KR20190079558A - Use of miR-204 inhibitors for treating osteoarthritis - Google Patents

Abstract

The present application discloses a pharmaceutical composition for preventing or treating arthritis, including a substance targeting miR-204. The present application also discloses markers that can be used for diagnosing arthritis or measuring prognosis and a use thereof. The composition of the present application can effectively treat osteoarthritis by controlling the synthesis of proteoglycans to reduce imbalance in synthesis and degradation of cartilage substrates.

Description

< RTI ID = 0.0 > miR-204 < / RTI > inhibitors for treating osteoarthritis &

The present application is a technical field related to osteoarthritis treatment and detection.

Osteoarthritis is the most common form of arthritis in which cartilage or cartilage matrix progresses progressively by aging or injury. This degenerative arthritis or osteoarthritis (OA) is a disease that affects 4.14 million people in 2014, and the demand for treatment is increasing rapidly.

Osteoarthritis is caused by a variety of causes including systemic factors due to aging or local factors such as mechanical / physical stress due to excessive body weight and joint instability. These aging and abnormal mechanical stresses promote the accumulation of oxidative stress in chondrocyte, which in turn triggers sub-step mechanisms such as cell senescence, de-differentiation and cell death. Finally, these osteoarthritic risk factors promote cell aging of chondrocytes, leading to the development of osteoarthritis, but the molecular pathways that govern chondrocyte senescence are not known.

The treatment of degenerative arthritis requires the development of an effective therapeutic agent targeting the molecular mechanism, at the level of pain relief such as the treatment with hyaluronic acid or antiinflammatory agent.

Korean Patent Laid-Open Publication No. 2014-0144508 relates to a composition for regenerating and repairing cartilage damage, which comprises a pharmaceutical composition for treating regeneration of cartilage damage comprising granulocyte macrophage-colony stimulating factor (GM-CSF) as an active ingredient .

US Publication No. 2015-0119449 discloses compositions and methods that are capable of modulating the expression and activity of miR-204 using miR-204 antagonists, but for purposes of modulating insulin production, .

None of the above references disclose in connection with the arthritis treatment targeted herein. Molecular mechanism for regulating the metabolism of cartilage matrix is needed and development of therapeutic strategy through regulation of these factors is required.

The present invention provides a therapeutic agent for osteoarthritis targeting miR-204 which regulates the metabolism of cartilage matrix.

In one aspect, the present disclosure provides a pharmaceutical composition for treating arthritis comprising a substance that inhibits miR-204 activity, or a pharmaceutically acceptable carrier thereof.

In one embodiment, the miR-204 may be miR-204-5p or mir-204-3p.

In one embodiment, the substance capable of inhibiting the miR-204 activity is selected from the group consisting of SLC35D1 (UDP-glucuronic acid / UDP-N-acetylgalactosamine dual transporter), member D1 (Chondroitin sulfate synthase 1), CSGALNACT2 (Chondroitin sulfate N-acetylgalactosaminyltransferase 2), CHST11 (Carbohydrate sulfotransferase 11), CHST15 (Carbohydrate sulfotransferase 15); It is a substance that can inhibit the interaction of 3'-UTR and miR-204 of HAS2 (Hyaluronan synthase 2) or HAPLN1 (Hyaluronan and proteoglycan link protein 1) gene.

In one embodiment, a substance capable of inhibiting the activity of miR-204 is a substance capable of inhibiting its expression.

In one embodiment, a substance capable of inhibiting the activity of miR-204 is a nucleic acid molecule capable of binding to all or part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the miR-204.

In one embodiment, the nucleic acid molecule is selected from the group consisting of antagomir, antisense molecule, siRNA, shRNA, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphorothioate-backbone ribonucleotide, decoy oligonucleotide, PNA (peptide nucleic acid) oligonucleotides or LNA (locked nucleic acid) oligonucleotides.

In one embodiment, the scFv nucleic acid molecule comprises all or part of the nucleotide sequence of 1 or 8 of the nucleotide sequence of SEQ ID NO: 1, for example, 6 to 100 mer of a nucleotide sequence complementary to nucleotides 2 to 7 Antisense oligonucleotides.

In one embodiment, the antisense oligonucleotides are constructed such that one or more of the nucleotides constituting the antisense oligonucleotide is 2'-O-methylated on the LNA, or the sugar of one or more nucleotides constituting it, or one or more phosphothioates on its backbone, .

In one embodiment, the antisense oligonucleotide is 5'-AAGGGA-3 '(SEQ ID NO: 4), 5'-AAAGGGAA-3' (SEQ ID NO: 5), or 5'-AGGCAUAGGAUGACAAAGGGAA-3 '(SEQ ID NO: 6).

In another aspect, the present invention provides a method of treating a subject comprising contacting miR-204 RNA with a test substance; And determining the activity of the miR-204 RNA contacted with the test substance, wherein the activity of the contacted miR-204 is decreased compared to the activity of the control miR-204 RNA not contacted with the test substance And screening the therapeutic agent for arthritis.

In one embodiment, the miR-204 may be miR-204-5p, or miR-204-3p.

In one embodiment, the miR-204 RNA expressing cells is selected from the group consisting of mouse primary cultured chondrocytes; Primary cultured chondrocytes derived from patients with degenerative arthritis; SW1353 cell line; C20A4, TC28A2, or human cartilage cells containing C28I2: or H4 site in mouse corned (RRID: CVCL_W634), ATDC5, or is available in a form that is expressed in a cell containing the mouse cartilage cells containing the MC615, and the active Is determined by expression analysis of the miR-204 RNA, which further expresses GATA4 and NF-kB (Nuclear Factor kappa B) as upstream regulators of miR-204 expression.

In one embodiment, the miR-204 RNA is provided in the form of a cell expressing the miR-204 RNA, wherein the activity is selected from the group consisting of the miR-204 RNA and the 3'-UTR of its target SLC35D1, CHSY1, CSGALNACT2, CHST11, CHST15, HAS2 or HAPLN1 And miR-204 RNA.

In another aspect, there is provided an arthritic diagnostic kit comprising a material for miR-204 detection.

In another embodiment, there is provided a method of treating a patient suffering from arthritis, comprising the steps of: Detecting the expression of miR-204 in said sample; And comparing the expression level of the detected marker with the arthritis or prognosis of the test subject, wherein the expression amount of miR-204 of the test subject in the associating step is higher than that of the control sample, And diagnosing the subject as arthritis, the method comprising the steps of: detecting the marker in the Invitro in order to provide information necessary for progress of arthritis or diagnosis or prognosis.

In one embodiment, the sample is not limited to, but not limited to, cartilage tissue, synovial fluid, blood or urine.

In one embodiment, the miR-204 in the kit and method may be miR-204-5p, or miR-204-3p.

The present invention discloses pharmaceutical compositions for the prevention or treatment of arthritis comprising a substance targeting miR-204, and markers that can be used for arthritis diagnosis or prognosis measurement, and uses thereof. The composition of the present invention can modulate the synthesis of proteoglycans, effectively reducing osteoarthritis by reducing the imbalance of synthesis and degradation of cartilage matrix.

In addition, the present invention newly identified target genes of GATA4 / NF-kB and miR-204 as an upstream regulator of miR-204, which can be useful for the development of therapeutic agents for arthritis.

