KR20020087453A - Treatment of Non-Solid Mammalian Tumors with Vascular Endothelial Growth Factor Receptor Antagonists - Google Patents

Abstract

Non-faithful tumor cells stimulated by ligands of vascular endothelial growth factor receptors in humans, comprising the step of administering an effective amount of a VEGFR antagonist to a human whose growth is stimulated by ligands of vascular endothelial growth factor receptors. Disclosed is a method of inhibiting growth.

Description

Treatment of Non-Solid Mammalian Tumors with Vascular Endothelial Growth Factor Receptor Antagonists Using Mammalian Endothelial Growth Factor Receptor Antagonists

Cancer is the second leading cause of death after death in the United States. Significant progress has been made in the development of new therapies in the treatment of these fatal diseases. This progress is usually based on a better understanding of cell proliferation in both normal and cancerous cells.

Normal cells proliferate by highly controlling the activation of these growth factor receptors through their respective ligands. An example of such a receptor is growth factor receptor tyrosine kinase.

Cancer cells also proliferate through activation of growth factor receptors, but have lost careful control for normal proliferation. This loss of control may be caused by a number of factors, such as overexpression of growth factors and / or receptors and the automatic activation of biochemical pathways regulated by growth factors.

Some examples of receptors involved in tumorigenesis include vascular endothelial growth factor receptor (VEGFR), platelet derived growth factor receptor (PDGFR), insulin-like growth factor receptor (IGFR), nerve growth factor receptor (NGFR) and fibroblast growth factor receptor (FGF) and the like.

During embryonic development, hematopoietic cells and early endothelial cells (angioblasts) originate from common precursor cells known as hemangioblasts. Because of their common origin, hematopoietic and vascular cells share several signaling pathways. One such pathway is the VEGFR signaling pathway. VEGF receptor (VEGFR) is FLT-1, sequenced in Shibuya M. et al., Onco gene 5, 519-524 (1990) (VEGFR-1), PCT / filed Feb. 20, 1992 US 92/01300 and Terman et al., Onco gene. 6: 1677-1683 (1991), and in Matthew W. et al., Proc. Natl. Acad. Sci. USA, 88: 9026-9030 (1991), FLK-1 (KDR and FLK-1 collectively referred to as VEGFR-2).

Unless otherwise stated or otherwise clearly inferred in context, the specification will be in accordance with the conventional document nomenclature for VEGF receptors. KDR refers to the human form of VEGFR-2. FLK-1 refers to the murine homologue of VEGFR-2. FLT-1 is different from, but related to, the KDR / FLK-1 receptor.

VEGFR binds to several soluble factors, including vascular endothelial growth factor (VEGF), which exerts proliferative and migration effects on the endothelium. VEGFR-2 was considered to be expressed only by endothelial cells. However, it has recently been found that VEGFR-2 is present on a subset of pluripotent hematopoietic stem cells (1). Several studies have shown that certain leukemia cells also express VEGFR-2 (2).

The two primary signaling tyrosine kinase receptors that mediate the various biological effects of VEGF are VEGFR-2 and VEGFR-1. Although the binding affinity of VEGFR-1 to VEGF is very high, with a Kd value of 10 to 70 pM (5), most studies suggest that VEGFR-2 is an important receptor for cell signaling for endothelial cell proliferation and differentiation. It turned out (6). VEGFR-1 appears to be more important for the remodeling of blood vessels. The relative importance of VEGF receptors on the regulation of angiogenesis and angiogenesis was known in studies that destroyed the VEGFR-2 and VEGFR-1 genes through homologous recombination in hepatocytes of murine embryos. Mice deficient in VEGFR-2 have very high deficiencies in angiogenesis, angiogenesis and hematopoiesis (7). In contrast, VEGFR-1 knockout mice generate abnormal vascular channels, suggesting that the receptors play a role in the regulation of endothelial cell-cell interactions or cell-matrix interactions (8).

Inhibition of angiogenesis through disruption of VEGFR-2 signaling inhibits growth and metastasis of solid tumors. For example, neutralizing monoclonal antibodies against murine VEGFR-2 (MoAb) inhibited tumor growth and metastasis in murine models (9, 10). In addition, glioblastoma growth was inhibited in dominant-negative mice against VEGFR-2 (11). This inhibition on tumor growth is attributed to the inhibition of angiogenesis, which effectively limits the blood supply to the tumor.

Leukemia cells originate from hematopoietic stem cells that differ in their maturation and differentiation stages. Acute leukemia cells originate from immature hematopoietic stem cells with self-renewal, but it is now well known that certain less invasive leukemia cells, such as chronic leukemia cells, etc., originate from more mature hematopoietic progenitor cells.

In any event, leukemia cells do not need an independent blood supply. Therefore, leukemia cells and other non-faithful tumors are not sensitive to the prior art therapies described above.

Several studies have shown that VEGF is almost invariably expressed by all established leukemia cell lines as well as by newly isolated human leukemia cells, such as the well-studied HL-60 leukemia cell line (2, 3). Several studies using RT-PCR have shown that VEGFR-2 and VEGFR-1 are expressed only by certain human leukemia cells (2, 3). However, none of these studies revealed whether expression of VEGF was associated with any parallel surface expression or functional response of VEGFR-2 / VEGFR-1.

Current cancer therapies typically include chemotherapy or radiation therapy. However, these therapies are not always effective and are not particularly effective when used over a long period of time.

Therefore, new methods for treating non-faithful tumors are needed. It is an object of the present invention to provide such a method.

Summary of the Invention

Several objects that will be apparent to those skilled in the art have been achieved by a method of inhibiting unfaithful tumor growth stimulated by a ligand of VEGFR in a mammal. The method includes treating the mammal with an effective amount of a VEGFR antagonist.

In other embodiments, the methods of the present invention comprise treating a human patient in combination with an effective amount of a VEGFR antagonist and a chemotherapeutic agent.

In other embodiments, the methods of the present invention comprise treating a human patient in combination with an effective amount of a VEGFR antagonist and irradiation.

1 . Human green species expresses FLT-1 / VEGFR-1 and KDR / VEGFR-2. Sections from human green species were stained using immunohistochemistry as described below. A. Control IgG showing little nonspecific staining (magnification: 400 ×); B. Factor VIII staining showing specific vascular staining (magnification: 100 ×); C. KDR / VEGFR-2 staining on leukemia cell compartment (magnification: 400 ×); D. FLT1 / VEGFR-1 expression also detected on a subset of leukemia cells (magnification: 400 ×); E and F. VEGF expression (magnification: 400 ×) showing specific leukemia cells (E) and perivascular (white arrows, F) staining as positive controls. These results are representative of experiments on four different samples.

2A . VEGFR-2 expression by leukemia cell line. Cell lines HL-60 and HEL (and five primary leukemia cells) expressed KDR / VEGFR-2 as detected by RT-PCR. K562 cells were KDR negative. β-actin was used as an internal control.

Figure 2B. VEGF ₁₆₅ induced dose-dependent induction of VEGFR-2 phosphorylation in VEGFR-2 positive leukemia cell lines. Whole cell lysates of HL-60 and HEL cells were immunoprecipitated by anti-phosphotyrosine antibodies, as described in the following method, and subsequently to VEGFR-1 (FLT-1) or VEGFR-2 (KDR). Analysis was by Western blotting using an antibody against. Fibroblasts were used as negative controls and showed no signs of VEGFR-1 or VEGFR-2 phosphorylation. The results shown represent three separate experiments.

3 . VEGF ₁₆₅ induced proliferation of leukemia cell subsets, and this effect is mediated through KDR / VEGFR-2. VEGF ₁₆₅ significantly increased the proliferation of all KDR / VEGFR-2 + leukemia cells (representing two cell lines and two primary leukemia cells) (*, p <0.003). This effect can be blocked by neutralizing MoAbs against KDR / VEGFR-2 as described in the methods below (**, p <0.04). The results shown represent three separate experiments.

4 . Tyrosine kinase inhibitors with high affinity for KDR / VEGFR-2 block VEGF ₁₆₅ -induced leukemia cell proliferation. The tyrosine kinase inhibitor AG1433 significantly blocks leukemia cell proliferation (*, p <0.05), confirming that the mitotic promoting effect of VEGF ₁₆₅ on leukemia cells is primarily mediated through KDR / VEGFR-2. This result is representative of two separate experiments.

5 . VEGF ₁₆₅ induces MMP secretion by leukemia cells. A. Zymography analysis of leukemia cell supernatants with or without VEGF ₁₆₅ stimulation for 24 hours; B. Quantification of Gelatin Fusion Activity Detected in Culture Supernatants. As detected via zymography, incubating leukemia cells with VEGF ₁₆₅ for 24 hours has a significant effect on the level of MMP release into the supernatant (p <0.05). These results represent three independent experiments.

6 . VEGF ₁₆₅ induced the migration of leukemia cells through a matrigel-coated transverse wall in a dose-dependent manner (50-200 ng / ml), which was performed by KDR / VEGFR-2 and FLT-1. Mediated via / VEGFR-1. In response to 200 ng / ml VEGF ₁₆₅ , the migration of HL-60 cells and four primary leukemia cells through the matrigel coated transverse wall was shown. This process requires MMP activity, as shown through the effects of synthetic MMPi. MoAbs against KDR / VEGFR-2 partially blocked the migration of leukemia cells, but incubating the cells with both FLT-1 / VEGFR-1 and KDR / VEGFR-2 MoAbs alone resulted in either of these antibodies alone. It was more effective than when used (**, p <0.05). These results represent three independent experiments.

7 . VEGF ₁₆₅ -induced migration of HL-60 cells is blocked by AG1433. The synthetic protein kinase inhibitor AG1433 (used at 10 μΜ) blocked the migration of VEGF ₁₆₅ -induced HL-60 cells (*, p <0.04). These results represent two different experiments, with three trials of each condition.

8 . A. HL-60 injection into NOD-SCID mice induced high levels of human VEGF in mouse plasma, but not murine VEGF. Mice were injected with 1 × 10 ⁶ HL-60 cells (iv) and plasma levels of human (A) and murine VEGF (B) were measured by ELISA at different time points after injection. The results shown represent two separate experiments; B. Mouse survival rate (%) after HL-60 injection (iv). Mice were injected with 1 × 10 ⁶ cells and three days after injection of leukemia cells, 400 μg (n = 5) or PBS / BSA (n = 8) of IMC-1C11 (neutralized MoAb against human VEGFR-2 / KDR). Ip treatment three times a week. One mouse was sacrificed to perform histological analysis. The results shown represent two separate experiments.

9 . Histology of liver (A, B) and spleen (C, D) in mice injected with HL-60. Untreated (control) mice had an increase in metastatic disease in the liver (white and red arrows, B) and spleen (D). In contrast, mice treated with IMC-1C11 showed no increase in the presence of leukemia cells in liver (A) and spleen, with evidence of apoptosis (blue arrow, C) but histological results were normal.

