KR20130013856A - Composition for anti-obesity or reducing body fat, containg meja-treated buckwheat sprout - Google Patents

Abstract

PURPOSE: A composition containing MeJA-treated buckwheat sprouts is provided to ensure excellent anti-obesity and body fat reduction effects and to be used as a medicine or a functional food. CONSTITUTION: A composition for treating obesity or reducing body fat contains buckwheat sprouts, which is treated with jasmonic acid or methyl jasmonate and cultivated, a crushed material thereof, or an extract thereof as an active ingredient. A health functional food for treating obesity or reducing body fat contains the composition. A pharmaceutical product for treating obesity or reducing body fat contains the composition. A method for cultivating buckwheat sprouts for enhancing anti-obesity or body fat reduction effects comprises a step of treating the buckwheat sprouts with jasmonic acid or methyl jasmonate.

Description

Composition for Anti-Obesity or Reducing Body Fat, Containg MeJA-Treated Buckwheat Sprout

The present invention relates to a composition for anti-obesity or body fat reduction. The invention also relates to a method of anti-obesity or body fat reduction. The present invention also relates to a cultivation method for enhancing the anti-obesity effect of buckwheat sprout.

As of 2006, the world's obesity population was 250 million, and Korea's obesity population was 11.7% in South Korea and 18.0% in 1995, but it increased to 26.5% and 25.9% in 2001, respectively. The domestic market for obesity drugs alone is about 100 billion won in 2009, and the annual growth rate is about 20%, and the market size of health functional foods and foods useful for improving obesity will far exceed the size of medicines. Judging.

Such drugs for improving obesity include sibutramine, a drug that suppresses appetite, and orlistat, which suppresses the absorption of fat contained in food by inhibiting lipase in the body.

However, in the case of sibutramine, side effects such as blood pressure rise, insomnia, dry mouth, and dizziness are relatively common. In addition, sibutramine was revoked from the Food and Drug Administration due to its high side effects in patients with cardiovascular disease and uncontrolled hypertension. In the case of olistat, side effects such as diarrhea, fatty stool, and loss money are common, and the effect of the drug is not obvious when the fat intake is less than that of Westerners such as Koreans.

Therefore, the need for steady research on drugs that are safer and excellent in anti-obesity effect and body fat reduction effect has been raised. Especially, efforts are being made to obtain active ingredients with plants, herbal medicines, etc., which have been taken for a long time and proven safe.

Therefore, the technical problem to be achieved by the present invention is to provide a composition having a low side effect and excellent in anti-obesity and / or body fat reduction effect and a pharmaceutical or functional food containing the same.

Another technical problem to be achieved by the present invention is to provide a safe and effective anti-obesity and / or body fat reduction method.

In order to achieve the above technical problem, the present invention is treated with jasmonic acid (jasmonic acid, JA) or methyl jasmonate (methyl jasmonate, MeJA), more preferably treated with methyl jasmonate buckwheat sprout It provides a composition for improving obesity or reducing body fat, comprising a pulverized product or extract thereof as an active ingredient.

In the present invention, the buckwheat sprout oil extract treated with MeJA and the like was more effective in reducing the accumulation of intracellular fat due to the higher inhibitory effect of differentiation of 3T3-L1 adipocytes than the buckwheat sprout oil extract grown in conventional cultivation water. The degree of inhibition of the expression of major transcription factors in cells associated with adipocyte differentiation is also based on the surprising fact that it is significantly higher than buckwheat sprouts grown in conventional cultivation.

In addition, the effects of rutin, a major component of buckwheat, on major transcription factors associated with adipocyte differentiation were relatively insignificant. From these results, it is speculated that buckwheat sprouts treated with MeJA, etc., play an important role as a main active ingredient that exhibits anti-obesity or body fat reduction effect. .

The present invention also provides a pharmaceutical or functional food for anti-obesity and / or body fat reduction, comprising the composition.

The present inventors endeavored to obtain a composition having anti-obesity and body fat-reducing effects among natural products that have been used for a long time and have proven safety, and have excellent anti-obesity with buckwheat sprouts (buckwheat sprout oil vegetable) grown with cultivated water added with JA or MeJA. And confirmed that the body fat reduction effect has been completed the present invention.

The active ingredient included in the anti-obesity and / or body fat-reducing health functional food or drug of the present invention may be the buckwheat sprout itself, and may be an extract of the dried, ground or buckwheat sprout of the buckwheat sprout.

Dried and crushed buckwheat sprouts can be prepared using methods well known in the art. For example, a dry matter may be manufactured by a method such as ventilation (natural wind) drying, hot air drying, freeze drying, or the like, and a powdery powder may be manufactured using a conventional mill.

The extract of buckwheat sprout can be obtained through an extraction method well known in the art. For example, the extractant may be purified water; Lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propyl alcohol and butyl alcohol; Polyhydric alcohols such as glycerin, butylene glycol and propylene glycol; Hydrocarbon solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether and dichloromethane; Or these can use a mixed solvent.

