KR20000010739A - New angiogenesis inhibiting peptide, polynucleotide encodeing the peptide, and inhibition method of angiogenesis - Google Patents

Abstract

PURPOSE: Many angiogenesis inhibitors are developed recently for use in the treatment of angiogenesis diseases. But some inhibitors cause serious systematic toxicity in human in the amount of administration required for tumor treating activity, or weak angiogenesis inhibiting effect if they are safe for use to human. Also other compounds are difficult to produce or expensive. CONSTITUTION: The invention relates to the field of peptide chemistry. The invention has angiogenesis inhibiting activity and comprises derivatives of cringle 5 peptide fragment and cringle 5 fusion proteins including whole class of cringle 5 peptide fragment and fusion proteins and homologs or analogs of the fragments and the proteins.

Description

Novel antiangiogenic peptides, polynucleotides encoding them and methods for inhibiting angiogenesis

This application is filed on May 3, 1996, currently pending. Serial No. U.S. Patent Application No. 08 / 643,219, filed April 3, 1997, filed in part. Serial No. Partial Serial Application of 08 / 832,087.

Angiogenesis, the process by which new blood vessels form, is essential for normal physical activity, including replication, growth, and recovery of the site of injury. Although this process is not fully understood, it is thought to include the complex internal actions of molecules that regulate the growth of endothelial cells (primary cells of the capillaries). Under normal conditions, these molecules have been shown to maintain the microvascular system in a dormant state (i.e., no maternal growth at all) for an extended period of time that can last for up to several weeks, or in some cases for decades. In some cases (such as during the repair of an injury site), these same cells can proliferate and replace rapidly within 5 days. See, Folkman, J. and Shing, Y., The Journal of Biological Chemistry, 267. 16), 10931-10934, and Folkman, J. and Klagsbrun, M., Science, 235, 442-447 (1987).

Angiogenesis is a highly regulated process under normal conditions, but a number of diseases (characterized by angiogenic diseases) are induced by sustained unregulated angiogenesis. Stated differently, unregulated angiogenesis can directly cause certain diseases or exacerbate current pathological conditions. For example, angiogenesis of the eye is recognized as the most common cause of blindness and predominant in approximately 20 eye diseases. In certain diseases, such as arthritis, newly formed capillaries invade the joints and destroy cartilage. In diabetes, new capillaries formed in the retina attack the vitreous of the eye and bleed, causing blindness. Growth and metastasis of solid tumors are also dependent on angiogenesis [Foklkman, J., Cancer Research, 46, 467-473 (1986), Folkman, J., Journal of the National Cancer Institute, 82, 4 -6 (1989). For example, tumors that are enlarged beyond 2 mm have been found to necessarily expand by obtaining their own blood supply source and causing growth of new capillaries. Once these new blood vessels are buried in the tumor, they provide a means for circulation access to the tumor cells, allowing them to metastasize to distant sites such as the liver, lungs or bones. Weidner, N., et al. , The New England Journal of Medicine, 324 (1): 1-8 (1991).

To date, several natural angiogenic factors have been described and characterized [Fidler, J.I. And Ellis, L. M., Cell, 79: 185-189 (1994). Recently, O'Reilly et al. Has isolated and purified 38 kidadalton (kDa) proteins from the serum and urine of tumor-bearing mice that inhibit endothelial cell proliferation [O'Reilly, M. et al. , Cell, 79: 315-319 (1994) and International Patent Application WO95 / 29242, published November 2, 1995]. Microsequence analysis of the endothelial inhibitors revealed 98% sequence homology to the internal sequence of rat plasminogen. Angiostatin, named murine inhibitory fragment, is a peptide comprising the initial four kringle regions of murine plasminogen. Peptide fragments from the same region of human plasminogen (ie containing Kringle 1-4) also strongly inhibit the proliferation of capillary endothelial cells in vitro and in vivo. Natural plasminogen derived from the peptide fragments does not have a strong inhibitory effect.

Several angiogenesis inhibitors have recently been developed for use in the treatment of angiogenic diseases [Ref. Gasparini, G. and Harris, A. L., J. Clin. Oncol., 13 (3): 765-782, (1995)], have disadvantages associated with these compounds. For example, suramin is a potent angiogenesis inhibitor, but causes severe systemic toxicity in humans at the dosages needed for oncogenic activity. Compounds such as retinoids, interferons and antiestrogens are safe for human use but have a weak angiogenic effect. Still other compounds are difficult or expensive to manufacture.

Thus, there is a need for compounds useful for the treatment of angiogenic diseases in mammals. More specifically, angiogenesis that is safe for therapeutic use and that is selective or non-toxic to normal (ie, non-carcinoma) cells but selectively inhibits the proliferation of endothelial cells, such as angiogenesis. There is a need for inhibitors. Such compounds should also be easy to manufacture and cost effective.

Summary of the Invention

In principle embodiments, the present invention provides a Kringle 5 peptide compound of Formula 1 or a pharmaceutically acceptable salt, ester or prodrug thereof.

A-B-C-X-Y

In the above formula,

A is absent or is a nitrogen protecting group;

Y is absent or is a carboxylic acid protecting group;

B is 1 to about 197 natural amino acid residues, absent or corresponding to the sequence from about amino acid position 334 to amino acid position 530 of SEQ ID NO: 1;

C is R ¹ -R ² -R ³ -R ⁴ , wherein R ¹ is lysyl; R ² is leucine or arginyl; R ³ is tyrosyl, 3-I-tyrosyl or phenylalanyl; R ⁴ is aspartyl;

X is from 1 to about 12 natural amino acid residues and homologues and analogs thereof, absent or corresponding to sequence from amino acid position 535 to about amino acid position 546 of SEQ ID NO: 1.

The invention also provides Kringle 5 peptide compounds of Formula (II) or their pharmaceutically acceptable salts, esters or prodrugs.

AB ₁ -C ₁ -X ₁ -Y

In the above formula,

A is absent or is a nitrogen protecting group;

Y is absent or is a carboxylic acid protecting group;

B ₁ is not present or is from 1 to about 176 natural amino acid residues corresponding to the sequence from about amino acid position 334 to amino acid position 513 of SEQ ID NO: 1;

C ₁ is the sequence of amino acid positions 514 to 523 of SEQ ID NO: 1;

X ₁ is 1 to about 10 natural amino acid residues and homologues and analogs thereof, absent or corresponding to sequences in amino acid positions 524 to amino acid positions 533 of SEQ ID NO: 1.

The present invention also includes a method of treating a patient comprising a Kringle 5 peptide fragment or a compound containing a Kringle 5 fusion protein to a patient in need of angiogenesis inhibitory treatment.

The present invention also alone or for treating compounds containing Kringle 5 peptide fragments or Kringle 5 antagonists, Kringle 5 antiserum, Kringle 5 receptor agonists, and compounds containing Kringle 5 antagonists bound to antagonists and cytotoxic agents Compositions for treating patients in need of angiogenesis inhibiting treatment, including with pharmaceutically acceptable excipients and / or optionally sustained release compounds for forming the composition.

The present invention also includes compositions for treating diseases selected from the group consisting of cancer, arthritis, macular degeneration and diabetic retinopathy, comprising compounds containing Kringle 5 peptide fragments or Kringle 5 fusion proteins.

The invention also includes compositions comprising isolated single-chain or double-stranded polynucleotide sequences encoding Kringle 5 peptide fragments or fusion proteins. Such polynucleotide is preferably a DNA molecule. The invention also relates to a vector containing a Kringle 5 peptide fragment or fusion protein capable of expressing a Kringle 5 peptide fragment or Kringle 5 fusion protein when present in a cell and to a Kringle 5 peptide fragment or A composition comprising a cell containing a vector containing a DNA sequence encoding a Ringle 5 fusion protein. The invention also relates to a method for gene therapy in which a DNA sequence encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein or Kringle 5 peptide fragment conjugate is introduced into a patient to modify Kringle 5 levels in vivo.

The invention also comprises the steps of (a) exposing a mammalian plasminogen to a human or swine elastase in a ratio of about 1: 100 to about 1: 300 to form a mixture of said plasminogen and said elastase. ; (b) culturing the mixture; And (c) separating the Kringle 5 peptide fragment from the mixture.

The invention also comprises the steps of (a) exposing a mammalian plasminogen to a human or swine elastase in a ratio of about 1: 100 to about 1: 300 to form a mixture of said plasminogen and said elastase. ; (b) culturing the mixture; (c) separating the protein conjugate of the Kringle 5 peptide fragment from the mixture; (d) exposing the protein conjugate of the Kringle 5 peptide fragment to pepsin at a ratio of about 1: 0.2 to form a mixture of the pepsin and the plasminogen; And (e) separating the Kringle 5 peptide fragment from the mixture. Alternatively, kringle 5 peptide fragment or kringle 5 fusion protein (a) isolating a polynucleotide encoding said kringle 5 peptide fragment or kringle 5 fusion protein; (b) cloning the polynucleotide into an expression vector; (c) transforming the vector into a suitable host cell; And (d) growing the host cell under conditions suitable for expression of the soluble Kringle 5 peptide fragment or Kringle 5 fusion protein.

The present invention relates to the field of peptide chemistry. More specifically, the present invention provides methods and uses for the preparation of peptides containing amino acid sequences substantially similar to the corresponding sequences of the Kringle 5 region of mammalian plasminogen, pharmaceutical compositions containing the peptides, angiostatin An antibody specific for angiostatin receptor, a method for detecting and measuring angiostatin, a cytotoxic agent bound to angiostatin protein, and a method for treating a disease arising from or worsening from angiogenesis.

1 shows the amino acid sequence of human plasminogen (SEQ ID NO: 1).

2 compares homology in amino acid sequences of human (SEQ ID NO: 34), mouse (SEQ ID NO: 35), Rhesus monkey (SEQ ID NO: 36), bovine (SEQ ID NO: 37), and swine (SEQ ID NO: 38) Kringle 5 will be.

3 shows the DNA sequence of human plasminogen (SEQ ID NO: 12).

4 is a graph of the proliferation inhibitory activity of single doses of various Kringle fragments on bovine capillary endothelial (BCE) cells when tested in an in vitro cell proliferation assay.

5 is a map of expression vector pHil-D8 containing recombinant protein secretion leader sequences.

FIG. 6 is a photo scan of Coomassie blue stained SDS-PAGE gel of culture supernatant (10 μL / lane) of Pichia pastoris expressing Kringle 5 peptide fragment or fusion protein. Lanes 1, 6 and 10: negative control; Lanes 2, 3 and 4: 3 separate clones expressing K5A; Lane 5: the clone expressing K5F; Lanes 7 and 8: clones expressing K4-5A; Lane 9: the clone expressing K4-5F. Arrows indicate protein bands of K5A (approximately 11 kDa) and K4-5F (approximately 20 kDa). Molecular weight markers are shown in lanes before lanes 1 and 10.

7 shows E. coli expressing a Kringle 5 peptide fragment or fusion protein. Scanned Coomassie blue colored SDS-PAGE gels of E. coli strains are shown. Unless otherwise indicated, each lane contains 10 μl of culture material equivalent to 10 A ₆₀₀ . Lane 1: low molecular weight marker; Lane 2: K5A / pET32a, total culture; Lane 3: K5A / pET32a, total culture (1/10 amount of lane 2); Lane 4: K5A / pET32a, soluble fraction; Lane 5: K5A / pET32a, insoluble fraction; Lane 6: K4-5A / pET32a, total culture; Lane 7: K4-5A / pET32a, total culture (1/10 amount of lane 6); Lane 8: K4-5A / pET32a, soluble fraction; Lane 9: K4-5A / pET32a, an insoluble fraction; Lane 10: K4-5A / pGEX-4T-2, total culture; Lane 11: K4-5A / pGEX-4T-2, soluble fraction; Lane 12: K4-5A / pGEX-4T-2, insoluble fraction; Lane 13: Kringle 5 standard; Lane 14: high molecular weight marker.

The term "Kringle 5" (hereafter K5) as used herein refers to a mammal having three disulfide bonds that aid in specific three-dimensional identification as defined by the fifth kringle region of the mammal's plasminogen molecule. Means the area of plasminogen in an animal. One of the disulfide bonds binds a cysteine residue located at amino acid positions 462 and 541, the second binds a cysteine residue located at amino acid positions 483 and 524, and the third binds a cysteine residue located at amino acid positions 512 and 536. do. The amino acid sequence of the complete mammalian plasminogen molecule (human plasminogen molecule) comprising the Kringle 5 region is shown in FIG. 1 (SEQ ID NO: 1).

As used herein, the term "Kringle 5 peptide fragment" has (including) an α-N-terminus at about amino acid position 443 and an α-N-terminus at about position 546 of a plasminogen of a natural mammal. By peptides of 4 to 104 amino acids having substantial sequence homology to the corresponding peptide fragment of mammalian plasminogen. The overall length of the Kringle 5 peptide fragment may vary depending on how the Kringle 5 peptide is obtained or the sequence may vary slightly depending on the species obtained. For example, certain forms of Kringle 5 peptide fragments can be prepared by proteolysis of glu-plasminogen, lys-plasminogen or miniplasminogen using the enzyme human or porcine elastase. When prepared by this method, the α-N-terminal amino acid may begin at amino acid positions 443, 449 or 454, although the α-C-terminal of the peptide residue at amino acid position about 543 of SEQ ID NO: 1 may be. Thus, the total length of a Kringle 5 peptide fragment resulting from human or porcine elastase degradation of glu-plasminogen, lys-plasminogen or miniplasminogen can be 101, 95 or 90 amino acids. A summary of these Kringle 5 peptide fragments is shown in Table 1. When prepared by the above-mentioned method, these three, about 60% of the fragments are 95 amino acids in length, about 35% of the fragments are 101 amino acids in length, and about 5% of the fragments are 90 amino acids in length A pool of fragments is obtained. If desired, these various fragments can be further purified by reverse phase HPLC, a technique known to those skilled in the art. Despite varying lengths, the K5 peptide fragments of the present invention may have the sequence Lys-Leu-Tyr-Asp (ie, amino acid position 531 to amino acid position 534 of SEQ ID NO: 1) or Asn-Pro-Asp-Gly-Asp-Val-Gly -Gly-Pro-Trp (ie, amino acid position 514 to amino acid position 523 of SEQ ID NO: 1) or analogs thereof.

The term "Kringle 5 fusion protein" as used herein refers to a polypeptide comprising an amino acid sequence derived from two or more proteins, which is one of the K4 peptide fragments. Fusion proteins are formed by expressing polynucleotides in which the coding sequence for a Kringle 5 peptide fragment is associated with one or more coding sequences of a polypeptide such that two (or more) reading frames are in the frame. Preferred Kringle 5 fusion proteins include Kringle 5 peptide fragments in Kringle 4 (K4), Kringle 3-4 (K3-4), Kringle 2-4 (K2-4) and Kringle 1-4 (K1-). It is fused to the corresponding sequence of human plasminogen as in 4). Preferred K5 fusion proteins are Kringle 4-5 (K4-5). Another example of a Kringle 5 fusion protein of the invention is K4-5, which is further bound to a K5 peptide fragment or biological tag. Such fusion proteins may or may not be separated into separate proteins from which they are derived.

As used herein, the term "conjugate of K5 peptide fragment" refers to a Kringle 5 peptide fragment that is chemically coupled to another protein to form the conjugate. Examples of conjugates of Kringle 5 peptide fragments are Kringle 5 peptide fragments that are coupled to peptide fragments from albumin or other Kringle regions of mammalian plasminogen. The molecular weight of the conjugate of the Kringle 5 peptide fragment is about 1,000 to about 25,000 kDa.

The term "substantial sequence homology" as used herein refers to at least about 60%, preferably at least about 70%, more preferably at least about 80%, most preferably at least amino acids of the corresponding peptide sequence of human plasminogen. Preferably about 95% or more identical. Sequences with substantial sequence homology to human plasminogen are referred to as "homologs". In addition to having substantial sequence homology, homologues of the invention have been shown to have biological activity (ie, angiogenesis inhibitory activity) similar to the K5 peptide fragments described herein. The amino acid sequence or number of amino acids of the Kringle 5 peptide fragment may vary depending on the species or the method of preparation, and in some cases, the total number of amino acids in the Kringle 5 peptide fragment may not be precisely defined. If these sequences are at least 73% of their amino acids identical, the amino acid sequence of the Kringle 5 peptide fragment is understood to be substantially similar among the species and the method of making the Kringle 5 peptide fragment is dependent on the corresponding amino acid sequence of human plasminogen. Cringle 5 peptide fragments having substantial sequence homology to. 2 shows the amino acid sequence of human Kringle 5 peptide (SEQ ID NO: 34) with 95 amino acids, the sequence of Kringle 5 fragment from rat (SEQ ID NO: 35), rhesus monkey (SEQ ID NO: 36), bovine (SEQ ID NO: 37), and A comparison with pig (SEQ ID NO: 38) plasminogen is shown.

The invention also relates to amino acid residue sequences similar to the sequences described herein, as demonstrated to have biological activity similar to the Kringle 5 peptide fragments described herein and their fusion proteins. It is known in the art that modifications and variations can be made without substantially altering the biological function of the peptide. In such a change, substitution of similar amino acid residues may be made based on the relative similarity of the side chain substituents, eg, their size, charge, hydrophobicity, hydrophilicity, and the like. Modifications to the described types can improve the efficacy or peptide's stability or pharmacodynamics against enzymatic degradation. Thus, sequences recognized as being within the scope of the present invention include analogous sequences characterized by the type of change or change in amino acid residue sequence that does not alter the basic properties and biological activity of the aforementioned K5 peptide fragments and / or fusion proteins. have.

K5 peptide fragments or K5 fusion proteins of the invention can be characterized based on their strength when tested for in vitro growth inhibition ability of bovine capillary (BCE) cells. The data in Table 1 and FIG. 4 show that when a K5 peptide fragment having a sequence from amino acid positions 443 to amino acid position 543 of SEQ ID NO: 1 is compared to a Kringle 5 peptide fragment having a sequence from amino acid positions 443 to amino acid position 546 of SEQ ID NO: 1 , Upon inhibition of BCE cell proliferation), increases activity approximately 300-fold and increases approximately 800-fold when compared to Kringle 1-4 peptide fragments.

As used herein, the term "isolated" means a substance that has been removed from its original environment (eg, the natural environment, if present naturally). For example, natural polynucleotides or polypeptides present in living animals are not isolated, but identical polynucleotides or DNAs or polypeptides isolated from some or all of the coexisting materials in the natural system are isolated. Such polynucleotides may be part of a vector and / or such polynucleotides or polypeptides may be part of a composition, and the vector or composition may be separated without being part of the natural environment.

The term “primer” refers to a specific oligonucleotide sequence that is complementary to the target nucleotide sequence and used to hybridize to the targeted nucleotide sequence and is catalyzed by nucleotide polymerization catalyzed by DNA polymerase, RNA polymerase or reverse transcriptase. It serves as a starting point for.

The term “probe” refers to a defined nucleic acid fragment (or nucleotide analogue fragment, ie, PNA) that can be used to identify specific DNA present in a sample comprising complementary sequences.

A "recombinant polypeptide" as used herein is not at least naturally related and / or not linked by origin or manipulation to all or part of a polypeptide bound to a polypeptide except that it is naturally linked. Means a polypeptide. Recombinant or derived polypeptides are not necessarily translated from the indicated nucleic acid sequences. It may also occur by methods involving expression of chemical synthetic or recombinant expression systems.

