KR20160029308A - Compostion preventing Infalmmatory diseases and autoimmune diseases Using Plant derived GA733-2-Fc protein - Google Patents

Abstract

The present invention relates to a composition for preventing or treating inflammatory diseases or immunological diseases, comprising a GA733-2-Fc protein extracted from a plant, and a producing method thereof and, more specifically, to a composition comprising a GA733-2-Fc protein derived from a plant, wherein the composition alleviates inflammatory diseases or immunological diseases, and controls activated immune cells which are abnormally activated. The producing method of the composition comprises the steps of: a) producing a GA733-2-Fc recombinant plant expression vector; b) producing transgenic tobacco leaves; and c) extracting a GA733-2-Fc protein derived from a plant.

Description

[0001] The present invention relates to a plant-derived GA733-2-Fc protein as an agent for treating an inflammatory disease or an immune disease, and a method for producing the same,

The present invention relates to a composition for preventing or treating an inflammatory disease or an immune disease comprising GA733-2-Fc protein extracted from a plant, and a method for producing the same, and more particularly, To a composition that alleviates a disease or immune disease and modulates abnormally transient activated immune cells.

Inflammatory bowel disease (IBD) or ulcerative colitis (UC) and Chron's disease (DC), a type of immune disease, have yet to elucidate the pathogenesis of this disease. Were classified as autoimmune diseases.

The most common symptom of ulcerative colitis is stool, which can be a mixture of mucus. These symptoms are persistent or repeated with aggravation and improvement, accompanied by lower abdominal pain, high fever and weight loss, and extra bowel symptoms are arthralgia, skin lesions, and liver disease. Most of them have a recurrence within 1 year and are localized diseases that invade the workplace, but there are serious cases that require some hospitalization. In addition, the symptoms of the entire large intestine with more than 10 times a day, and rarely toxic to the large colic (Toxic dilation) is also shown.

Crohn's disease is characterized by fever, abdominal pain, diarrhea, general fatigue, weight loss, and symptomatic symptoms in only part of the rectum. Anal fever, fistula, perianal abscess, etc., and symptoms of the intestinal tract may also appear. Symptoms in the large intestine indicate diarrhea and abdominal pain. Symptoms in the small intestine indicate symptoms such as fatigue, weight loss, discomfort in the right lower abdomen, abdominal pain, diarrhea, mild fever, nausea, and vomiting.

Ulcerative colitis has local mucosal inflammation, such as rectum and colon, whereas Crohn's disease is a transmural inflammation of the intestinal mucosa in all parts of the gastrointestinal tract. The cause of these two diseases is not clear, so it is presumed that mucosal immunoregulation is lost due to genetic and environmental factors. Currently, the treatment of ulcerative colitis is to control the immune function and inflammation to relieve the symptoms and then to prevent secondary problems, such as anti-inflammatory drugs, corticosteroids, immunosuppressants, antibiotics, such as drugs or injections are used.

Methods for using antibiotics or monoclonal antibodies as a method for alleviating inflammatory diseases or immune diseases such as ulcerative colitis or Crohn's disease have been developed but not yet achieved.

On the other hand, GA733-2 is a 40kDa colon cancer specific cell surface glycoprotein that is overexpressed in colorectal cancer. GA733-2 monoclonal antibody is used as a treatment for colorectal cancer -0102646, KR No. 2011-0042934) It is not known that the plant-derived GA733-2-Fc protein inhibits inflammatory diseases such as ulcerative colitis or Crohn's disease or immune diseases.

Therefore, the present applicant has for the first time confirmed that GA733-2 protein related to early diagnosis and treatment of colorectal cancer may be used as an agent for the prevention and treatment of inflammatory diseases or immunological diseases by controlling excessive inflammatory reaction and immune system, The present inventors completed the present invention by confirming the inhibition of inflammatory disease symptoms by orally administering GA733-2-Fc protein extracted from plants to a model.

KR 2012-0102646 KR 2011-0042934

The present invention relates to a method for the treatment of an inflammatory disease or an immune disorder, which comprises the step of using a plant-derived GA733-2-Fc protein as a preventive and therapeutic agent for an inflammatory disease or an immunological disease, And to provide a composition for the prevention and treatment of inflammatory diseases or immunological diseases and a method for producing the same.

