KR20190003383A - A composition comprising an exosome derived from adipose-derived stem cell as an active ingredient and its application for improving dermatitis - Google Patents

Abstract

The present invention provides a composition for preventing, improving, relieving or treating dermatitis which comprises an adipose stem cell originated exosome as an active ingredient. A composition of the present invention acts on multiple cytokine targets which cause dermatitis, and thus widespread application with respect to dermatitis which is result from various causes is possible and dermatitis can be effectively controlled and relieved. Additionally, a composition of the present invention reduces moisture evaporation of a horny layer and improves skin moisturizing to protect and strengthen a skin barrier. Dermatitis can be prevented, improved, relieved or treated through protecting and strengthening a skin barrier. In detail, a composition of the present invention can control cytokine targets which show different expression aspects according to progression of disease of a mild, moderate or serious case, and thus a composition can be applied to prevent, improve, relieve or treat dermatitis of a mild, moderate or serious case. Moreover, cytokine targets which show different expression aspects according to a dermatitis occurring aspect of an acute or chronic case, and thus a composition can be applied to prevent, improve, relieve or treat dermatitis of an acute or chronic case.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a composition containing an exosome derived from an adipocyte stem cell as an active ingredient and a method for improving dermatitis in a composition comprising an exosome derived from an adipose-derived stem cell and an application thereof for improving dermatitis.

The present invention relates to a composition for improving dermatitis in a composition comprising an exosome derived from adipose stem cells as an active ingredient.

The present invention also relates to a pharmaceutical composition for preventing, improving, alleviating or treating dermatitis, an external preparation for skin and a cosmetic composition containing the composition.

Further, the present invention can obtain a large amount of exosomes derived from adipose stem cells having a high purity and a uniform particle size distribution that can be clinically applicable in the prevention, improvement, alleviation or treatment of dermatitis, This invention relates to a clinically and commercially superior technique capable of providing a large amount of a composition containing an exosome derived from an adipose stem cell, which is excellent in activity, as an effective ingredient at a low cost.

The skin of the human body is an organ that physically and chemically protects the body from the outside and performs the biochemical functions necessary for the metabolism of the whole body. In general, inflammatory skin diseases that appear on human skin are called dermatitis. Relatively common dermatitis includes atopic dermatitis, contact dermatitis, and seborrhoic dermatitis.

Contact dermatitis is a dermatitis caused by contact with foreign substances. Contact dermatitis is characterized by irritant contact dermatitis and allergic contact dermatitis, depending on the mechanism by which one substance can cause both of these reactions simultaneously. Most of the substances that cause contact dermatitis are organic compounds. When the dermatitis-inducing substance comes into contact with the skin sensitized to these substances, it is known that the memory cell senses it and secretes various chemicals to cause inflammation.

Atopic dermatitis is a chronic inflammatory skin disease characterized by itchy and eczematous lesions. According to the results of previous studies, it is known that various factors are involved in the onset of atopic dermatitis. When atopic dermatitis is induced, inflammatory cells such as eosinophil, neutrophil and mast cell are observed in the lesion and immunoglobulin IgE produced from mast cells increases. In addition, IL-4, IL-5, and IL-13, which are inflammatory cytokines, are amplified and amplified by this process. Recently, TSLP (Thymic stromal lymphopoietin) has been associated with the severity of dermatitis and it is known to cause itching symptoms in atopic dermatitis. In addition, seborrheic dermatitis is a chronic inflammatory skin disease that occurs due to increased activity of sebaceous gland, which occurs in the scalp and face, especially around eyebrows, nose, lips, ears, underarms, chest, groin and the like.

Based on the results of these studies, there are efforts to develop a treatment for dermatitis through inflammation and immunosuppression. Drug remedies developed to date include steroids, antihistamines, and immunosuppressants such as cyclosporin A. However, these drugs have serious problems such as skin atrophy, vasodilation, pigment desalination, hypersensitivity of injection site, tolerance and neutropenia. In addition, these medicines have limitations that can help control symptoms to an adequate level rather than the underlying treatment.

In view of these problems, studies on the treatment of dermatitis using natural products are actively conducted. In the case of dermatitis treatments using these natural substances as raw materials, since the active ingredient content in the natural extracts is low, it is necessary to use a large amount to obtain the dermatitis treatment effect, and most of them are used for marketing The practical efficacy of treating dermatitis is a more scientific situation.

On the other hand, skin regeneration and treatment methods using stem cells have been proposed. Embryonic stem cells or embryonic stem cells derived from embryonic stem cells are excellent in their ability to differentiate and regenerate and have a low rejection rate. However, they can not be applied to clinical practice due to ethical problems, and there is a risk of forming tumors. As an alternative, skin regeneration and treatment methods using adult stem cells have been proposed. However, when adult adult stem cells use an adult adult stem cell, there is a risk of causing graft-versus-host disease. In order to treat using adult stem cells, There is a complicated and costly problem in that stem cells are collected and cultured.

In recent years, attempts have been made to regenerate and treat skin using a culture solution obtained by culturing adult stem cells in consideration of the problems of stem cells as described above. However, adult stem cell culture contains various proteins, cytokines, and growth factors secreted by adult stem cells. On the other hand, components such as antibiotics and animal-derived serum added to prevent contamination, It is highly likely to be exposed to various risks when used on skin because it is included.

Recently, studies have been carried out on the secretion of a variety of bioactive factors that regulate cell behavior. In particular, exosomes (exosomes), which have intercellular signal transduction, And researches on its components and functions are actively under way.

Cells release various membrane-type vesicles in the extracellular environment, and these release vesicles are commonly referred to as extracellular vesicles (EVs). The extracellular endoplasmic reticulum is sometimes referred to as cell membrane-derived endoplasmic reticulum, ectosomes, shedding vesicles, microparticles, exosomes and, in some cases, differentiated from exosomes.

Exosome is an endoplasmic reticulum of several tens to several hundreds of nanometers in size, composed of double lipid membranes identical to the cell membrane structure, and contains proteins, nucleic acids (mRNA, miRNA, etc.) called exosomal cargo inside. Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells. Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known. Exosomes contain specific genetic material and bioactivity factors depending on the nature and condition of the derived cells. The proliferating stem cell-derived exosomes regulate cell behavior such as cell migration, proliferation and differentiation, and reflect the characteristics of stem cells involved in tissue regeneration (Nature Review Immunology 2002 (2) 569-579).

However, in spite of various studies such as the possibility of treatment of some diseases using exosome, more detailed clinical and non-clinical studies are needed, and in particular, In the treatment of various diseases.

The present inventors have sought to develop a therapeutic agent that is superior in efficacy and safety compared to a conventional dermatitis treating agent in relation to dermatitis accompanied with itching and inflammation. Accordingly, the inventors of the present invention have made intensive studies on the new use of exosomes derived from adipose stem cells, and found that exosome isolated from adipose stem cell culture liquid solves the above-mentioned problems of stem cell itself or stem cell culture solution safety And is effective for preventing, improving, alleviating or treating dermatitis. Thus, the present invention has been completed.

It should be understood, however, that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention, and not as an admission that it can be used as the " prior art "

Korean Registered Patent No. 10-1330686 (Nov. 31, 2013) Korean Registered Patent No. 10-1663912 (October 10, 2016) Korean Patent Publication No. 10-2017-0099743 (2017.09.01) Korean Patent Publication No. 10-2016-0116802 (October 10, 2016)

Pin Li et al., Progress in Exosome Isolation Techniques, Theranostics, 2017, 7 (3): 789-804 (2017.01.26) Coumans et al., Methodological Guidelines to Study Extracellular Vesicles, Circulation Research, 2017, 120: 1632-1648 (Jul.

An object of the present invention is to provide a composition for improving dermatitis of a composition comprising an exosome derived from adipose stem cells as an active ingredient. In particular, it is an object of the present invention to provide a method for treating dermatitis, which can act on multiple cytokine targets causing dermatitis and thus can be widely applied to dermatitis caused by various causes, effectively inhibiting and alleviating dermatitis, Preventing, ameliorating, alleviating or treating a disease or condition.

Another object of the present invention is to provide a pharmaceutical composition for preventing, improving, alleviating or treating dermatitis, an external preparation for skin and a cosmetic composition containing the composition.

It is still another object of the present invention to provide a method for producing an exosome derived from adipose stem cells having high purity and having a uniform particle size distribution in a large amount and to provide an exosome derived from adipose stem cells having excellent functional activity thus obtained as an active ingredient And to provide a composition which can be used as a composition.

It is still another object of the present invention to provide a method for preventing, improving, alleviating or treating dermatitis using the composition.

It is still another object of the present invention to provide a cosmetic method for controlling the condition of mammalian skin except for therapeutic use using the above composition.

However, the above-described problems of the present invention are illustrative and not intended to limit the scope of the present invention. Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

In order to achieve the above object, the present invention provides a composition for preventing, improving, alleviating or treating dermatitis, which comprises an exosome derived from adipose stem cells as an active ingredient.

In addition, the present invention can obtain a large amount of exosomes derived from adipose stem cells having a high purity and a uniform particle size distribution that can be clinically applicable in the prevention, improvement, alleviation or treatment of dermatitis, The present invention provides a novel clinical and commercial superior technique which can provide a large amount of a composition containing the exosome derived from an excellent adipose stem cell as an effective ingredient at a low cost.

As used herein, the term " exosomes " refers to an endoplasmic reticulum of several tens to several hundred nanometers (preferably about 30 to 200 nm) in size, consisting of double lipid membranes identical in structure to the cell membrane The particle size of the exosome may be variable depending on the type of stem cells to be separated, the method of isolation and the method of measurement) (Vasiliy S. Chernyshev et al., "Size and shape characterization of hydrated and desiccated exosomes", Anal Bioanal Chem, ) DOI 10.1007 / s00216-015-8535-3). Exosomes contain proteins called exosomal cargo (cargo), nucleic acids (mRNA, miRNA, etc.). Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells. Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known.

