KR19980703677A - Fibroblast Growth Factor-14 - Google Patents

Abstract

The present invention describes human fibroblast growth factor-14 polypeptides and DNA (RNAs) encoding such polypeptides. The present invention also provides a method for producing the polypeptide by recombinant technology. It also promotes wound healing due to, for example, burns and ulcers to prevent neuronal damage associated with seizures, promotes neuronal growth, prevents skin aging and hair loss, angiogenesis in early fetal and limb regeneration, A method of using the polypeptide to stimulate induction is described. It also describes an antagonist and its use as a therapeutic agent for preventing cellular aberrant proliferation, hypervascular disease and epithelial proliferation. Diagnostic methods for detecting mutations in the coding sequence of polypeptides and changes in polypeptide concentration in samples from a host are described.

Description

Fibroblast Growth Factor-14

The present invention relates to newly identified polynucleotides, polypeptides encoded by said polynucleotides, the use of said polynucleotides and polypeptides, as well as methods of making polynucleotides and polypeptides. More specifically, the polypeptides of the present invention were presumably identified as fibroacetic growth factor / heparin binding factor, referred to as FGF-14. The present invention also relates to a method of inhibiting the activity of such a polypeptide.

Fibroblast growth factor is a family of proteins that have the property of binding to heparin, commonly referred to as heparin binding growth factor (HBGF). Different types of expression of these proteins are found in a variety of tissues and are under certain periodal and spatial control. These proteins include fibroblasts, corneal and vascular endothelial cells, granulocytes, adrenal cortical cells, chondrocytes, myoblasts, vascular smooth muscle cells, lens epithelial cells, black blood cells, keratinocytes, oligodendrocytes, astrocytes, osteoblasts, and hematopoietic cells. It is a powerful mitotic material for various cells of mesoderm, ectoderm, and endoderm origin, including.

Each of these features overlaps each other and also has unique features. In addition to inhibiting proliferation of blood and endothelial cells, FGF-1 and 2 are both chemotactic for endothelial cells and FGF-2 is known to allow endothelial cells to penetrate the basement membrane. In line with these properties, both FGF-1 and 2 have the ability to stimulate angiogenesis. Another important property of these growth factors is their ability to promote wound healing. Many other members of the FGF family also have comparable abilities to FGF-1 and 2, such as angiogenesis and promoting wound healing. Some of the FGF families have been shown to induce mesoderm formation and to regulate the differentiation of neurons, adipose and skeletal cells.

In addition to these biological activities in normal tissues, FGF proteins have been found to be involved in promoting tumorigenesis in carcinomas and sarcomas by stimulating tumor vascularization and modifying the protein if their expression is not suppressed.

To date, the FGF family consists of eight structurally related polypeptides: basic FGF, acidic FGF, int 2, hst 1 / k-FGF, FGF-5, FGF-6, keratinocyte growth factor, and AIGF (FGF-8). Recently, glial-activating factors have been found to be novel heparin-binding growth factors purified from the culture supernatants of human glioma cell lines (Miyamoto, Met al., Mol. And Cell. Biol., 13 (7): 4251-). 4259 (1993). Genes for these have been cloned and sequenced. Two of these members, FGF-1 and FGF-2, have been characterized by numerous names, but are commonly referred to as acidic and basic fibroblast growth factors, respectively. Normal gene products influence the general proliferative capacity of the majority of mesoderm and neuroectodermal-derived cells. They can induce angiogenesis in vivo and can play an important role in early development (Burgess, W. H. and Maciag, T., Annu. Rev. Biochem., 58: 575-606, (1989).

Numerous FGF members identified above also bind to the same receptors and elicit secondary messages through binding to these receptors.

Eukaryotic expression vectors encoding the secreted form of FGF-1 were introduced into porcine arteries by gene transfer. This model defines the gene function in arterial cell walls in vivo. FGF-1 expression causes endothelial thickening in porcine arteries 21 days after gene shear (Nabel, E. G., et al., Nature, 362: 844-6 (1993)). It has also been demonstrated that basal fibroblast growth factor can regulate glial growth and antitussion independent of its role in tumor angiogenesis and that basal fibroblast growth factor release or secretion may be required for these actions. (Morrison, R. S., et al., J. Neurosci. Res., 34: 502-9 (1993)).

Fibroblast growth factors such as primary FGF are also involved in the growth of Kaposi's sarcoma cells in vitro (Huang, Y. Q., et al., J. Clin. Invest., 91: 1191-7) (1993). In addition, the cDNA sequence encoding human basal fibroblast growth factor was cloned down the bottom of the electron promoter recognized by bacteriophage T7 RNA polymerase. The basal fibroblast growth factor obtained was found to have biological activity that can be distinguished from human placental fibroblast growth factor in mitogenicity, synthesis of plasminogen activator and angiogenesis analysis (Squires, CH, et. al., J. Biol. Chem., 263: 16297-302 (1988)).

U. S. Patent No. 5,155, 214 describes substantially pure mammalian basic fibroblast growth factors and methods for their preparation. Not only are the amino acid sequences of bovine and human basic fibroblast growth factors described, but also the DNA sequences encoding bovine polypeptides.

Newly discovered FGF-9 has approximately 30% sequence similarity with others of the FGF family. Two residues and other standard sequences, which are systems in the FGF family, are also conserved in the FGF-9 sequence. FGF-9 was found to have no signal sequence typical at the N terminus, similar to the N terminus in acidic and basal FGFs. However, FGF-9 was found to be secreted from cells after synthesis instead of lacking the typical signal sequence FGF (Miyamoto, M. et al., Mol. And Cell. Biol., 13 (7): 4251-4259 ( 1993). In addition, FGF-9 stimulates cell growth of BALB / c3T3, and PC-12 cells, which are pluripotent neuroglial type 2 astrocytic progenitor cells, but does not stimulate cell growth of human umbilical vein endothelial cells (Naruo, K., et al., Biol. Chem., 268: 2857-2864 (1993)).

Basic and acidic FGFs are potent regulators of cell proliferation, cell motility, differentiation, and survival and act on cells from ectoderm, mesoderm and endoderm. These two FGFs, along with KGF and ALGF, were confirmed by protein purification. However, the other four FGFs were isolated as tumor sources. Its expression is limited to embryogenicity and certain types of cancer. FGF-9 has proven to be a mitotic material for glial cells. Members of the FGF family are reported to be potent oncogenic. FGF-9 was found to alter strength when transformed into BALB / c3T3 cells (Miyamoto, M. et al., Mol. And Cell. Biol., 13 (7): 4251-4259 (1993)).

Androgen-induced growth factor (AIGF), known as FGF-8, was purified from refined media of rat breast cancer cells (SC-3) stimulated with tetosterone. AIGF is a specific FGF-like growth factor with putative signal peptides and 30-40% homology with known FGF members. Mammalian cells transformed with AIGF show significant stimulatory effects on the growth of SC-3 cells in the absence of androgens. Therefore, AIGF mediates androgen-induced growth of SC-3 cells, and possibly also androgen-induced growth of other cells as they are secreted by the tumor cells themselves.

Polypeptides of the invention have been presumed to be members of the FGF family and as a result have imino acid sequence homology with other members of the FGF family.

According to one aspect of the present invention, novel complete polypeptides as well as fragments, homologs and derivatives thereof are biologically active and useful for diagnostic or therapeutic purposes. Polypeptides of the invention are of human origin.

According to another aspect of the invention, isolated nucleic acids encoding polypeptides of the invention, including mRANs, DNAs, cDNAs, genomic DNA, as well as their antisense homologs and fragments thereof which are biologically active and diagnostic or therapeutically useful Molecules are provided.

According to another aspect of the invention, a prokaryotic comprising a recombinant vector, as well as a cloning and expression plasmid useful as a reagent in the production and production of a polypeptide of the invention, as well as a nucleic acid sequence encoding a polypeptide of the invention and ( Or) a method of producing a polypeptide of the invention by recombinant technology through the use of a eukaryotic host cell.

According to another aspect of the present invention, the purpose of screening agonists and antagonists and the purpose of treatment, such as promoting wound healing by burns and ulcers, preventing neuronal damage associated with seizures and promoting neuronal growth To this end, and to prevent skin aging and hair loss, a method is provided using a polypeptide or polynucleotide encoding the polypeptide for the purpose of promoting angiogenesis, mesoderm induction in early embryo and limb regeneration.