10 . For VEGFR-2 positive leukemia cells, VEGF can support the growth of leukemia cells through lateral secretion (increases the mass of bone marrow endothelial cells) and auto-secretion (directly stimulates proliferation of leukemia cells) mechanisms. Antibodies to human VEGFR-2 (arrows) can block the autosecretory loop induced by leukemia derived human VEGF.

11 . Nucleotide and Amino Acid Sequences of p1C11.

The present invention provides an improved method of treating unfaithful tumors, in particular unfaithful malignancies, in human patients.

Unfaithful Tumor Cells

Non-faithful tumor cells include tumors that affect hematopoietic structures, including immune system components. Some examples of non-faithful tumors include leukemia cells, multiple myeloma and lymphoma. Such tumor cells typically appear in the bone marrow and peripheral circulation.

The type of non-faithful tumor that can be treated according to the invention is any non-faith tumor stimulated by a ligand of VEGFR. Examples of VEGFR receptor families include VEGFR-2, (KDR, flk-1) and VEGFR-1 (flt-1). Some examples of ligands that stimulate VEGFR include VEGF.

Some examples of non-faithful tumors include leukemia, multiple myeloma and lymphoma. Some examples of leukemia cells include acute myeloid leukemia cells (AML), chronic myeloid leukemia cells (CML), acute lymphocytic leukemia cells (ALL), chronic lymphocytic leukemia cells (CLL), erythroblastic leukemia cells, or monocytic leukemia. Cells and the like. Some examples of lymphomas include Hodgkin's disease and Lymphoma associated with Non-Hodgkin's disease.

Unfaithful tumors may express VEGFR at normal levels or overexpress VEGFR to levels above 10, 100 or 1000 times normal levels.

VEGFR antagonist

Non-faithful tumors of the invention are treated with VEGFR antagonists. For the purposes herein, VEGFR antagonists are any molecule that inhibits the stimulation of VEGFR by VEGFR ligands. Inhibition of such stimulation inhibits the growth of cells expressing VEGFR.

The present invention does not conform to any specific suppression mechanism. Nevertheless, VEGFR tyrosine kinases are typically activated by phosphorylation events. Therefore, the antagonists of the present invention typically inhibit the phosphorylation of VEGFR. Therefore, phosphorylation assays are useful for predicting antagonists useful in the present invention.

Sufficiently inhibiting growth of non-faithful tumors in a patient prevents or reduces cancer progression (ie, growth, invasion, metastasis and / or recurrence of non-faithful tumors). VEGFR antagonists of the present invention have cell arrest activity, ie, inhibit the growth of non-faithful tumors. Preferably, the ERGR antagonist destroys cell fusion, ie tumors.

VEGFR antagonists include biological molecules or small molecules. Biological molecules include polymers of all lipids and monosaccharides, amino acids and nucleotides having a molecular weight greater than 450. Thus, examples of biological molecules include oligosaccharides and polysaccharides, oligopeptides, polypeptides, peptides and proteins and oligonucleotides and polynucleotides. Examples of oligonucleotides and polynucleotides include DNA and RNA.

Additional biological molecules include any derivative of the molecules described above. Examples of derivatives of biological molecules include glycosylated derivatives of lipids and oligopeptides, polypeptides, peptides and proteins. Further derivatives of biological molecules include oligosaccharides and derivatives of polysaccharides such as lipid polysaccharides and the like.

The most typical biological molecule is the antibody or functional equivalent of the antibody. Functional equivalents of antibodies have binding properties comparable to binding of antibodies and inhibit the growth of cells expressing VEGFR. Examples of such functional equivalents include chimeric antibodies, humanized antibodies and single chain antibodies and fragments thereof.

The functional equivalent of the antibody is preferably a chimeric or humanized antibody. Chimeric antibodies include the variable regions of non-human antibodies and the constant regions of human antibodies. Humanized antibodies include hypervariable regions (CDRs) of non-human antibodies. In humanized antibodies, variable regions other than hypervariable regions, such as framework variable regions and constant regions, are regions of human antibodies.

Suitable variable and hypervariable regions of non-human antibodies for applying the present invention can be derived from antibodies produced by any non-human mammal that produces monoclonal antibodies. Suitable examples of non-human mammals include rabbits, rats, mice, horses, goats or primates. Mice are preferred.

Functional equivalents further include fragments of the antibody that have binding properties that are the same or comparable to those of the intact antibody. Suitable fragments of the antibody include any fragment comprising a sufficient portion of the hypervariable (ie, complementarity determining) region to specifically bind VEGFR with sufficient affinity, thereby inhibiting the growth of cells expressing VEGFR.

Such fragments may contain, for example, one or both of Fab fragments or F (ab ') ₂ fragments. Although it is preferred that the antibody fragment contains all six complementarity determining regions of an intact antibody, functional fragments containing less than all six such regions, such as three, four or five CDRs, are also included.

Preferred fragments are single chain antibodies or Fv fragments. Single chain antibodies are polypeptides comprising at least one heavy chain variable region of an antibody linked to the variable region of a light chain, with or without an interconnect linker. Therefore, the Fv fragment includes the entire antibody binding site. The chain can be produced in bacteria or eukaryotic cells.

Antibodies and functional equivalents can be members of any class and subclasses of immunoglobulins such as IgG, IgM, IgA, IgD, or IgE. Preferred antibodies are members of the IgG1 subclass. In addition, the functional equivalent may be an equivalent of any combination of the above classes and subclasses.

Antibodies can be prepared from desired receptors by methods known in the art. Receptors are either commercially available or can be isolated by known methods. For example, methods for isolating and purifying KDRs are known from PCT / US92 / 01300. Methods for isolation and purification of flk-1 are described in Proc. Natl. Sci. 88: 9026-30 (1991). Methods for isolation and purification of flt-1 are described in Onco Gene 5: 519-24.

Methods for preparing monoclonal antibodies are described by Kohler and Milstein (Nature 256, 495-497 (1975)) and Campbell, "Monoclonal Antibody Technology, The Production and Characterization of Rodent and Human Hybridomas "in Burdon et al., Eds, Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13, Elsevier Science Publishers, Amsterdam (1985). Also suitable are recombinant DNA methods as described in Huse et al., Science 246, 1275-1281 (1989).

In short, to prepare monoclonal antibodies, the host mammal is inoculated with a receptor or receptor fragment as described above and optionally boosted. Receptor fragments are useful only if they contain enough amino acid residues to define the epitope of the molecule to be detected. If the fragment is too short to show immunogenicity, the fragment can be conjugated to a transport molecule. Some suitable transport molecules include keyhole limpet hemocyanin and bovine serum albumin. Conjugation can be carried out by methods known in the art. One such method is to join the cysteine residue of the fragment with the cysteine residue of the transport molecule.

Spleens are collected from inoculated mammals a few days after the final boost. Cell suspension from the spleen is fused with tumor cells. Thus produced, hybridoma cells expressing antibodies are isolated and grown and maintained in culture.

Antibodies, which are essentially human antibodies, can be prepared in transgenic mammals, in particular transgenic mice genetically modified to express human antibodies. Methods of making chimeric and humanized antibodies are also known in the art. For example, methods for producing chimeric antibodies include those described in US patents of Boss, Celltech, and Cabilly, Genetech. See US Patent Nos. 4,816,397 and 4,816,567, respectively. Methods of making humanized antibodies are described in Winter et al., US Pat. No. 5,225,539.

Preferred methods for humanizing antibodies are called CDR-grafts. In CDR-transplantation, a complementary determining region or CDR, which is a region directly involved in binding to an antigen in a mouse antibody, is implanted into a human variable region to generate a "reconstituted human" variable region. This fully humanized variable region is then linked to a human constant region to produce an “fully humanized” antibody.

It is advantageous to carefully design reconstituted human variable regions to produce fully humanized antibodies that bind well to antigens. Careful selection of the human variable region to be implanted with the CDRs is required, and it is usually necessary to change several amino acids at important positions within the framework region (FR) of the human variable region.

For example, the reconstituted human variable region may comprise up to 10 amino acid changes in the FR of the selected human light chain variable region and may comprise about 12 amino acid changes in the FR of the selected human heavy chain variable region. The DNA sequences encoding such reconstituted human heavy and light chain variable region genes are linked with the DNA sequences encoding human heavy and light chain constant region genes, preferably γ1 and κ, respectively. The reconstituted humanized antibody is then expressed in mammalian cells and its affinity to the target is compared with that of the corresponding murine and chimeric antibodies.

Methods of selecting residues of humanized antibodies to be substituted and methods of preparing substituents are well known in the art. See, eg, Co et al., Nature 351, 501-502 (1992); Queen et al., Proc. Natl. Acad. Sci. 86, 10029-1003 (1989) and Rodrigues et al., Int. J. Cancer, Supplement 7, 45-50 (1992). Methods for humanization and reconstitution of 225 anti-EGFR monoclonal antibodies are described in PCT application WO 96/40210 to Goldstein et al. Such methods can be used to humanize and reconstitute antibodies against other growth factor receptor tyrosine kinases.

In addition, methods for preparing single chain antibodies are also known in the art. Some suitable examples are described in European Patent Application No. 502 812 to Wels et al. And Int. J. Cancer 60, 137-144 (1995) and the like. Single chain antibodies can also be prepared by screening phage display libraries. See below.

Other methods of making the functional equivalents described above are described in PCT Application WO 93/21319, European Patent Application No. 239 400, PCT Application WO 89/09622, European Patent Application No. 338 745, US Patent No. 5,658,570, US Patent No. 5,693,780 and European patent application EP 332 424.

Preferred VEGFR antibodies are chimeric, humanized and single chain antibodies in which the amino acid and nucleotide sequences of the heavy and light chain hypervariable regions are derived from murine antibodies as shown below. Chimeric antibodies and single chain antibodies can be prepared according to standard methods such as those described below. Humanized antibodies can be prepared according to the methods described in Example IV of the PCT application WO 96/40210, which is incorporated herein by reference.

The sequences of the hypervariable (CDR) regions of the light and heavy chains are shown below. The nucleotide sequence is shown below the amino acid sequence.

The entire light and heavy chain sequence is shown below. The nucleotide sequence is shown below the amino acid sequence.

Other examples of biological molecules useful as antagonists include soluble receptors and the like [Exp. Cell Res. 241: 1, 161-170; Proc. Natl. Acad. Sci. 92:23, 10457-61.

In addition, the antagonists useful in the present invention may be small molecules as well as the biological molecules discussed above. Any molecule that is not a biological molecule is considered herein as a small molecule. Some examples of small molecules include organic compounds, organometallic compounds, salts of organic and organometallic compounds, sugars, amino acids and nucleotides, and the like. Small molecules also include molecules that can be considered as biological molecules, except that the molecular weight does not exceed 450. Therefore, small molecules may be lipids, oligosaccharides, oligopeptides and oligonucleotides and derivatives thereof having a molecular weight of 450 or less.