As used herein, the term "synthetic peptide" refers to a polymer type of amino acids of a certain length, which can be chemically synthesized by methods known to those of ordinary skill in the art. These synthetic peptides are useful for various purposes.

A "purified polynucleotide" refers to a polynucleotide in which the polynucleotide is essentially free of naturally related proteins, that is, contains less than about 50%, preferably less than about 70%, more preferably less than about 90% It means a fragment thereof. Techniques for purifying polynucleotides of interest are well known in the art and include, for example, disrupting cells containing polynucleotides with chaotropic agents to ion-exchange chromatography, affinity chromatography and polynucleotide (s) and proteins. Separation by sedimentation according to density. Thus, a "purified polypeptide" means that the polypeptide contains essentially no freely relevant cellular components, i.e., less than about 50%, preferably less than about 70%, more preferably less than about 90%. Means a polypeptide or a fragment thereof. Purification methods are known in the art.

As used herein, "polypeptide" refers to the molecular chain of amino acids and does not mean a product of a particular length. Thus, peptides, oligopeptides and proteins are not included within the definition of polypeptide. The term also means post-modification of the polypeptide, eg, glycosylation, acetylation, phosphorylation and the like.

The terms “recombinant host cell”, “host cell”, “cell”, “cell line”, “cell culture” and other eukaryotic cell lines cultured as other microorganisms or single cell bodies refer to recombinant vectors or other transcribed DNA. By a cell that can be used or used as a receptor, it includes the original progeny of the original cell that has been transfected.

As used herein, the term "replicon" refers to a genetic factor, such as a plasmid, chromosome or virus, that acts as its own unit of polynucleotide replication in a cell.

A "vector" is a replication unit to which another polynucleotide fragment is attached, such as to cause replication and / or expression of an attached fragment.

The term "regulatory sequence" means a polynucleotide sequence that is essential for carrying out the expression of the coding sequence to which they are bound. The nature of such regulatory sequences differs depending on the host organism. In prokaryotic cells, such regulatory sequences are generally promoters, ribosomal binding sites and terminators; In eukaryotic cells, such regulatory sequences are generally promoters, terminators, and in some instances, enhancers. Thus, the term “regulatory sequence” includes all minimal components whose presence is essential for expression, and may also include additional components whose presence is advantageous, eg, leader sequences.

By "functionally coupled" is meant a state in which the described components exist in a relationship that allows them to function in their intended manner. Thus, for example, a regulatory sequence “functionally linked” to a coding sequence is one that is bound in such a way that expression of the coding sequence is performed in a manner consistent with the regulatory sequence.

The term “open reading frame” or “ORF” refers to a region of a polypeptide sequence that encodes a polypeptide; The region may represent part of the coding sequence or the entire coding sequence.

A "coding sequence" is a polynucleotide sequence that is transcribed into mRNA and translated into a polypeptide when placed under the control of a suitable regulatory sequence. The boundary of the coding sequence is determined by the translation initiation codon at the 5'-end and the translation termination codon at the 3'-end. Coding sequences may include, but are not limited to, mRNA, cDNA, and recombinant polynucleotide sequences.

The term “transformation” means the insertion of an exogenous polynucleotide into a host cell, regardless of the method used for insertion. For example, direct injection, transduction or f-bite is included. Exogenous polynucleotides can be maintained as non-fusion vectors, eg, plasmids, or otherwise fused into the host genome.

"Purified product" refers to a product preparation isolated from the cellular components typically associated with the product, and other types of cells that may be present in the sample of interest.

All peptide sequences are designated according to the conventions generally employed, with the α-N-terminal amino acid residues on the left and the α-C-terminal on the right. The term "α-N-terminus" as used herein refers to the free alkyl-amino group of amino acids in the peptide, and the term "α-C-terminus" refers to the free alpha-carboxylic acid terminus of the amino acids in the peptide. .

The term "N-protecting group" as used herein means a group for protecting the α-N-terminus of an amino acid or peptide or otherwise protecting the amino group of an amino acid or peptide against undesirable reactions during the synthesis process. do. Commonly used N-protective groups are described in the following references, which are incorporated herein by reference (Greene, "Protective Groups In Organic Synthesis," John Wiley & Sons, New York (1981)). In addition, protective groups can be used as prodrugs that are readily degraded in vivo, for example by enzymatic hydrolysis, to release biologically active agents. N-protecting groups include lower alkanoyl groups such as formyl, acetyl ("Ac"), propionyl, pivaloyl, t-butylacetyl and the like; Other acyl groups include 2-chloroacetyl, 2-bromoacetyl, trifluoroacetyl, trichloroacetyl, phthalyl, o-nitrophenoxyacetyl, α-chlorobutyryl, benzoyl, 4-chlorobenzoyl, 4-bro Mobenzoyl, 4-nitrobenzoyl and the like; Sulfonyl groups include benzenesulfonyl, p-toluenesulfonyl, and the like; Carbamate forming groups include benzyloxycarbonyl, p-chlorobenzyloxycarbonyl, p-methoxybenzyloxycarbonyl, p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl, p-bromobenzyloxy Carbonyl, 3,4-dimethoxybenzyloxycarbonyl, 3,5-dimethoxybenzyloxycarbonyl, 2,4-dimethoxybenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 2-nitro-4 , 5-dimethoxybenzyloxycarbonyl, 3,4,5-trimethoxybenzyloxycarbonyl, 1- (p-biphenylyl) -1-methylethoxycarbonyl, α, α-dimethyl-3, 5-dimethoxybenzyloxycarbonyl, benzhydryloxycarbonyl, t-butyloxycarbonyl, diisopropylmethoxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl, methoxycarbonyl, allyloxycarbon Neyl, 2,2,2-trichloroethoxycarbonyl, phenoxycarbonyl, 4-nitrophenoxycarbonyl, fluorenyl-9-methoxycarbonyl, cyclopentyloxycarbonyl, adamantyloxycarbon Neyl, Cyclohexyloxycarbonyl , Phenylthiocarbonyl and the like; Arylalkyl groups include benzyl, triphenylmethyl, benzyloxymethyl, 9-fluorenylmethyloxycarbonyl (Fmoc) and the like, and silyl groups include trimethylsilyl and the like. Preferred N-protecting groups are formyl, acetyl, benzoyl, pivaloyl, t-butylacetyl, phenylsulfonyl, benzyl, t-butyloxycarbonyl (Boc) and benzyloxycarbonyl (Cbz). For example, lysine can be protected at the α-N-terminus with an acid labile group (eg Boc) and protected at the ε-N-terminus with a base labile group (eg Fmoc) and then selectively deprotected during synthesis. You can.

The term "carboxy protecting group" as used herein refers to a carboxylic acid protecting ester or amide group used to block or protect the carboxylic acid functionality while the other functional moieties involved in the reaction of the compound perform their functions. Carboxy protecting groups are described in the following references, which are hereby incorporated by reference [Greene, "Protective Groups In Organic Synthesis" pp. 152-186 (1981). Carboxy protecting groups can also be used as prodrugs that are readily degraded in vivo, for example by enzymatic hydrolysis, to release biologically active agents. Such carboxy protection groups are well known to those skilled in the art and are described in the protection of carboxyl groups in penicillins and cephalosporins described in US Pat. Nos. 3,840,556 and 3,719,667, which are incorporated herein by reference. It is widely used. Representative carboxy protecting groups include C ₁ -C ₈ lower alkyl (eg methyl, ethyl or t-butyl, etc.); Arylalkyl such as phenethyl or benzyl and substituted derivatives thereof such as alkoxybenzyl or nitrobenzyl groups; Arylalkenyl such as phenylethenyl and the like; Aryl and substituted derivatives thereof, such as 5-indanyl; Dialkylaminoalkyl such as dimethylaminoethyl and the like; Acetoxymethyl, butyryloxymethyl, valeryloxymethyl, isobutyryloxymethyl, isovaleryloxymethyl, 1- (propionyloxy) -1-ethyl, 1- (pivaloyloxy) -1-ethyl Alkanoyloxyalkyl such as 1-methyl-1- (propionyloxy) -1-ethyl, pivaloyloxymethyl, propionyloxymethyl and the like; Cycloalkanoyloxyalkyl groups such as cyclopropylcarbonyloxymethyl, cyclobutylcarbonyloxymethyl, cyclopentylcarbonyloxymethyl, cyclohexylcarbonyloxymethyl and the like; Aroyloxyalkyl such as benzoyloxymethyl, benzoyloxyethyl and the like; Arylalkylcarbonyloxyalkyl such as benzylcarbonyloxymethyl, 2-benzylcarbonyloxyethyl and the like; Alkoxycarbonylalkyl or cycloalkyloxycarbonylalkyl such as methoxycarbonylmethyl, cyclohexyloxycarbonylmethyl, 1-methoxycarbonyl-1-ethyl and the like; Alkoxycarbonyloxyalkyl or cycloalkyl such as methoxycarbonyloxymethyl, t-butyloxycarbonyloxymethyl, 1-ethoxycarbonyloxy-1-ethyl, 1-cyclohexyloxycarbonyloxy-1-ethyl, and the like Oxycarbonyloxyalkyl; Aryloxycarbonyloxyalkyl such as 2- (phenoxycarbonyloxy) ethyl, 2- (5-indanyloxycarbonyloxy) ethyl and the like; Alkoxyalkylcarbonyloxyalkyl such as 2- (1-methoxy-2-methylpropane-2-yloxy) ethyl and the like; Arylalkyloxycarbonyloxyalkyl such as 2- (benzyloxycarbonyloxy) ethyl and the like; Arylalkenyloxycarbonyloxyalkyl such as 2- (3-phenylpropen-2-yloxycarbonyloxy) ethyl and the like; alkoxycarbonylaminoalkyl such as t-butyloxycarbonylaminomethyl and the like; Alkylaminocarbonylaminoalkyl such as methylaminocarbonylaminomethyl and the like; Alkanoylaminoalkyl such as acetylaminomethyl and the like; Heterocyclic carbonyloxyalkyl such as 4-methylpiperazinylcarbonyloxymethyl and the like; Dialkylaminocarbonylalkyl, such as dimethylaminocarbonylmethyl, diethylaminocarbonylmethyl, and the like; (5-t-butyl-2-oxo-1,3-dioxolen-4-yl) methyl, and the like (5- ( Lower alkyl) -2-oxo-1,3-dioxolen-4-yl) alkyl; And (5-phenyl-2-oxo-1,3-dioxolen-4-yl) alkyl such as (5-phenyl-2-oxo-1,3-dioxolen-4-yl) methyl and the like.

Representative amide carboxy protective groups are aminocarbonyl and lower alkylaminocarbonyl groups.

Preferred carboxy-protected compounds of the invention are those in which the protected carboxy group is a lower alkyl, cycloalkyl or arylalkyl ester, for example methyl ester, ethyl ester, propyl ester, isopropyl ester, butyl ester, secondary-butyl ester , Isobutyl ester, amyl ester, isoamyl ester, cyclohexyl ester, phenylethyl ester and the like or alkanoyloxyalkyl, cycloalkanoyloxyalkyl, aroyloxyalkyl or arylalkylcarbonyloxyalkyl ester. Preferred amide carboxy protective groups are lower alkylaminocarbonyl groups. Aspartic acid, for example, is protected at the α-C-terminus by an acid labile group (e.g. t-butyl) and protected at the β-C-terminus by a hydrogenation labile group (e.g. benzyl) and then selectively during synthesis. Can be deprotected.

As used herein, the term “lower alkylaminocarbonyl” refers to a group of —C (O) NHR ^{10 that} caps the α-C-terminus of the synthetic Kringle 5 peptide fragment, wherein R ¹⁰ is C ₁ -C ₄ Alkyl).

The term "aminocarbonyl" as used herein refers to the group -C (O) NH ₂ that caps the α-C-terminus of the synthetic Kringle 5 peptide fragment.

As used herein, the term “prodrug” refers to a compound that is rapidly converted in vivo to produce the parent compound, eg, by enzymatic hydrolysis in the blood. Reference is made to the following references, which are incorporated herein by reference: T. Higuchi and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the A.C.S. Symposium Series and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, Americana Pharmaceutical Association and Permagon Press, 1987].

As used herein, the term “pharmaceutically acceptable prodrug” means (1) within the scope of safety medicinal judgment, without excessive toxicity, irritation, allergic reactions, etc., in contact with tissues of humans and lower animals. By prodrugs of the compounds of the invention suitable for use, with a suitable benefit-to-risk ratio and effective for their intended use, and (2) optionally, zwitterionic forms of the parent compound.

The term "activated ester derivative" as used herein refers to acid halides such as acid chlorides, and anhydrides derived from alkoxycarbonyl halides such as, but not limited to, formic and acetic anhydrides, isobutyloxycarbonylchloride and the like, N -Hydroxysuccinimide-derived ester, N-hydroxyphthalimide-derived ester, N-hydroxybenzotriazole-derived ester, N-hydroxy-5-norbornene-2,3-dicarboxamide-derived ester, It means an activated ester including 2,4,5-trichlorophenol-derived ester and the like.

As used herein, the term "angiogenesis inhibitory activity" means the ability of a molecule to inhibit the growth of blood vessels.

The term "endothelial inhibitory activity" as used herein generally refers to the growth or migration of intestinal capillary endothelial cells in culture in the presence of fibroblast growth factor or other known growth factor that inhibits angiogenesis. Refers to the ability of the molecule to inhibit.

As used herein, the term “ED ₅₀ ” refers to inhibiting vascular growth, inhibiting the growth of intestinal capillary endothelial cells, or inhibiting the migration of endothelial cells in culture in the presence of fibroblast growth factor or other known growth factors. Abbreviation for the dosage of Kringle 5 peptide fragment or fusion protein effective to inhibit growth or migration by half.

As used herein, in most cases, the names of natural amino acids and aminoacyl residues used herein are defined by Nomenclature of α-Amino Acids (Recommendations, 1974), Biochemistry, 14 (2), (1975) in accordance with the naming convention proposed by the IUPAC Commission on the Nomenclature of Organic Chemistry and the IUPAC-IUB Commission on Biochemical Nomenclature. Thus, the terms "Ala", "Arg", "Asn", "Asp", "Cys", "Gln", "Glu", "Gly", "His", "Ile", "Leu", "Lys" , "Met", "Phe", "Pro", "Ser", "Thr", "Trp", "Tyr" and "Val" are amino acids alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine , Histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine and their corresponding aminoacyl residues in peptides in L-, D- or D, L- form do. Unless specific coordination is indicated, those skilled in the art will recognize that the α-carbons of amino acids and aminoacyl residues in the peptides described in this specification and the appended claims are symmetric or otherwise "D-" compared to the symmetric molecule glycine. It is understood that it is a natural or "L" configuration except for the indicated amino acids.

The term "3-I-Tyr" as used herein refers to L-, D-, or D, L-tyrosyl residues in which the ortho-hydrogen radicals for phenolic hydroxy have been replaced with iodine radicals. Iodine radicals may be radioactive or nonradioactive.

The invention also includes amino acid residues having non-natural side chain residues such as homophenylalanine, phenylglycine, norvaline, norleucine, ornithine, thiazoylalanine (2-, 4- and 5-substituted) and the like.

Accordingly, the invention provides an Kringle 5 peptide fragment and Kringle 5 fusion protein having an angiogenesis inhibitory activity and comprising the entire class of Kringle 5 peptide fragments and fusion proteins described herein and homologs or analogs of said fragments and proteins. It is believed to include derivatives of. The present invention also provides a method for preparing a Kringle 5 peptide fragment or fusion protein, that is, (1) proteolytic digestion of isolated plasminogen of a mammal, and (2) amino acid sequence of Kringle 5 peptide fragment or fusion protein. Expression of a recombinant molecule having a polynucleotide encoding and (3) independent of methods by solid phase synthesis techniques known to those skilled in the art.

In one embodiment, the invention is a 88-mer peptide wherein B is initiated at Val ⁴⁴³ of SEQ ID NO: 1 and terminated at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of structural BCX, which is a 9-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and terminating at Ala ⁵⁴³ .

In another embodiment, the present invention relates to an antibody comprising: B is an 82-mer peptide starting at Val ⁴⁴⁹ in SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of structural BCX, which is a 9-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and terminating at Ala ⁵⁴³ .

In another embodiment, the present invention provides a peptide comprising: B is a 77-mer peptide starting at Val ⁴⁵⁴ of SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of structural BCX, which is a 9-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and terminating at Ala ⁵⁴³ .

In another embodiment, the present invention relates to an antibody, wherein B is an 88-mer peptide starting at Val ⁴⁴³ of SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of formula BCX wherein X is a 12-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and ending at Phe ⁵⁴⁶ .

In another embodiment, the present invention provides an antibody, wherein B is an 82-mer peptide starting at Val ⁴⁴⁹ in SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of formula BCX wherein X is a 12-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and ending at Phe ⁵⁴⁶ .

In another embodiment, the present invention provides a peptide comprising: B is a 77-mer peptide starting at Val ⁴⁵⁴ of SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of formula BCX wherein X is a 12-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and ending at Phe ⁵⁴⁶ .

In another embodiment, the present invention relates to an antibody comprising: B is a 176-mer peptide starting at Val ³⁵⁵ of SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of Formula BCX, which is a 12-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and terminating at Ala ⁵⁴³ .

In another embodiment, the present invention relates to compounds of the invention, wherein B is a 176-mer peptide starting at Val ³⁵⁵ of SEQ ID NO: 1 and terminating at Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X provides a peptide of formula BCX wherein X is a 12-mer peptide starting at Tyr ⁵³⁵ of SEQ ID NO: 1 and ending at Phe ⁵⁴⁶ .

In another embodiment, the present invention provides that A is acetyl; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; Provided is a peptide of the structural ACY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X is tyrosyl; Provided is a peptide of the structural ACXY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is a dipeptide starting at amino acid position Pro ⁵²⁹ of SEQ ID NO: 1 and terminating at amino acid position Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; Provided is a peptide of the structure ABCY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is a dipeptide starting at amino acid position Pro ⁵²⁹ of SEQ ID NO: 1 and terminating at amino acid position Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; Provided is a peptide of the structure ABCY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is a hexapeptide starting at amino acid position Tyr ⁵²⁵ of SEQ ID NO: 1 and terminating at amino acid position Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X is tyrosyl; Provided is a peptide of the structure ABCXY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is arginyl; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X is tyrosyl; Provided is a peptide of the structure ABCXY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is a dipeptide starting at amino acid position Pro ⁵²⁹ of SEQ ID NO: 1 and terminating at amino acid position Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X is 3-I-tyrosyl; Provided is a peptide of the structure ABCXY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B is a dipeptide starting at amino acid position Pro ⁵²⁹ of SEQ ID NO: 1 and terminating at amino acid position Arg ⁵³⁰ ; C is a 4-mer peptide wherein R ¹ and R ⁴ are as defined above, R ² is leucine and R ³ is tyrosyl; X is tyrosyl; Provided is a peptide of the structure ABCXY wherein Y is aminocarbonyl.

In another embodiment, the present invention provides that A is acetyl; B ₁ and X ₁ are absent and C is a 10-mer peptide starting at amino acid position Arg ⁵¹⁴ of SEQ ID NO: 1 and terminating at amino acid position Trp ⁵²³ ; Provides peptides of the structure AB ₁ -C ₁ -X ₁ -Y wherein Y is aminocarbonyl.