According to another aspect of the invention, an antibody against a polypeptide of the invention is provided.

According to another aspect of the invention, in order to inhibit the action of antagonists and polypeptides of the invention, for example, in the transformation of cells, for example in the treatment of tumors, wounds are reduced and excess blood vessels Methods of using them to treat a disease are provided.

According to another aspect of the invention, a nucleic acid probe is provided comprising a nucleic acid molecule of sufficient length to specifically hybridize to a polynucleotide encoding a polypeptide of the invention.

According to another aspect of the present invention, diagnostic assays are provided for detection of a disease associated with or mutation in a nucleic acid sequence of the present invention and detection of overexpression of a polypeptide encoded by a nucleic acid sequence.

According to another aspect of the present invention, a method of using the polypeptide of the present invention, or a polynucleotide encoding the same, is provided for in vitro purposes related to scientific research, synthesis of DNA, and production of a DNA vector.

These and other aspects of the invention should be apparent to those skilled in the art from the description herein.

The following figures are merely illustrative of specific embodiments of the present invention and should not be construed as limiting in any way.

1 shows the cDNA sequence of FGF-14 and the corresponding deduced amino acid sequence. The initial 26 amino acid residues are putative leader sequences.

According to another aspect of the invention, a mature polypeptide having the deduced amino acid sequence of SEQ ID NO: 1 (SEQ ID NO: 2) or a mature polypeptide encoded by cDNA of a clone deposited with ATCC Accession No. 97148 dated May 12, 1995 An isolated nucleic acid molecule (polynucleotide) is provided.

Polynucleotides encoding the FGF-14 of the present invention were initially found in cDNA libraries derived from human cerebellar tissue. It has a structural association with all members of the fibroblast growth factor family and creates an open reading frame that encodes a 225 amino acid polypeptide, the putative signal sequence of the first 26 amino acids, such as a complete polypeptide comprising 199 amino acids. Include. Among the top pairs: 1) 40% identity and 61% sequence similarity to human FGF-9 over 126 amino acids; 2) 40% identity and 61% similarity to rat FGF-9 over 126 amino acid regions; 4) 36% identity and 57% similarity to human KGF over 148 amino acids.

GXLX (S, T, A, G) X6 (D, E) CXFXE, an FGF / HBFG family designation, is conserved in the polypeptides of the invention (X is an amino acid residue; D, E represents a D or E residue; X6 represents 6 amino acid residues).

Polynucleotides of the invention may be in the form of RAN or DNA, and DNA includes cDNA, genomic DNA, synthetic DNA. DNA may be double or single yarn. The coding sequence that encodes a complete polypeptide may be identical to that of the cloned sequence (SEQ ID NO: 1) or the deposited clone, or may encode the same complete polypeptide as the DNA (SEQ ID NO: 1) or deposited cDNA of FIG. May be different coding sequences that are excess or degraded genetic code.

Polynucleotides encoding for the mature polypeptide (SEQ ID NO: 2) or the mature polypeptide encoded by the deposited cDNA (s) of FIG. 1 only encode the coding sequence for the complete polypeptide; Additional coding sequences such as coding sequences for complete polypeptides and leader or secretory sequences or proprotein sequences; Coding sequences for mature polypeptides (and optionally additional coding sequences) and introns of coding sequences for mature polypeptides or non-coding sequences such as 5 'and / or 3'.

Thus, polynucleotides encoding the term polypeptide include polynucleotides comprising additional coding sequences and / or non-coding sequences as well as polynucleotides comprising only the coding sequence for the polypeptide.

The present invention also relates to a polypeptide having the deduced amino acid sequence (SEQ ID NO: 2) or to a fragment, homologue and derivative of the polypeptide encoded by the cDNA (s) of the deposited clone (s) of the polynucleotide described above. It is about a variant. Variants of polynucleotides may be allelic variants found in nature of polynucleotides or non-natural variants of polynucleotides.

Thus, the present invention is directed to the same complete polypeptide encoded by cDNA (s) of the same complete polypeptide or deposited clone (s) as shown in Figure 1 (SEQ ID NO: 2) as well as the polypeptide or deposited of Figure 1 (SEQ ID NO: 2). Variants of the polynucleotide encoding for fragments, derivatives or homologs of the polypeptide encoded by the cDNA (s) of the clone (s). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As described above, the polynucleotide may have a coding sequence that is a natural genotype variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone (s). As is known in the art, allelic variants are other forms of polynucleotide sequences in which one or more nucleotides may be substituted, deleted, or added, with substantially no change in the function of the encoded polypeptide.

The invention also relates to polynucleotides that aid in expression and secretion of a polypeptide from a host cell within the same reading frame as the coding sequence for the complete polypeptide (e.g., as a sequence for controlling the transport of the polypeptide from the host cell). Polynucleotides that can be fused to a leader sequence that acts). A polypeptide having a leader sequence is a preprotein and may have a leader sequence that is degraded by a host cell to form a complete form of the polypeptide. The polynucleotide may also encode for a complete protein and a proprotein, which is an additional 5 'amino acid sequence. Complete proteins with prosequences are proproteins and inactive proteins. Once the prosequences are broken down, only the complete, active protein remains.

Thus, for example, the polynucleotide of the present invention can encode for a complete protein or a protein having a pro sequence or a protein having both a prosequence and a presequence (leader sequence).

Polypeptides of the invention may also have coding sequences fused to a marker sequence that allows for purification of the polypeptide of the invention in a frame. The marker sequence may be a nucleated histidine tag provided by the pQE-9 vector to provide a method of purifying a complete polypeptide fused to a marker in the case of a bacterial host, for example a mammalian host such as a COS-7 cell. When used, hemagglutinin (HA) tag may be. HA tags correspond to epitopes derived from influenza hemagglutinin protein (Wilson, I., et al., Cell, 37: 767 (1984)).

The term gene means a segment of DNA involved in producing a polypeptide chain; Front and back of the coding region (leader and trailer) as well as intermediate sequences (introns) between each coding segment (exon).

Fragments of full length FGF-14 genes can be used as hybridization probes for cDNA libraries to isolate full length genes and to isolate other genes with high sequence similarity or similar biological activity to the gene. This type of probe preferably has at least 30 bases and may comprise, for example, at least 50 bases. The probe can also be used to identify cDNA clones and genomic clones corresponding to full length transcripts or clones comprising the complete FGF-14, including regulatory and promoter regions, exons, and introns. Selective examples include a method of separating the coding region of the FGF-14 gene using a known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having sequences complementary to the gene sequences of the present invention are used to select libraries of human cDNA, genomic DNA or mRNA and determine which members of the library the probes are hybridized to.

The present invention also relates to polynucleotides which hybridize to the above sequences when the intersequence identity is at least 70%, preferably at least 90%, more preferably at least 955. The present invention relates in particular to polynucleotides which hybridize to the above-described polynucleotides under stringent conditions. As used herein, the term stringent conditions means that hybridization occurs only when the degree of identification between sequences is at least 95%, preferably at least 97%. The polynucleotide hybridized to the polynucleotide described above encodes a polypeptide that substantially retains the same biological function or activity as the complete polypeptide encoded by the cDNAs (SEQ ID NO: 1) or deposited cDNA (s) of Figure 1 in a preferred embodiment. .

Alternatively, the polynucleotide hybridizes with the polynucleotide of the present invention and, as described above, has at least 20 bases, preferably at least 30 bases, more preferably, having a degree of identification and no activity. May have more than 50. For example, such polynucleotides can be used, for example, as probes for polynucleotides of SEQ ID NO: 1 or as diagnostic probes or PCR primers for the recovery of polynucleotides.

Accordingly, the present invention provides for at least 30, preferably 50, as well as polynucleotides having at least 70%, preferably at least 90%, more preferably at least 95% identity with respect to the polynucleotide encoding the polypeptide of SEQ ID NO: 2. To fragments having more than one base and to polypeptides encoded by such polynucleotides.

The deposit (s) referred to herein are preserved under the Budapest Treaty for International Recognition of Microbial Deposits for Patent Procedures. These deposits are provided for convenience only and the deposits may be U.S.C. It is not an approval required under § 112. The sequences of the polynucleotides included in the deposited material, as well as the amino acid sequences of the polypeptides encoded by them, are incorporated herein by reference and are adjusted if they conflict with the technical details of the sequences of the invention. In order to use or sell the deposit, rights must be obtained, and so far no such rights have been granted.