It is emphasized that small molecules can have any molecular weight. These are typically called small molecules because their molecular weight is less than 450. Small molecules include synthetic compounds as well as compounds found in nature. It is desirable for small molecules to inhibit the growth of non-faithful tumor cells expressing VEGFR tyrosine kinase.

Some examples of small molecules useful as VEFGR molecules are described in Hennequin et al. in J. Med. Chem. 42, 5369-5389 (1999), quinazoline, quinoline and cynoline, and the like. See also Annie et al., Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 17, A41 (1998).

VEGFR Antagonist Administration

The present invention includes administering an effective amount of a VEGFR antagonist to a human patient. VEGFR antagonist administration can be accomplished in a variety of ways, including systemic administration by parenteral and enteral routes. For example, the VEGFR antagonist of the present invention can be easily administered intravenously (eg, intravenous injection), which is the preferred route of delivery. Intravenous administration can be accomplished by contacting the VEGFR antagonist with a suitable pharmaceutical carrier (vehicle) or excipient, as will be appreciated by those skilled in the art.

VEGFR antagonists of the present invention significantly inhibit the growth of non-faithful tumors when administered to patients in an effective amount. As used herein, an effective amount is an amount effective to achieve the result that the growth of an unfaithful tumor is inhibited.

The optimal dosage of a VEGFR antagonist can be determined by the attending physician based on a number of parameters including, for example, age, sex, weight, the severity of the condition to be treated, the antagonist to be administered and the route of administration. Typically, the serum concentration of the antagonist is preferably a concentration that allows saturation of the target receptor. For polypeptides and antibodies, concentrations above, for example, about 0.1 nM are usually sufficient. For example, an antibody dose of 100 mg / m ² provides a serum concentration of about 20 nM for about 8 days.

In general, dosages of the antibody may be provided in an amount of 10 to 300 mg / m ² each week. The same dose of antibody fragments should be used at more frequent intervals to maintain serum levels above concentrations that allow for saturation of the receptor.

Combination therapy

In a preferred embodiment, the non-faithful tumor can be treated with a combination of an effective amount of a VEGFR antagonist and a chemotherapeutic agent as described above, radiation therapy or a combination thereof.

Examples of chemotherapeutic agents include alkylating agents such as nitrogen mustards, ethyleneimine compounds and alkyl sulfonates; Antimetabolites such as folic acid, purine or pyrimidine antagonists; Mitosis inhibitors, such as vinca alkaloids and derivatives of podophyllotoxin; Cytotoxic antibiotics; And compounds that impair or disrupt DNA expression.

Specific examples of chemotherapeutic agents or chemotherapy include cisplatin, dacarbazine (DTIC), dactinomycin, mechloretamine (nitrogen mustard), streptozosin, cyclophosphamide, carmustine (BCNU), romustine (CCNU ), Doxorubicin (Adriamycin), daunorubicin, procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel (taxol), docetaxel (Taxotere), aldesrukin, asparaginase, busulfan, carboplatin, cladribine, dacarbazine, phloxuridine, fludarabine, hydroxyurea, ifosfamide, interferon alpha, leuprolide, Megestrol, melparan, mercaptopurine, plicamycin, mitotan, pegaspargase, pentostatin, fifobroman, plicamycin, streptozosin, tamoxifen, teniposide, testosterone, thiogua And the like, thiotepa, uracil mustard, vinorelbine, chlorambucil, taxol and combinations thereof.

As described above, administration of chemotherapeutic agents can be accomplished in a variety of ways, including systemic administration by parenteral and enteral routes.

In other embodiments, non-faithful tumors can be treated by using an effective amount of a VEGFR antagonist in combination with radiation therapy. The source of irradiation may be external or internal to the patient to be treated. Treatment when the source is outside of the patient is known as external beam radiation therapy (EBRT). Treatment when the source of irradiation is inside the patient is called brachytherapy (BT).

Radiation is administered according to known standard techniques using standard devices made for this purpose, such as AECL Theratron and Varian Clinac. The radiation dose depends on several factors as are well known in the art. These factors include the organ to be treated, a healthy organ in the radiation pathway that can be accidentally adversely affected, the patient's acceptance of radiation therapy, and the area of the body in need of treatment. The dosage is usually 1 to 100 Gy, more particularly 2 to 80 Gy. Some of the reported doses are, for example, 35 Gy for the spinal cord, 15 Gy for the kidneys, 20 Gy for the liver and 65 to 80 Gy for the prostate. However, it should be emphasized that the present invention is not limited to any particular dosage. Dosages, including the factors mentioned above, will be determined by the treating physician according to the particular factors given the circumstances.

The distance between the source of external radiation and the entry point to the patient can be any distance that represents an acceptable balance between the death of the subject cell and the minimization of side effects. Typically, the source of external radiation is at a distance of 70-100 cm from the entry point into the patient.

Brachytherapy is typically performed by placing a source of radiation within the patient. Typically, the source of irradiation is located about 0 to 3 cm from the tissue to be treated. Known techniques include interstitial brachytherapy, intercavitary brachytherapy and surface brachytherapy. Radioactive seeds may be implanted permanently or temporarily. Some typical radioactive atoms that have been used in permanent implants include iodine 125 and radon. Some typical radioactive atoms that have been used in transient implants include radium, cesium-137, and iridium-192. Some additional radioactive atoms that have been used in brachytherapy include Americium-241 and Gold-198.

The radiation dose in brachytherapy may be the same as the radiation dose in external radiation therapy mentioned above. To determine the dosage of brachytherapy, consider the characteristics of the radioactive atoms as well as the factors mentioned above in relation to the dosage determination of external radiation therapy.

In a preferred embodiment, the non-faithful tumors of human patients have a synergistic effect when treated in combination with VEGFR antagonists and chemotherapeutic agents, irradiation or a combination thereof. In other words, inhibition of tumor growth by VEGFR antagonists is enhanced when chemotherapy or radiation is used or in combination thereof. For example, non-faithful tumor growth can be synergistic, with much more inhibition when treated in combination with them than would be expected with treatment with VEGFR antagonists, chemotherapeutic agents or radiation alone. Preferably, the synergistic effect is evidenced by the alleviation of cancer, which is not expected when the VEGFR antagonist, chemotherapeutic agent or radiation alone is treated.

VEGFR antagonists are administered not only before, during, or after the initiation of chemotherapeutic or radiation therapy, but also in any combination thereof, ie, prior to the onset of chemotherapy and / or radiation therapy, and During initiation, before initiation and after initiation, or before initiation, during initiation and after initiation. For example, if the VEGFR antagonist is an antibody, the VEGFR antagonist is typically 1 to 30 days, preferably 3 to 20 days, more preferably 5 prior to initiation of radiation therapy and / or administration of the chemotherapeutic agent. To 12 days.

The following examples demonstrate that certain subsets of leukemia cells not only produce VEGF but also express autologous VEGFR-2 in vivo and in vitro, resulting in an autosecretory loop that enhances leukemia cell proliferation and migration. About 50% of newly isolated acute myeloid leukemia (AML) was investigated to express mRNA and protein for VEGFR-2. VEGF ₁₆₅ induced phosphorylation of VEGFR-2 and increased the proliferation of leukemia cells. VEGF ₁₆₅ also induced the expression of metalloproteinase-9 (MMP-9) by leukemia cells and promoted their migration through the reconstituted basement membrane.

Neutralizing specific inhibitors of neutralizing MoAb and VEGFR-2 against VEGFR-2 blocked VEGF ₁₆₅ -mediated proliferation and VEGF-induced leukemia cell migration of leukemia cells. Xenograft of human leukemia cells to immunocompromised NOD-SCID mice significantly increased human VEGF in plasma but not murine VEGF, and inoculated mice died within two weeks. Injection of human specific neutralizing monoclonal antibodies that selectively block signaling through human VEGFR-2 inhibited the proliferation of xenografted human leukemia cells and increased mouse survival over the duration of the experiment.

Unless otherwise stated, all chemicals and reagents were purchased from Sigma.

Example I. Inhibition of VEGFR

Collection of Primary AML Samples and Isolation of monocytes by Ficoll Gradient

Peripheral blood samples from leukemia patients (patients diagnosed with acute leukemia) are collected by phlebotomy, diluted 1/2 in Hank's buffered saline (Gibco BRL) and Lymphoprep (Accurate Chemical and Scientific) Corporation, Picol, NY). Each sample was spun for 30 minutes at 4,000 rpm to collect the monocyte interface into a new tube and washed twice with Hank brine for 5 minutes at 2,500 rpm. Finally, the resulting cell pellet was resuspended in RPMI / 10% FCS.

Cell culture

The three AML cell lines used in this study, HL-60 (pro-osteoblasts), HEL (macronuclear cells) and K562 (red blood cells), 10% FCS, penicillin (100 U / mL), streptomycin (100 Cultured in RPMI containing μg / mL) and fungizone (0.25 μg / mL). Cells were placed in RPMI alone for 16 hours to overnight to deplete serum and then incubated with VEGF and / or antibody / protein kinase inhibitors.

After collecting and isolating monocytes from peripheral blood, primary leukemia cells were incubated overnight in RPMI / 10% FCS to prevent possible contamination by monocytes / macrophages that readily adhered to tissue culture flasks. The cells present in the suspension consist mainly of blast cells of leukemia cells. These leukemia cells were then transferred to other flasks and serum depleted for 16 hours to overnight in serum-free RPMI as above, followed by the addition of VEGF and / or anti-VEGFR antibodies.

In the proliferation experiment, cells were incubated at a cell density of 1 × 10 ⁵ cells / well in serum-free RPMI in 6 well plates (Corning). Cells were treated (10-50 ng / mL VEGF) or untreated (medium alone) and immunoneutralized MoAb against KDR / VEGFR-2, IMC-1C11 (12) or MoAb, clone against FLT 1 / VEGFR-1 6.12 (both purchased from ImClone Systems Incorporated) was incubated in the presence or absence of 500 ng to 1 μg / mL. To determine whether the mitogenic effects of VEGF on leukemia cell lines were mediated through VEGFR-2, a kinase inhibitor (AG1433, IC ₅₀ : 9.3 μM, Calbiochem, La), a synthetic protein with high affinity for VEGFR-2 Jolla, CA) was used at a concentration of 10 μM as recommended by the manufacturer. After 24, 48 and 96 hours, hemocytometer was used to count living cells (as determined by trypan blue exclusion) three times. Each experimental condition was performed three times, and the experiment using the leukemia cell line was repeated three times.

