KR20070115808A - Therapeutic use of cpg oligodeoxynucleotide for skin immune disease - Google Patents

Abstract

A CpG oligodeoxynucleotide is provided to induce the immune reaction effective for preventing or treating skin diseases, thereby being usefully used as an agent for treating or preventing skin diseases. A CpG oligodeoxynucleotide for immune reaction adjuvant or immune diseases treatment is represented by the formula 1 of SYYSSACGTTGSCGAWMYTC or the formula 2 of AXSSWXTCGXWXCGTTCGSC, wherein S is G or C, Y is C or T, W is A or T, M is A or C, and X is A or G. A pharmaceutical composition for treating or preventing skin immune diseases such as atopic dermatitis, allergy, viral skin diseases or skin cancer comprises the oligodeoxynucleotide. The composition further comprises at least one immunity supplemental agent selected from the group consisting of INF-gamma, IL-12, cyclosporine, FK506(Tacrolimus) and TP-5(Thymopoietin pentapeptide).

Description

Therapeutic use of CpG oligodeoxynucleotide for skin immune disease

1 is a diagram showing IL-8 promoter activation in RAW 264.7 cells, a mouse macrophage line treated with a concentration-dependent oligonucleotide BD-ODN type 4 synthesized in the form of phosphodiester binding. .

Figure 2 is a mouse macrophage cell line synthesized in the form of phosphodiester (phosphodiester) and phosphorothioate (4) backbone of the oligonucleotide BD-ODN for immune response regulation Figures are compared on RAW 264.7 cells.

3 is a diagram showing the activation of NF-κB when the phosphorothioate backbone form is stimulated in RAW 264.7 cell line. RAW 264.7 cells were treated with BD-ODN (10 ㎍ / ㎖) for 30 minutes, and the cells were fixed. Indirect immunofluorescence was performed using NF-κB p65-specific antisera to confirm the location of NF-κB.

FIG. 4 is a diagram illustrating the fluid response of Balb / c mice intraperitoneally immunized by HEL (hen egg lysozyme) by synthesizing four candidate BD-ODNs in the form of phosphodiester skeletons.

Figure 5 is a comparison of the effects of the skeletal modification of BD-ODN according to the present invention and the production of IL-12 p40 and IFN-γ. Figure a) shows the production of IL-12 p40 in serum after intraperitoneal immunization of BD-ODN in Balb / c mice. Figure b) shows the production of IFN-γ in serum after intraperitoneal immunization of BD-ODN in Balb / c mice.

FIG. 6 shows an experimental schedule showing that the delayed immune response is restored upon treatment of CpG ODN of the present invention with respect to the inhibition of contact hypersensitivity due to ultraviolet irradiation in mice.

Figure 7 shows the effect of restoring the delayed immune response upon treatment of CpG ODN of the present invention on the inhibition of contact hypersensitivity to the specific antigen (TNCB, Trinitrochlorobenzene) induced by UV irradiation in mice. .

FIG. 8 shows the T cell proliferation responses of TNP (trinitrophenyl) specific antigen isolated from the spleen in mice suppressed by contact hypersensitivity to the specific antigen (TNCB) induced by UV irradiation. The effect of CpG ODN of the present invention is shown.

FIG. 9 shows the results of investigating IgE levels in serum isolated from mice in which contact hypersensitivity to UV-induced specific antigen (TNCB) was inhibited.

FIG. 10 shows the effect of CpG ODN of the present invention on histopathological changes in mouse ear tissues that inhibited contact hypersensitivity to UV-induced specific antigen (TNCB).

FIG. 11 shows an experimental schedule showing that the type 1 immune response is recovered upon treatment of CpG ODN of the present invention with respect to activation of the type 2 immune response using a trimetillic anhydroxide (TMA).

12 shows changes in ear edema upon treatment of CpG ODN of the present invention for inhibiting contact hypersensitivity to TMA-induced type 2 specific antigen in mice (A) and Changes in ear edema at the last induction (B) are shown.

FIG. 13 shows the results of investigating IgE levels isolated from plasma in mice in which delayed immune response (contact hypersensitivity) to TMA induced type 2 immunospecific antigens was inhibited.

The present invention relates to a CpG oligodeoxynucleotide comprising a CpG dinucleotide and increased immunomodulatory ability, a composition for treating or preventing skin immune diseases, and a method for treating skin immune diseases using the same.

Skin disease is any abnormality that occurs in the skin of animals, including humans. Among them, atopic dermatitis is a chronic / inflammatory skin disease, which is characterized by severe pruritus, dry skin and eczema skin lesions (Rudikoff, D. et al ., Lancet. 351: 1715-1721, 1998). Atopic dermatitis generally tends to be hereditary and is often accompanied by allergic asthma, allergic rhinitis, allergic conjunctivitis and urticaria. A series of immunological abnormalities reported in patients with atopic dermatitis include increased IgE production and decreased number of T-cell Helper type 1 (Th1) lymphocytes that secrete IFN-γ. In addition, atopic dermatitis has histologically increased CD4 ⁺ phenotype, T lymphocytes, monocyte / macrophage infiltration, mast cells and eosinophils in skin lesions, dendritic cells (DCs) and epidermal Langerhans cells are also known as atopic dermatitis. Is increased in skin lesions (Imokawa, G., et al ., J. Invest. Dermatol., 96: 523-526, 1991). This phenomenon has been investigated in normal areas, not in lesions (Leung DY, Bhan AK, Schneeberger EE, Geha RS. J Allergy Clin Immunol., 71 (1 Pt 1), 47-56, 1983). Recently, the number of CCR4-expressing memory CD4 ⁺ T lymphocytes has been reported to increase at the lesion site of atopic dermatitis (Imai, T. et al ., Int. Immunol., 11: 81-88, 1999). Van der Heijden FL et al . Also reported that T lymphocytes with infiltrated CD4 ⁺ phenotypes primarily release IL-4 (Van der Heijden FL et al ., J Invest Dermatol., 97: 389-394, 1991 The action of IL-4 promotes low-affinity Fc receptors on immunoglobulin E in antigen-delivered cells.

In addition, experimental evidence has recently been reported that T lymphocytes and several cytokines released therefrom are closely related to the immunopathological mechanism of atopic dermatitis. In patients with atopic dermatitis, allergen-specific T helper type 2 lymphocytes producing IL-4, IL-5 and IL-10 are increased at the site of the inflamed lesion, which is an allergic reaction and IgE It has been reported to have a significant effect on both increases (hussain, I. et al ., Curr Drug Targets Inflamm Allergy., 2: 199-120, 2003). Other researchers have investigated the chemokines and their receptors associated with atopic dermatitis play an important role in skin barriers. As a result, a large amount of thymic stromal lymphopoietin (TSLP) and macrophage-derived chemokine (MDC) are produced from keratinocytes of patients with atopic dermatitis and IFN-γ stimulation produces a large amount of RANTES, TARC, MDC. (Giustizieri, ML. Et al ., J. Allergy Clin Immunol., 107: 871-877, 2001).