The invention also relates to FGF polypeptides having the deduced amino acid sequence of FIG. 1 (SEQ ID NO: 2) or having amino acid sequences encoded by deposited cDNA (s), as well as fragments, homologs and derivatives of such polypeptides.

The term fragments, derivatives and homologs when referring to the polypeptide of FIG. 1 (SEQ ID NO: 2) or encoded by deposited cDNA (s) means a polypeptide having essentially the same biological function or activity as such polypeptide. . Thus, homologues include proproteins that are activated by degradation of the proprotein region to produce an active complete polypeptide.

Polypeptides of the invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, with recombinant polypeptides being preferred.

The polypeptide of FIG. 1 (SEQ ID NO: 2) or fragments, derivatives or homologues of those encoded by deposited cDNA (s) may comprise (i) one or more of the amino acid residues conserved or nonconserved amino acid residues (preferably conserved amino acid residues). ) And may or may not be one of the amino acid residues substituted by the genetic code, or (ii) one or more of the amino acid residues contain substituents, or (iii) the complete polypeptide Fused with another compound, eg, a compound for increasing the half-life of a polypeptide (eg, polyethylene glycol), or (iv) a sequence or proprotein sequence used for purification of a leader or secretive sequence or a complete polypeptide As such, additional amino acids may be fused to the complete polypeptide. Such fragments, derivatives and homologues are deemed to be within the scope of those skilled in the art from the art of this invention.

Polypeptides and polynucleotides of the invention are preferably provided in isolated form, preferably homogeneously purified.

The term isolated means that the substance is removed from the underlying environment (eg, the natural environment if present naturally). For example, natural polynucleotides or polypeptides present in a living animal are not isolated, but the same polynucleotides or DNAs or polypeptides isolated from some or all of the coexisting materials in the natural system are isolated. Such polynucleotides may be part of a vector and / or such polynucleotides or polypeptides may be part of a composition, and such vectors or compositions may be separated as being not part of the natural environment.

Polypeptides of the invention have at least 70% similarity (preferably at least 70% identity) with the polypeptide of SEQ ID NO: 2 as well as the polypeptide of SEQ ID NO: 2, more preferably at least 90% similarity with the polypeptide of SEQ ID NO: 2 More preferably at least 90% identity), even more preferably at least 95% similarity (more preferably at least 95% identity) to the polypeptide of SEQ ID NO: 2 and generally at least 30 amino acids, More preferably, a fraction of a polypeptide having 50 or more polypeptides.

Similarity between two polypeptides as known in the art is determined by comparing the amino acid sequence of the polypeptide and its conserved amino acid substituents with the sequence of the second polypeptide.

Fragments or fractions of the polypeptides of the invention can be used to produce corresponding full length polypeptides by peptide synthesis; Thus, such fragments can be used as intermediates to produce full length polypeptides. Fragments or fractions of the polynucleotides of the invention can be used to synthesize full length polynucleotides of the invention.

The invention also relates to a vector comprising a polynucleotide of the invention, a host cell genetically engineered with the vector of the invention and a method for producing a polypeptide of the invention by recombinant technology.

The host cell can be genetically engineered (transduced or transformed or transfected) with a vector of the invention, which can be, for example, a cloning vector or an expression vector. The vector may be in the form of, for example, a plasmid, viral particles, phage or the like. The engineered host cell can be cultured in conventional nutrient media modified to be suitable for activating the promoter and selecting a transformant or amplifying the FGF gene. Culture conditions such as temperature, pH and the like are those already used for the host cell selected for expression and are apparent to those of ordinary skill in the art.

Polynucleotides of the invention can be used for the production of polypeptides by recombinant techniques. Thus, for example, the polynucleotide sequence can be included in one of several expression vehicles, in particular one of the vectors or plasmids for polypeptide expression. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV40; Bacterial flasks; Phage DNA; Yeast plasmids; Vector derived from a combination of plasmid and phage DNA, boxynia, adenovirus, infectious epithelial virus, and viral DNA such as Pseudorabis. However, other vectors or plasmids can also be used if they are replicable and viable in the host.

Appropriate DNA sequences can be inserted into the vector in a number of ways. In general, DNA sequences are inserted into suitable restriction endonuclease sites by methods known in the art.

The DNA sequence in the expression vector is functionally linked to the appropriate expression control sequence (s) (promoter) to direct mRNA synthesis. Representative examples of such promoters may be mentioned as follows; LTR or SV40 promoter, E. coli lac or trp, phagelamida P _L promoter and other promoters or viruses thereof known to control expression of genes in prokaryotic or eukaryotic cells. Expression vectors also contain ribosomal binding sites and transcription terminators for initiation of translation. The vector may also include sequences suitable for amplifying expression.

In addition, the expression vector is dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or E. It is preferred to contain genes to provide phenotypic properties for the selection of transgenic host cells such as tetramycin or ampicillin resistance in E. coli.

A vector containing a suitable DNA sequence as described above, as well as a suitable promoter or regulatory sequence, can be used to transform the suitable host so that the host expresses the protein. Representative examples of suitable hosts may include the following; this. Bacterial cells such as E. coli, Salmonella typhimurium, Streptomyces; Fungal cells such as yeast; Insect cells such as Drosophila S2 and Spodoptera Sf9; Animal cells such as CHO, COS or Bowes melanoma; Adenovirus; Plant cells etc. Selection of a suitable host is deemed within the scope of those skilled in the art from the description herein.

More specifically, the present invention also broadly includes recombinant constructs comprising one or more of the sequences as described above. The construct includes a vector, such as a plasmid or viral vector, inserted in a forward or backward direction in a sequence of the present invention. In a preferred embodiment of this embodiment, the construct also comprises regulatory sequences, including, for example, a promoter, functionally linked to the sequence. Numerous suitable vectors and promoters are known to those skilled in the art and are commercially available. By way of example, the following vectors are provided. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, phage transcription, psiX174, pBluscript SK, pBsKS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTRC99A, pKK223-3, pKK233-3, pDR540, pRIT5 from Pharmacia. Eukaryotic: pWLneo, pSV2cat, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL from Pharmacia. However, other plasmids or vectors can be used as long as they are replicable and viable in the host.

Promoter regions can be selected from genes of interest using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two suitable vectors are pKK23208 and pCM7. Particularly mentioned bacterial promoters are lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic promoters include early CMV, HSV thyminin kinase, early and late SV40, LTRs from retroviruses, and mouse metallothionein-I. Selection of suitable vectors and promoters is within the level of ordinary skill in the art.

In another aspect, the invention relates to a host cell containing the construct described above. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or it may be a prokaryotic cell, such as a host cell bacterial cell. Introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran mediated transfection, or electrophoresis (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986.

Constructs in host cells can be used in conventional manner to produce gene products encoded by recombinant sequences. Alternatively, polypeptides of the invention can be produced synthetically by conventional peptide synthesizers.

Complete proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of suitable promoters. Cell-free translation systems using RNAs derived from the DNA constructs of the invention can also be used to produce such proteins. Cloning and expression vectors suitable for use with prokaryotic and eukaryotic hosts are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second, Second Edition, (Cold Spring Harbor, NY, 1989). ).

Transcription by the higher eukaryotic cells of the DNA encoding the polypeptide of the invention is increased by inserting an enhancer into the vector. Enhancers are typically cis-acting elements of DNA, which are about 10 to 300 base pairs and act on the promoter to increase its transcription. For example, there are SV40 enhancers (bp 100 to 270) on the back of the origin of replication, cytomegalovirus early promoter enhancers, polyoma enhancers on the back of the origin of replication, and adenovirus enhancers.

In general, recombinant expression vectors are selective markers that allow origin of replication and transformation of host cells, such as E. coli. Ampicillin resistance gene and S. coli S. cerevisiae TRP1 gene, and promoters derived from highly-expressed genes for directing transcription of underlying sequence sequences. Such a promoter may be derived from a bacterium encoding a corresponding enzyme, such as 3-phosphoglycerate kinase (PGK), α factor, acid phosphatase, or heat shock protein. The heterologous structural sequence is assembled into a suitable phase with translation, initiation and termination sequences, and preferably a leader sequence that can direct the translated protein to be secreted into the extravaginal space or extracellular media. Optionally, the heterologous sequence can encode a fusion protein comprising an N-terminal identifying peptide that confers the desired properties, eg, safety or simplified purification of the expressed recombinant product.

