KR20200076603A - Cell penetrating Domain derived from human CLK2 protein - Google Patents

Abstract

The present invention relates to a cell membrane penetrating domain derived from human CLK2 protein. Particularly, the present invention relates to a cell membrane penetrating domain (CLK2P cell membrane penetrating domain) or cell penetrating peptide, derived from human CLK2 protein, and to an intracellular delivery system including the same. The cell membrane penetrating domain derived from human CLK2 protein can be used to deliver cargo materials, such as compounds, biomolecules and various polymeric materials, into cells. The CLK2P cell membrane penetrating domain shows higher cell penetration efficiency as compared to conventional cell penetrating peptides, is derived from a human protein and can avoid side reactions and immune reactions caused by foreign protein-derived peptides, and thus can be used advantageously for a method for delivering compounds, biomolecules and various polymeric materials applied to the human body effectively into cells.

Description

Cell penetrating domain derived from human CLK2 protein}

The present invention relates to a cell membrane permeation domain derived from human CLK2 protein and an intracellular delivery system comprising the same.

Medicines used to treat disease or relieve symptoms are largely divided into low-molecular-weight compound medicines and high-molecular biopharmaceuticals. Biopharmaceuticals include therapeutic proteins, antibodies, vaccines for prevention or treatment, gene therapy, and cell therapy. In particular, recombinant protein drugs are drugs that are produced in large quantities using gene recombination technology for therapeutic proteins that are difficult to produce through a living body. Growth hormone, erythropoietin, interferon, colony stimulating factor (CSF), and blood coagulation factor (Recombinant human insulin) for the treatment of diabetes in the early 1980s were first approved by the U.S. FDA. Various recombinant protein drugs, such as blood factors, have been released. However, most polymer materials including recombinant proteins or nucleic acids are very difficult to transfer into cells compared to low-molecular compound drugs that are relatively easy to enter the cell and show activity through the cell membrane. have. Therefore, electroporation, microinjection, cationic lipid vesicle, viral vector, virus-like-particles, etc. Methods using or have been studied. However, the above methods are difficult to directly use in a living body, or there is a difficulty in injecting a cell separated from a living body and then re-injecting it into a living body. In addition, it causes a side effect inducing apoptosis or an immune response in vivo, and thus has great limitations in application.

Researches to develop new drug delivery systems and polymer biopharmaceuticals that can overcome the above problems are being actively conducted, and among them, a representative method is a protein transduction domain (PTD) or cell permeation peptide. (Cell Penetrating Peptides, CPP). The cell-penetrating peptide was first discovered to have the properties of the HIV virus' TAT protein and the polypeptides present in the TAT protein (GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR) to pass through the cell membrane. MPG (GALFLGFLGAAGSTMGAWSQPKKKRKV), bovine prion protein-derived BPrPr (MVKSKIGSWILVLFVAMWSDVGLCKKRP), human Hph-1 protein-derived Hph-1 (YARVRRRGPRR), and human NLBP protein-derived NP2 (KIKKVKKKGRK. Since then, studies using the cell-penetrating peptide as described above have been actively conducted, and through this, it has been found that cargo substances such as DNA, siRNA, peptide nucleic acid (PNA), protein, and liposome nanoparticles can be effectively delivered into cells.

Prior studies have shown that cell-penetrating peptides are energy-independent through direct penetration and that polymer materials can be delivered into cells even at low temperatures, and that they can also penetrate through endocytosis.

Currently, cell-penetrating peptides are developed for the treatment of cerebral vascular disease (Cerebral ischemia) and degenerative brain disease (Alzheimer's disease) using TAT-JBD20, the treatment of amyotrophic lateral sclerosis using TAT-BH4, MPG-8/siRNA and TAT -Preclinical experiments such as cancer treatments using DRBD/siRNA are in progress. In addition, the development of a treatment for myocardial infarction using TAT-δPKC inhibitor, a treatment for hearing loss and inflammation using TAT-JBD20, and a treatment for brain tumor using p28 are in clinical trials.

As described above, research on cell-penetrating peptides and development of several new drug candidates using the same are actively progressing, but there are problems to be overcome, and for this, the cell-penetrating efficiency is improved, and the cell-penetrating peptides and cargo substances bound thereto are used in vivo. There is a need to develop new cell-penetrating peptides that can minimize side effects and unintended immune responses.