On the other hand, in general, during the evolution of vertebrates, the immune system recognizes molecules of several kinds of characteristic microorganisms, and has developed so that immune activity occurs quickly against the invasion of microorganisms. Several researchers have reported that bacterial DNA contains a number of structural determinants that are not present in vertebrate DNA, and these factors are known to activate immune cells (Gillkeson, GS. Et al ., J. Clin). Invest., 95: 1398-1402, 1995). A distinctive difference between vertebrate and bacterial DNA is that the vertebrate genome is CpG inhibited, and that 70% of cytosine is methylated in the CpG motif dinucleotide (Krieg, AM. et al ., Nature 374: 546-549, 1995). Unmethylated CpG motifs are very common in bacteria, but not in mammals. Oligodeoxynucleotides (ODNs), including CpG motifs, activate host defense mechanisms ranging from innate immune responses to acquired immune responses (Akdis, CA.Curr Opin Immunol., 12: 641-646, 2000). In general, CpG ODN can activate both B and NK cells. The CpG sequence also stimulates macrophages to secrete IL-12, a potential derivative of IFN- [gamma] production from NK cells (Krieg, AM. Annual Review Immunol., 20: 709-760, 2002). At the same time, these cells create pro-inflammatory cytokines such as IL-1, IL-6, IL-18 and TNF-α and Th1-biased immune environments such as IFN-γ and IL-12 Secrete cytokines or chemokines. Moreover, CpG ODN enhances humoral responses leading to IgG2a isotypes (Th1 type indicator) and induces increased cytotoxic T lymphocyte (CTL) activation (Warren, TL. Et al ., J. Immunol., 165: 6244-6251, 2000). The use of CpG ODN for allergy and cancer treatment in animal models is a very effective way to boost direct or indirect immune responses. These CpG ODNs are known to exhibit different physiological activities depending on their nucleotide sequences even though they have the same CpG motif.

Recently, in order to increase the usefulness of the CpG ODN, a CpG ODN having been modified with a backbone has been developed. The CpG ODN of the phosphodiester backbone, the basic backbone of DNA, is sensitive to nucleases and degrades rapidly in the body. Therefore, there is a small risk of causing toxicity in vivo. However, its activity is known to be lower than that of other backbone CpG ODN (Kwon, HJ. Et al ., Biochem. Biophys. Res. Commun., 311: 129-138, 2003 Lee, KW. Et al., Mol Immunol. 41: 955-964, 2004). In contrast, the CpG ODN of the phosphorothioate backbone is artificially made by altering its structure so that it is not degraded by nucleases in the body. The CpG ODN of the phosphorothioate backbone is more stable in the body and more capable of inducing B cells than the CpG ODN of the phosphodiester backbone. Therefore, CpG ODN modified with phosphorothioate backbone is currently the most widely used. However, the CpG ODN of these phosphorothioate backbones increases the binding of nonspecific ODNs to numerous proteins and causes toxicity because they are not readily degraded in the body. In addition, CpG ODN of the phosphorothioate backbone exacerbates the induction and symptoms of arthritis (Deng GM et al., Arthritis & Rheumatisum , 43 (2): 356-364, 2000; Masayuki Miayta et al., Arthritis & Rheumatisum , 43 (11): 2578-2582, 2000), and has been reported to cause autoimmune diseases such as systemic lupus erythematosis (SLE) (Tanaka, T. et al ., J Exp. Med. 175: 597-607, 1992; Hans-Joachim Anders et al., The FASEB Journal express article 10. 1096 / fj. 03-0646fje. Published online January 20, 2004). In addition, several researchers have reported side effects of CpG ODN with phosphorothioate backbone (Tsunoda I. et al., Brain Pathol ., 9 (3): 481-493, 1999; Bachmaier K. et al., Science , 283 (5406): 1335-1339, 1999).

As such, the CpG ODN is currently only extensively studied for its use as an immunoactive agent, and has not been studied for the treatment and prophylactic effects of skin diseases, and in particular, the treatment and prevention of skin diseases of CpG ODN having a phosphodiester backbone. No effect has been studied.

One object of the present invention is to provide a CpG oligodeoxynucleotide comprising a CpG dinucleotide and having an increased immunomodulatory capacity, in particular a CpG oligodeoxynucleotide having the nucleic acid sequences of SEQ ID NOs: 1-8.

Another object of the present invention to provide a composition for treating or preventing skin immune diseases comprising the CpG oligodeoxynucleotide.

Another object of the present invention to provide a method for treating a skin immune disease comprising the CpG oligodeoxynucleotide.

In one embodiment, the present invention relates to a CpG oligodeoxynucleotide represented by the following general formula (1) or (2).

SYYSSACGTTGSCGAWMYTC

AXSSWXTCGXWXCGTTCGSC

Wherein S is G or C, Y is C or T, W is A or T, M is A or C, and X is A or G.

In particular, the present invention relates to CpG oligodeoxynucleotides having the nucleic acid sequences of SEQ ID NOs: 1-8, preferably SEQ ID NOs: 5-8.

As used herein, the term 'CpG oligodeoxynucleotide (hereinafter referred to as' CpG ODN ')' refers to an oligodeoxynucleotide including at least two CpG motifs. The 'CpG motif (motif)' contains an unmethylated cytosine-guanine dinucleotide (or 'unmethylated cytosine-phosphate-guanine dinucleotide') linked by a phosphate bond. Refers to a nucleotide sequence that activates an immune response. As a specific embodiment, the CpG ODN of the present invention is any one selected from the group consisting of SEQ ID NOs: 1 to 8, preferably any one selected from the group consisting of SEQ ID NOs: 5 to 8, more preferably SEQ ID NO: 5 or CpG ODN, SEQ ID NO: 7.

The CpG ODN of the present invention may be derived from natural sources (eg, chromosomal DNA of Escherichia coli) and may be chemically synthesized or recombinantly produced. The CpG ODN of the present invention can be synthesized using various nucleic acid synthesis techniques and machinery known in the art (Ausubel et al ., Current Protocols in Molecular Biology , Chs 2. and 4., Wiley Interscience, 1989; Maniatis, et al ., Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Lab., New York, 1982); U.S. Patent 4,458,066 and U.S. Patent 4,650,675). It may also be prepared from existing nucleic acid sequences using restriction enzymes, exonucleases or endonucleases.