Expression vectors useful for bacteria are constructed by inserting a structural DNA sequence encoding a protein of interest into an operable readout with a functional promoter with suitable translation, initiation and termination signals. The vector contains at least one phenotypic selectable marker and origin of replication to maintain the vector and optionally provide for amplification in the host. Suitable prokaryotic hosts for transformation are E. coli. Several species in the genus Coli, Bacillus subtilis, Salmonella typhimurium and Pseudomonas, Streptomyces, and Staphylococcus are included, but others are optional. Can be used as

As a non-limiting representative example, an expression vector suitable for bacteria can comprise bacterial replication origin derived from a commercially available plasmid comprising a selectable marker and the genetic elements of the known cloning vector pBR 322 (ATCC 37017). Examples of such commercially available vectors include pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA). These pBR322 backbone sites are combined with suitable promoters and structural sequences to be expressed.

The appropriate host strain is transformed and the host strain is grown to the appropriate cell density, then the selected promoter is activated by the appropriate method (eg, temperature transfer or chemical induction) and the cells are cultured for an additional period of time.

Cells are typically harvested by centrifugation and destroyed by physical or chemical methods, leaving the resulting crude extract for further purification.

Microbial cells used for the expression of proteins can be disrupted by conventional methods, including freeze-thaw cycling, sonication, mechanical disruption, or methods using cell lysates.

Various mammalian cell culture systems can also be used to express recombinant proteins. Examples of mammalian expression systems are described in Gluzman, Cell, 23: 175 (1981), COS-7 line of monkey kidney fibroblasts, and other cell lines capable of expressing compatible vectors, such as C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and also necessary ribosomal binding sites, polyadenylation sites, conjugate donor and receptor sites, transcription termination sequences, and 5 'flanking non-transcription sequences. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early promoter, insensor, conjugation, and polyadenylation sites, may be used to provide the required nontranscribed genetic elements.

Polypeptides of the invention include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography It is possible to recover and purify from recombinant cell culture by the methods used so far. In some cases, a protein refolding step may be used in the arrangement of the complete protein. Finally, high performance liquid chromatography (HPLC) can be used for the last purification step.

Polypeptides of the invention may be natural purification products, or products of chemical synthesis processes, or may be produced in culture by recombinant techniques (e.g., by bacteria, yeast, higher plants, insects, and mammalian cells) from prokaryotic or eukaryotic hosts. A) can be produced. Depending on the host used in the recombinant production process, the polypeptides of the invention can be glycosylated or aglycosylated with carbohydrates of mammals or other eukaryotic cells. Polypeptides of the invention may also comprise initial methionine amino acid residues.

As a result of their ability to stimulate vascular endothelial growth, the polypeptides of the present invention can be used in the treatment to stimulate vasculature of ischemic tissues caused by various diseases such as thrombosis, arteriosclerosis, and other cardiovascular diseases. These polypeptides can also be used to stimulate angiogenesis and fingertip regeneration.

Polypeptides of the invention are also mitotic for various cells of different origins, such as fibroblast cells and skeletal muscle cells, and thus injuries, burns, postoperative tissue damage, and ulcers because they promote recovery or replacement of tissues, whether injuries or diseases. Can be used to treat wounds caused by

Polypeptides of the invention are also used to treat and prevent neuronal damage that stimulates nerve growth and is associated with seizures and is a specific neurological disease or Alzheimer's disease and neurodegenerative diseases such as diseases, Parkinson's disease, and AIDS-related complications Can be. FGF-14 has the ability to stimulate chondrocyte growth and, therefore, they can be used to enhance bone and root fascia regeneration and assist tissue transplantation or bone transplantation.

Polypeptides of the invention can also be used to prevent skin aging due to sunburn by stimulating keratinocyte growth.

FGF-14 polypeptides can also be used to prevent hair loss, because FGF family members activate hair forming cells and promote black blood cell growth. According to the same background, the polypeptides of the invention can be used to stimulate the growth and differentiation of hematopoietic and bone marrow cells when used with other cytoplasms.

FGF-14 polypeptides can also be used to maintain pre-transplant organs or to maintain cell culture of primary tissue.

Polypeptides of the invention can also be used to elicit tissue of mesodermal origin to differentiate in early embryos.

According to another aspect of the present invention, a polypeptide of the present invention, or such polypeptide, for the purpose of providing scientific research, synthesis of DNA, in vitro purposes associated with the manufacture of a DNA vector, and diagnostic and therapeutic methods for treating diseases of humans. A method of using a polynucleotide to darken is provided.

Provided are methods for identifying a receptor for a polypeptide of the invention of the invention. Genes encoding such receptors have been described in numerous ways known to those skilled in the art, for example, ligand panning and FACS classification (Coligan, et al., Current Proptocols in Immum., 1 (2), Chapter 5, (1991). Preferably, the polyadenylation RNA is prepared from cells reactive to the polypeptide, eg, NIH3T3 cells known to contain multiple receptors for FGF protein, and SC-3 cells. The cDNA library generated from the RNA is divided into pools and used for transfection of COS cells and other cells that are not reactive to the polypeptides. The polypeptide may be exposed in a number of ways, including iodide or introduction of a recognition site for site-specific protein kinases. It can be labeled.

After fixation and incubation, the slides are placed in an auto-radiograph analyzer. Positive pools are identified and sub- pools are prepared to re-transfect using repeated sub- pooling and reselection procedures, and finally a single clone encoding the putative receptor.

As an alternative to receptor identification, an agent can be extracted that photolabels the labeled polypeptide to the cell membrane or expresses the receptor molecule. The crosslinked material is separated by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptor of the polypeptide is excised, digested into peptide fragments, and the protein is sequenced. The amino acid sequences obtained from microsequencing are used to design a set of degenerate oligonucleotide probes for selecting cDNA libraries for gene identification encoding putative receptors.

The present invention provides a method for screening a compound to confirm that it modulates the action of the polypeptide of the present invention. Examples of such assays include combining mammalian fibroblast cells, polypeptides of the invention, selected compounds and ³ [H] thymidine under cell culture conditions in which fibroblast cells normally proliferate. Control assays can be performed in the absence of the compound to be selected to determine if the compound stimulated proliferation by comparing the amount of fibroblast proliferation in the presence of the compound and measuring the consumption of ³ [H] thymidine in each case. Fibroblast cell proliferation is determined by liquid scintillation chromatography, which measures the amount of ³ [H] thymidine incorporation. Both agonists and antagonists can be identified by this method.

Alternatively, a cell or membrane preparation of a mammal expressing a receptor for a polypeptide of the invention is incubated with the labeled polypeptide of the invention in the presence of a compound. The ability of the compound to enhance or block the interaction can then be measured. Alternatively, by determining the compound is a potent agonist or antagonist by measuring the interaction of the compound to be screened with the FGF-14 receptor following the reaction of a known second messenger system and measuring the receptor binding capacity and secondary messenger response of the compound. do. Such secondary messenger systems include, but are not limited to, cAMP guanylate cyclase, ion channel, tyrosine phosphorylation or phosphorinositide hydrolysis.

Examples of antagonist compounds are antibodies or, in some cases, oligonucleotides that bind to the receptor for a polypeptide of the invention but do not elicit a second messenger response or bind to the FGF-14 polypeptide itself. Alternatively, the potent antagonist may be a mutant form of the polypeptide that binds to the receptor but does not elicit a second messenger response, thereby effectively blocking the action of the polypeptide.

Other antagonist compounds for the FGF-14 gene and gene products are antisensitizing constructs prepared using antisensitization techniques. Antisensitization techniques can be used to modulate gene expression via triple helix formation or antisensitizing DNA or RNA, both methods based on binding of polynucleotides to mode DNA or RNA. For example, anti-sensitizing RNA oligonucleotides of about 10 to 40 base pairs in length are designed using the 5 'coding region of the polynucleotide sequence, which encodes for the complete polypeptide of the invention. DNA oligonucleotides are designed to be complementary to gene regions involved in transcription (triple screw-see: Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); and Dervan et al., Science, 251: 1360 (1991); prevent the electronic and production of the polypeptides of the invention.Anti-sensitizing RNA oligonucleotides hybridize to mRNA in vivo to Blocking translation (Antisense-Okano, J. Neurochem., 56: 560 (1991); Oligonucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). Alternatively, the DNA may be transported to cells to be expressed in vivo to inhibit the production of the polypeptide.