1, (A) mouse chondrocytes were cultured with P0 or P2 under high oxygen (20% oxygen) conditions. SA-β-Gal staining and SA-β-Gal positive cell counts in mouse P0 and P2 chondrocytes ( n = 5). Scale bar, 100 μm. (B) Immunofluorescence for 4-HNE in chondrocytes cultured under hypoxic (3% oxygen), 20% oxygen conditions or treated with hydrogen peroxide (200 μM). Scale bar, 25 μm. (C and D) ^{Immunofluorescence} for (C) γ-H2AX and (D) p16 ^INK4a in chondrocytes cultured in high oxygen (PO and P2) or hypoxic (P2) (E) Measurement of relative mRNA expression levels of CDK inhibitor and Lmnb1 in P0 and P2 cartilage cells. (F) Alcian blue staining and absorbance determination in mouse P0 and P2 chondrocytes ( n = 4). (G) Volcano plot log2 (fold change) Volcano plot for contrast log10 (FDR). The plot shows the difference in miRNA expression between P0 and P2 cartilage cells. (H) The degree of concentration distribution between the predicted target transcripts of 41 miRNAs with statistically significant increases and degenerative arthritis and sets of genes reduced in aging cartilage. The prediction of the target genes of miRNAs was performed with the TargetScan algorithm. (I) sGAG release ( n = 5) of chondrocytes delivered with specified miRNAs via sGAG assay. (J) Tissue section staining of injured and uninjured areas of degenerative arthritis cartilage. Alcian blue staining, immunohistochemistry of p16 ^INK4a , and in situ hybridization of miR-204. Also, the degree of damage to the cartilage ( n = 10). Scale bar, 25 μm. (K and L) (K) Cartilaginous tissue sections staining at 2 and 24 months ( n ≥ 4) and (L) control and degenerative arthritis-induced mice (8 weeks after DMM, n ≥ 6). ^Safranin O staining, immunohistochemistry of p16 ^INK4a and in situ hybridization technique of miR-204. Scale bar, 200 μm. (M) GSEA analysis of miR-204 target genes in degenerative arthritis (stomach), aging (middle) and degenerative arthritis mice (below) cartilage tissue. Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. NS, not significant. Student's t test in (A), (E), and (F). ANOVA in (E). Mann-Whitney U test in (J) to (L).
In Figure 2 (A) cartilage menadione (25 μM; n = 3 ) in the cell and hydrogen peroxide (500 μM; n = 4) the amount of relative expression of miR-204 after treatment for a specified time. (B) Relative expression of miR-204 ( n = 6) after 7 days of treatment with hydrogen peroxide at the indicated concentration in cartilage cells. (C) ^{Immunofluorescence} for γ-H2AX (indicated by white arrows) and p16 ^INK4a after treatment with Vehicle or hydrogen peroxide (200 μM). Scale bar, 100 μm. (D) SA-β-Gal staining and SA-β-Gal positive cell counts ( n = 3) after treatment of cartilage cells with vehicle or hydrogen peroxide (200 μM). Scale bar, 100 μm. (E) Measurement of relative mRNA expression levels of CDK inhibitors and Lmnb1 in chondrocytes treated with vehicle or hydrogen peroxide. ( n = 4). (F) SA-β-Gal staining and SA-β-Gal positive cell counts ( n = 3) after 5 days of gamma irradiation on chondrocytes. Scale bar, 100 μm. (G) Measurement of relative mRNA expression level of chondrocyte CDK inhibitor and Lmnb1 irradiated with gamma rays ( n = 6). (H) Relative expression level of miR-204 ( n = 6) 5 days after gamma irradiation on chondrocytes. (J and K) (J) Bleomycin or (K) doxorubicin-treated cartilage cells treated with bleomycin ( n = 4) and doxorubicin ( n = 6) The relative mRNA expression level of intracellular CDK inhibitor and Lmnb1 was measured ( n = 6). (L) Relative expression of miR-204 in chondrocytes treated with Bleomycin or (K) doxorubicin ( n = 4). (M) The relative expression levels of miR-204, Il6 , and Mmp3 (5 Gy; n = 6) over time after gamma irradiation on chondrocytes. (N and O) Relative expression levels of miR-204 after siRNA delivery targeting Gata4 or Rela and (N) gamma irradiation ( n ≥ 3) and (O) doxorubicin ( n = 3) treatment. Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. NS, not significant. ANOVA in (A), (B), (F), (H), (I), and (L) to (O). Student's t test in (D), (E), (G), (J), and (K).
Figure 3 (A) Quantification of Alcian blue staining (left) and pericellular matrix (right) thickness in chondrocytes ( n = 68) delivered with miR-Ctrl or miR-204 and grown in a 3-dimensional matrix for 14 days. Scale bar, 100 μm. (B) sGAG release ( n = 8) of chondrocytes transfected with miR-Ctrl or miR-204. (C) Spontaneous degenerative arthritis model A diagrammatic illustration of miRNA delivery experiments in mouse (stomach) or degenerative arthritis-induced mouse (below). (D) An in situ hybridization technique of miR-204 (indicated by the black arrow) on a section of the synovial membrane (above) or cartilage (below) delivered with miR-Ctrl or miR-204. Scale bar, 25 μm. (E) Delivery of miR-Ctrl or miR-204 in the mouse knee joint via in vivo-jetPEI (0.4 mg / kg miRNA, once every 2 weeks for 10 weeks). Joint tissue sections were stained with safranin O, fast green, and hematoxylin. Scale bar, 200 μm. (F) cartilage damage, osteochondral hardening, bony sputum formation, synovitis were analyzed by safranin O / hematoxylin staining ( n = 4). (G) Control and Degenerative Arthritis Induction Surgery Transferring miR-Ctrl or miR-204 intraarticularly in mice (0.4 mg / kg; once every 2 weeks for 6 weeks). Joint tissue sections were stained with safranin O, fast green, and hematoxylin. Scale bar, 200 μm. (H) cartilage damage, osteochondral hardening, bony spindle formation, and synovitis were analyzed by safranin O / hematoxylin staining ( n = 4). Data represent mean ± SEM. * P < 0.05, *** P < 0.001. NS, not significant. ANOVA and post hoc test in (B). Mann-Whitney U test (F). Kruskal-Wallis test and Mann-Whitney U test (H).
4 (A) SA-β-Gal staining of chondrocytes carrying miR-Ctrl or miR-204 or chondrocytes treated with bleomycin or doxorubicin. Representative images ( n = 3) of SA-β-Gal in chondrocytes that delivered miR-Ctrl or miR-204. Scale bar, 100 μm. (B) Analysis of chondrocyte growth that delivered miR-Ctrl or miR-204 ( n = 6). (C) The relative mRNA expression level of (C) CDK inhibitor or (D) SASP factor in chondrocytes that delivered miR-Ctrl or miR-204 ( n ≥ 4). (E) PG biosynthetic pathway is obtained from IPA. The changes in gene expression following miR-204 transfer were observed in RNA seq. Data were expressed in color from green (low expression level) to red (high expression level). (F) Relative mRNA expression level ( n = 8) of genes with reduced expression levels in (E) using qRT-PCR. (G) Design of a 3'UTR reporter vector for the predicted miR-204 target gene. AAGGGA, the 6-mer seed binding site of miR-204, was mutated to CGTACC in a mutant 3'UTR reporter. Relative luciferase activity of WT or mutant 3'UTR reporters of (H) Slc35d1 , Chsy1 , Chst11 , Chst15 and (I) Csgalnact2 in chondrocytes transfected with miR-Ctrl or miR-204 ( n ≥ 3) (J) Relative luciferase activity of Hapln1 and Has2 3'UTR reporters in chondrocytes transducing miR-Ctrl or miR-204 ( n = 3). (K) Immunostaining of SLC35D1, CHSY1, CHST11, HAPLN1 and CS in cartilaginous sections of mice after intra-articular injection of miR-Ctrl or miR-204. Scale bar, 25 μm. (L) Slc35d1, Chsy1, Chst11 , or Hapln1 a 25 nM siRNA targeting or sGAG emission amount of cartilage passing the mixture thereof siRNA cell. The total amount of siRNA delivered (100 nM) was set as negative control siRNA ( n = 6). Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. NS, not significant. Student's t test in (A) to (D), (F), (H) to (J), and (L).
5 (A) Relative mRNA expression level of PG-related miR-204 target gene ( n = 6) in P2 cartilage cells transfected with antimiR-Ctrl or antimiR-204. (B) sGAG release ( n = 5) of chondrocytes delivered antimiR-Ctrl or antimi-204. (C) SA-β-Gal quantification ( n = 3) in chondrocytes after IR exposure after transfer of antimiR-Ctrl or antimiR-204. (D) Relative mRNA expression level of SASP factor in chondrocytes after gamma irradiation after antimiR-Ctrl or antimiR-204 ( n = 4). (E) Schematic of antimiR treatment in degenerative arthritis model mice after trauma. (F) In vivo-jetPEI (0.4 mg / kg, once every 12 days for 10 weeks), an in vivo transfection reagent, delivered antimiR-Ctrl or antimiR-204 to mice treated with the control or DMM. Joint tissue sections were stained with the positional hybridization technique for safranin O, fast green, hematoxylin and miR-204. Scale bar, 200 μm. (G) cartilage damage, cartilage hypoplasia, bony formation, and synovitis were analyzed by safranin O / hematoxylin staining ( n = 3 for sham, n = 8 for DMM). (H) An analysis of degenerative arthritis pain through the ratio of body weight of the operated leg to that of the opposite leg after the intramuscular injection of antimiR-Ctrl or antimiR-204 after performing Sham or DMM. (I) CS, SASP factors (MMP3 and MMP13) and immunohistochemistry for the aging marker p16 ^INK4a . Scale bar, 25 μm. Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. NS, not significant. Student's t test (A), (B), and (H). ANOVA and post hoc test in (C) and (D). Kruskal-Wallis test and Mann-Whitney U test (G).
6 (A) Representative images and quantification ( n = 3) of SA-β-Gal staining of human-derived chondrocytes treated with doxorubicin (1 μM) for 14 days. Scale bar, 100 μm. (B) ^{Immunofluorescence} for p16 ^INK4a in human-derived chondrocytes treated with vehicle or doxorubicin. Scale bar, 25 μm. (C) Relative mRNA expression of human or chondrocyte CDK inhibitor and LMNB1 treated with vehicle or doxorubicin ( n = 5). (D) Relative expression level of miR-204 in human-derived chondrocytes treated with vehicle or doxorubicin ( n = 4). (E) Relative mRNA expression levels ( n = 3) of genes constituting the PG-biosynthetic pathway in human-derived chondrocytes overexpressing miR-Ctrl or miR-204. (F) Tissue cultures of cartilage in patients with degenerative arthritis, followed by overexpression of antimiR-Ctrl or antimiR-204. Cartilaginous tissue sections were stained with immunostaining for CS, MMP3, MMP13, and spot hybridization technique of miR-204. The chondrocyte positivity for miR-204, CS, MMP3, MMP13 was quantitated ( n ≥ 3). Scale bar, 100 μm. (G) signal path diagram of OA generation induced by miR-204 mediated induction of aging. Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. Student's t test in (A), (C), (D), (E), and (F).
7 (A) is a schematic diagram of a screening method for miRNA screening associated with progression of degenerative arthritis. (B) fold change in expression of 41 miRNAs with significantly increased expression in P2 chondrocytes versus P0 chondrocytes. (C) Relative expression of miR-204 in P2 cartilage cells versus P0 cartilage cells. Data represent mean ± SEM. * P < 0.05. Student's t test in (C).
FIG. 8 (A) Western blotting of HA, p16 ^INK4a , Vinculin, and Actin in HEK293T cell line overexpressing mouse p16 ^INK4a , mouse p19 ^Arf protein, and a blank vector associated with HA tag. (B) Immunohistochemistry for p16 ^INK4a in cartilage tissue of control sham and degenerative arthritis-induced mice. (C) Immunohistochemistry for p16 ^INK4a in cartilage tissue of 2-month or 24-month-old mice.
FIG. 9 (A) Representative image of SA-β-Gal staining 5 days after irradiation of gamma ray to the chondrocytes. Scale bar, 100 μm. (B) Immunofluorescence for γ-H2AX (indicated by white arrow) in mouse or chondrocytes irradiated with gamma rays of control or 5 Gy. DAPI stained nuclei are stained blue. Scale bar, 25 μm.
Figure 10 (A and B) Representative images of SA-β-Gal staining after treatment with (A) bleomycin or (B) doxorubicin at the indicated concentrations in mouse cartilage cells. Scale bar, 100 μm. (C) ^{Immunofluorescence} for p16 ^INK4a in chondrocytes treated with bleomycin (200 μg / ml) or doxorubicin (100 nM). Scale bar, 25 μm.
Gamma irradiation in FIG. 11 (A) mouse chondrocytes (5 Gy; n = 4) , bleomycin (200 μg / ml; n = 6); relatively the back a handle Cdkn1a, or doxorubicin (n = 3 100 nM) Expression level. (B) Expression levels of Cdkn1a ( n = 4) and miR-204 ( n = 3) in chondrocytes treated with the indicated concentration of Nutlin-3a. (C and E) (C) The knockdown efficiency of siRNAs against Trp53 and (E) Cdkn2a was confirmed by RT-PCR (top) and qRT-PCR (bottom). (D) and (D) Trp53 or (F) Cdkn2a after irradiating gamma rays. The relative expression level of miR-204 in chondrocyte-transfected siRNAs. ( n &gt; = 3). Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P &lt; 0.001. NS, not significant. Student's t test in (A), (C), and (E). ANOVA and post hoc test in (B), (D), and (F).
FIG. 12 (A) shows the relative expression level of Trpm3 ( n = 6) 5 days after gamma irradiation at a specified concentration in mouse cartilage cells. (B) Relative expression level of Trpm3 after gamma irradiation (5 Gy; n = 6) on mouse cartilage cells after the specified time. (C) A schematic diagram showing the genomic location of the miR-204 gene (top). Two transcription initiation sites (TSS) are conserved between humans and mice. The vertical line represents the exon region of Trpm3 , the host gene of miR-204. Sequence coding for miR-204 located in intron 6 is indicated by a green arrow. The reporter construct for the Trpm3-miR-204 TSS1 and TSS2 promoters was designed based on an evolutionarily conserved region (ECR). (D) Relative luciferase activity ( n = 4) of chondrocyte Trpm3- miR-204 TSS1 and TSS2 promoters in gamma irradiation. (E) A schematic diagram of binding sites for GATA and NF-κB transcription factors on the Trpm3- miR-204 TSS1 promoter. (F and G) The knockdown efficiency of siRNA against Gata4 or Rela was verified by RT-PCR (top) and qRT-PCR (below) ( n = 3) on primary cultured chondrocytes. (H) 40 nM or 100 nM miR-Ctrl or miR-204 transfected miR-204 ( n = 4) in chondrocytes. Data represent mean ± SEM. * P < 0.05, ** P < 0.01, *** P &lt; 0.001. NS, not significant. ANOVA and post hoc test in (A), (B), and (D). Student's t test in (F) to (H).
In Fig. 13 (A), FITC was combined with miR-Ctrl and injected into mouse joint (0.4 mg / kg). FITC (black arrow) is stained by immunohistochemistry in synovial membrane and cartilage tissue of mouse knee joint. AC, articular cartilage; Sy, synovial membrane. Scale bars, 25 μm. (B) Immunohistochemical staining for (B) IL-1β, TNF-α and (C) MMP13 in synovial sections of mice injected intramuscularly with miR-Ctrl or miR-204. (D) Immunohistochemistry for MMP13 in cartilage tissue of mice injected intramuscularly with miR-Ctrl or miR-204. Scale bar, 100 μm.
14 (A) is a heatmap representing the co-expression pattern of genes whose expression is decreased by overexpression of miR-204 in chondrocytes. The strong positive correlations between the Gene profiles were red, and the strong negative correlations were expressed in blue. Four potential gene clusters are selected through hierarchical clustering. (B) Hypergeometric P value between the target gene of potential miR-204 and each gene cluster. (C) Cluster 2 was analyzed by Enrichr pathway using KEGG, Reactome, and HumanCyc pathway database, and the four annotations with the combined score with the highest combined score and the corresponding combined score were graphically represented. (D) An Enrichr pathway analysis of Cluster 1, 3 and 4 shows the annotation with the highest combined score.
In FIG. 15, mRNA expression of genes by miR-Ctrl or miR-204 transfection in (A and B) (A) mouse cartilage cells or (B) SW1353 cartilage cancer cell line was analyzed by RT-PCR. (C) mRNA relative expression levels of Slc35b4, Xylt1, Chsy3, and Hs2st1 genes in mouse chondrocytes transfected with miR-Ctrl or miR-204. Four genes contain the seed sequence for miR-204 in the 3 'UTR, but the expression does not decrease in mouse primary cultured chondrocytes by miR-204 mimic transfection ( n ≥ 8). Data represent mean ± SEM. NS, not significant. Student's t test in (C).
16 (A) Relative expression level of Sox9 or Acan mRNA ( n = 3) in mouse chondrocytes transfected with miR-Ctrl or miR-204. (B) Relative luciferase activity of SOX9 and ACAN 3 'UTR reporter in mouse cartilage cells transfected with miR-Ctrl or miR-204 ( n = 5). (C) Western blotting for SOX9, ACAN, Actin in mouse cartilage cells over-expressing miR-Ctrl or miR-204. (D) Immunohistochemical staining of SOX9 and ACAN in cartilage tissues of mice transplanted with miR-Ctrl or miR-204. Data represent mean ± SEM. Scale bar, 25 μm. NS, not significant. Student's t test in (A) and (B).
In Figure 17 (knockdown efficiency of siRNA for Slc35d1, Chsy1, Chst11, Hapln1 RT -PCR ( top) and qRT-PCR (under;.. N = 3) The data represent the mean ± SEM Student's t test.
Figure 18 (A) Representative image of SA-beta-Gal staining in mouse cartilage cells transfected with antimiR-Ctrl or antimiR-204 after gamma irradiation. (B and C) (B) Chondrocyte cells irradiated with IL-1β (1 ng / ml) or gamma ray (5 Gy) Relative mRNA expression of Timp2 and Igfbp7 SASP factors. Data represent mean ± SEM. * P &lt; 0.05, *** P &lt; 0.001. NS, not significant. ANOVA and post hoc test in (B) and (C).
In Figure 19 (A), sham control mice were delivered antimiR-Ctrl or antimiR-204 using in vivo-jetPEI (0.4 mg / kg, once every 12 days for 10 weeks), an in vivo transfection reagent. Cartilaginous tissue was stained with safranin O staining and spot hybridization technique to miR-204. Scale bar, 25 μm. (B) AntimiR-Ctrl or antimiR-204 was injected into mice that had undergone Sham or DMM. In the cartilage tissue with an antibody (Abcam # 54210) for p16 ^INK4a immunohistochemical for p16 ^INK4a. Scale bar, 25 μm.