Accordingly, in order to overcome the disadvantage that the existing cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila or have low permeation efficiency, cell permeation peptides having high permeation efficiency among human derived peptides, human CLK2 (CDC Like Kinase 2) ) The protein-derived cell permeation peptide was invented, and similarity to the existing cell permeation peptides was confirmed for peptides present in human-derived proteins, thereby completing the present invention.

1. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol., 83 (2002), pp. 1173-1181 2.The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem., 269 (1994), pp. 10444-10450 3.A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 14 (1997) pp. 2730-2736. 4.N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis. Biochem. Biophys. Res. Commun., 348 (2006), pp. 379-385 5.Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med, 12 (2006), pp. 574-579 6.dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13

An object of the present invention is to provide a novel cell membrane permeation domain that exhibits high cell permeation efficiency and can minimize side effects.

Another object of the present invention is to provide an intracellular delivery system including a cell membrane permeation domain to which a cargo of an intracellular transport target is bound to the end of a peptide.

Another object of the present invention is to provide a method for transporting a cargo into a cell, the method comprising contacting a cell membrane permeation domain to which a cell of the intracellular transport target is bound to the cell at the end of the peptide.

In order to achieve the above object, the present invention is to provide a cell membrane permeation domain comprising a polypeptide of any one of SEQ ID NOs: 1 to 11 derived from human CLK2 (CDC Like Kinase 2) protein.

In the present invention, the term "cell penetrating peptide (Cell penetrating peptide, CPP)" refers to a peptide having the ability to carry a cargo (Cargo) of a transport target into a cell in vitro or in-compensation, the term "cell membrane permeation domain ”.

In addition, in the present invention, the term'peptide' or'peptide' means a polymer in the form of a chain formed by combining 4 to 1000 amino acid residues by a peptide or a peptide bond, and mixed with'polypeptide' or'polypeptide' It is possible.

In the present invention, in order to minimize the side effects that occur when the cargo material is delivered through the cell permeation peptide into the human body, unlike the cell permeation peptide derived from a virus or other species, it is a peptide existing in a human-derived protein. In comparison, a novel human-derived cell membrane permeation domain or cell permeation peptide capable of minimizing side effects when treated to the human body and having a very high delivery efficiency into cells.

The present invention provides a recombinant cargo with improved cell membrane permeability, including a cargo fused to the cell membrane permeation domain and the N-terminal or C-terminal of the cell membrane permeation domain.

The cargo may be a recombinant cargo that is a protein, nucleic acid, lipid, or compound. In addition, the cargo may be an adjuvant or antigen.

According to one embodiment, the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native peptide , Glycated protein, fragmented protein, disulfide peptide, recombinant protein, chemically modified protein, and any one selected from the prion group.

In the present invention, the term'recombinant cargo' means a complex formed by recombination of cell membrane permeation domains and one or more cargoes by genetic fusion or chemical bonding.

In the present invention, the term'contact' means that the cargo is in contact with eukaryotic or prokaryotic cells, and the cargo is transferred into the eukaryotic or prokaryotic cells.

In addition, in the present invention, it is used interchangeably with expressions such as transporting, penetrating, transporting, transferring, or passing for introducing proteins, peptides, etc. into cells.

In addition, according to one embodiment, the cargo may be any one of a recombinant cargo selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.

In addition, according to one embodiment, the cargo may be a recombinant cargo that is a contrast agent, drug, or chemical.

In the present invention, the term “contrast material” refers to all materials used for imaging biological structures or fluids in medical imaging. The contrast material may include, but is not limited to, radiopaque contrast material, paramagnetic contrast material, superparamagnetic contrast material, CT contrast material, or other contrast material. For example, it may include radiopaque metals and salts thereof (e.g., silver, platinum, platinum, etc.) and other radiopaque chemicals (e.g., calcium salts, barium salts such as barium sulfate, tantalum and tantalum oxide). have. Paramagnetic contrast materials (for MR imaging) include gadolinium dientylene triaminepentaacetic acid and its derivatives and other gadolinium, manganese, iron, dysprosium, copper europium, erbium, chromium, Nickel and cobalt complex hydroxybenzylethylene diamine diacetic acid (HBED). The superparamagnetic contrast material (for MR imaging) may include magnetite, superparamagnetic iron oxide, ultrafine, superparamagnetic iron oxide, and monocrystalline iron oxide. Other suitable contrast materials may include iodized and non-iodinated, ionic and nonionic CR compositions, and contrast materials such as spin-labels, or other diagnostic actives. When expressed in a cell, it may include a marker gene encoding an easily detectable protein. Various labels such as radionuclides, fluorescent substances, enzyme cofactors, and enzyme inhibitors can be used.