A) preparing a GA733-2-Fc recombinant plant expression vector in which the GA733-2-Fc gene is inserted into a pBINPLUS expression vector to regulate GA733-2-Fc gene expression;

b) transforming the plant expression vector into Nicotiana tabacum cells to produce transformed tobacco leaves;

c) harvesting the tobacco leaves and extracting the plant-derived GA733-2-Fc protein by ammonium sulfate fractionation;

And a method for producing a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease.

The present invention provides a method for producing a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease, wherein the plant-derived GA733-2-Fc protein has the amino acid sequence of SEQ ID NO: 1.

The present invention relates to the above-mentioned plant-derived GA733-2-Fc protein for the prophylaxis and treatment of inflammatory diseases or immunological diseases characterized by reducing inflammatory cytokines and enhancing inflammatory response and mucosal immunity through increase of B cells The present invention provides a method for producing the composition.

The present invention provides a method for the preparation of a pharmaceutical composition for the prophylaxis and treatment of an inflammatory disease or an immunological disease, wherein the inflammatory disease or the immune disorder is ulcerative colitis or Crohn's disease.

The present invention provides a pharmaceutical composition for the prophylaxis and treatment of an inflammatory disease or an immunological disease produced by the above-mentioned method.

The present invention provides an inflammatory disease or an immunological disease diagnostic kit comprising the composition.

The present invention provides a method for the prevention and treatment of inflammatory diseases or immunological diseases including GA733-2-Fc protein extracted from plants by using a transformation technique of introducing GA733-2-Fc gene into a plant cell line which is easy to mass- The pharmaceutical composition can be usefully used for the diagnosis, improvement, prevention or treatment of inflammatory growth diseases by controlling the inflammatory reaction and inhibiting excessive immune activity in the colon tissue.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a photograph of a plant expression vector and a transformed tobacco (b) photograph according to the present invention. FIG.
FIG. 2 shows the results of Western blotting of the GA733-2-Fc protein extracted from the transgenic tobacco according to the present invention.
FIG. 3 shows toxicity and stability when the plant-derived GA733-2-Fc protein was orally administered to mice.
FIG. 4 shows the effect of DSS (dextran sodium sulfate) -induced animal model on the length of the plant-derived GA733-2-Fc protein treated.
FIG. 5 shows the effect of DSS (dextran sodium sulfate) -induced disease animal model on plant-derived GA733-2-Fc protein on the follicle and intercellular boundary of the colon.
FIG. 6 shows the effect of the plant-derived GA733-2-Fc protein on mucosal immune activity in an animal model of DSS (dextran sodium sulfate) -induced disease.
FIG. 7 shows the results of a change in inflammation-related cytokines when a plant-derived GA733-2-Fc protein was treated with an animal model of DSS (dextran sodium sulfate) -induced disease.
Figure 8 shows the amino acid sequence of GA733-2-Fc prepared according to the present invention.

The present inventors have conducted continuous research on a method of using an immune system that is present in the intestines and related to mucosal immunity, in addition to current treatments using antibiotics and the like in the treatment of inflammatory diseases or immune diseases. As a result, it has been unexpectedly confirmed that GA733-2 protein related to early diagnosis and treatment of colorectal cancer may be used as an agent for preventing or treating inflammatory diseases or immunological diseases by controlling excessive inflammatory reaction and immune system. Furthermore, the present invention has been accomplished by confirming the inhibition of inflammatory disease symptoms by orally administering GA733-2-Fc protein extracted from plants to animal models.

GA733-2 of the present invention is a 40kDa colorectal cancer-specific cell surface glycoprotein that is overexpressed in colorectal cancer. GA733-2 monoclonal antibody is used as a therapeutic agent for colorectal cancer, but GA733- 2 The relationship between protein and inflammatory disease or immune disease has not yet been developed.

The present inventors transformed plant cells using a plant expression vector to over-express GA733-2-Fc protein in plants, thereby facilitating mass production.

Hereinafter, the present invention will be described in more detail.

 A) preparing a GA733-2-Fc recombinant plant expression vector in which the GA733-2-Fc gene is inserted into a pBINPLUS expression vector to regulate GA733-2-Fc gene expression;

b) transforming the plant expression vector into Nicotiana tabacum cells to produce transformed tobacco leaves;

c) harvesting the tobacco leaves and extracting the plant-derived GA733-2-Fc protein by ammonium sulfate fractionation;

And a method for producing a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease.