The term " iontophoresis " as used herein refers to a method in which an ionized active ingredient is allowed to permeate through the skin by an electrical repulsive force by applying a minute current to the skin to which the effective substance is applied, . The iontophoresis used in one embodiment of the present invention is a method in which a current flows from an external power source to an electrode patch on the skin to introduce minute current into the skin, A method in which minute current is introduced, a method in which minute current is introduced into skin through a patch equipped with a reversed electrodialysis means for generating current through a difference in ion concentration between a high concentration electrolyte solution and a low concentration electrolyte solution, and the like . However, the present invention is not limited thereto, and it is needless to say that various types of iontophoresis can be used.

Limited wrinkle improvement and skin regeneration effects using exosomes derived from adipose stem cells have been reported. Although exosomes derived from neural stem cells, which are not adipose stem cells, have been reported to be effective in the treatment of brain damage and inflammatory diseases due to rejection of stem cell transplantation, the use of exosomes isolated from the adipose- Treatment of dermatitis, etc. " has not been known.

There has been no development of a therapeutic agent that has been clinically applicable to the treatment of dermatitis after culturing adipose stem cells capable of mass culture up to now and economically separated and purified from fat stem cell culture fluids economically. Adipose-derived stem cells derived from fat can be obtained in large quantities by simple procedures such as liposuction, and about 40 times more stem cells than bone marrow, umbilical cord or umbilical cord blood, It is difficult to economically mass-separate exosomes having a high purity and uniform particle size distribution from the adipose-derived stem cell culture liquid because the fat is abundant in the fat, such as cellular debris, waste products, proteins and macromolecules. Therefore, in terms of economics, there were technical barriers to massive separation of exosomes having a high purity particle size distribution from the adipose stem cell culture fluid.

When the composition of the present invention is applied to a pharmaceutical composition such as an injection or an external preparation for skin, the exosome derived from adipose stem cells contained as an active ingredient has a significant effect on the prevention, improvement, alleviation or treatment of dermatitis, The safety problem of the stem cell culture liquid can be solved. Therefore, the exosome derived from adipose stem cells contained in the composition for preventing, improving, alleviating or treating dermatitis of the present invention is a mechanism completely different from the conventional wrinkle improvement and skin regeneration known in the art, And that such efficacy is entirely unpredictable from the prior art.

The composition for preventing, improving, alleviating or treating dermatitis according to one embodiment of the present invention contains exosome derived from adipose stem cells as an active ingredient.

In the composition of one embodiment of the present invention, the exosome can be obtained by performing the following steps: (a) adding trehalose to the adipose stem cell culture, (b) adding the trehalose (C) separating the exosomes from the filtered adipose stem cell culture liquid using TFF (Tangential Flow Filtration), and (d) separating the exosomes with diafiltration ) Was added to the buffer solution to be used for the separation of the exosomes, and the desalted and exfoliated diafiltration was performed using TFF (Tangential Flow Filtration) using the buffer solution to which the trehalose was added. ).

In the composition of one embodiment of the present invention, trehalose is added to the buffer solution used for desalting and diafiltration in the step (d), whereby the exosome having a uniform particle size distribution and high purity can be effectively (See Fig. 6).

On the other hand, trehalose in the present invention imparts a function of efficiently separating exosomes from impurities such as cellular debris, waste products, proteins and macromolecules.

In the composition of one embodiment of the present invention, desalination and buffer exchange can be performed continuously or intermittently. Desalting and buffer exchange can be carried out using a buffer solution having a volume of at least 4 times, preferably 6 times to 10 times, more preferably 12 times the starting volume.

In a composition of one embodiment of the present invention, a TFF filter having a molecular weight cutoff (MWCO) of 100,000 Da (Dalton), 300,000 Da, 500,000 Da or 750,000 Da, or a 0.05 占 TFF filter may be used for TFF.

In the composition of one embodiment of the present invention, the step (c) may further include a step of concentrating the solution to a volume of 1/100 to 1/25 using TFF (Tangential Flow Filtration).

In the composition of one embodiment of the present invention, the filtered adipose stem cell culture fluid may be subjected to sonication before TFF.

In the composition of one embodiment of the present invention, the exosome is characterized by decreasing the amount of expression of IL-4 and IL-31 in skin tissue or skin cells. Additionally, the exosomes may reduce the expression level of at least one of IL-23 or TNF-a in skin tissue or skin cells.

In the composition of one embodiment of the present invention, the exosome can reduce the level of blood IgE and the number of blood leukocytes and eosinophils.

In the composition of one embodiment of the present invention, the exosome can reduce the number of mast cells, CD86 + cells and CD206 + cells in the dermal tissue.

In a composition of one embodiment of the present invention, the exosome is characterized by reducing TEWL and increasing skin hydration.

In a composition of one embodiment of the present invention, the exosome is characterized by reducing TNF-α mRNA expression, IL-6 mRNA expression, and IL-1β mRNA expression in an in vitro assay.

In the composition of one embodiment of the present invention, the type of adipose stem cells is not limited as long as it does not cause the risk of infection by a pathogen and does not cause an immune rejection reaction, but may be preferably stem cells derived from human adipose.

The composition of one embodiment of the present invention can be effectively used for preventing, improving, alleviating or treating various dermatoses accompanied by itch, and is preferably used for the treatment of contact dermatitis, irritant contact dermatitis, allergic contact dermatitis, phototoxic and photoallergic contact dermatitis, It can be used for atopic dermatitis, acne or eczema, and more preferably for atopic dermatitis, seborrheic dermatitis, autoimmune dermatitis, autoimmune progesterone dermatitis, ulcerative dermatitis, acne or eczema.

The composition of one embodiment of the present invention may be prepared from a pharmaceutical composition. When the composition of one embodiment of the present invention is made from a pharmaceutical composition, the pharmaceutical composition according to one embodiment of the present invention may be various oral or parenteral formulations.

The pharmaceutical composition of one embodiment of the present invention may include a pharmaceutically acceptable carrier, excipient or diluent. Examples of the carrier, excipient and diluent include lactose, dextrose, trehalose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium carbonate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. . The pharmaceutical composition according to one embodiment of the present invention may be administered orally or parenterally in the form of powders, pills, tablets, capsules, suspensions, emulsions, syrups, granules, elixirs, aerosols, Or in the form of sterile injectable solutions.

Administration of the pharmaceutical composition according to one embodiment of the present invention means introduction of a predetermined substance into a patient by any appropriate method, and the administration route of the pharmaceutical composition may be administered through any ordinary route so long as the drug can reach the target tissue . For example, the pharmaceutical composition of one embodiment of the present invention may be administered orally or parenterally, and examples of the parenteral administration include transdermal administration, intraperitoneal administration, intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, Administration, topical administration, rectal administration, and the like. However, it is not limited thereto and does not exclude various methods of administration known in the art. In addition, the pharmaceutical composition of one embodiment of the present invention may be administered by any device capable of moving the active substance to a target tissue or cell. An effective amount of the pharmaceutical composition of one embodiment of the present invention means an amount required for administration in order to expect the therapeutic effect of the disease.

The preparation for parenteral administration of the pharmaceutical composition of one embodiment of the present invention may be a sterilized aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, or a left-over preparation. The preparation for parenteral administration of the pharmaceutical composition of one embodiment of the present invention may also be prepared by injection. The injection agent of one embodiment of the present invention may be, but not limited to, an aqueous injection agent, a non-aqueous injection agent, an aqueous suspension injection agent, a non-aqueous suspension injection agent, or a solid injection agent used by dissolving or suspending. Injection agents of one embodiment of the present invention may be administered orally or parenterally depending on the type thereof, for example, distilled water for injection, vegetable oil (for example, peanut oil, sesame oil, camellia oil, etc.), monoglyceride, diglyceride, propylene glycol, camphor, benzoic acid estradiol, , Arsenobenzazole sodium, or streptomycin sulfate, and may optionally contain stabilizers or preservatives.

The compounding ratio of the pharmaceutical composition according to one embodiment of the present invention can be appropriately selected depending on the kind, quantity and form of the additional components as described above. For example, for the total amount of the injection, the pharmaceutical composition of the present invention may contain about 0.1 to 99% by weight, preferably about 10 to 90% by weight. In addition, a suitable dose of the pharmaceutical composition of one embodiment of the present invention may be appropriately determined depending on the kind of disease of the patient, the severity of the disease, the type of the formulation, the formulation method, the age, sex, weight, health condition, diet, Can be adjusted according to the method. For example, when the pharmaceutical composition of one embodiment of the present invention is administered to an adult, it may be administered at a dose of 0.001 mg / kg to 100 mg / kg per day for 1 to several times.

On the other hand, when the composition of one embodiment of the present invention is prepared with an external preparation for skin and / or a cosmetic composition, the components commonly used in cosmetics or external skin preparations, for example, moisturizers, antioxidants , An oil component, an ultraviolet absorber, an emulsifier, a surfactant, a thickener, alcohols, a powder component, a colorant, an aqueous component, water, various skin nutrients, and the like.

In addition, the external preparation for skin according to one embodiment of the present invention may be prepared by mixing together conventionally used dermatitis remedy and / or moisturizing agent in addition to exosome derived from adipose stem cells to the extent that the action thereof (suppression of dermatitis and itching) Can be used. For example, the exosome of the present invention may be supported on or mixed with at least one of hydrogel, hyaluronic acid, hyaluronic acid salt (for example, sodium hyaluronate), or hyaluronic acid gel. In the external preparation for skin of one embodiment of the present invention, the kind of the hydrogel is not limited, but it may be a hydrogel obtained by dispersing a gelated polymer in a polyhydric alcohol. Wherein the gel polymer is at least one selected from the group consisting of pluronic, purified agar, agarose, gellan gum, alginic acid, carrageenan, cacao gum, xanthan gum, galactomannan, glucomannan, pectin, cellulose, guar gum and locust bean gum And the polyhydric alcohol may be at least one selected from the group consisting of ethylene glycol, propylene glycol, 1,3-butylene glycol, isobutylene glycol, dipropylene glycol, sorbitol, xylitol and glycerin.