As an example, when the cargo according to the present invention is a protein or a peptide, by binding the DNA expressing the transport peptide to the DNA expressing the transport target and expressing it, the transport peptide and the transport peptide form a fusion protein form You can combine objects. A specific example of binding by a fusion protein is as follows: When preparing a primer for producing a fusion protein, a nucleotide encoding a transport peptide is attached to a nucleotide expressing a moving target, and then the obtained nucleotide is vectored as a restriction enzyme. (Example: PET vector), and BL-21 (DE3) is introduced into cells and expressed. At this time, by treating an expression inducer such as IPTG (Isopropyl β-D-1-thiogalactopyranosid), and then purifying the fusion protein, and then treating PBS, the carrier peptide is a dye or fluorescent substance, specifically fluorescein ithiothiosia Nate (FITC, fluorescein isothiocyanate), luciferase (Luc), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), Tag GFP, Superfolder GFP, PA GFP , AcGFP, PS-GFP2, Yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, blue fluorescent protein (Cyan fluorescent protein, CFP), enhanced Cyan fluorescent protein (ECFP), TagCFP, PS-CFP2, Red fluorescent protein (RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP , Blue fluorescent protein (BFP), mTag BFP, Yellow-green fluorescent protein (mNeongreen), Bright monomeric fluorescent protein (Scarlet-i), Emblem, Emblem Cherry (monomeric cherry fluorescent protein, mcherry), PAmcherry, mStrawberry (mStrawberry), m orange (mOrange), PSmOrange, m-largeberry (mR) asberry), mKate, mKate2, mTFP, mNeptune, mRubby, mRubby2, mBanana, diesred, mCitrine, Emerald ), T-Sapphire, mApple, mgrape, Venus, Topaz, J-Red, tdTomato, mTurquoise, mTurquosie2, mKO, mKO2, mUKG. IFP1.4, mEos2, mEos4, mHoneydew, Dronpa, katushka, Ypet, CyPet, Clover, kaede, KikGR, mTangerine, Zsgreen, ZsYellow, Serulean, Beta-galactosidase, LacZ, Combined with beta-lactamase (BLA), beta-glucuronidase (GUS), alkaline phosphatase, chloramphenicol acetyltransferase or peroxidase can do.

According to another aspect of the present invention, the present invention provides a gene construct comprising a polynucleotide encoding the cell membrane permeation domain.

In addition, the present invention provides an expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, including a gene construct.

According to another aspect of the invention, the step of producing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with isolated cells.

In addition, according to another aspect of the invention, the step of producing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And administering the prepared recombinant cargo to animals other than humans.

There are no special requirements for the contact between the cell membrane permeation domain and the cell membrane, such as limited time, temperature, and concentration, and can be carried out as general conditions applied to cell membrane permeation in the art.

The cell permeation peptide of the present invention exhibits significantly improved permeation efficiency or cell permeability compared to conventional peptides, thereby allowing the carried cargo or biologically active molecule to be introduced into the cell, effectively maintaining activity, and significantly reducing cost. .

In addition, it is possible to increase the effect of the cargo material delivered through the cell permeation peptide or cell membrane permeation domain.