It is believed that miR-204 plays an important role in the development of osteoarthritis as an important regulator factor that regulates the synthesis of proteoglycans in cartilage cells and inhibition of miR-204 activity reduces the imbalance of cartilage matrix synthesis and degradation, It is based on the discovery that it can.

In one aspect, this disclosure relates to a pharmaceutical composition for treating osteoarthritis comprising a miR-204 inhibitor.

The composition according to the present application may be used for the prevention or treatment of osteoarthritis (OA). Osteoarthritis, also commonly referred to as degenerative arthritis, is the most common arthritis of the joint disease and gradually destroys the cartilaginous matrix. It also causes pathological conditions in other parts of the joint, such as cartilage osteosarcoma, osteoporosis, And conditions such as inflammation. The pathogenesis of OA includes a number of causes including systemic causes such as age, and local causes due to weight gain and mechanical stress due to joint instability. This pathogenesis promotes oxidative stress accumulation in chondrocytes, which in turn activates a number of lower signaling pathways such as cell senescence, de-differentiation and cell death. Oxidative stress leads to production of reactive oxygen species (ROS) that exceeds the antioxidant capacity of cells. Increased concentrations of ROS in articular cartilage of ROS are known to be closely related to the development of OA. OA cartilage breaks down air homeostasis due to increased catabolic mediator release by chondrocytes and decreased cartilage-specific substrate production. Chondrocyte senescence is an important cellular event that leads to substrate metabolic imbalance of OA development.

Articular cartilage contains a rich sulfated PG (proteoglycan) composed of a glycosaminoglycan (GAG) chain linked to a core protein. The most abundant GAG chain in cartilage is chondroitin sulfate (CS) consisting of a repeating disaccharide structure of N-acetylgalactosamine (GalNAc) and glucuronic acid (GlcA) sulfated at the 4- or 6-position of GalNAc (2) . The sulfated PG interacts with hyaluronic acid (HA) to form highly charged PG aggregates. The anionic properties of PG strongly attract osmotically active cations and retain water molecules in the cartilage matrix, giving the joints a unique load-bearing capacity. Cartilage matrix homeostasis is regulated by chondrocytes, the main cell type of cartilage.

Here we have shown that miR-204 is significantly increased in OA cartilage and is induced in senescence signals through the transcription factors GATA4 and NF-kB. This up-regulated miR-204 has been found to simultaneously block multiple factors involved in the multiple sulfated proteoglycan (PG) biosynthetic pathway and block PG synthesis. Expression of exogenous miR-204 resulted in automatic cartilage loss and OA development, while inhibition of miR-204 inhibited PG synthesis in cartilage cells and suppressed inflammatory SASS (senescence-associated secretory phenotype) factors and alleviated OA Respectively.

Therefore, the composition according to the present invention can be effectively used for prevention or treatment of arthritis.

As used herein, the term " miR "or" microRNA "refers to a nucleic acid that binds to the 3'UTR (non-translational site) of a target RNA to facilitate its degradation, 21 to 23 noncoding RNAs. The maturation sequences of the miRNAs used herein can be obtained from the miRNA database (http://www.mirbase.org). As of August 2012, 25,141 mature miRNAs from 193 species are registered according to the miRNA database (19th edition, miRBase). In general, microRNAs are transcribed into precursors of about 70-80 nt (nucleotide) long with a hairpin structure called pre-miRNA and then matured by cleavage by the RNAse III enzyme Dicer. MicroRNAs form a ribonucleotide complex called miRNP, which cleaves the target gene by complementary binding to the target site, or inhibits translation. Over 30% of human miRNAs are present in clusters, which are transcribed into a single precursor and then cleaved to form the final mature miRNA.

MiR-204 is expressed up-regulated in chondrocytes generated by OA and binds to the 3'UTR of a gene involved in PG biosynthesis, thereby inhibiting PG biosynthesis. These genes are SLC35D1 ( 52 ), which acts as a carrier for the UDP-GlcA and UDP-GalNAc repeating building blocks per CS peat; CHSY1 and CSGALNACT2 ( 53, 54 ) involved in the elongation of the CS chain; The enzymes CHST11 and CHST15 ( 55, 56 ) required for the GalNAc sulfation of the chain; And HAS2 and HAPLN1 ( 57, 58 ) , which are required for assembly of HA and core protein PG backbones. The expression of the gene was decreased by the introduction of miR-204 (see FIG. 4F, etc.).

Therefore, the miR-204 activity inhibitor according to the present invention can inhibit binding to the 3'UTR of SLC35D1, CHSY1, CSGALNACT2, CHST11, CHST15, HAS2 and HAPLN1 as a target gene of miR-204. The sequence of the gene is known in NCBI DB as follows: human SLC35D1: NM015139.2, human CHSY1: NM014918.4, human CSGALNACT2: NM018590.4, NM001319654.1, NM001319656.1, human CHST11: NM01888413.5 , NM001173982.1, human CHST15: NM015892.4, NM014863.3, NM001270764.1, human HAS2: NM005328.2, human HAPLN1: NM001884.3

The sequence of miR-204 herein is human-derived and the matured sequence is miR-204-5p [5'- UUCCCUUU GUCAUCCUAUGCCU-3 '(SEQ ID NO: 1)], miR-204-3p [5'- GCUGGGAA GGCAAAGGGACGU-3 (SEQ ID NO: 2)], a full-length sequence [(5'gg cagagucuuccucugugacacugguggacuucccuuugucauccuaugccugagaauaugaaggaggcugggaaggcaaagggacguucaauugucaucacuggc 3 '(SEQ ID NO: 3)). The underlined part indicates the seed sequence. The seed sequence is a specific sequence in which the miRNA binds to the 3'UTR portion of the target gene and inhibits the expression of the target gene.

In particular, miR-204-5p expression inhibitors were used in this study, confirming that miR-204-5p was expressed upon chondrocyte senescence.

MiR-204 inhibitors according to the present invention include those capable of inhibiting, or degrading, or inhibiting the activity of miR-204-5p, in particular.

As used herein, inhibition of the activity of miR-204 means inhibiting or interfering with the intracellular action or function of miR-204. Typically, miR-204 directly inhibits its binding to a target molecule, Or directly inhibit the function of miR-204 using a fragment of an antibody, or indirectly regulated using small interfering RNA molecules. Furthermore, the inhibition or inhibition of the activity of miR-204 involves directly or indirectly inhibiting the activity of the precursor sequence (SEQ ID NO: 1) and the maturation sequence (SEQ ID NO: 1 or 2). Inhibition of miR-204 activity also involves inhibiting the transcription of miR-204 itself and lowering its intracellular concentration.

The term &quot; substance capable of inhibiting the activity of miR-204 &quot; herein includes any substance capable of inhibiting its expression and / or activity. Such materials include, for example, antigens, antisense molecules, small hairpin RNA molecules (shRNA), Firefly RNA molecules (siRNA), seeded LNA (Locked Nucleic Acid) oligonucleotides, decoy oligonucleotides, aptamers, ribozymes, Or an antibody that recognizes a DNA: RNA hybrid.

As used herein, the term "antisense oligonucleotide" refers to all or part of the sequence of a miRNA, in particular an miRNA, or a sequence complementary to all or part of an miRNA comprising all or part of the sequence of a miRNA, lt; RTI ID = 0.0 &gt; miRNA-based &lt; / RTI &gt; molecules capable of forming duplexes with miRNAs. In one embodiment, it is an RNA-RNA duplex. Thus, the term "antisense oligonucleotide" as used herein may be referred to as "complementary nucleic acid-based inhibitor &quot;.

The antisense oligonucleotides include various molecules such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomir, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, Thioate-backbone ribonucleotide, a PNA (peptide nucleic acid) oligonucleotide or a LNA (locked nucleic acid) oligonucleotide. Preferably a ribonucleic acid.

LNA is a modified ribonucleotide with an additional bridge between the 2 'to 4' carbons of the ribose sugar site to have a locked form, whereby the oligonucleotide with the LNA has improved thermal stability.

PNA (peptide nucleic acids) include peptide-based backbones instead of sugar-phosphate backbones. The 2'-O-modified oligonucleotides are preferably 2'-O-alkyl oligonucleotides, more preferably 2'-OC _1-3 alkyl oligonucleotides, and most preferably 2'-O-methyl oligonucleotides to be.