The external preparation for skin and / or the cosmetic composition according to one embodiment of the present invention can be used in the form of, for example, patches, mask packs, mask sheets, creams, tonics, ointments, suspensions, emulsions, pastes, lotions, , Mist, foundation, powder, oil paper, and the like. For example, the external preparation for skin and / or cosmetic composition may be applied or deposited on at least one surface of the patch, mask pack, or mask sheet.

When the external preparation for skin according to one embodiment of the present invention is made of a cosmetic composition, it is used for the purpose of preventing, improving, alleviating, or normalizing dermatitis. Cosmetic formulations can be prepared in any formulations conventionally produced in the art . For example, it is possible to use a lotion, a mask pack, a mask sheet, a softener, a nutritional lotion, a convergent lotion, a nutritional cream, a massage cream, an eye cream, a cleansing cream, an essence, an essence, a cleansing lotion, a cleansing foam, But are not limited to, soaps, shampoos, surfactant-containing cleansers, bath salts, body lotions, body creams, body oils, body essences, body cleansers, hair dyeing agents, hair tonics and the like.

The external preparation for skin and / or cosmetic composition according to one embodiment of the present invention includes components commonly used in external preparations for skin and / or cosmetics and includes conventional additives such as antioxidants, stabilizers, solubilizers, vitamins, And may include a carrier. Further, in the respective formulations for the external preparation for skin and / or cosmetic composition, the other ingredients can be mixed and selected without difficulty by the person skilled in the art depending on the kind of the external preparation for skin and / or cosmetic composition or purpose of use.

Another embodiment of the present invention provides a cosmetic method for regulating the condition of mammalian skin, except for therapeutic use, using the above cosmetic composition. In the cosmetic method of the present invention, conditioning of the skin means improvement of the condition of the skin and / or prevention of the condition of the skin, and improvement of the condition of the skin means visual and / Or a tactile perceptible positive change.

The cosmetic method of one embodiment of the present invention comprises the steps of (a) applying the cosmetic composition directly onto the skin of a mammal, (b) applying the patch, mask pack or mask sheet coated or deposited with the cosmetic composition to the skin , Or sequentially advancing the above (a) and (b).

The cosmetic method of one embodiment of the present invention may further comprise performing iontophoresis by flowing a microcurrent to the skin of the mammal to which the cosmetic composition is applied. In addition, the cosmetic method of one embodiment of the present invention may further comprise contacting or attaching the iontophoresis device to the skin of the mammal.

In the cosmetic method according to one embodiment of the present invention, the iontophoresis device is composed of a flexible battery, a lithium ion secondary battery, an alkaline battery, a dry battery, a mercury battery, a lithium battery, a nickel-cadmium battery, A mask pack, or a mask sheet on which the at least one battery is mounted.

Another embodiment of the present invention provides a method of preventing, ameliorating, alleviating or treating dermatitis, comprising administering to the mammal a therapeutically effective amount of the above pharmaceutical composition.

In the method for preventing, ameliorating, alleviating or treating dermatitis of the present invention, the mammal may be a human, a dog, a cat, a rodent, a horse, a cow, a monkey, or a pig.

The composition of the present invention reduces the production of various inflammatory cytokines and inflammation-related factors that cause dermatitis and inhibits the activity or involvement of inflammation-related immune cells, thereby preventing, ameliorating, alleviating or treating dermatitis. In addition, the composition of the present invention can protect and enhance the skin barrier by reducing moisture evaporation of the stratum corneum, improving skin moisturization, and preventing, improving, alleviating or treating dermatitis through the protection and strengthening of the skin barrier.

In particular, the compositions of the present invention act on multimeric cytokine targets that cause dermatitis and thus can be applied broadly to dermatitis caused by various causes and effectively inhibit and alleviate dermatitis. In addition, the composition of the present invention can control cytokine targets with different expression patterns depending on the degree of mild, moderate, and severe disease of dermatitis, and thus can be applied to prevent, improve, alleviate or treat mild, moderate or severe dermatitis It is expected. In addition, the composition of the present invention is expected to be applicable to the prevention, improvement, alleviation or treatment of acute and chronic dermatitis since the expression patterns of cytokines having different expression patterns can be controlled according to the onset patterns of acute and chronic dermatitis.

Accordingly, the composition of the present invention can be usefully used as a pharmaceutical composition for preventing, improving, alleviating or treating dermatitis, external preparation for skin and cosmetic composition.

Further, the present invention can obtain a large amount of exosome derived from adipose stem cells at a low cost and having a high purity and a uniform particle size distribution. Therefore, the present invention can provide a large amount of a composition containing an exosome derived from adipose stem cells excellent in functional activity as an effective ingredient at low cost. In addition, the composition of the present invention is scale-upable and is also suitable for GMP (Good Manufacturing Practice).

On the other hand, the scope of the present invention is not limited by the above-mentioned effects.

1 is a flow chart illustrating a process of separating and purifying exosomes in a method for producing exosomes from an adipose stem cell culture solution according to one embodiment of the present invention.
FIG. 2 shows a result of measuring the relative amount of protein contained in a solution for each step of preparing exosome from an adipose stem cell culture solution according to one embodiment of the present invention. The ratio of the total amount of protein in each step was expressed as a relative ratio of total protein amount to the total stem cell culture solution. The experimental results show the results obtained in two different batches, respectively.
FIG. 3 shows the results of measuring the productivity and purity of exosomes obtained according to one embodiment of the present invention. The productivity of exosomes was calculated as "the number of particles of exosome obtained per mL of stem cell culture (CM)" and the purity of exosome was calculated as "the number of particles of exosome per microgram of protein unit contained in the final fraction" Respectively. The experimental results show the results obtained in five different batches.
FIG. 4 shows the results of physical property analysis of exosomes obtained according to one embodiment of the present invention. &Quot; A " represents particle size distribution and particle number by TRPS (tunable resistive pulse sensing) analysis. "B" represents particle size distribution and particle number by NTA (nanoparticle tracking analysis) analysis. &Quot; C " shows the particle image by transmission electron microscopy (TEM) according to the magnification. &Quot; D " represents the western blotting result of exosomes obtained according to one embodiment of the present invention. &Quot; E " represents flow cytometric analysis results for CD63 and CD81 in marker analysis for exosomes obtained according to one embodiment of the present invention.
Figure 5 shows the results of NTA analysis on particle size distribution showing that a uniform and high-purity exosome is obtained with trehalose addition. As the amount of trehalose added increases, a particle size distribution having a single peak can be obtained.
FIG. 6 shows the results of NTA analysis showing the particle size distribution according to whether trehalose was added during the preparation of exosome according to one embodiment of the present invention. &Quot; A " indicates that when trehalose is added throughout the manufacturing process, " B " indicates that when trehalose is added after storing the cell culture solution after thawing, " C " The results are shown in FIG. &Quot; D " shows the result of comparing relative productivity and relative concentration of exosomes separated by methods A to C, respectively. &Quot; E " shows the mean size of exosomes isolated by the methods A to C.
FIG. 7 shows real-time PCR results showing that the expression level of TNF-α, IL-6, IL-1β and iNOS mRNA induced by LPS decreased when RAW 264.7 cells were treated with LPS and the present exosome FIG.
FIG. 8 shows experimental results of confirming the effect of reducing exogenous NO formation, which is a kind of inflammatory reaction, by exoose according to one embodiment of the present invention. In FIG. 8, PBS is phosphate-buffered saline, DEX is dexamethasone, EXO is exosomes, CM is conditioned medium, and CM-EXO is exosomally removed adipose-derived adipose stem cells (Exosome-depeleted conditioned media).
FIG. 9 shows experimental results of confirming the effect of reducing exogenous TNF-.alpha., An inflammatory cytokine, by exoose according to one embodiment of the present invention. In Fig. 9, PBS represents phosphate-buffered saline, DEX represents dexamethasone, and each numeral represents exosome throughput (μg / mL).
FIG. 10 shows experimental results comparing the effect of reducing NO formation by the exoose isolated according to one embodiment of the present invention and the effect of reducing NO formation by the exosome isolated by the conventional precipitation method (PPT) . A is the result of NTA analysis of exosomes separated by the conventional precipitation method, B is the result of NTA analysis of exosomes isolated and purified by the method according to one embodiment of the present invention, FIG. The degree of reduction of NO formation was expressed as a relative ratio (%) to the degree of NO formation reduction by the positive control dexamethasone (Dex).
FIG. 11 shows the results of confirming that atopic symptoms are alleviated as a result of treating the exosome according to one embodiment of the present invention in an atopy-induced mouse (dermatitis-inducing animal model 1).
FIG. 12 shows a real-time PCR result in which the amount of inflammatory cytokines IL-4 and IL-31 mRNA in the skin damaged area sample after treating the dermatitis-inducing animal model 1 according to an embodiment of the present invention was examined Graph.
FIG. 13 shows the result of treatment of exosome according to one embodiment of the present invention in a mouse in which atopy has been induced (dermatitis-inducing animal model 2) to confirm that atopy symptoms are relieved dose-dependently on exosomes.
FIG. 14 is a graph comparing the results of FIG. 13 with numerical values.
FIG. 15 is a graph showing changes in the amounts of inflammatory cytokines IL-4, IL-31, TNF-a and IL-23 mRNA in skin damage area samples after treatment with exoemia according to one embodiment of the present invention in dermatitis- And a real-time PCR result.
(A) IgE, (B) white blood cells, and (C) eosinophils present in the blood after treating the dermatitis-inducing animal model 2 according to one embodiment of the present invention. As shown in FIG.
FIG. 17 shows fluorescence intensity measurement results of exosomes stained with PKH67.
FIG. 18 is a fluorescence microscope image showing the degree of the fluorescence-stained exosome of the present invention transferred into the pig skin tissue. FIG. It is an image of a fluorescence microscope obtained by diluting a fluorescently-stained exosome of the present invention in a buffer solution and applying it to the surface of a pig skin after a certain period of time.
FIG. 19 is a graph showing a fluorescence microscope image obtained by confirming the extent to which the exosome of the present invention is fluorescently transferred into a mouse skin tissue, and a total fluorescence intensity obtained by measuring the fluorescence intensity on each image from the fluorescence microscope image to be. The upper part of FIG. 19 is an image of a confocal fluorescence microscope obtained after a certain time has elapsed after application of the fluoresceinized exosome of the present invention to the surface of a mouse skin by diluting it in a buffer solution.
FIG. 20 shows the result of confirming the absence of cytotoxicity after treating exosome according to one embodiment of the present invention to human skin fibroblast HS68 cells.
FIG. 21 is a graph showing the results of an ionophore treatment in which a composition containing an exosome according to an embodiment of the present invention is applied to human skin (circles) and then a microcurrent is applied to the skin As a result, it is a photograph showing that the erythema of the skin (the affected part) which has severe dermatitis is remarkably improved.
FIG. 22 is a photograph showing that atopic symptoms are significantly improved as a result of subcutaneous injection of exosomes according to one embodiment of the present invention to a Shetland cichlids suffering from naturally occurring severe atopic dermatitis.
FIG. 23 is a graph showing that the transepidermal water loss (TEWL) of the exosomes is dose-dependently reduced as a result of treatment with exosomes according to one embodiment of the present invention in mice in which skin barrier damage causing dermatitis is caused .
24 is a graph showing that skin hydration is increased in a dose-dependent manner in exosomes as a result of treatment with exosomes according to one embodiment of the present invention in mice in which skin barrier damage causing dermatitis is caused to be.
FIG. 25 is a graph showing a result of measuring body weight of mice suffering from skin barrier damage that causes dermatitis. As shown in FIG. 25, in the dexamethasone-treated group, body weight was decreased due to adverse effects. In the experimental group treated with exosomes according to one embodiment of the present invention, Is almost not decreased.
Figure 26 shows that when the exosomes of the present invention were co-treated with LPS and IFN-y for THP-1 derived macrophages obtained after differentiating THP-1 monocytes into macrophages, proinflammatory cytokines Lt; / RTI > mRNA expression of IL-6, which is a human IL-6.
FIGS. 27 to 29 show that the THP-1-derived macrophages obtained by differentiating THP-1 monocytes into macrophages were pre-treated with the present exosomes and incubated for a predetermined time, and then treated with LPS and IFN-γ Time PCR results confirming that the expression levels of IL-6, IL-1 [beta] and TNF- [alpha] mRNAs, which are proinflammatory cytokines, are decreased.

