KR20080086729A - Effect of motor protein, kif5b, on wound healing - Google Patents

Abstract

A motor protein, KIF5B is provided to identify the biological activity associated with wound healing of KIF5B, and control various biological phenomena and disease such as cancer, regulated by KIF5B transport. An expression of a human motor protein, KIF5B(NM_004521) is inhibited by siRNA(small interfering RNA) against KIF5B having the nucleotide sequence of CGCAATTGGAGTTATAGGAAA, which is prepared by using RNAi(RNA interference) method by using an algorithm of qiagen company in U.S., thereby reducing ability of wound healing.

Description

Effect of motor protein, KIF5B, on wound healing}

Figure 1 shows the time when wound healing is completed when non-specific siRNA is treated to human primary cell HDF cells and HUVEC (16 hours for HDF cells, 9 hours for HUVEC) and wound healing of cells treated with PIX siRNA compared to KIF5B. Representative picture showing the status.

Figure 2 is a statistical analysis of the results in Figure 1, when treated with PIF siRNA compared with KIF5B, it can be seen that the wound healing ability is reduced by about 60% compared to non-specific siRNA. For HDF fibroblasts, 43.42 ± 8.21% (n = 8) and PIX siRNA were 42.89 ± 3.44% (n = 8) wound healed when treated with KIF5B siRNA, compared to non-specific siRNA treated HUVEC endothelial cells. In case of KIF5B siRNA, wound healing was 34.6 ± 7.12% (n = 12) and PIX siRNA was 37.1 ± 16.12% (n = 12). *, p <0.03, was repeated twice.

  FIG. 3 was subjected to immunoblot with each indicating antibody to confirm whether the siRNA used in the above experiments inhibited the expression of the targeted protein. As a result, it was confirmed that expression of KIF5B and PIX was specifically inhibited by each siRNA.

Cau J, Hall A. Cdc42 controls the polarity of the actin and microtubule cytoskeletons through two distinct signal transduction pathway. J Cell Sci. 2005 Jun 15; 118: 2579-87

        [2] Miki H, Setou M, Kaneshiro K, Hirokawa N. All kinesin superfamily protein, KIF, genes in mouse and human. Proc Natl Acad Sci U S A. 2001 Jun 19; 98: 7004-11

The present invention relates to the discovery of proteins involved in wound healing.

  Kinesin family proteins are motor proteins that transport various intracellular substances along the microtubule to the + -end using energy from the hydrolysis of ATP. Since kinesin-I was first identified in axoplasm of giant exon of squids more than 20 years ago, it has been known that it contributes to various intracellular functions including molecular transport in neurons. Kinesin-I has three isoforms of KIF5A, KIF5B, and KIF5C, and KIF5B was identified in relation to the wound healing ability of the present invention. Kinesin-I is composed of two heavy chains (KHC) and two light chains (KLC) that form heterodimers. The heavy chain consists of a motor domain, a stalk, and a tail that are kinetic. KLC has an α-helical domain that binds to KHC and a tetratricopeptide repeat (TPR) motif that binds to transporters. Kinesin has a biological activity that precisely transports various intracellular substances, such as membrane intracellular organelles, macromolecular complexes, and mRNA, to specific sites. Because of this, kinesin is involved in the development of various diseases and also affects learning and memory in the brain. Because Kinsine plays such an important role, inhibition of KIF5B expression can be an important tool in understanding the biological activity of the motor protein KIF5B, as well as a number of biological phenomena and diseases (especially cancer diseases) that are regulated in the transport of KIF5B. It can be used as a controlling agent.

  Therefore, an object of the present invention is to reveal that KIF5B, a non-neural isoform of kinesin motor protein, plays an important role in the movement of fibroblasts and endothelial cells (HDF, HUVEC, etc.) and is a novel candidate for wound healing research in vivo.

The purpose of the present invention is to reduce the wound healing ability by inhibiting the expression of KIF5B by using siRNA specific to KIF5B, thereby revealing that KIF5B is an important protein involved in wound healing. To provide important clues.

Step 1: Search and Synthesize KIF5B siRNA

  SiRNA for human KIF5B (NM — 004521) was synthesized using the algorithm of US qiagen to inhibit expression of KIF5B using RNAi (RNA interference) method.

Step 2: KIF5B expression inhibition and wound healing experiment

  Synthesized nonspecific siRNA and KIF5B siRNA were transfected into human primary cells HDF (Human diploid fibroblast) and HUVEC (Human umbilical vein endothelial cells) using lipofectmaine 2000 at a concentration of 100 pmole and two days later, cells were removed and 100% Saturated again. When the cells adhered, they were wound with a syringe needle, and observed and imaged with a DIC microscope every 30 minutes (Fig. 1), and then statistically analyzed and plotted (Fig. 2). In parallel with the above, in order to confirm whether KIF5B siRNA specifically inhibits the expression of KIF5B protein, cells were detached and immunoblot was performed with some of the antibodies indicated in the figure (Fig. 3).

 The present invention uses KIF5B as a protein for research aimed at wound healing, and is expected to be useful in the basic research field and the medical industry by providing clues to the therapeutic research.

Claims (2)

 Inhibition of KIF5B results in a decrease in wound healing capacity. Thus siRNA having or comprising a sequence of siRNA that inhibits KIF5B (CGCAATTGGAGTTATAGGAAA). Inhibition of KIF5B results in a decrease in wound healing ability, and therefore KIF5B protein associated with wound healing.

Images