The CpG ODN of the present invention preferably has a phosphodiester skeleton. The phosphodiester backbone, which is the basic backbone of DNA, is easily degraded by nucleases in vivo and therefore has a low risk of inducing toxicity. The CpG ODN of the present invention is characterized in that it exhibits excellent immune activity not only in vitro but also in vivo, unlike other CpG ODNs, even in the phosphodiester backbone. In addition, the CpG ODN of the present invention may have a modified backbone. It has been known that modification of the oligonucleotide backbone can enhance the activity and / or stability of CpG ODN when administered in vivo. Preferred modifications of the skeleton in the CpG ODN of the present invention include phosphorothioate modifications that render it resistant to degradation. Phosphorothioate modifications can occur at the ends, such as the last two or three 5 'or 3' nucleotides can be linked by phosphorothioate bonds. The CpG ODN of the invention can also be modified to include secondary structures (eg, stem loop structures) that are resistant to degradation. Preferably it may be modified to have one or more partially phosphorothioate modified backbones. Phosphorothioates can be synthesized by automated techniques using phosphoramidate or H-phosphonate chemistry (SE Beaucage et al., Tetrahedron Lett ., 22: 1859, 1981; Connolly et al., Biochemistry , 23: 3443, 1984; Agrawal et al., Proc.Antl. Acad. Sci. USA 85: 7079-7083, 1988; Garegg et al., Tetrahedron Lett ., 27: 4051-4054, 1986; Froehler et al , Nucl.Acidv.Res. , 14: 5399-5407, Garegg et al., Tetrahedron Lett ., 29: 2619-2622, 1988). Another variant, aryl- and alkyl-phosphonates, may be prepared as described, for example, in US Pat. No. 4,469,863, and alkylphosphotriesters having charged oxygen moieties in US Pat. No. 5,023,243 and European Patent 092,574. Alkylated as described herein) can be prepared by automated solid phase synthesis using commercially available reagents. Another modification that makes it less susceptible to degradation is the inclusion of atypical bases such as inosine and quecine as well as acetyl-, thio- and similar modifications of adenine, cytosine, guanine, thymine and uridine. CpG ODNs containing terminally diols such as tetraethylglycol or hexaethyleneglycol are also more resistant to degradation. Others include combinations of phosphodiester and phosphorothioate, phosphorus esters, phosphorates, methylphosphonates, methylphosphorothionates, phosphorodithyroates and combinations thereof (Khorana et. al ., J. Molec . Biol ., 72: 209, 1972; Reese, Tetrahedron Lett ., 33: 3143-3179, 1978; Jaget et al., Biochemistry ., 27: 7237, 1988; Agrawal et al., Proc. Antl. Acad. Sci. USA 85: 7079-7083, 1988; Uhlmann, E. et al., Chem. Rev. , 90: 544, 1990; Goodchild, J. Bioconjugate Chem ., 4: 165, 1990). Such skeletal modified CpG ODNs have enhanced nuclease resistance, increased cellular uptake, increased protein uptake and / or altered intracellular localization. Intracellular localization can be used to show stronger immunity.

Preferred skeletons of the CpG ODN of the present invention are phosphodiester (hereinafter referred to as 'type O') or phosphorothioate (hereinafter referred to as 'type S') skeletons, and the most preferred skeletons are readily degraded in vivo. It is a type O skeleton that does not cause side effects.

The inventors have found that in international application PCT / KR2005 / 003717 the CpG ODN regulates the equilibrium of Th1 / Th2 immune responses, and also continued the study of the above formula 1 or 2, preferably SEQ ID NOs: 1-8 CpG oligodeoxynucleotides with nucleic acid sequences have also been found to be effective in controlling the equilibrium of Th1 / Th2 immune responses.

That is, the CpG ODN of the present invention inhibits Th2 cytokines (e.g. IL-4, IL-10) and / or induces Th1 cytokines (e.g. IL-12, IFN-γ) It has a physiological activity to regulate the balance of. Specifically, the CpG ODN of the present invention activates macrophages, white blood cells and dendritic cells to induce the expression of IL-12 and / or INF-γ. In addition, the CpG ODN of the present invention activates immune cells in experimental animals suppressed immune response using ultraviolet rays, induces proliferation of T lymphocytes and peripheral blood mononuclear cells and increases serum IgE levels to restore immune responses. Furthermore, unlike the conventionally known CpG ODN, the CpG ODN of the present invention is characterized by showing almost the same activity regardless of the shape of the skeleton.

Accordingly, the present invention provides a method of inhibiting and / or inducing a Th2 cytokine and stimulating an immune response, comprising administering the CpG ODN to a subject in need thereof.

Accordingly, the present invention relates to a pharmaceutical composition for treating or preventing skin immune diseases comprising the CpG ODN and a method for treating or preventing skin immune diseases by administering the same to an individual.

Th2 cytokines inhibited by the CpG ODN of the present invention include all of the cytokines secreted in Th2 cells. For example, IL-4, IL-5, IL-10, IL-13 and the like. In addition, the Th1 cytokine induced by the CpG ODN of the present invention includes all of the cytokines secreted from Th1 cells, IL-12, IFN-γ and the like. In the present invention, 'stimulating the immune response' means activation of dendritic cells, induction of proliferation of immune cells (eg T lymphocytes, peripheral blood mononuclear cells), inflammation-related cytokines (eg TNF-α, MIP-2, Induction of IL-1, IL-12) and / or recovery of the immune suppression response by ultraviolet irradiation.

In addition, CpG ODN according to the present invention exhibits the effect of the treatment or improvement of symptoms of skin diseases through the above activity. Therefore, CpG ODN of the present invention can be effectively used for the treatment or prevention of skin diseases. The present invention provides a method for treating or preventing skin diseases comprising administering the CpG ODN to a subject in need thereof. Dermal diseases to which the method may be applied include diseases caused by abnormalities in the balance of Th1 / Th2 immune responses, ie overexpression of cytokines mediated by Th2-lymphocytes; Low expression of cytokines mediated by Th1-lymphocytes; Increase in serum IgE levels; It may be a skin disease caused by one or more selected from the group consisting of numerical abnormalities and functional abnormalities of CD8 ⁺ phenotype T lymphocytes and / or CD4 ⁺ phenotype T lymphocytes and deactivation of dendritic cells and / or macrophages. In particular, skin diseases that can be treated / prevented by the CpG ODN of the present invention may be skin diseases that can be caused by decreased expression of the Th1 cytokine IL-12 or treated by increasing the expression or production of IL-12. have.

IL-12 not only functions to amplify the innate immunity produced against early infections, but also is involved in the interaction of TPCs with antigen presenting cells (APCs), including dendritic and macrophages. It plays a very important role in inducing an effective adaptive immune response. The production of IL-12 from APCs such as dendritic cells and macrophages is largely divided into T cell independent and T cell dependent mechanisms. T cell-independent mechanisms are induced by infectious agents, including viruses or bacteria, or by their product, LPS or bacterial DNA (D 'Andrea A et al., J. Exp. Med ., 176: 1387, 1992; Sato T et al., Science 273: 352-354, 1996), suggesting the immunological significance of IL-12 as a mediator between innate and acquired immunity. In addition, T cell dependent IL-12 production mechanism is mainly induced through interaction with activated T cells that provide co-stimulatory signals through molecules such as CD40 ligands (Shu U et al. , Eur. J. Immunol ., 25: 1125-1128, 1995; Cella M et al., J. Exp. Med ., 184: 747-752, 1996), which showed cytotoxic T cell proliferation and IL-12 plays an important role in inducing T cell immune responses such as increased cytotoxicity or sustained maintenance of Th1 immune responses. IL-12 is produced primarily from APCs, which act directly on dendritic cells or macrophages to induce the production of IFN-γ. IL-12 can also act on activated T cells, inducing the production of IFN-γ from T cells and modulating the immune response induced by IFN-γ (Chan SH et al., J. Exp. Med). , 173: 869-879, 1991).

