KR20140117854A - Method for cultivating and detecting Sacbrood virus - Google Patents

Abstract

The present invention relates to a cultivating method and a detecting method of sacbrood virus. The cultivating method makes sacbrood virus cultivation, which has been difficult, possible. A method for detecting the sacbrood virus using the cultivating method of the present invention can always detect the sacbrood virus (SBV) easily and quickly by deviating from the existing passive reaction to the sacbrood virus.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for culturing and detecting saccharodovirus

The present invention relates to a culture method and a detection method of SBV virus, and a vaccine composition for preventing acne scarness, which comprises as an active ingredient non-pathogenic bacterium capsicum virus cultured by the above culture method.

In general, infectious diseases of bees can be divided into bacterial, fungal, viral and protozoan infectious diseases depending on the pathogen. There are bacterial infectious diseases such as American foulbrood (AFB) and European foulbrood (EFB), fungal infectious diseases such as chalkbrood and viral infectious diseases such as paralysis, Sacbrood, and the protozoan epidemic is nosema disease. Without preventive management of these diseases, thorough control is crucial, since no economic loss can be avoided no matter how well the disease is treated. In particular, the major diseases that occur in larvae of bees include brood, bursitis, and chalkbite.

Sacbrood is a viral disease, unlike the bacterial disease, which is a bacterial disease. The larva that is caught in this disease is similar to the buzzer in that it rots in the honeycomb but it is a totally different disease. The initial appearance of this disease is similar to the appearance of a blister, which is sometimes called a sacbrood. The larvae begin to become blistered as the body becomes blistered and the skin begins to harden. The body gradually changes from white to yellowish yellow. The head becomes brown to grayish brown, later turns to dark brown, gradually dries and remains in the honeycomb. The viral particles grow in the body of the adult insect, and the virus particles enter the body of the bee larva through the food. Symptoms appear from the 2nd day of infection and the larvae of this disease can not take off their faeces, become pupae, die and become rotten, causing severe decay.

The disease has already spread in Europe and the Americas in 2007, causing 75% of the total bees to be harmed by the bee industry. In Korea, it started to spread in the spring of 2010 and spread nationwide, causing more than 90% The damage is serious.

Only a passive method, preventive therapy, was the best tool because there is currently no cure for viral infectious disease. In case of infection, bees and honeycomb must be isolated and incinerated, and spraying and spraying disinfectant around honey bee breeding box and beekeeping apparatus and beehive to prevent disease spread to healthy bees.

The current method for isolation and cultivation of capsular disruptive virus is not yet known, and the current method for detecting viruses is the Polymerase chain reaction (PCR), which diagnoses the antigen. However, And the method for quantitative determination of the antigen has not been clearly developed.

Therefore, the inventors of the present invention have confirmed that it is possible to quickly and easily detect the infectious bursal disease virus by the method of culturing the scarlet fever virus, the non-pathogenic property of the virus obtained through the culture, and the method using the primer against the scarlet fever virus , Thereby completing the present invention.

It is an object of the present invention to provide a culture method and a detection method for scarlet fever virus.

Another object of the present invention is to provide a vaccine composition for the prevention of acne scarlet rot infection comprising an insect cellulitis virus cultured by the above culture method as an active ingredient.

In order to solve the above-mentioned problems, the present invention provides a method of culturing and detecting a virus of capsular loosening virus.

In addition, the present invention provides a vaccine composition for preventing acne scarlet rot infection comprising, as an active ingredient, scarlet fever virus which has been cultured by the above culture method.

The culture method according to the present invention makes it possible to cultivate the insecticidal bacterial endocarditis virus which has been difficult in the past, and the method for detecting the insecticidal bacterial endocarditis virus using the culture method of the present invention is a method of detecting the endocervical disease (SBV) viruses can be detected quickly and easily.