Potent antagonist compounds also include small molecules that prevent the receptor from accessing the polypeptide such that it binds and occupies the binding site of the receptor, thereby preventing normal biological activity. Non-limiting examples of small molecules are small peptides or peptide-dusa molecules.

Antagonist compounds inhibit cell growth and proliferative effects of the polypeptides of the invention on neoplastic cells and tissues, stimulation of angiogenesis of specific tumors, and thus prevent, for example, the growth and proliferation of abnormal cells in tumor formation or growth. Used to delay or prevent.

Antagonists can also be used to prevent excessive columnar disease and to prevent proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of mitotic activity of the polypeptides of the present invention may also be desirable in cases such as responentiation after balloon angiogenesis.

Antagonists can also be used to prevent the growth of scar tissue during wound healing.

Antagonists can be used with pharmaceutically acceptable carriers, for example as described below.

Polypeptides, agonists and antagonists of the invention can be used with suitable pharmaceutical carriers to render pharmaceutical compositions for parenteral administration. Such compositions comprise a therapeutically effective amount of a polypeptide, agonist or antagonist and a pharmaceutically acceptable carrier or excipient. Non-limiting examples of such carriers include saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should be suitable for the method of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the components of the pharmaceutical composition of the invention. In connection with such container (s), there may be notices in the form prescribed by government agents regulating the manufacture, use or sale of pharmaceuticals or biological products, which notices may be directed to the manufacture, use or sales agent for human administration. To reflect approval. In addition, the polypeptides, agonists and antagonists of the invention can be used in combination with other therapeutic agents.

Pharmaceutical compositions can be administered by convenient methods by oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or transdermal routes. Pharmaceutical compositions are administered in an amount effective to treat and / or prevent specific indicators. In general, they are administered in an amount of at least about 10 μg / kg body weight and in most cases they are administered in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is about 10 μg / kg body weight per day given the route of administration, symptoms and the like. For topical administration, the dosage is preferably about 0.1 μg to 9 mg per cm.

Polypeptides of the invention and agonist and antagonist compounds of the polypeptides can also be used according to the invention by expressing such polypeptides in vivo, which is often referred to as gene therapy.

Thus, for example, cells can be engineered with polynucleotides (DNA or RNA) that encode for the polypeptide ex vivo, and then the engineered cells are provided to the patient for treatment with the polypeptide. Such methods are well known in the art. For example, cells can be engineered by methods known in the art using retroviral particles containing RNA encoding for the polypeptides of the invention.

Similarly, cells can be engineered in vivo to express polypeptides in cells, eg, by methods known in the art. As is known in the art, producer cells for producing retroviral particles containing RNA encoding a polypeptide of the invention are administered to a patient to manipulate the cells in vivo and to express the polypeptide in vivo. These and other methods of administration of the polypeptides of the invention by such methods should be apparent to those skilled in the art from the art of the invention. For example, the expression vehicle for manipulating the cells may exclude a retroviral particle and may be, for example, an adenovirus that may be used to manipulate the cell in vivo after mixing with a suitable transport vehicle.

Non-limiting examples of retroviruses from which the above-mentioned retroviral plasmid vectors may be derived include leukemia varicose virus, splenic necrosis virus, Ruth sarcoma virus, Harvey sarcoma virus, avian leukemia virus, Gibbon leukemia virus in Moroni rats. And retroviruses such as human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Mulone's leukemia virus.

The vector contains one or more promoters. Suitable promoters that can be used include, but are not limited to, retrovirus LTR; SV40 promoter; And in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989) describes a cell promoter of eukaryotic cells, including but not limited to cytomegalovirus (CMV) promoters, or other promoters (eg, but not limited to histones, pol III, and β-acting promoters). Cell promoters). Other viral promoters that can be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of suitable promoters will be apparent to those skilled in the art from the techniques included herein.

Nucleic acid sequences encoding polypeptides of the invention are under the control of suitable promoters. Suitable promoters that can be used include, but are not limited to, adenovirus promoters, such as, but not limited to, the major late promoter of adenoviruses; Or heterologous promoters such as cytomegalovirus (CMV) promoters; Respiratory syncytial virus (RSV) promoter; Inducible promoters such as MMT promoter, metallothionein promoter; Heat shock promoters; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as herpes simplex thymidine kinase promoter; Retroviral LTRs (including the modified retrovirus LTRs mentioned above); β-acting promoter; And human growth hormone promoters. The promoter may also be a natural promoter that modulates the gene encoding the polypeptide.

Retrovirus plasmid vectors are used to transduce cell lines to form producer cell lines. Examples of cells to be transfected include, but are not limited to, PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E = 86, GP + envAm12, And literature, which is incorporated herein by reference in its entirety: Miller, Human Gene Therapy, Vol. 1, pgs. DNA cell lines described in 5-14 (1990). The vector can transduce cells through methods known in the art. Non-limiting examples of such methods include electrophoresis, the use of liposomes, and CaPO ₄ precipitation. Alternatively, retroviral plasmid vectors can be microencapsulated into liposomes, coupled to lipids, and then administered to a host.

Producer cell lines generate infectious retroviral vector particles comprising nucleic acid sequence (s) encoding a polypeptide of the invention. The retroviral vector particles can then be used to transduce eukaryotic cells in vitro or in vivo. Transduced eukaryotic cells express nucleic acid sequence (s) encoding the polypeptides of the invention. Non-limiting examples of eukaryotic cells that can be transduced include embryonic stem cells, embryonic sarcoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells. There is.

The invention also relates to the use of the genes of the invention as part of a diagnostic assay for detecting a sensitivity associated with a disease or disorder associated with the presence of a mutation in a nucleic acid sequence encoding a polypeptide of the invention.

Individuals with mutations in the genes of the invention can be detected at the DNA level by various techniques. Diagnostic nucleic acids can be obtained from cells of a patient, such as blood, urine, saliva, tissue biopsies and autopsies. Genomic DNA can be used directly for detection or enzymatically amplified by PCR (Saiki et al., Nature, 324: 163-166 (1986) prior to analysis. RNA or cDNA can also be used for the same purpose. For example, mutations can be identified and analyzed using complementary PCR primers for nucleic acids encoding polypeptides of the invention, eg, deletions by changes in the size of the amplified product compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or, alternatively, to a radiolabeled antisensitized DNA sequence, a perfectly matched sequence of RNase A degradation or melting point differences. Can be distinguished from a mismatched double yarn.

Genetic tests based on DNA sequence differences can be performed by detecting changes in electrophoretic motility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and inserts can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on modified formamide gradient gels where the motility of the different DNA fragments is delayed in the gel to different locations depending on their specific melting point or partial melting temperature (Myers et al., Science, 230: 1242 (1985)).

Sequence changes at specific positions can also be revealed by nuclease protection assays, such as RNase and S1 protection methods or aesthetic digestion methods (Cotton et al, PNAS, USA, 85: 4397-4401 (1985)).

Thus, detection of specific DNA sequences can be accomplished by methods such as hybridization, RNase protection, chemical digestion, direct DNA sequencing or the use of restriction enzymes (eg, restriction fragment length polymorphism (RELP) and southern blotting of genomic DNA). Can be done.

In addition to the more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

The present invention also relates to diagnostic assays for detecting levels of FGF-14 protein change in various tissues because protein overexpression can detect abnormal cell proliferation, eg, the presence of tumors, as compared to normal regulatory tissue samples. will be. Assays used to detect levels of proteins in samples derived from the host are well known to those skilled in the art and include radioimmunoassays, competitive-binding assays, western blot assays, ELISA assays, and sandwich assays, ELISA assays (Coligan). , et al., Current Protocols in Immunology, 1 (2), Chapter 6, (1991)) first describe the steps of preparing an antibody, preferably a monoclonal antibody, specific for an antigen against a polypeptide of the invention. Include. In addition, reporter antibodies are prepared for monoclonal antibodies. The reporter antibody is attached with a radioactive, fluorescent or detectable reagent such as, for example, horseradish peroxidase enzyme. Samples are taken from the host and incubated on a solid support such as a polystyrene dish to which proteins in the sample bind. It is then incubated with nonspecific protein-like bovine serum albumin to cover the free protein binding site on the dish. Next, the monoclonal antibody is incubated in the dish, where the monoclonal antibody is attached to the polystyrene dish. All unbound monoclonal antibodies are washed out of the dish with buffer. When the reporter antibody bound to wasabi peroxidase is placed in a dish, the reporter antibody binds to the monoclonal antibody bound to the protein of interest.