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Throughout the specification, when an element is referred to as " comprising ", it means that it can include other elements as well, without excluding other elements unless specifically stated otherwise.

Example

Example 1: Culture of cells

Mouse macrophage line RAW 264.7 was purchased from Korean Cell Line Bank and cultured. For cell culture, DMEM (purchased from ThermoFisher Scientific) medium containing 10% fetal bovine serum (purchased from ThermoFisher Scientific) and 1% antibiotic-antimycotics (purchased from ThermoFisher Scientific) ₂ , and 37 ° C.

HS68 cells, a human dermal fibroblast, were purchased from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (purchased from ThermoFisher Scientific) and 1% antibiotic-antimycotics (purchased from ThermoFisher Scientific) The cells were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 5% CO ₂ at 37 ° C.

According to the cell culturing method known in the art, adipose-derived stem cells were cultured at 5% CO ₂ and 37 ° C. Then, the cells were washed with a phosphate-buffered saline (purchased from ThermoFisher Scientific), replaced with serum-free, non-phenol red medium, cultured for 1 to 10 days, and the supernatant .

Trehalose was added to the culture medium in an amount of 2% by weight in order to obtain an exosome having a uniform particle size distribution and high purity in the process of separating exosome. After the addition of trehalose, the culture was filtered with a 0.22 μm filter to remove impurities such as cellular debris, waste products and large particles. The filtered cultures were immediately separated to isolate exosomes. In addition, the filtered culture was stored in a refrigerator (image below 10 ° C) and used for exosome isolation. In addition, the filtered culture was frozen in an ultra-low temperature freezer at -60 ° C or lower, and thawed, followed by exosome isolation. Then, the exosomes were separated from the culture medium by using Tangential Flow Filtration (TFF).

Example 2: Isolation and purification of exosome by TFF method

In Example 1, a TFF (Tangential Flow Filtration) method was used for separating, concentrating, desalting and diafiltration exosomes from a culture filtrated with a 0.22 μm filter. TFF method was used to isolate and concentrate the exosomes, sonication of the culture medium to loosen lumps of potential exosomes. For the TFF method, a cartridge filter (also called a hollow fiber filter (purchased from GE Healthcare) or a cassette filter (purchased from Pall or Sartorius or Merck Millipore) was used. The TFF filter can be selected by a variety of molecular weight cutoffs (MWCO). Exosomes were selectively isolated and concentrated by selected MWCOs, and particles, proteins, lipids, nucleic acids, low molecular weight compounds, etc. smaller than MWCO were removed.

To separate and concentrate the exosomes, TFF filters of MWCO 100,000 Da (Dalton), 300,000 Da, or 500,000 Da were used. The culture medium was concentrated to a volume of about 1/100 to 1/25 using the TFF method, and substances smaller than MWCO were removed to separate the exosomes.

Separated and concentrated exosomal solutions were further desalted and buffered (diafiltration) using the TFF method. At this time, the desalination and buffer exchange are performed by continuous diafiltration or discontinuous diafiltration, and at least 4 times, preferably 6 times to 10 times or more, more preferably, Was performed using a buffer solution having a volume of 12 times or more. To the buffer solution, 2% by weight of trehalose dissolved in PBS was added to obtain an exosome having a uniform particle size distribution and high purity. 6 shows the results of confirming the effect of obtaining an exosome with high purity and homogeneous particle size distribution at a high yield by trehalose treatment.

Example 3: Characterization of isolated exosomes

The amount of protein in the fractions of the isolated exosome, culture medium, and TFF separation process was measured using BCA colorimetry (purchased from ThermoFisher Scientific) or FluoroProfile fluorescence (purchased from Sigma). The extent to which the exosome was isolated and concentrated by the TFF method of the present invention and the removal of proteins, lipids, nucleic acids, and low-molecular compounds was monitored by a protein determination method, and the results are shown in FIG. As a result, it was found that the protein present in the culture solution was very effectively removed by the TFF method of one embodiment of the present invention.

FIG. 3 shows the results of comparing the productivity and purity in five independent batches when isolating exosomes by the TFF method of one embodiment of the present invention. As a result of analyzing the results obtained from the five independent batches, it was confirmed that the exosome can be separated very stably by the TFF method of one embodiment of the present invention.

Separated exosomes were measured for particle size and concentration by nanoparticle tracking analysis (NTA; purchased from Malvern) or tunable resistive pulse sensing (TRPS; purchased from Izon Science). The uniformity and size of isolated exosomes were analyzed by transmission electron microscopy (TEM). The results of the TRPS, NTA and TEM analyzes of the exosomes isolated according to one embodiment of the present invention are shown in FIG.

FIG. 5 shows the result of NTA analysis of the size distribution of exosomes according to whether or not trehalose was added after the exosome was separated by the TFF method. The concentration of trehalose was increased to 0% by weight, 1% by weight and 2% by weight (from top to bottom in FIG. 5) and repeated three times. In the absence of trehalose, particles having a size of 300 nm or more were identified, while particles having a size of 300 nm or more were reduced by increasing the amount of trehalose, and the size distribution of the exosome was uniformized .

The effect of adding trehalose was further investigated in the process of isolating exosome by the TFF method. As shown in FIG. 6, when 2 wt% trehalose dissolved in PBS was added to the entire TFF, exosomes having a uniform size distribution were obtained (FIG. 6A). On the other hand, in the case of using the culture solution free of trehalose, which was stored in freeze, only TFF process was performed by addition of trehalose only in desalting and buffer exchange process, or TFF process was performed without adding trehalose On the other hand, uneven exosomes containing large particles were obtained (Figs. 6B and 6C).

As a result of comparing the relative productivity and the concentration of the separated exosomes, it was found that when trehalose was added to the entire TFF, the exosome was obtained with a very high productivity, and the concentration of the obtained exosome was 5 times higher (FIG. 6D) . As shown in the results of NTA analysis, the average size of the separated exosomes was uniformly observed at 200 nm when trehalose was added to the entire TFF (FIG. 6E).

FIG. 4D shows the presence of CD9, CD63, CD81 and TSG101 markers as a result of performing Western blotting on isolated exosomes according to the method of one embodiment of the present invention. Anti-CD9 (purchased from Abcam), anti-CD63 (purchased from System Biosciences), anti-CD81 (purchased from System Biosciences), and anti-TSG101 (purchased from Abcam) were used as the antibodies for each marker.

FIG. 4E shows the presence of CD63 and CD81 markers as a result of analysis using a flow cytometer on exosomes isolated according to the method of one embodiment of the present invention. Human CD63 isolation / detection kit (purchased from ThermoFisher Scientific) was used according to the manufacturer's method to isolate the positive exosomes for CD63 and PE-mouse anti-human CD63 (PE-Mouse anti markers were stained using the PE-mouse CD63 (purchased from BD) and PE-mouse anti-human CD81 (purchased from BD), and analyzed using a flow cytometer (ACEA Biosciences) Respectively.

According to the present invention, trehalose is added in the separation and / or purification process using tangential flow filtration to isolate and purify exosomes having high purity and uniform particle size distribution in a high yield in an economical and efficient manner . Also, it can be seen that the processes of the separation method according to one embodiment of the present invention are scalable and suitable for GMP.

Example 4: Measurement of cytotoxicity by treatment with exosome

In order to evaluate the toxicity of exosomes obtained according to the isolation method of one embodiment of the present invention in human skin fibroblast HS68 cells, exosomes were treated by concentration to the cells and the proliferation rate of the cells was confirmed. HS68 cells were suspended in DMEM containing 10% FBS, and then the cells were subcultured to have a confluency of 80 to 90% and cultured in a 5% CO ₂ incubator at 37 ° C for 24 hours. After 24 hours, the culture solution was removed, and the cell survival rate was evaluated by culturing the exosome prepared in Example 2 for each concentration and culturing for 24 to 72 hours. Cell viability was measured using WST-1 reagent (purchased from Takara), MTT reagent (purchased from Sigma), CellTiter-Glo reagent (purchased from Promega), or Aramar Blue reagent alamarBlue reagent (purchased from ThermoFisher Scientific) and a microplate reader (purchased from Molecular Devices).