Exemplary compounds of the invention include A is acetyl, Y is aminocarbonyl, and B-C-X is (a) the sequence of amino acid positions 355-543 of SEQ ID NO: 1; (b) the sequences of amino acid positions 355-546 of SEQ ID NO: 1; (c) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (d) the sequences of amino acid positions 449-543 of SEQ ID NO: 1; (e) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; (f) the sequences of amino acid positions 443-546 of SEQ ID NO: 1; (g) the sequences of amino acid positions 449-546 of SEQ ID NO: 1; (h) the sequences of amino acid positions 454-546 of SEQ ID NO: 1; (i) the sequences of amino acid positions 525-535 of SEQ ID NO: 1; (j) the sequences of amino acid positions 529-535 of SEQ ID NO: 1; And (k) the sequences of amino acid positions 530-535 of SEQ ID NO: 1.

Other preferred compounds are those wherein A is acetyl, Y is aminocarbonyl, and B ₁ -C ₁ -X ₁ is the sequence of amino acid positions 514-523 of SEQ ID NO: 1.

K5 fragments or K5 fusion proteins can be obtained by expressing a recombinant molecule comprising a polynucleotide having a sequence encoding a protein having a Kringle 5 peptide fragment and then purifying the expressed peptide product. Menhart, N , et al., Biochemistry, 32: 8799-8806 (1993). The DNA sequence of human plasminogen is published [Brown, M.J. et al. Fibrinolysis, 5 (4): 257-260 (1991)], FIGS. 3A and 3B (SEQ ID NO: 12). The polynucleotide sequence encoding Kringle 5 begins at nucleotide position about 1421 of SEQ ID NO: 12 and terminates at nucleotide position about 1723.

Genes encoding K5 peptide fragments or K5 fusion proteins can be used to (1) isolate messenger RNA from tissue or cells, (2) generate the corresponding DNA sequence using reverse transcriptase, and (3) use suitable primers. Polymerase chain reaction (PCR) can be isolated from cells or tissues that express high levels of human plasminogen or K5 fusion protein by amplifying a DNA sequence encoding for an active K5 amino acid sequence or a fusion protein thereof. In addition, polynucleotides encoding K5 peptide fragments or K5 fusion proteins may be incorporated into commercially available expression vectors (e.g., pBR322, pUC vectors, etc.) or expression / purification vectors (e.g., GST fusion vectors: Pharmacia ^R , Piscataway, NJ). After cloning, it can be expressed in a suitable prokaryotic, viral or eukaryotic host. Purification can then be carried out in conventional manner or for commercial expression / purification systems, according to the manufacturer's instructions.

K5 peptide fragments or K5 fusion proteins may also be synthesized by solid phase standard chemistry known to those skilled in the art. See, eg, Steward and Young; Steward, J.M. And Kringle 5 peptide fragment by solid phase chemistry using an Applied Biosystem synthesizer according to the method described by Young, JD, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Company, Rockford, IL (1984). Can be synthesized. Similarly, multiple fragments can also be combined together to synthesize larger fragments. These synthetic peptide fragments can also substitute amino acids at specific positions to test for angiogenesis inhibitory activity in vitro and in vivo. For solid phase peptide synthesis, a summary of numerous techniques can be found in J.M. Stewart and J.D. Young, Solid Phase Peptide Synthesis, W.H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973. For conventional liquid phase synthesis, see G. Schroder and K. Lupke, The Peptides, Vol. 1, Academic Press (New York)]. In general, these methods include the step of continuously adding one or more amino acids or suitably protected amino acids to the growing peptide chain. Typically, the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid is then used in solution by attaching the following amino acid to a sequence having complementary (amino or carboxyl) groups suitably protected under conditions suitable for forming an amide bond or attached to an inert solid support. The protecting group is then removed from the newly added amino acid residue and the next amino acid (suitably protected) is added continuously. After the desired amino acids are all bound to the appropriate sequence, the remaining protecting groups (and solid supports) are subsequently or simultaneously removed to obtain the final polypeptide. This general method can be modified simply by, for example, coupling a protected prepeptide to a suitably protected dipeptide (under conditions that do not racemize chiral centers) to form pentapeptides after deprotection. One or more amino acids can be added to the chain at the same time.

Particularly preferred methods for preparing compounds of the present invention include solid phase peptide synthesis which protects the amino acid α-N-terminus with an acid or base sensitive group. Such protecting groups should have stable properties against peptide bond formation conditions while being able to easily remove the growing peptide chain without breaking or chimeric centers contained in the chain. Suitable protecting groups include 9-fluorenylmethyloxycarbonyl (Fmoc), t-butyloxycarbonyl (Boc), benzyloxycarbonyl (Cbz), biphenylisopropyloxycarbonyl, t-amyloxycarbonyl, Isobornyloxycarbonyl, α, α-dimethyl-3,5-dimethoxybenzyloxycarbonyl, o-nitrophenylsulphenyl, 2-cyano-t-butyloxycarbonyl and the like. 9-fluorenylmethyloxycarbonyl (Fmoc) protecting groups are particularly preferred for the synthesis of Kringle 5 peptide fragments. Other preferred side chain protecting groups are, for side chain amino groups such as lysine and arginine, 2,2,5,7,8-pentamethylchroman-6-sulfonyl (pmc), nitro, p-toluenesulfonyl, 4- Methoxybenzenesulfonyl, Cbz, Boc and adamantyloxycarbonyl; For tyrosine, benzyl, o-bromobenzyloxycarbonyl, 2,6-dichlorobenzyl, isopropyl, t-butyl (t-Bu), cyclohexyl, cyclopentyl and acetyl (Ac); For serine, t-butyl, benzyl and tetrahydropyranyl; For histidine, trityl, benzyl, Cbz, p-toluenesulfonyl and 2,4-dinitrophenyl; For tryptophan, formyl; For aspartic acid and glutamic acid, benzyl and t-butyl and cysteine for triphenylmethyl (trityl). In solid phase peptide synthesis methods, the α-C-terminal amino acid is attached to a suitable solid support or resin. Suitable solid supports useful for this synthesis are materials which are inert to the reagents and reaction conditions of the staged condensation-deprotection reaction as well as insoluble in the medium used. A preferred solid support for the synthesis of α-C-terminal carboxy peptide is 4-hydroxymethylphenoxymethyl-copoly (styrene-1% divinylbenzene). Preferred solid supports for the α-C-terminal amide peptide are 4- (2 ', 4'-dimethoxyphenyl-Fmoc-aminomethyl) phenoxyacetamido, available from Foster City, Calif. Ethyl resin. α-C-terminated amino acids are N, N'-dicyclohexylcarbodiimide (DCC), N, N'-diisopropylcarbodiimide (DIC) or O-benzotriazol-1-yl-N, N 4-dimethylaminopyridine (DMAP), 1-hydroxybenzotriazole (HOBT), benzotriazol-1-yljade, using N ', N'-tetramethyluronium-hexafluorophosphate (HBTU) Dichloromethane or by coupling to the resin with or without ci-tris (dimethylamino) phosphonium-hexafluorophosphate (BOP) or bis (2-oxo-3-oxazolidinyl) phosphine chloride (BOPCl) The coupling is mediated for about 1 to about 24 hours at a temperature of 10 to 50 ° C. in a solvent such as DMF. When the solid support is 4- (2 ', 4'-dimethoxyphenyl-Fmoc-aminomethyl) phenoxy-acetamidoethyl resin, the Fmoc group is prepared using a secondary amine, preferably piperidine, Before coupling with the α-C-terminated amino acid as described above, digestion is performed. Preferred coupling methods for the deprotected 4- (2 ', 4'-dimethoxyphenyl-Fmoc-aminomethyl) phenoxy-acetamidoethyl resin are O-benzotriazol-1-yl-N, in DMF, N, N ', N'-tetramethyluronium hexafluorophosphate (HBTU, 1 equiv) and 1-hydroxybenzotriazole (HOBT, 1 equiv). Coupling of consecutive protected amino acids can be performed with an automatic polypeptide synthesizer as is known in the art. In a preferred embodiment, the α-N-terminus of the amino acid in the growing peptide chain is protected by Fmoc. Removal of the Fmoc protecting group from the α-N-terminal side chains of the growing peptide is carried out by treatment with secondary amines, preferably piperidine. Subsequently, each protected amino acid is introduced in about three-fold molar excess, and coupling is preferably performed in DMF. Coupling agents are typically O-benzotriazol-1-yl-N, N, N ', N'-tetramethyluronium hexafluorophosphate (HBTU, 1 equivalent) and 1-hydroxybenzotriazole (HOBT, 1 equivalent). At the end of the solid phase synthesis, the polypeptide is removed from the resin and deprotected continuously or in a single process. Removal and deprotection of the polypeptide can be carried out in a single process by treating the resin-bound polypeptide with a disintegrating agent comprising thianisole, water, ethanedithiol and trifluoroacetic acid. If the α-C-terminus of the polypeptide is an alkylamide, the resin is degraded by aminolysis with alkylamines. Alternatively, the peptide can be removed, for example by transesterification with methanol, followed by aminolysis or direct amide exchange. The protected peptide can then be purified or introduced directly to the next step. Removal of the side chain protecting group is carried out using the above decomposition cocktail. Fully deprotected peptides are purified by a series of chromatographic steps using one or both of the following types: ion exchange on weakly basic resins (in the form of acetate); Hydrophobic adsorption chromatography on uninduced polystyrene-divinylbenzene (eg Amberlite XAD); Silica gel adsorption chromatography; Ion exchange chromatography on carboxymethylcellulose; For example, partition chromatography or countercurrent dispersion on Sephadex G-25, LH-20; High performance liquid chromatography (HPLC), especially reverse phase HPLC on octyl- or octadecylsilyl-silica bound phase column packings. The molecular weight of these Kringle 5 peptide fragments is determined using a fast atomic bombardment (FAB) mass spectrometer. Solid phase Kringle 5 peptide fragment synthesis is described in Examples 1-12.

Depending on how they are prepared, the K5 peptide fragment or K5 fusion protein may or may not have a disulfide bond in the Kringle 5 region of the mammalian plasminogen mentioned above, or may have a Kringle region of another mammal. Can be present with or without disulfide bonds of the corresponding region or may be present with disulfide bonds that form a tertiary structure different from the tertiary structures found in plasminogen in natural mammals. Kringle 5 peptide fragments prepared by enzymatic digestion of Glu-, Lys-, or miniplasminogen using elastase and / or pepsin (an enzyme that degrades at sites removed from cysteine bonds) are obtained from natural tertiary Kringle 5 Contains a protein structure; The Kringle 5 peptide fragment prepared by solid phase peptide synthesis may or may not contain a cisyl amino acyl residue and the Kringle 5 peptide fragment prepared by expression is found in the Kringle 5 peptide fragment prepared by enzymatic digestion. It may contain disulfide bonds at different positions except.

Compounds of the invention, including but not limited to the compounds specified in the examples, have angiogenesis inhibitory activity. As an angiogenesis inhibitor, such compounds include breast; Leader; rectal; lungs; Oropharyngeal; Hypopharyngeal; esophagus; top; Pancreas; liver; Gallbladder; Bile ducts; Intestine; Primary and metastatic solid tumors and carcinomas of the ureters, including the kidney, bladder, and urinary epithelium; Female reproductive tract, chorionic cancer, and gestational ectoderm disease including the cervix, uterus and ovaries; Male reproductive tract and embryonic cell tumors including prostate, hyposperm, posterior glomeruli; Endocrine glands, including the thyroid, adrenal glands and pituitary; Skin, including hemangiomas, melanoma, sarcomas, and Kaposi's sarcomas resulting from bone or soft tissue; Tumors of the brain, nerves, eyes and meninges, including astrocytoma, glioma, glioblastoma, retinoblastoma, neuroma, glioma, schwannoma and meningioma; Solid tumors resulting from hematopoietic malignancies, including plaques and tumors of leukemias and green tumors, plasmacytomas, filamentous fungal fungi and cutaneous T-cell lymphoma / leukemia; Treating lymphoma, including both Hodgkin's and non-Hodgkin's lymphomas; Prevention of autoimmune diseases including rheumatoid, immune and degenerative arthritis; Ocular diseases including diabetic retinopathy, prematurity retinopathy, corneal graft rejection, posterior capsular fibrosis, retinal glaucoma, redness, macular degeneration and hypoxia due to retinal retinitis; Abnormal revascularization disease of the eye; Skin diseases including psoriasis; Vascular diseases including capillary proliferation in hemangiomas and atherosclerotic plaques; Osler-Weber symptoms; Myocardial angiogenesis; Granular plaques at the site of injury; Diseases characterized by excessive or abnormal stimulation of endothelial cells, including enteric adhesions, Crohn's disease, atherosclerosis, scleroderma and hypertrophic scars (ie, keloids), and cat disease (Rochele minalia quintosa) and ulcers (Helicobacter pylori) It is useful for the treatment of diseases with angiogenesis as a pathological consequence. Another use is birth control that inhibits ovulation and placenta establishment.

The compounds of the present invention may also be useful to prevent metastases from such tumors, either alone or in combination with other chemotherapeutic treatments commonly administered to patients for the treatment of radiotherapy and / or angiogenic diseases. For example, when used in the treatment of solid tumors, the compounds of the present invention are alpha interferon, COMP (cyclophosphamide, vincristine, methotrexate and prednisone), etoposide, mBACOD (methotrexate, bleomycin, doxorubicin, cyclophosphama Id, vincristine and dexamethasone), PRO-MACE / MOPP (prednisone, methotrexate, doxorubicin, cyclophosphamide, taxol, etoposide / mechloretamine, vincristine, prednisone and procarbazine) , Vincristine, vinblastine, angioinhibin, TNP-470, pentosan polysulfate, platelet factor 4, angiostatin, LM-609, SU-101, CM-101, techgalan, thalidomide, SP-PG, etc. It may be administered with the same chemotherapeutic agent. Other chemotherapeutic agents include alkylating agents such as nitrogen mustards including mecloethamine, melpan, chlorambusil, cyclophosphamide and ifosfamide; Nitrosoureas including carmustine, rollmustine, semustine and treptozocin; Alkyl sulfonates including busulfan; Triazines including dacarbazine; Ethienimine, including thiotepa and hexamethylmelamine; Folic acid analogs including methotrexate; Pyrimidine analogs including 5-fluorouracil, cytosine arabinoside; Purine analogs including 6-mercaptopurine and 6-thioguanine; Tumor therapeutic antibiotics including actinomycin D; Anthracyclines, including doxorubicin, bleomycin, mitomycin C and methramycin; Hormones and hormonal antagonists including tamoxifen and cortiosteroids and admixtures including cisplatin and brequinar. For example, tumors can typically be treated with Kringle 5 administration in which surgery, radiation or chemotherapy, and micrometastasis are extended and Kringle 5 is administered continuously to stabilize and inhibit the growth of residual primary tumors.

A cytotoxic agent, such as lysine, may be bound to a Kringle 5 peptide fragment to provide a cell disruption tool for binding Kringle 5. Peptides bound to cytotoxic agents can be injected in the indicated manner to maximize the amount delivered to the desired location. For example, lysine-linked high affinity Kringle 5 fragments can be delivered directly via cannulas to a vessel that supplies a target or target site. Such agents may also be delivered in a controlled manner via an osmotic pump coupled to the infusion cannula. Combinations of Kringle 5 antagonists can be applied with angiogenesis stimulants to increase tissue vascularization. This type of treatment regimen may provide an effective means of destroying metastatic cancer.

The compounds of the present invention can also be used in the form of pharmaceutically acceptable salts derived from inorganic or organic acids. "Pharmaceutically acceptable salts" are suitable for use within the scope of safety pharmaceutical judgments, without excessive toxicity, irritation, allergic reactions, etc. in contact with tissues of humans and lower animals, with a moderate to benefit ratio and Means salts that are effective for their intended use. Pharmaceutically acceptable salts are known in the art. For example, S.M. Berge et al. Described in detail the pharmaceutically acceptable salts in J. Pharmaceutical Sciences, 1977, 66: 1 et seq., Which is incorporated herein by reference. The salts can be prepared by reacting the free base functional group with a suitable organic acid in situ or separately during the final separation and purification of the compounds of the invention. Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerol Lophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate (isethionate), lactate, maleate, methanesulfonate , Nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, Phosphate, glutamate, bicarbonate, p-toluenesulfonate and undecanoate. In addition, basic nitrogen-containing groups include lower alkyl halides such as methyl, ethyl, propyl and butyl chloride, bromide and iodide; Dialkyl sulfates such as dimethyl, diethyl, dibutyl and diamyl sulfates; Long chain halides such as decyl, lauryl, myristyl and stearyl chloride, bromide and iodide; It may be quaternized with agents such as arylalkyl halides such as benzyl and phenethyl bromide. Water or oil-soluble or dispersible products are obtained. Examples of acids that can be used to form pharmaceutically acceptable acid addition salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid and phosphoric acid, and oxalic acid, maleic acid, Organic acids such as succinic acid and citric acid.

Base addition salts are suitable bases such as hydroxides, carbonates or bicarbonates of pharmaceutically acceptable metal cations or ammonia or organic primary, secondary during the final separation and purification of the Kringle 5 peptide fragment. Or by reacting with a tertiary amine. Pharmaceutically acceptable salts include, but are not limited to, cations and ammonium, tetramethylammonium, tetraethylammonium, methylamine, based on alkali or alkaline earth metals such as lithium, sodium, potassium, calcium, magnesium and aluminum salts, Nontoxic quaternary ammonia and amine cations including dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine and the like. Other representative organic amines useful for base addition salt formation include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine and the like. Preferred salts of the compounds of the invention are phosphate, tris and acetate.

Kringle 5 peptide fragments, Kringle 5 antiserum, Kringle 5 receptor agonists, Kringle 5 receptor antagonists or combinations thereof are combined with a pharmaceutically acceptable sustained release matrix such as a biodegradable polymer to form a therapeutic composition. You can. Sustained release matrices as used in the present invention are matrices made of materials that are typically biodegradable, typically biodegradable by enzymes or acid-base hydrolysis or dissolution. Once inserted into the body, the matrix acts by enzymes and body fluids. Sustained release matrices include liposomes, polylactide (polylactic acid), polyglycolide (polymers of glycolic acid), polylactide co-glycolide (copolymers of lactic acid and glycolic acid) polyanhydrides, poly (ortho) esters, poly Peptides, hyaluronic acid, collagen, chondroitin sulfate, carboxylic acids, fatty acids, phospholipids, polysaccharides, nucleic acids, polyamino acids, amino acids such as phenylalanine, tyrosine, isoleucine, polynucleotides, polyvinyl propylene, polyvinylpyrrolidone and It is preferably selected from biocompatible materials such as silicon. Preferred biodegradable matrices are one of polylactide, polyglycolide, or polylactide co-glycolide (a copolymer of lactic acid and glycolic acid).

Kringle 5 peptide fragments, Kringle 5 antiserum, Kringle 5 receptor agonists, Kringle 5 receptor antagonists or combinations thereof may be combined with pharmaceutically acceptable excipients or multimers to form a therapeutic composition. Pharmaceutically acceptable carriers or excipients refer to non-toxic solid, semisolid or liquid fillers, diluents, encapsulating materials or formulation aids. The composition may be administered parenterally, sublingually, subretinally, vaginally, intraperitoneally, rectally, orally or topically (by powder, ointment, drop, transdermal patch or iontophoretic device). .