The antisense oligonucleotides include antisense oligonucleotides in the narrow sense, antagomir and inhibitory RNA molecules described below.

As used herein, the term " antagomir "is a single-stranded chemically modified oligonucleotide that is used for the silencing of endogenous microRNAs. Antagomir contains sequences that are not complementary to the Arganoute 2 (Ago 2) cleavage site, or that the base is modified to, for example, a 2 'methoxy group, a 3' cholesterol group or a phosphorosioate to inhibit Ago2 cleavage And has a complementary sequence to the target sequence. An antagonist according to the present invention has a sequence which is at least partially or completely complementary to the seed sequence of miR-204, in particular miR-204, in particular all or part of the miR-204-5p, . In one embodiment, the antigomere comprises one or more modifications (e. G., 2'-O-methyl-sugar modifications, or 3'cholesterol modifications). In other embodiments, the antigomere comprises at least one phosphorocytoate linkage and at least partially has a phosphorothioate backbone.

The length of a suitable antisense oligonucleotide or antagonist to inhibit miR-204 according to the present invention is limited to 6-50 nucleotides, especially 10-40 nucleotides, more particularly 15-30 nucleotides, even more particularly 15-25 nucleotides, And may include various lengths as long as the effect according to the present invention is achieved.

As used herein, the term "complementary" means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively to the miR-204 target under certain hybridization or annealing conditions, preferably physiological conditions, and is partially or partially substantially complementary Substantially complementary &quot; and &quot; perfectly complementary &quot;, and preferably means completely complementary. Substantially complementary, although not entirely complementary, is intended to mean a complementarity sufficient to bind to the target sequence to effect an effect herein, i. E., Sufficient to interfere with the activity of miR-204.

As used herein, the term "nucleic acid" includes polynucleotides, oligonucleotides, DNA, RNA, and analogs and derivatives thereof such as peptide nucleic acids (PNA) or mixtures thereof. The nucleic acid can also be single or double stranded and can encode molecules including polypeptides, mRNA, microRNA or siRNA, and the like.

In one embodiment according to the present disclosure, a substance capable of inhibiting the activity of miR-204 is complementary to all or part of the precursor and / or maturation sequence of miR-204, in particular to the seed sequence, Lt; / RTI &gt; oligonucleotides. The inhibition of this activity is to inhibit the transcription of miR-204 and / or the binding of miR-204 to the target mRNA. An antisense oligonucleotide according to the present invention may or may not include one or more of the following modifications of the backbone (skeleton) connecting the nucleotides or nucleotides constituting the antisense oligonucleotide. That is, the antisense oligonucleotide may comprise 2'-O-methylation of one or more nucleotides constituting the LNA or a sugar of one or more nucleotides constituting the antisense oligonucleotide, or one or more phosphotioates in its backbone.

In one embodiment according to the present disclosure, the antisense oligonucleotide or nucleic acid molecule of the present disclosure comprises a sequence complementary to all or part of the sequence of miR-204, particularly miR-204-5p. Seed sequences are conserved sequences that are conserved in a variety of species that are critical for the recognition of target molecules of miRNAs (Krenz, M. et al., J. Am. Coll Cardiol. 44: 2390-2397 (2004); H. Kiriazis, et al., Rev. Physiol. 62: 321 (2000)). Since miRNA binds to the target through the seed sequence, it can effectively suppress the translation of the target mRNA when the interaction of the seed sequence with the target is inhibited. In one embodiment according to the present application, all or part of the nucleotide sequence of nucleotides 1 to 8 of the nucleotide sequence of SEQ ID NO: 1, for example all or part of the nucleotide sequence from the 2nd to 7th nucleotides in the nucleotide sequence, For example, the antisense oligonucleotides herein are 5'-AAGGGA-3 '(SEQ ID NO: 4) or 5'-AAAGGGAA-3' that can bind to all or part of the seed sequence of miR- (SEQ ID NO: 5); Or 5'-AGGCAUAGGAUGACAAAGGGAA-3 '(SEQ ID NO: 6), or the AGGCAUAGGAUGACAAAGGGAA may be a miR-204-5p sponge sequence repeated three or more times over a linker region within and outside the 10-nucleotide. The sponge sequence may be operatively linked to a plasmid and introduced into a plasmid. Such a sequence binds to the seed sequence of miR-204-5p to prevent miR-204-5p from binding to the target, thereby inhibiting its activity. Wherein one or more nucleotides constituting the oligonucleotide are 2'-O-methylated, or each of the one or more nucleotides is LNA, or at least one of the chemical bonds constituting the backbone may be a phosphothioate, . &Lt; / RTI &gt;

As mentioned previously, the composition according to the present invention can treat bone-speckled salts by regulating the synthesis of PG in chondrocytes and reversing the imbalance of cartilage matrix metabolism.

The term "treatment ", as used herein, refers to any act that improves or alleviates the symptoms of arthritis or a disease caused by the administration of a composition according to the invention. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data presented by the Korean Medical Association, and to judge the degree of improvement, improvement, and cure.

As used herein, the term "prophylactic" means any act that inhibits or delays the onset of a related disorder. It will be apparent to those skilled in the art that the compositions herein may prevent early onset symptoms, or related disorders when administered prior to appearance.

In addition to the above-mentioned active ingredients, the composition of the present invention may contain, in addition to the substances capable of inhibiting the activity of miR-204 of the present invention, one or more active ingredients exhibiting the same or similar functions in relation to the treatment of diseases and / And may further contain a compound that maintains / increases water absorption.

The composition of the present invention may further comprise one or more pharmaceutically acceptable diluents, carriers and / or adjuvants in addition to the above-mentioned active ingredients. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and one or more of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injection formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Can further be suitably formulated according to the respective disease or ingredient according to the appropriate method in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA have. For example, as solutions, emulsions and liposomes, and the like. For example, the active ingredient may be formulated into tablets, capsules, gels, syrups or suppositories by mixing with pharmaceutically acceptable liquid and / or solid carriers or excipients of fine powder. The composition according to the invention may also be prepared as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further comprise a material that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran.

If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, it can be formulated into injection formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Can further be suitably formulated according to the respective disease or ingredient according to the appropriate method in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA have.

The method of administration of the composition of the present invention is not particularly limited thereto, and the known method of administering the inhibitor may be applied. Depending on the intended method, parenteral administration (for example, local administration in the joint cavity) or oral administration In the case of parenteral administration, it can be administered through a patch type attached to the skin.

The composition according to the present application is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically or therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type, severity, The activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage ranges vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and a proper dosage is, for example, And / or the degree of specific activity of the polynucleotide used. It may be calculated on the basis of the EC ₅₀ generally measured as effective in the in vivo animal model and in vitro, for example from 0.01 μg to 1 g per kg of body weight, and may be calculated on a daily, weekly, monthly or yearly basis , May be administered once or several times per unit period, or may be continuously administered for a long period using an infusion pump. The number of repeated administrations is determined in consideration of the duration of the drug in the body, the drug concentration in the body, and the like. The composition may be administered for recurrence, even after treatment according to the course of the disease treatment.

In the case of antisense oligonucleotides, siRNA, shRNA preparations, parenteral administration may be preferred but not excluding other routes and means. In the case of typical medicaments, the dosage unit comprises, for example, from about 0.01 mg to about 100 mg, but does not exclude the following ranges and above. The daily dose may be about 1 μg to 10 g, and may be administered once a day or divided into several times a day.

The active ingredients according to the present invention, for example antisense oligonucleotides, may be used in the composition as such or in the form of pharmaceutically acceptable salts. A pharmaceutically acceptable salt means that the undesirable toxicity is minimized while maintaining the biological activity of the polynucleotide according to the present invention. Such salts include salts formed with metal cation such as, for example, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, But are not limited to, salts formed with cations derived from N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine. no.

In one embodiment according to the present application, the active ingredients of the present invention, such as antisense oligonucleotides, are negatively charged due to the nature of the nucleotides thereof. Due to the lipophilic nature of the cell membrane, the uptake of antisense oligonucleotides into the cell membrane can be reduced. Absorption inhibition due to this polarity can be overcome through the prodrug approach described below (Crooke, RM (1998) in Crooke, ST Antisense research and Application, Springer-Verlag, Berlin, Germany, vol. 103-140).

MiR-204 molecules according to the present disclosure may be up-expressed in arthritis due to aging or other stresses as disclosed herein, and may be useful in the diagnosis of arthritis.

In another aspect, this disclosure relates to a kit or method for the diagnosis of arthritis, comprising the miR-204 nucleotide sequence, a complementary sequence thereof, or a fragment of the sequence as an arthritic diagnostic marker.

The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally comprise reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus Thermostable DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

According to a preferred embodiment of the present invention, the kit of the present invention may be a microarray. According to a preferred embodiment of the present invention, the kit of the present invention is a gene amplification kit.

When the kit of the present invention is a microarray, the probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer. The probe or primer specifically recognizes miR-204 according to the present invention and has a sequence complementary to the sequence. The term "complementary " as used herein means having complementarity to selectively hybridize to the nucleotide sequence under certain hybridization or annealing conditions, as defined above, and the probe or primer of the present invention May have one or more mismatch nucleotide sequences so long as they are capable of selectively hybridizing to the nucleotide sequence in addition to being fully complementary. The nucleotide sequence of the miRNA of the present invention to be referred to in the preparation of the primer or probe can be confirmed by the sequence disclosed herein or miRBase, and a primer or a probe can be designed with reference to this sequence.

In another aspect, the invention provides a method of detecting miR-204, comprising: detecting expression of miR-204 from a sample; And a method of detecting the miR-204 marker to provide information necessary for diagnosis or prognosis of arthritis, comprising the step of associating the expression level of the detected marker with the diagnosis or prognosis of arthritis of the test subject.

In the method according to the present invention, the associating step compares the expression amount of the determined marker with the detection result for each marker determined in the normal control group, wherein the expression level is increased as compared with the normal control group.

Further, the method according to the present invention may further use the non-marker clinical information of the subject to be tested for seizure disease upon diagnosis of arthritis or prognosis of the test subject. The non-marker clinical information of the subject includes, but is not limited to, the age, sex, weight, diet, body mass, baseline disease, and ultrasound of the subject.

The degree of expression of the miRNA analyzed by the kit or method of the present invention, such as RT (reverse transcriptase) -PCR or real-time-PCR (see Sambrook, J. et al., Molecular Cloning. For example, about 1.5 times or more, preferably twice or more than that of the normal control, the expression level measured by the method described in the Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001) (subject) has arthritis or has a high risk of onset.

The present invention also identifies the upstream regulator of miR-204 and the target gene of miR-204, which are important regulators of PG synthesis in chondrocytes, and screening for substances that inhibit the expression or activity of miR-204 is used to treat arthritis Can be developed.

In this respect, the present invention relates to a method of screening a therapeutic for arthritis comprising the steps of:

contacting miR-204 RNA with the test material; And determining the activity of the miR-204 RNA contacted with the test substance, wherein the activity of the contacted miR-204 is decreased compared to the activity of the control miR-204 RNA not contacted with the test substance And screening the therapeutic agent for arthritis.

In one embodiment according to the present application, said miR-204 RNA is provided in the form of a cell expressing said miR-204 RNA, said activity being analyzed by expression of said miR-204 RNA. For example, after contacting a cell expressing miR-204 according to the present invention with a test substance, a change in the amount of miR-204 compared to that of the control cell before or after the contact, Is selected as a candidate substance. The expression level of miR-204 used in the method according to the present invention can be performed using known methods such as Northern blot, RT-PCR, hybridization method using a microarray, and the like.