FIG. 1 is a graph showing the highest dilution concentration showing a positive test for DNA amplification as a nested primer in the cloning of scabbard rot virus using cell culture.
FIG. 2 is a diagram for confirming the cell proliferation of the domestic isolate scutellaria pertussis virus.
FIG. 3 shows the detection of the capsid gene by the stepwise dilution-specific gene amplification (RT-PCR) of the culture supernatant in the Vero cell line of SBV virus.
FIG. 4 is a diagram showing the result of observing the capsular-trophoblastic virus of cultured cysts with an electron microscope (TEM).
FIG. 5 is a diagram showing the encapsid gene of a herpes simplex virus from a larva after artificially infecting a bee larva with SBV virus cultured in a cell.
FIG. 6 is a graph showing the results of comparison between the gene sequence (SEQ ID NO: 5) of the insect cellulitis virus cultured in Vero cells and the existing gene.
FIG. 7 is a graph showing the results of comparison between the gene sequences of the capsular-borne rotivirus virus cultured in Vero cells and the existing genes (SEQ ID NO: 6).
FIG. 8 is a diagram showing the results of capturing gene electrophoresis of cell cultured insect cellulitis virus.
FIG. 9 is a diagram showing the detection of a specific gene in an infecting larval as a result of applying the present gene detection method to an outdoor sample.

 According to the present invention,

1) infecting vero cells with an infectious disease virus; And

2) culturing the vero cells infected with the above-mentioned scab vesicular virus, and cultivating the scarlet fever virus.

Hereinafter, the present invention will be described in detail.

In the culture method of the present invention, PK-15 cells were inoculated after diluting 5-passaged virus samples with 10-10 ^-6 cells. After inoculation of the PK-15 cells, the supernatant was separated, RT-PCR was performed using the primer corresponding to SEQ ID NO: 2, followed by amplification again using a nested primer corresponding to SEQ ID NO: 3 and SEQ ID NO: 4, and then the highest dilution concentration twice using a sample of 10 ^-2) (7) consecutive cloning by creating strains, and characterized in that Thereafter, subculturing the virus strains in Vero cells.

After the above cultivation, it was confirmed that pathogenic fungal infectious disease virus was converted into non-pathogenic fungal infectious disease virus in Vero cells.

The method for culturing the scarlet fever virus of the present invention will now be described in detail.

The step 1) is a step of infecting Vero cells with an infectious disease virus, and Vero cells were used as a host cell for culturing the infected virus.

The step 2) is a step of culturing the strain of step 1) using DMEM medium supplemented with an antibiotic antimycotic and culturing in a fetal calf serum of 3% to 7%, preferably 5% But can also be cultured in IMDM medium and serum-free medium. The preferred incubation temperature is 35 to 38 degrees, more preferably 36 to 37 degrees.

In addition, subculture can be performed in the step of culturing, and the subculture number is preferably 24 to 34 weeks, but is not limited thereto.

To investigate the pathogenicity of the bacterium infestant virus cultured by the cultivation method of the bacterium, the virus strain cultured in the 24th and 34th passages was artificially infected with the bee larvae in the laboratory. As a result, All of the infected samples survived. As a result of the examination of the bee larvae as a sample, the capsid gene of the infectious disease of the bacterium was detected.

In the case of HBK cells, IBRS2 cells, and Vero cells, cell proliferation was examined. In the culture supernatant, the protein gene was detected in the cultured supernatant. In the cells inoculated with the undiluted solution, Positive reaction was observed and the proliferation was highest in Vero cells.

The virus cultured by the method for culturing the scab sufferer virus is a non-pathogenic virus and includes the nucleotide sequence of SEQ ID NO: 5 or 6.

The present invention also provides a vaccine composition for preventing insect bite infestation, comprising an infectious bursary disease virus cultured by the above method as an active ingredient. The Acanthopanax senticosus virus includes, but is not limited to, the non-pathogenic virus, and has the nucleotide sequence of SEQ ID NO: 5 or 6.

The vaccine composition of the present invention includes a pharmacologically acceptable carrier or diluent in addition to the pathogenic capsular rotavirus. Suitable carriers for vaccines are known to those skilled in the art and include, but are not limited to, proteins, sugars, and the like. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carriers include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, inert gases and the like may be additionally present. Preferred preservatives include formalin, thimerosal, neomycin, polyamicin B and amphotericin B.