RNA extraction, cDNA synthesis and RT-PCR

Total RNA was extracted using TRI-reagent according to the manufacturer's instructions. Subsequently, cDNA was synthesized from total RNA using a ready-to-use kit (Amersham Pharmacia Biotech, Piscataway, NJ), and PCR was performed using a PCR heating cycler (MWG Biotech, High Point, Carolina, USA). Was performed. The PCR program used to amplify KDR, FLT-1 and β-actin consisted of a pre-cycle of 5 minutes at 94 ° C, 45 seconds at 60 ° C, and 45 seconds at 72 ° C. After this initial cycle, the reaction was continued for 35 cycles of 1 minute at 94 ° C., 45 seconds at 65 ° C., and 2 minutes at 72 ° C., and ended at 7 ° C. at 72 ° C. Primer sequences are as follows: β-actin forward primer: tcatgtttgagaccttcaa (SEQ ID NO: 17); β-actin reverse primer: gtctttgcggatgtccacg (SEQ ID NO: 18) (β-actin PCR product: 513 bp); VEGFR-2 forward primer: gtgaccaacatggagtcgtg (SEQ ID NO: 19); VEGFR-2 reverse primer: ccagagattccatgccactt (SEQ ID NO: 20) (VEGFR-2 PCR product: 660 bp); VEGFR-1 forward primer: atttgtgattttggccttgc (SEQ ID NO: 21); VEGFR-1 reverse primer: caggctcatgaacttgaaagc (SEQ ID NO: 22) (VEGFR-1 PCR product: 550 bp). Endothelial cell cDNA was used as a positive control for all three sets of primers.

Protein Extraction and Western Blotting

Phosphorylated VEGF receptors (VEGFR-1 and VEGFR-2) were cell incubated with 20 ng / ml of VEGF ₁₆₅ (R & D Systems, Minnesota, USA) for 10 minutes at 37 ° C. and then detected by western blotting. After this short stimulation, cooling RIPA buffer (in the presence of protease inhibitors (1 mg / mL aprotinine, 10 mg / mL lufetin, 1 mM β-glycerophosphate, 1 mM sodium orthovanadate and 1 mM PMSF) ( The cells were lysed in 50 mM Tris, 5 mM EDTA, 1% Triton X-114, 0.4% Sodium Cacodylate and 150 mM NaCl) to obtain total protein extracts from primary leukemia cells and cell lines. Embryonic fibroblasts (MRC5 cell line) were used as negative controls. Cell debris was removed by centrifugation, and then the supernatant (total protein content was at least 500 ng) was added to 4 ° C using protein-G agarose beads and anti-phosphotyrosine antibody (Santa Cruz Biotechnology, CA, USA). Phosphorylated protein was precipitated by immunoprecipitation overnight at. It was resuspended in loading buffer and subjected to SDS Page-acrylamide gel electrophoresis (gel 7.5%) under reducing conditions (in the presence of β-mercaptoethanol). The proteins were then blotted onto nitrocellulose membranes according to conventional protocols. Finally, the blots were blocked in 1% BSA / PBS-1% Tween-20 for 1 hour at room temperature (RT) and then incubated with the primary and secondary antibodies. Rabbit polyclonal anti-VEGFR-2 (Santa Cruz Biotechnology, California, USA) and goat monoclonal anti-VEGFR-1 (R & D Systems, Minn., USA) antibodies are used at a concentration of 1 μg / ml, Secondary anti-rabbit IgG-HRP (for VEGFR-2) or anti-goat IgG-HRP (for VEGFR-1) was used at a ratio of 1: 6,000. An ECL chemiluminescence detection system and an ECL film (Amersham Pharmacia biotech, Piscataway, NJ) were used to visualize the presence of proteins on nitrocellulose blots.

Gelatin Fusion Zymography

Incubate overnight in serum-free medium with or without VEGF ₁₆₅ and then collect supernatants from leukemia cell lines and primary cultures of cells, as described above (13), by gelatin fusion zymography Metalloproteinase activity was measured. In brief, the cell culture supernatant was treated with gelatin-agarose beads to concentrate the gelatinase and treated via SDS-Page-acrylamide gel containing 1% gelatin. The gel is then incubated in 2.5% Triton X-100 for 1 hour at room temperature, rinsed with distilled water (DW) and low concentration salt collagenase buffer (50 mM Tris-pH 7.6, 0.2 M NaCl, 5 for 18 hours at 37 ° C). mM CaCl ₂ and 0.2% v / v Brij-35). At room temperature, gels were stained for 30 to 60 minutes using 0.2% Coomassie Blue solution followed by 190 mL destaining (DW, methanol and crystalline acetic acid, 6: 3: 1) The band was visualized. In each experiment 1 × 10 ⁶ cells were plated into each well and the experiment was performed in triplicates. Gels were scanned using an Adobe Photoshop 4.0 software application and a Umax Astra scanner, and the intensity of the gelatin fusion bands was evaluated using NIH Image 1.58.

Mobile experiment

Freshly isolated leukemia cells and cell lines were resuspended in serum-free RPMI and 10 ⁶ cells / ml of stock were prepared. A new version of the transverse wall movement technique 14 mentioned above was used. In brief, LC aliquots (100 μl) were added to 8 μm pore cross-wall inserts coated with 25 μg of growth factor-deficient Matrigel (Beckton and Dickinson, Jos., CA) and added to wells of 24-well plates. Located. The lower portion contained serum-free RPMI with or without VEGF ₁₆₅ (R & D Systems, Minnesota, USA). To block migration, each condition was prepared in separate aliquots, IMC-1C11, anti-VEGFR-1 (clone 6.12) neutralizing MoAb 1 μg / mL, 10 μM AG1433 (Calbiochem, CA, USA) or a wide range Incubated with MMP inhibitor, 5,10-phenanthroline (1 μM). The antibodies and tyrosine kinase inhibitors used in this study have already been found to block VEGF-induced endothelial cell proliferation and receptor phosphorylation (12,15,16). Transfer was performed at 37 ° C. and 5% CO ₂ for 14-18 hours. The migrated cells were collected from the lower compartment and rotated at 8,000 rpm and counted using a hemocytometer. In this quantification only live cells are considered as measured via trypan blue exclusion. The experiment was performed in triplicates and the results are expressed as the number of cells migrated in response to VEGF.

Detection of KDR / VEGFR-2, FLT-1 / VEGFR-1 and VEGF on Potentially Transplanted Leukemia Cells (Green Carcinoma) by Immunohistochemistry

According to a conventional protocol, green species sections in paraffin were immunohistochemically stained for VEGFR-1 and VEGFR-2. The antibodies used were as follows: mouse MoAb against VEGFR-2, clone 6.64 (ImClone Systems Incorporated), used at 300 ng / ml; Rabbit polyclonal antibody to VEGFR-1 (R & D Systems), used at 200 ng / ml; vWF polyclonal antibody, used at 200 ng / ml; VEGF polyclonal antibody (BioGenex, Ab No. 360p), used at 200 ng / ml. Peroxidase-labeled secondary antibodies (antibodies to mouse and rabbit immunoglobulins) were used diluted to 1 / 6,000. Sections were counterstained with Hematoxilin / Eosin and observed through light microscopy.

In vivo experiments with HL-60 cells

In all experiments, non-obese diabetic immunocompromised mice (NOD-SCIDs) of matching age and gender were used. HL-60 cells (1 × 10 ⁶ / mouse) were injected intravenously (iv) into 10 NOD-SCID mice, and three days after injection, the mice were divided into two groups of five mice. One group was intraperitoneally treated with 400 μg of IMC-1C11 (12) three times per week, whereas the control group was injected with PBS / 1% BSA (diluted control for antibodies) throughout the experimental period.

Quantification of VEGF Levels in Mouse Plasma

VEGF concentrations were measured in the plasma of mice injected with HL-60 cells using each of two ELISA kits (both from R & D Systems) specific for human and murine VEGF. Plasma samples were collected at various time points after injection of leukemia cells and used without further dilution. Each sample was analyzed in triplicates and measured through two separate experiments. Both analyzes showed a sensitivity limit of 7.5 pg / ml and developed according to the manufacturer's instructions.

Human green species express VEGF, VEGFR-2 and VEGFR-1

Human leukemia may not only be located in the bone marrow and peripheral circulation, but also metastasize to tissue to form a solid mass called green species.

When immunohistochemically staining human green species using antibodies specific for VEGFR-1 or VEGFR-2, these receptors were shown to be expressed not only in the endothelial layer of blood vessels but also by a subset of leukemia cells (FIG. 1C). And 1D). Staining and positive cells located in the cell membrane appeared to be dispersed throughout the sections (FIGS. 1C and 1D). Overall, the analyzed sections had more VEGFR-2 positive regions than VEGFR-1 positive regions. These receptors were mainly detected in various regions of the tumor, suggesting that staining patterns of VEGFR-1 and VEGFR-2 can identify different cell populations. In addition, leukemia cells in the analyzed sections were also stained for VEGF (FIGS. 1E and 1F), suggesting that the autosecretory loop between VEGF and its receptors may contribute to the formation of green species.

Primary leukemia and leukemia cell lines produce VEGF and express VEGFR-2

Three leukemia cell lines and 10 primary acute leukemia samples (isolated from peripheral blood samples) were analyzed for production of VEGF and expression of VEGFR-2 by ELISA and RT-PCR.

Of the leukemia cell lines analyzed, HL-60 and HEL expressed VEGFR-2 at the mRNA level, while K562 cells were negative (FIG. 2A). RT-PCR analysis of primary leukemia samples showed that 5 out of 10 primary AML samples (50% total) expressed VEGFR-2. VEGFR-1 was also detected via RT-PCR in VEGFR-2-positive leukemia samples. In addition, all VEGFR-2 positive leukemia cell lines produced VEGF in vitro. Thus, the presence of functional receptors on leukemia cells that produce VEGF can form a self-secreting loop that supports cell growth and survival.

VEGF ₁₆₅ Induces VEGFR-1 and VEGFR-2 Phosphorylation on Leukemia Cells

VEGF ₁₆₅ induced dose-dependent increases in VEGFR-1 and VEGFR-2 phosphorylation in leukemia cell lines and primary leukemia cells, but not fibroblasts or VEGFR negative leukemia cells (FIG. 2B). In the absence of VEGF, leukemia cells showed baseline VEGFR-1 and VEGFR-2 phosphorylation (FIG. 2B), which may be due to the production of VEGF by these cells and the expression of their receptors.

The observation that VEGF ₁₆₅ induces phosphorylation of its receptor in a subset of leukemia cells suggested that it could also induce phenotypic changes on these cells. Thus, the effect of VEGF ₁₆₅ on leukemia cells was further investigated by observing changes in phenotype, such as increased proliferation, matrix-metalloproteinase (MMP) production and migration through the reconstituted basement membrane. Anti-VEGFR MoAb and specific protein kinase inhibitors (AG1433) were used to investigate whether VEGF ₁₆₅ induces its effect on leukemia cells via VEGFR-2.