It is known that such IL-12 is associated with various diseases. Examples include atopic dermatitis and allergic skin diseases (Neumann C., et al ., J Mol Med. , 74: 401-406, 1996; Aiba S., et al ., Exp Dermatol. , 12: 86-95, 2003 Nilsson C., et al ., Clin Exp Allergy. , 34: 373-380, 2004), including viral HIV, Herpes simplex virus, infectious continuum, warts (Verruca / Wart), etc. Skin diseases (Katakura, T., et al ., Clin. Immunol . 105: 363-370, 2002 Hengge UR, et al ., Br. J. Dermatol. , 149: 15-19, 2003; Arany I., et al ., Antiviral Res. , 43: 55-63, 1999), skin cancer (Rook AH., et al Ann. NY Acad. Sci ., 795: 310-318, 1996; Glolob, JA., et al., J. Clin. Oncol ., 21: 2564-2573, 2003; Trinchieri G., et al., Annu Rev Immunol., 13: 251-276, 1995; Krepler C., et al ., J invest Dermatol. , 122 : 387-391, 2004).

Therefore, the skin diseases that can be applied to the present invention can be preferably applied to the treatment of atopic dermatitis, allergic skin diseases mediated by IgE, viral skin diseases and skin cancer. Most preferably, it can be widely used for atopic dermatitis or skin disease with reduced Th1 immune response.

As used herein, the term 'individual' may be an animal, preferably a mammal, or may be a cell, tissue, organ or the like derived from the animal.

CpG ODN according to the invention can be administered directly to the subject. It may also be administered in the form of a nucleic acid delivery complex that is bound to or encapsulated within a molecule that induces high affinity binding to a target cell (eg, the surface of a dendritic cell). CpG ODNs of the invention can be prepared by sterols (e.g. cholesterol), lipids (e.g. cationic lipids, virosomes or liposomes) or target cell specific binding agents (e.g., via ionic or covalent bonds using techniques known in the art. Ligands recognized by target cell specific receptors). Suitable coupling or crosslinking agents can include, for example, Protein A, carbodiimide, N-succinimidyl-3- (2-pyridyldithio) propiotate (SPDP) and the like.

CpG ODN according to the present invention is a method known in the art (Donnelly et al., J. Imm. Methods ., 176: 145, 1994; Vitrello et al., J. Clin. Invest ., 95: 341, 1995) It can be administered by various routes depending on. That is, orally or parenterally, such as oral, intramuscular, intravenous, intradermal, intraarterial, intramedullary, intradural, intraperitoneal, intranasal, intravaginal, rectal, sublingual or subcutaneous, or by gastrointestinal tract, mucosa or respiratory tract. May be administered. For example, the CpG ODN according to the present invention is prepared as an injectable formulation, and a 30-gauge thin needle is used to inject a certain amount into the lower layer of the skin or to lightly prick the skin with the needle, or directly apply it to the skin. It can be administered by the method.

In addition, CpG ODN according to the invention may be formulated in oral or parenteral dosage forms. For oral administration, the CpG ODN according to the present invention may be formulated in admixture with excipients in the form of intake tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups and wafers. These formulations may contain, in addition to the active ingredient, diluents (e.g. lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine) and suspending agents (e.g. silica, talc, stearic acid and magnesium or calcium salts thereof and / or Or polyethylene glycol). The tablets may comprise binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, optionally starch, agar, alginic acid or its Disintegrants such as sodium salts, absorbents, colorants, flavors and / or sweeteners may be further included. The formulations may be prepared by conventional mixing, granulating or coating methods.

Also for parenteral administration, it may be formulated as an injectable formulation such as an isotonic aqueous solution or suspension or a formulation for skin application. Injectable formulations may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. Formulations for application may be formulated with a pharmaceutical composition of the present invention and a pharmaceutically acceptable carrier to provide powders, liniments, gels, lotions, creams, ointments and pastas. It may be formulated in the form of a pasta, pape, aerosol, suppository and the like. Especially, an ointment is more preferable. As the carrier, depending on each formulation, hydrocarbons such as petrolatum, liquid paraffin, gelling hydrocarbons, heavy chain fatty acid triglycerides, lard, hard fats, animal and vegetable oils such as cacao butter, stearyl alcohol, stearic acid, isopropyl palmitate Higher fatty acid alcohols such as fatty acids and esters thereof, such as polyethylene glycol, 1,3-butylene glycol, glycerol, gelatin, white sugar, sugar alcohol, water-soluble base glycerin fatty acid esters, stearic acid polyoxyl, polyoxyethylene hardened castor oil, etc. Emulsifiers Adhesives such as acrylate esters and sodium alginate and propellants such as liquefied petroleum gas and carbon dioxide and preservatives such as paraoxybenzoic acid esters can be used. In addition, it may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-parabens and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following references (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The total effective amount of CpG ODN of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol that is administered in multiple doses for long periods of time. The term 'effective amount' refers to an amount that shows the effect of inhibiting Th2 cytokine, inducing Th1 cytokine, activating immune cells, stimulating an immune response, or treating or preventing skin diseases. The pharmaceutical composition comprising the CpG ODN of the present invention may vary the content of the active ingredient depending on the extent of the disease. When administered systemically, the pharmaceutical composition of the present invention is preferably administered daily in a dose sufficient to obtain a blood oligonucleotide concentration of about 0.01 μM to 100 mM. In the case of topical administration, smaller amounts may be administered as compared to administration by other routes. Preferably the preferred total dose of CpG ODN of the invention may be about 0.01 μg to 100 mg per kg of patient body weight per day. However, the concentration of CpG ODN is determined by taking into consideration not only the route of administration and the frequency of treatment, but also various factors such as the age, weight, health condition, sex, severity of disease, diet and excretion rate of the patient. In view of this, one of ordinary skill in the art will be able to determine the appropriate effective dosage for the particular use of the CpG ODN as a therapeutic or prophylactic for skin diseases. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, route of administration and method of administration as long as the effect of the present invention is shown. The pharmaceutical compositions of the present invention may be administered alone or in combination with other therapeutic methods known in the art, such as chemotherapy treatment, radiation therapy, surgery, other oral therapeutic agents and therapeutic ointments such as Elidel (pimecrolimus). May be administered. It may also be coadministered with other immune adjuvants known in the art. As the immune adjuvant, INF-γ, IL-12, cyclosporine (Cyclosporine), FK506 (Tacrolimus), TP-5 (Thymopoietin pentapeptide, thymopentin) and the like can be used. In addition, the pharmaceutical composition containing the CpG OND according to the present invention may be Tetratracycline, oxytetracycline, gentamicin, neomycin sulfate, bacitracin and polymyxin B sulfate, mupirocin Antibiotics such as; Anti-histamines, such as diphenhydramine, promethadine, triprenamine, phenothiazine, chloropheniramine, antazoline and pantolyl; Anti-inflammatory drugs; It may further include one or more selected from the group consisting of anti-viral drugs and anti-fungal agents.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the present invention, the contents of the present invention is not limited to the following examples.

<Example 1>

<1> Synthesis of BD-ODNs

The sequence disclosed in Table 1 was prepared using an automated synthesizer that stretches the base chain (oligonucleotide) by attaching single bases one by one in the 3 'direction to the 5' direction by using Genotech Co., Ltd. Backbone) was synthesized in the form of phosphodiester (type O) and phosphorothioate (type S), and used to search for candidates. The synthesized sequence of Table 1 is a candidate having an immune response control effect by analyzing the chromosomal DNA sequence of E. coli .

