KR102472344B1 - Composition for treating alleviated hip dysplasia of dog using prime editors - Google Patents

Abstract

The present invention relates to a method for treating hip dysplasia in dogs using prime editing technology. By using a recombinant vector of the present invention, genes involved in hip dysplasia in dogs can be corrected more efficiently and with higher accuracy compared to an existing CRISPR/Cas9 system, and the recombinant vector can be utilized to treat or prevent hip dysplasia in dogs and manage sarcoma in dogs. Prime editing guide RNA for the recombinant vector of the present invention includes guide RNA, a scaffold, a reverse transcription polymerase template, and a primer binding site, which are connected in sequence.

Description

Composition for treating alleviated hip dysplasia of dog using prime editors}

The present invention relates to a method for treating hip dysplasia in dogs using prime editing technology, wherein genes involved in hip dysplasia in dogs are modified by using a recombinant vector containing a guide RNA, a primer binding site, and a reverse transcriptase template gene. Compared to the CRISPR/Cas9 system, it can be calibrated more efficiently and with higher accuracy.

Hip dysplasia has very similar clinical manifestations and pathogenesis in both humans and dogs. Hip dysplasia is a musculoskeletal disease caused by an incomplete connection between the femoral head and the acetabulum. It is accompanied by severe pain and is a common disease in medium-large dogs such as retrievers. It is known that individuals with hip dysplasia cause osteoarthritis, lameness, reduced mobility, and the like. The causes of hip dysplasia include both genetic and environmental influences. Breeding strategies can be used according to well-established selection plans to reduce the prevalence of hereditary hip dysplasia, and these strategies have been used to produce healthy individuals in all species. However, research on treating the disease by directly regulating the gene that causes hip dysplasia in dogs has not yet been attempted.

Recently, a precision genome editing technique known as prime editor (PE) has been developed and validated in mice and plants. Unlike methods using CRISPR/Cas9-HDR (homology-directed repair), prime editing does not induce double-strand breaks and does not require oligo DNA. Prime editing is designed to generate nickase in double strands using CRISPR/Cas9 (H840A) and edit DNA at the nickase-generating site using reverse transcriptase (Moloney murine leukemia virus: M-MLV). . Prime editing allows low off-target efficiency and precise transitions, insertions, and removals. Because of this low off-target efficiency, prime editing has great potential for correcting pathogenic alleles. Prime editing was originally developed in human cells, but has recently been used to develop plant strains, and mice and fruit flies have been used as human disease models.

However, no reports have been made of the use of prime editing to treat hip dysplasia in dogs.

One aspect provides a recombinant vector comprising a guide RNA represented by SEQ ID NO: 1, a primer binding site represented by SEQ ID NO: 3, and a reverse transcriptase polymerase template represented by SEQ ID NO: 4.

Another aspect provides a composition for treating or preventing canine hip dysplasia comprising the recombinant vector.

Another aspect provides a method for treating or preventing hip dysplasia in dogs, comprising introducing the recombinant vector into a subject.

One aspect provides a recombinant vector comprising a guide RNA represented by SEQ ID NO: 1, a primer binding site represented by SEQ ID NO: 3, and a reverse transcriptase polymerase template represented by SEQ ID NO: 4.

The recombinant vector is for treating or preventing canine hip dysplasia, and may be for targeting a gene involved in canine hip dysplasia.

The recombinant vector may be defined as a gene cassette or may be a genome editing vector.

As shown in FIG. 2, the recombinant vector of the present invention includes not only gRNA (guide RNA) but also a scaffold, a reverse transcription polymerase template (RT template), and a primer binding site, each component are closely connected to make a set. Therefore, targeting with gRNA may be the same as the previous Cas9, but as a whole, more stable and accurate gene editing function can be performed compared to conventional CRISPR/Cas9.

In the recombinant vector, gRNA, scaffold (including PAM gene), reverse transcription polymerase template, and primer binding site may be defined as prime editing guide RNA (pegRNA).

As used herein, the term “pegRNA” refers to a new type of ‘engineered’ guide RNA configured to contain new genetic information that replaces target DNA nucleotides instead of existing guide RNA (gRNA). The pegRNA may be configured to include a guide RNA (gRNA), a nucleotide sequence complementary to the non-target strand of the target gene (Primer binding site), and a template strand region (RT template) of reverse transcriptase containing the nucleotide sequence to be corrected. have.