More specifically, for example, the buckwheat sprout may be dried and pulverized, followed by extracting the extractant by adding 1 to 20 times the volume of the buckwheat sprout, and then selectively (decompression) concentration, drying or purification to prepare the process. Can be. More specifically, the active ingredient material is extracted by adding an extraction solvent as described above (a) by heating for 1 to 20 hours at a temperature of 50 to 100 ℃ in a state that the cooling condenser is installed to prevent the solvent from evaporating Extraction or (b) may be performed by dipping for 1 to 15 days at 5 to 37 ℃ temperature conditions to extract the active ingredient. That is, it can manufacture using extraction methods, such as stirring extraction, reflux cooling extraction, cold needle extraction, ultrasonic extraction, or supercritical extraction.

The anti-obesity or body fat reducing composition of the present invention can be prepared in the form of pharmaceuticals and functional foods. Such medicaments and functional foods may include pharmaceutically acceptable excipients or additives. The anti-obesity or body fat reducing composition of the present invention may be administered alone or in admixture with any convenient carrier, excipient, etc., and such dosage forms may be single or repeated dose formulations.

The pharmaceutical or functional food comprising the anti-obesity or body fat reducing composition of the present invention may be a solid preparation or a liquid preparation. Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like. Solid form preparations may include, but are not limited to, excipients, flavors, binders, preservatives, disintegrants, lubricants, fillers and the like. Liquid formulations include, but are not limited to, solutions such as water, propylene glycol solutions, suspensions, emulsions, and the like, and may be prepared by adding suitable colorants, flavors, stabilizers, viscosity agents, and the like.

For example, powders may be prepared by simply mixing the buckwheat sprout mill or extract of the present invention with a suitable pharmaceutically acceptable excipient such as lactose, starch, microcrystalline cellulose. Granules are buckwheat sprouts or extracts of the present invention; Pharmaceutically acceptable excipients; And a pharmaceutically acceptable binder such as polyvinylpyrrolidone and hydroxypropyl cellulose, and then prepared by using a wet granulation method using a solvent such as water, ethanol, isopropanol, or a dry granulation method using a compressive force. Can be. Tablets may also be prepared by mixing the granules with a suitable pharmaceutically acceptable glidant such as magnesium stearate and then tableting using a tableting machine.

Buckwheat sprouts or extracts may be administered daily from about 0.01 mg / kg to about 5 g / kg, and from about 0.1 mg / kg to about 1 g / kg, in order to achieve the object of the present invention called anti-obesity or body fat reduction. Daily doses of are preferred. However, the dosage may vary depending on the condition of the patient (age, sex, weight, etc.), the severity of the condition being treated, and the like. If desired, the total daily dose may be divided for convenience and divided several times throughout the day.

The present invention also provides a method for anti-obesity, weight maintenance or body fat reduction, comprising administering buckwheat sprout, dried product, ground product or extract thereof.

The invention also provides a method of anti-obesity and / or body fat reduction comprising administering a composition according to the invention to a subject in need of weight loss or body fat loss.

The present invention also provides anti-obesity or body fat of buckwheat sprouts, characterized by treatment with jasmonic acid or methyl jasmonate, more preferably with buckwheat jasmonate. Provide a cultivation method that increases the reduction effect.

For example, the JA or MeJA is added to the planting water at a concentration of about 0.01-200 mM, preferably 0.05-2 mM, more preferably at a concentration of 0.08-0.5 mM. If it is added below 0.01 mM concentration, the antiobesity / body fat reduction effect of the addition is not large, and if the treatment exceeds 200 mM there is a fear that the growth of buckwheat sprout. Such cultivation water can be cultivated by feeding 50 mL-4 L / m ² once per 1-3 days. More preferably, during the germination (cultivation) of buckwheat seeds, methyl jasmonate can be grown by adding 100 mL once daily at a concentration of 0.1 mM.

The present invention provides an anti-obesity or body fat reduction use of buckwheat sprouts, their dried products, ground products or extracts which have been treated with jasmonic acid or methyljasmonate. Medicines or functional foods according to the present invention is excellent in anti-obesity or body fat reduction effect. The present invention also provides a cultivation method for enhancing the anti-obesity or body fat reduction effect of buckwheat sprout.

1 is a result of analyzing the effect of buckwheat sprout extract on the fat accumulation of 3TC-L1 cells.
2 is a result of analyzing the effect of buckwheat sprout extract on the expression of C / EBPα (CCAAT / enhancer binding protein α), a transcription factor associated with adipocyte differentiation, and aP2 (adipocyte protein 2), a target gene.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example 1 Cultivation of MeJA-treated Buckwheat Sprouts

In this experiment, buckwheat was purchased from Bongpyeong in 2008 and set to dispense four times a day (15 minutes) using a sprout cultivator (Mikrofarm, EasyGreen Co., MA, USA). Grown. As abiotic treatment during growth, methyl jasmonate (MeJA) was additionally dispensed 100 mL once daily at a concentration of 0.1 mM. The buckwheat sprout is cut at the part above the stem except for the root part, frozen at -70 ℃, dried using a lyophilizer, crushed with a blender (KA-2600, Kaiser, Korea), and then 60mesh (850mm ² ) standard. It was passed through a network and used as an extract sample.