Can be carried out according to methods generally known in the art for producing transgenic plant cells and transgenic plants of the present invention

As a production method according to an embodiment of the present invention, a pBINPLUS vector backbone which can be selected as a kanamycin antibiotic and a gene expression system in which the expression of GA733-2 gene is regulated by a plant systemic expression promoter, 35S promoter, Expression vectors were constructed. Nicotiana tabacum was transformed with the constructed pBINPLUS plant expression vector and the leaves of transformed tobacco were harvested to extract GA733-2-Fc protein.

The method for harvesting the GA733-2-Fc protein from the transformed tobacco leaves is not particularly limited as far as the protein is fractionated, but it is most preferable to extract it by ammonium sulfate fractionation.

More specifically, the protein is extracted by adding 5 to 30 parts by weight of ammonium sulfate based on 100 parts by weight of the mixed powder obtained by harvesting the transformed leaves and pulverizing with the pulverizer and the GA733-2-Fc protein eluate But is not limited thereto.

In extracting the GA733-2-Fc protein from the transformed tobacco leaf, the ammonium sulfate salt was treated to select the largest concentration of GA733-2-Fc protein, and most preferably 25 to 50% of the protein was extracted Respectively.

The present invention provides a method for producing a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease, wherein the plant-derived GA733-2-Fc protein extracted from a plant according to the above production method has an amino acid sequence represented by SEQ ID NO:

According to an embodiment of the present invention, there is provided a method of preparing a pharmaceutical composition for preventing or treating an inflammatory disease or an immune disorder, wherein the inflammatory disease or the immune disorder is ulcerative colitis or Crohn's disease.

The present invention relates to a plant-derived GA733-2-Fc protein extracted from a plant by the above-described method and has a function of reducing inflammation-induced cytokines and enhancing mucosal immunity by regulating inflammatory and immune responses.

More specifically, the plant-derived GA733-2-Fc protein of the present invention reduces the inflammatory cytokines IL-1β, IL-17, TNF-α and TNF-β, which are overexpressed in inflammatory diseases, Inflammatory diseases or immune diseases which are characterized in that they act through the activity of regulating inflammatory responses and enhancing mucosal immunity.

In particular, the inflammatory diseases according to the present invention are diseases caused by excessive production of inflammatory cytokines induced by lipopolysaccharide (LPS), and autoimmune diseases. More preferably, the autoimmune disease is ulcerative colitis or Crohn's disease. Ulcerative colitis has local mucosal inflammation, such as rectum and colon, whereas Crohn's disease is a transmural inflammation of the intestinal mucosa in all parts of the gastrointestinal tract. Therefore, both of these diseases can not be explained by any one cause, but it is presumed that the immune regulation function of the mucosa is lost due to environmental factor and genetic predisposition. Therefore, the treatment of ulcerative colorectal cancer by controlling the immune function and inflammation to alleviate symptoms, and then to prevent secondary problems, anti-inflammatory drugs, corticosteroids, immunosuppressants, antibiotics, such as drugs or injections to be used in parallel .

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases or immunological diseases produced by the above-mentioned method.

More specifically, the plant-derived GA733-2-Fc protein having the inflammation-regulating and immunomodulating functions prepared by the manufacturing method according to one embodiment of the present invention is used as an active ingredient and is used as an active ingredient for the treatment of ulcerative colitis or Crohn's disease As a pharmaceutical composition for the prevention and treatment of cancer.

In addition, as an embodiment of the present invention, the plant-derived GA733-2-Fc protein according to the present invention was orally administered to mice suffering from inflammatory diseases or immune diseases with dextran sodium sulfate (DDS) -2-Fc protein by the colonic histopathological findings or the shape of the colonic tissues, it was confirmed that the plant-derived GA733-2-Fc protein having the inflammation-regulating and immunomodulating functions was used as an active ingredient, Or as a pharmaceutical composition for the prophylaxis and treatment of ulcerative colitis or Crohn's disease, among other immune diseases.

 In addition, from the above example, the expression of plant-derived GA733-2-Fc protein, particularly inflammatory cytokines (IL-1β, IL-17, TNF-α and TGF-β) which are overexpressed in ulcerative colitis disease or Crohn's disease The present invention provides an advantage that can be usefully used for the development of a diagnostic and therapeutic agent for an inflammatory disease or an immune disease.