In addition, since it is derived from human protein, side effects caused by peptides derived from non-human proteins can be minimized.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 is a schematic diagram of a gene composite for making an expression gene composite of CLK2P-EGFP recombinant fusion protein.
FIG. 2 shows that a gene composite expressing a protein in which a human permeable peptide derived from human CLK2 protein (CLK2P) and Enhanced Green Fluorescent Protein (EGFP) is fused is observed through agarose gel electrophoresis.
FIG. 3 shows that the result was confirmed by processing a restriction enzyme on the bound gene composite by inserting the CLK2P-EGFP gene composite into the protein expression vector pET28a+.
FIG. 4 shows that CLK2P-EGFP-pET28a+ vector was transformed into Rosetta (DE3) receptor cells, followed by inducing protein production, followed by sonication, and observed through polyacrylamide gel electrophoresis.
FIG. 5 shows that CLK2P-EGFP recombinant fusion protein produced using Rosetta (DE3) receptive cells was purified and observed through polyacrylamide gel electrophoresis.
FIG. 6 shows the results of comparing the permeation efficiency in cells with a flow cytometer after treating the recombinant protein fused with the existing cell permeation peptide with EGFP and the CLK2P-EGFP recombinant protein in a human T immune cell line (Jurkat).
7 shows the results of comparing the permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by concentration.
8 shows the results of comparing the permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by time.
Figure 9 shows the distribution pattern of CLK2P-EGFP recombinant protein permeated into cells using a confocal microscope after treating the CLK2P-EGFP recombinant protein on the cervical cancer cell line (HeLa).
Figure 10 shows the results of confirming the efficiency of introduction into cells by flow cytometry (FACS) after processing the intracellular delivery efficiency of the CLK mutant (EG) fusion protein of the present invention to a human T immune cell line (Jurkat).

Unless defined otherwise herein, all technical and scientific terms used have the meaning as commonly understood by one of ordinary skill in the art. Various scientific events, including the terms included herein, are well known and available in the art.

The present invention provides a cell membrane permeation domain or cell permeation peptide comprising the polypeptide of any one of SEQ ID NOs: 1 to 11 derived from human CLK2 (CDC like Kinase 2) protein.

Conventional conventional cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila, or have a disadvantage of low permeation efficiency. To overcome this, the present inventors discovered a CLK2P peptide (RRKHRRRRRRSR, SEQ ID NO: 1) consisting of the 115th to 126th amino acid sequences in human CLK2 (CDC like kinase 2) protein, which is expected to have cell permeability among human-derived peptides. Did.

The gene sequence information expressing CLK2P in the base sequence of human-derived CLK2 protein was cggaggaagcacagacggcggaggaggcgcagccgg (SEQ ID NO: 12) and was converted to cgcagaaaacaccgccgtcgcagaagacgctccaga (SEQ ID NO: 13) through codon optimization during gene synthesis. In order to verify cell permeability, the base sequence expressing the EGFP fluorescent protein linked after the base sequence expressing the CLK2P peptide is represented by SEQ ID NO: 14, and the base sequence of the linker portion between the CLK2P peptide and the EGFP protein is ggaggtgggggctcg (SEQ ID NO: 15). to be.

The cell permeation peptides or cell membrane permeation domains represented by SEQ ID NOs: 2 to 11 of the present invention are mutant cell permeation peptides of the CLK2P cell permeation peptide, and the histidine, the fourth amino acid of CLK2P, and serine, the 11th amino acid, are different. CLK2P mutants substituted with amino acids and CLK2P mutants that have each removed the N-terminal and C-terminal amino acids one by one, a mutated cell membrane domain or a cell penetrating peptide.

The cell membrane permeation domain or cell permeation peptide derived from human CLK2 protein of the present invention is shown in Table 1 below.

Cell membrane permeation domain or cell permeation peptide derived from human CLK2 protein Sequence number Sequence name Sequence SEQ ID NO: 1 CLK2P RRKHRRRRRRSR SEQ ID NO: 2 CLK2P-M1 RRKYRRRRRRSR SEQ ID NO: 3 CLK2P-M2 RRKSRRRRRRSR SEQ ID NO: 4 CLK2P-M3 RRKERRRRRRSR SEQ ID NO: 5 CLK2P-M4 RRKGRRRRRRSR SEQ ID NO: 6 CLK2P-M5 RRKHRRRRRRYR SEQ.ID No. 7 CLK2P-M6 RRKHRRRRRRER SEQ.ID No. 8 CLK2P-M7 RRKHRRRRRRKR SEQ ID NO: 9 CLK2P-M8 RRKHRRRRRRGR SEQ.ID No. 10 CLK2P-M9 RKHRRRRRRSR SEQ ID NO: 11 CLK2P-M10 RRKHRRRRRRS

Advantages and features of the present invention, and methods for achieving them will be clarified with reference to embodiments described below in detail. Hereinafter, the present invention will be described in more detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