ODNs Sequence shape SEQ ID NO: BD-ODN 3611 GCTCGACGTTGGCGATACTC O type One BD-ODN 3611 GCTCGACGTTGGCGATACTC S type 2 BD-ODN 4546 CTCGCACGTTGCCGAACTTC O type 3 BD-ODN 4546 CTCGCACGTTGCCGAACTTC S type 4 BD-ODN 5419 AAGGTATCGGTACGTTCGCC O type 5 BD-ODN 5419 AAGGTATCGGTACGTTCGCC S type 6 BD-ODN 5441 AGCCAGTCGAAGCGTTCGGC O type 7 BD-ODN 5441 AGCCAGTCGAAGCGTTCGGC S type 8

<2> synthetic BD - ODN  Immune response

The synthetic BD-ODNs prepared in Table 1 above were examined to activate the promoter of IL-8 of macrophages in a concentration-dependent or backbone form.

a) culture of mouse macrophages

Raw 264.7 cells (ATCC, Manassas, VA) were cultured in DMEM medium with 10% FBS (Gibco BRL). Cell cultures were performed in 37 ^° C., 5% CO ₂ incubator (Forma).

b) IL-8 promoter Luc  Construction of Reporter Plasmids

To amplify the IL-8 promoter region (-135 bp to +46 bp), human genomic DNA was used as a template and PCR was performed using the following primer sets.

5 'primer (SEQ ID NO: 9)  5'- GTGAGATCTGAAGTGTGATGACTCAGG-3 ' 3 'primer (SEQ ID NO: 10) 5'- GTGAAGCTTGAAGCTTGTGTGCTCTGC-3 '

The amplified IL-8 promoter region fragment was inserted into pGL3-Basic plasmid (Promega, USA) digested with Bgl II and Hin dIII. This produced the IL-8 promoter- Lu reporter plasmid (Wu GD et al ., J. Biol . Chem ., 272: 2396-2403, 1997).

c) Promoter Activation Assay: Luciferase Activity Assay

RAW 264.7 cells (ATCC, Rockviller, MID) were dispensed into 12-well plates at a concentration of 1 × 10 ⁵ cells / well and incubated for 24 hours in a 37 ^° C., 5% CO ₂ incubator. The cells were co-transfected with the IL-8 promoter- Lu reporter plasmid prepared in b) and the pRL-null plasmid (Promega, USA). Then, incubated for 24 hours in a 37 ^° C, 5% CO ₂ incubator. BD-ODNs described in Table 1 above were treated in each well at a concentration of 1, 2, 5, 10 μg / well, and incubated for 8 hours in a 37 ^° C., 5% CO ₂ incubator. At this time, the control group was treated with PBS. Subsequently, PLB (passive lysis buffer) of the Dual-luciferase reporter assay system (Promega, USA) was added to each well at a concentration of 100 μl / well to disrupt the cells. Luciferase assay was performed using the supernatant (15 μl) obtained by centrifuging the cell lysate. Luciferase activity was measured using a TD-20 / 20 luminometer (luminometer, Turner designs, USA). The activity of each promoter following treatment with BD-ODN is shown as relative to the control. That is, the activity of the control group is represented as 'fold activation'.

As a result, as shown in FIG. 1 , it was confirmed that BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 activate IL-8 promoters in a concentration-dependent manner.

<3> BD - Of ODNs  According to skeletal deformation RAW  264.7 Activation of Cells

RAW 264.7 cells were co-transfected with the IL-8- Luc promoter reporter vector prepared in b) of Example <2> and the pRL-null plasmid (Promega, USA). Type O (phosphodiester backbone) and S type (phosphothioate backbone) BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 (10 μg / ml) were respectively applied to the transfected cells. Treated and incubated for 8 hours. Thereafter, IL-8 promoter activity was measured in the same manner as in Example <2>. As a result, as shown in Figure 2 , BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, BD-ODN 5441 according to the present invention is highly active regardless of the shape of the skeleton (both type O and S) Indicated.

<4> NF-κB activation of BD-ODNs

Cover glass was placed in a 24-well plate and RAM 264.7 cells were added 5x10 ⁵ cells / ml and incubated in 37 ° C. and 5% CO ₂ incubator for 24 hours. BD-ODN 3611, BD-ODN 4546, BD-ODN 5419 and BD-ODN 5441 were each treated with 5 μg / well. After 30 minutes, the cells were fixed with 3.7% formaldehyde and permeabilized with PBS containing 0.2% Triton-X 100. After blocking for 30 minutes with a solution containing 1% donkey serum in PBS (PBST) containing 0.2% Tween-20, mouse anti-p65 (titer 1: 500) antibody was added to PBST at 0.5 μl / well for 2 hours. It was left at room temperature for a while. After washing with PBST, it was treated with Donkey-anti-mouse-IgG-FITC (titer 1: 250) antibody for 2 hours. Confocal microscopy was used to observe migration to NF-kB nuclei (Lee, Y., et. Al., (2002) Blood 99, 4307-4317).

3 is a diagram illustrating the phenomenon of NF-κB migration to the nucleus using confocal microscopy by staining NF-κB by immunostaining. NF-κB was located in the cytoplasm in the no-treated or non-CpG motif control (non-CpG-ODN 2041). When macrophages were treated with BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441, NF-κB migrated into the nucleus.

<5> Induction of hematological immune response of BD-ODNs

<5-1> Immunization

Four-week-old Balb / c mice were intraperitoneally treated with a mixture of hen egg lysozyme (HEL, 50 μg / horse), BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 (50 μg / horse). Was administered. One week later, a second dose of HEL and BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 were administered. After one week, blood was collected by heart punching, centrifuged to precipitate blood cells, and serum was obtained. ELISA was performed to confirm the titer of anti-HEL antibodies (total IgG, IgG1, IgG2a) from the obtained serum.

<5-2> ELISA

The obtained serum was diluted to 1:10 with PBS / 0.2% sodium azide and stored at -20 ° C. HEL (10 μg / ml sodium bicarbonate buffer pH 9.6) was added to a 96 well Immunoplate (Nunc) and left at 4 ° C. for 16 hours to attach HEL to the bottom of the plate. The plate was washed with PBST (PBS / 0.05% Tween 20) and 1% bovine serum albumin (BSA) was added to block for 1 hour at room temperature. Serum was serially diluted to 1: 3 using PBS, placed in the plate in order, and left at 4 ° C. for 16 hours and washed with PBST. Alkaline phosphatase-conjugated detecting antibody was mixed in PBST and placed in a plate and left at room temperature for 2 hours. 1: 2,000 goat anti-mouse Ig (H + L) (Southern Biotechnology Associates) antibody was used for total IgG detection. 1-StepTM ABTS (PIERCE, USA) was added for color development and absorbance was measured at 405 nm using an ELISA reader (Labsystems, USA) (Chu, RS, et.al., (1997) J. Exp. Med . 186, 1623-1631).