When a pharmaceutical composition for preventing or treating an inflammatory disease or an immunological disease comprising the plant-derived GA733-2-Fc protein according to the present invention as an active ingredient is to be used as a therapeutic agent, the effective dose may be appropriately selected depending on the age, sex, The type of the disease and the severity of the disease. For example, the dose may be 20 to 100 mg per adult, and may be administered once or twice or three times a day.

In addition, the composition may be administered through any tour route known in the art, and may be administered by oral or parenteral administration. For parenteral administration, it may be administered by intravenous injection, Preferably, the composition can be administered by an oral administration method.

Therefore, the plant-derived GA733-2-Fc protein of the present invention may be used alone or in combination with one or more pharmaceutically acceptable carriers, excipients or diluents to form tablets, hard or soft capsules, Such as tablets, capsules, granules, chewing tablets, pills, powders, elixirs, suspensions, emulsions, solutions, syrups and preparations for oral administration or aerosols, sterile injectable solutions or sterile powders, and the like. For the purpose of oral administration, when the active ingredient of the present invention is formulated into preparations such as tablets, capsules, granules, chewing tablets, pills, powders, elixirs, suspensions, emulsions, solutions and syrup, , Binders such as microcrystalline cellulose or gelatin, excipients such as dicalcium phosphate or lactose, disintegrants such as alginic acid, corn starch or potato starch, lubricants such as magnesium stearate, sweeteners such as sucrose or saccharin, Methyl salicylate or a flavor such as fruit flavor. When the unit dosage form is a capsule, in addition to the above components, a liquid carrier such as polyethylene glycol or fatty oil may be included. Injections in the form of solutions or suspensions for parenteral administration may also be administered parenterally, for example, subcutaneously, intravenously, intramuscularly or intraperitoneally. In general, injectable solutions or suspensions may be formulated in pharmaceutically acceptable liquid carriers such as water, saline, aqueous dextrose and related sugar solutions, non-volatile oils, glycols such as ethanol, glycerin, polyethylene glycols and propylene glycol, Can be prepared by homogeneously mixing the active ingredients. In addition, adjuvants such as antibacterial agents, chelating agents, buffering agents and preservatives may be included if necessary. As the pharmaceutically acceptable carrier, any adjuvant that is pharmaceutically pure, substantially non-toxic, and does not interfere with the action of the active ingredient may be used.

In another aspect of the present invention, the present invention provides a pharmaceutical composition for the diagnosis and treatment of an inflammatory disease or an immunological disease comprising a pharmacological composition for preventing or treating an inflammatory disease or an immunological disease comprising the plant-derived GA733-2-Fc protein as an active ingredient Kit.

The kit for diagnosing inflammatory disease or immune disease comprises a kit for the diagnosis and treatment of an inflammatory disease or an immune disease, particularly ulcerative colitis or Crohns disease, using GA733-2 antibody specifically binding to the plant-derived GA733-2-Fc protein But is not limited thereto.

For example, if a kit is used for detection or diagnostic purposes, it can be made in the form of, for example, a microarray or a chip. The microarray or chip of the present invention may be fabricated using any method known in the art. For example, a polymer compound of silica, semiconductor, plastic, gold, silver, magnetic molecule, nylon, polydimethylsiloxane (PDMS), cellulose or nitrocellulose, But is not limited thereto.

 Another aspect of the present invention provides a health food comprising a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease, which comprises a plant-derived GA733-2-Fc protein as an active ingredient.

May be added to health functional foods for the purpose of preventing and treating inflammatory diseases or immunological diseases of the present invention. When the plant-derived GA733-2-Fc protein of the present invention is used as a food additive, the plant-derived GA733-2-Fc protein may be directly added or used in combination with other food or food ingredients, .

According to a preferred embodiment of the present invention, the health food can be manufactured in a form selected from the group consisting of powder, granule, tablet, capsule and beverage.

When the composition of the present invention is prepared as a food composition, it includes not only the plant-derived GA733-2-Fc protein as an active ingredient but also components that are ordinarily added at the time of food production, for example, protein, carbohydrate, fat, , Seasoning agents, and flavoring agents. Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavorings such as tau martin and stevia extract (e.g., rebaudioside A and glycyrrhizin) and synthetic flavorings (saccharine, aspartame, etc.) can be used as flavorings.

There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include health functional foods in a conventional sense.

For example, when the food composition of the present invention is prepared as a drink, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, mulberry extract, jujube extract, licorice extract, Can be included.

Hereinafter, the present invention will be described in more detail with reference to examples and comparative examples. It is intended to assist the understanding of the present invention and is not intended to limit the scope of the present invention in any way.