<Example 1> Construction of a plasmid vector expressing a protein in which a cell-penetrating peptide (CLK2P) derived from human CLK2 protein and EGFP fluorescent protein are fused

The present invention provides a gene construct comprising a polynucleotide encoding a cell membrane permeation domain (CLK2P cell permeation peptide, CLK2P), and the gene construct containing the recombinant cargo protein expression with improved cell membrane permeability A dragon expression vector is provided. The vector is characterized in that it further comprises a gene encoding a cargo protein, so that a recombinant cargo protein in which the cargo of the cell membrane permeation domain and the protein is fused can be expressed.

In addition, the present invention comprises the steps of preparing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with cells.

To test the cell permeation efficiency of CLK2P, artificial gene synthesis was performed as follows. As shown in Figure 1, 5'-NheI restriction enzyme recognition sequence -CLK2P base sequence -Linker sequence -EGFP protein sequence -terminated codon -XhoI restriction enzyme recognition sequence -3' was synthesized.

In particular, the CLK2P base sequence was converted to a base sequence expressing the same peptide through codon optimization during artificial gene synthesis, and was synthesized by attaching a gene expressing the EGFP fluorescent protein to the base sequence of the CLK2P peptide to verify cell permeability (FIG. 2). . In addition, linker sequencing was added between the cell-penetrating peptide and the EGFP protein to increase flexibility. The artificial synthetic gene was introduced into the pET28a+ plasmid vector treated with NheI restriction enzyme and XhoI restriction enzyme through T4 ligase after treatment with NheI restriction enzyme and XhoI restriction enzyme. The pET-28a plasmid vector used herein allows protein purification through Ni-NTA Resin by expressing 6 histidines (6 x His) at the N-terminus in front of the CLK2P-EGFP fusion protein. The pET28a+ plasmid vector into which the CLK2P-EGFP fusion protein artificial gene has been introduced is transformed into Top10 recipient cells and cultured in LB agar plates containing Kanamycin to incubate grown colonies in LB medium for about 16 hours. Thereafter, a plasmid was obtained through a DNA extraction experiment, treated with NheI restriction enzyme and XhoI restriction enzyme, and then confirmed that the artificial gene of CLK2P-EGFP fusion protein was successfully introduced into the pET-28a plasmid vector through agarose gel electrophoresis. (Figure 3). As described above, a recombinant cargo in which cargo was fused to the cell membrane permeation domain (CLK2P) was prepared. The method of delivering cargo to cells of the present invention comprises the steps of: 1) preparing the recombinant cargo; And 2) contacting the recombinant cargo prepared in the step with cells. Preparation 2) The contact between the cargo and the cell can be performed in vitro or in vivo. When the contact is performed in vitro, the contact is made by culturing the cell by treating the medium containing the recombinant cargo to cells in vitro. When in contact with the contact, in vivo, the recombinant cargo is intramuscular, intra-peritoneal, intravenous, oral, intranasal, subsutaneous ), subcutaneous (intradermal), mucosal (muscosal), or inhalation (inhale) is injected into the body in vivo (injection), the cell is in contact with the recombinant cargo in vivo.

<Example 2> CLK2P-EGFP fusion protein expression conditions established and high purity purification

In order to establish the expression conditions of the CLK2P-EGFP fusion protein, the plasmid vector prepared in Example 1 above was transformed into Rosetta (DE3) recipient cells and cultured for about 16 hours in LB medium containing Kanamycin. Here, 100 times more LB medium was added, incubated until the OD value reached 0.4-0.6, and then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, followed by 5 hours at 37°C. Or incubate for 16 hours at 20 ℃. Thereafter, the cells obtained through centrifugation were ultrasonically decomposed, and again, the supernatant and the cell pellet were separated through centrifugation to confirm the expressed amount and water solubility of the protein through polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 4). . Through this, it was confirmed that CLK2P-EGFP fusion protein increased the water solubility and expression efficiency of the protein under the condition of incubating at 20° C. for 16 hours after adding IPTG. Therefore, in order to purify the high-purity CLK2P-EGFP fusion protein, the transformed Rosetta (DE3) recipient cells were cultured under the same conditions, and then the culture solution was centrifuged to obtain a cell pellet and lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM Imidazole ). After supernatant, the supernatant was recovered by centrifugation, filtered through a 45 μm filter, and the supernatant was passed through a Ni-NTA agarose column to bind the recombinant protein. To remove the protein that is non-specifically bound to the Ni-NTA agarose column, wash the Ni-NTA agarose column using washing buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM Imidazole), and then recover the recombinant protein bound to the Ni-NTA agarose column For this, the recombinant protein was eluted using elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole). After the solution containing the CLK2P-EGFP fusion protein was replaced with PBS using the PD-10 desalting column, it was confirmed by polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 5).