VEGF Induces Leukemia Cell Proliferation, an Effect Mediated Through VEGFR-2

VEGF ₁₆₅ induced increased proliferation of VEGFR-2 positive leukemia cells and leukemia cell lines in a dose dependent manner (FIG. 3). This effect could be blocked by incubating the cells with IMC-1C11 used in an amount of 1 μg / ml (FIG. 3, *, p <0.05). Mitosis promoting effect of VEGF ₁₆₅ for the compound for leukemia cells is primarily mediated through VEGFR-2 receptors, since the neutralizing MoAb to VEGFR-1 does not affect the leukemia cell proliferation induced by VEGF _165. Importantly, leukemia cells that did not respond to VEGF ₁₆₅ , such as K562 cell lines and primary samples 6, 7, 8, 9 and 10 had no effect on VEGF-induced cell proliferation when incubated with IMC-1C11 ( 3).

Experiments with protein kinase inhibitor AG1433 confirmed that leukemia cell proliferation induced by VEGF ₁₆₅ is mediated primarily through VEGFR-2 (FIG. 4). AG1433 significantly blocked leukemia cell proliferation induced by EGF ₁₆₅ over 72 hours (**, p <0.05, FIG. 4). As incubation with neutralizing MoAb, incubation of K562 cells, VEGFR-2-negative leukemia cells or fibroblasts (not shown) and AG1433 with or without VEGF ₁₆₅ did not affect cell proliferation (FIG. 4).

These results show that VEGF ₁₆₅ induces cell proliferation against a subset of leukemia cell lines and primary leukemia cells. This effect can be blocked by MoAb for VEGFR-2 and synthetic protein kinase inhibitors with high affinity for VEGFR-2. As reported for endothelial cells, this suggests that VEGF ₁₆₅ delivers its mitogenic effect on leukemia cells via VEGFR-2.

VEGF Induces MMP Secretion / Production by Leukemia Cells

VEGF ₁₆₅ typically induces MMP production by smooth muscle cells, an effect associated with the acquisition of higher invasive phenotypes (17). Applicants investigated whether VEGF ₁₆₅ can induce similar effects on leukemia cells.

The level of MMP released into the supernatant by each sample under serum-free conditions varied (Figure 5). It was found that MMP production by leukemia cells could identify leukemia sub-types or sub-populations with a higher invasive phenotype. For the primary leukemia and / or cell line investigated, the osteoblast sub-types (shown in FIG. 5: HL-60 cells, Sample 2 and Sample 3) consistently showed higher levels of baseline MMP production and release. When MMP-producing leukemia cells were measured by densitometry while incubating with VEGF ₁₆₅ , MMP-9 secretion by leukemia cells was significantly increased over 18 hours (FIGS. 5A and 5B). For primary leukemia, MMP-9 is the major MMP released into the culture supernatant and MMP-2 was not present in most cases (FIG. 5). However, as measured through western blotting, the level of TIMP-1 produced by leukemia cells showed only a slight change after stimulation with VEGF ₁₆₅ .

VEGF induces effects mediated through VEGFR-1 and VEGFR-2, ie leukemia cell migration through Matrigel-coated transverse walls

Applicants investigated whether increased VEGF ₁₆₅ -induced MMP production by leukemia cells reflects the acquisition of a higher invasive phenotype. This was demonstrated using a transit system (intrusion model through the basement membrane) in which the transverse wall inserts were coated with a thin layer of Matrigel. VEGF ₁₆₅ induced leukemia cell migration of HL-60 cells and VEGFR-2 + primary leukemia in a dose-dependent manner (FIG. 6). This process requires MMP production and activation because VEGF-induced cell migration was blocked by the use of synthetic MMP inhibitors 5,10-phenanthroline (FIG. 6) and recombinant human TIMP-1.

The remaining cell lines and VEGFR-2 negative primary leukemia cells did not migrate in response to VEGF even through uncoated transverse walls. This is associated with a decrease in the ability to secrete MMPs of these cells, but may be due to a decrease in VEGFR expression, ie, the level of VEGFR-1 expression on these cells.

As indicated above, the mitogenic effect of VEGF ₁₆₅ on leukemia cells was mediated through VEGFR-2. However, in the migration system used in this study, incubation of IMC-1C11 (1 μg / ml) and HL-60 could only block (40%) VEGF ₁₆₅ -induced migration via Matrigel (FIG. 6). ). In contrast, MoAbs against VEGFR-1, used at the same concentrations, significantly blocked HL-60 cell migration (60-70%) (FIG. 6 *, p <0.05), in which VEGF ₁₆₅ had two receptors on these cells. Imply that it can induce MMP activation and cell migration. The combination of VEGFR-1 MoAb with VEGFR-2 MoAb and incubation of HL-60 cells blocked the VEGF ₁₆₅ -induced migration (70-80%) more effectively than when the antibodies were used alone. I confirmed it. Nevertheless, incubation of VEGFR-2-specific tyrosine kinase inhibitor AG1433 with HL-60 cells significantly blocked (70%) migration induced by VEGF ₁₆₅ (FIG. 7, *, p <0.05). Thus, these results suggest that the interaction of VEGF ₁₆₅ with VEGFR-1 and VEGFR-2 on HL-60 cells may be essential for inducing cell migration and invasion, but the exact contribution of each receptor to this process should be further investigated. Suggest that

In the case of primary leukemia, both anti-VEGFR-1 and anti-VEGFR-2 MoAbs exhibited comparable migration-blocking effects overall (FIG. 6). However, for HL-60 cells, the combination of anti-VEGFR-1 MoAb and anti-VEGFR-2 MoAb and incubation of primary leukemia cells used the antibodies alone while blocking 80% of VEGF ₁₆₅ induced migration. It was more effective than the case (Figure 6). Finally, the migration of leukemia cells in response to VEGF ₁₆₅ could not be blocked by anti-MMP-2 antibodies in any of the cells tested, but was significantly reduced when cells were incubated with MMP-9-neutralizing antibodies. It suggests that MMP-9 may be a major protein involved in the migration process.

As mentioned above, the migration assay used in this study requires cell chemotaxis in response to VEGF ₁₆₅ as well as active MMP secretion and activation. In addition, antibody and protein kinase inhibitor studies suggest that VEGF ₁₆₅ -induced signaling through VEGFR-1 and VEGFR-2 may be required for cells to migrate and invade the basement membrane. This is not surprising since VEGFR-1 has been found to mediate monocyte migration (18) and MMP secretion by smooth muscle cells (17).

Thus, these results show that VEGF ₁₆₅ induces a more invasive phenotype for leukemia cell subsets as measured by increased proliferation, MMP production, and migration through the basement membrane. Although signaling through VEGFR-1 may be particularly necessary for migration and MMP activation, the effect is primarily mediated through VEGFR-2.

HL-60 releases VEGF in vivo

It is now well known that HL-60 cells release VEGF in picograms in vitro. Applicants used NOD-SCID mice to investigate whether these cells release VEGF even in vivo. As shown in FIG. 8A, plasma levels of human VEGF increased significantly after injection of leukemia cells, correlated with an increase in circulating leukemia cells and a corresponding decrease in mouse survival (FIG. 8B). Importantly, murine VEGF plasma levels were maintained at very low levels (analytic detection levels or below) throughout the experiment. These results support the role for self-secreting VEGF to sustain leukemia cell growth and survival.

Anti-human VEGFR-2 / KDR moAb (IMC-1C11) blocks leukocyte growth in vivo

In the absence of any treatment, mice injected with 1 × 10 ⁶ HL-60 cells (iv) survived only 14 to 18 days, at which time the invasiveness of these leukemia cells was most pronounced (n = 8). Applicants used IMC-1C11 to investigate whether leukemia-derived VEGF supports leukemia cell growth through self-secreting interaction with VEGFR-2. As shown in FIG. 8B, mice treated with IMC-1C11 survived throughout the experimental period (> 80 days, FIG. 8B, p <0.005). Importantly, it has recently been confirmed that the antibodies used in this study are specific for human VEGFR-2 (KDR) and do not cross react with murine flk-1 [Lu et al, submitted]. In addition, as mentioned above, human VEGF plasma levels were increased in control (untreated) mice, which correlated with a decrease in overall mouse survival (FIGS. 8A and 8B).

These in vivo results confirm the role of VEGF and VEGFR-2 in regulating leukemia cell growth and suggest that antibodies to the VEGF receptor may represent a novel therapeutic approach for the treatment of leukemia subsets. .

Anti-human VEGFR-2 / KDR moAbs block the formation of liver and spleen metastases

14 days after initiation of the treatment, histological analysis of liver and spleen from PBS-treated mice injected with HL-60 cells showed that leukocyte infiltrates (greenomas) were present in both liver and spleen ( 9B and 9D). Liver sections had several zones invaded by leukemia cells with signs of active cell proliferation (FIG. 9B). In addition, the red pulp zones of these mouse spleens were largely replaced with leukemia cells (FIG. 9D). In contrast, mice treated with neutralizing MoAb IMC-1C11 had normal liver and spleen tissue configurations (FIGS. 9A and 9C). In treated mice, there appeared evidence of apoptosis in the liver (Figure 9A) and the spleen that appeared normal (Figure 9C), but no evidence of leukocyte invasion (Figure 9A). These results indicate that mice inoculated with MoAb against human VEGFR-2 blocked the proliferation and invasion of HL-60 cells.

Example I

In order to define the role of the VEGF / VEGFR-2 self-secreting loop in the regulation of leukemia cells in vivo, we have established an xenograft model in which the human leukemia cell line HL-60 was engrafted into immunodeficient mice (19-21). ) Was used. Injection of 1 million HL-60 cells into NOD-SCID mice resulted in grafts and formation of leukemia green tumors in the bone marrow, spleen, liver and peripheral circulation. Applicants demonstrated that HL-60 cells produce human VEGF that can be detected at high levels in the plasma of HL-60 xenografted mice as determined by human specific ELISA (FIG. 8A). An increase in human VEGF levels was detected in plasma samples and increased over time during the proliferation of HL-60 cells in NOD-SCID mice. In contrast, the plasma levels of resulting murine VEGF were not significant and did not increase during HL-60 proliferation (FIG. 8A).

In the absence of any intervention, HL-60 xenografted NOD-SCID mice died of metastatic proliferation of green tumors within 14 days of inoculation. However, injection of MoAb specific to the VEGF binding domain of human VEGFR-2 inhibited the proliferation of HL-60 human leukemia in NOD-SCID mice and survived for extended periods of time over the experimental period (> 80 days, FIG. 8B). . Histological examination of the liver and spleen demonstrates that MoAb treatment with VEGFR-2 effectively inhibits the proliferation of leukemia infiltrates and green species in the liver and spleen (FIG. 9). These data strongly suggest that human VEGF endogenously produced by HL-60 promotes the growth of these leukemia cells through interaction with human EGFR-2, which produces an autosecretory loop, confirming in vitro data. Collectively, these data describe the adaptability of VEGFR signaling in the vascular and hematopoietic lineages and their potential to support specific proliferative subsets of VEGFR-2 + acute leukemia cells.