The comparative group was based on the number of cells cultured in the normal cell culture medium not treated with exosome, and it was confirmed that the exosome-induced cytotoxicity did not appear within the tested concentration range (FIG. 20).

Example 5 Measurement of Inflammatory Response Using Macrophage Cell Lines

RAW 264.7 cells were suspended in DMEM medium containing 10% FBS and dispensed into each well of a multiwell plate to have a confluency of 80-90%. On the next day, the exosomes of the present invention diluted in a fresh serum-free medium containing LPS (exosome prepared in Example 2) were cultured for 1 to 24 hours at an appropriate concentration. The cultured supernatant was taken and NO and inflammatory cytokines present in the culture were measured to confirm the inflammatory response. The inflammatory response in the culture medium was measured using a NO detection kit (purchased from Intron Bio or Promega). The ELISA kit (purchased from the R & D system) was performed according to the manufacturer's manual to confirm the amount of inflammatory cytokine TNF-α in the group treated with LPS alone and the group treated with exosomes of the present invention. Dexamethasone (purchased from Sigma) was treated as a positive control. In addition, cDNA was prepared from the total RNA obtained from the RAW 264.7 cells treated as described above, and the amount of mRNA change of iNOS, TNF-α, IL-6 and IL-1β was measured using a real-time PCR method. The GAPDH gene was used as a standard gene for quantifying the above genes. The types and sequences of the primers used in the real-time PCR are shown in Table 1 below.

Primer types and base sequences used in real-time PCR gene order The forward primer (5 '- > 3') The reverse primer (5 '- > 3') TNF-a TCT CAT CAG TTC TAT GGC CCA GAC (SEQ ID NO: 1) GGC ACC ACT AGT TGG TTG TCT TTG (SEQ ID NO: 2) iNOS GCT ACC ACA TTG AAG AAG CTG GTG (SEQ ID NO: 3) CCA TAG GAA AAG ACT GCA CCG AAG (SEQ ID NO: 4) GAPDH GAC ATC AAG AAG GTG GTG AAG CAG (SEQ ID NO: 5) CCC TGT TGC TGT AGC CGT ATT CAT (SEQ ID NO: 6) IL-6 GCC AGA GTC CTT CAG AGA GAT ACA (SEQ ID NO: 7) ATT GGA TGG TCT TGG TCC TTA GCC (SEQ ID NO: 8) IL-1? GCA ACG ACA AAA TAC CTG TGG CCT (SEQ ID NO: 9) AGT TGG GGA ACT CTG CAG ACT CAA (SEQ ID NO: 10)

First, as shown in Fig. 7, when the exosomes of the present invention were treated with LPS against RAW 264.7 cells, which are macrophages of mice, LPS-induced inflammatory cytokines TNF-a, IL-6 and IL -1β mRNA was decreased and the expression amount of mRNA of iNOS, which is a NO synthase, decreased.

Next, as shown in FIG. 8, treatment of exosome of the present invention with RAW 264.7 cells, a macrophage of mice, in the presence of LPS revealed that the production of NO, an inflammatory reaction induced by LPS, was dose-dependently reduced Respectively. In addition, as shown in Fig. 9, treatment of exosome of the present invention in the presence of LPS in RAW 264.7 cells, a macrophage of mice, confirmed that TNF-a production, an inflammatory cytokine induced by LPS, was reduced . These results show that the exosome of the present invention has an activity of reducing the inflammatory reaction induced by LPS, which is useful for preventing, improving, alleviating or treating dermatitis, and the exosome of the present invention is useful for preventing, , Can be usefully utilized as an effective ingredient of a composition for alleviation or treatment.

Example 6: Comparison of reduction effect of NO formation according to separation method

In order to compare the effect of reducing the formation of NO in the exosome according to the separation method, exosomes isolated by the conventional precipitation method were prepared in addition to the exosomes obtained by the TFF separation purification of one embodiment of the present invention. The precipitation method was performed according to the protocol of the manufacturer (System Biosciences). The exosome (see Fig. 10A) isolated by the conventional precipitation method has a low uniformity of the particle size distribution and a large particle size distribution (see Fig. 10B) as compared with the exosome (see Fig. 10B) isolated and purified by the TFF method of one embodiment of the present invention Respectively. In addition, as shown in FIG. 10C, it was confirmed that the exosomes isolated and purified by the TFF method of one embodiment of the present invention inhibit NO formation to a much higher level than the exosomes obtained by the conventional precipitation method. These results show that the exo-somatically purified exosomes according to one embodiment of the present invention are superior to the exosomes isolated according to the conventional method in terms of uniformity of the particle size distribution and suppression of NO formation.

Thus, the exosomes obtained according to the separation method of one embodiment of the present invention have improved performance or functional activity (e. G., Uniformity of particle size distribution, inhibition of NO production, Reduction of inflammatory response, etc.), and the composition of the present invention, containing the stem cell-derived exosome having excellent functional activity as an active ingredient, is far superior to the conventional art in terms of preventing, improving, alleviating or treating dermatitis .

Example 7: Dermatitis inducing animal model 1

Male NC / Nga mice (16-18 g, 5 weeks old; purchased from the central laboratory animal) were purchased and used for this experiment through a 7-day adaptation period. The mice that had undergone adaptation were classified into 5 groups as follows after induction of dermatitis.

(1) Normal: normal control group

(2) Vehicle (dermatitis-induced group): negative control which caused dermatitis by house dust mite extract

(3) IV: Dermatitis induced by house dust mite extract. Exosome prepared in Example 2 was administered intravenously (IV) for 2 weeks three times a week at a dose of 2.8 μg per subject

(4) SC: Exposure prepared in Example 2 after inducing dermatitis by house dust mite extract was subcutaneously injected (SC: subcutaneous injection) for 2 weeks three times a week at a dose of 2.8 μg per individual

(5) Pred: Experiments in which daily oral administration of prednisolone after dermatitis induction with house dust mite extract

The pinna portion of the NC / Nga mouse (purchased from the central laboratory animal) was shaved with a razor, and then the hair removal agent was applied in a proper amount to remove hair. The hair removal agent was wiped off and the AD-inducing reagent (house dust mite extract; purchased from BioStir Inc.) was uniformly applied to the pinna area using a micropipette tip. If necessary, 150 μL of a 4% SDS aqueous solution was uniformly applied to the pinna portion of the pinna using a micropipette tip. Dried using a drier in a cold air, and then dried naturally for about 2-3 hours. Then, the AD-inducing reagent was uniformly applied to a pinna portion using a micro pipette tip. All pretreatments were carried out twice a week, six times a total of three weeks.

The skin clinical index was evaluated before starting the administration of exosome prepared in Example 2, and the groups were randomly distributed so that the average score of each group was uniformly distributed according to the ranking score.

11A are photographs showing atopy symptom relief by atopy-induced mouse treatment (No treatment) and exosome treatment (IV and SC) according to one embodiment of the present invention. FIG. 11B is a graphical representation of the atopic clinical scores of the experimental groups (2) to (5), and it was confirmed that the atopic clinical score was improved in the group treated with exosomes according to one embodiment of the present invention. FIG. 11C is a graph showing relative changes in the thickness of the ear measured in each of the experimental groups (2) to (5) compared to the normal group of (1), wherein the exosome according to one embodiment of the present invention The ear thickness was reduced in one group.

Taken together, these experiments confirmed that the skin clinical index and ear thickness decreased in the exosomal treated group (both IV and SC) of the present invention.

Example 8: Dermatitis inducing animal model 2

To confirm the dose-dependent effect of exosomes, dermatitis was induced as in Example 7 and classified into the following 9 groups.

(1) Normal: Normal control group (denoted by " N " in FIG. 13)

(2) Control (dermatitis-induced group): a negative control group (referred to as "C" in FIG. 13)

(3) IV, L (exosome, low): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was intravenously injected IV for 4 weeks at a dose of 0.14 μg per subject

(4) IV, M (exosome, medium): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was intravenously injected for 4 weeks at a dose of 1.4 μg /

(5) IV, H (exosome, high): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was intravenously injected for 4 weeks for 3 weeks at a dose of 10 μg per subject

(6) SC, L (exosome, low): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was subcutaneously injected (SC: subcutaneous injection) at a dose of 0.14 μg per 3 weeks for 4 weeks

(7) SC, M (exosome, medium): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was subcutaneously injected (SC) three times a week for 4 weeks at a dose of 1.4 μg per subject

(8) SC, H (exosome, high): exonome prepared in Example 2 after induction of dermatitis by house dust mite extract was subcutaneously injected (SC) three times a week for 3 weeks at a dose of 10 μg per subject

(9) Pred: Experimental group (designated as " P " in FIG. 13) that was orally administered prednisolone daily after inducing dermatitis with house dust mite extract

The dermatitis induction proceeded as in Example 7, and an excess of AD-inducing reagent was applied so that the average skin clinical index was 9 at the time of administration of exosome. The skin clinical index was evaluated before starting the administration of exosome prepared in Example 2, and the groups were randomly distributed so that the average score of each group was uniformly distributed according to the ranking score.

The top (first and second from the top) of FIG. 13 shows that atopic symptoms were alleviated (Day 28) by dose-dependently treatment of mice with atopy (Day 0) and treatment with exosomes according to one embodiment of the present invention These are the pictures that show. FIG. 14A is a graph illustrating the relative improvement of the atopic clinical scores of the experimental groups (2) to (9), wherein the groups treated with exosomes (IV and SC) according to one embodiment of the present invention were dose- And atopic clinical scores were improved.