The unattached reporter antibody is then washed away. Peroxidase substrate is then added to the dish and the amount of color developed within a given time period is a measure of the amount of polypeptide of the invention present in the given volume of the patient sample when compared to a standard curve.

Competition assays are directed to an antibody specific for a polypeptide of the invention attached to a solid support, wherein a sample derived from labeled FGF-13 and a host passes through the solid support and is detected, for example, by liquid scintillation chromatography. It can be used when the amount can be correlated with the amount of the polypeptide of the present invention in the sample.

The sandwich assay is similar to the ELISA assay. In a sandwich assay, polypeptides of the invention pass through a solid support and bind to an antibody attached to the solid support. The second antibody is then bound to the polypeptide of interest. The amount can then be quantified after labeling and binding a third antibody specific for the second antibody through the solid support to bind to the second antibody.

The sequences of the invention are also valuable for identifying chromosomes. The sequence can be specifically targeted and hybridized to specific locations on each human chromosome. Moreover, there is a need to identify specific sites on the chromosome. Several chromosomal marking reagents based on substantial sequence data are useful for marking chromosomal positions. Mapping of DNAs to chromosomes according to the invention is an important first step in correlating sequences with genes associated with disease.

In short, the sequence can be mapped to the chromosome by making a PCR primer (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 'untranslated region can be used to quickly select primers that do not span more than one exon in genomic DNA and thus complicate the amplification process. These primers are then used for PCR selection of somatic hybrids containing each human chromosome. Only hybrids containing a human gene corresponding to Pri and produce amplified fragments.

PCR mapping of somatic cell hybrids is a rapid process for assigning specific chromosomes to specific DNA. When using polypeptides of the invention having the same oligonucleotide primers, sublocalization can be performed in a similar manner for panels of clones from specific chromosomes or large genomic clones. Other mapping methods that can be similarly used to map to chromosomes include in situ hybridization, preliminary selection for labeled flow-sorted chromosomes, and preliminary selection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones for meta autosomal diffusion can be used to provide the correct chromosome location in one step. This method can be used for cDNAs with the shortest 50 or 60 bases. Reference is made to several studies of this method: Verma et al., Human Chromosome: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data (such data can be found, for example, in V. McKusick, Mendelian Inheritance in Man; Johns). Available through Hopkins University Welch Medical Library). Relationships between genes and diseases mapped to the same chromosomal region are confirmed by binding assays (simultaneous inheritance of physically adjacent genes).

It is then essential to measure the difference in cDNA or genomic sequence between the affected and unaffected individuals. If mutations are observed in some or all of the affected individuals but not in normal individuals, the mutation is likely the causative agent of the disease.

With this solution of physical mapping and gene mapping techniques, a cDNA accurately localized in the chromosomal region with respect to disease can be one of 50 to 60 potential causative genes (1 megabase mapping resolution and one gene per 20 kb). Is estimated).

Polypeptides, fragments or other derivatives thereof, or homologues thereof, or cells expressing them can be used as immunogens to produce antibodies against them. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also encompasses the products of chimeric, single chain, and humanized antibodies, as well as Fab fragment Fab expression libraries. Various methods known in the art can be used to produce such antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably an animal other than a human. The obtained antibody then binds the polypeptide itself. In this way, even a sequence encoding only a fragment of the polypeptide can be used to generate an antibody that binds the entire natural polypeptide. The antibody can then be used to isolate the polypeptide from the tissue expressing the polypeptide.

To prepare monoclonal antibodies, methods can be used to provide antibodies produced by continuous cell culture. Examples of methods include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72). , And EBV-hybridoma technology (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) to produce human monoclonal antibodies. .

Methods described for the production of single chain antibodies (US Pat. No. 4,946,778) can be employed to produce single chain antibodies against the immunogenic polypeptide products of the invention. Gene ear mice can also be used to express humanized antibodies against the immunogenic polypeptide products of the invention.

The invention is further described with reference to the following examples; It should not be understood that the present invention is limited to the examples. Unless otherwise indicated, all parts or amounts are by weight.

To aid in understanding the following examples, frequently occurring methods and / or terms are described.

Plasmids are indicated by a lowercase p before and / or after an uppercase letter and / or a number. Starting plasmids in the present invention are commercially available under strict criteria and can be constructed from plasmids available to the public or available according to published methods. In addition, plasmids equivalent to those described are known in the art and will be apparent to those skilled in the art.

Degradation of DNA refers to catalytic degradation of DNA by restriction enzymes that act only on specific sequences in the DNA. Various restriction enzymes used in the present invention are commercially available and their reaction conditions, cofactors and other requirements are used as known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer. For the purpose of isolating DNA fragments for plasmid construction, typically 5-50 μg of DNA is digested into 20 to 250 units of enzyme in larger volumes. Suitable buffers and base masses for certain restriction enzymes are specified by the manufacturer. Incubation times are typically about 1 hour at 37 ° C., but can be varied as directed by the supplier. After digestion, the reaction is electrophoresed directly on polyacrylamide gel to separate the desired fragments.

Separation according to the size of the digested fragments is carried out using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

Oligonucleotides refer to single-chain polydeoxynucleotides or two complementary polydeoxynucleotide strands that can be chemically synthesized. It does not have such synthetic oligonucleotide 5 'phosphate and therefore does not bind to other oligonucleotides unless phosphate with ATP is added in the presence of groupase. Synthetic oligonucleotides bind to fragments that are not dephosphorylated.

Ligation refers to the process by which phosphodiester bonds are formed between double-stranded nucleic acid fragments (Maniatis, T., et al., Id., P. 146). Unless otherwise indicated, binding can be carried out using buffers and conditions for 10 units of T4 DNA ligase (ligase) per 0.5 μg approximately equimolar amount of DNA fragment to be bound.

Unless stated otherwise, transformation is performed as described by the methods of Graham, F. and Van der Ed, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of FGF-14 Protein

DNA sequences encoding FGF-14 ATCC # 97148 are first amplified with the gene using PCR oligonucleotide primers corresponding to the 5 'sequence (excluding signal peptide sequence) and vector sequence 3' of the processed protein. Additional nucleotides corresponding to the gene are added to the 5 'and 3' sequences. The 5 'oligonucleotide primer has the sequence 5' GCCAGAGCATGCAGCGGCGCGTGTGTCCCGC 3 '(SEQ ID NO: 3) and contains an SphI restriction enzyme site. The 3 'sequence 5' GCCAGAAGATCTGGGGGCAGGGGGACTGGAAGG 3 '(SEQ ID NO: 4) contains a sequence complementary to the BglII site and is located after 21 nucleotides of the FGF-14 coding sequence.

The restriction enzyme site corresponds to the restriction enzyme site on bacterial expression vector pQE70 (Qiagen, Inc. Chatsworth, CA91311). pQE70 encodes antibiotic resistance (Amp ^r ), replication of bacterial origin (ori), IPTG-regulated promoter operator (P / O), ribosomal binding site (RBS), 6-Histag and restriction enzyme sites. PQE70 is then digested with NcoI and BglII. The amplified sequence is bound in pQE70 and inserted in frame using sequences encoding for histidine tag and ribosomal binding site (RBS). Subsequently, using the binding mixture, E. coli was described in Sambrook, J. et al. E. coli strain M15 / rep 4 (Qiagen, Inc.) is transformed. M15 / rep 4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kan ^r ). Transformants are identified with the ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). Large amounts of culture are inoculated at a ratio of 1: 100 to 1: 250 using O / N culture. The cells are grown to an optical density of 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. IPTG (isopropyl-BD-thiogalacto pyranoside) is then added at a final concentration of 1 mM. The lacI repressor is inactivated and the PTG is washed to induce IPTG to amplify gene expression. The cells are grown for an additional 3-4 hours. The cells are then harvested by centrifugation. The cell pellet is lysed in 6M guanidine HCl made with chaotropic agent. After clarification, the dissolved FGF-14 was dissolved in nickel under conditions such that it was tightly bound by the protein containing the 6-His tag (Hochuli, E. et al., J. Chromatgography 411: 177-184). Purify by chromatography on a chelate column. The protein is eluted from the column in 6M guanidine HCl pH 5.0 (and adjusted to 3M guanidine HCl for denaturation), 100 mM sodium phosphate, 10M glutathione (reduced) and 2 mM glutathione (oxidation). After incubation for 12 hours in the solution, the protein is dialyzed with 10 mM sodium phosphate.