As used herein, the term "parenteral" refers to a mode of administration that includes intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion. Pharmaceutical compositions for parenteral injection include pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders or dispersions immediately prior to use for recombination into sterile injectable solutions. Suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (e.g. glycerol, propylene glycol, polyethylene glycol, etc.), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (e.g. olive oil) and liquor. Organic esters used, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin or by the maintenance of the required particle size and surfactant in the case of dispersions. These compositions may also contain adjuvant such as preservatives, wetting agents, emulsifiers and dispersants. Various antimicrobial and fungal agents, such as parabens, chlorobutanol, phenol sorbic acid, and the like can be included to prevent microbial activity. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like. Injectable pharmaceutical forms can be absorbed for an extended period of time by including agents such as aluminum monostearate and gelatin that delay absorption. Injectable depot forms are prepared by forming microcapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly (orthoesters) and poly (anhydrides). Depending on the ratio of drug to polymer and the nature of the particular polymer used, the rate of release of the drug can be adjusted. Depot injectable formulations are also prepared by trapping the drug in liposomes or microfluids that are compatible with body tissues. Injectable formulations are sterilized, for example, by incorporation of a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable media prior to use, for example, by filtration through a bacterial-retaining filter. You can.

Topical administration is administration to the skin, mucous membranes, and the surface of the lungs and eyes. Compositions for topical administration, including for inhalation, may be prepared from anhydrous powders that are pressurized or not pressurized. In non-pressurized powder compositions, the finely divided active ingredient may be used in a mixture with a larger size pharmaceutically acceptable inert carrier comprising particles of size up to 100 μm in diameter. Suitable inert carriers include sugars such as lactose. Preferably, at least 95% by weight of the active ingredient particle weight has an effective particle size range of 0.01 to 10 μm. For topical administration to the eye, the compounds of the present invention are administered to the cornea and the interior of the eye, such as, for example, anterior chamber, posterior chamber, vitreous body, sap, vitreous fluid, cornea, iris / shape, lens, choroid / retina and sclera. The area is delivered to a pharmaceutically acceptable ophthalmic vehicle that is kept in contact with the eye surface for a period sufficient to allow the compound to penetrate. Examples of pharmaceutically acceptable ophthalmic vehicles may be ointments, vegetable oils or encapsulating materials. Alternatively, the compounds of the present invention can be injected directly into the vitreous body and into the sap.

The composition may be pressurized and may contain a compressed gas such as nitrogen or liquefied gas propellant. It is preferred that the liquefied propellant medium and the entire composition do not dissolve the active ingredient to a substantial extent. Pressurized compositions may also contain surface active agents such as liquid or solid non-ionic surface active agents or may contain solid anionic surface active agents. Preference is given to using the solid anionic surfactant in the form of sodium salts.

Compositions for rectal or vaginal administration may comprise a compound of the present invention with a suitable non-irritating excipient or carrier such as cocoa butter, polyethylene glycol or suppository wax that is solid at room temperature but liquid at body temperature and thus melts in the rectum or vaginal cavity to release the active compound. Suppositories that can be prepared by mixing are preferred.

Compounds of the invention can also be administered in the form of liposomes. As is known in the art, liposomes are generally derived from phospholipids or other fatty substances. Liposomes are formed from single- or multi-lamellae hydrate crystals dispersed in an aqueous medium. Physiologically acceptable and metabolizable nontoxic lipids capable of forming liposomes can be used. Compositions of the present invention in liposome form may contain, in addition to the compounds of the present invention, stabilizers, preservatives, excipients, and the like. Preferred lipids are natural and synthetic phospholipids and phosphatidyl choline (lecithin). Methods of forming liposomes are known in the art. See Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N. Y. (1976), p. 33 et. seq].

When used in these or other methods of treatment, a therapeutically effective amount of one of the compounds of the invention is in pharmaceutically acceptable form or in the form of a pharmaceutically acceptable salt, if such form is present. It can be used in the presence or absence of excipients. A “therapeutically effective amount” of a compound of the invention is sufficient for the treatment of angiogenic diseases (eg, limiting tumor growth or delaying or blocking tumor metastasis) at a suitable benefit / risk ratio applicable to medical treatment. Mean amount of compound. However, it should be understood that the total daily dose of the compounds and compositions of the present invention is determined by the attending physician within the scope of the safety medicinal judgment. The specific therapeutically effective dosage level for a particular patient may include the severity of the disease and disorder to be treated; The activity of the specific compound employed; The specific composition employed; The age, body weight, general health, sex and diet of the patient; Dosing time; Route of administration; The rate of release of the specific compound employed; Duration of treatment; Many factors, including drugs used in combination with or concurrently with the specific compound employed, are familiar in the medical arts. For example, it is within the scope of those skilled in the art to initiate administration of a compound at a lower level than necessary to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. The total daily dosage of a Kringle 5 peptide fragment or fusion protein to be administered to a human or other mammal, either locally or systemically in a single or divided dose, may be, for example, 0.0001 to 200 mg / kg body weight per day, more typically Amount of from 1 to 300 mg / kg body weight. In some cases, the effective daily dose may be divided into multiple doses for administration purposes. As a result, a single dosage composition may contain this amount or multiple amounts thereof to bring the daily dosage.

Agents that can be mixed with the compounds of the present invention for the inhibition, treatment or prevention of angiogenic diseases are not limited to those mentioned above, but are in principle useful agents for the treatment or prevention of angiogenic diseases.

The present invention also provides an isolated polynucleotide encoding a Kringle 5 peptide fragment or fusion protein of a mammal having angiogenesis inhibitory activity. Such polynucleotides can be used for expression or gene therapy (hereinafter described) of recombinant Kringle 5 peptide fragments.

The polynucleotides of the present invention may exist in the form of mRNA or DNA. Polynucleotides in the form of DNA, cDNA, genomic DNA and synthetic DNA are included within the scope of the present invention. The DNA may be double stranded or single stranded, and the single stranded strand may be a coding (sensitizing) chain or a non-coding (anti-sensitizing) chain. Polypeptides of the invention may be in unmodified form or include modifications such as methylation or capping.

The coding sequence encoding the polypeptide may be identical to the coding sequence provided herein or may be a different coding sequence that encodes a polypeptide whose coding sequence is identical to the DNA provided herein, due to duplication or degradation of the genetic code. have. The polynucleotide may comprise only a coding sequence for the polypeptide, or an additional coding sequence such as a coding sequence for a polypeptide and a leader or auxiliary sequence or proprotein sequence, or a coding sequence for a polypeptide (and optionally an additional coding sequence). And non-coding sequences of coding sequences for polypeptides, such as 5 'and / or 3'.

The invention also relates to modifications such as polynucleotide deletions, substitutions or additions; And variant polynucleotides containing polypeptide modifications that generate variant polynucleotide sequences. Polynucleotides of the invention may also have a coding sequence that is a natural allelic variant of the coding sequence provided herein.

In addition, the coding sequence for the polypeptide is within the same reading frame as the leader sequence that serves as a polynucleotide that aids in the expression and secretion of the polypeptide from the host cell, eg, a leader sequence for coordinating the transport of the polypeptide from the cell. Can be fused. A polypeptide having a leader sequence is a free protein and has a leader sequence degraded by a host cell to form the polypeptide. The polynucleotide may also encode for proteins and proproteins, which are additional 5 ′ amino acid residues. Proteins with prosequences are proproteins and in some cases may be inactive proteins. Once the sequence is broken down, the active protein remains. Thus, the polynucleotide of the present invention can be encoded for a protein or for a protein having a prosequence or a protein having both a presequence (leader sequence) and a prosequence.

The polynucleotides of the invention may also have coding sequences fused in frame to a marker sequence that allows the polypeptide of the invention to be purified. The marker sequence may be a GST tag supplied by a pGEX vector for providing for purification of a polypeptide fused to a marker in a bacterial host, or for example, the marker sequence may be a mammalian host, eg, COS-7. Cells can be hemagglutinin (HA) tags. HA tags correspond to epitopes derived from influenza hemagglutinin protein (I. Wilson, et al., Cell 37: 767 (1984)). Polynucleotides can be generated by methods including, but not limited to, chemical synthesis, replication, reverse transcription, or transcription based on information provided by the sequence of bases in the region (s) from which the polynucleotide is derived; It may represent sensitized or anti-sensitized cultures of the original polynucleotides. A preferred method of generating polynucleotides is by the polymerase chain reaction described in US Pat. Nos. 4,683,195 and 4,683,202, which are incorporated herein by reference.

It is contemplated that a polynucleotide can hybridize to the sequences provided herein when the identity between the polynucleotide and the sequence is at least 50%, preferably at least 70%.

The invention also provides a vector comprising the polynucleotide of the invention, a host cell genetically engineered with the vector of the invention and a method for producing the polypeptide of the invention by recombinant technology. Such a method is characterized by culturing the host cell under conditions suitable for expression of the Kringle 5 derived polynucleotide and recovering the Kringle 5 derived polypeptide from the cell culture.

The polynucleotides of the present invention can be used for the production of polypeptides by recombinant techniques. Thus, the polynucleotide sequence can be included in one of several expression vehicles, in particular in a vector or plasmid for expressing the polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV40; Bacterial plasmids; Phage DNA; Yeast plasmids; Plasmids and vectors derived from combinations of phage DNA, bacsinia, adenoviruses, smallpox viruses, and viral DNAs such as Pseudorabis. However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

Suitable DNA sequences can be inserted into the vector in a number of ways. In general, DNA sequences are inserted into suitable restriction endonuclease sites by methods known in the art. Such and other methods are considered to be within the scope of those skilled in the art. The DNA sequence in the expression vector is functionally bound to the appropriate expression control sequence (s) (promoter) to direct mRNA synthesis. Representative examples of such promoters include, but are not limited to, the LTR or SV40 promoter, E. Coli lac or trp, phage lambda P sub L promoter and other promoters known to modulate expression of genes in prokaryotic or eukaryotic cells or viruses thereof. Expression vectors also contain ribosomal binding sites and transcriptional ends for initiation of translation. The vector may also include suitable sequences for amplifying expression. In addition, the expression vector is either dihydrofolate reductase or neomycin resistant, or E. coli for prokaryotic culture. It is desirable to contain genes to provide phenotypic traces for the selection of transformed host cells, such as tetracycline or ampicillin resistance in E. coli.

Suitable host cells can be transformed to express the protein using a vector containing a suitable DNA sequence as well as a suitable promoter or regulatory sequence as described above. As a representative example of a suitable host, the following may be mentioned: Collie, Salmonella typhimurium; Bacterial cells such as Streptomyces spp; Fungal cells such as yeast; Insect cells such as Drosophila and Sf9; And animal cells such as CHO, COS or Bowes and the like. Selection of suitable hosts is deemed to be within the scope of those skilled in the art from the techniques provided herein.

More specifically, the present invention also encompasses recombinant constructs comprising one or more sequences broadly as described above. Such constructs include vectors, such as plasmids or viral vectors, in which the sequences of the invention are inserted in a forward or reverse orientation. In a preferred embodiment of the invention, the construct also comprises regulatory sequences, including, for example, a promoter that is functionally linked to the sequence. Many of suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vector is provided as an example. Bacterial: pSPORT1 (GIBCO BRL, Gaithersburg, MD), pQE70, pQE60, pQE-9 (Qiagen) pBs, phagescript, psiX174, pBluescript SK, pBsKS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene ^R) , La Jolla, CA pTrc99A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia ^R ). Prokaryotic: pWLneo, pSV2cat, pOG44, pXT1, pSG (Stratagene ^R ) pSVK3, pBPV, pMSG, pSVL (Pharmacia ^R ). However, it can be used as another plasmid or vector because of its viability and viability in the host.

Promoter regions can be selected from genes of interest using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two suitable vectors are pKK232-8 and pCM7. Particularly mentioned bacterial promoters are lacI, lacZ, T3, SP6, T7, gpt, lambda P sub L and trp. Prokaryotic promoters include cytomegalovirus (CMV) early, herpes zoster virus (HSV) thymidine kinase, early and late SV40, LTR from retrovirus, and mouse metallothionein-I. Selection of suitable vectors and promoters is within the scope of those skilled in the art.

In another aspect, the present invention provides a host cell containing the construct described above. The host tax may be higher eukaryotic cells, such as mammalian cells, or lower eukaryotic cells, such as yeast cells, or the host cells may be prokaryotic cells, such as bacterial cells. Introduction of the construct into host cells can be accomplished by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation [L. Davis et al., "Basic Methods in Molecular Biology", 2nd edition, Appleton alc Lang, Paramount Publishing, East Norwalk, CT (1994).

Constructs in host cells can be used to make gene products encoded by recombinant sequences using conventional methods. Alternatively, the polypeptides of the invention can be prepared synthetically with conventional peptide synthesizers.

Proteins can be expressed under the control of a suitable promoter in mammalian cells, yeast, bacteria or other cells. Cell-free translation systems can also be used to prepare such proteins using RNA derived from the DNA constructs of the invention. Cloning and expression vectors suitable for use with prokaryotic and eukaryotic hosts are described in the following references, which are incorporated herein by reference: Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, ( Cold Spring Harbor, NY, 1989).

Transcription by the higher eukaryotic cells of the DNA encoding the polypeptides of the invention is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting factors of DNA that act on a promoter to increase transcription, typically about 10 to 300 bp. Examples include SV40 enhancers (bp 100-270) on late aspects of origin of replication, cytomegalovirus early promoter enhancers, polyoma enhancers on later aspects of origin of replication, and adenovirus enhancers.

In general, recombinant expression vectors are selective markers that allow the origin of replication and the host cell to be transformed, eg, E. coli. Ampicillin resistance gene and S. coli S. cerevisiae TRP1 gene, and promoters derived from highly expressed genes for directing transcription of downstream structural sequences. Such promoters may be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), alpha factor, acid phosphatase, or heat shock protein. The heterologous structural sequence is arranged in a suitable phase with translation initiation and termination sequences, and preferably with a leader sequence capable of directing secretion of the translated protein into the foreign matter space or extracellular medium. Optionally, the heterologous sequence may encode a fusion protein comprising an N-terminal identifying peptide that confers the desired properties, eg, stabilization or simplified purification of the expressed recombinant product.

Expression vectors useful for bacteria can be constructed by inserting a structural DNA sequence encoding a protein of interest into an operable readout with a functional promoter along with a suitable translational initiation and termination signal. The vector includes one or more phenotypic selectable markers and origins of replication to allow the vector to be conserved and optionally provide amplification in the host. Suitable prokaryotic hosts for transformation may be those conventionally selected, but E. Various species within the genus Coli, Bacillus subtilis, Salmonella typhimurium and Pseudomonas, Streptomyces, and Staphylococcus.

Vectors useful for bacteria include bacterial replication origins derived from plasmids comprising selectable markers and genetic factors of the known cloning vector pBR322 (ATCC 37017). Other vectors include, but are not limited to, PKK223-3 (Pharmacia ^R , Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis.). These pBR322 "backbone" sites are combined with a suitable promoter and the structural sequence to be expressed.

Useful expression vectors may also include fusion partners for facilitating purification of the polypeptide of interest of the invention or for preparing soluble polypeptides. Expression vectors that avoid the use of fusion partners can also be constructed for high levels of expression, particularly in bacterial cells of Kringle 5 peptide fragments or fusion proteins. For example, it can be optimized by taking a translational coupling as described in Pilot-Matias, TJ, et al., In Gene, 128: 219-225 (1993), which is incorporated herein by reference. I can make it. Alternatively, the polynucleotides of the present invention can be expressed with an accessory adjunct plasmid that itself encodes a protein or peptide that helps to solubilize the first peptide of interest. Makrides, SC, Microbiological Reviews, 60: 512 (1996). For example, certain Kringle 5 peptide fragments (found to produce soluble fusion proteins with thioredoxin: see Example 20) may be expressed from a non-fusion vector concurrently with a second vector expressing thioredoxin. Can be.

Suitable host strains are transformed to grow host strains at suitable cell densities, and then the selected promoters are activated by appropriate methods (eg, temperature shift or chemical induction), and the cells are then incubated for an additional period of time. Cells are typically harvested by centrifugation, disrupted by physical or chemical methods and leaving the resulting crude extract for further purification. Microbial cells used for expression of proteins can be disrupted in any convenient manner, including freeze-thaw cycling, sonication, mechanical disruption, or using cell lysates; Such methods are known to those skilled in the art.

Various mammalian cell culture systems can also be used to express recombinant proteins. Examples of mammalian expression systems include compatible vectors, such as the COS-7 strain of monkey kidney fibroblasts described in Gluzman, Cell 23: 175 (1981), and the C127, 3T3, CHO, HeLa and BHK cell lines. There are other cell lines that can be expressed. Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and also necessary ribosomal binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5 'flanking non-transcribed sequences. DNA sequences derived from the SV40 viral genome, such as SV40 origin, early promoters, enhancers, splices, and polyadenylation sites, can be used to provide the necessary nontranscriptional genetic factors. Representative useful vectors are pRc / CMV and pcDNA3 (available from Invitrogen, San Diego, CA).

The present invention includes gene therapies in a patient regulating a gene encoding a Kringle 5 peptide fragment or Kringle 5 peptide fragment conjugate. Various methods of delivering or transporting DNA into cells for the expression of gene product proteins, otherwise termed gene therapy, are described in the Gene Transfer into Mammalian Somatic Cells in vivo. , N. Yang, Crit. Rev. Biotechn. 12 (4): 335-356 (1992). Gene therapy involves the incorporation of polynucleotide sequences into somatic cells or germ cells for use in vitro or in vivo therapy. Gene therapy replaces genes, augments normal or abnormal gene function, and functions to fight infectious diseases and other pathogens.

Strategies for treating medical problems with gene therapy include treating a therapeutic strategy or disease such as identifying a defective gene and then adding a functional gene to replace the function of the defective gene or augmenting a slightly functional gene, There are prophylactic strategies such as adding genes encoding protein products that make them more sensitive to therapeutic curing. As an example of a prophylactic strategy, a gene encoding a Kringle 5 peptide fragment or a Kringle 5 peptide fragment conjugate is placed in a patient to prevent the occurrence of angiogenesis or to insert a gene that makes tumor cells more sensitive to radiation. Irradiation of the tumor may increase the death of tumor cells.

Numerous protocols are contemplated for delivering a DNA encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein or for delivering a DNA for a Kringle 5 peptide fragment regulatory sequence (or that of a fusion partner). Except as specifically associated with Kringle 5 peptide fragments, transfection of promoter sequences or other sequences that increase production of Kringle 5 peptide fragments is also contemplated as a method of gene therapy. Examples of such techniques, using homologous recombination, to insert "gene switches" that act on erythrocyte genes in cells as described in Genetic Engineering News, April 15, 1994, are herein incorporated by reference. See Transkaryotic Therapies, Inc., of Cambridge, Massachusetts. Such "gene switches" can be used to activate Kringle 5 peptide fragments (or Kringle 5 receptors) in cells that do not normally express these proteins.

Gene delivery methods for gene therapy fall into three broad categories: (1) physical (eg, electroporation, direct gene delivery and particle collision), (2) chemical (eg, fat- Base carriers and other non-viral vectors) and (3) biological (eg, viral derived vectors). For example, non-viral vectors such as liposomes coated with DNA can be injected intravenously directly into a patient. Liposomal / DNA complexes are believed to be concentrated in the liver as they transport DNA to macrophages and Kupffer cells. The "naked" DNA of the vector or gene can also be injected directly into the desired organ, tissue or tumor for targeted delivery of the therapeutic DNA.