The interruption (third and fourth from the top) of Figure 13 is the result of staining sections of the ear skin tissue with H & E and toluidine blue. The ear skin tissue of the sacrificed mice was stained with H & E and the thickness of the ear skin tissue was measured. FIG. 14B is a graph showing the thickness of the ear skin tissue measured in each experimental group of (2) to (9) in comparison with the normal group of (1), which is a group treated with exosomes according to one embodiment of the present invention (IV and SC) showed a dose-dependent decrease in the thickness of the ear skin tissue. In addition, the ear skin tissue of the sacrificed mice was stained with toluidine blue, and the degree of infiltration of mast cells, which is a kind of inflammatory cells, was measured. 14C is a graph showing the number of mast cells measured in each of the experimental groups (2) to (9) in comparison with the normal group of (1), wherein the group treated with exosomes according to one embodiment of the present invention And SC) showed a dose-dependent decrease in the influx of mast cells.

13 (fifth and sixth from the top) is the result of immunohistochemical staining of anti-CD86 antibody and anti-CD206 antibody in the ear skin tissue of sacrificed mice. It is known that inflammatory dendritic epidermal cells (IDECs), which are not found in normal skin and are abundant in atopic dermatitis lesions, express CD86 antigen and CD206 antigen on its surface (J Invest Dermatol 2002; 118: Arch Dermatol Res 2001; 293: 448-454). Therefore, the degree of improvement of dermatitis symptoms can be determined by measuring the number of CD86 + cells and CD206 + cells in atopic dermatitis lesions.

CD86 + cell numbers and CD206 + cell counts were measured after immunohistochemical staining with anti-CD86 antibody and anti-CD206 antibody (Abcam, Cambridge, MA) in ear skin tissue sections of sacrificed mice. 14D and 14E are graphs showing the number of CD86 + cells and the number of CD206 + cells measured in each of the experimental groups (2) to (9) in comparison with the normal group of (1) The number of CD86 + cells and CD206 + cells were decreased in a dose-dependent manner in the group treated with mosses (IV and SC). These results suggest that the infiltration of inflammatory dermal epidermal cells in atopic dermatitis lesions was reduced and dermatitis symptoms were alleviated or improved.

Taken together, these experiments show that the skin clinical index, thickness of the ear skin tissue, mast cell infiltration, and infiltration of inflammatory dermal epidermal cells are decreased in a dose-dependent manner in the group treated with exosomes of the present invention (both IV and SC) Respectively.

Example 9: Measurement of cytokine mRNA expression level

CDNA was prepared from the total RNA obtained by grinding the tissues of skin injured parts of the sacrificed mice, and the amount of various inflammatory cytokine mRNAs, which is a major cause of dermatitis, was measured using a real time PCR method. GAPDH gene was used as a standard gene for quantifying IL-4, IL-31, IL-23 and TNF-alpha genes. The types and sequences of the primers used in the real-time PCR are shown in Table 2 below.

Primer types and base sequences used in real-time PCR gene order The forward primer (5 '- > 3') The reverse primer (5 '- > 3') IL-4 ACA GGA GAA GGG ACG CCA T (SEQ ID NO: 11) GAA GCC CTA CAG ACG AGC TCA (SEQ ID NO: 12) IL-31 CAC ACA GGA ACA ACG AAG CC (SEQ ID NO: 13) CGA TAT TGG GGC ACC GAA G (SEQ ID NO: 14) IL-23 CAC ATG CAC CAG CGG GAC AT (SEQ ID NO: 15) CTT TGC AAG CAG AAC TGG CTG TTG (SEQ ID NO: 16) TNF-a CGT CGT AGC AAA CCA CCA AG (SEQ ID NO: 17) TTG AAG AGA ACC TGG GAG TAG ACA (SEQ ID NO: 18) GAPDH CAT GGC CTT CCG TGT TCC TA (SEQ ID NO: 19) CCT GCT TCA CCA CCT TCT TGA T (SEQ ID NO: 20)

Experiments on the animal model 1 showed that both the IL-4 and IL-31 mRNA expression levels of the inflammation-related cytokines responsible for dermatitis in the exosome-treated group (both IV and SC) (Figs. 12A and 12B). In addition, experiments on the animal model 2 showed that various inflammation-related cytokines, IL-4, IL-31, TNF-a, which cause dermatitis in the exosomes treated group (both IV and SC) And IL-23 mRNA expression levels were all dose-dependently reduced (Figs. 15A to 15D).

The group treated with the exosomes of the present invention decreased the mRNA expression levels of IL-4, IL-31, TNF-α and IL-23 in a dose-dependent manner compared to the control and prednisolone- Related cytokines are a major target for development of dermatitis-related therapeutics. Decreased expression levels for these multiple targets are associated with inhibition and mitigation of dermatitis. IL-4 initiates isotype class switching to IgE and activates eosinophils. In addition, it is known that IL-31 affects isotype class switching to IgE, inflammatory cells aggregate into the skin, and increased IL-31 is associated with exacerbation of dermatitis. IL-23 differentiates ThO-type T-cells into pathogenic helper T-cells that produce TNF-α, and TNF-α is known to be associated with exacerbation of dermatitis when plasma concentrations are high. Taken together, these findings suggest that the exosome of the present invention modulates the inflammatory response by inhibiting the expression of multiple cytokines, which are major causes of dermatitis.

Thus, the exosomes of the present invention act on a variety of inflammatory cytokine targets (i.e. IL-4, IL-31, IL-23, and TNF-a) causing dermatitis, Is expected to be able to effectively and effectively inhibit and alleviate dermatitis.

Example 10: Blood analysis

Plasma was separated from the blood of the sacrificed mice and the concentration of immunoglobulin E (IgE) in the blood was measured using an ELISA kit. In the above experiment, it was confirmed that the serum IgE level was decreased in a dose-dependent manner in the exosome-treated group prepared in Example 2 (FIG. 16A).

In addition, the number of blood cells was measured using whole blood of sacrificed mice. A certain amount of whole blood cells were centrifuged at 1,000 rpm for 10 minutes using Saito Spin (purchased from ThermoFisher Scientific), slide-dried, and then subjected to Diff-Quik staining. Then, white blood cells and eosinophils Was measured. Through these experiments, it was confirmed that the number of leukocytes and eosinophils in blood was reduced in a dose-dependent manner in the group treated with exosome prepared in Example 2 (FIG. 16B and FIG. 16C).

From the above results, it can be concluded that the composition of the present invention not only reduces the serum IgE level, which is an inflammatory reaction factor that causes dermatitis, but also decreases the number of blood leukocytes and eosinophils and also produces various inflammatory cytokines and inflammation- And inhibits the activity or involvement of inflammation-related immune cells. Thus, it can be usefully used as a pharmaceutical composition for preventing, improving, alleviating or treating dermatitis, an external preparation for skin, and a cosmetic composition.

Example 11: Animal model causing skin barrier damage causing dermatitis

If the skin barrier is damaged, chemicals and microorganisms can easily penetrate into the skin to cause or exacerbate the dermatitis, and the dermatitis repeatedly causes a vicious cycle in which the skin barrier is damaged or exacerbated. Thus, by reducing moisture evaporation of the stratum corneum and enhancing skin moisturization to protect and enhance skin barrier, dermatitis symptoms can be ameliorated, alleviated or treated.

Oxazolone is used to establish an animal model in which skin barrier damage caused by dermatitis is caused. Oxazolone causes impairment of skin barrier function when applied to the skin. It causes decrease of moisture of skin stratum corneum caused by increase of transepidermal water loss (TEWL), decrease of expression of loricrin, involucin tin, It is possible to provide an animal model with impaired skin barrier function that causes an increase in the pH of the stratum corneum and causes dermatitis (Journal of Investigative Dermatology (2008) 128 (1), 79-86).

Female SKH-1 mice (5 weeks old; purchased from the central laboratory animal) were purchased and used for this experiment through a 7-day adaptation period. The mice that had undergone adaptation were divided into 6 groups as shown below after inducing skin barrier damage.

(1) Normal: normal control group (denoted by " N " in FIG. 23);

(2) Control (skin barrier impairment group): negative control which caused skin barrier damage by oxazolone (denoted by " C " in FIG. 23);

(3) Exosomal low dose: Exosome prepared in Example 2 after inducing skin barrier damage with oxazolone was subcutaneously injected (SC: subcutaneous injection) at a dose of 1 μg per subject for 4 weeks (FIG. 23 Quot; L ");

(4) Medium dose of exosomes: Exosome prepared in Example 2 after induction of skin barrier damage with oxazolone was administered subcutaneously for 3 weeks at a dose of 3 μg per day for 4 weeks (indicated as "M" in FIG. 23 );

(5) High dose of exosome: Exosome prepared in Example 2 after inducing skin barrier damage with oxazolone was administered subcutaneously for 4 weeks three times a week at a dose of 10 μg per subject (indicated as "H" in FIG. 23 );

(6) Dexamethasone: An experimental group (positive control) (100 mg / d) in which 0.03% dexamethasone (purchased from Sigma) dissolved in ethanol after inducing skin barrier damage with oxazolone was subcutaneously administered for 4 weeks three times a week Quot; D ").

200 μL of 2% oxazolone (purchased from Sigma) was applied to the back skin of mice in each of the experimental groups (2) to (6), and the skin barrier recovery period after 5-7 days Skin barrier damage was induced by applying 100 μL of 0.025% to 0.05% oxazolone to the skin of mice in each of the experimental groups (2) to (6) every other day for 15 days. In order to maintain skin barrier damage, 100 μL of 0.025% ~ 0.05% oxazolone was applied to the skin of rats in each of the experimental groups (2) to (6) every other day during the treatment with exosomes.

Before and after the treatment of the exosomes of the present invention, the average moisture evaporation of the skin was measured using a TEWL measuring instrument and the skin moisture content was measured using a moisture meter (Corneometer CM825) (Courage-Khazaka eletronic GmbH, Germany) .

As a result, in the test group of (3) to (5) in which exosome was treated according to one embodiment of the present invention, it was confirmed that decrease of transepidermal water loss, that is, decrease of moisture evaporation of the stratum corneum 23). In addition, an increase in skin hydration in a dose-dependent manner of exosomes was confirmed in the experimental groups (3) to (5) in which exosome of the present invention was treated (FIG. 24). Therefore, the composition comprising the exosome of the present invention as an active ingredient can reduce moisture evaporation of the stratum corneum and improve skin moisturization, thereby protecting and strengthening the skin barrier. Through the protection and strengthening of the skin barrier, It can alleviate or cure.