The hematological immune response was examined by injecting BD-ODNs with hen egg lysozyme (HEL) in the mouse abdominal cavity. Compared with the injection of HEL alone, the amount of antibody against HEL injected with BD-ODNs is increased, so it was confirmed that BD-ODNs have an adjuvant effect in hematologic immunity ( FIG. 4 ). Freund's adjuvant, a drug that combines the extract of Mycobacteria with paraffin oil, is one of the representative immunoadjuvant agents used 60 years ago. However, the problem with this adjuvant is that cellular immunity is not achieved and cannot be used in humans. BD-ODNs of the present invention, as well as the role of an adjuvant to increase the blood immunity, as well as stimulating immune cells to induce cellular immunity has obtained a result that can be used as a new adjuvant. BD-ODNs have also been shown to be effective in the production of antibodies specific for Th1 immune response-specific IgG2a.

<6> Induced Cytokine Production by BD-ODNs

<6-1> Analysis of Cytokine Expression in Human Peripheral Blood Cells

a) Isolation of Human Peripheral Blood Cells and Treatment of BD-ODNs

Blood purchased from a blood source was mixed with PBS in the same amount, and blood cells were separated using Ficoll-paque solution. The cells were aliquoted into 6-well plates (Nunc corp., USA) at a concentration of 2 × 10 ⁶ cells / well. RPMI medium containing 10% FBS with GM-CSF (Biosource, USA) at a concentration of 10 ng / mL was added to each well (Ghosh, M., J Immunol. 170: 5625-5629). , 2003). After incubating the cells for one day in an incubator containing 5% CO ₂ at 37 ^° C., 10 μg / g of O-type BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 according to the present invention were used. ML treatment.

 b) ELISA

First, the titers of the cytokines IL-12 p40 and IFN-γ secreted into the cell cultures treated with BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441, respectively, as shown in Example 5 above. Sandwich ELISA assays were performed using commercially available IL-12 p40 and IFN-γ antibodies (R & D systems, Minneapolis, Minn.) To confirm. As a result, as shown in Figure 5 , BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, BD-ODN 5441 of the present invention induced the production of IL-12p40 and IFN-γ. The present invention shows that BD-ODN 3611, BD-ODN 4546, BD-ODN 5419, and BD-ODN 5441 increase the production of IL-12p40 and IFN-γ, thereby increasing Th1 immunoreactivity.

< Example  2>

Restoration Effect of CpG-ODN on Delayed Immune Inhibitory Response in Mice by UV Irradiation

8-week-old female Balb / c mice (SLC, Korea) of about 20 g were divided into the following 5 groups, 5 for each group.

(1) Negative control group: does not induce ultraviolet irradiation and sensitization

(2) Positive control group: induced only sensitization without irradiating ultraviolet rays

(3) UV alone treatment group: Induced sensitization 3 days after irradiation with ultraviolet rays

(4) CpG-ODN 1826 experimental group: intraperitoneal injection of the S-type CpG-ODN 1826 of the present invention 24 hours after irradiating ultraviolet rays and induced sensitization 3 days after ultraviolet irradiation

(5) BD-ODN 3611 experimental group: 24 hours after irradiation with ultraviolet rays, intraperitoneal injection of O-type BD-ODN 3611 of the present invention and induced sensitization three days after ultraviolet irradiation.

(6) BD-ODN 5419 experimental group: intraperitoneal injection of the O-type BD-ODN 5419 of the present invention 24 hours after irradiation with ultraviolet rays, and induced sensitization three days after ultraviolet irradiation.

(7) BD-ODN 5441 Experimental group: intraperitoneal injection of the O-type BD-ODN 5441 of the present invention 24 hours after irradiation with ultraviolet rays and induced sensitization three days after irradiation with ultraviolet rays.

Hair was removed from the rat's back for UV irradiation, and experiments were conducted with hair from the belly of the rat to induce sensitization reactions. Experiment schedule of each step is shown in FIG.

Mice in each group were placed in an ultraviolet box equipped with an ultraviolet B lamp (4FSX24T12 / UVB-HO, UBL, USA), and irradiated with ultraviolet rays for 28 minutes at a light quantity of 0.6 mW / cm ² . In this case, the total amount of energy irradiated with ultraviolet B is 10 KJ / m ² . Thus, by irradiating with ultraviolet light, the immunosuppressive effect of the contact delay hypersensitivity reaction by ultraviolet light was induced in experimental animals. After 24 hours of ultraviolet irradiation, 20 μg per head were intraperitoneally injected with BD-ONDs of the present invention dissolved in PBS at a concentration of 1 mg / ml. For the control group, the same amount of PBS solution was injected.

Two days after drug injection, 100 μl of 3% TNCB solution (2,4,6-trinitrochlorobenzene; Tokyo Kasei Co., Tokyo, Japan) was applied to the abdomen of the hairless Balb / c female mice to induce sensitization. On day 5 after sensitization, the thickness of the ear of the rat was measured, and then again a 1% TNCB solution was applied to both sides of the mouse for induction test. After 24 hours, the degree of ear edema was measured using a micrometer (Mitutyo, Tokyo, Japan).

As a result, as shown in FIG. 7, 100 μl of 3% TNCB was applied to the hairless embryo, causing contact dermatitis in mice (positive control: 21.7 ± 1.18 × 10 ⁻² mm), and when irradiated with ultraviolet rays, The degree of edema was reduced (7.0 ± 1.17 × 10 ^-2 mm). As a result of injecting the BD-ODN of the present invention intraperitoneally, it was found that all of the contact delayed immune responses suppressed by ultraviolet rays were significantly recovered. From this, it was confirmed that the BD-ODNs of the present invention restore the suppressed immune response due to ultraviolet rays.

< Example  3>

TNP (trinitrophenyl) specific antigen isolated from the spleen of mice suppressed by contact hypersensitivity to the specific antigen (TNCB) induced by ultraviolet irradiation of the T cell proliferation responses Induction of proliferation of BD-ODN

In the same manner as in Example 2, five Balb / c mice of 8-week-old mice were used in the same manner as in Example 2 (negative control group, positive control group, UV treatment group, CpG-ODN 1826 experimental group, BD-ODN 3611 experimental group, BD-ODN 5419 experimental group, BD-ODN 5441 experimental group) was subjected to ultraviolet irradiation, CpG ODN treatment of the present invention, sensitization induction as in Example 2. To induce antigen-specific responses, splenocytes isolated from negative control mice without UV irradiation and sensitization induced conjugation with 10 mM TNBSO ₃ (Trinitrochlolrobenzensulfonic acid; Tokyo Kasei Co., Tokyo, Japan) It was used as a (stimulator cell). Round-bottom 96-well plate using splenocytes isolated from mice of positive control group, UV alone treatment group, and CpG-ODN 1826 or BD-ODN 3611, 5419, 5441 treated group after UV irradiation as response cells. 1 x 10 ⁵ cells were added per well. Thereafter, the stimulation cells were mixed in each well and incubated for 5 days. At this time, the stimulation cells and the reaction cells were mixed in a 1: 1 ratio. 18 hours before cell collection, [ ³ H] thymidine was added at 0.5 μCi per well and reacted for 18 hours. Cells from each well were collected on filter paper using a harvest machine and dried at room temperature. Thereafter, 2 ml of an aqueous scintillation counter (Amersham Biosciences, USA) was dispensed into vials, and each filter paper was added thereto and dissolved. Proliferative capacity of immune cells (T cells) isolated from the spleen was measured by measuring the cpm (counter per minute) value using a β-scintillation counter (Amersham Biosciences, USA).