Example 1: Development of GA733-2-Fc transgenic tobacco

In order to construct the overexpression vector of GA733-2-Fc gene, the protein expression of plant-derived GA733-2-Fc was examined using various kinds of plant expression vectors, and pBINPLUS vector and pCAMBIA; Protein expression of GA733-2-Fc was confirmed in the pPZP 200-Bar vector. As a result, a plant expression vector under the condition that the expression of GA733-2 gene was regulated by the plant systemic expression promoter 35S promoter and ER targeting was made as a pBINPLUS vector backbone which can be easily selected as kanamycin antibiotic (Fig. 1- a)). 35S: GA733-2-Fc and 35S: Fc were transformed into tobacco (Nicitiana tabacum) cells using the plant expression vectors thus prepared to produce transformed tobacco (Fig. 1- (b)).

Example 2: Extraction of GA733-2-Fc protein in transgenic tobacco

The transgenic tobacco leaves obtained in Example 1 were harvested, and 100 ml of the protein elution solution was pulverized with a pulverizer, and 14.4 g of ammonium sulfate was dissolved by slowly adding 14.4 g of ammonium sulfate to the mixture of the sieves and the tobacco leaves with the impurities removed. After centrifugation at 5000 xg for 30 minutes, the precipitate was dissolved in 1 ml of PBS solution. The precipitate was selected with a concentration range of 0 to 25%, and the supernatant was dissolved in 100 ml of PBS solution by slowly adding 15.8 g of ammonium sulfate Followed by centrifugation at 5000 xg for 30 minutes. After centrifugation, the precipitate was dissolved in 1 ml of PBS solution, and the mixture was selected with a concentration range of 25 to 50%. To the supernatant, 13.7 g of ammonium sulfate was slowly added to the supernatant and then centrifuged. 1 ml of PBS solution was added to the precipitate, .

Among them, GA733-2-Fc protein was found to be the most abundant in the range of 25-50%, and the highest amount of GA733-2-Fc protein was extracted. The GA733-2-Fc protein extracted from the transformed tobacco leaves was separated and purified by SDS-PAGE and Western blot analysis to show that 40 KDa GA733-2-Fc protein was purified as shown in FIG.

Example 3: Determination of toxicity and stability by oral administration of plant-derived GA733-2-Fc protein in animal models

In order to establish the conditions for the administration of the plant-derived GA733-2-Fc protein produced in Example 2, toxicity and stability tests were conducted on animal models based on toxicity test standards such as KFDA drugs. 100 μg / 100 μl, 500 μg / 100 μl of plant-derived GA733-2-Fc in which the Fc region of the immunoglobulin heavy chain portion (Fc region) of the plant-derived GA733-2 protein was fused (Morbidity and specificity), weight change, feed and water intake test were conducted after oral administration for 3 weeks, once every two days. As a result, the general symptom change, death and specificity were not found when the plant-derived GA733-2-Fc protein was compared with the control which was not treated during oral administration (Fig. 3).

Example 4, Comparative Examples 1 to 3: Comparative analysis of the efficacy of plant-derived GA733-2-Fc protein in animal models induced by DSS (dextran sodium sulfate)

Four mice of 6-week-old C57BL / 6 (Darum Science, Korea) mice were divided into experimental groups as shown in Table 1 below. PBS group 2, group 3 and group 4, h-FC, The GA733-2-Fc protein extracted from the mice was orally administered at a dose of 10 mg / kg of body weight every other day for a total of 3 weeks. After 2 weeks from the oral administration, 3.5 wt% DSS (molecular weight 36,000-50,000 kDa, MP Biomedicals, Cat No. 16110) was freely ingested for 7 days in the remaining groups 2 to 4 excluding group 1.

Experimental group administration Comparative Example 1 Group 1 Non-administration Comparative Example 2 Group 2 DSS + PBS Comparative Example 3 Group 3 DSS + h-FC Example 4 Group 4 DSS + plant-derived GA733-2-Fc protein

The mice were weighed at the same time every day after DSS administration. After 6 days, the mice were dissected and the large intestine was removed. The length from the appendix to the upper portion of the rectum was measured. As a result, it was confirmed that in Example 4, the shortening of the intestinal length, which is a common symptom of DSS-induced ulcerative colitis disease, was suppressed (FIG. 4). These results indicate that the shortening of the length of the intestine, which is one of the symptoms of DSS-induced ulcerative colitis disease, is suppressed, and the symptom of the inflammatory disease is alleviated by the plant-derived GA733-2-Fc protein .