On the other hand, the body weight of each experimental group was measured. As a result, the body weight of the experimental group treated with dexamethasone was reduced due to adverse effects. However, in the experiment group of (3) to (5) , There was almost no decrease in body weight compared to the normal control group (Fig. 25). That is, while dexamethasone generally used for the recovery or alleviation of skin barrier damage and treatment of dermatitis exhibits side effects such as weight loss, the composition comprising the exosome as an active ingredient according to one embodiment of the present invention, While protecting against side effects such as weight loss.

Example 12: Skin permeability test of exosome of the present invention

PKH67 dye (purchased from Sigma) was used to prepare fluorescently stained exosomes. 1 mM PKH67 was diluted in Diluent C (purchased from Sigma) to prepare a 10 μM PKH67 solution, mixed with an appropriate concentration of exosome solution, and allowed to react at room temperature for 10 minutes in the absence of light. After the reaction, an MW3000 spin column (purchased from ThermoFisher Scientific) was used to remove residual PKH67 dye from the exosome of the present invention (hereinafter abbreviated as "PKH-exosomes") stained with PKH67. After confirming the use of a fluorescence meter (purchased from Molecular Devices), PKH67 which did not react with the exosome of the present invention was removed, and fluorescence of sufficient intensity was detected in PKH-exosomes (FIG. 17).

The PKH-exosomes were dispersed in phosphate buffer (PBS) at a proper concentration, for example, a concentration of 1 × 10 ⁵ to 1 × 10 ⁹ particles / mL, and then applied to the skin outer surface of the pig skin tissue. To prevent drying of the applied PKH-exosomes, the nonwoven fabric was covered and allowed to react for an appropriate period of time, for example, 30 minutes to 1 hour to allow the PKH-exosomes to be delivered to the subcutaneous tissues. After the reaction was completed, the pig skin tissue was immersed in a 3.7% formaldehyde solution, reacted overnight, and washed three times for 5 minutes each with phosphate buffered saline. The washed pig skin tissue was immersed in a 30% sucrose solution and treated with OCT compound. After washing three times for 5 minutes with phosphate buffer solution, sections were prepared on a longitudinal section using a microtome, and tissue sections were placed on a slide glass. On the other hand, the preparation of the tissue section may be carried out before the tissue is fixed with formaldehyde solution. Fluorescence detected from PKH-exosomes in tissue sections was observed using fluorescence microscopy. In this way, PKH-exosomes transmitted through the epidermis of the pig skin tissue and transferred to the subcutaneous tissues were identified (Fig. 18). As shown in Fig. 18, the exosome of the present invention can effectively pass through the skin barrier and be deeply transferred into the skin tissue, and can be effectively absorbed to the skin. Accordingly, the external preparation for skin or cosmetic composition containing the exosome as an active ingredient is expected to act effectively in preventing, improving, alleviating or treating dermatitis.

Next, the skin tissue of the hairless mouse was removed and placed on top of the chamber of the Franz Diffusion Cell. At this time, the inside of the diffusion cell was filled with a phosphate buffer solution. PKH-exosomes were dispersed in phosphate buffer (PBS) at a proper concentration, for example, 1 × 10 ⁵ to 1 × 10 ⁹ particles / mL, and then applied to the outside of the skin tissue of the mice. At this time, in order to prevent drying of PKH-exosomes, the nonwoven fabric was pre-positioned outside the mouse skin tissue, and PKH-exosomes were injected between the nonwoven fabric and skin tissue. Then, the reaction was carried out for 30 minutes to 1 hour. After completion of the reaction, the PKH-exosomes transferred into the skin tissue were confirmed immediately using a confocal fluorescence microscope (Leica, SP8X) or the skin tissue and the PKH-exosomal solution were further reacted for 1 hour to 6 hours , And PKH-exosomes were identified by confocal fluorescence microscopy. As a result of the above-mentioned method, the exosome of the present invention can effectively pass through the skin barrier and be deeply transferred into the skin tissue, and can be effectively absorbed to the skin (FIG. 19).

Accordingly, the external preparation for skin or cosmetic composition containing the exosome as an active ingredient is expected to act effectively in preventing, improving, alleviating or treating dermatitis.

Example 13: Treatment of composition comprising exosome as an active ingredient for human skin

A composition (exosome-containing suspension) containing the exosome obtained according to the separation method of one embodiment of the present invention is applied to the affected part (hand, neck, arm, etc.) of three severe atopic patients for 1 to 2 weeks And then iontophoresis was performed by using a iontophoresis device to flow a microcurrent into the affected part of the composition. As a result, the severe itching of the patients was remarkably alleviated, and erythema symptoms associated with dermatitis were also markedly improved (Fig. 21). All of the patients who applied the composition containing the exosome of the present invention alleviated the symptoms of severe itching and erythema-related erythema, and symptoms improved to such an extent that the prescription of the steroid or antihistamine preparation was stopped.

Accordingly, the external preparation for skin or cosmetic composition containing the exosome obtained as an active ingredient according to the separation method of one embodiment of the present invention can prevent, improve, alleviate or cure dermatitis .

Example 14: Treatment of a Composition Containing Exosome as an Active Ingredient for Canine Animals

Experiments were conducted on Shetland Sheepdog (weight 13 kg, 9 years old) suffering from naturally occurring severe atopic dermatitis. The composition containing the exosome (the exosome prepared in Example 2) obtained according to the separation method of one embodiment of the present invention was applied to the Shetland Sextant, who suffered from naturally occurring severe atopic dermatitis, for a total of 12 times for 5 weeks Respectively. The exosomes prepared in Example 2 were injected at a dose of 117 μg per individual in one injection. In week 1 and week 2, subcutaneous injections were performed three times a week. In weeks 3, 4, and 5, subcutaneous injections were performed twice weekly. After the administration of the exosome of the present invention, the administration of the other drug was stopped.

FIG. 22A shows that erythema and inflammation are severe in the abdomen as a photograph of the affected area before administration of the exosome of the present invention. The dermatitis symptoms were significantly improved from the third day after the administration of the exosome of the present invention (Fig. 22B), and the dermatitis almost disappeared on the tenth day after administration (Fig. 22C) and the second week after administration (Fig. 22D). In addition, after the exosome administration of the present invention, the vitality of the Shetland sheath was significantly increased and the body weight increased to 16 kg. The increase of vitality and the increase of the concentration are thought to be due to the improvement of dermatitis symptom.

In order to confirm whether the exosome of the present invention sustained the dermatitis treatment effect, the lesion of the Shetland Islands was continuously observed after completion of the exosome administration of the present invention. As a result, it was confirmed that the effect of improving dermatitis symptoms persisted on the 50th day after the end of administration (Fig. 22E) and on the 93th day (Fig. 22F).

Therefore, the composition containing the exosome obtained according to the separation method of one embodiment of the present invention can effectively alleviate or improve the dermatitis, as confirmed by the animal test on the canine animal as described above, The effect can be maintained continuously.

Example 15: Determination of anti-inflammatory effect using THP-1 monocyte

After the THP-1 monocyte (THP-1 human monocyte) was differentiated into macrophages, the anti-inflammatory effect of the exosome of the present invention was confirmed as follows.

THP-1 monocytes were cultured in RPMI supplemented with 10% FBS (Fetal Bovine Serum), 1% penicillin-streptomycin and 100 nM Phorbol 12-myristate 13-acetate (purchased from Sigma) 1640 (purchased from ThermoFisher Scientific) medium at 1640 (purchased from ThermoFisher Scientific), and then seeded in a 12-well plate at a density of 6 × 10 ⁵ cells / mL and cultured in a 5% CO ₂ incubator at 37 ° C. for 48 hours to obtain THP-1 Derived macrophage (THP-1 derived macrophage). The differentiated cells were then washed once with PBS and cultured in RPMI 1640 medium without formalin 12-myristate 13-acetate for 24 hours to stabilize the cells.

For the co-treatment group, RPMI 1640 medium without FBS (Fetal Bovine Serum), 100 ng / mL LPS (purchased from Sigma) and 20 ng / mL IFN -gamma (purchased from Peprotech) to activate THP-1 derived macrophages and to treat the positive control group dexamethasone (purchased from Sigma) or the exosome of the present invention (exosome prepared in Example 2) for 24 hours Lt; / RTI > On the other hand, in the case of the pre-treatment experimental group, RPMI 1640 medium containing no FBS (Fetal Bovine Serum) for the THP-1 derived macrophages and dexamethasone (purchased from Sigma) (Obtained from Sigma) and 20 ng / mL IFN-y (purchased from Peprotech) and cultured for 4 hours to obtain THP (exoprotein prepared in Example 2) for 24 hours and then treated with 100 ng / -1-derived macrophages.

CDNA was prepared from the RNA isolated from cultured THP-1 derived macrophages, and cDNA was prepared from the pro-inflammatory cytokines IL-6, IL-1β And TNF-alpha mRNA expression levels were measured. GAPDH was used as a standard gene for quantifying the genes. The types and sequences of the primers used in the PCR are shown in Table 3 below.

Primer types and base sequences used in real-time PCR gene order The forward primer (5 '- > 3') The reverse primer (5 '- > 3') IL-6 AAGCCAGAGCTGTGCAGATGAGTA (SEQ ID NO: 21) TGTCCTGCAGCCACTGGTTC (SEQ ID NO: 22) IL-1? ACCTGTCCTGCGTGTTGAAAGATG (SEQ ID NO: 23) TGGGCAGACTCAAATTCCAGCTTG (SEQ ID NO: 24) TNF-a CTGCCTGCTGCACTTTGGAG (SEQ ID NO: 25) ACATGGGCTACAGGCTTGTCACT (SEQ ID NO: 26) GAPDH CTTTGGTATCGTGGAAGGACTC (SEQ ID NO: 27) GTAGAGGCAGGGATGATGTTCT (SEQ ID NO: 28)

26, when THP-1 derived macrophages obtained after differentiating THP-1 monocytes into macrophages were treated with the exosomes of the present invention together with LPS and IFN-y (co-treatment) , The expression level of IL-6 mRNA, which is a proinflammatory cytokine, was decreased as compared with the negative control group. 27 to 29, THP-1-derived macrophages obtained after differentiating THP-1 monocytes into macrophages were pretreated with the exosomes of the present invention before LPS and IFN- -treatment), the expression levels of pro-inflammatory cytokines IL-6, IL-1 [beta] and TNF- [alpha] were decreased compared to the negative control.