As used herein, the term "vector" refers to a genetic construct comprising a nucleotide sequence of a gene operably linked to a suitable control sequence so as to express a gene of interest in a suitable host, the control sequence being transcribed. A promoter capable of initiating, an optional operator sequence for regulating such transcription, and sequences regulating the termination of transcription and translation.

As used herein, the term "recombinant vector" refers to a target polypeptide that can express the target polypeptide with high efficiency in an appropriate host cell when the coding gene of the target polypeptide to be expressed is operably linked. It can be used as an expression vector, and the recombinant vector can be expressed in a host cell. The host cell may preferably be a eukaryotic cell, and expression control sequences such as a promoter, terminator, and enhancer, sequences for membrane targeting or secretion, etc. are appropriately selected according to the type of host cell. and can be combined in various ways depending on the purpose.

The vector may be an expression vector or a genome editing vector, and may be, for example, a non-viral vector or a viral vector. The non-viral vector is preferably plasmid DNA, and the viral vector is lentivirus, retrovirus, adenovirus, herpes virus or avipox virus A vector or the like may be used, but is not limited thereto.

The expression vector preferably further includes a gene encoding a selectable marker such as a fluorescent protein to facilitate selection of transformed cells. Markers conferring a selectable phenotype such as, for example, drug resistance, auxotrophy, resistance to cytotoxic agents or expression of surface proteins, such as fluorescent proteins, puromycin, neomycin, hygromycin, hiss Thidinol dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt) can be exemplified.

The fluorescent protein is, for example, green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (Orange fluorescent protein, OFP) ), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), or far-red fluorescent protein, but is not limited thereto.

The recombinant vector may further include a PAM gene represented by the polynucleotide sequence of SEQ ID NO: 2. The PAM gene may be specifically located in a scaffold region between the guide RNA and the primer binding site, more specifically between the guide RNA and the primer binding site. The guide RNA, PAM gene, primer binding site, and reverse transcription polymerase template are operably linked.

The recombinant vector may further include components of CRISPR/Cas9 and RNA polymerase so as to serve as gene scissors. Cas9 protein and RNA polymerase can be commonly known.

Another aspect provides a recombinant virus into which the recombinant vector is introduced. The virus may be a lentivirus, a retrovirus, an adenovirus, a herpes virus, or an avipox virus, but is not limited thereto.

Another aspect provides a composition for treating hip dysplasia comprising the recombinant vector.

Another aspect provides a composition for breeding management of dogs comprising the recombinant vector. The breeding management of the dog may mean obtaining a second-generation individual whose hip dysplasia is corrected from an individual who is likely to have hip dysplasia or has hip dysplasia.

As used herein, the terms "prevention", "improvement", and "treatment" refer to reversing, alleviating, inhibiting, delaying, or preventing the symptoms of hip dysplasia, and "" may refer to the act of treating in the sense of "treatment method".

As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate organisms and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added if necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets.

Another aspect provides a method of treating canine hip dysplasia comprising introducing the recombinant vector into the subject.

Another aspect provides a dog breeding management method comprising introducing the recombinant vector into an individual. Specifically, the breeding management method may be for correcting a hip dysplasia inducing gene in a dog determined to have hip dysplasia.

The subject may be a dog ( Canis lupus familiaris ). The dogs may be more specifically Labrador retrievers.

The step of injecting the recombinant vector into the subject is to convert the expression vector containing the recombinant vector to G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, cationic phospholipid nano It can be introduced into cells together with delivery reagents including particles, cationic polymers, cationic micelles, cationic emulsions or liposomes, or can be conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular uptake, A subject or cell may be directly infected, an electro-cell fusion device may be used, or iontophoresis may be used, but is not limited thereto.

The step of injecting the recombinant vector into the organism may be more specifically, a method of introducing the recombinant vector into somatic cells to obtain knocked-in somatic cells, and then obtaining cloned embryos of somatic cells; a method of directly injecting a recombinant vector into a fertilized egg; A method of making fertilized eggs through nuclear transfer in which a recombinant vector is injected into somatic cells of the subject and the nucleus of the somatic cells into which the recombinant vector is injected is injected into an egg, but is not limited thereto.

Using the genetic construct of the present invention, canine hip dysplasia can be effectively and successfully treated. The genetic construct of the present invention is applied with prime editing technology, and has the advantage of being simple and highly efficient compared to CRISPR/Cas9-HDR without the need for cell division or introduction of oligo DNA.

