 day at 37°C and 5% CO2.

2) Kitruda treatment

Kitruda is prepared at 100 μl at a concentration of 20 μg/ml. PBMC (peripheral blood mononuclear cells) is recovered only suspended cells, T (cancer cells): E (PBMC) = 100: 1 to prepare a ratio of 1: 10, mixed with kitruda and reacted for 20 minutes at room temperature. Subsequently, 200 μl of the medium is removed from the cancer cell well.

3) Analysis

After incubation for 24 hours, the medium of each well is carefully pipetted three times to resuspend the PBMC, and then the medium and the PBMC are removed as much as possible using a pipette. Using the cell activity and cytotoxicity analysis kit EZCYTOX (purchased from Daeil Lab Service Co., Ltd.), the medium: EZCYTOX solution is mixed at a ratio of 100:1, added to the wells, and incubated at 37°C for 1 hour.

At the end of the reaction, the activity of the cells was measured with a value of 450 nm of O.D. (Activity here is the rate at which metabolism of cancer cells alone is considered as 1, and based on this, the rate at which metabolism decreases due to cell death after drug treatment) was measured.

18 to 21 show the cell killing effect by combination administration of kitruda and TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') in breast cancer, melanoma, lung cancer, and colon cancer cell lines, respectively. will be. From this result, it can be seen that the activity of cancer cells was significantly reduced by the combination administration.

Experimental Example 5: Cell death effect test by using honey and human PBMC and TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') in breast cancer cell line and melanoma cell line

Experiments were performed on breast cancer cell lines and melanoma cell lines in the same manner as in Experimental Example 4, except that Yello was used instead of Kitruda.

22 and 23 show the cell death effect by administration of honey and TASO in breast cancer cell line and melanoma cell line, respectively. From this result, it can be seen that the activity of cancer cells was significantly reduced by the combination administration.

Experimental Example 6: Kitruda or honey and TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') for melanoma or triple negative breast cancer using human PBMC in a humanized mouse model (NSG Humanized mouse) Cell death effect test (in vivo)

(1) Experiment to confirm the effect on melanoma

After inoculating A2058 melanoma cancer cells in the humanized mouse model NSG (NSC immuno-deficiency mice, NOD SCID gamma mouse), treatment with TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') and kitruda (PD- 1 antibody) to confirm the effect.

The experimental method is as follows: On the first day of the experiment, PBMC (1ⅹ10 ⁷ ) of a human blood donor is intravenously administered to a humanized mouse NSG (NSG). A2058 melanoma (2x10 ⁶ ) cell line is inoculated 7 days after the start of the experiment. When cancer cells are 50-100 mm ^{3 in} size, TASO is administered intraperitoneally at 16 mg/kg or 8 mg/kg every other day until the end of the experiment. Kitruda is administered intraperitoneally until the end of the experiment at a frequency of 100 ug/maritime twice a week. As a control group, a negative control group (NC), no PBMC, no PBMC, only PBMC, only Kitruda, and only TASO were used (each experimental group and control group are mice. 6).

(2) Experiment to confirm the effect on breast cancer

In addition, after inoculating the MDA-MB-231 triple negative breast cancer cell line (TNBC) in a humanized mouse model NSG (NSC immuno-deficiency mice, NOD SCID gamma mouse), TGF-β2 targeting anti-sense oligonucleotide ( 5'-CGGCATGTCTATTTTGTA-3') treatment and honey (CTLA-4 antibody) treatment to confirm the effect.

The experimental method is as follows: On the first day of the experiment, MDA-MB-231 triple negative breast cancer (TNBC) is prepared and inoculated into a humanized mouse NSG. TASO (32 mg/kg each time) is administered intraperitoneally on the 2nd, 4th, 6th, 8th and 10th days after the start of the experiment. PBMC (1ⅹ10 ⁷ ) of human blood donor is administered intravenously on Day 11, and honey is administered intraperitoneally on Days 11, 16, and 21 (10 mg/kg administered on Day 11, 5 mg/kg respectively on Days 16 and 21) administration). As a control group, a negative control group (NC) without any drugs, no PBMC, a group with only PBMC, a group with only honey, and a group with only TASO were used (each experimental group and control group were mice. 6 are used)

(3) Effect check

For the mice inoculated with the skin cancer cell line, tumor volumes were measured on the 8th, 10th, 13th, 15th, 17th, 20th, and 22nd days, respectively. For the mice inoculated with the breast cancer cell line, tumor volumes were measured at 11, 15, 19, and 24 days after inoculation, respectively. Tumor volume was measured using a caliper.