Example 2 Preparation of MeJA-treated Buckwheat Sprout Extract

The extracts used in the following experimental examples were prepared as follows. The buckwheat sprouts grown in Example 1 were divided into MeJA and non-treated groups, and then lyophilized. Thereafter, 80 wt% ethanol 5 times was added thereto, and then extracted three times at 20 ° C. for 3 hours. This was centrifuged at 10,000 x g for 15 minutes to filter the supernatant and then lyophilized to prepare an extract sample.

Experimental Example 1 Intracellular Adipose Accumulation During Differentiation of 3T3-L1 Adipocytes

The results of comparing the amount of intracellular fat accumulation by the buckwheat sprout oil extracts during the differentiation of 3T3-L1 adipocytes are shown in FIG. 1.

Cells were treated with 3T3-L1 cells to induce cell differentiation, and buckwheat sprout oil extracts were treated with 100 ㎍ / mL each to differentiate into adipocytes for 8 days. The amount of fat accumulated in the differentiated adipocytes was oil red O staining. It was measured using the method. Specifically, the stained Oil red O (lipid accumulation) was dissolved and the absorbance was measured at 490 nm. Each value is the mean and standard deviation of six different plates (n = 6). Statistical treatment was performed using One-way ANOVA ( p <0.05).

As shown in Figure 1, during the differentiation of adipocytes, 3T3-L1 cells of the control group was found to accumulate a large amount of lipid drop in the cells. When 100 ㎍ / mL of buckwheat sprout oil extract, buckwheat sprout oil extract treated with 0.1 mM MeJA and rutin (the main ingredient of buckwheat sprout oil) were treated, the fat accumulation of fat cells was decreased as compared with the control. In particular, it showed the strongest inhibitory effect of lipid drop formation in adipocytes treated with 0.1 mM MeJA-treated buckwheat sprout oil extract.

<Experiment 2> Examination of the effect on the expression of transcription factor C / EBPa and target gene aP2 associated with adipocyte differentiation

In this experiment, we investigated the mechanism of action on mRNA levels of anti-obesity activity of buckwheat sprout oil extract and 0.1 mM MeJA-treated buckwheat sprout oil extract. In other words, to investigate the mechanism of action of fat accumulation inhibitory effect in 3T3-L1 cells, expression of C / EBPα (CCAAT / enhancer binding protein α), a transcription factor associated with adipocyte differentiation, and aP2 (adipocyte protein 2), a target gene, were expressed. The effect was examined and the results are shown in FIG. 2.

On the eighth day of treatment, total cellular RNA was extracted by a conventional method using an RNA prep kit and the like, and RT-PCR was performed. GAPDH gene was used as a control gene to quantify the levels of CEBPα and aP2 mRNA. Band intensities were quantified using Image J program. The forward primers and reverse primers used are shown in Table 1 below.

Gene name Forward primer Reverse primer GAPDH CAAGGTCATCCATGACAACTTTG GGCCATCCACAGTCTTCTGG C / EBPa GCAGTGTGCACGTCTATGCT AGCCCACTTCATTTCATTGG aP2 GACCTGGAAACTCGTCTCCA CATGACACATTCCACCACCA

As shown in FIG. 2, C / EBPa and aP2 mRNA expression of adipocytes treated with 0.1 mM MeJA-treated buckwheat sprout vegetable extract (TBWE) at a concentration of 10 μg / ml showed a tendency to decrease compared to the control group. In contrast, C / EBPa and aP2 mRNAs of adipocytes treated with rutin showed similar expression levels as control. These results indicate that rutin contained in buckwheat sprout oil extracts treated with 0.1 mM MeJA did not affect the expression of major transcription factors in adipocytes. It seems to be different from rutin's mechanism of action. In addition, in the case of buckwheat sprout vegetable extract (NBWE) not treated with MeJA, the expression of C / EBPa and aP2 mRNA was decreased in the case of increasing the concentration (for example, 100 ㎍ / ml) compared with the control group. The degree was weak compared to buckwheat sprout oil vegetable extract treated with MeJA according to the present invention.

Claims (6)

A composition for improving obesity or reducing body fat, comprising buckwheat sprouts grown by treatment with jasmonic acid or methyl jasmonate, pulverized products thereof or extracts thereof as an active ingredient. The composition for improving obesity or reducing body fat according to claim 1, wherein the buckwheat sprout is treated with methyl jasmonate. A dietary supplement for obesity improvement or body fat reduction comprising the composition of claim 1 or 2. A drug for improving obesity or reducing body fat, comprising the composition of claim 1 or 2. A cultivation method for enhancing the anti-obesity or body fat reduction effect of buckwheat sprout, characterized by treatment with jasmonic acid or methyl jasmonate. 6. The cultivation method according to claim 5, wherein the buckwheat sprout is treated with methyl jasmonate.

Images