In humans, acute leukemia cells are classified based on the pro-committed cell type and the differentiation state of the hepatocytes from which they originated (M1 to M7). Most leukemia cells, most of which are located in the bone marrow and peripheral circulation, are due to malignant transformation of bone marrow progenitor cells (Ml, M2, M3, M4, M5). However, leukemia cells acquire the ability to invade various tissues that are suitable for the formation of large tumor masses, sometimes called green species. Based on Applicants' in vivo data, most of the green species tested to date express VEGFR-2 and VEGFR-1. Formation of greenomas, similar to angiogenesis, then requires invasion, proliferation and stabilization of leukemia cells, and it is not surprising that leukemia cells with the potential to form greenomas also express VEGFR. For example, HL-60 cells represent a leukemia model that has the ability to metastasize and form angiogenic solid tumors when implanted subcutaneously. Therefore, leukemia cells that form melanoma use VEGFR to upregulate MMP expression and promote invasion into tissues. Expression of VEGFR-2 may eventually promote leukemia cell proliferation. In the absence of counterregulatory factors, leukemia cells can continue to proliferate.

Based on Applicants' in vivo data, the growth of HL-60 cells xenografted into NOD-SCID mice is inhibited by human specific neutralizing MoAbs for VEGFR-2, which is a secretory loop and VEGF / VEGFR- It suggests that the autosecretory loop produced by 2 mediates leukemia cell proliferation (FIG. 10).

Example II. Generation of single chain antibodies

Cell Lines and Proteins

Super-cultured HUVECs were maintained at 37 ° C., 5% CO ₂ in EBM-2 medium. Cells between passages 2-5 were used in all assays. VEGF ₁₆₅ protein was expressed and purified in baculovirus. CDNA encoding the extracellular domain of KDR was isolated from human fetal kidney mRNA via RT-PCR and subcloned into the BglII and BspEI sites of the vector AP-Tag. In this plasmid, cDNA for KDR extracellular domain was fused in-frame with cDNA for human placental AP. The plasmid was electroporated with NIH 3T3 cells with neomycin expression vector pSV-Neo and stable cell clones were selected using G418. Soluble fusion protein KDR-AP was purified from cell culture supernatants by affinity chromatography using immobilized monoclonal antibodies against AP.

Construction of Mouse Immunization and Single Chain Antibody Phage Display Library

Female BALB / C mice were injected intraperitoneally (i.p.) twice with 10 μg of KDR-AP in 200 μl of RIBI Adjuvant System over a two month period, followed by one i.p. Injection. In addition, upon the first immunization, mice were injected subcutaneously (s.c.) with 10 μg of KDR-AP in 200 μl RIBI. 20 μg KDR-AP was further added to i.p. Boosted and euthanized the mice 3 days later. Spleens were removed from the mice and cells were isolated. RNA was extracted and mRNA was purified from all of the RNA of spleen cells. The scFv phage display library was constructed using mRNA presented on the surface of filamentous phage M13.

When presenting the scFv on the surface of filamentous phage, the antibody V _H and V _L domains were conjugated together via a 15 amino acid long linker (GGGGS) ³ (SEQ ID NO: 23) and fused to the N-terminus of phage protein III. For detection and other analysis purposes, an E-tag of 15 amino acids length followed by an amber codon (TAG) was inserted between the VL and the C terminus of Protein III. If an Amber codon located between the E-tag and Protein III transforms the construct into an inhibitory host (eg, TG1 cells), the scFv can be made in a surface-presented format and the non-inhibiting host (eg, HF2151 cells) can make the scFv in soluble form.

The assembled scFv DNA was ligated with pCANTAB SE vector. Transformed TG1 cells were plated on 2YTAG plates and incubated. Colonies were scraped into 10 ml of 2YT medium and mixed with 5 ml of 50% glycerol and stored at −70 ° C. as a library stock.

Bio Panning

Library stocks were cultured in log phase and rescued with M13K07 helper phage and amplified overnight in 2YTAK medium (2YT containing 100 μg / ml ampicillin and 50 μg / ml kanamycin) at 30 ° C. Phage preparations are precipitated in 4% PEG / 0.5M NaCl, resuspended in 3% nonfat milk / PBS containing 500 μg / ml of AP protein and incubated at 37 ° C. for 1 hour to present anti-AP scFv. Phage were captured and other nonspecific binding was blocked.

KDR-AP (10 μg / ml) coated Maxisorp Star tube (Nunc, Denmark) was first blocked with 3% milk / PBS for 1 hour at 37 ° C., and then the phage preparation was added at room temperature. Incubate for 1 hour. The tube was washed 10 times with PBST and then 10 times with PBS (PBS containing 0.1% Tween-20). Using 1 ml of freshly prepared 100 mM triethylamine solution, bound phages were eluted at room temperature for 10 minutes. Eluted phages were incubated with 10 ml of medium log TG1 cells for 30 minutes at 37 ° C. and shaken for 30 minutes. Infected TG1 cells were then plated in 2YTAG plates and incubated at 30 ° C. overnight.

After the third run of panning, it was found that 99% (185/186) of the clones screened were specific KDR binders. However, only 15 (8%) of these binding factors could block the binding of KDR to immobilized VEGF. DNA BstN I fingerprinting of the 15 clones indicated that there were two different cleavage modalities, while four different modalities were obtained with 21 randomly selected VEGF nonblocking factors. In addition, all of the above aspects appeared in the clone confirmed after the second panning. After the second run of panning, a representative clone of each cleavage pattern was selected from the collected clones and subjected to DNA sequencing. Of the 15 sequences sequenced, two unique VEGF blockers and three nonblockers were identified. In all studies, one scFv, p2A7, which neither binds to KDR nor blocks VEGF's binding to KDR, was selected as a negative control.

Phage ELISA

As described above, individual TG1 clones were grown in 96-well plates at 37 ° C. and rescued with M13K07 helper phage. Amplified phage preparations were blocked for 1 hour at RT with 1/6 volume of 18% milk / PBS and Maxi-sorp 96 wells coated with KDR-AP or AP (1 μg / ml × 100 μl) Added to microtiter plate (Nunc). After incubation for 1 hour at room temperature, the plates were washed three times with PBST and incubated with rabbit anti-M13 phage Ab-HRP conjugates. Plates were washed five times, TMB peroxidase substrate was added, and OD at 450 nm was read using a microplate reader to identify and sequence scFv antibodies.

Preparation of Soluble scFv

Phage from individual clones were used to infect non-inhibiting E. coli host HB2151 and infected cells were selected on 2YTAG-N plates. The cells were cultured in 2YTA medium containing 1 mM isopropyl-1-thio-B-D-galactopyranoside at 30 ° C. to induce the expression of scFv in HB2 151 cells. The cell pellet was resuspended in 25 mM Tris, pH 7.5 containing 20% (w / v) sucrose, 200 mM NaCl, 1 mM EDTA, and 0.1 mM PMSFA to prepare periplasmic extracts of cells, followed by 4 ° C. Incubate gently for 1 hour at. After centrifugation at 15,000 rpm for 15 minutes, soluble scFv was purified from the supernatant via affinity chromatography using the RPAS purification module (Pharmacia Biotech).

Example III. analysis

Quantitative KDR Binding Assay

Two assays were used to quantitatively investigate the binding of purified soluble scFv to KDR.

Non-inhibiting host E. coli HB2151 cells were used to express four different clones, including two VEGF blockers, p1C11 and p1F12, one nonblocking factor, dominant clone p2A6 and nonbinding factor p2A7 in shake flasks. P1C11 has the heavy and light chain sequences shown in FIG. 11. Soluble scFv was purified from the periplasmic extract of Escherichia coli via anti-E-tag affinity chromatography. The yield of purified scFv of the clones ranged from 100 to 400 μg per liter of culture.

In a direct binding assay, soluble scFv was added to KDR coated 96 well Maxi-Sof microtiter plates in varying amounts and incubated for 1 hour at room temperature before the plates were washed three times with PBST. Plates were then incubated with 100 μl mouse anti-E tag antibody for 1 hour at room temperature, followed by incubation with 100 pl of rabbit anti-mouse-antibody HRP conjugates. After washing the plates, the procedure was described above for phage ELISA.

In other assays, eg, competitive VEGF blocking assays, soluble scFv was mixed in varying amounts with a fixed amount of KDR-AP (50 ng) and incubated for 1 hour at room temperature. The mixture was then transferred to a 96-well microtiter plate coated with VEGF ₁₆₅ (200 ng / well) and further incubated at room temperature for 2 hours, after which the plates were washed five times and added substrate for AP to bind KDR-. AP molecules were quantified. Subsequently, the scFv concentration required to inhibit 50% binding of KDR to IC ₅₀ , eg, VEGF, was calculated.

Clones p1C11 and p1F12 also blocked KDR for immobilized VEGF but did not block p2A6. After each panning run, the dominant clone, clone p1C11, showed the highest potential in blocking KDR binding and VEGF binding to KDR (Table 1). The antibody concentration of clone p1C11 required for 50% of the maximum binding to KDR and the antibody concentration of clone p1C11 required for 50% inhibition of KDR binding to VEGF were 0.3 nM and 3 nM, respectively (see Table 1). FACS analysis demonstrated that p1C11, p1F12 and p2A6 could also bind to receptors expressed on the cell surface of HUVECs.

BIAcore analysis of soluble scFv

The binding kinetics of soluble scFv to KDR was measured using a BIAcore Biosensor (Pharmacia Biosensor). KDR-AP fusion protein was immobilized on the sensor chip and soluble scFv was injected at concentrations ranging from 62.5 nM to 1000 nM. By taking a sensorgram at each concentration and evaluating using the program (BIA Evaluation 2.0), the rate constants kon and koff were measured. Kd was calculated as koff / kon, the ratio of rate constants.

Table 1 shows the results of surface forming resonance on the BIAcore instrument. VEGF-blocked scFv, p1C11 and p1F12 bound Kd to KDR fixed at 2.1 and 5.9 nM, respectively. The non-blocking scFv, p2A6, bound to KDR with about 6-fold weaker affinity (Kd, 11.2 nM) than the best binding factor p1C11 because dissociation is much faster. As expected, p2A7 did not bind to KDR immobilized on BIAcore.

Phosphorylation Analysis

In accordance with the protocol described above, phosphorylation analysis was performed using early passage HUVECs. In brief, HUVECs were incubated for 10 minutes at room temperature in serum-free EBM-2 basal medium supplemented with 0.5% bovine serum albumin with or without 5 μg / ml scFv antibody, followed by the use of 20 ng / ml of VEGF ₁₆₅ . Further stimulated at room temperature for 15 minutes. Cells were lysed and KDR receptors were immunoprecipitated from cell lysates using protein A Sepharose beads (ImClone Systems Incorporated) coupled to rabbit anti-KDR polyclonal antibodies. Beads were washed and mixed with SDS loading buffer and the supernatants analyzed by Western blot. To detect KDR phosphorylation, blots were probed with anti-phosphotyrosine Mab, 4G10. For MAP kinase activity analysis, cell lysates were separated by SDS-PAGE followed by Western blot using phosphate-specific MAP kinase antibodies. All signals were detected using ECL.