Example 5: Colonic histopathological effect of plant-derived GA733-2-Fc protein treatment on animal model induced by DSS (dextran sodium sulfate)

Immediately after the large intestine was removed in Example 4, the colon tissue was frozen using OCT solution. A piece of frozen colonic tissue was obtained with a thickness of 10 ㎛ and stained with colonic tissue using H & E staining technique. In the staining process, OCT solid was removed by immersing the fragments in xylene for 5 minutes, and the cells were reacted with 100, 95, 85 and 70% ethanol sequentially for 2 minutes to prepare a hydration state. Washed with water to remove residual ethanol, stained with hematoxylin for 6 minutes, and then immersed in a 1% hydrochloric acid-ethanol mixed solution for 3 times and taken out to repeat the steps so that the hematoxylin was sufficiently absorbed into the tissue, The procedure was repeated 10 times by immersing it in 10% ammonia water and fixing it. Next, the cells were stained with eosin for 1 minute, and reacted with 70, 85, 95, and 100% ethanol sequentially for 2 minutes to form a dehydrated state. Then, the section of the tissue that had been stained was observed with a microscope. As shown in FIG. 5, the colon tissue of the normal mouse without the DSS treatment (Comparative Example 1) has a clear boundary between the border of the hair follicle and the connective tissue and the follicle, but the model of the inflammatory disease mouse does not show the hair follicle shape, . Among them, in the case of Example 4 in which the plant-derived GA733-2-Fc protein was orally administered, it was confirmed that the shape of the hair follicle and the reduction of cell boundary between the cells were inhibited in comparison with Comparative Example 2 and Comparative Example 3. As a result, the border between the hair follicle and the connective tissue and the follicle is broken down by the DSS, which is a symptom caused by the inflmmation reaction by the DSS. Therefore, the plant-derived GA733-2-Fc protein The result is that the plant-derived GA733-2-Fc protein alleviates the inflammatory response by alleviating the appearance of hairs and the disappearance of cell-to-cell borders in the animal disease model of Example 4.

Example 6: Assessment of mucosal immune activity by plant-derived GA733-2-Fc protein treatment in an animal model inducing inflammatory diseases induced by DSS (dextran sodium sulfate)

Plant-derived GA733-2-Fc protein In order to measure the immune cell activity changes in an inflammatory disease induced mice treated to extract the cells from the peritoneal cavity of the mouse in group 1 to group 4 experimental groups of Table 1 staining buffer to 5x10 ⁵ cells Mouse IgA-FITC (BD biosciences pharmingen, USA) or anti-mouse CD45R / FITC (1% FBS, PBS containing 0.01% NaNO ₃ , pH 7.4) The reaction was carried out at 4 ° C for 15 minutes with B220-PE (phycoerythrin) (Southern biotech, USA) antibody. The cells were washed twice with the staining buffer solution and the expression of cell surface molecules was analyzed by flow cytometry (BD science) Respectively. As shown in FIG. 6, in comparison with Comparative Examples 1 to 3 in Example 4 in which plant-derived GA733-2-Fc protein was orally administered to an animal model of inflammatory disease induced by DSS (dextran sodium sulfate), GA733-2 And increased the number of IgA production and the number of B cells. These results indicate that the plant-derived GA733-2-Fc protein according to the present invention enhances immune response through IgA and B cells in an animal model inducing DSS (dextran sodium sulfate) induced inflammation.

Example 7: Regulation of regulatory T cell differentiation and inflammation-related cytokine expression in mesenteric lymph nodes through plant-derived GA733-2-Fc protein treatment in an animal model inducing inflammatory diseases induced by DSS (dextran sodium sulfate)

To compare the expression of genes involved in anti-inflammation from each cell and tissues in the experimental groups 1 to 4 shown in Table 1, total RNA was isolated using RNA ZolB solution (Molecular Research Center, USA). CDNA was synthesized by reacting extracted RNA (7 μg) with reverse transcriptase (RTase), dNTP, oligo dt, and PCR buffer (Promega, Madison, To the synthesized cDNA, 10 pmol of a primer (see Table 2) suitably prepared for each PCR mixture (10X PCR buffer, 0.25 mM dNTP, 0.5 U of Taq DNA polymerase (Bioneer)) was added.