<Example 3> CLK2P-EGFP fusion protein intracellular delivery efficiency confirmation

In order to confirm the intracellular delivery efficiency of the CLK2P-EGFP fusion protein, the plasmid vector expressing the protein in which the EGFP fluorescent protein is fused with the cell permeation peptides TAT, Hph-1 and NP2, respectively, express the CLK2P-EGFP fusion protein It was prepared in the same manner as the plasmid vector. Expression and purification of the conventional CPP-EGFP fusion protein was also performed in the same manner as CLK2P-EGFP fusion protein. For cell experiments, Jurkat cells were dispensed into a 24 well plate at 1.5 X 10 ⁶ /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% FBS and 1% penicillin/streptomycin to bring the CPP-EGFP fusion protein to a final concentration of 5 μM. After treatment, the cells were cultured in a 5% CO ₂ incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing with PBS solution was repeated 3 times. Thereafter, Jurkat cells were suspended in 650 μl of PBS, and then fluorescence of CPP-EGFP introduced into the cells was measured through a flow cytometer to confirm the efficiency of cell introduction (FIG. 6). Through this, it was confirmed that the CLK2P exhibits an efficiency of about 3 to 5 times compared to conventional cell permeation peptides.

Recombinant protein used in Example 3 Recombinant protein used in Example 3 Eumseong Control Wild type EGFP Experimental group Recombinant CLK2P fusion protein purified in Example 2, CLK2P-EGFP
Positive control TAT-EGFP (Hph-1)-EGFP NP2 EGFP

In order to confirm the efficiency of introduction of CLK2P-EGFP fusion protein by concentration, a comparative experiment was conducted using EGFP protein and the fusion protein of TAT and EGFP, the most widely used cell permeation peptides. The EGFP, TAT-EGFP, and CLK2P-EGFP fusion proteins were treated in Jurkat cells at final concentrations of 0.5, 1, 2, 5, and 10 μM, respectively, and the introduction efficiency was confirmed through the same procedure as in the previous experiment (FIG. 7). Through this, it was confirmed that the CLK2P-EGFP fusion protein was introduced into cells in a concentration-dependent manner, and it was confirmed that it showed a significantly higher delivery efficiency at all concentrations compared to the TAT-EGFP fusion protein.

Next, in order to confirm the introduction efficiency of CLK2P-EGFP fusion protein by time, a comparative experiment was conducted using EGFP and TAT-EGFP fusion proteins. EGFP, TAT-EGFP, and CLK2P-EGFP fusion proteins were treated with Jurkat cells at a final concentration of 5 μM, respectively, and cultured for 0.5, 1, 2, 4, and 6 hours, respectively. It was confirmed (Fig. 8). Through this, it was confirmed that the CLK2P-EGFP fusion protein was introduced into cells in a time-dependent manner, and it was confirmed that it showed a significantly higher delivery efficiency at all times compared to the TAT-EGFP fusion protein.

<Example 4> CLK2P-EGFP fusion protein to confirm the intracellular delivery pattern

In order to confirm the CLK2P-EGFP fusion protein introduced into the cell by confocal microscopy, first HeLa cells are dispensed into a 24 well cell culture slide with 2 X 10 ⁴ /well, and 10% Fetal Bovine Serum and 1% penicillin/streptomycin are included. The cells were suspended in 500 μl of DMEM medium and cultured for 18 hours in a 5% CO ₂ incubator maintained at 37°C. Thereafter, EGFP and CLK2P-EGFP fusion proteins were treated with cells at a final concentration of 1 μM, and then cultured for 1 hour. After removing the culture solution, washed 3 times with PBS solution, and fixed by treating the 4% PFA solution at room temperature for 30 minutes. After removing the PFA solution, washed again with PBS solution three times, treated with a mounting medium and covered with a cover slide, and observed with a confocal microscope (FIG. 9). Through this, it was confirmed that the CLK2P-EGFP fusion protein was effectively introduced into HeLa cells.