As a result, as shown in FIG. 8, TNP (trinitrophenyl) specific antigen T cell proliferative response isolated from the spleen of mice suppressed by contact hypersensitivity to the specific antigen (TNCB) induced by UV irradiation. (T cell proliferation responses) was shown to significantly increase the proliferative response by the BD-ODN treatment of the present invention. From this, it was confirmed once again that the immunosuppressive effect caused by UV in the contact dermatitis model was positively recovered by the BD-ODN of the present invention.

<3-1> Serum IgE Level Analysis

After each group of mice was anesthetized with ether, blood was immediately taken from the orbital vein and placed in a heparinized tube. Thereafter, plasma was obtained by centrifugation at 1000 g for 10 minutes and stored at -20 ° C until use. Total IgE levels were measured using the mouse IgE BD OptEIA Kit (BD phamingen, USA). Experimental method was carried out according to the manual process of BD OptEIA Kit. First, 100 µl of IgE capture antibody was added to each well of a 96 well plate and reacted at 4 ° C. for at least 12 hours. The solution in the wells was removed and washed three times with wash buffer (PBS, 0.05% Tween-20). Then, 200 μl of blocking buffer (PBS, 10% FBS) was added to each well and allowed to react at room temperature for 1 hour. The blocking buffer was removed and washed three times with the wash buffer. Plasma samples obtained from each mouse were added to each well of 100 µl each, and reacted for 2 hours at room temperature. The solution in the wells was then removed and washed 5 times with the wash buffer. 100 μl of avidin-Hrad (avidin-horseradish peroxidase) bound and biotin-labeled mouse IgE antibody (BD pharmingen, USA) was added to each well and allowed to react at room temperature for 1 hour. After the reaction was completed, it was washed seven times. TMB Substrate Solution (BD pharmingen, USA) 100 µl was added to each well and allowed to react for 30 minutes in a dark place at room temperature. 50 μl of stop solution 1M phosphoric acid (BD pharmingen, USA) was added to each well. Within 30 minutes after addition of the stop solution, the absorbance of the solution was measured at 450 nm with an ELISA reader.

As a result, as shown in Figure 9 , when the O-type BD-ODN of the present invention was administered to the mice suppressed immune response by ultraviolet irradiation, it was confirmed that the serum IgE level significantly increased.

<3-2> Immune-induced Response Lesions to TNP Specific Antigens

One day after the immune-induced response to the TNP specific antigen of mice intraperitoneally administered the BD-ODN of the present invention, the ear site, which is the induced site, was extracted and examined for the immunorecovery effect of the BD-ODN of the present invention by H & E staining. As shown in FIG. 10, lymphocyte infiltration and inflammatory cell infiltration were significantly increased in the ear dermis of the O-coated BD-ODN-coated mouse. It was confirmed that this proceeded successfully (X 200-fold observation).

From these results, the expression of Th1-lymphocyte-mediated cytokines was decreased in mice in which the O-type BD-ODN of the present invention suppressed the delayed-type immune response to specific antigen (TNCB), thereby increasing serum IgE levels. Through it was confirmed that the very excellent effect on the immune recovery.

<Example 4>

<4-1> Recovery Effect of CpG-ODN on Delayed Immunosuppressive Response in Mice Following Continuous Administration of TMA (trimellitic anhydride)

8-week-old female Balb / c mice (SLC, Korea) of about 20 g were divided into the following 6 groups, 5 for each group.

(1) Negative control group: does not induce sensitization and induction using TMA

(2) Positive control group: induces sensitization and induction using TMA

(3) CpG-ODN 1826 Experimental group: Immediately after induction of sensitization using TMA, intraperitoneal injection of S-type CpG-ODN 1826, and again 5 days later, after induction of secondary sensitization using TMA, again S-type CpG- Induced response to TMA 5 days after intraperitoneal injection of ODN 1826.

(4) BD-ODN 3611 Experimental group: Immediately after induction of sensitization using TMA, intraperitoneal injection of O-type BD-ODN 3611 of the present invention, and immediately after 5 days of induction of secondary sensitization using TMA, Induced response to TMA 5 days after intraperitoneal injection of O-type BD-ODN 3611 of the invention.

(5) BD-ODN 5419 Experimental group: Immediately after induction of sensitization using TMA, intraperitoneal injection of O-type BD-ODN 5419 of the present invention, and immediately after 5 days of induction of secondary sensitization using TMA, Induced reaction with TMA 5 days after intraperitoneal injection of O-type BD-ODN 5419 of the invention.

(6) BD-ODN 5441 Experimental group: Immediately after induction of sensitization using TMA, intraperitoneal injection of O-type BD-ODN 5411 of the present invention, and again 5 days after induction of secondary sensitization using TMA, Induced response to TMA 5 days after intraperitoneal injection of O-type BD-ODN 5441 of the present invention.

In order to induce the sensitization reaction of mice using TMA, experiments were conducted by depilating the hair of the rat's abdomen. The experimental schedule of each step is shown in FIG.

Sensitization was induced by applying 100 μl of 10% TMA solution (Trimellitic anhydride; Sigma-Aldrich, USA) dissolved in acetone and olive oil in a 4: 1 mixed solution on the abdomen of the hairless Balb / c female mouse. Immediately after induction of sensitization, 20 μg per animal were intraperitoneally injected with BD-ODNs of the present invention dissolved in PBS at a concentration of 1 mg / ml. For the negative control group, acetone-olive oil mixture without TMA was used, and the same amount of PBS solution was injected. On day 5 after the sensitization, acetone and olive oil were placed on the abdomen of Balb / c female mice with hairs removed again. 100 μl of 10% TMA solution (Trimellitic anhydride; Sigma-Aldrich, USA) dissolved in 4: 1 mixed solution was applied to induce secondary sensitization. Immediately after induction of sensitization, 20 μg per animal were intraperitoneally injected with BD-ODNs of the present invention dissolved in PBS at a concentration of 1 mg / ml. In the case of the negative control, the same amount of PBS solution was injected using an acetone-olive oil mixture in which TMA was not dissolved. After the second sensitization induction was measured for 5 consecutive days from the 5th day of the rat ear, 10% TMA solution was again applied to both sides of the mouse 12.5 μl for the challenge test. Twenty four hours after each induction, ear edema was measured using a micrometer (Mitutyo, Tokyo, Japan).

As a result, contact dermatitis of mice was induced by applying 100 μl of 10% TMA to the hairless embryos twice (negative control: 31.0 ± 1.6 × 10 ⁻² mm, positive control: 68.8 ± 0.7 × 10 ⁻²⁾ mm). Intraperitoneal injection of BD-ODN of the present invention showed that all of the Th2 immune responses increased by TMA contact were significantly recovered (FIG. 12).