Gene Sense Anti-sense IL-1? CAGGACAGGTATAGATTCTTTCCT ATGGCAACTGTTCCTGAACTCAAC IL-17 TCCCCTGGAGGATAACACTG GGTGCAGCCAACTTTTAGGA TNF-a CCTGTAGCCCACGTCGTAGC TTGACCTCAGCGCTGAGTTG TGF-beta GCCCTGGATACCAACTATTGC TCAGCTGCACTTGCAGGAGTAGCG GA733 AGAGAAAGCCCCTACGACCA GAGAACTCGGGTGCCTTTTC β-actin GACGGCCAGGTCATCACTAT AGTCCGCCTAGAAGCACTTG

The amount of each cDNA was constantly adjusted through the expression level of b-actin. Each cycle was performed at 95 ^° C for 1 min, 55 ^° C for 1 min and 72 ^° C for 1 min. The b-actin cycle was repeated 29 cycles and the other genes were cycled for 37 cycles. ^o C for 10 minutes. Primer amplified products were loaded in 1.0% agarose gel in the same amount, and the results were analyzed according to the degree of color development. The degree of gene expression was confirmed by RT-PCR of regulatory T-cell differentiation and inflammation-related cytokines IL-1β, IL-17, TNF-α and TGF-β in lymph nodes (FIG. As shown in FIG. 7, the expression levels of IL-1β, IL-17, TNF-α and TGF-β as inflammation-related cytokines were significantly increased in Comparative Example 2 shown in Table 2, In Example 4 in which Fc was orally administered, the expression amount thereof was greatly decreased. These results indicate that the plant-derived GA733-2-Fc protein according to the present invention reduces the expression level of inflammation-related cytokines in an animal model of inflammation, and thus can regulate excessive inflammatory response.