The proinflammatory cytokines IL-6, IL-1 [beta] and TNF- [alpha] increase expression in proinflammatory M1 macrophages and decrease expression in anti-inflammatory M2 macrophages. Therefore, the above results suggest that the exosome of the present invention can inhibit, alleviate and reduce the inflammatory reaction and the dermatitis symptom thereof, and this result strongly supports the animal experimental results discussed above.

Example 16: Preparation of cosmetic composition containing exosome of the present invention

The cosmetic composition (lotion) was prepared by suspending the exosomes prepared in Example 2 at the concentration of 1704 μg / mL with the ingredients listed in Table 4 below. The content of each component is shown in Table 4 below.

Ingredients and content of lotions containing the exosome of the present invention ingredient Content (% by weight) The exosome prepared in Example 2 One glycerin 7.375 Caprylic / capric triglyceride 6 Cetyl ethyl hexanoate 5 Propanediol 5 Phenyl trimethicone 3.5 Stearic acid 3 1,2-hexanediol 2 Panthenol 2 Cetearyl olivate 1.8 Sorbitan olivate 1.2 Diisostearyl malate One Fructan One Ammonium acryloyldimethyltaurate / VP copolymer 0.3 Arachidyl alcohol 0.25 Behenyl alcohol 0.15 Arachidyl glucoside 0.1 Hydrogenated lecithin 0.1 Shea Butter 0.09 Xanthan gum 0.05 Lavender Oil 0.02 Bergamot oil 0.02 Ceramide NP 0.02 Orange peel oil 0.02 Phytosphingosine 0.015 Palmitoyl tetrapeptide-7 0.01 Palmitoyl tripeptide-1 0.01 Purified water Balance

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> ExoCoBio Inc. <120> A composition comprising an exosome derived from adipose-derived          stem cell as an active ingredient and its application for          improving dermatitis <130> P17-0031KR <150> KR 10-2017-0083506 <151> 2017-06-30 <150> KR 10-2017-0111179 <151> 2017-08-31 <150> KR 10-2018-0018617 <151> 2018-02-14 <150> KR 10-2018-0062854 <151> 2018-05-31 <160> 28 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha forward primer <400> 1 tctcatcagt tctatggccc agac 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha reverse primer <400> 2 ggcaccacta gttggttgtc tttg 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> iNOS forward primer <400> 3 gctaccacat tgaagaagct ggtg 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> iNOS reverse primer <400> 4 ccataggaaa agactgcacc gaag 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 5 gacatcaaga aggtggtgaa gcag 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 6 ccctgttgct gtagccgtat tcat 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-6 forward primer <400> 7 gccagagtcc ttcagagaga taca 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-6 reverse primer <400> 8 attggatggt cttggtcctt agcc 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-1beta forward primer <400> 9 gcaacgacaa aatacctgtg gcct 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-1beta reverse primer <400> 10 agttggggaa ctctgcagac tcaa 24 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> IL-4 forward primer <400> 11 acaggagaag ggacgccat 19 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> IL-4 reverse primer <400> 12 gaagccctac agacgagctc a 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-31 forward primer <400> 13 cacacaggaa caacgaagcc 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> IL-31 reverse primer <400> 14 cgatattggg gcaccgaag 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-23 forward primer <400> 15 cacatgcacc agcgggacat 20 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-23 reverse primer <400> 16 ctttgcaagc agaactggct gttg 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha forward primer <400> 17 cgtcgtagca aaccaccaag 20 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha reverse primer <400> 18 ttgaagagaa cctgggagta gaca 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 19 catggccttc cgtgttccta 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 20 cctgcttcac caccttcttg at 22 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-6 (THP-1) forward primer <400> 21 aagccagagc tgtgcagatg agta 24 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-6 (THP-1) reverse primer <400> 22 tgtcctgcag ccactggttc 20 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-1beta (THP-1) forward primer <400> 23 acctgtcctg cgtgttgaaa gatg 24 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> IL-1beta (THP-1) reverse primer <400> 24 tgggcagact caaattccag cttg 24 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> TNF-alpha (THP-1) forward primer <400> 25 ctgcctgctg cactttggag 20 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> TNF-alpha (THP-1) reverse primer <400> 26 acatgggcta caggcttgtc act 23 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH (THP-1) forward primer <400> 27 ctttggtatc gtggaaggac tc 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH (THP-1) reverse primer <400> 28 gtagaggcag ggatgatgtt ct 22

Claims (26)

A pharmaceutical composition for preventing, improving, alleviating or treating dermatitis, which comprises an exosome derived from an adipose stem cell as an active ingredient. The method according to claim 1,
Wherein the exosome is obtained by performing the following steps:
(a) adding trehalose to the adipose stem cell culture fluid, (b) filtering the adipose stem cell culture solution to which the trehalose has been added, (c) (D) separating the exosomes by using Tangential Flow Filtration, and (d) adding trehalose to the buffer used for desalting and diafiltration, adding the trehalose-added buffer solution And performing desalination and diafiltration on the separated exosomes using TFF (Tangential Flow Filtration) using the same. 3. The method of claim 2,
Wherein the desalting and buffer exchange is carried out continuously or intermittently. 3. The method of claim 2,
Characterized in that desalting and buffer exchange are carried out using a buffer solution having a volume at least 4 times the starting volume. 3. The method of claim 2,
Characterized in that a molecular weight cutoff (MWCO) of 100,000 Da, 300,000 Da, 500,000 Da or 750,000 Da TFF filter or 0.05 占 퐉 TFF filter is used for Tangential Flow Filtration. 3. The method of claim 2,
Wherein the step (c) further comprises concentrating to a volume of 1/100 to 1/25 using TFF (Tangential Flow Filtration). 3. The method of claim 2,
Wherein the filtered fat stem cell culture fluid is sonicated prior to TFF. 8. The method according to any one of claims 1 to 7,
Wherein said exosomes reduce the expression levels of IL-4 and IL-31 in skin tissue or skin cells. 9. The method of claim 8,
In addition, the exosomes reduce the expression level of at least one of IL-23 or TNF-a in skin tissue or skin cells. 8. The method according to any one of claims 1 to 7,
Wherein the exosome reduces the level of blood IgE and the number of blood leukocytes and eosinophils. 8. The method according to any one of claims 1 to 7,
Wherein said exosomes reduce the number of mast cells, CD86 + cells and CD206 + cells in the dermal tissue. 8. The method according to any one of claims 1 to 7,
Wherein the exosome reduces transepidermal water loss (TEWL) and increases skin moisture content. 8. The method according to any one of claims 1 to 7,
Wherein the exosomes reduce TNF-a mRNA expression, IL-6 mRNA expression, and IL-1 beta mRNA expression in an in vitro assay. An external preparation for skin for preventing, improving, alleviating or treating dermatitis, which comprises an exosome derived from adipose stem cells as an active ingredient. 15. The method of claim 14,
Wherein the exosome is carried or mixed with at least one of hydrogel, hyaluronic acid, hyaluronic acid salt, or hyaluronic acid gel. 16. The method of claim 15,
Wherein the hydrogel is a hydrogel obtained by dispersing a gelated polymer in a polyhydric alcohol. 17. The method of claim 16,
Wherein the gel polymer is at least one selected from the group consisting of pluronic, purified agar, agarose, gellan gum, alginic acid, carrageenan, cacao gum, xanthan gum, galactomannan, glucomannan, pectin, cellulose, guar gum and locust bean gum Wherein said polyhydric alcohol is at least one selected from the group consisting of ethylene glycol, propylene glycol, 1,3-butylene glycol, isobutylene glycol, dipropylene glycol, sorbitol, xylitol and glycerin. . A cosmetic composition for preventing, ameliorating or alleviating dermatitis, comprising an exosome derived from an adipose stem cell as an active ingredient. 19. The method of claim 18,
At least one member selected from the group consisting of patches, mask packs, mask sheets, creams, tonics, ointments, suspensions, emulsions, pastes, lotions, gels, oils, packs, sprays, aerosols, mist, foundations, Wherein the composition is applied to the cosmetic composition. 20. The method of claim 19,
Wherein the cosmetic composition is applied or deposited on at least one surface of the patch, mask pack or mask sheet. (a) directly applying the cosmetic composition of claim 18 to the skin of a mammal, (b) contacting or depositing a patch, mask pack or mask sheet on which the cosmetic composition is applied or deposited, with the skin of the mammal , Or (a) and (b) above, in order to control the condition of the mammalian skin except for the treatment. 22. The method of claim 21,
(c) conducting iontophoresis by flowing a minute current through the skin of the mammal to which the cosmetic composition is applied. 23. The method of claim 22,
Further comprising contacting or attaching an iontophoresis device to the skin of said mammal. 24. The method of claim 23,
The iontophoresis device may include at least one battery selected from the group consisting of a flexible battery, a lithium ion secondary battery, an alkaline battery, a dry battery, a mercury battery, a lithium battery, a nickel-cadmium battery, , A patch, a mask pack or a mask sheet on which said at least one battery is mounted. 8. A method for preventing, ameliorating, alleviating or treating dermatitis, comprising administering to a mammal a therapeutically effective amount of a pharmaceutical composition as claimed in any one of claims 1 to 7. 26. The method of claim 25,
Wherein the mammal is a human, a dog, a cat, a rodent, a horse, a cow, a monkey, or a pig, the method of preventing, ameliorating, alleviating or treating dermatitis.

Images