Gene therapy methods can also be described by delivery site. Basic gene delivery methods include ex vivo gene delivery, in vivo gene delivery and in vitro gene delivery. In ex vivo gene transfer, cells are harvested from a patient and grown by cell culture. The DNA is transfected into cells to expand the number of transfected cells and then transplanted back to the patient. In in vitro gene transfer, transformed cells are cells that grow in culture, such as tissue culture cells, and are not specific cells from a particular patient. These "laboratory cells" are transfected and the transfected cells are selected and expanded for transplantation or other use in the patient. In vivo gene transfer involves introducing DNA into a patient's cells when the cells are in the patient. All three broad categories described above can be used to deliver genes in vivo, ex vivo and in vitro.

Mechanical (ie physical) DNA delivery involves microinjecting DNA into reproductive or somatic cells, DNA-coated particles and calcium phosphate delivered in compressed air, such as gold particles used in "gene guns". It can be carried out by inorganic chemical methods such as transfection. Physical injection of plasmid DNA into muscle cells has been shown to increase the proportion of cells that are transfected and delayed in expression of the marker gene. Plasmid DNA may or may not be fused into the genome of the cell. Non-fusion of the transfected DNA allows the gene product protein to be transfected and expressed in terminally differentiated, non-proliferative tissue for extended periods of time without fear of mutagenic insertion, deletion or change in the cell or mitochondrial genome. The delivery of therapeutic genes into specific cells over long periods of time, but not necessarily permanently, may provide therapeutic or prophylactic use for genetic diseases. The DNA may be periodically re-injected to maintain gene product levels so that mutations do not occur in the genome of the receptor cells. Non-fusion of exogenous DNA causes several different exogenous DNA constructs to be present in the cell with all of the constructs expressing various gene products.

Particle-mediated gene delivery can also be used to inject DNA into cells, tissues and organs. In the case of a particle impact device, or "gene gun," the propulsion produces acceleration at high speeds such that DNA-coated dense particles (such as gold or tungsten) penetrate the target organ, tissue or cell. A brief electric shock to the given electric field strength is used to increase the permeability of the membrane in such a way that DNA molecules can penetrate into the cell. Particle-mediated gene delivery techniques and electroporation are well known to those skilled in the art.

Chemical methods of gene therapy can deliver carrier-mediated genes using fusional lipid vesicles, such as liposomes, or other vesicles for membrane fusion. Carriers that anchor DNA can be conveniently introduced into body fluids or blood flow and then site-specifically directed to target organs or tissues in the body. For example, cells or organ-specific DNA-containing liposomes can be developed to include DNA by liposomes taken up by a particular cell. Injecting targeted immunoliposomes to specific receptors on specific cells can be used as a convenient way to insert DNA in cells containing receptors. Another carrier system in use is an asialo glycoprotein / polylysine conjugate system for DNA delivery to hepatocytes for in vivo gene delivery.

The transfected DNA can also be complexed with other types of carriers to deliver the DNA to receptor cells and then stored in the cytoplasm or nuclear protoplasts. DNA may be coupled directly to the nucleus of a carrier nuclear protein in a specifically engineered cystic complex.

Carrier mediated gene delivery can also utilize lipid-based compounds other than liposomes. For example, lipofectin and cytofectin form complexes capable of transporting DNA cross cell membranes to lipid-based cations that bind to negatively charged DNA. Another method of carrier mediated gene delivery involves receptor-based endocytosis. In this method, ligands (specific for cell surface receptors) are prepared to form a complex with the gene of interest and then injected into the bloodstream. Target cells with cell surface receptors specifically bind ligands and transport the ligand-DNA complexes to the cells.

Biological gene therapy methods insert viral genes into cells using viral vectors or non-viral vectors such as ligand-DNA conjugates, liposomes and lipid-DNA complexes as discussed above. The transfected cells can be cells derived from normal tissue of the patient, disease tissue of the patient or non-patient cells.

Functionally binding a recombinant DNA molecule comprising a Kringle 5 peptide fragment DNA sequence or a Kringle 5 fusion protein DNA sequence to an expression control sequence to form an expression vector capable of expressing the Kringle 5 peptide fragment or fusion protein, respectively It may be desirable. Alternatively, the gene regulation of a Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound that binds to a regulatory region or corresponding RNA transcript associated with the Kringle 5 gene, fusion partner gene or Kringle 5 gene or fusion partner thereof. Can be performed to modify the rate of transcription or translation.

Viral vectors used in gene therapy protocols include, but are not limited to, other RNA viruses such as retroviruses, polioviruses or Sindbis viruses, adenoviruses, adeno-associated viruses, herpes virus, SV40, baccinia and There are other DNA viruses. Retroviral vectors of replication-deficient mice are the most widely used gene transfer vectors. Rat leukemia retroviruses consist of polymerase (pol) enzymes surrounded by glycoprotein envelopes wrapped in single-stranded RNA and protein cores complexed with nuclear core proteins to determine host range. The genomic structure of retroviruses includes gag, pol, and env genes that are enclosed in 5 'and 3' long terminal repeat units (LTRs). Retroviral vector systems take advantage of the fact that minimal vectors containing 5 'and 3' LTRs and package signals are sufficient for fusion into target cells that provide vector packaging and infection and viral structural proteins to be supplied trans from the package cell line. . Fundamental advantages of retroviral vectors for gene delivery are efficient infection and gene expression for most cell types, accurate single replication vector fusion into target cell chromosomal DNA, and ease of manipulation of the retroviral genome. For example, modified retroviral vectors in in vitro methods are used to introduce into site and tumor-induced lymphocytes, hepatocytes, surface cells, myocytes or other somatic cells (which are then introduced into the patient and gene product from the inserted DNA). Can be provided).

Adenoviruses are composed of linear, double-stranded DNA complexed with core proteins and surrounded by capsid proteins. Advances in molecular virology can develop the biology of these organisms to generate vectors that can transduce novel gene sequences into target cells in vivo. Adenovirus-based vectors express high levels of gene product peptides. Adenovirus vectors have high infection efficiency, even when the titers of viruses are low. In addition, the virus is cell-free virion and fully infectious and does not necessarily require infection of producer cell lines. Another powerful advantage over adenoviral vectors is the long-term expression of heterologous genes in vivo.

In addition, genes are inserted into cells using viral vectors and using in vivo protocols. In order to direct tissue-specific expression of foreign genes, cis-acting regulators or promoters known to be tissue-specific may be used. Alternatively, this can be done using in situ delivery of DNA or viral vectors to specific anatomical sites in vivo. For example, gene delivery to blood vessels within an individual is performed by implanting in vitro transduced endothelial cells at the site of selection on the arterial wall. Likewise, virus-infected surrounding cells also express gene products. Viral vectors can be delivered directly to a site in vivo (eg, by a catheter) such that only certain regions are infected with the virus, allowing for long-term, site-specific gene expression. In vivo gene transfer using retroviral vectors has also been demonstrated in mammalian and liver tissues by injecting modified viruses into blood vessels that lead to organs.

Kringle 5 peptide fragments can also be produced and used for various applications. For example, different peptide fragments of Kringle 5 can be used as (1) agonists and antagonists active at the Kringle 5 binding site, (2) as antigens for the development of specific antisera, and (3) peptides for use in diagnostic kits. And as (4) peptides that bind to or are used with cytotoxic agents to target and kill cells that bind Kringle 5 peptide fragments. Amino acid sequences comprising these peptide fragments can be selected based on the inhibitory strength of the peptide fragments for processes caused by or exacerbated by their location or angiogenesis on the outer region of the molecule that is susceptible to binding to antiserum. Furthermore, these peptide sequences can be compared to known sequences using protein sequence databases such as GenBand, Brookhaven Protein, SWISS-PROT, and PIR to determine potential sequence homology. This information facilitates the removal of sequences exhibiting high sequence homology to other molecules, thereby enhancing the potential for high specificity in the development of antisera, agonists and antagonists against Kringle 5.

The Kringle 5 peptide fragment or fusion protein may also be subjected to a Kringle 5 peptide fragment or fusion protein by subjecting it to a solid support, e.g., on an affinity column through which endothelial cells or membrane extracts are separated. It can be used as a means for. As is known in the art, isolation and purification of the Kringle 5 receptor can be followed by amino acid sequencing to identify and isolate the polynucleotide encoding the Kringle 5 receptor. Such polynucleotides may then be transfected into tumor cells by cloning into a suitable expression vector. Expression of receptors by transfected tumor cells enhances the reactivity of these cells to endogenous or exogenous Kringle 5 peptide fragments, thereby reducing the rate of metastatic growth. In addition, the recombinant invention of such a receptor allows for a greater amount of receptor produced, for example to produce an amount sufficient for use in a high yield screening assay to identify smaller antagonists that mimic the action of Kringle 5 do.

Global substitution of amino acids in these synthesized peptides can yield high affinity peptide agonists and antagonists of Kringle 5 receptors that enhance or reduce Kringle 5 peptide fragments that bind to the receptor. Such agonists can be used to inhibit the proliferation of micrometastases and to limit the spread of cancer. In case of inadequate saturation, an antagonist can be applied to the Kringle 5 peptide fragment to block the inhibitory effect of the Kringle 5 peptide fragment and enhance angiogenesis. For example, this type of treatment may have a therapeutic effect in enhancing the treatment of an injury site in a diabetic patient.

Kringle 5 peptide fragments or fusion proteins or conjugates of the invention can also be used as antigens to generate polyclonal or monoclonal antibodies specific for Kringle 5 inhibitors. One of the methods by which such antibodies can be used is used in diagnostic methods and kits for detecting or quantifying Kringle 5 peptide fragments in body fluids or tissues.

Kringle 5 peptide fragments or Kringle 5 fusion proteins can be labeled with radioisotopes (see Example 13) or chemically coupled to proteins to form conjugates. Conjugates facilitate the testing of compounds containing Kringle 5 peptide fragments with the ability to bind Kringle 5 antiserum, detection of cell types with Kringle 5 peptide fragment receptors, or helping to purify Kringle 5 peptide fragments. There are enzymes, carrier proteins, cytotoxic agents, phosphors, chemiluminescent agents and bioluminescent molecules that are used to. Coupling techniques are generally selected based on the functionalities available at the amino acids of the Kringle 5 peptide fragment sequence, including but not limited to alkyl, amino, sulfhydryl, carboxyl, amide, phenol, indolyl and imidazoyl. . Various reagents used to effect such coupling include glutaraldehyde, diazotized benzidine, carbodiimide and p-benzoquinone. The effect of the coupling reaction is measured using different techniques suitable for the particular reaction. For example, radiolabeling using I ¹²⁵ of Kringle 5 peptides or biologically active fragments thereof can be performed using chloramine T and NaI ¹²⁵ having high specific activity. The reaction is terminated using sodium metabisulfite and the mixture is desalted on a disposable column. The labeled peptide is eluted from the column and the fractions are collected. Aliquots are removed from each fraction to measure radioactivity on a gamma counter. The method provides a radiolabeled Kringle 5 peptide fragment free of unreacted NaI ¹²⁵ . As another example, blood or tissue extracts containing Kringle 5 peptide fragments coupled to Kringle 4 can be purified on a polylysine resin affinity column to provide kringle 4-penetration through the affinity of Kringle 4 peptide fragments for lysine. Kringle 5 peptide fragment is bound to the resin. Elution of the bound protein yields a purified Kringle 4-Kringle 5 peptide fragment.

Another use of peptide conjugation is the production of polyclonal antisera. The production of anti-serum against Kringle 5 peptide fragments, Kringle 5 peptide fragment analogs and Kringle 5 receptors can be accomplished using established techniques known to those skilled in the art. For example, Kringle 5 peptide fragments containing lysine residues can be bound to purified bovine serum albumin (BSA) using glutaraldehyde. The effect of the reaction can be measured by measuring the incorporation amount of the radiolabeled peptide. Unreacted glutaraldehyde and peptides can be separated by dialysis, and adhesives can be used to generate polyclonal antiserum in rabbits, sheep, goats or other animals. Kringle 5 peptide fragments conjugated to a carrier molecule, such as BSA, can be combined with an adjuvant mixture, emulsified, and injected subcutaneously into various regions of the back, neck, flank, and sometimes the sole of the suitable host. In general, booster injections are made at regular intervals, such as from 2 to 4 weeks. Approximately 7 to 10 weeks after each injection, a blood sample is obtained by venipuncture using, for example, an edge vein after dilation. Blood samples are coagulated overnight at 4 ° C. and centrifuged at approximately 2400 × g for about 30 minutes at 4 ° C. Serum is collected, aliquoted and stored at 4 ° C. immediately before use or at −20 to −90 ° C. for subsequent analysis.

Serum samples from polyclonal antiserum development or media samples from the production of monoclonal antiserum can be analyzed for the determination of antibody titers, in particular for the determination of high titer antiserum. Subsequently, the maximum titer Kringle 5 peptide fragment antiserum can be tested to establish: a) optimal antiserum dilution for maximum specific binding and lowest non-specific binding of the antigen, b) Kringle in a standard substitution curve Increased binding capacity of the 5 peptide fragments, c) potential cross-reactivity between the related species of plasminogen and related peptides and proteins, including Kringle 5 peptide fragments, and d) cell culture medium and plasma, furnace and tissue extracts. Ring 5 peptide fragment detectability. Titers may be precipitated using dot blot and density assays and / or protein A, secondary antiserum, cold ethanol or charcoal-dextran of radiolabeled peptide-antibody complexes, and then measured for activity with a gamma counter. This can be accomplished through various methods known in the art. If desired, maximum titer antiserum may be purified on an affinity column. For example, Kringle 5 peptide fragments can be used to couple a commercially available resin to form an affinity column. An antisera sample is then passed through the column to allow the Kringle 5 antibody to bind to the column (via the Kringle 5 peptide fragment). These bound antibodies are then eluted, harvested and evaluated for titer and specificity measurements.

Kringle 5 peptide fragments and kits for Kringle 5 receptor measurement are also contemplated as part of the present invention. Rapid, reliable, sensitive and specific measurement and determination of Kringle 5 peptide fragments using antiserum with maximum titer and specificity and capable of detecting Kringle 5 peptide fragments in plasma, urine, tissue extracts and cell culture media Assay kits for localization can be established. These assay kits can use, but are not limited to, the following techniques: competitive and non-competitive assays, radioimmunoassays, bioluminescent and chemiluminescent assays, fluorometric assays, sandwich assays, immunoradiometric assays, dot blots, ELISA Enzyme-bound assays, microtiter plates, immunocytochemistry and antibody-coated strips or dipsticks for rapid monitoring of urine or blood. For each kit, assay range, sensitivity, accuracy, reliability, specificity and reproducibility are established by methods known to those skilled in the art.

One example of an assay kit commonly used in the investigation and clinical field is a radioimmunoassay (RIA) kit, in which the Kringle 5 peptide fragment RIA can be established by the following methods: After purification, antiserum with the maximum titer of anti-Cringle 5 peptide fragment antibody is added to a suitable buffer system at various dilution ratios in a tube containing a relatively constant amount of radioactivity, eg 10,000 cpm. After 24 hours of incubation at 4 ° C., protein A was added to all tubes and the vortexed tubes, incubated for 90 minutes at room temperature, and centrifuged at 4 ° C. at approximately 2000 to 2500 × g for the binding of the antibody to the labeled antigen. Precipitate the complex. The supernatant is removed by aspiration and counted in the pellet for gamma counter. Antiserum dilution ratios that bind approximately 10-40% of the labeled peptide after limiting nonspecific binding are selected for further characterization.

The dilution range (approximately 0.1 pg to 10 ng) of the Kringle 5 peptide fragment used to open the antiserum is then assessed by adding a known amount of peptide to a tube containing radiolabeled peptide and antiserum. After the incubation period (eg 24 hours or 48 hours), Protein A is added and the tube centrifuged to remove the supernatant to count radioactivity in the pellet. The binding of the radiolabeled Kringle 5 peptide fragment is replaced with an unlabeled Kringle 5 peptide fragment (standard) to obtain a standard curve. In addition, other Kringle 5 peptide fragments, plasminogen, Kringle 5 peptide fragments from other species, and homologous peptides can be added to the assay tubes at various concentrations to characterize the specificity of the Kringle 5 peptide fragment antiserum.

Then, without limitation, Kringle extracts of various tissues including primary and secondary tumors, Lewis lung carcinoma, cultures of Kringle 5 peptide fragment-producing cells, placenta, uterus and other tissues such as brain, liver and intestine. 5 peptide fragments are prepared using extraction techniques that have been used successfully. After working out the tissue extract, assay buffer is added and different aliquots are placed in RIA tubes. Extracts of known Kringle 5 peptide fragment-producing cells yield a replacement curve parallel to the standard curve, whereas extracts of tissues that do not produce Kringle 5 peptide fragments can be used to produce radiolabeled Kringle 5 peptide fragments. It is not replaced with peptide fragment antiserum. Such replacement curves show the utility of the Kringle 5 peptide fragment assay for measuring Kringle 5 peptide fragments in tissues and body fluids.

Tissue extracts containing Kringle 5 peptide fragments can also be characterized by reverse phase HPLC. Eluate fractions are collected, dried in Speed Vac, reconstituted in RIA buffer and analyzed in Kringle 5 RIA. In this case, the maximum amount of Kringle 5 peptide fragment immunoreactivity is located in the fraction corresponding to the elution position of the Kringle 5 peptide fragment.

The assay kit described above provides gang, antiserum, Kringle 5 peptide fragments and possibly radiolabeled Kringle 5 peptide fragments and / or reagents for precipitation of bound Kringle 5 peptide antibody complexes. Such kits are useful for the determination of Kringle 5 peptide fragments in biological fluids and tissue extracts of tumored animals and humans and tumor free animals and humans.

Other kits can be used to visualize or localize Kringle 5 peptide fragments in tissues and cells. For example, immunohistochemistry techniques and kits using such techniques are well known to those skilled in the art. As is known in the art, immunohistochemistry kits block binding to Kringle 5 peptide fragment antiserum and possibly other fluorescent reagents such as fluorescein isothiocyanate or other reagents used to visualize primary antiserum. Serum and secondary antiserum are provided. Using this method, biopsy tumors can be examined for Kringle 5 peptide fragment production sites or Kringle 5 peptide fragment receptor sites. Alternatively, the kit can supply radiolabeled nucleic acids for use in situ hybridization to probes for Kringle 5 peptide fragment messenger RNA.

Compounds of the present invention may be prepared using processes known to those skilled in the art. See Sottrup-Jensen et al., Progress in Chemical Fibrinolysis and Thrombolysis, Vol. 3, Davidson, J.F., Rowan, R.M., Samama, M.M. And Desnoyers, P.C. editors, Raven Press, New York, 1978]. One method of preparing the Kringle 5 peptide fragment is a natural protein (glu-plasminogen) or variant thereof (which can be degraded by enzymatic digestion and at least as described above, such as lys-plasminogen or miniplasminogen). By cleaved form of a full-length protein comprising a Ringle 5 sequence. This method first requires separating proteins from human plasma in the absence of plasmin inhibitors to enhance the conversion of glu-plasminogen to lys-plasminogen. Novokhatny, V and Kudinov, SA, J. Mol. Biol. 179: 215-232 (1984). The cleaved molecule is then treated with a protease enzyme at a concentration sufficient to degrade the Kringle 5 peptide fragment from the polypeptide and then purified from the remaining fragments by methods known to those skilled in the art. Preferred proteases digest plasminogen and its cleaved variants between kringle regions 3-4 and 4-5 (and thereby contain kringle 1-3 and 1-4 or kringle 4 or 5 alone). Is capable of forming peptide fragments). For example, lys-plasminogen or glu-plasminogen may be used as a neutrophil elastase in swine or human at a ratio of about 1: 100 to 1: 300 lys-plasminogen: elastase (preferably 1: In buffers (eg Tris-HCl, NaCl, sodium phosphate, etc.) at a ratio of 150 to 1: 250, most preferably 1: 150. Alternatively, the elastase is first immobilized (such as a resin) to facilitate purification of the degradation product. Glu-plasminogen or lys-plasminogen is generally treated with human or swine elastase at a temperature in the range of about 10 to about 40 ° C. for about 4 to about 24 hours, depending on the degree of degradation desired. In order to completely degrade glu-plasminogen, lys-plasminogen or miniplasminogen into human or swine elastase, it is necessary to expose these polypeptides to enzymes at room temperature for at least about 12 hours. Changing the pH and exposure time to enzymes results in less or partial degradation of one or more sensitive degradation sites. The degradation product is then purified by methods known in the art, such as column chromatography. A preferred purification method is to apply the degradation product to the lysine-sepharose column as described in Example 4.