<110> Chonam Natinal University <120> Compostion preventing Inflammatory diseases and autoimmune          diseases Using Plant-derived GA733-2-Fc protein <130> 14080280934 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 522 <212> PRT <213> Unknown <220> <223> GA733-2-Fc <400> 1 Met Ala Thr Gln Arg Arg Ala Asn Pro Ser Ser Leu His Leu Ile Thr   1 5 10 15 Val Pè Ser Leu Ale Val Val Ser Ala Glu Val Asp Met Asp              20 25 30 Thr Ala Thr Phe Ala Ala Gln Glu Glu Cys Val Cys Glu Asn Tyr          35 40 45 Lys Leu Ala Val Asn Cys Phe Val Asn Asn Asn Arg Gln Cys Gln Cys      50 55 60 Thr Ser Val Gly Ala Gln Asn Thr Val Ile Cys Ser Lys Leu Ala Ala  65 70 75 80 Lys Cys Leu Val Met Lys Ala Glu Met Asn Gly Ser Lys Leu Gly Arg                  85 90 95 Arg Ala Lys Pro Glu Gly Ala Leu Gln Asn Asn Asp Gly Leu Tyr Asp             100 105 110 Pro Asp Cys Asp Glu Ser Gly Leu Phe Lys Ala Lys Gln Cys Asn Gly         115 120 125 Thr Ser Thr Cys Trp Cys Val Asn Thr Ala Gly Val Arg Arg Thr Asp     130 135 140 Lys Asp Thr Glu Ile Thr Cys Ser Glu Arg Val Arg Thr Tyr Trp Ile 145 150 155 160 Ile Ile Glu Leu Lys His Lys Ala Arg Glu Lys Pro Tyr Asp Ser Lys                 165 170 175 Ser Leu Arg Thr Ala Leu Gln Lys Glu Ile Thr Thr Arg Tyr Gln Leu             180 185 190 Asp Pro Lys Phe Ile Thr Ser Ile Leu Tyr Glu Asn Asn Val Ile Thr         195 200 205 Ile Gly Leu Val Gln Asn Ser Ser Gln Lys Thr Gln Asn Asp Val Asp     210 215 220 Ile Ala Asp Val Ala Tyr Tyr Phe Glu Lys Asp Val Lys Gly Glu Ser 225 230 235 240 Leu Phe His Ser Lys Lys Met Asp Leu Thr Val Asn Gly Glu Gln Leu                 245 250 255 Asp Leu Asp Pro Gly Gln Thr Leu Ile Tyr Tyr Val Asp Glu Lys Ala             260 265 270 Pro Glu Phe Ser Met Gln Gly Leu Lys Ala Ala Ala Asp Leu Val Glu         275 280 285 Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro     290 295 300 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 305 310 315 320 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val                 325 330 335 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp             340 345 350 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr         355 360 365 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp     370 375 380 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 385 390 395 400 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg                 405 410 415 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys             420 425 430 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp         435 440 445 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys     450 455 460 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 465 470 475 480 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser                 485 490 495 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser             500 505 510 Leu Ser Leu Ser Pro Gly Lys Asp Glu Leu         515 520 <210> 2 <211> 1569 <212> DNA <213> Unknown <220> <223> GA733-2-Fc <400> 2 atggctactc aacgaagggc aaaccctagc tctctccatc taattactgt attctctctg 60 ctagctgctg tcgtctccgc tgaggtcgac atggatacgg cgacttttgc cgcagctcag 120 gaagaatgtg tctgtgaaaa ctacaagctg gccgtaaact gctttgtgaa taataatcgt 180 caatgccagt gtacttcagt tggtgcacaa aatactgtca tttgctcaaa gctggctgcc 240 aaatgtttgg tgatgaaggc agaaatgaat ggctcaaaac ttgggagaag agcaaaacct 300 gaaggggccc tccagaacaa tgatgggctt tatgatcctg actgcgatga gagcgggctc 360 tttaaggcca agcagtgcaa cggcacctcc acgtgctggt gtgtgaacac tgctggggtc 420 agaagaacag acaaggacac tgaaataacc tgctctgagc gagtgagaac ctactggatc 480 atcattgaac taaaacacaa agcaagagaa aaaccttatg atagtaaaag tttgcggact 540 gcacttcaga aggagatcac aacgcgttat caactggatc caaaatttat cacgagtatt 600 ttgtatgaga ataatgttat cactattgat ctggttcaaa attcttctca aaaaactcag 660 aatgatgtgg acatagctga tgtggcttat tattttgaaa aagatgttaa aggtgaatcc 720 ttgtttcatt ctaagaaaat ggacctgaca gtaaatgggg aacaactgga tctggatcct 780 ggtcaaactt taatttatta tgttgatgaa aaagcacctg aattctcaat gcagggtcta 840 aaagcggccg cagatctcgt tgagcccaaa tcttgtgaca aaactcacac atgcccaccg 900 tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 960 gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1020 gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1080 acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1140 ctgcaccagg actggctgaa tggcaaggag tacaagtgca aggtctccaa caaagccctc 1200 ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1260 tacaccctgc ccccatcccg ggaggagatg accaagaacc aggtcagcct gacctgcctg 1320 gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1380 aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctatagc 1440 aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctctgtgatg 1500 catgaggctc tgcacaacca ctacacgcag aagagcctct ccctgtcccc gggtaaagat 1560 gagctctaa 1569

Claims (7)

a) preparing a GA733-2-Fc recombinant plant expression vector in which the GA733-2-Fc gene is inserted into the pBINPLUS expression vector and the GA733-2-Fc gene expression is regulated;
b) transforming the plant expression vector into Nicotiana tabacum cells to produce transformed tobacco leaves;
c) harvesting the tobacco leaves and extracting the plant-derived GA733-2-Fc protein by ammonium sulfate fractionation;
&Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof, for the manufacture of a pharmaceutical composition for the prophylaxis and treatment of inflammatory diseases or immune diseases.
The method according to claim 1,
Wherein the plant-derived GA733-2-Fc protein has an amino acid sequence represented by SEQ ID NO: 1, or a method for producing a pharmaceutical composition for preventing or treating an inflammatory disease or an immunological disease.
The method according to claim 1,
The plant-derived GA733-2-Fc protein is a pharmaceutical composition for the prophylaxis and treatment of an inflammatory disease or an immunological disease, characterized by reducing inflammatory cytokines and enhancing inflammatory response and mucosal immunity through increase of B cells Gt;
The method according to claim 1,
Wherein the inflammatory disease or immune disease is ulcerative colitis or Crohn's disease.
A pharmaceutical composition for the prophylaxis and treatment of an inflammatory disease or an immunological disease produced by the production method according to any one of claims 1 to 4.
A kit for the diagnosis of an inflammatory disease or an immunological disease comprising the composition according to claim 5.
A health food comprising a pharmaceutical composition for the prevention and treatment of an inflammatory disease or an immunological disease according to claim 5.

Images