In another embodiment, the miR-204 RNA is provided in the form of a cell expressing the miR-204 RNA, wherein the activity is a carrier of UDP-GlcA and UDP-GalNAc, which are repeating building blocks per CS peat target of the miR- Acting SLC35D1 52 ; CHSY1 and CSGALNACT2 ( 53, 54 ) involved in the elongation of the CS chain; The enzymes CHST11 and CHST15 ( 55, 56 ) required for the GalNA sulfation of the chain; And by analyzing the interaction of 3'-UTR of HAS2 and HAPLN1 ( 57, 58 ) required for assembly of HA and core protein PG backbone. For example, after contacting cells expressing miR-204 according to the present invention with a test substance, the degree of interaction of at least one, preferably all, of the 3'-UTR with miR-204 is measured before or after the contact Compared to cells, candidates are selected for variation, especially reduction, in their interaction. Methods for detecting RNA-RNA interactions used in the methods according to the present application are known in the art and are described for example in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38 (1): e5 ) Or Yeast two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), and can refer to RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011).

In other embodiments, miRNAs and / or target genes that may be used in the methods herein may also be provided in the form of separate forms, e.g., plasmids or cells expressing them. In the case of a cell, it may be a cell strain expressing or overexpressing the substance employed in the method of the present invention, either internally or by introduction of a plasmid expressing it (transient or stable delivery).

In one embodiment, the cell line that may be used in the method according to the present invention includes, but is not limited to, primary cultured chondrocytes, primary cultured chondrocytes derived from degenerative arthritis patients, SW1353 cell line.

In another embodiment, the cell line comprises cells comprising a human chondrocyte cell line comprising C20A4, TC28A2, or C28I2: or a mouse cartilage cell line comprising H4 mouse conglucoside (RRID: CVCL_W634), ATDC5, or MC615, But is not limited thereto.

In one embodiment, the activity is determined by expression analysis of the miR-204 RNA in the cell line, wherein the cell is a transcription factor that binds to the GATA motif as an upstream modulator of miR-204 expression, such as GATA4 (human GATA4 protein sequence NCBI database NF-KB (human NF-KB protein: NP068810.3, NP001138610.1, NP001230913.1, NP001295022.1, NP002043.2, NP001295023.1, nucleic acids: NM001308093.1, NM002052.4, NM001308094.1) NP001230914.1, nucleic acids: NM021975.3, NM001145138.1, NM001243984.1, NM001243985.1) or NF-kB (Nuclear Factor kappa B) (protein sequence NCBI database: NP_001158884.1 NP_001306155.1 etc.) Lt; / RTI &gt; The candidate substance can regulate the expression (transcription) of miR-204 through regulation of the above-mentioned regulator. For example, a substance that inhibits the transcription of miR-204 may be screened through the system described in Figs. 12 (c) and 12 (e) and the promoter that can be used in the system is shown in SEQ ID NO: 7.

The type of cells used and the amount and type of the test substance used in the present method will depend on the specific experimental method used and the kind of the test substance. Those skilled in the art will be able to select appropriate cell types, amounts and / or conditions. As a result of the experiment, a candidate substance is selected as a candidate substance which causes a decrease in activity of miR-204 RNA in the presence of the test substance as compared with the control substance not in contact with the test substance. Less than about 99%, less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70% less, less than about 65% , About 55% reduction, about 50% reduction, about 45% reduction, about 40% reduction, about 30% reduction, about 20% reduction or less.

In one embodiment, a substance that is likely to inhibit the expression or activity of miR-204 is used as the test substance. As mentioned earlier, miR-204 activity is able to inhibit its binding to its target gene. In another embodiment, a substance capable of inhibiting the transcription of the gene encoding miR-204 is used as the test substance.

As used herein, the term "test substance" means a substance that is expected to inhibit the activity of miR-204 RNA as described above, and may be a low molecular weight compound, a high molecular weight compound, a mixture of compounds (e.g., a natural extract or a cell or tissue culture) , Or biopharmaceuticals (e.g., proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzymes and DNAzymes) or sugars and lipids. The test substance may be a polypeptide having two or more amino acid residues, such as six, ten, twelve, twenty or fewer or more than twenty such as 50 amino acid residues. The test materials can be obtained from libraries of synthetic or natural compounds, and methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich Available from MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, &quot; 1-bead 1-compound &quot; library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

In one embodiment according to the present application, for the purpose of screening a drug, a compound having a therapeutic effect of a low molecular weight may be used. For example, compounds having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may constitute a part of a library of compounds, and the number of compounds constituting the library may vary from several tens to several millions. Such a library of compounds can be prepared by reacting peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on a template, such as benzodiazepines, hydantoins, biaryls, carbocycles, and polycycle compounds such as naphthalene, Carbodihydrate and amino acid derivatives, dihydropyridines, benzhydryls and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is merely exemplary It is not limited thereto.

For example, biologics can also be used for screening. Biologics refers to a cell or a biomolecule, which refers to a substance produced using biomolecules, proteins, nucleic acids, carbohydrates, lipids, or in vivo and in vitro cell systems. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, proteins or biological organic materials found in polynucleotides, peptides, antibodies, or other plasma.

Example

Experimental Method

Design of experiments

The purpose of this study is to identify miRNAs associated with the progression of degenerative arthritis and to develop strategies for treatment with miRNA inhibitors. As the importance of cellular senescence increases in the progression of degenerative arthritis, we aimed to select miRNAs that effectively mitigate the senescence phenotype in chondrocyte and treat degenerative arthritis by inhibiting miRNA function. To do this, we performed paired analysis of knee joint cartilage tissue from degenerative arthritis patients. We analyzed the function of miRNA and antimiR inhibitors using aging and post traumatic degenerative arthritis mouse models. The mice used in the experiments were randomly assigned to each group and all samples were analyzed by bladder assessment. The number of experimental groups was determined through previous studies, and no specific samples were excluded from the analysis. For each experiment, the number of experimental groups is an independent number of repeated experiments and is described in the description of each drawing. Experiments involving analysis of human derivatives and animal experiments were approved by the relevant ethical review body.

Statistical analysis

For cell experiments, each experiment was independently performed at least three times. Comparisons of the experimental groups were made through two-tailed Student's t test or ANOVA with post hoc test (LSD) for the parametric test. In animal experiments at an individual level, one mouse was used as each independent trail. A non-parametric test for animal testing was conducted using the Mann-Whitney U test or the Kruskal-Wallis test with Mann-Whitney U test for comparison of multiple study groups. P-value <0.05 was statistically significant. All statistical analyzes were performed using the IBM SPSS Statistics 23 program.

Mouse Degenerative Arthritis Experimental Model

All animal experiments were approved by Seoul National University Animal Experimental Ethics Committee. The design, analysis and reporting of animal experiments proceeded according to the ARRIVE code. Animals were raised at Seoul National University Asterile (SPF) facility. Wild-type male C57BL / 6N mice were used in the experiment. FITC-miRNA transfection experiments were performed with 5 μg of FITC-labeled miR-Ctrl in a 10 μl transfection mixture (1.2 μl of in vivo-jetPEI® (Polyplus), 5% glucose, 0.2 mg of miRNA / kg) was performed by intra-articular injection of the knee. FITC delivery was analyzed two days after intra-articular injection. Intra-knee miRNA delivery experiments were performed by injecting 10 μg of miR-Ctrl or miR-204 into a 10 μl transfection mixture (1.2 μl of in vivo-jetPEI® (Polyplus), 5% glucose, 0.4 mg of miRNA / kg) . In the case of spontaneous degenerative arthritis induction experiment, miR-Ctrl or miR-204 was injected into 12 week-old mice for 10 weeks five times and then proceeded through tissue analysis of mouse. Post-traumatic degenerative arthritis model through DMM surgery was induced in 12-week-old mice, and sham operated mice were used as controls. Mice were sacrificed 6, 8, or 10 weeks after DMM surgery. In order to observe degenerative arthritis deepening by miR-204, mice that underwent DMM underwent miR-204 delivery through intramuscular injection of four knees for 6 weeks. In order to observe degenerative arthritis inhibition by antimiR-204, DMM-treated mice received antimiR-204 delivery through intramuscular injection of the knee at five times for 10 weeks. A 24-month-old mouse was used as an aging mouse model. The degree of degeneration of the cartilage was analyzed through the degenerative arthritis deepening analysis using Safranin O staining and OARSI grading system.

Sample collection from human body separated from human body

We collected knee articular cartilage with relatively degenerative arthritis and relatively less affected areas from 10 patients with degenerative arthritis who underwent artificial joint replacement at Seoul National University Boramae Hospital. We approved the study of human derivatives at the Boramae Hospital of Seoul National University and the Bioethics Committee of Seoul National University. Signed a consent form to agree with the IRB study from 10 patients prior to prosthetic arthroplasty.

Cell culture

For primary cultivation of mouse knee articular cartilage cells, femoral condyle and tibial plateau were separated from ICR mice at 5 days after birth and collagenase treatment was performed to remove chondrocytes. Mouse chondrocytes were cultured in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. Cells were cultured at 37 ° C, 5% CO 2, and 3% oxygen. After 3 days of primary culture of mouse chondrocytes, experiments using cells were performed. In the chondrocyte cell culture experiment, cells cultured at 37 ° C, 5% CO 2 and 20% oxygen were subcultured through trypsin treatment. After two passages, P2 cells were used for transcript analysis and Alcian blue staining. SW1353 cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. For primary culture of human articular cartilage cells, femoral condyle and tibial plateau were separated from human cartilage specimens and collagenase treatment was performed as in the previous study. Human chondrocytes were cultured in DMEM / F-12 supplemented with 10% FBS, 1% antimycotics, and 1% antibiotics. Chondrocytes were placed in DMEM supplemented with hyaluronidase type I-S (4 units / ml) for 4 hours before transfection. siRNA, miRNA, and antimiR transfection were performed using METAFECTENE® PRO (Biontex). For the intracellular stabilization of p53, chondrocytes were treated with nutlin-3a.

Human-derived cartilage tissue culture isolated from human body

Fractures of the degenerative arthritis of the cartilage tibial plateau of a patient with degenerative arthritis were cut into 8 mm ³ size and then stained with DMEM / F-12 supplemented with 10% FBS, 1% antimycotics and 1% antibiotics at 3% Cultured. AntimiR transfection was performed with METAFECTENE® PRO, and the tissue was stained 7 days after the 24-hour trait injection.

Histology and immunohistochemical staining

Degenerative arthritis The human body was placed in OCT compound, hardened and frozen to a thickness of 5 μm. For histological analysis of the frozen sections, air-dried for 20 min and then fixed for 10 min with cold acetone. Histological analysis of human derivatives was performed through Alcian blue staining and OARSI grading. Knee joint cartilage tissues collected from mouse models were fixed with 4% paraformaldehyde, decalcified with 0.5M EDTA and processed to produce paraffin blocks. Histologic analysis was performed through Safranin O staining and OARSI grading in 5 μm-thickness mouse joints. Cartilage damage was analyzed by safranin O staining and OARSI grading. Tibial medial hardening is measured as the ratio between cartilage and cortical bone and bone marrow. The formation of the bony spur is accomplished through an analysis of the medial tibia. The synovitis was measured based on the penetration of inflammatory cells in the synovium.

Immunofluorescence

Human-derived or mouse cartilage cells were fixed in 50% methanol and 10% acetic acid fixative, and treated with blocking solution (0.1% BSA, 10% FBS in PBS) three times with PBS. Fluorescence was then labeled using primary and secondary antibodies and DAPI.