Solid Phase Synthesis of Kringle 5 Peptide Fragments

The following examples are provided to further illustrate the preparation of the novel compounds of the present invention.

Example 1

N-Ac-Val-Leu-Leu-Pro-Asp-Val-Glu-Thr-Pro-Ser-Glu-Glu-Asp-NH ₂

The amide peptide synthesis column (Applied Systems) is placed in the peptide synthesis column position of the Perkin Elmer / Applied Biosystems “Synergy” peptide synthesizer, using the following synthetic sequence:

1. solvate the resin with DMF for about 5 minutes;

2. De-blocking the Fmoc group using 20% piperidine in DMF from the α-N-terminus of the resin-bound amino acid;

3. wash the resin with DMF for about 5 minutes;

4. 0.2 M solution of HBTU (25 μmol) and HOBT (25 μmol) in DMSO-NMP (N-methylpyrrolidone) with α-C-terminus of amino acid 1 (Fmoc-Asp (β-O ^t Bu), 25 μmol) And activation with a 0.4 M solution of diisopropylethylamine (25 μmol) in DMSO-NMP to couple the activated amino acid to the resin;

5. coupling the activated Fmoc-protected amino acid (prepared in step 5) to the resin-bound amino acid (prepared in step 2) in DMF for about 30 minutes;

6. Wash with DMF for 5 minutes;

7. Repeat steps 3 to 6 for the following amino acids:

Number amino acids

2.Fmoc-Glu (γ-O ^t Bu)

Fmoc-Glu (γ-O ^t Bu)

4.Fmoc-Ser ( ^t Bu)

5. Fmoc-Pro

6.Fmoc-Thr ( ^t Bu)

7.Fmoc-Glu (γ-O ^t Bu)

8.Fmoc-Val

9.Fmoc-Asp (β-O ^t Bu)

10. Fmoc-Pro

11.Fmoc-Leu

12.Fmoc-Leu

13.Fmoc-Val

8. coupling acetic acid to the α-N-terminus of the resin-bound peptide through the conditions of steps 4 and 5;

9. Wash the resin with THF for about 5 minutes to remove DMF and shrink the resin, then dry the resin with argon for 10 minutes and nitrogen for at least 10 minutes to obtain a clean, resin-bound peptide;

10. Just prepared by mixing the decomposition reagent (thioanisole (100 μl), water (50 μl), ethanedithiol (50 μl) and trifluoroacetic acid (1.8 mL) in the above order at -5 to -10 ° C. 10-15 minutes at 0 ° C. followed by an additional 1.75 hours at ambient temperature (add 0.5 hours for each Arg (Pmc) if present) from the resin while simultaneously deprotecting the amino acid side chains Decompose peptides. The amount of decomposition reagent used is determined by the following equation:

Weight (mg) of peptide bound resin Amount of degradation reagent (μl)

0-10 100

10-25 200

25-50 400

50-100 700

100-200 1200

11. The product is filtered off and washed with pure trifluoroacetic acid, the filtrate is added to a centrifuge tube containing about 8 ml of cold diethyl ether in 0.5 ml fractions and centrifuged to decantation and the above until all the peptides are precipitated. Repeating the process (if the peptide did not precipitate upon ether addition, the mixture was extracted with 30% aqueous acetic acid solution (3 × 1 mL) and the aqueous extracts were combined and lyophilized to yield the product);

12. A 7 μm Symmetry Prep C18 column (7.8 × 300 mm) was used with the crude peptide or with a solvent mixture that varied the 5% to 100% acetonitrile (water, 0.1% TFA) gradient over 50 minutes. Purification using HPLC followed by lyophilization yielded N-Ac-Val-Leu-Leu-Pro-Asp-Val-Glu-Thr-Pro-Ser-Glu-Glu-Asp-NH ₂ .

Example 2

N-Ac-Met-Phe-Gly-Asn-Gly-Lys-Gly-Tyr-Arg-Gly-Lys-Arg-Ala-Thr-Thr-Val-Thr-Gly-Thr-Pro-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Pro as amino acid 1. The following amino acids were added using the indicated conditions to add N-Ac-Met-Phe-Gly-Asn-Gly-Lys-Gly-Tyr-Arg-Gly-Lys-Arg-Ala-Thr-Thr-Val-Thr-Gly-Thr 35 mg of Pro-NH ₂ is obtained.

Number amino acids

2.Fmoc-Thr ( ^t Bu)

3. Fmoc-Gly

4.Fmoc-Thr ( ^t Bu)

5. Fmoc-Val

6.Fmoc-Thr ( ^t Bu)

7.Fmoc-Thr ( ^t Bu)

8. Fmoc-Ala

9. Fmoc-Arg (Pmc)

10.Fmoc-Lys (Boc)

11.Fmoc-Gly

12.Fmoc-Arg (Pmc)

13.Fmoc-Thr ( ^t Bu)

14.Fmoc-Gly

15.Fmoc-Lys (Boc)

16.Fmoc-Gly

17.Fmoc-Asn (Trt)

18.Fmoc-Gly

19.Fmoc-Phe

20.Fmoc-Met

Example 3

Ac-Gln-Asp-Trp-Ala-Ala-Gln-Glu-Pro-His-Arg-His-Ser-Ile-Phe-The-Pro-Glu-Thr-Asn-Pro-Arg-Ala-Gly-Leu- Glu-Lys-Asn-Tyr-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. Using the conditions indicated, add the following amino acids to Ac-Gln-Asp-Trp-Ala-Ala-Gln-Glu-Pro-His-Arg-His-Ser-Ile-Phe-The-Pro-Glu-

40 mg of Thr-Asn-Pro-Arg-Ala-Gly-Leu-Glu-Lys-Asn-Tyr-NH ₂ is obtained.

Number amino acids

2.Fmoc-Asn (Trt)

Fmoc-Lys (Boc)

4.Fmoc-Glu (γ-O ^t Bu)

5. Fmoc-Leu

6. Fmoc-Gly

7. Fmoc-Ala

8.Fmoc-Arg (Pmc)

9. Fmoc-Pro

10.Fmoc-Asn (Trt)

11.Fmoc-Thr ( ^t Bu)

12.Fmoc-Glu (γ-O ^t Bu)

13. Fmoc-Pro

14.Fmoc-Thr ( ^t Bu)

15. Fmoc-Phe

16.Fmoc-Ile

17.Fmoc-Ser ( ^t Bu)

18.Fmoc-His (Trt)

19.Fmoc-Arg (Pmc)

20.Fmoc-His (Trt)

21.Fmoc-Pro

22.Fmoc-Glu (γ-O ^t Bu)

23. Fmoc-Gln (Trt)

24. Fmoc-Ala

25.Fmoc-Ala

26.Fmoc-Trp

27.Fmoc-Asp (β-O ^t Bu)

28.Fmoc-Gln (Trt)

Example 4

N-Ac-Arg-Asn-Pro-Asp-Gly-Asp-Val-Gly-Gly-Pro-Trp-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Trp as amino acid 1. The following amino acids were added using the indicated conditions to yield 20 mg of N-Ac-Arg-Asn-Pro-Asp-Gly-Asp-Val-Gly-Gly-Pro-Trp-NH ₂ .

Number amino acids

2. Fmoc-Pro

3. Fmoc-Gly

4. Fmoc-Gly

5. Fmoc-Val

6.Fmoc-Asp (β-O ^t Bu)

7. Fmoc-Gly

8.Fmoc-Asp (β-O ^t Bu)

9. Fmoc-Pro

10.Fmoc-Asn (Trt)

11.Fmoc-Arg (Pmt)

Example 5

N-Ac-Tyr-Thr-Thr-Asn-Pro-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to yield 10 mg of N-Ac-Tyr-Thr-Thr-Asn-Pro-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3. Fmoc-Tyr ( ^t Bu)

4. Fmoc-Leu

Fmoc-Lys (Boc)

6.Fmoc-Arg (Pmc)

7. Fmoc-Pro

8.Fmoc-Asn (Trt)

9.Fmoc-Thr ( ^t Bu)

10.Fmoc-Thr ( ^t Bu)

11.Fmoc-Tyr ( ^t Bu)

Example 6

N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂ (4 mg). MS (FAB) m / z 995 (M + H) ⁺ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3. Fmoc-Tyr ( ^t Bu)

4. Fmoc-Leu

Fmoc-Lys (Boc)

6.Fmoc-Arg (Pmc)

7. Fmoc-Pro

Example 7

N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1. The following amino acids were added using the indicated conditions to afford N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-NH ₂ (6 mg). MS (FAB) m / z 832 (M + H) ⁺ .

Number amino acids

2. Fmoc-Tyr ( ^t Bu)

3. Fmoc-Leu

4.Fmoc-Lys (Boc)

5. Fmoc-Arg (Pmc)

6. Fmoc-Leu

Example 8

N-Ac-Pro-Glu-Lys-Arg-Tyr-Asp-Tyr-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Pro-Glu-Lys-Arg-Tyr-Asp-Tyr-NH ₂ (6 mg). MS (FAB) m / z (1101) (M + H) ⁺ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3. Fmoc-Tyr ( ^t Bu)

Fmoc-Arg (Pmc)

Fmoc-Lys (Boc)

6. Fmoc-Glu

7. Fmoc-Pro

Example 9

N-Ac-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Arg-Lys-Leu-Tyr-Asp-Tyr-NH ₂ (8 mg). MS (FAB) m / z (898) (M + H) ⁺ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3. Fmoc-Tyr ( ^t Bu)

4. Fmoc-Leu

Fmoc-Lys (Boc)

6.Fmoc-Arg (Pmc)

Example 10

N-Ac-Pro-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr-NH ₂ (SEQ ID NO: 13)

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Pro-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr-NH ₂ (2 mg). MS (ESI) m / z (1121) (M + H) ⁺ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3.Fmoc-3-I-Tyr ( ^t Bu)

4. Fmoc-Leu

Fmoc-Lys (Boc)

6.Fmoc-Arg (Pmc)

7. Fmoc-Pro

Example 11

N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-NH ₂ (SEQ ID NO: 14)

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Tyr ( ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-NH ₂ (2.5 mg). MS (ESI) m / z (1121) (M + H) ⁺ .

Number amino acids

2.Fmoc-Asp (β-O ^t Bu)

3. Fmoc-Tyr ( ^t Bu)

4. Fmoc-Leu

Fmoc-Lys (Boc)

6.Fmoc-Arg (Pmc)

7. Fmoc-Pro

Example 12

N-Ac-Lys-Leu-Tyr-Asp-NH ₂

The title compound is prepared using the synthetic sequence described in Example 1 and using Fmoc-Asp (β-O ^t Bu) as amino acid 1. The following amino acids were added using the indicated conditions to afford N-Ac-Lys-Leu-Tyr-Asp-NH ₂ (2 mg).

Number amino acids

2. Fmoc-Tyr ( ^t Bu)

3. Fmoc-Leu

4. Fmoc-Lys

Example 13

N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I ¹²⁵ -Tyr ⁵³⁵ -NH ₂ and N-Ac-Pro-Arg-Lys-Leu-3-I ^{125 which} are SEQ ID NO: 13 and SEQ ID NO: 14, respectively Preparation and Separation of a Mixture of -Tyr ⁵³³ -Asp-Tyr-NH ₂

1 iodine (Pierce, Rockford, IL) in a solution of 30 μg of N-acetyl-prolyl-arginyl-lysyl-leucil-tyrosyl-aspartyl-tyrosylamide in 80 ml of phosphate buffered saline (PBS) And NaI ^{125 10} μCi are added. After 10 minutes, the reaction mixture was applied to a Waters C18-Light SepPack column to remove excess NaI ¹²⁵ reagent and eluted with water, then eluted with 0.1% TFA in a 1: 1 CH ₃ CN / water mixture, 3 × 200 μl fractions are collected to yield a mixture of Tyr ⁵³³ − and Tyr ⁵³⁵ radiolabeled peptides.

The hot peptide mixture was transferred to the cold carrier Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-NH ₂ and N-Ac-Pro-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr The equimolar solution of —NH ₂ is simultaneously injected into the C18HPLC column and the elution times are set to 36 minutes and 38 minutes, respectively. Elution was repeated for the solvent system in Example 1 and the relevant fractions were combined and lyophilized to yield the desired compound N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-NH ₂ in a minimum amount. Obtained with impurity N-Ac-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr-NH ₂ .

General methodology

Example 14

Isolation and Purification of Kringle 5 Peptide Fragments

Powell et al., Arch Biochem, Biophys. 248 (1): 390-400 (1986); Incorporated herein by reference] Lys plasminogen (Lys-HPg, Abbott Laboratories, Abbott Park, IL) was digested with porcine elastase (SIGMA, St. Louis, Mo.) to Cringle 5 Prepare peptide fragments. 1.5 mg of pig elastase is incubated with 200 mg of Lys-HPg in 50 mM Tris-HCl pH 8.0. DPF (diisopropyl fluorophosphate, SIGMA) is added to a final concentration of 1 mM to terminate the reaction. The mixture is ground for an additional 30 minutes and concentrated by dialysis overnight against 50 mM Tris pH 8.0. The isolated plasminogen was subjected to 2.5 cm × 15 cm Lysine-Sepharose 4B column [Brockway, WJ and Castellino, FJ, Arch Biochem. Biophys. 151: 194-199 (1972); Cited herein by reference and equilibrated with 50 mM Tris pH 8.0 until the absorbance reaches 0.05 (280 nm) (this step is followed by the Kringle 1 region and / or Kringle 4 region (both lysine) To recover the fragments). Non-absorbing Kringle 5 peptide fragments are dialyzed against 50 mM Na ₂ PO ₄ buffer, pH 5.0 and then applied to BioRad Mono-S columns equilibrated with the same buffer. The degraded Kringle 5 region, uncleaved mini-HPg and the remaining protease domain fractions are eluted with 0-20%, 20-50% and 50-70% step gradients of 20 mM phosphate / 1M KCl pH 5.0. Kringle 5 peptide fragments are eluted in 50% steps as determined by gel electrophoresis. The collected peaks are dialyzed overnight against 20 mM Tris pH 8.0.

Isolated Kringle 5 fragments were determined to be at least 95% pure by silver staining (Coomasie Blue) by FPLC chromatography and DodSO4 / PAGE. Sequencing of the amino terminal regions of the purified fragments revealed that there are three polypeptides having the α-N-terminal sequence of VLLPDVETPS, VAPPPVVLL and VETPSEED, which are amino acid positions Val ⁴⁴⁹ -Ser ⁴⁵⁸ , Val ⁴⁴³ of SEQ ID NO: 1 Corresponding to -Leu ⁴⁵⁰ and Val ⁴⁵⁴ -Asp ⁴⁶¹ , respectively.

Example 15

Endothelial Proliferation Assay

In vitro proliferation of endothelial cells is described in Lingen, et al., In Laboratory Investigation, 74: 476-483 (1996); As described herein by reference, the cell titers measured using a Cell Titer 96 Aqueous Non-Radioactive Cell Proliferation Assay kit (Promega Corporation, Madison, Wis.). do. Bovine capillary (adrenal) endothelial cells were prepared in Dulbecco's Modified Eagle Medium (DMEM) containing 10% donor calf serum and 1% BSA (bovine serum albumin, GIBCO BRL, Gaithersburg, MD). Plate at 1000 cell density per well of well plate. After 8 hours, the cells are fasted overnight in DMEM containing 0.1% BSA and then resupplied with medium containing the indicated concentrations of inhibitor and 5 ng / ml bFGF (basic fibroblast growth factor). Assay results are corrected for unstimulated cells (ie without bFGF) and bFGF alone (ie without inhibitor) as maximum proliferation. When multiple experiments are combined, the results are expressed in% change compared to bFGF only.

Example 16

Endothelial cell migration assay

Essentially, Polverini, PJ et al., Methods Enzymol, 198: 440-450 (1991); Endothelial cell migration assays as described herein by reference. Briefly, bovine capillary (adrenal cortex) endothelial cells (BCE, Judah Folkman, supplied by Harvard University Medical School) are fasted overnight in DMEM containing 0.1% bovine serum albumin (BSA). Cells are then harvested with trypsin and resuspended in DMEM containing 0.1% BSA at a concentration of 1.5 × 10 ⁶ cells / ml. Cells are added to the base of a 48-well modified Boyden chamber (Nucleopore Corporation, Cabin John, MD). The chamber is aligned and switched over and dried by allowing cells to adhere to a polycarbonate chemotactic membrane (5 μm pore size) immersed in 0.1% gelatin overnight at 37 ° C. for 2 hours. The chamber is then switched back and test material is added to the wells above the chamber (50 μl total volume); The device is incubated at 37 ° C. for 4 hours. Membranes are recovered, fixed and stained (DiffQuick, Fisher Scientific, Pittsburgh, Pa.) To count the number of cells that have migrated to the upper chamber per ten high power fields. When subtracting the baseline shift to DMEM + 0.1% BSM and adding the number of cells migrated per 10 high power fields or the results from multiple experiments, report the data as% migration inhibition compared to the positive control. The results are shown in Table 1.

Example 17

Effect of Kringle 5 Peptide Fragment on In Vitro Endothelial Cell Proliferation

The effect of Kringle 5 peptide fragments on endothelial cell proliferation is measured in vitro using the endothelial cell proliferation assay described above. For these experiments, Kringle 5 peptide fragments are tested at various concentrations ranging from about 100 to 1000 pM using bFGF prepared as described in Examples 1-14 and used as maximal growth control. Kringle 5 peptide fragment SEQ ID NO: 3 is effective in inhibiting BCE cell proliferation in a dose-dependent manner. The concentration of Kringle 5 peptide fragment sequence 3 (ED ₅₀ ) required to reach 50% inhibition was determined to be about 300 pM. In contrast, the ED ₅₀ of Kringle 1-4 was found to be 135 nM.

The effect of different Kringle peptide fragments on BCE cell proliferation is summarized in Table 1. The Kringle 3 peptide fragment had the least effect on inhibiting BCE cell proliferation (ED ₅₀ = 460 nM), followed by the Kringle 1 peptide fragment (ED ₅₀ = 320 nM), followed by the Kringle 1-4 peptide fragment (ED ₅₀ = 135 nM), followed by Kringle 1-3 peptide fragment (ED ₅₀ = 75 nM). Kringle 5 peptide fragment was most effective in inhibiting BCE cell proliferation and ED ₅₀ was 0.3 nM.