Example 2

Cloning and Expression of FGF-14 Using a Baculovirus Expression System

The DNA sequence encoding full length FGF-14 protein, ATCC # 97148, is amplified using PCR oligonucleotide primers corresponding to the sequences 5 'and 3' of their genes.

The FGF-14 5 'primer has the sequence 5' CTAGTGGAGCCCATCATGGCGGCGCTGGCCAGT 3 'for the pA2 vector (SEQ ID NO: 5) and is an efficient signal for initiation of translation in eukaryotic cells, just behind the first 18 nucleotides of the gene (Kozak, M., 4 nucleotides resembling J. Mol. Biol., 196: 947-950, followed by a BamHI restriction enzyme site (gothic body) (underlined in translation start codon ATG).

For the pA2gp vector, it has the sequence 5 'CGACTGGATCCCCAGCGGCGCGTGTGTCCC 3' (SEQ ID NO: 6).

The 3 'primer has the sequence 5' CGACTTCTAGAATCAGGGGGCAGGGGGACTGGA 3 '(SEQ ID NO: 7) and contains 22 nucleotides complementary to the 3' non-translational sequence of the gene and the cleavage site for restriction endonuclease XbaI.

Amplified sequences are separated from 1% agarose gels using commercially available kits (Geneclean, BIO 101 Inc., La Jolla, Ca). The fragment is then digested with each endonuclease and purified again on a 1% agarose gel. The fragment is denoted by F2.

The vector pA2gp (and pA2) (variant of the pVL941 vector, described later) was described in the Baculovirus expression system (Summers, MD and Smith, GE 1987, A Manual of methods for vaculovirus vectors and insect coll culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) is used for the expression of proteins. The expression vector contains a potent polyhedrin promoter of AcMNPV (Autographa californica nuclear polyhedrosis virus) followed by recognition sites for restriction endonucleases BamHI and XbaI. The polyadenylation site of Simian virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses, these. The beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter following the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked on both sides with viral sequences for cell-mediated homologous recombinants of co-transfected wild type viral DNA. Numerous other baculovirus vectors can be used in place of pA2 (Luckow, V.A. and Summers, M.D., Virology, 170: 31-39) such as pRG1, pAc373, pVL941 and pAcIM1.

The plasmid is digested with restriction enzymes and dephosphorylated using calf intestinal phosphatase by methods known in the art. DNA is then isolated from the 1% agarose gel using a commercially available kit (Geneclean BIO 101 Inc., La Jolla, Ca.). The vector DNA is represented by V2.

Fragment F2 and dephosphorylated plasmid V2 are coupled with T4 DNA ligase. Followed by this. E. coli DH5α cells were transformed and each restriction enzyme was used to confirm that the bacteria contained the plasmid (pBacFGF-14). The sequence of the cloned fragment is confirmed by DNA sequencing method.

5 μg of the plasmid pBacFGF-14 was applied to 1.0 μg of a commercially available linearized baculovirus (BaculoGold®; Baculovirus DNA, Pharmingen, San Diego, Calif.) (Felgner et al. Proc. Natl. Acad. Sci. USA, 84: 7413-7414 (1987) is used to transfect at the same time.

Baculo Gold: registered trademark; 1 μg of baculovirus DNA and 5 μg of plasmid are mixed on sterile walls of microtiter plates containing 50 μl of serum free Grace medium (Lofe Technologies Inc., Gaithersburg, MD). After that, 10 µl of lipofectin and 90 µl of the culture medium are added, mixed, and incubated at room temperature for 15 minutes. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates containing 1 ml of serum-free Grace medium. Shake the plate back and forth to mix the freshly added solution. The plate is then incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution is removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal bovine serum is added. The plate is pushed back to the incubator and incubated at 27 ° C. for 4 days.

After 4 days, the supernatant is harvested and plaque assays are performed as described by Summers and Smith (mentioned above). Agarose gels are used to modify agarose gels with Blue Gal (Life Technologies Inc., Gaithersburg) to facilitate separation of blue stained plaques (for details on plaque assay, see Life Technologies Inc., Gaithersburg, pp. 9-10 Found in the User's Guide to Insect Cell Culture and Bacolobiology, which is distributed by

Four days after the serial dilution, the virus is added to the cells and the blue stained plaques are lifted with an Eppendorf pipette. The agar containing the recombinant virus is then suspended again in an Eppendorf tube containing 200 μl of Grace's medium. The baby is removed by centrifugation briefly and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. After 4 days, the supernatants of these culture dishes are harvested and stored at 4 ° C.

Sf9 cells are grown in grace medium supplemented with 10% heat-inactivated FBS. Infection with recombinant baculovirus V-FGF-14 at multiplicity of infection (MOI) 2. After 6 hours the medium is removed and replaced with SF900 II medium (Life Technologies Inc., Gaithersburg) excluding methionine and cysteine. After 42 hours the the ³⁵ S- methionine and 5μCi ³⁵ S- cysteine methionine 5μCi (Amersham). Cells are then incubated for 16 hours and harvested by centrifugation to visualize labeled proteins by SDS-PAGE and radiography.

Example 3

Expression of Recombinant FGF-14 in COS Cells

The expression of the plasmid, FGF-14-HA, is 1) the origin of replication of SV40, 2) ampicillin resistance gene, 3) E. E. coli replication origin, 4) polylinker region, SV40 intron and polyadenylation site followed by vector pcDNA3 / Amp (Invitrogen) containing CMV promoter. The DNA fragment encoding the entire FGF-14 precursor and the HA tag fused to the 3 'end of the frame is cloned into the polylinker region of the vector so that recombinant protein expression is under the direction of the CMV promoter. HA tags are described as influenza hemaggluti as described in I, Wilson, H, Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37: 767, (1984). Corresponds to epitopes derived from nin proteins. Fusion of the HA tag to the target protein facilitates detection of recombinant proteins using antibodies that recognize HA epitopes.

The plasmid construction process is as follows:

DNA sequence encoding FGF-14, ATCC # 97148 is constructed by PCR using two primers: 5 'primer 5' CTAGTGGATCCCATCATGGCGGCGTGGCCAGT 3 '(SEQ ID NO: 8) is followed by 18 nucleotides of the coding sequence starting from the start codon. Contains a BanHI site; 3 'SEQ ID NO: 5' GATTTACTCGAGGGGGGCAGGGGGACTGGA 3 '(SEQ ID NO: 9) contains a sequence complementary to the XhoI site, translation stop codon, HA tag, and final 18 nucleotides (not including stop codon) of the FGF-14 coding gene. The PCR product therefore contains a BamHI site, a coding sequence following the HA tag fused in frame, a translation termination stop codon adjacent to the HA tag, and an XhoI site.

PCR amplified DNA fragments and vectors, pcDNA3 / Amp, are digested and bound with their respective restriction enzymes. Combine this mixture. E. coli strain SURE (commercially available from Stratagent Cloning Systems, La Jolla, CA 92037). The transfected cultures are placed in ampicillin media plates to select resistant colonies. Plaskeid DNA is isolated from the transformants and examined in the restriction assay for the presence of the correct fragment. COS cells were transfected with the DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecyular Cloning: A Laboratory Manual, Coldd Spring Laboratory Press, (1989)) for expression of recombinant FGF-14. Let's do it. Expression of FGF-14-HA protein is detected by radiolabeling and immunoprecipitation (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Post-transfection cells are labeled with ³⁵ S-cysteine for 8 hours. Culture medium was then collected and cells were washed (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson, I. et al. , Id. 37: 767 (1984).

Both cell lysate and culture medium are precipitated with HA specific monoclonal antibodies. Precipitated protein is analyzed on a 15% SDS-PAGE gel.