Weight load measurement

For weight bearing, the mice were trained more than three times to be stable in the Incapacitance meter, and the mice were allowed to adapt until they did not put one leg on the wall. After confirming that both legs of the mouse were placed on both measurement pads, we measured the weight load that takes 1 second on both legs. After 3 or more measurements, the weight of the legs that underwent the DMM compared to the sham was converted into percentage.

Reporter gene analysis

The miR-204 promoter reporter gene assay was performed as follows. The culture medium containing the Trpm3-miR-204 TSS1 or TSS2 promoter vector and 0.1 μg of the constitutive Renilla luciferase vector for 6 hours was transfected with the medium containing the reagent and FBS for 5 days. The 3'UTR reporter gene assay was performed as follows. 0.225 μg of 3 'UTR vector, 0.1 μg of constitutive Renilla luciferase vector, 50 nM of miR-Ctrl or miR-204 were transfected into chondrocytes for 24 hours and cultured for another day. The reporter gene activity of cell lysate was analyzed using Dual Luciferase Assay Kit.

sGAG assay

P0 cartilage cells were transfected with miR-204 or various siRNAs for 24 hours, and then cultured for 3 days in a medium without FBS. After the transfection, cell culture medium was collected daily to analyze the amount of sGAG in the medium. The amount of sGAG in the medium was determined by measuring the absorbance of 525 nM in the DMMB assay. The amount of sGAG was corrected by MTT assay.

MTT assay

The cells were treated with 33 μg / ml of PBS-based MTT solution for 30 min and washed twice with PBS. DMSO was treated for 15 minutes to dissolve the precipitate and the absorbance at 570 nM was measured.

RT-PCR and quantitative RT-PCR

Total intracellular RNA was extracted via TRI reagent and reverse transcribed using EasyScript Reverse Transcriptase (Transgen Biotech). cDNA was amplified by RT-PCR or qRT-PCR. Quantitative RT-PCR was performed using SYBR TOPreal PCR 2x premix (Enzynomics) and the StepOnePlus Real-Time PCR System (Applied iosystems). Quantitative analysis of miRNAs was performed using the miRCURY LNA microRNA PCR kit (Exiqon), and the results were corrected using the U6 snRNA control.

Plasmid

For the reporter gene assay of the miR-204 promoter, the promoter portion of two transcriptional start points of the evolutionarily conserved Trpm3-miR-204 was amplified from genomic DNA and inserted into the pGL3-basic vector. Anticipated binding sites in target genes of miR-204 were predicted via TargetScanHuman 7.0. The 3'UTR containing the miR-204 binding site was inserted 3 'downstream of the luciferase gene of the pGL3-UC vector. For a gene with one miR-204 binding site, a 300 bp centered on the binding site was inserted. For genes with multiple miR-204 binding sites, we inserted all binding sites and sites containing 300 bp of the surrounding sequences. The entire 3'UTR region was inserted for genes that did not have the miR-204 binding site. The mutant 3'UTR vector was constructed by replacing the entire miR-204 binding site (5'-AAGGGA-3 ') with an arbitrary sequence (5'-CGTACC-3'). For the immunofluorescence of p16 ^INK4a , the translational sites of the p16Ink4a and p19Arf genes were extracted from the reverse transcriptase of mouse chondrocytes and inserted into the pcNA3-HA vector.

SA-β-Gal staining

Chondrocyte cells were washed twice with PBS and fixed with 2% PFA and 0.2% glutaraldehyde for 5 minutes. And stained in SA-β-Gal stain for 12-16 hours at 37 ° C. After staining, the cells were washed twice with PBS, air-dried, and imaged using an Eclipse Ni-U microscope (Nikon). The number of total cells and the number of cells showing SA-β- The results are shown in Fig.

Immunoblot

HEK293T cell line was transfected with pcDNA3-HA, pcDNA3-HA-p16 ^Ink4a , or pcDNA3-HA-p19 ^Arf plasmid and PEI complex. Mouse cartilage cells were transfected with miR-Ctrl or miR-204. Cells were resuspended in RIPA buffer containing protease inhibitor after two washes of PBS. 50 μg of lysate was separated by 12.5% SDS-PAGE gel and transferred onto NC membrane. Membrane was blocked with TBS-T containing 3% skimmed milk powder, followed by ECL substrate and LuminoGraph II System after treatment with primary antibody (4 ° C, 12 hr) and secondary antibody (room temperature, 1 hr) .

Inducing DNA damage in cartilage cells

DNA damage induction by doxorubicin in mouse chondrocytes was induced by treatment for 5 days, and induction of DNA damage by bleomycin was induced by temporary treatment for 1 day and further cultured in fresh medium for 3 days. DNA damage induction by ionizing radiation (IR) was carried out by irradiating 4 Gy / min gamma ray using a GC 3000 Elan irradiator (MDS Nordion). Cells were analyzed after 5 days of IR. To produce oxidative stress in mouse cartilage cells, hydrogen peroxide or menadione was treated for a defined concentration and time in a medium without sodium pyruvate. The siRNA or antimiR transfection was carried out for 2 days and 24 hours after IR irradiation, and the cells were further cultured for 2 days in fresh medium. Doxorubicin was treated for 14 days to induce cell senescence in human derived chondrocytes.

Agarose culture of cartilage cells

Three-dimensional culture of chondrocytes was performed by culturing in agarose gel. Chondrocytes cultured for 24 hours with miR-Ctrl or miR-204 (100 nM) were cultured for 2 days and lysed with 2% low melting agarose, 2% FBS, The cells were cultured in agarose gel medium containing 1% HEPES, 1% penicillin / streptomycin and DMEM. The cells were cultured in a 24-well plate for 14 days, fixed with 4% PFA for 3 days, processed and sectioned to a thickness of 7 μm. Cell ECM was stained with Alcian blue staining and the thickness of ECM was measured using Image Pro Premier software (Media Cybernetics).

miRNA alignment hybridization technique

The miRCURY LNA detection probes (5 'and 3' DIG-labeled, Exiqon) for miR-204-5p and U6 snRNA were used to perform in situ hybridization. The cartilage slice was treated with 5 μg / ml proteinase K for 30 min at 37 ° C and post-fixation with 4% PFA for 20 min. Probe was treated overnight and then stained with anti-DIG-AP antibody (Roche) and NBT / BCIP (Sigma Aldrich).

in silico analysis of miR-204 promoter region

Trpm3-miR-204 The promoter region of TSS1 and TSS2 was analyzed by the ECR browser (https://ecrbrowser.dcode.org) according to reference (22) and the Evolution Conservation Area (ECR) was selected. A region of about 1.3 (TSS1) and 1.0 (TSS2) kb upstream from each TSS was selected as the promoter region. Analysis of the binding site for the putative transcription factor was performed by minSUM cutoff by TRANSFAC 7.0 (Biobase).

Small RNA sequencing

Total RNA was extracted from P0 or P2 mouse chondrocytes using TRI reagent. The small RNA sequencing library was generated by Macrogen using the TruSeq small RNA library preparation kit (Illumina) according to the manufacturer's instructions. To summarize, small RNA fragments (17-25 nt) are gel purified and then ligated sequentially to 3 'and 5' adapters. The ligated RNA was reverse transcribed and amplified by PCR, and the PCR products were sequenced by HiSeq 2500 System (Illumina).

Small RNA Sequencing

In the data processing, the Truseq 3 'adapter sequence was removed from the FASTQ file, and readings shorter than 18 nt were filtered using cutadapt (45). Next, use the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) to generate low-quality leads (phred quality <20 or <30 in> 95% or> 50% of nucleotides) Deleted. The treated leads were aligned to the Mus musculus reference genome (mm10) with the -n 3 (46) option of BWA. We selected the alignment result as the best alignment score to amplify the mapped leads. The best sorting score only uses a custom script to allow discrepancies in the lead at the end of the 3 '. The miRNA coordinates of miRBase V21 miRNA (miRBase V21) and redundant lead values were confirmed by BEDTools' intersectBed and used for further analysis. We found a differentially expressed miRNA between senescent chondrocytes (49) consistent with the control using a general linear model (GLM) embedded in the edgeR library. The P value was calculated by the likelihood ratio test and adjusted by the Benjamini-Hochberg procedure. The cutoff for differential miRNA expression was set to FDR <0.0001.

RNA sequencing

Mouse chondrocytes were transfected with 50 nM miR-Ctrl or miR-204 mimic for 24 hours and cultured in fresh medium for 48 hours. Four biological replicates were used for each experimental group. Total RNA was isolated using TRI reagent. A cDNA library was obtained with the TruSeq Stranded mRNA LT sample preparation kit (Illumina) using 1 microgram of total RNA (RIN> 9.5). The final cDNA library was quantified with qRT-PCR (Kapa Library Quant. KIT, Kapa Biosystems) using an Agilent 2100 Bioanalyzer, and the size distribution was normalized to 2 nmol / L for sequencing. RNA sequencing was performed using the HiSeq 2500 System, and the RNA sequencing procedure was performed by Macrogen. The lead was processed using the TopHat program and aligned to the reference genome (mm10). TopHat integrated the Bowtie v2.2.3 (2) algorithm for sorting, and the reference genome sequence and annotation data was downloaded from the UCSC genome browser (http://genome.ucsc.edu). Gene annotation information is used to run TopHat using the "-G" option while setting other parameters to default values. After aligning leads with the genome, we used Cufflinks v2.2.1 to compile the sorted leads into copies and estimate the amount. mRNA transcripts were quantified by calculating fragments per FPKM (fragments per kilobase per million mapped read) using Cufflinks. For statistical analysis of gene expression, genes with zero FPKM in one or more specimens were excluded. Quantile normalization of the samples was performed using log2 (FPKM + 1) values. Statistically significant gene expression between miR-Ctrl and miR-204 transduced chondrocytes was set at a detection P value of less than 0.05.

Bioinformatics analysis of RNA sequencing data and open data

Four sets of genes were classified according to co-expression patterns using a hierarchical clustering algorithm based on Pearson correlation, Euclidean distance, and Ward criterion among differentially expressed genes constructed based on detection P value <0.05. . The analysis used R version 3.3.2. Based on the TargetScan, the estimated P value of the predicted miR-204-5p target genes was calculated and the enrichment socre of the target gene was measured in each group. We used Enrichr (http://amp.pharm.mssm.edu/Enrichr/) to analyze the gene ontology of four clusters. In cluster 2, the top four terms of KEGG, Reactome, and HumanCyc were selected as Enrichr combined score. In clusters 1, 3, and 4, the top terms of KEGG, Reactome, and HumanCyc were selected by the Enrichr total score and the combined scores were displayed. PG biosynthetic pathways are obtained from Ingenuity Pathway Analysis (https://www.qiagenbioinformatics.com/products/ingenuity-pathwayanalysis/). The difference in the components of the path is indicated by the difference in color. To analyze the extent of miR-204 target gene enrichment in OA cartilage, the number of duplicated genes between predicted target transcripts of 41 miRNAs that were statistically significantly increased and degenerative arthritis and degenerated sets of genes in aging cartilage was determined. In the case of GSEA, the gene list of GSE57218 or GSE41342 was sorted according to the fold change. The GSEA software was used in a re-ranked mode of both baseline criteria for GSEA analysis of a list of genes reduced in OA or elderly cartilage.