Figure 1 shows the genetic construct of the virus for the treatment of hip dysplasia. Here, pegRNA contains CRISPR/Cas9 guide RNA, RNA RT polymerase template and RNA binding site.
Figure 2 shows the genetic structure of pegRNA in detail. Here, [AGG] is the PAM sequence (scaffold region), the left side of the scaffold is the gRNA, the right side is the RT template and primer binding site, and the red base is the mutation site.
Figure 3 shows the results of analyzing the nucleotide sequence of cells corrected using the genetic construct of the present invention.
Figure 4 shows the results of analyzing the nucleotide sequence of cells corrected using the genetic construct of the present invention.
Figure 5 confirms the image and GFP expression of an individual delivered after correcting using the genetic construct of the present invention.
6 confirms the presence of the corrected gene from the genomic DNA of an individual calibrated after correction using the genetic construct of the present invention.
7 is a sequencing result showing that SNPs causing hip dysplasia were corrected in the genomic DNA of an individual delivered after correction using the genetic construct of the present invention.
8 is an X-ray image of a hip joint of a cell donor dog and a cloned dog. Specifically, FIG. 8A is the hip joint of an 18-month-old cell donor dog, FIG. 8B is the hip joint of a 38-month-old cell donor dog, FIG. 8C is the hip joint of cloned dog #1 at 11 months, and FIG. 8D is the hip joint of cloned dog #2. This is an X-ray image of the hip joint at 11 months.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

[Example 1] Preparation of a gene cassette for prime editing and a virus containing the same

A guide RNA (pegRNA) for prime editing and a vector construct containing the same were designed as follows.

First, 25 single nucleotide polymorphisms (SNPs) were derived by analyzing gene mutations inducing hip dysplasia, and among them, one SNP that was statistically evaluated to cause hip dysplasia was selected as a target. The SNP selected as a target has the feature of point mutation of T to C at the BISF2S23030416 locus.

The pegRNA used for prime editing was designed to start with a 13 nt primer binding site and a 14 nt RT template (Bioneer, Inc) (Fig. 2). A lentivirus-derived vector was used (addgene #135955), and it was designed to include CRISPR/Cas9, RNA polymerase, and pegRNA, and include a GFP gene to confirm the insertion with fluorescence (FIG. 1). A virus containing the gene cassette as described above was prepared by a company (Lugen SCI, Inc).

gene order gRNAs GAG GGG AAC ACA CGC AGG AC (SEQ ID NO: 1) scaffold gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID NO: 5) PAM AGG (SEQ ID NO: 2) 13 nt primer binding site CTG CGT GTG TTC C (SEQ ID NO: 3) 14 nt RT template (reverse transcriptase template) ACT CTG CTC CTG TC (SEQ ID NO: 4)

[Example 2] Confirmation of hip dysplasia correction

Fibroblasts were obtained from the ear of an 18-month-old dog suffering from hip dysplasia to confirm hip dysplasia correction in a cell line. Then, the cells were cultured in a culture medium containing DMEM-Glutamax, 15% FBS and 1% penicillin/streptomycin. After infecting the cultured fibroblasts by treating the virus at 100 MOI in a 12-well plate, the presence or absence of infection was confirmed by GFP and sequencing analysis. As a result, it was confirmed that the prime editing was working as the cell lines treated with the virus showed a heterogeneous type with C and T, whereas the cells without treatment had the C sequence (Figs. 3 and 4).

[Test Example 1] Confirmation of the treatment effect of hip dysplasia in dogs

To treat hip dysplasia in dogs using the genetic construct of the present invention, somatic cell nuclear transfer (SCNT) and embryo transfer methods were used.

Specifically, Labrador Retriever was selected as the dog breed, matured oocytes of hip dysplasia individuals having the first polar body were obtained, metaphase chromosomes were removed, and the extracted oocytes were transferred to the perivitelline space. After transferring the somatic cells of Example 2, each donor cell-cytoplasmic junction was fused with two direct current pulses (24-26V for 15 μsec) in an electro-cell fusion device. The fused SCNT embryos were cultured in 10 μM calcium ion channel (Sigma) to induce chemical activation, washed and then incubated in synthetic oviduct fluid medium (mSOF) containing 1.9 mM 6-dimethylaminopurine (6-DMAP). Then, the SCNT embryos were surgically transferred to the fallopian tubes of surrogate mothers, and implantation was confirmed by ultrasonography on the 30th day after embryo transfer. Two puppies were obtained by cesarean section from a surrogate mother.