24 and 25 show the results of measuring the tumor size. As a result, it was found that the tumor size was the smallest when TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') was administered in combination with Kitruda or Honey.

Therefore, TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-) compared to TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3') alone or immunosuppressant inhibitor alone. It can be seen that when the combination of 3') and the immune checkpoint inhibitor is administered, the cell apoptosis effect or cancer cell suppression effect of cancer cells is significantly exhibited.

Particularly, when only the immune checkpoint inhibitor is administered, the anticancer effect may be low due to the drug response rate. However, when the immune checkpoint inhibitor is used in combination with TGF-β2 targeting anti-sense oligonucleotide (5'-CGGCATGTCTATTTTGTA-3'), the anticancer effect is significantly increased. Can be improved.

The composition of the present invention can be used for anticancer treatment.

<110> Autotelic Bio Inc. <120> A composition for treating cancer <130> KR20P0102 <150> KR 10-2019-0006462 <151> 2019-01-17 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TGF-beta2 Targeting Anti-Sense Oligonucleotide <400> 1 cggcatgtct attttgta 18

Claims (23)

A combination composition for anticancer comprising the oligonucleotide of SEQ ID NO: 1 and an immune checkpoint inhibitor. The combination composition for anti-cancer according to claim 1, wherein the oligonucleotide of SEQ ID NO: 1 and the immune checkpoint inhibitor are administered simultaneously, sequentially, or separately. The combination composition for anticancer according to claim 1, wherein the immune checkpoint inhibitor is a PD-1 antibody, a PD-L1 antibody, or a CTLA-4 antibody. The combination composition for anticancer according to claim 1, wherein the immune checkpoint inhibitor is a PD-1 antibody or a PD-L1 antibody. The combination composition for anticancer according to claim 4, wherein the immune checkpoint inhibitor is pembrolizumab, nivolumab, atezolizumab or duvalumab. The combination composition for anticancer according to claim 4 for treating solid cancer. The composition of claim 6, wherein the solid cancer is breast cancer, colorectal cancer, skin cancer or lung cancer. The composition for anticancer according to claim 7, wherein the breast cancer is triple negative breast cancer. The combination composition for anticancer according to claim 1, wherein the immune checkpoint inhibitor is a CTLA-4 antibody. The combination composition for anticancer according to claim 9, wherein the immune checkpoint inhibitor is ipilimumab. The combination composition for anticancer according to claim 9 for treating solid cancer. 12. The composition of claim 11, wherein the solid cancer is breast cancer, colon cancer, skin cancer or lung cancer. 13. The composition for anticancer according to claim 12, wherein the breast cancer is triple negative breast cancer. A composition for anticancer containing the oligonucleotide of SEQ ID NO: 1, for coadministration with an immune checkpoint inhibitor. The anticancer composition according to claim 14, wherein the immune checkpoint inhibitor is a PD-1 antibody or a PD-L1 antibody. 16. The composition of claim 15 for treating solid cancer. 15. The composition of claim 14, wherein the immune checkpoint inhibitor is a CTLA-4 antibody. The composition for anticancer according to claim 17 for treating solid cancer. An anticancer composition containing an immune checkpoint inhibitor and co-administered with the oligonucleotide of SEQ ID NO: 1. The anti-cancer composition according to claim 19, wherein the immune checkpoint inhibitor is a PD-1 antibody or a PD-L1 antibody. The composition for anticancer according to claim 20, for treating solid cancer. The anti-cancer composition according to claim 19, wherein the immune checkpoint inhibitor is a CTLA-4 antibody. 23. The composition of claim 22 for treating solid cancer.

Images