Example 18

Effect of Kringle 5 Peptide Fragment on Endothelial Cell Migration in Vitro

The effect of Kringle 5 peptide fragments on endothelial cell xenografts is also determined in vitro using the endothelial cell migration assay described above. Kringle 5 peptide fragments inhibit BCE cell migration in a dose-dependent manner and ED ₅₀ is approximately 300 pM. At the concentration of Kringle 5 peptide fragments required for maximum inhibition of BCE cells, PC-3 cells and MDA 486 cells are also inhibited. Considered in conjunction with the results of Example 2, these results indicate that the inhibition of simulated proliferation and migration of BCE cells by Kringle 5 peptide fragments is both potent, specific for endothelial cells and specific for normal or tumor cells. Not shown.

The foregoing is merely illustrative of the invention and is not intended to limit the invention to the described compounds. Modifications and variations apparent to those skilled in the art are within the scope and nature of the invention as defined in the appended claims.

Table 1 summarizes the ED ₅₀ values obtained from the various kringle fragments of the present invention for in vitro BCE cell proliferation and cell migration. In the table, Kringle peptide fragments are labeled according to their corresponding sequence homology to SEQ ID NO: 1. The symbol "*" refers to Marti, D., et al., Eur. J. Biochem., 219: 455-462 (1994). The symbol "-" indicates no data.

Protein fragment from SEQ ID NO: 1 Antiproliferative Activity of BCE Cells (ED ₅₀ ) Inhibition of migration of HMVEC cells (ED ₅₀ ) Kringle 1-4 (Angiostatin) ^* 135nM 160nM Kringle 1 (Tyt ⁸⁰ -Glu ¹⁶³ ) ^* 320 nM - Kringle 2 (Glu ¹⁶¹ -Thr ²⁴⁵ ) ^* Inactive - Kringle 3 (Thr ²⁵³ -Ser ³³⁵ ) ^* 460 nM - Kringle 4 (Val ³⁵⁴ -Val ⁴⁴³ ) ^* Inactive - Kringle 1-3 (Tyr ⁸⁰ -Pro ³⁵³ ) ^* 75nM 60nM Kringle 2-3 (Glu ¹⁶¹ -Ser ³³⁵ ) ^* - - Kringle 5 (Val ⁴⁴³ -Ala ⁵⁴³ ) 250 pM 200 pM Kringle 5 (Val ⁴⁴⁹ -Ala ⁵⁴³ ) - 240pM Kringle 5 (Val ⁴⁵⁴ -Ala ⁵⁴³ ) - 220 pM Kringle 5 (Val ⁴⁴³ -Phe ⁵⁴⁶ ) 60nM 55 nM Kringle 5 (Val ⁴⁴⁹ -Phe ⁵⁴⁶ ) - - Kringle 5 (Val ⁴⁵⁴ -Phe ⁵⁴⁶ ) - - Kringle 4-5 (Val ³⁵⁵ -Ala ⁵⁴³ ) - 280pM Kringle 4-5 (Val ³⁵⁵ -Phe ⁵⁴⁶ ) - - N-Ac-Val ⁴⁴⁹ -Asp ⁴⁶¹ -NH ₂ - > 1mM N-Ac-Met ⁴⁶³ -Pro ⁴⁸² -NH ₂ - > 1mM N-Ac-Gln ⁴⁸⁴ -Tyr ⁵¹¹ -NH ₂ - > 100 μM N-Ac-Arg ⁵¹³ -Trp ⁵²³ -NH ₂ - 500 pM N-Ac-Tyr ⁵²⁵ -Tyr ⁵³⁵ -NH ₂ - 200 pM N-Ac-Pro ⁵²⁹ -Tyr ⁵³⁵ -NH ₂ - 120 pM N-Ac-Pro ⁵²⁹ -Asp ⁵³⁴ -NH ₂ - 123pM N-Ac-Pro ¹⁵⁰ -Tyr ¹⁵⁶ -NH ₂ - 160nM N-Ac-Arg ⁵³⁰ -Tyr ⁵³⁵ -NH ₂ - 80 pM N-Ac-Pro-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr-NH ₂ - > 100nM N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-NH ₂ - 400 pM N-Ac-Lys ⁵³¹ -Tyr ⁵³⁴ -NH ₂ - -

Example 19

Recombinant Expression of Kringle 5 Fragment in Pichia Pastoris

A. Preparation of cDNA encoding Kringle 5 fragment by PCR:

Amino acid positions 450-543 (hereinafter K5A) of SEQ ID NO: 1 for cloning and expression in both eukaryotic and prokaryotic hosts using PCR, (2) amino acid positions 450-546 (hereafter K5F), (3) CDNA fragment encoding a Kringle 5 peptide fragment having amino acid sequence from amino acid position 355-543 (hereinafter K4-5A) of SEQ ID NO: 1 and (4) amino acid position 355-546 (hereafter K4-5F) of SEQ ID NO: 1 Generate. CDNA encoding human plasminogen as a template (Dr. E. Reich, State University of New York, Stony Brook, NY) and a set of forward and reverse primers shown below (Operon Technologies, Inc.). Alameda, CA) is used to generate DNA fragments.

SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 5

Standard PCR conditions, ie, each dNTP, using primer set SEQ ID NO: 2 and SEQ ID NO: 4 (for K5A), SEQ ID NO: 5 (for K5F), SEQ ID NO: 3 and SEQ ID NO: 8 (K4-5A) and SEQ ID NO: 5 (for K4-5A) (Where N is A, T, G and C) PCR in 100 μl total reaction volume containing 200 μM, 0.2 μM of each primer, approximately 10 ng of template DNA and Vent ^R , 1 unit of DNA polymerase (New England Biolabs) Perform amplification. A total of 25 cycles were performed on DNA Thermal Cycler 480 (Perkin Elmer, Foster City, CA) for 1 cycle = 1 minute at 94 ° C, 2 minutes at 48 ° C, and 1 minute at 72 ° C. After amplification, the PCR product was gel purified and digested with BamHI and XhoI (New England Biolabs) to bind to modified Pichia expression vectors (pHi1-D8, see below) digested with the same enzymes and into HB101 cells (BioRad). Transformation is performed by electroporation. DNA from each clone is prepared and restriction enzyme digested and sequenced to confirm that it contains the insert with the correct sequence as the clone in the proper orientation. Plasmids from positively identified clones are transformed into Pichia Pastors strain GS115 (Invitrogen, Carlsbad, Calif.) According to the manufacturer's instructions. To identify positive clones in Pichia, cells are grown overnight at 29 ° C. in 5 mL BMGY medium (Invitrogen), harvested by centrifugation and resuspended in 0.5 mL BMMY medium for expression. After 2 days of incubation at 29 ° C., the culture supernatants are harvested and aliquots are analyzed by SDS-PAGE and Western blot according to known techniques. SDS-PAGE gels are shown in FIG. 6.

B. Construction of the expression vector pHIl-D8:

The Pichia expression vector, pHil-D8, is constructed by modifying the vector pHil-D2 to include a synthetic leader sequence for secretion of the recombinant protein (see FIG. 5). The leader sequence, 5'-ATGTTCTCTCCAATTTTGTCCTTGGAAATTATTTTAGCTTTGGCTACTTTGCAATCTGTCTTCGCTCAGCCAGTTATCTGCACTACCGTTGGTTCCGCTGCCGAGGGGATCC-3 '(SEQ ID NO: 9), is functionally bound to the pro-peptide sequence (in bold) that secretly binds the PHO1. To construct pHil-D8, the vector is a reverse primer having a sequence encoding PHO1, a forward primer corresponding to nucleotides 509-530 of pHil-S1 (SEQ ID NO: 7), and a nucleotide sequence encoding a late region of the PHO1 secretion signal. (SEQ ID NO: 8) and the pro-peptide sequence (nucleotides 67-108 of SEQ ID NO: 9), so it is carried out using pHil-S1 (Invitrogen) as a template. Primer sequences (Operon Technologies, Inc. Alameda, CA) are as follows:

SEQ ID NO: 7 SEQ ID NO: 8

Amplification is performed for 25 times in a cycle as described in Example 19. The PCR product (approximately 500 bp) is gel-purified, digested with BlpI and EcoRI and bound to pHil-D2 digested with the same enzyme. The DNA. Positive clones are identified by transformation into Coli HB101 cells and restriction enzyme digestion and sequencing. One clone with the appropriate sequence is designated pHil-D8.

Example 20

Recombinant Expression of Kringle 5 Peptide Fragments in Bacteria

Other reagents as well as limitations or other modifying enzymes used are commercially available. Primers are synthesized in Abbott Laboratories by standard methods known in the art on automated synthesizers.

The DNA of the Kringle 5 peptide fragment is also generated by PCR amplification for cloning and expression in bacterial cells (E. coli). The general method chosen is to generate the PCR fragment of the desired coding region without terminating the codon, treating the end kinase, and cloning the fragment directly into the selected vector. The vector construct is then transformed into suitable host cells and colonies selected by PCR using vector primers to confirm the presence of the insert. To determine the orientation of the inserts, the PCR reactions showing insert positive clones are directly PCR using 1 vector primer and 1 insert primer.

A. Preparation of smooth-terminated, phosphatase-treated vectors:

Expression vectors useful for bacterial production of Kringle 5 peptide fragments are shown in Table 2.

vector Source Restriction enzymes fusion Upet Abbott-Modified pET21d SapI none UpET-HTh Abbott-Modified pET21d SapI N-terminal His6-thrombin recognition Upet-ubi Abbott-Modified pET21d SapI N-terminal His6-ubiquitin-Enterokinase Recognition pET32a Novagen NcoI + Xhol Thioredoxin, Enterokinase Awareness pGEX-4T-2 Pharmacia ^R EcoRI + NotI GST pCYB3 New england biolabs NcoI + SapI C-terminal intein

All vectors are first isolated and purified using a Qiagen column according to the manufacturer's instructions (QIAGEN, Inc., Santa Clarita, CA). Vector DNA (1 μg) is digested with 20 μl of NEB4 buffer (New England Biolabs) containing 100 μg / ml bovine serum albumin (BSA) with a suitable restriction enzyme (see Table 2). The reaction was briefly centrifuged and 20 μl of deionized H ₂ O, 0.4 μl of dNTP mix (Pharmacia ^R ; dNTP 20 mM each) and 0.25 μl of cloned pfu DNA polymerase (Stratagene ^R ; 2.5 units / μl) were added to the reaction mixture. Incubate at 65 ° C. for 20 minutes to fill the ends of the vector. The reaction mixture is briefly centrifuged again and 4 μl of diluted calf intestinal phosphatase (GIBCO BRL, Gaithersburg, MD; 5 units in total) is added. The mixture is then incubated at 50 ° C. for 1 hour. 5 μl 10% SDS, 2 μl 5M NaCl, 2 μl 0.5M EDTA, and 45 μl H ₂ O are added and the reaction is briefly centrifuged and then incubated at 65 ° C. for 20 minutes. The reaction is then extracted three times with buffer-saturated phenol-chloroform (GIBCO BRL) and once with chloroform. The aqueous phase is purified via CHROMA SPIN ^R , 1000 TE column (CLONTECH, Palo Alto, CA).

B. Generation of DNA Fragments by PCR:

PCR primers are designed and ordered based on the published sequences for human plasminogen (see SEQ ID NO: 12) and are shown below:

SEQ ID NO: 10 SEQ ID NO: 11 SEQ ID NO: 13

Unless indicated otherwise, all PCRs are performed with 200 μM of each dNTP and 1 μM of each primer using pfu DNA polymerase and buffer (Stratagene ^R ). Primer sets used are SEQ ID NO: 11 and SEQ ID NO: 13 (for K5A), and SEQ ID NO: 10 and SEQ ID NO: 13 (for K4-5A). Vector pHil-D8 (described in Example 19) containing K4-K5A is used as a template. Prior to use as template, the DNA is digested with DraI (which multiplexes the outer surface of the Kringle region) to remove the background caused by the pHil-D8 vector in the transformation. Approximately 10 ng of template per 50 μl of PCR reaction is used. PCR reactions were performed at 94 ° C. for 2 minutes; Then 94 ° C., 30 seconds; 49 ° C., 1 minute; 72 ° C., 4 minutes; And 72 ° C., for 15 cycles of 7 minutes. After the PCR reaction, 0.5 [mu] l of 100 mM ATP and 5 units of T4 kinase are added and the reaction is incubated at 37 [deg.] C. for 20 minutes to treat the ends with kinases. The reaction is then heated at 68 ° C. for 15 minutes and purified on an S400-HR spin column (Pharmacia ^R ) for use in binding.

C. Binding of PCR Fragments into Expression Vectors:

Six recombinant constructs described above (i) K5A in UpET-PS3, (ii) K5A in pET32a, (iii) K4-5A in UpET-PS3, (iv) K4-5A in UpET-Ubi, (v) K4-5A in pET32a and (vi) K4-5A in pGEX-4T-2) are prepared as follows: blunt-ended, phosphatase treated vector (1 μl from step A) and PCR fragment (step B above) 1 μl) is bound to 5.5 μl total volume using a Rapid Ligation Kit according to the manufacturer's instructions (BOEHRINGER-MANNHEIM Corp., Indianapolis, IN). The binding mixture (1 μl) is then transformed into 20 μl of competitive cells (XL1-Blue Supercompetent cells or XL2-Blue Ultracompetent cells (Stratagene ^R )). Recombinant cells are selected on LB-Amp agar plates (MicroDiagnostics, Lombard, IL).

D. Expression Studies:

pGEX vector to this. It is expressed in Coli XL1-Blue or XL2-Blue. By separating all the other vectors. Transform into Coli BL21 (DE3) (Novagen) according to the manufacturer's instructions. Each colony was inoculated in 2.5 ml of LB / Amp and shaken overnight at 37 ° C. at 225 rpm. Overnight cultures (0.5 mL) were shaken at 225 rpm, 37 ° C. to OD600 0.5 to 0.6 when inoculated into 50 mL LB / Amp in 250 mL flasks. Isopropyl-1-thio-β-D-galactopyranoside (IPTG, 100 mM) is then added at a final concentration of 1 mM. The culture is shaken at 225 rpm, 30 ° C. for 3 hours before spin down. Samples for SDS-PAGE are prepared according to known techniques. The first experiment shows that cells with K5A / pET32a, K4-5A / pET32a and K4-5A / pGEX produce most of the recombinant protein. Cultures of these clones are then analyzed for soluble versus insoluble expression by SDS-PAGE. As shown in FIG. 7, K5A / pET32a produces recombinant proteins that are almost completely soluble (compare lanes S and P of Trx-K5A), while K4-5A / pET32a and K4-5A / pGEX are about 75% soluble. Produces protein

E. Construction of Abbott-Modified Vectors:

i. VB1, VB2, VB3 and VB4 Cassette Preparation: VB1, VB2, VB3 and VB4 are made of synthetic DNA using techniques known to those skilled in the art. The sequences of synVB1, synVB2, synVB3 and synVB4 are as follows:

synVB1 SEQ ID NO: 14 synVB2 SEQ ID NO: 15 synVB3 SEQ ID NO: 16 synVB4 SEQ ID NO: 17

Each synthetic sequence is double stranded and cloned into pCR-script Cam ^™ (Stratagene ^R ) according to the manufacturer's instructions: clones with the correct sequence are then isolated by standard methods. 5 μg of purified DNA is digested in 20 μl of reaction in 1 × NEβ4 buffer containing 100 μg / ml BSA at 55 ° C. in BsmBI 8 units. Centrifuge the reaction briefly, add 20 μl of deionized H ₂ O, 0.4 μl of dNTP mix (Pharmacia ^R ; dNTP 20 mM each) and 0.25 μl of cloned pfu DNA polymerase (Stratagene ^R ; 2.5 units per μl) and add reaction 65 Incubate for 20 minutes at ℃ to fill the ends. DNA is then performed on 3% MetaPhor ^™ agarose gel (FMC, Rockland, Maine) in 0.5 × Tris-acetate-EDTA buffer (TAE). The cassette band is cleaved and the gel frozen to centrifuge the buffer via Ultrafree ^™ Probind Cartridge (MILLIPORE Corp., Bedford, Mass.), And the DNA is eluted by isopropanol precipitation using Pellet Paint ^™ (Novagen) as a carrier. DNA (cfVB1, cfVB2, cfVB3 and cfVB4) is washed with 70% ethanol, dried briefly and resuspended in 25 μl of Tris-EDTA (TE) buffer.

ii. Construction of UpET: The vector pET21d (Novagen) is digested with SapI, first treated with T4 DNA polymerase + dGTP, followed by binding with Mung Bean Nuclease, followed by DNA polymerase I Klenow fragment. Each colony is selected to select a plasmid from which the existing SapI sites have been removed. The DNA is digested with NcoI + BamHI and bound to 5'-CATGTGAAGAGC-3 '(SEQ ID NO: 19) + 5'-GATCGCTCTTCA-3' (SEQ ID NO: 20) to introduce a single SapI site. Purified, validated and cloned DNA was digested with SapI + HindIII as described above, smoothed to phosphatase treatment, bound with a cfVB1 cassette, and e. Transform into Collie and plate on LB-Amp plates. Colon Thermowell containing 1 μM of each vector primer 5′-AGATCTCGATCCCGCGAA-3 ′ (front primer, SEQ ID NO: 21) and 5′-ATCCGGATATAGTTCCTC-3 ′ (SEQ ID NO: 22), respectively, by picking colonies on LB-Amp agar plates with sterile pipette tips Transfer to 20 μl AmpliTaq ^R PCR Mix (Perkin Elmer) in the plate. The reaction was heated at 94 ° C. for 5 minutes and then 94 ° C., 30 seconds for 30 cycles using a GeneAmp 9600 thermal cycler; 40 ° C., 1 minute; Cycling at 72 ° C. for 2 minutes. 10 μl of each reaction is run on agarose gel. To determine the orientation of the cassette, 0.25 [mu] l of the correct size PCR screen is added to the fresh reaction containing the reverse primer and the cassette primer 5'-CGGGCTTTTTTTTGCTCTTCA-3 '(SEQ ID NO: 23). The reaction is cycled for an additional 10 cycles as described above. The final vector is sequenced using standard methods and one clone is labeled UpET.

iii. Construction of UpET-HTh: UpET is digested with SapI to prepare for smooth, phosphatase treated cloning. Binding to the cfVB2 cassette results in transformation, colony selection and sequencing as for cfVB1 binding.

iv. Construction of UpET-H: UpET is digested with SapI to prepare for smooth, phosphatase treated cloning. Binding to the cfVB3 cassette results in transformation, colony selection and sequencing as for cfVB1 binding.

v. Creation of UpET-Ubi: S. PCR fragments for S. cerevisiae ubiquitin were run on Ultma DNA polymerase and buffer (Perkin Elmer), dNTP 40 μM, primer 5'-CAGATTTTCGTCAAGACTT-3 '(Ubi-5p, SEQ ID NO: 24) and 5, respectively. '-ACCACCTCTTAGCCTTAG-3' (Ubi-3p, SEQ ID NO: 25) using 94 μg and 1.75 μg of yeast DNA, respectively, at 94 ° C., 2 minutes, followed by 94 ° C., 1 minute, 40 ° C., 1 minute; 72 ° C., 2 minutes; Subsequently, it occurs in 72 degreeC, 25 cycles of 7 minutes. PCR fragments were 94 ° C., 2 minutes, followed by primer 5′-CATGGTATATCTCCTTCTT-3 ′ (pET3p-ATG, SEQ ID NO: 26) and 5′-TGAGCAATAACTAGCATAAC-3 ′ (T7RevTerm, SEQ ID NO: 27) from 20 ng of pET15b (Novagen). 94 ° C., 45 seconds; 42 ° C., 1 minute; 72 ° C., 15 minutes; Subsequently, it generate | occur | produces in 72 degreeC and 10 cycles of 7 minutes. Ubiquitin and pET15b-derived PCR fragments are gel-purified and bound together using BRL T4 ligase and ligase buffer. The T7 promoter-ubiquitin PCR fragment was then subjected to 94 ° C., 2 using the binding as a template and Ultma DNA polymerase and primer 5′-AGATCTCGATCCCGCGAA-3 ′ (pET5p, SEQ ID NO: 28) and SEQ ID NO: 25. minute; Then 94 ° C., 30 seconds; 42 ° C., 1 minute; 72 ° C., 3 minutes; Subsequently, it generate | occur | produces in 72 degreeC and 25 cycles of 7 minutes. T7-ubiquitin PCR fragments are gel purified.