In addition, the vaccine composition may further comprise an adjuvant. The adjuvant includes any absorption-promoting agent which refers to a compound or mixture that promotes an immune response and / or promotes the rate of absorption after inoculation. Acceptable adjuvants include, but are not limited to, Freund's complete adjuvant, Freund's incomplete adjuvant, saponin, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyol polyanions, peptides, oils or hydrocarbon emulsions, , Dinitrophenol, and the like, but are not limited thereto. The preferred adjuvant is the METASTIM adjuvant of Fort Dodge Animal Health.

The composition of the present invention is formulated into an appropriate formulation together with an acceptable pharmaceutical carrier and administered in various routes. The composition of the present invention may be formulated into a cream, a lotion gel, an ointment, an emulsion, a spray, an aerosol, a droplet and a suspension, and may be administered orally, topically, or transdermally as an administration route.

The compositions of the present invention are administered in an immunologically effective amount. The term " immunologically effective amount " means an amount sufficient to exhibit a preventive effect and an amount not causing side effects or severe or excessive immune response, and the exact dosage level will depend on the specific immunogen to be administered, It is possible. In addition, the vaccine composition of the present invention can be administered together with known vaccines. Preferably, the vaccine composition of the present invention can be inoculated 2-3 times at 3 to 4 week intervals at a concentration of 10 ⁴ cells / 0.5 ml to 10 ⁵ cells / 0.5 ml.

In addition, the present invention provides a method for detecting scarlet fever virus comprising the step of performing RT-PCR using a primer set for scarlet fever virus of SEQ ID NOS: 1 and 2 in a biological sample.

The method of detecting the virus may further include performing nested PCR using a primer set consisting of the nucleotide sequences shown in SEQ ID NOS: 3 and 4 after performing RT PCR, and the primer sets And amplifying the capsid gene of the scabbard rot virus.

Preferably, the biological sample is selected from at least one of cells, tissues, secretions and body fluids of a bee larva, pupae, adult cells and tissues, adult secretion, and body fluids.

Hereinafter, the present invention will be described in more detail by way of the following examples, but the present invention is not limited by these examples.

[Example 1] Virus and cell.

Pig kidney cells (PK-15), hamster kidney cells (BHK) and Vero cell lines were used for virus culture, and viruses were continuously transferred in the cell line. Cell line cultures were incubated in a 36-37 degree thermostat using 5% fetal calf serum and antibiotic-antimycotic medium (DMEM).

[Example 2] Cloning of SBV virus.

The cloning of domestic isolate bursal disease (SBV) virus is as follows

To create a nangchung bongah domestic rot isolates of the virus cultured in PK-15 cells were inoculated into 5 based on virus samples 10-10 ^-6 dilution in decimal following PK-15 cells. After culturing, KVP1 F (1837-1860): 5 'GTTTCAAATGCGTTTCACACTGGA 3' (SEQ ID NO: 1) and KVP1R (2193-2169): 5 primers for the gene for the capsular vesicle constipation virus structural protein were obtained using PK-15 supernatant RT-PCR was performed using 'TCCTCCTCGCATATACACCAAAAC 3' (SEQ ID NO: 2). The amplified samples were amplified again using KVP1 R (2035-2015): 5 'CCGGTAAATAGGCGCTAGCCG 3' (SEQ ID NO: 3) and KVP1 F (1837-1860): 5 'GTTTCAAATGCGTTTCACACTGGA 3' (SEQ ID NO: 4) as nested primers Two clones (7 clones) were cloned in succession to prepare isolates. The results are shown in Fig.

As shown in Fig. 1, each sample showed a specific positive reaction and the highest dilution concentration was found to be 10 ^-2 .

[Example 3] Surveillance of proliferative activity of domestic isolate, insecticide, pertussis virus.