Example 5

Gene Therapy Through Expression

Skin biopsy obtains fibroblasts from the subject. The resulting tissue is placed in tissue culture medium and separated into small pieces. A small mass of tissue is placed in a tissue culture flask, with approximately 10 pieces placed in each flask. The flask is shaken up and down, tightly sealed and left overnight at room temperature. After 24 hours at room temperature, the flask is inverted to leave the tissue mass fixed at the bottom of the flask and fresh medium (e.g., F12 medium of Ham supplemented with 10% FBS, penicillin and streptomycin) is added. . It is then incubated at 37 ° C. for approximately 1 week. At this time, fresh medium is added and the medium is changed daily for seven days. After two more weeks of culture, fibroblast monolayers appear. The monolayer is trypsinated and scaled into a larger flask.

PM-7 (Korschmeier, PT et al., DNA, 7: 219-25 (1988)) flanked with long terminating repeats of the sarcoma virus of the Moroni rats was digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase do. Linear vectors are fractionated on agarose gels and purified using glass beads.

CDNAs encoding polypeptides of the invention are amplified using PCR primers corresponding to 5 'and 3' terminal sequences, respectively. The 5 'primer contains an EcoRI site and the 3' primer has HindIII. Equivalent amounts of sarcoma virus linear backbone and EcoRI and HindIII fragments of mouse colonies are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for the joining of the two fragments. The binding mixture is used to transform bacterial HB 101, which is then placed on agar containing kanamycin for the purpose of confirming that the subject of interest has the gene with the vector properly inserted.

Amphiphilic pA317 or GP + am12 packaging cells are grown in Dulbecco's modified Eagle's medium (DMEM) modified with 10% calf serum (CS), penicillin and stremtomycin at a density consistent with tissue culture. MSV vectors containing the genes are then added to the medium and packaging cells are transduced with the vectors. The packaging cells will now produce infectious viral particles containing the gene (now the packaging cells are referred to as producer cells).

Fresh medium is added to the transduced producer cells, and the medium is then harvested from 10 cm plates of confluent producer cells. The spent medium containing infectious virus particles is filtered through a Millipore filter to remove unattached producer cells and then the medium is used to infect fibroblasts. The medium is removed from the sub-confluent plate of fibroblasts and quickly replaced with medium from producer cells. Remove the medium and replace with fresh medium. If the titer of the virus is high, substantially all fibroblasts are infected and do not need to be selected. If the titer is very low, it is necessary to use retroviral vectors with selectable markers such as neo or his.

The engineered fibroblasts are then grown confluent either alone or on cytodex 3 microcarrier beads and then infected with the host. Fibroblasts now produce protein products.

Numerous modifications and variations of the present invention are possible in light of the above description, and therefore, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.

Sequence list

(1) General Information:

(i) Applicant: Hu et al.

(ii) Name of the Invention: Fibroblast Growth Factor-14

(iii) number of sequences: 8

(iv) Contact Address:

(A) Recipient's name: Karella, Birn, Bain, Gilphylan, Sechi, Stuart and Allstein

(B) Street Address: Becker Farm Road 6

(C) Attempt Name: Roseland

(D) State: New Jersey

(E) Country name: United States

(F) Zip Code: 07068

(v) Computer readable type:

(A) Medium form: 3.5 inch diskette

(B) Computer: IBM PS / 2

(C) operating system: MS-DOS

(D) Software: Word Perfect 5.1

(vi) Current application data:

(A) Application number:

(B) Application date: same person

(C) classification:

(vii) First application data:

(A) Application No. 08/207, 412

(B) Application date: March 8, 1994

(viii) Agent Information:

(A) Statement: Ferraro, Gregory D.

(B) Registration Number: 36,134

(C) Note / Dock Number: 325800-402

(ix) transfer information:

(A) Telephone: 201-994-1700

(B) Fax: 201-994-1744

(2) Information about SEQ ID NO: 1

(i) sequence properties

(A) Length: 680 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: cDNA

(xi) Sequence description:

[SEQ ID NO 1]

(2) Information about SEQ ID NO: 2

(i) sequence properties

(A) Length: 225 base pairs

(B) Type: amino acid

(C) strand:

(D) form: linear

(ii) Molecular type: protein

(xi) Sequence description:

[SEQ ID NO 2]

(2) Information about SEQ ID NO:

(i) sequence properties

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO 3]

(2) Information about SEQ ID NO: 4

(i) sequence properties

(A) Length: 33 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO 4]

(2) Information about SEQ ID NO:

(i) sequence properties

(A) Length: 33 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO: 5]

(2) Information about SEQ ID NO:

(i) sequence properties

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO: 6]

(2) Information about SEQ ID NO: 7

(i) sequence properties

(A) Length: 33 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO: 7]

(2) Information about SEQ ID NO: 8

(i) sequence properties

(A) Length: 33 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO: 8]

(2) Information about SEQ ID NO: 9

(i) sequence properties

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strand: single

(D) form: linear

(ii) Molecular type: oligonucleotide

(xi) Sequence description:

[SEQ ID NO: 9]

Claims (20)

(a) a polynucleotide encoding a polypeptide comprising amino acids-26 to amino acids 199 as described in SEQ ID NO: 2; (b) a polynucleotide encoding a polypeptide comprising amino acids 1 to 199 as described in SEQ ID NO: 2; (c) a polynucleotide capable of hybridizing to at least 70% of the polynucleotides of (a) or (b); And (d) An isolated polynucleotide comprising one selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). The polynucleotide of claim 1 which is DNA. The polynucleotide of claim 1 comprising nucleotides 1 to nucleotide 680 as described in SEQ ID NO: 1. The polynucleotide of claim 1 comprising nucleotides 79 to nucleotide 680 as described in SEQ ID NO: 1. (a) a polynucleotide encoding a mature polypeptide encoded by DNA contained in ATCC Accession No. 97148; (b) a polynucleotide encoding a polypeptide expressed by DNA contained in ATCC Accession No. 97148; (c) a polynucleotide capable of hybridizing to at least 70% of the polynucleotides of (a) or (b); And (d) An isolated polynucleotide comprising one selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). A vector containing the DNA of claim 2. A host cell genetically engineered using the vector of claim 6. A method for producing a polypeptide comprising expressing a polypeptide encoded by DNA from a host cell of claim 7. A method of making a cell capable of expressing a polypeptide, comprising genetically manipulating the cell using the vector of claim 6. (i) a polypeptide having the inferred amino acid sequence of SEQ ID NO: 2 and fragments, homologs and derivatives thereof; And (ii) a polypeptide encoded by the cDNA of ATCC Accession No. 97148 and a polypeptide selected from the group consisting of fragments, homologs and derivatives of said polypeptide. An antibody against the polypeptide of claim 10. Compounds that inhibit the biological action of the polypeptide of claim 10. A compound that activates the receptor of the polypeptide of claim 10. A method of treating a patient in need of an FGF-14 polypeptide, characterized by administering a therapeutically effective amount of the polypeptide of claim 10 to the patient. A method of treating a patient in need of inhibiting an FGF-14 polypeptide, characterized by administering a therapeutically effective amount of the compound of claim 12 to the patient. The method of claim 14, wherein the therapeutically effective amount of the FGF-14 polypeptide is administered by providing a patient with DNA encoding the FGF-14 polypeptide and expressing the polypeptide in vivo. The method of claim 15, wherein the compound is a polypeptide and the therapeutically effective amount of the antagonist compound is administered by providing a patient with DNA encoding the antagonist to express the antagonist in vivo. (a) combining the compound to be selected with a cell-containing reaction mixture containing a label that is incorporated into the cell as the cell proliferates under conditions where the cell is normally stimulated by the polypeptide; (b) identifying a compound that is active as an agonist for the polypeptide of claim 10, characterized by determining the compound is an effective agonist by measuring the extent of proliferation of the cell. (a) combining a reaction mixture containing a compound to be screened, a polypeptide, and a cell containing a label that is incorporated into the cell as the cell proliferates under conditions where the cell is normally stimulated by the polypeptide; (b) A method for identifying a compound active as an antagonist for the polypeptide of claim 10, characterized in that the degree of proliferation of the cells is determined to confirm that the compound is an effective antagonist. A method for diagnosing a sensitivity to a disease or disorder associated with a decreased expression of a polypeptide, characterized by measuring a mutation in the nucleic acid sequence encoding the polypeptide of claim 10.