<4-2> Serum IgE Level Analysis

After each group of mice was anesthetized with ether, blood was immediately taken from the orbital vein and placed in a heparinized tube. Thereafter, plasma was obtained by centrifugation at 1000 g for 10 minutes and stored at -20 ° C until use. Total IgE levels were measured using the mouse IgE BD OptEIA Kit (BD phamingen, USA). Experimental method was carried out according to the manual process of BD OptEIA Kit. First, 100 µl of IgE capture antibody was added to each well of a 96 well plate and reacted at 4 ° C. for at least 12 hours. The solution in the wells was removed and washed three times with wash buffer (PBS, 0.05% Tween-20). Then, 200 μl of blocking buffer (PBS, 10% FBS) was added to each well and allowed to react at room temperature for 1 hour. The blocking buffer was removed and washed three times with the wash buffer. Plasma samples obtained from each mouse were added to each well of 100 µl each, and reacted for 2 hours at room temperature. The solution in the wells was then removed and washed 5 times with the wash buffer. 100 μl of avidin-Hrad (avidin-horseradish peroxidase) bound and biotin-labeled mouse IgE antibody (BD pharmingen, USA) was added to each well and allowed to react at room temperature for 1 hour. After the reaction was completed, it was washed seven times. TMB Substrate Solution (BD pharmingen, USA) 100 µl was added to each well and allowed to react for 30 minutes in a dark place at room temperature. 50 μl of stop solution 1M phosphoric acid (BD pharmingen, USA) was added to each well. Within 30 minutes after addition of the stop solution, the absorbance of the solution was measured at 450 nm with an ELISA reader.

As a result, as shown in Figure 13 , it was confirmed that the administration of the O-type BD-ODN of the present invention significantly reduced the serum IgE level increased by TMA contact.

<Application example 1>

Skin diseases caused by viruses

Viral skin diseases occur well in people with reduced immune conditions or in chronic diseases. In these, type 1 T cell responses are reduced, while type 2 T cell responses are increased (Hengge UR, et al. , Br J Dermatol. , 149: 15-19, 2003). Katakura T., et al ., Clinical Immunol. 105: 363-370, 2002). These viral diseases include infectious sequencing, warts, and herpes virus infections. Successful treatment of these infectious diseases can be achieved by direct injection of IL-12 or by treatment that promotes IL-12 (Arany I., et al ., Antiviral Res. , 43: 55-63, 1999 Matsuo, R., et al ., 59: 623-630, 1996; Katakura, T., et al ., Clin. Immunol. 105: 363-370, 2002). Therefore, the IL-12 enhancing effect of the BD-ODNs of the present invention is very effective in the treatment of viral skin diseases.

<Application example 2>

cutaneous cancer

Skin cancer incidences occur well in immunosuppressed or degraded humans, in particular the lack of Th1 immune responses involved in cellular mediated immunity and an increase in Th2 immune responses (Rook AH., Et al ., Ann NY Acad Sci. , 795: 310-318, 1996). IL-12 is known to be a cytokine that can treat these diseases by inducing an immune response to infectious infections and tumors, and its effects are known to be produced by the production of IFN-γ in vivo (Trinchieri G., et al ., Annu Rev Immunol. 13: 251-276, 1995). Along with reports that IL-12 can be used to treat skin cancer, BD-ODN has been shown to be effective in treating malignant melanoma in mice (Gollob JA., Et al ., J Clin Oncology. , 21: 2564-2573, 2003; Krepler C., et al ., J invest Dermatol. , 122: 387-391, 2004). Therefore, the enhancing effect of IL-12 by BD-ODN of the present invention will be very effective in the treatment of skin cancer.

<Application Example 3>

Atopic Dermatitis and Allergic Skin Diseases

The pathogenesis of atopic dermatitis is not yet clear, but it is thought that the disease is caused by allergen-specific T cells producing Th2 cytokines including IL-4 and IL-5. Infiltration has been demonstrated (Neumann C., et al ., J Mol Med. , 74: 401-406, 1996). It has been reported that when monocytes or monocyte-derived dendritic cells from atopic dermatitis patients are stimulated with LPS (lipopolysaccaride), the production of IL-12 p40 is significantly reduced compared to normal individuals (Aiba S., et al ., Exp Dermatol. , 12: 86-95, 2003). In addition, a decrease in the number of IL-12-producing monocytes from umbilical cord blood in infants is associated with an increase in IgE production, which has been reported to increase the likelihood of atopic dermatitis (Nilsson C., et al ., Clin Exp Allergy. , 34: 373-380, 2004). Given that IL-12 is one of the important determinants of the Th1 / Th2 immune response, increasing BD-12 production in dendritic cells is sufficient treatment in atopic dermatitis and increased IgE allergic skin diseases. Show that it has an effect.

BD-ODNs according to the present invention induce an immune response effective in the treatment or prevention of skin diseases, regardless of their skeleton form. Therefore, BD-ODNs according to the present invention, in particular BD-ODNs of type O can be usefully used as a treatment or prevention of skin diseases.

<110> BIO CLUE & SOLUTION CO., LTD          SHIN, DONG HEON <120> Therapeutic use of CpG oligodeoxynucleotide for skin immune          disease <130> PA9705-0359 <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 3611 O form <400> 1 gctcgacgtt ggcgatactc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 3611 S form <400> 2 gctcgacgtt ggcgatactc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 4546 O form <400> 3 ctcgcacgtt gccgaacttc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 4546 S form <400> 4 ctcgcacgtt gccgaacttc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 5419 O form <400> 5 aaggtatcgg tacgttcgcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 5419 S form <400> 6 aaggtatcgg tacgttcgcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 5441 O form <400> 7 agccagtcga agcgttcggc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BD-ODN 5441 S form <400> 8 agccagtcga agcgttcggc 20 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer for IL-8 promoter <400> 9 gtgagatctg aagtgtgatg actcagg 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for IL-8 promoter <400> 10 gtgaagcttg aagcttgtgt gctctgc 27  

Claims (8)

Immune response enhancers (adjuvant) or CpG oligodeoxynucleotide for the treatment of immune diseases represented by the following formula (1) or (2). Formula 1 SYYSSACGTTGSCGAWMYTC Formula 2 AXSSWXTCGXWXCGTTCGSC Wherein S is G or C, Y is C or T, W is A or T, M is A or C, and X is A or G. The CpG oligodeoxynucleotide of claim 1 selected from the group consisting of SEQ ID NOs: 1-8. The CpG oligodeoxynucleotide of claim 1 selected from the group consisting of SEQ ID NOs: 5, 6, 7, and 8. 8. A pharmaceutical composition for treating or preventing skin immune diseases comprising the oligodeoxynucleotide of claim 1. The composition of claim 4 further comprising at least one immune adjuvant selected from the group consisting of INF-γ, IL-12, Cyclosporine, FK506 (Tacrolimus) and TP-5 (Thymopoietin pentapeptide, thymopentin) Phosphorus composition. The composition according to claim 4 or 5, wherein the skin immune disease is a disease caused by an abnormality in the balance of the Th1 / Th2 immune response. The composition of claim 6 wherein the disease is atopic dermatitis, allergy, viral skin disease or skin cancer. A method of treating or preventing skin immune diseases by administering the composition of claim 4 or 5 to a subject.

Images