PK-15 cells were inoculated with PK-15, IBRS2, and BERO cells by stepwise dilution. Then, in the culture supernatant, the protein gene of the scabbard virus was detected and diluted 10 times with the undiluted solution. The results are shown in Fig.

As shown in FIG. 2, a specific positive reaction was confirmed in all of the inoculated cells, and Vero cells showed the highest proliferation.

[Example 4] Analysis of the infectivity of infectious bursal disease virus using vero cell culture.

The bacterium was infected with Bacillus thuringiensis virus (Bacillus thuringiensis) from Bero cells to 35 generations by the above culture method, and the culture supernatant was diluted by deciduous method. Then, after inoculation with Vero cells, specific genes for the structural proteins of diluted viruses were examined using the culture supernatant. The results are shown in Fig.

As shown in Fig. 3, gene detection of the virus in Vero cells was confirmed to be positive until 10 ⁵ -fold dilution.

[Example 5] Morphological characteristics of cell cultured insect cellulitis virus.

The results are shown in FIG. 4. The results are shown in FIG. 4. The results are shown in FIG. 4. FIG. 4 shows the results of the centrifugation at 25,000 rpm for 3 hours in a supernatant of Bacillus sp.

As shown in FIG. 4, the supernatant cultured in Vero cells was observed to have a presumptive form of virus particles equivalent to 21 nm in size.

[Example 6] Test for artificial inoculation of bee larvae of scarab bean rot virus using Vero cell culture.

Artificial infections of bee larvae were carried out in 24 and 24 weeks, respectively. As a control group, non-treatment group, physiological saline inoculation group and cell culture medium were used. Then, the capsid gene of the scabbard virus was examined in larvae of larvae. The results are shown in FIG. 5 and Table 1.

Table 1. Cell culture cultivars Bonga bee larvae of rotavirus virus Artificial insemination test

As shown in FIG. 5, when the capsid gene of the larvae of the larvae was examined using the larvae of the larvae, it was detected that the larvae larvae were infected with the bacterium, which was cultured in Vero cells.

In addition, as shown in Table 1, the bee larvae survived until the fifth day of infection in both the SBV 24 and the 36th passage subculture except for the non-treatment group, indicating that the capsular-borne pathogenic virus cultured in Vero cells was non-pathogenic Respectively.

[Example 7] Vero cell cultivation Comparison of gene sequence numbers of insect cellulitis virus with existing genes.

In the case of PCR using primer sets 1 and 2 and the nested PCR using the primer sets of SEQ ID NOs: 3 and 4 in the case of the bacteriophage of non-pathogenic non-pathogenic viral pathogens in Vero cells, Respectively, and the results are shown in FIGS. 6 and 7. FIG.

FIG. 6 is a result of comparing nucleotide sequence similarity with nucleotide sequence (SEQ ID NO: 5) of the scarlet fever virus of the present invention using the primer set of SEQ ID NOS: 1 and 2 and known nucleotide sequences of the conventional scarlet fever virus.

FIG. 7 shows the nucleotide sequence (SEQ ID NO: 6) of the necrotic fungus infestible virus when the nested primer set of SEQ ID NOS: 3 and 4 was used and the nucleotide sequence similarity of the known nucleotide sequence of the insecticide virus to be.

[Example 8] Comparison of SBV gene cultured in Vero cells and results using SBV diagnosis method.

The specific gene of the cultured bacterium Sephroticollis virus and the specific gene of the cell supernatant cultured through the detection method developed for confirming the proliferation of the bacteriophage infected virus were electrophoresed and the result is shown in FIG. .

As shown in FIG. 8, a specific gene of SBV was detected in FIG. 8A. In FIG. 8B, a specific gene using the supernatant obtained by the detection method developed for confirming the proliferation of the scarlet fever virus Respectively.

[Example 9] Results of application to outdoor ward sample.

We applied the virus specific gene of the confirmed cell line to the outdoor eyebrow specimens. PCR was carried out using the primer set of SEQ ID NOs: 1 and 2 to confirm that the bee larvae, which were obtained in the 1-5 region, had the viruses of the bursary rot disease. Nested PCR was performed using the primer sets of SEQ ID NOS: 3 and 4 Respectively. The results are shown in Fig.