These results indicated that VEGF-blocked scFv p1C11 could inhibit KDR receptor phosphorylation stimulated by VEGF, but not non-blocked scFv p-2A6. In addition, p1C11 also effectively inhibited VEGF-stimulated activation of MAP kinase p44 / p42. In contrast, both p1C11 and IMC-2A6 did not inhibit FGF-stimulated activation of MAP kinase p44 / p42.

Anti-mitotic analysis

HUVECs (5 × 103 cells / well) were plated on 96 well tissue culture plates (Wallach, Inc., Gaitsburg, MD, USA) in 200 μl of VEGF, bFGF or EGF-free EBM-2 medium, 37 Incubate at 72 ° C. for 72 hours. Various amounts of antibody were added to double wells and preincubated at 37 ° C. for 1 hour before VEGF ₁₆₅ was added to a final concentration of 16 ng / ml. After 18 hours of incubation, 0.25 μCi [ ³ H] -TdR (Amersham) was added to each well and incubated for another 4 hours. The cells were placed on ice and washed twice with serum containing medium and then incubated for 10 minutes at 4 ° C. with 10% TCA. The cells were then washed with water and lysed in 25 μl 2% SDS. Scintillation counts were added (150 μl / well, radioactive DNA was measured with a Scintillation Counter (Wallach, Model 1450 Microbeta Scintillation Counter).

The ability of scFv antibodies to block VEGF-stimulated mitogenic activity on HUVECs is shown in FIG. 3. VEGF-blocked scFv p1C11 strongly inhibited VEGF induced DNA synthesis in HUVEC to about 5 nM, EC ₅₀ (ie, antibody concentration that inhibits 50% mitosis of VEGF stimulated HUVEC). Unblocked scFv p2A6 did not show any inhibitory effect on the mitogenic activity of VEGF. Neither p1C11 nor p2A6 inhibited bFGF-induced DNA synthesis in HUVECs.

Example IV. Generation of Chimeric Antibodies

Cell Lines and Proteins

Primary cultured human umbilical vein endothelial cells (HUVEC) were maintained in EBM-2 medium at 37 ° C. and 5% CO ₂ . In all assays, cells passaged between 2 and 5 times were used. VEGF ₁₆₅ and KDR-alkaline phosphatase fusion protein (KDR-AP) were expressed in baculovirus and NIH 3T3 cells, respectively, and purified according to the procedure described below. Anti-KDR scFv p1CC11 and scFv p2A6, antibodies that bind KDR but do not block KDR-VEGF interactions, were isolated from phage display libraries constructed from mice immunized with KDR as described above. C225 is a chimeric IgG1 antibody directed against epidermal growth factor (EGF) receptor.

Cloning of the Variable Domain of scFv p1C11

The light chain variable domain (V _L ) and heavy chain variable domain (V _H ) of p1C11 were cloned from the scFv expression vector by PCR using primers 1 and 2 and primers 3 and 4, respectively. Subsequently, leader peptide sequences for protein secretion in mammalian cells were added to 5 ′ of V _L and V _H via PCR using primers 5 and 2 and primers 5 and 4, respectively.

Construction of Expression Vectors for Chimeric p1C11 IgG

Individual vectors were constructed for the expression of chimeric IgG light and heavy chains. The cloned V _L gene was cleaved with HindIII and BamHI and ligated into vector pKN100 containing human κ light chain constant region (C _L ) to generate IMC-1C11-L, the expression vector for the light chain of chimeric p1C11. The cloned V _H gene was cleaved with HindIII and BamHI and ligated into vector pGID105 containing human IgG1 (γ) heavy chain constant domain (C _H ) to yield IMC-1C11-H, the expression vector for the heavy chain of chimeric p1C11. Generated. These two constructs were examined by restriction enzyme cleavage and confirmed by dideoxynucleotide sequencing.

As shown in FIG. 4, both the V _H and V _L domains are already fused to gene segments encoding their 5 ′ ends, which encode the indicated leader peptide sequences. The V _H and V _L domains are ligated through the HindIII / BamHI site into the expression vector pKN100 containing the cDNA form of the human κ chain constant region gene and the expression vector pG1D105 containing the cDNA form of the human γ1 constant region gene, respectively. . In each case, expression is under the control of the HCMVi promoter and is terminated by an artificial termination sequence. The complementarity determining region (CDR) residues of the light and heavy chains defined according to the hypervariable sequence definition of Kabat et al. Are underlined and denoted CDR-H1 to H3 and CDR-L1 to L3, respectively.

IgG Expression and Purification

COS cells were simultaneously transfected with equal amounts of IMC-1C11-L and IMC-1C11-H plasmids for transient IgG expression. Subconfluent COS cells cultured in 150 mm Petri dishes containing DMEM / 10% FCS were rinsed once with 20 ml of DMEM medium containing 40 mM Tris (pH 7.4), followed by DMEM / DEAE- 37 ° C. with 4 ml of dextran / DNA mixture (40 mM Tris, 0.4 mg / ml of DEAE-dextran (Sigma) and DMEM containing 20 μg of each of IMC-1C11-L and IMC-1C11-H plasmids) Incubate for 4.5 h. The cells were incubated for 1 hour at 37 ° C. with 4 ml of DMEM / 2% FCS containing 100 nM chloroquinone (Sigma) and then incubated with 1.5 ml of 20% glycerol / PBS for 1 minute at room temperature. The cells were washed twice with DMEM / 5% FCS and incubated overnight at 20 ° C. in 20 ml of the same medium. After washing the cells twice with conventional DMEM, the cell culture medium was exchanged with serum free DMEM / HEPES. Cell culture supernatants were harvested 48 and 120 hours after transfection. Chimeric IgG was purified from the harvested supernatant by affinity chromatography using a Protein-G column according to the protocol described by the manufacturer (Pharmacia Biotech). The IgG containing fractions were collected, the buffer was replaced with PBS, and then concentrated using a Centricon 10 concentrator (Amicon Corp., Beverly, Mass.). Purity of IgG was analyzed by SDS-PAGE. The concentration of purified antibody was measured by ELISA using goat anti-human y-chain specific antibody as capture agent and HRP-conjugated goat anti-human k-chain antibody as detection agent. . Standard curves were corrected using C225, a clinical grade antibody.

After affinity purification by Protein-G, a single protein band of about 150 kD was observed on SDS-PAGE. Western blotting analysis using HRP-conjugated anti-human IgG1 Fc specific antibodies confirmed the presence of human IgG Fc moieties in the purified proteins.

The results of the ELISA indicate that IMC-1C11 binds more efficiently to immobilized KDR than the parent antibody scFv.

Example V. Assays and Analysis

FACS analysis

Early passages of HUVEC cells were cultured overnight in growth factor-depleted EBM-2 media to induce KDR expression. The cells were harvested and washed three times with PBS, incubated with IMC-p1C11 IgG (5 μg / ml) at 4 ° C. for 1 hour, followed by rabbit anti-human Fc antibody (Capper, Organon Teknika Corp. , West Chester, PA) for 60 minutes more. The cells were washed and analyzed with a flow cytometer (Model EPICS®, Coulter Corp., Edison, NJ). As indicated above with respect to the parent antibody scFv p1C11, IMC-1C11 specifically binds KDR expressed on HUVECs in the early passages.

Quantitative KDR Binding Assay

Antibodies were added to KDR-coated 96-well Maxi-Sorp microtiter plates (Nunc. Denmark) with varying amounts of incubation at room temperature for 1 hour and then plated three times with PBS containing 0.1% Tween-20. Washed. The plates were combined with 100 μl of mouse anti-E tag antibody-HRP conjugate (Pharmacia Biotech) for scFv and rabbit anti-human IgG Fc specific antibody-HRP conjugate for chimeric IgG (Cappel, Organon Teknika Corp. ) Was incubated with 100 μl for 1 hour at room temperature. The plate was washed five times and TMB peroxidase substrate (KPL, Reuters, MD) was added, followed by a microplate reader (Molecular Device, Sunnivale, Calif.) At 450 nm. OD was read. IMC-1C11 bound more efficiently to immobilized KDR receptors than the parent antibody scFv.

BIAcore analysis

The binding kinetics of the antibody to KDR was measured using the BIAcore Biosensor (Pharmacia Biosensor). KDR-AP fusion proteins were immobilized on the sensor chip and antibodies or VEGF were injected at concentrations ranging from 25 nM to 200 nM. Sensorgrams at each concentration were obtained and evaluated using a program (BIA Evaluation 2.0) to determine the rate constants kon and koff. Kd was calculated as koff / kon, the ratio of rate constants.

BIAcore analysis revealed that IMC-1C11 binds to KDR with higher affinity than the parental scFv (Table 2). Kd of IMC-1C11 was 0.82 nM compared to 2.1 nM for scFv. The increased affinity of IMC-1C11 is mainly due to the slower dissociation rate (koff) of bivalent chimeric IgG. It is important to note that the binding affinity (Kd) of IMC-1C11 to KDR was determined to be 0.93 nM in our BIAcore analysis (Table 2), which is similar to the binding affinity of natural ligand VEGF to KDR.

Competitive VEGF Binding Assay

In the first assay, various amounts of antibody were mixed with fixed amounts of KDR-AP (50 ng) and incubated for 1 hour at room temperature. The mixture was then transferred to a 96-well microtiter plate coated with VEGF ₁₆₅ (200 ng / well), incubated for another 2 hours at room temperature, the plates were washed five times and the substrate (p-nitrophenyl phosphate) for AP , Sigma) was added to quantify bound KDR-AP molecules. The antibody concentrations required to inhibit 50% of the binding of KDR to EC ₅₀ , ie VEGF, were then calculated.

IMC-1C11 blocked KDR receptor binding to immobilized VEGF in a dose-dependent manner. Chimeric antibodies more strongly block VEGF-KDR interactions with an IC ₅₀ of 0.8 nM (i.e., the antibody concentration required to inhibit 50% of KDR binding to VEGF) compared to an IC ₅₀ of 2.0 nM for scFv. It was. The control scFv p2A6 also binds to KDR but does not block VEGF-KDR interaction.

In a second assay, various amounts of IMC-1C11 antibody or cold VEGF ₁₆₅ protein were mixed with a fixed amount of ¹²⁵ I labeled VEGF ₁₆₅ and added to a 96 well microtiter plate coated with KDR receptors. The plates were incubated for 2 hours at room temperature and washed five times, after which the amount of radiolabeled VEGF ₁₆₅ bound to the immobilized KDR receptor was counted. The concentrations of IMC-1C11 and cold VEGF ₁₆₅ required to block 50% of radiolabeled VEGF binding to immobilized KDR receptors were determined.