[Table 1] Sequence of siRNA, miRNA and antimiR

[Table 2-1] PCR primer sequences used in the present invention

[Table 2-2] The PCR primer sequences used herein

Table 3 PCR Primer List for Cloning used herein

Example 1: Up-expression of miR-204 in human and mouse OA (osteoarthritis) cartilage

This example attempts to identify previously unknown aging-related signaling pathways in chondrocytes associated with major OA cartilage indications such as PG loss and cartilage degeneration. Long-term normoxia effects on primary cultured cells are known (25-27). The physiological niches in which chondrocytes are separated are at low oxygen tension (0.5-5%) (28). Primary mouse chondrocytes cultured at concentrations higher than physiological oxygen concentrations herein showed extensive oxidative stress as evidenced by an increase in the lipid peroxidation product, 4-hydroxynonenal (4-HNE) (FIG. 1B). Chondrocytes exposed to normal oxygen concentration (ie, the second passage) not only showed DNA damage responses as seen from the intense gamma-H2AX nuclear ^envelope , but also induce p16 ^INK4a , upregulate Cdkn1a and Cdkn2a, downregulate Lmnb1 , And increased SA-beta-Gal positivity (Fig. 1A and Figs. 1C to IE, Fig. 8A). Chondrocytes in this state also stopped the active synthesis of sulfated PGs (Fig. 1F).

Herein, small RNA sequencing was performed on chondrocytes that were successively subcultured under normal oxygen concentration (Fig. 7A). As a result, a total of 41 miRNAs were identified as differentially up-regulated miRNAs with the onset of aging (Fig. 7B). In particular, miR-204 had significant differences in terms of positive (18.1-fold increase) FDR (false discovery rate, FDR, 1.66 x 10-60) (Figure 1G and Figure 1C). Using the targetScan algorithm (30), 41 differentially up-regulated miRNA target transcripts were predicted and compared with OA and aging cartilage transcripts. In particular, the predicted targets of three different miRNAs, miR-204-5p and miR-24-3p, miR-27b-3p and miR-30a-3p, were focused on OA and a set of white control genes of aging cartilage ). Furthermore, it has been shown that miR-204, rather than miR-24, miR-27b or miR-30a, inhibits the neo-synthesis of sulfated GAG (sGAG) in chondrocytes, an OA-associated phenotype observed in aged chondrocytes (Fig. 1I). Therefore, based on the above results, we examined the relationship between miR-204 and the pathogenesis of OA.

Here we characterize miR-204 expression in human and mouse OA cartilage. The miR-204 concentration was increased in human cartilage affected by OA but hardly detected in the undamaged articular cartilage area. This expression pattern is related to the expression pattern of p16INK4a (FIG. 1J), a biomarker of cell senescence. In an aging mouse model in which the OA phenotype was expressed in articular cartilage of the knee joint, miR-204 expression was significantly elevated with the expression of p16INK4a (Fig. 1K and Fig. 2B). We also used the instability of DMM (Destabilization of Medial Meniscus) as a mouse model of post-traumatic osteoarthritis (33, 34). Consistent with previous studies showing that mechanical instability of the joints causes aging of cartilage cells, we have found a significant increase in p16INK4a and miR-204 levels after surgical induction of OA (Fig. 1L and Fig. 8C). Gene set enrichment analysis (GSEA) analysis showed that the target gene of miR-204 was also negatively enriched in the entire transcript of OA cartilage. Indicating that upregulation of miR-204 plays a role in inhibiting the target gene in OA conditions (FIG. 1M).

Example 2 Induction of miR-204 Expression by Aging-Induced Stress

In this example, miR-204 was investigated for the up-regulation of miR-204 transcription induction in order to study the molecular mechanism of upregulation in OA cartilage. The role of ROS in miR-204 expression control was analyzed (FIG. 1B, FIG. 1G and FIG. 7C), noting the crucial importance of oxidative stress in OA and the miR-204 expression pattern correlated with oxidative stress. The role of ROS in the regulation of miR-204 expression in chondrocytes was analyzed. In primary cultured mouse chondrocytes, acute treatment with menadione or hydrogen peroxide (H2O2), which is a free radical generator, did not affect miR-204 expression, indicating that the short term redox signal is not a parental regulator (Fig. 2A) .

Interestingly, prolonged exposure to H2O2 (7 days) significantly induced miR-204 expression with accumulation of DNA damage and induction of senescence markers (Figures 2B-2E). In addition, we examined whether other aging-induced stimuli also affect miR-204 expression. Ionizing radiation (IR), which causes DNA damage and cell senescence in chondrocytes, strongly induced the expression of miR-204 (FIG. 2H, FIG. 2F and FIG. 2G, and FIG. 3). Chemical agents that damage DNA, such as bleomycin or doxorubicin, have similarly been shown to promote aging phenotype and miR-204 expression (Figs. 2I-2L, Fig. 4).

p53 is activated in response to DNA damage and causes aging-induced cell cycle arrest (37). OA induction conditions, such as mechanical stress, cause DNA damage and activate p53 (38). Therefore, we investigated whether p53 acts as an upstream regulator of miR-204. In chondrocytes, the DNA damage factor markedly promoted the expression of Cdkn1a to activate p53 (Fig. 11A). However, p53 activation induced by nutlin-3a did not increase miR-204 expression (Figure 5b). Consistently, small interfering RNA (siRNA) mediated knockdown of p53 did not affect IR-induced miR-204 expression (Fig. 11, C and D). Similarly, another major aging-related cell cycle arrest regulator, p16INK4a (32), failed to regulate the expression of miR-204 (Fig. 11E and F).

Along with cell cycle arrest, cell senescence causes an inflammatory response called SASP (39). As previously reported (40, 41), SASP occurred relatively slowly and appeared a few days after the onset of aging-mediated cell cycle arrest. In particular, miR-204 expression is consistent with the expression of SASP factors such as Il6 and Mmp3 (Fig. 2M), suggesting that miR-204 and SASP can be regulated by a common upstream regulator. To explore this hypothesis, we first identified promoters that are presumed to regulate transcription of miR-204. miR-204 is located in the intron region of the Trpm3 host gene, and expression of miR-204 and Trpm3 is common (42). Trpm3 mRNA was induced by IR in a dose and time dependent manner consistent with the miR-204 expression pattern (Fig. 2H and Fig. 12A and B). According to genome analysis, Trpm3 has two evolutionarily conserved transcriptional start sites (TSS), TSS1 and TSS2 (FIG. 12C). We have created two reporter constructs that reflect transcription in TSS1 and TSS2. The TSS1 reporter, not the TSS2 reporter, responded to IR exposure (FIG. 12D). TRANSFAC analysis (43) predicted that the transcription factors GATA4 (40) and NF-κB (44) involved in the regulation of SASP would bind upstream of the TSS1 promoter (FIG. 12E). Indeed, miR-204 expression induced by IR exposure or DNA damaging factors was effectively removed by siRNA targeting Gata4 or Rela (Fig. 2N and Fig. 20, and F and G in Fig. 12).

Example 3 Inhibition of Sulfated PG Synthesis and OA Induction in Chondrocytes by miR-204

This example explored the pathophysiological role of miR-204 up-regulated in cartilage cells. The chondrocytes were cultured in a three-dimensional (3D) matrix (45) by direct delivery of miR-Ctrl or miR-204. Matrix-embedded miR-Ctrl-transduced chondrocytes accumulated PG-rich pericellular matrix. In contrast, chondrocytes transfused into miR-204 were significantly reduced in the deposition of extracellular matrix (ECM) (Fig. 3A). Consistently miR-204 delivery reduced the extracellular release of sGAG in chondrocytes (Figure 3B and H in Figure 12).

Because reduction in cartilage matrix performance is a major manifestation of OA chondrocytes, here we examined whether intraarticular (IA) delivery of miR-204 induces OA-related phenotypes in vivo in mice (Figure 3C). A cationic polymer was used as a transfer-inducing reagent that effectively transfers small RNA to mouse knee cartilage. It has been experimentally confirmed that chondrocytes in cartilage ECM are targets of pre-migration by jet injection of jetPEI and FITC-labeled miRNA (FITC-miRNA) complexes. FITC-miRNA was mainly found in cartilage cells located on the surface and in the middle region of articular cartilage (Fig. 13A). In addition, injected miRNAs were found in synovial cells of the joints.

MiR-204 transfer into mouse knee joint tissue resulted in significant PG loss and destruction of natural cartilage, as evidenced by fibrous spasm or fissure, whereas miR-Ctrl transfer affects cartilage (Figures 3D to 3F). Mice that received miR-204 also exhibited moderate subchondral bone sclerosis. Osteoporosis and synovitis were not observed. Immunohistochemical staining analysis revealed an increase in MMP13 levels in articular cartilage cells of mice injected with miR-204, indicating that the degenerative process is progressing in cartilage (FIG. 13D). In contrast, expression of IL-1β, TNF-α or MMP13 was not found in the synovial membrane and was not consistent with the manifestation of synovitis, despite the efficient delivery of miR-204 to synovial cells. Taken together, these results exclude the possibility that the synovial lining inflammatory reaction may contribute secondary to the matrix hyperactivity of articular cartilage (FIGS. 13B and 13C). We then investigated how miR-204 expression affects OA progression after trauma in mice. In contrast to miR-Ctrl delivery, miR-204 delivery significantly accelerated the progression of OA in DMM-induced OA, including cartilage destruction, osteophyte maturation, and synovitis To increase all of the OA related symptoms examined (Figures 3G and 3H).

Example 4. Regulation of PG biosynthetic pathway in chondrocytes by miR-204

In order to clarify the underlying mechanisms by which miR-204 interferes with cartilage homeostasis, RNA sequencing was performed on chondrocytes transduced with miR-Ctrl and miR-204. We wanted to determine functional modules, a set of genes involved in biological processes and controlled by miR-204. We performed hierarchical clustering to arrange downregulated genes differentially according to the co-expression pattern. This clustering revealed four gene sets rich in sequence-based miR-204 targets (A and B in Figure 14). We assume here that this gene set reflects a functional module inactivated by up-regulation of miR-204. Pathway analysis showed that the set of genes identified was related to tin associated with 'proteoglycan synthesis', 'cell cycle' or 'programmed cell death' (FIGS. 14C and D). Because these tins are closely related to cellular aging (49, 50), we analyzed the possibility that miR-204 is the driving force of cell senescence in chondrocytes. However, miR-204 delivery did not directly induce an aging-related phenotype in chondrocytes (Fig. 4, A through D). This suggests that miR-204 has a function of directly inhibiting the PG decrease and is indirectly required for the expression of SASP among the PG reduction, osteoarthritis phenotype, and cell senescence and SASP. (Fig. 5D) However, Figures 4A-D and 5C show that overexpression of miR-204 does not promote cell senescence and miR-204 inhibitors do not inhibit cell senescence.

Among the four functional gene modules, Cluster 2 was the most abundant in the predicted miR-204 target and strongly associated with terms related to the PG biosynthetic pathway (Fig. 14C). Thus, we have assumed that the major miR-204 target is a gene involved in the chondrocyte PG synthesis pathway. GAG chains rich in sulfated PG in cartilage consist of CS (4). Thus, here we describe how miR-204 affects the gene of the PG biosynthetic pathway, including the genes involved in the sulfate backbone assembly, the CS chain extension, and the sulfate linkage to the CS chain derived from the Ingenuity Pathway Analysis (IPA) database 51 (Fig. 4E). At the time of miR-204 delivery in cartilage cells, there was overall downward regulation of the gene including the PG biosynthetic pathway. Specifically, 11 genes involved in the pathway included the putative miR-204 binding site in the 3'UTR, of which 7 were actually down-regulated by miR-204 transfer transduction in chondrocytes.