As shown in FIG. 9, PCR results for L1 to L5 were shown, and nested PCR results for L1-1 to L6-1 were shown. Among them, L5 was able to detect the specific gene (VP1, 360bp) of the scabbard virus, and L5-1 was able to detect the scabbard virus (about 200bp).

<110> REPUBLIC OF KOREA, Ministry for Food, Agriculture, Forestry and Fisheries.Animal, Plant and Fisheries Quarantine and Inspection Agency (QIA) <120> Method for cultivating and detecting Sacbrood virus <130> P-11 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> it is forward primer for gene encoding capsid protein from          sacbrood virus <400> 1 gtttcaaatg cgtttcacac tgga 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> it is reverse primer for gene encoding capsid protein from          sacbrood virus <400> 2 tcctcctcgc atatacacca aaac 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> it is reverse nested primer for gene encoding capsid protein from          sacbrood virus <400> 3 ccggtaaata ggcgctagcc g 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> it is forward nested primer for gene encoding capsid protein from          sacbrood virus <400> 4 gtttcaaatg cgtttcacac tgga 24 <210> 5 <211> 358 <212> DNA <213> Artificial Sequence <220> <223> it is gene encoding capsid protein from non-pathogenic sacbrood          virus <400> 5 gtttcaaatg cgtttcacac tggaactgtg attatatcag cggagtataa tcgatcatct 60 accaatacgg atgagtgcca atctcactcc acttatacaa aaacgttcca tttgggagaa 120 cacatta gctagtgcct atttaccggt tactgataat gataaggtag ataatgttag taaggcgcag 240 gctacgggga ttagagcaga gtctaaaatg agagtgaaag tgagagtagt taatgtttta 300 aggcctgttg cctctactac ctcaactata gaagttttgg tgtatatgcg aggaggaa 358 <210> 6 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> it is gene encoding capsid protein from non-pathogenic sacbrood          virus <400> 6 tgtttcaaat gcgtttcaca ctggaaccgt gattatatca gcggagtatc atcgatcatc 60 taccaatacg gatgagtgcc aatctcactc cacttataca aaaacgttcc atttgggaga 120 acaaaaatcc gtacatttta ctgtgccgta tatatatgat accgtgttac gtagaaatac 180 ggctagcgcc tatttaccgg 200

Claims (12)

1) infecting vero cells with an infectious bursal disease virus; and
2) culturing the vero cells infected with the infectious bursal disease virus.  [2] The method according to claim 1, wherein the culturing in step 2) is carried out in a DMEM culture medium supplemented with 3 to 7% of fetal calf serum and an antibiotic-antimycotic agent. . The method according to claim 1, wherein the infectious bursal disease virus is a non-pathogenic bursal disease virus.  The method according to claim 1, wherein the culture of Vero cells in the second stage is cultured in passage 24 ~ 34. The method according to claim 1, wherein the scab sufferer virus comprises the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
 A vaccine composition for the prevention of infestation of insect bite infestation, comprising an insecticidal bacterial capsid virus cultured by the method of any one of claims 1 to 5 as an active ingredient. [Claim 7] The vaccine composition according to claim 6, wherein the infectious disease virus is a non-pathogenic virus. The vaccine composition according to claim 6, wherein the virus is the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
And performing RT-PCR using the primer set consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2 in the biological sample. The method according to claim 9, further comprising performing nested PCR using a primer set consisting of the nucleotide sequences shown in SEQ ID NOS: 3 and 4 after performing RT PCR. 10. The method according to claim 9 or 10, wherein the primer set amplifies a capsid gene of a scabious rotavirus virus. 10. The method according to claim 9 or 10, wherein the biological sample is at least one selected from the group consisting of a bee larva, a larval secretion and a body fluid, a pupa, an adult cell, an adult secretion and a body fluid.

Images