PCR fragments for Stromlysin in mature humans include primers 5'-TTAGGTCTCAGGGGAGT-3 '(Strom-3p, SEQ ID NO: 29) and kinase treated primers 5'-TTCAGAACCTTTCCTGGCA-3' (Strom-5p, SEQ ID NO: 30). 94 ° C., 2 seconds, followed by 94 ° C., 1 minute using approximately 20 ng of Ultma DNA polymerase (above) and the template (ie, stromoricin cloned into pET3b (Novagen)); 44 ° C., 1 minute; It generate | occur | produces in 15 cycles of 72 degreeC, 2 minutes, and 72 degreeC, and then 7 minutes. The stromelysine PCR reaction (10 μl) was annealed to the oligos 5'-AGCGGCGACGACGACGACAAG-3 '(Ek-Cut-5p, SEQ ID NO: 31) and 5'-CTTGTCGTCGTCGTCGCCGCT-3' (Ek-Cut-3p, enterokinase digestion site SEQ ID NO. 32) binds to 100 pMol in 40 μl of BRL ligase and ligase buffer. Enterokinase site-matured Ek-Stromelysin PCR fragments were 94 ° C., 2 min, using 1 μl of the binding as the template, primer sequence 29 and kinase treated sequence 31, Ultma DNA polymerase and buffer; Then 94 ° C., 1 min; 44 ° C., 1 minute; It generate | occur | produces in 10 cycles of 72 degreeC, 2 minutes, and then 72 degreeC, 7 minutes. Ek-stromericin PCR fragments are gel purified.

T7-ubiquitin and Ek-stromericin PCR fragments are combined together in BRL ligase and ligase buffer. Subsequently, 94 ° C., 2 sec., Using the conjugate as a template and Ultma DNA polymerase and primers SEQ ID NO: 28 and SEQ ID NO: 29; Then 94 ° C., 30 seconds; 42 ° C., 1 minute; T7-ubiquitin-Ek-stromyricin PCR fragments are generated in 25 cycles of 72 ° C., 6 minutes, followed by 72 ° C., 7 minutes.

PCR fragments were 94 ° C., 2 seconds, followed by 94 using Klen Taq (AB Peptides, St. Louis, MO) and pfu DNA polymerase using a stromelysin-pET3b plasmid template having primer sequences 26 and 30 30 ° C .; 42 ° C., 2 minutes; It generate | occur | produced in 68 cycles and 15 cycles of 20 minutes. The PCR fragment is mixed with the T7-Ubiquitin-Ek-Stromelysin PCR fragment to transform into BRL DH5α maximal effect competition cells. Isolation of the plasmid DNA studied as described above, transfection into BL21 (DE3), and expression confirm the correct clone.

94 ° C., 2 seconds, then 94 ° C., 30 seconds from the correct T7-Ubiquitin-Ek-Stromelysin expression plasmid using primers SEQ ID NO: 24 and SEQ ID NO: 32 and pfu DNA polymerase; 40 ° C., 1 minute; PCR fragments for Ubiquitin-Ek are generated in 20 cycles of 72 ° C., 3 minutes, 72 ° C., 7 minutes. The fragment is purified on a Pharmacia S-400 HR Spin column and bound to the VBC1 cassette using the Rapid DNA Binding Kit. PCR fragments were 94 ° C., 2 minutes followed by 94 ° C., 30 seconds using the binding and primer sequences 25 and 5′-TGAAGAGCAAAAAAAAGCCCG-3 ′ (SEQ ID NO: 33) and pfu DNA polymerase as templates; 40 ° C., 1 minute; It generate | occur | produces in 20 cycles of 72 degreeC, 2 minutes, 72 degreeC, and 7 minutes. The PCR fragment is treated with kinase and bound to Upet-H prepared for smooth, phosphatase treated cloning. The binding is transformed into competitive cells and colonies are selected by PCR as described above. Sequencing the plasmid DNA identifies the correct clone of UpET-Ubi.

Claims (62)

A compound of formula (I) or a pharmaceutically acceptable salt, ester or prodrug thereof. Formula I A-B-C-X-Y In the above formula, A is absent or is a nitrogen protecting group; Y is absent or is a carboxylic acid protecting group; B is 1 to about 197 natural amino acid residues, absent or corresponding to the sequence from about amino acid position 334 to amino acid position 530 of SEQ ID NO: 1; C is R ¹ -R ² -R ³ -R ⁴ , wherein R ¹ is lysyl; R ² is leucine or arginyl; R ³ is tyrosyl, 3-I-tyrosyl or phenylalanyl; R ⁴ is aspartyl; X is from 1 to about 12 natural amino acid residues and their analogs and analogs which are absent or correspond to the sequence of about amino acid position 546 at amino acid position 535 of SEQ ID NO: 1. The compound of claim 1, wherein B is present and A, C, X and Y are as defined above. The compound of claim 2, wherein X is present and A, B, C and Y are as defined above. 4. A compound according to claim 3 wherein A and Y are present and B, C and X are as defined above. The compound of claim 3, wherein A and Y are as defined above and B-C-X is (a) the sequence of amino acid positions 355-543 of SEQ ID NO: 1; (b) the sequences of amino acid positions 355-546 of SEQ ID NO: 1; (c) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (d) the sequences of amino acid positions 449-543 of SEQ ID NO: 1; (e) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; (f) the sequences of amino acid positions 443-546 of SEQ ID NO: 1; (g) the sequences of amino acid positions 449-546 of SEQ ID NO: 1; (h) the sequences of amino acid positions 454-546 of SEQ ID NO: 1; (i) the sequences of amino acid positions 525-535 of SEQ ID NO: 1; (j) the sequences of amino acid positions 529-535 of SEQ ID NO: 1; And (k) the sequence of amino acid positions 530-535 of SEQ ID NO: 1. The compound of claim 5, wherein A is N-Ac and Y is -NH ₂ . The compound of claim 1, wherein X is absent and A, B, C and Y are as defined above. 8. The compound of claim 7, wherein X, A and Y are as defined above and B-C is the sequence of amino acid positions 529-534 of SEQ ID NO: 1. The compound of claim 1, wherein B and X are absent and A, C and Y are as defined above. The compound of claim 9, wherein C is the sequence of amino acid positions 531-534 of SEQ ID NO: 1. The compound of claim 1 wherein the molecular weight of the compound is from 0.5 to 25,000 kilodaltons as determined by reduced polyacrylamide gel electrophoresis or mass spectrometry analysis and the amino acid sequence is substantially similar to the corresponding amino acid sequence of SEQ ID NO: 1. The compound of claim 1, wherein the endothelial cell migration inhibitory ED ₅₀ is about 100 to about 500 pM. The compound of claim 1, wherein the ED ₅₀ inhibiting endothelial cell proliferation is about 100 to about 500 pM. A compound of formula (II) or a pharmaceutically acceptable salt, ester or prodrug thereof. Formula II AB ₁ -C ₁ -X ₁ -Y In the above formula, A is absent or is a nitrogen protecting group; Y is absent or is a carboxylic acid protecting group; B ₁ is not present or is from 1 to about 176 natural amino acid residues corresponding to the sequence from about amino acid position 334 to amino acid position 513 of SEQ ID NO: 1; C ₁ is the sequence of amino acid positions 514 to 523 of SEQ ID NO: 1; X ₁ is 1 to about 10 natural amino acid residues and homologues and analogs thereof, absent or corresponding to sequences in amino acid positions 524 to amino acid positions 533 of SEQ ID NO: 1. The compound of claim 14, wherein B ₁ and X ₁ are absent and A, C ₁ and Y are as defined above. 16. The compound of any one of claims 8, 10 or 15, wherein A is N-Ac and Y is -NH ₂ . Cringle 5 peptide fragment having substantial sequence homology to plasminogen selected from plasminogen of human, rat, bovine, Rhesus monkey and pig. A Kringle 5 peptide fragment or fusion protein, wherein the Kringle 5 peptide fragment or the Kringle 5 fusion protein has substantial sequence homology to human plasminogen. A therapeutically effective amount of a mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is administered to a human or animal, thereby treating a disease in a patient in need of angiogenesis suppression treatment. The method of claim 19, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is selected from the group consisting of Kringle 5 peptide fragments or fusion proteins of human, rat, bovine, rhesus monkey and pig. The method of claim 20, wherein the Kringle 5 peptide fragment or Kringle 5 fusion protein is a human Kringle 5 peptide fragment or Kringle 5 fusion protein. The method of claim 19, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound of Formula I or a pharmaceutically acceptable salt, ester or prodrug thereof. Formula I A-B-C-X-Y In the above formula, A is absent or is a nitrogen protecting group; Y is absent or is a carboxylic acid protecting group; B is 1 to about 197 natural amino acid residues, absent or corresponding to the sequence from about amino acid position 334 to amino acid position 530 of SEQ ID NO: 1; C is R ¹ -R ² -R ³ -R ⁴ , wherein R ¹ is lysyl; R ² is leucine or arginyl; R ³ is tyrosyl, 3-I-tyrosyl or phenylalanyl; R ⁴ is aspartyl; X is from 1 to about 12 natural amino acid residues and their analogs and analogs which are absent or correspond to the sequence of about amino acid position 546 at amino acid position 535 of SEQ ID NO: 1. The method of claim 22, wherein the mammalian Kringle 5 fragment or Kringle 5 fusion protein is as defined above, wherein A and Y are as defined above, and B-C-X is (a) the sequence of amino acid position 355-543 of SEQ ID NO: 1; (b) the sequences of amino acid positions 355-546 of SEQ ID NO: 1; (c) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (d) the sequences of amino acid positions 449-543 of SEQ ID NO: 1; (e) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; (f) the sequences of amino acid positions 443-546 of SEQ ID NO: 1; (g) the sequences of amino acid positions 449-546 of SEQ ID NO: 1; (h) the sequences of amino acid positions 454-546 of SEQ ID NO: 1; (i) the sequences of amino acid positions 525-535 of SEQ ID NO: 1; (j) the sequences of amino acid positions 529-535 of SEQ ID NO: 1; And (k) a compound selected from the group consisting of sequences of amino acid positions 530-535 of SEQ ID NO: 1. The method of claim 22, wherein the compound is a Kringle 5 fragment of mammal, wherein X is absent, A and Y are as defined above, and B-C is the sequence of amino acid positions 529-534 of SEQ ID NO: 1. The method of claim 22, wherein said compound is free of X and B and A, C and Y are mammalian Kringle 5 fragments as defined above. The method of any one of claims 23 to 25, wherein A is N-Ac and Y is -NH ₂ . 20. The method of claim 19, wherein said disease is selected from the group consisting of cancer, arthritis, macular degeneration and diabetic retinopathy. The method of claim 27, wherein the disease is cancer. The method of claim 28, wherein the disease is selected from primary and metastatic solid tumors, carcinomas, sarcomas, lymphomas, psoriasis and hemangiomas. The method of claim 19, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound of Formula II, or a pharmaceutically acceptable salt, ester or prodrug thereof. Formula II AB ₁ -C ₁ -X ₁ -Y In the above formula, A is absent or is a nitrogen protecting group; Y is absent or is a carboxylic acid protecting group; B ₁ is not present or is from 1 to about 176 natural amino acid residues corresponding to the sequence from about amino acid position 334 to amino acid position 513 of SEQ ID NO: 1; C ₁ is the sequence of amino acid positions 514 to 523 of SEQ ID NO: 1; X ₁ is 1 to about 10 natural amino acid residues and homologues and analogs thereof, absent or corresponding to sequences in amino acid positions 524 to amino acid positions 533 of SEQ ID NO: 1. The compound of claim 30, wherein B ₁ and X ₁ are absent and A, C ₁ and Y are as defined above. A composition comprising an isolated single-stranded or double-stranded polynucleotide sequence encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein having angiogenesis inhibitory activity. 33. The composition of claim 32, wherein said polynucleotide sequence is a DNA sequence. The method of claim 33, wherein the DNA sequence comprises: (a) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (b) the sequence of amino acid positions 449-543 of SEQ ID NO: 1; (c) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; And (d) encodes an amino acid sequence selected from the group consisting of the sequences of amino acid positions 355-543 of SEQ ID NO: 1. The composition of claim 33, wherein said polynucleotide sequence encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37. A composition comprising a Kringle 5 peptide fragment or Kringle 5 fusion protein and a pharmaceutically acceptable excipient. A human or human may contain a cell containing a DNA sequence encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein and, if present in the cell, capable of expressing the Kringle 5 peptide fragment or Kringle 5 fusion protein. Transplanting into animal cells. (a) exposing the mammalian plasminogen to an elastase in a ratio of about 1: 100 to about 1: 300 to form a mixture of the plasminogen and the elastase; (b) culturing the mixture; And (c) separating Kringle 5 from the mixture. An isolated single-chain or double-stranded polynucleotide encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein of a mammal having angiogenesis inhibitory activity. 40. The group of claim 39, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein encoded by the polynucleotide consists of a human, rhesus monkey, bovine, rat, and porcine Kringle 5 peptide fragment or fusion protein. Polynucleotide selected from. 41. The polynucleotide of claim 40, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a human Kringle 5 peptide fragment or Kringle 5 fusion protein. 40. The method of claim 39, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is 1 to about 197 native, free of B or corresponding to the sequence from amino acid position about 334 to amino acid position 530 of SEQ ID NO: 1. Amino acid residues; C is R ¹ -R ² -R ³ -R ⁴ , wherein R ¹ is lysyl; R ² is leucine or arginyl; R ³ is tyrosyl or phenylalanyl; R ⁴ is aspartyl; X is absent or from 1 to about 12 natural amino acid residues corresponding to the sequence from amino acid position 535 to amino acid position about 546 of SEQ ID NO: 1; B ₁ is absent or from 1 to about 176 natural amino acid residues corresponding to the sequence from amino acid position about 334 to amino acid position 513 of SEQ ID NO: 1; C ₁ is the sequence from amino acid position 514 to amino acid position 523 of SEQ ID NO: 1; A polynucleotide wherein X ₁ is absent or a compound of formula BCX or B ₁ -C ₁ -X ₁ that is from 1 to about 10 natural amino acid residues corresponding to the sequences of amino acid positions 524 to amino acid positions 533 in SEQ ID NO: ₁ . The polynucleotide of claim 42, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound in which B is present and C and X are as defined above. The polynucleotide of claim 42, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound in which X is present and B and C are as defined above. The polynucleotide of claim 42, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a fragment in which B and X are present and C is as defined above. The method of claim 39, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein comprises (a) the sequence of amino acid positions 355-543 of SEQ ID NO: 1; (b) the sequences of amino acid positions 355-546 of SEQ ID NO: 1; (c) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (d) the sequences of amino acid positions 449-543 of SEQ ID NO: 1; (e) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; (f) the sequences of amino acid positions 443-546 of SEQ ID NO: 1; (g) the sequences of amino acid positions 449-546 of SEQ ID NO: 1; And (h) a sequence consisting of the sequence of amino acid positions 454-546 of SEQ ID NO: 1. The polynucleotide of claim 42, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is free of X and fragments B and C as defined above. The polynucleotide of claim 39 which is a DNA molecule. The polynucleotide of claim 39 which is an RNA molecule. A vector comprising a polynucleotide encoding a Kringle 5 peptide fragment or Kringle 5 fusion protein of a mammal having angiogenesis inhibitory activity. 51. The vector of claim 50 which is an expression vector. 52. The mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein encoded by the polynucleotide according to claim 51, wherein B is absent or corresponds to a sequence from amino acid position about 334 to amino acid position 530 of SEQ ID NO: 1 1 to about 197 natural amino acid residues; C is R ¹ -R ² -R ³ -R ⁴ , wherein R ¹ is lysyl; R ² is leucine or arginyl; R ³ is tyrosyl or phenylalanyl; R ⁴ is aspartyl; X is absent or from 1 to about 12 natural amino acid residues corresponding to the sequence from amino acid position 535 to amino acid position about 546 of SEQ ID NO: 1; B ₁ is absent or from 1 to about 176 natural amino acid residues corresponding to the sequence from amino acid position about 334 to amino acid position 513 of SEQ ID NO: 1; C ₁ is the sequence from amino acid position 514 to amino acid position 523 of SEQ ID NO: 1; X ₁ is not present or the sequence of amino acid positions 1 to 524, 1 to about 10 naturally occurring amino acid residue, and their complementary chain expression BCX or B ₁ -C ₁ -X ₁ in the compounds of vector corresponding to the sequence of amino acid position 533. The vector of claim 52, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is a compound in which B and X are present and C is as defined above. The vector of claim 52, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein is free of X and B and C are compounds as defined above. The method of claim 52, wherein the mammalian Kringle 5 peptide fragment or Kringle 5 fusion protein comprises (a) the sequence of amino acid positions 355-543 of SEQ ID NO: 1; (b) the sequences of amino acid positions 355-546 of SEQ ID NO: 1; (c) the sequence of amino acid positions 443-543 of SEQ ID NO: 1; (d) the sequences of amino acid positions 449-543 of SEQ ID NO: 1; (e) the sequence of amino acid positions 454-543 of SEQ ID NO: 1; (f) the sequences of amino acid positions 443-546 of SEQ ID NO: 1; (g) the sequences of amino acid positions 449-546 of SEQ ID NO: 1; And (h) a sequence selected from the group consisting of amino acids positions 454-546 of SEQ ID NO: 1. The vector of claim 52, wherein the vector is selected from the group consisting of pHil-D8, pET32a, pGEX-4T-2, Up-ET, UpEt-Ubi, and pCYB3. The vector of claim 52, further comprising a host cell transformed with said vector. The vector of claim 57, wherein the host cell is a eukaryotic cell. 59. The vector of claim 58, wherein the eukaryotic cell is Pichia pastoris. The host cell of claim 57, wherein the host cell is E. coli. Vector, which is coli prokaryote. (a) isolating a polynucleotide encoding a Kringle 5 peptide fragment; (b) cloning the polynucleotide into an expression vector; (c) transforming the vector into a suitable host cell; And (d) propagating said host cell under conditions suitable for expression of said soluble Kringle 5 peptide fragment or Kringle 5 fusion protein. (a) A-Pro-Arg-Lys-Leu-Tyr-Asp-3-I-Tyr-Y; (b) A-Pro-Arg-Lys-Leu-3-I-Tyr-Asp-Tyr-Y; (c) A-Pro-Glu-Lys-Arg-Tyr-Asp-Tyr-Y; And (d) A-Gln-Asp-Trp-Ala-Ala-Gln-Glu-Pro-His-Arg-His-Ser-Ile-Phe-Thr-Pro- A compound selected from the group consisting of Glu-Thr-Pro-Glu-Thr-Asn-Pro-Arg-Ala-Gly-Leu-Glu-Lys-Asn-Tyr-Y.