<Example 5> CLK2P mutant-EGFP fusion protein cell delivery efficiency confirmation

In order to study the intracellular delivery efficiency of CLK2P variants, CLK2P mutants, each of which is substituted with histidine, the fourth amino acid of CLK2P, and serine, the eleventh amino acid, with different amino acids, and the CLK2P mutant with the N-terminal and C-terminal amino acids removed one by one, are designed. Did. Thereafter, a plasmid vector expressing the CLK2P mutant-EGFP fusion protein was produced and then purified by expressing the protein. For cell experiments, Jurkat cells were dispensed into a 24 well plate at 1.5 X 10 ⁶ /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% FBS and 1% penicillin/streptomycin to bring the CPP-EGFP fusion protein to a final concentration of 5 μM. After treatment, the cells were cultured in a 5% CO ₂ incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, and centrifugation was performed to remove the supernatant and washing was repeated 3 times with PBS solution. Thereafter, the Jurkat cells were suspended in PBS of 650 μl, and the fluorescence of CLK2P mutant-EGFP fusion proteins introduced into the cells was measured through a flow cytometer to confirm the efficiency of cell introduction. Through this, CLK2P mutants showed a change in the introduction efficiency through mutation, but it was confirmed that the cell permeation ability was maintained (FIG. 10).

<110> KRICT <120> Cell penetrating Domain derived from human CLK2 protein <130> M18-5793-A <150> KR 10-2018-0165437 <151> 2018-12-19 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P <400> 1 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M1 <400> 2 Arg Arg Lys Tyr Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 3 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M2 <400> 3 Arg Arg Lys Ser Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 4 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M3 <400> 4 Arg Arg Lys Glu Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 5 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M4 <400> 5 Arg Arg Lys Gly Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 6 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M5 <400> 6 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Tyr Arg 1 5 10 <210> 7 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M6 <400> 7 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Glu Arg 1 5 10 <210> 8 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M7 <400> 8 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Lys Arg 1 5 10 <210> 9 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M8 <400> 9 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Gly Arg 1 5 10 <210> 10 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M9 <400> 10 Arg Lys His Arg Arg Arg Arg Arg Arg Ser Arg 1 5 10 <210> 11 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CLK2P-M10 <400> 11 Arg Arg Lys His Arg Arg Arg Arg Arg Arg Ser 1 5 10 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> CLK2P expression nucleic acid <400> 12 cggaggaagc acagacggcg gaggaggcgc agccgg 36 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> CLK2P synthesis nucleic acid <400> 13 cgcagaaaac accgccgtcg cagaagacgc tccaga 36 <210> 14 <211> 720 <212> DNA <213> Artificial Sequence <220> <223> CLK2P EGFP nucleic acid <400> 14 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 720 <210> 15 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> linker <400> 15 ggaggtgggg gctcg 15

Claims (10)

Cell membrane permeation domain comprising the polypeptide of any one of SEQ ID NOs: 1 to 11 derived from human CLK2 (CDC like Kinase 2) protein
A recombinant cargo having improved cell membrane permeability, comprising a cell membrane permeation domain of claim 1 and a cargo fused to the N-terminus or C-terminus of the cell membrane permeation domain.
The recombinant cargo of claim 2, wherein the cargo is a protein, nucleic acid, lipid or compound.
The method according to claim 2, wherein the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native (native). Recombinant cargo, which is any one selected from the group of peptides, glycosylated proteins, fragmented proteins, disulfide peptides, recombinant proteins, chemically modified proteins and prions.
The recombinant cargo according to claim 2, wherein the cargo is any one selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.
3. The recombinant cargo of claim 2, wherein the cargo is a contrast material, drug or chemical.
A gene construct comprising a polynucleotide encoding the cell membrane permeation domain of claim 1.
An expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, comprising the gene construct of claim 7.
Preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain of claim 1; And contacting the prepared recombinant cargo with isolated cells.
Preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain of claim 1; And administering the prepared recombinant cargo to animals other than humans.

Images