IMC-1C11 competed efficiently with ¹²⁵ I labeled VEGF in a dose-dependent manner in binding to immobilized KDR receptors. As expected, chimeric antibodies directed against the EGF receptor neither bound the KDR receptor nor blocked the VEGF-KDR interaction.

Phosphorylation Analysis

HUVEC cells in sub- front growth were tested after incubation for 24 to 48 hours in EBM-2 medium depleted of growth factors. After pretreatment of 50 nM sodium orthovanadate for 30 minutes, the cells are incubated for 15 minutes with or without antibodies and further at room temperature with 20 ng / ml of VEGF ₁₆₅ or 10 ng / ml of FGF. Stimulated for 15 minutes. The cells were then lysed in lysis buffer (50 nM Tris, 150 mM NaCl, 1% NP-40, 2 mM EDTA, 0.25% sodium deoxycholate, 1 mM PMSF, 1 μg / ml leupeptin, 1 μg / ml pepstatin, Cell lysates lysed in 10 μg / ml aprotinin, pH 7.5) were used for KDR and MAP kinase phosphorylation assays. KDR receptors were immunoprecipitated from cell lysates using protein A Sepharose beads (Santa Cruz Biotechnology, Inc., California, USA) coupled with anti-KDR antibody Mab 4.13 (ImClone Systems). Proteins were separated by SDS-PAGE and western blotting analysis performed. To detect KDR phosphorylation, blots were probed with PY20 (ICN Biomedicals, Inc., Aurora, OH), an anti-phosphotyrosine Mab. For activity assays of MAP kinases, cell lysates were separated by SDS-PAGE followed by Western blotting analysis using phospho-specific MAP kinase antibodies (New England BioLabs, Beverly, Mass.). All signals were detected using ECL (Amersham, Arlington Heights, Ill.). For all assays, the blot was probed again with polyclonal anti-KDR antibody (ImClone Systems) to ensure that the same amount of protein was loaded into each lane of the SDS-PAGE gel.

IMC-1C11 effectively inhibited VEGF-stimulated phosphorylation of KDR receptor and activation of p44 / p42 MAP kinase. In contrast, C225 did not inhibit any VEGF-stimulated activation of the KDR receptor and MAP kinase. Both IMC-1C11 and C225 alone had no effect on KDR receptor activity and p44 / p42 MAP kinase. As can be seen from the above for scFv p1C11, IMC-1C11 did not inhibit FGF-stimulated activation of p44 / p42 MAP kinase. In addition, both the scFv p2A6 and chimeric IgG forms of p2A6 (c-p2A6) did not inhibit VEGF-stimulated activation of the KDR receptor and MAP kinase.

Anti-mitotic assay

The effect of anti-KDR antibodies on VEGF-stimulated mitogenic factor production in human endothelial cells was measured by [ ³ H] -TdR DNA incorporation assay using HUVEC. HUVECs (5 × 10 ³ cells / well) were plated in 96-well tissue culture plates containing 200 μl of EBM-2 medium without VEGF, bFGF or EGF and incubated at 37 ° C. for 72 hours. Various doses of antibody were added to double wells and preincubated at 37 ° C. for 1 hour before VEGF ₁₆₅ was added at a final concentration of 16 ng / ml. After 18 hours of incubation, 0.25 μCi of [ ³ H] -TdR was added to each well and incubated for another 4 hours. Radioactive DNA was measured with a scintillation counter.

IMC-1C11 and scFv p1C11 both effectively inhibited the mitogenic factor production of HUVECs stimulated by VEGF. IMC-1C11 was a more potent inhibitor of the parent antibody scFv for the production of VEGF-induced mitogenic factors of HUVECs. The antibody concentration required for 50% inhibition of mitosis of EGF-induced HUVEC was 0.8 nM for IMC-1C11 and 6 nM for scFv. As expected, scFv p2A6 showed no inhibitory effect on VEGF-stimulated endothelial cell proliferation.

<Reference>

KDR Binding Assay of Anti-KDR scFv Antibodies scFv clone KDR Binding ¹ (ED ₅₀ , nM) VEGF Block ² (IC ₅₀ , nM) Binding kinetics ³ kon (10 ⁵ M ^-1 s ^-1 ) koff (10 ^-4 s ^-1 ) Kd (10 ^-9 M) p1C11 Yes (0.3) Yes (3.0) 1.1 2.3 2.1 p1F12 Yes (1.0) Yes (15) 0.24 1.4 5.9 p2A6 Yes (5.0) No (> 300) 4.1 46.1 11.2 p2A7 NO No (> 300) NA NA NA 1. Measured by direct binding ELISA. The numbers in parentheses indicate the concentration of scFv conferring 50% of the maximum binding. Measured by competitive VEGF blocking ELISA. The numbers in parentheses indicate the concentration of scFv required to inhibit 50% binding of KDR to immobilized VEGF. Measured by BIAcore analysis. NA = not applicable.

Binding Kinetics of p1C11 scFv and IMC-1C11 to KDR Receptor ^* Antibodies kon (10 ⁵ M ^-1 s ^-1 ) koff (10 ^-4 s ^-1 ) Kd (10 ^-9 M) p1C11 scFv 1.11 2.27 2.1 IMC-1C11 0.63 0.52 0.82 VEGF 1.87 1.81 0.93 * All rates were measured by surface plasmon resonance using the BIAcore system and averaged over three separate measurements.

Claims (44)

An effective amount of a VEGFR antagonist is administered to a mammal in which unfaithful tumor cell growth is stimulated by a ligand of vascular endothelial growth factor receptor (VEGFR), the mammal stimulated by a ligand of vascular endothelial growth factor receptor in the mammal. Methods of Inhibiting Insufficient Tumor Cell Growth. The method of claim 1, wherein the VEGFR is KDR. The method of claim 1, wherein the VEGFR is flk-1. The method of claim 1, wherein the VEGFR is flt-1. The method of claim 1, wherein the mammal is a human. The method of claim 1, wherein the antagonist is a biological molecule. The method of claim 6, wherein the biological molecule is a fragment comprising a monoclonal antibody specific for VEGFR or a hypervariable region thereof. The antibody of claim 7, wherein the antibody comprises one or more variable heavy chain fragments comprising SEQ ID NO: 1, CDRH1 having an amino acid sequence shown in SEQ ID NO: 1, CDRH2 having an amino acid sequence shown in SEQ ID NO: 2, and CDRH3 having an amino acid sequence shown in SEQ ID NO: 3; At least one variable light chain fragment comprising a CDRL1 having an amino acid sequence as shown in FIG. 1, a CDRL2 having an amino acid sequence as shown in SEQ ID NO: 5 and a CDRL3 having an amino acid sequence as shown in SEQ ID NO: 6. 8. The method of claim 7, wherein the antibody comprises at least one variable heavy chain fragment having an amino acid sequence as shown in SEQ ID NO: 7 and at least one variable light chain fragment having an amino acid sequence as shown in SEQ ID NO: 8. 8. The method of claim 7, wherein said monoclonal antibody is a chimeric antibody or a humanized antibody. The method of claim 1, wherein the antagonist is a small molecule. The method of claim 1, further comprising treating the non-faithful tumor cells with radiation therapy, chemotherapy, or a combination thereof. The method of claim 1, wherein said tumor cells affect hematopoietic structure. The method of claim 13, wherein the tumor cells are bone marrow cells. The method of claim 14, wherein said tumor cells are leukemia cells. The method of claim 15, wherein the leukemia is acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), erythrocytic leukemia or monocytic leukemia. . The method of claim 14, wherein the tumor cells are multiple myeloma cells. The method of claim 14, wherein the tumor cells are lymphoid cells. 19. The method of claim 18, wherein the lymphoid cells are associated with Hodgkin's disease or Non-Hodgkin's disease. Ligands of vascular endothelial growth factor receptors in mammals comprising the step of treating the mammals stimulated with non-faithful tumor growth by ligands of vascular endothelial growth factor receptors (VEGFR) in an effective amount in combination with VEGFR antagonists and irradiation A method of inhibiting non-faithful tumor growth stimulated by. The method of claim 20, wherein the mammal is a human. The method of claim 20, wherein the antagonist is administered prior to irradiation. The method of claim 20, wherein the antagonist is administered during irradiation. The method of claim 20, wherein the antagonist is administered after irradiation. The method of claim 20, wherein the antagonist is administered before and during the irradiation. The method of claim 20, wherein the antagonist is administered during and after irradiation. The method of claim 20, wherein the antagonist is administered before and after irradiation. The method of claim 20, wherein the antagonist is administered before, during and after irradiation. The method of claim 20, wherein the source of radiation is external to the mammal. The method of claim 20, wherein the source of radiation is inside the mammal. The method of claim 20, wherein said antagonist is a monoclonal antibody. The method of claim 20, wherein said tumor cell affects hematopoietic structure. An effective amount of a VEGFR antagonist and a chemotherapeutic agent is administered to a mammal in which unfaithful tumor growth is stimulated by a ligand of vascular endothelial growth factor receptor (VEGFR). A method of inhibiting non-faithful tumor growth stimulated by. The method of claim 33, wherein the antagonist is administered prior to chemotherapy treatment. The method of claim 33, wherein the antagonist is administered during chemotherapy treatment. The method of claim 33, wherein the antagonist is administered after chemotherapy treatment. The method of claim 33, wherein the antagonist is administered prior to and during the chemotherapeutic treatment. The method of claim 33, wherein the antagonist is administered during and after the chemotherapeutic treatment. The method of claim 33, wherein the antagonist is administered before and after the chemotherapeutic treatment. The method of claim 33, wherein the antagonist is administered prior to, during and after the chemotherapeutic treatment. The method of claim 33, wherein the chemotherapeutic agent is cisplatin, dacarbazine, dactinomycin, mechloretamine, streptozosin, cyclophosphamide, carmustine, lomustine, doxorubicin, daunorubicin, procarbazine, mito Mycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel, docetaxel, aldesleukin, asparaginase, busulfan, carboplatin, cladribine, Dacarbazine, phloxuridine, fludarabine, hydroxyurea, ifosfamide, interferon alfa, luprolide, megestrol, melfaran, mercaptopurine, plicamycin, mitotan, pegaspargaze, pento With statins, fibrobromine, plicamycin, streptozosin, tamoxifen, teniposide, testoslactone, thioguanine, thiotepa, uracil mustard, vinorelbine, chlorambucil, taxol and combinations thereof The method selected from the group consisting of: The method of claim 33, wherein the chemotherapeutic agent is selected from the group consisting of cisplatin, doxorubicin, taxol, and combinations thereof. The method of claim 33, wherein said tumor cells affect hematopoietic structure. The method of claim 33, wherein the antagonist is a monoclonal antibody.