The seven genes regulated by miR-204 play a crucial role in PG biosynthesis and assembly. SLC35D1 is a carrier that carries UDP-GlcA and UDP-GalNAc, which are components of CS disaccharide repeats (52). CHSY1 and CSGALNACT2 are involved in the elongation of the CS chain (53, 54), while CHST11 and CHST15 are enzymes necessary for the sulfation of GalNAc in the chain (55, 56). HAS2 and HAPLN1 are required for assembly of HA and key protein PG backbones (57, 58). We also used real-time PCR analysis to confirm that the mRNA levels of these genes were inhibited by miR-204 in both primary cultured mouse chondrocytes and human chondrosarcoma cell line SW1353 (FIG. 4F and FIG. 15).

Given the net effect of miR-204 on PG synthesis, we investigated the possibility that miR-204 could regulate the expression of SOX9 and aggrecan even in the absence of the miR-204 standard binding seed sequence in the 3'UTR of these genes. However, mRNA levels of Sox9 and Acan or 3'UTR reporter activity were not affected by miR-204 in chondrocytes (FIGS. 16A and B). Similarly, protein concentrations of SOX9 and aggrecan in whole cell melts were unaffected, which excludes the possibility of regulation at the level of translation by miR-204 (FIG. 16C). We also examined the concentrations of SOX9 and aggrecan in cartilage sections obtained from miR-Ctrl or miR-204 injected mice. The protein level of SOX9 was unaffected, but the protein level of aggrecan was moderately reduced in the miR-204 delivery cartilage (FIG. 16D). Thus, we hypothesized that a decrease in protein concentration of Aggrecan might be related to the overall loss of sulfated PG in the cartilage during OA progression (FIG. 3E). Similarly, the increased concentration of MMP13 (Fig. 13D) in articular cartilage at miR-204 injection was not due to the modulatory role of miR-204 on MMP13 expression (Fig. 4D). This suggests that the reduction of PG synthesis by miR-204 impairs the loading function of cartilage matrix and increases the mechanical stress applied to articular cartilage, thereby inducing the expression of catabolism factors such as MMP13 expression.

Next, we examined which of the miR-204 targets identified herein served as limiting factors for flux regulation through PG synthesis. However, the individual depression results of Slc35d1, Chsy1, Chst11 or Hapln1 did not affect the rate of PG synthesis of cartilage cells (Fig. 4L and Fig. 11S). Here, we have noted the ability of miR-204 to simultaneously target multiple genes involved in PG synthesis. Interestingly, the simultaneous introduction of siRNA targeting Slc35d1, Chsy1, Chstll and Hapln1 markedly reduced PG synthesis in chondrocytes (Fig. 4L). Thus, the results of the present study indicate that these miR-204 targets, when collectively regulated, have a net effect of fine tuning the flux to PG synthesis and emphasize the importance of miRNA's ability to inhibit multiple genes simultaneously will be.

Example 5. Effect of OA treatment by miR-204 antagonistic action

Next, we examined the effect of miR-204 antagonism on sulfated PG synthesis, cartilage cell senescence and OA pathogenesis. Inhibition of miR-204 activity by antimiR-204 increased miR-204 target (Fig. 5A) gene expression and promoted PG neoplastic biogenesis in chondrocytes (Fig. 5B). These results support the fact that miR-204 modulates the sulfated PG biosynthetic pathway. The aging due to DNA damage was not alleviated in chondrocytes by treatment with antimiR-204, consistent with the results of this study showing that aging of cartilage cells alone (Fig. 4A) does not occur only with miR-204 delivery itself 18 A). This indicates that miR-204 delivery itself does not induce cell senescence and that miR-204 inhibitor delivery itself did not inhibit cell senescence, as observed in Fig. 4A at the chondrocyte level. However, as shown in FIG. 5D, SASP, which is one of the sub-phenotypes of cell senescence, specifically showed that expression was decreased by miR-204 inhibitor delivery. However, up-regulation of the SASP factor, which is a delayed response to chondrocyte DNA damage, was effectively abolished by inhibition of miR-204 activity (FIGS. 5D and 18B and 18C) Lt; RTI ID = 0.0 &gt; SASP &lt; / RTI &gt;

Therapeutic effects of miR-204 inhibition in a surgically induced OA model in mice were then investigated (Fig. 5E). IA delivery of antimiR-204 did not affect the normal shape of articular cartilage of the knee joint of sham operated mice (Fig. 19A). DMM-operated mice with antimiR-Ctrl delivered significant cartilage destruction, subchondral bone sclerosis, osteolytic moon and moderate synovial inflammation. IA injection of antimiR-204 significantly improved cartilage destruction and subchondral bone hardening by DMM, and also affected osteophyte maturation and synovial inflammation (Fig. 5, F and G). At the molecular level, miR-204 inhibition in the knee joints of DMM-operated mice led to both simultaneous recovery of sulfated PG synthesis and inhibition of inflammatory SASP factors and inhibition of non-cellular autonomous propagation of cellular senescence in cartilage 5I and Fig. 19B). Also, the weight distribution between the surgically (DMM or sham) treated legs and the untreated legs was measured by the behavioral assessment of OA-induced pain. DMM surgery with antimiR-Ctrl's IA injection reduced the weight of the injured legs. Body weight imbalance due to DMM surgery was alleviated by antimiR-204 (Fig. 5H) treatment. Taken together, this indicates that miR-204 antagonism can effectively treat OA expression in mice.

Example 6. Stress-activated miR-204 as an osteoarthritis therapeutic target

Finally, the applicability of the present results to humans was tested using primary cultured human articular cartilage cells and explants from patients who underwent total knee arthroplasty. In primary cultured human articular cartilage cells, doxorubicin, a DNA damaging chemical, induced cellular aging, as evidenced by SA-β-Gal activity and induction of p16INK4a expression (FIGS. 6, A and B). Aging was further confirmed by examining the expression profiles of aging markers such as up-regulation of CDKN1A and CDKN2A and down-regulation of LMNB1 (Fig. 6C). The expression of miR-204 in these aging-induced human articular cartilage cells was markedly increased (Fig. 6D), indicating that this was a conserved regulatory mechanism of miR-204 expression between human and mouse. Similarly, the mRNA concentration of an identified miR-204 target gene encoding a protein containing the PG biosynthetic pathway was inhibited in human articular cartilage cells transfected with miR-204 (Fig. 6E), indicating that primary cultured mouse chondrocytes And the results of the human chondrosarcoma cell line SW1353 (Fig. 4F and Fig. 15B). Finally, to test the possibility of miR-204 target therapy in clinical OA, we evaluated the effect of miR-204 antagonism on OA cartilage explants from patients who underwent total knee arthroplasty. MiR-204 inhibition in OA engrafted explants clearly restored synthesis of sulfated PG and inhibited the expression of catabolism mediators such as MMP3 and MMP13 (Fig. 6F). These results indicate that miR-204 can be used as a target for the treatment of arthritis in humans.

<110> Seoul National University R & DB Foundation <120> Use of miR-204 inhibitors for treating osteoarthritis <130> DP201808001P <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uucccuuugu cauccuaugc cu 22 <210> 2 <211> 21 <212> RNA <213> Homo sapiens <400> 2 gcugggaagg caaagggacg u 21 <210> 3 <211> 110 <212> RNA <213> Homo sapiens <400> 3 ggcuacaguc uuucuucaug ugacucgugg acuucccuuu gucauccuau gccugagaau 60 auaugaagga ggcugggaag gcaaagggac guucaauugu caucacuggc 110 <210> 4 <211> 6 <212> RNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide <400> 4 aaggga 6 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide <400> 5 aaagggaa 8 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide <400> 6 aggcauagga ugacaaaggg aa 22

Claims (14)

A pharmaceutical composition for treating arthritis comprising a substance that inhibits miR-204 activity or a pharmaceutically acceptable carrier thereof.
The method according to claim 1,
A substance capable of inhibiting the miR-204 activity may be selected from the group consisting of SLC35D1 (UDP-glucuronic acid / UDP-N-acetylgalactosamine dual transporter), CHD1 (Chondroitin sulfate synthase 1), CSGALNACT2 (Chondroitin sulfate N-acetylgalactosaminyltransferase 2), CHST11 (Carbohydrate sulfotransferase 11), CHST15 (Carbohydrate sulfotransferase 15); A pharmaceutical composition for the treatment of arthritis, which is a substance capable of inhibiting the interaction of 3'-UTR and miR-204 of HAS2 (Hyaluronan synthase 2) and HAPLN1 (Hyaluronan and proteoglycan link protein 1) gene.
The method according to claim 1,
Wherein the substance capable of inhibiting the activity of miR-204 is a substance capable of inhibiting its expression or activity.
The method according to claim 1,
Wherein the substance capable of inhibiting the activity of miR-204 is a nucleic acid molecule capable of binding to all or a part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of miR-204.
5. The method of claim 4,
The nucleic acid molecule may be selected from the group consisting of RNA, DNA, antigens, antisense molecules, siRNAs, shRNAs, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, PNA (peptide nucleic acid) oligonucleotide or LNA (oligonucleotide) oligonucleotide.
5. The method of claim 4,
Wherein said nucleic acid molecule is an antisense oligonucleotide of 6 to 100 mer comprising a sequence complementary to all or a portion of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 8.
The method according to claim 6,
The antisense oligonucleotide is one in which at least one nucleotide comprises 2'-O-methylation of a LNA, or a sugar of one or more nucleotides constituting it, or one or more phosphorothioates in its backbone, or a combination thereof &Lt; / RTI &gt;
The method of claim 6 or 7, wherein the antisense oligonucleotide is selected from the group consisting of 5'-AAGGGA-3 '(SEQ ID NO: 4), 5'-AAAGGGAA-3' (SEQ ID NO: 5), or 5'- AGGCAUAGGAUGACAAAGGGAA- SEQ ID NO: 6).
contacting miR-204 RNA with the test material; And
Determining the activity of miR-204 RNA contacted with the test substance,
Wherein the activity of the contacted miR-204 is reduced as compared to the activity of a control miR-204 RNA not contacted with the test substance, the candidate substance is screened.
10. The method of claim 9,
The miR-204 RNA expresses the cells of mouse primary cultured chondrocytes; Primary cultured chondrocytes derived from patients with degenerative arthritis; SW1353 cell line; Human chondrocyte cell line comprising C20A4, TC28A2, or C28I2: or a mouse cartilage cell line comprising H4 mouse conglucoside (RRID: CVCL_W634), ATDC5, or MC615,
Wherein said activity is determined by expression analysis of said miR-204 RNA, wherein said cell further expresses GATA4 and NF-kB as an upper regulator of miR-204 expression.
10. The method of claim 9,
The miR-204 RNA is provided in the form of a cell expressing it,
Wherein said activity is determined by an interaction assay of said miR-204 RNA with its target SLC35D1, CHSY1, CSGALNACT2, CHST11, CHST15, HAS2 or 3'-UTR of HAPLN1.
An arthritic diagnostic kit comprising a material for miR-204 detection.
Providing a sample from a subject requiring progression of arthritis or diagnosis or prognosis;
Detecting the expression of miR-204 in said sample; And
And comparing the expression level of the detected marker with the arthritis or prognosis of the test subject, wherein the expression amount of miR-204 of the test subject in the associating step is higher than that of the control sample, Wherein the marker is diagnosed as arthritis, wherein the marker is detected in Invitro in order to provide information necessary for the degree of progression or diagnosis or prognosis of arthritis.
14. The method of claim 13,
Wherein said sample is cartilage tissue, synovial fluid, blood or urine.

Images