All tests were performed with the support of the "Companion Animal Research Center Joint Research Program (Project No. PJ01398702)", and the experimental procedures and methods were approved by the Animal Welfare Ethics Corporation of Chungnam National University (CNU-2019012A-CNU-174). In this study, female mongrel dogs between the ages of 2 and 6 were provided with oocytes and used for embryo transfer.

After 40 days, juveniles weighing 656 g (C>T dog#1) and 585 g (C>T dog#2) were obtained. Dogs were housed indoors and allowed to drink water ad libitum once a day, and all methods and tests were performed in accordance with relevant guidelines and regulations.

In order to identify the gene inserted into the genomic DNA of the transfected dog from the obtained individual, the gene between the CMV promoter and CRISPR/Cas9 was amplified by PCR and compared with donor cells (FIGS. 5 and 6). In addition, it was confirmed by sequencing that the mutation occurred successfully (FIG. 7). Primer sequences used for PCR are as follows.

gene order Gene identification between the CMV promoter and CRISPR/Cas9 Forward 5'-catcgctattaccatggtgat-3' Reverse genetic identification between the CMV promoter and CRISPR/Cas9 5'-ctcttgcagatagcagatcc-3'

As a result, it was confirmed that the nucleotide sequence causing hip dysplasia was corrected by the gene sphere of the present invention in both of the obtained individuals.

[Test Example 2] Hip joint X-ray image comparison confirmation

A cell donor dog (dog name: Miwoo) with hip dysplasia disease was diagnosed with hip dysplasia at 18 months, and an individual that maintained the findings of hip dysplasia even after 38 months was used.

X-rays were taken at 11 months of age for two cloned dogs produced through gene editing technology and somatic cell nuclear transfer technology in the same manner as in Test Example 1 above.

The results are shown in FIG. 8 . FIG. 8A is the hip joint of an 18-month-old cell donor dog, and FIG. 8B is the hip joint of a 38-month-old cell donor dog. It was confirmed that hip dysplasia disease was caused by acetabular dysplasia resulting in shallow ball depth and detachment of the femoral head. It was confirmed that the femoral head was dislocated even at the age of 12 months, and that the hip dysplasia disease was maintained. As cloned dogs after gene correction, Fig. 8C shows the hip joint of cloned dog #1 at 11 months old, and Fig. 8D shows the hip joint of cloned dog #2 at 11 months old.

Therefore, by gene correction using the present invention, all individuals showed normal findings in hip joint formation, and even when it was determined whether the disease symptoms were cured or alleviated through re-photography at the age of 18 months, which is the time point for determining the disease of the cell donor dog, normal findings in hip joint formation were observed. showed

<110> MK biotek <120> Composition for treating alleviated hip dysplasia of dog using prime editors <130> WP20211220 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> gRNA <400> 1 gaggggaaca cacgcaggac 20 <210> 2 <211> 3 <212> DNA <213> artificial sequence <220> <223> PAM <400> 2 agg 3 <210> 3 <211> 13 <212> DNA <213> artificial sequence <220> <223> primer binding site <400> 3 ctgcgtgtgt tcc 13 <210> 4 <211> 14 <212> DNA <213> artificial sequence <220> <223> reverse transcriptase template <400> 4 actctgctcc tgtc 14 <210> 5 <211> 76 <212> DNA <213> artificial sequence <220> <223> <400> 5 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60 ggcaccgagt cggtgc 76

Claims (11)

A guide RNA composed of the nucleotide sequence of SEQ ID NO: 1, a scaffold composed of the nucleotide sequence of SEQ ID NO: 5, a reverse transcription polymerase template composed of the nucleotide sequence of SEQ ID NO: 4, and a nucleotide sequence of SEQ ID NO: 3 Prime editing guide RNA (pegRNA), which is sequentially linked so that the formed primer binding sites are operative. The prime editing guide RNA of claim 1, wherein the prime editing guide RNA includes the PAM gene represented by SEQ ID NO: 2 located in the scaffold region. A recombinant vector comprising the prime editing guide RNA of claim 1. The recombinant vector according to claim 3, wherein the recombinant vector further comprises a gene encoding Cas9 (CRISPR associated protein 9) protein and/or a gene encoding RNA polymerase. The recombinant vector according to claim 4, wherein the recombinant vector further comprises a gene encoding a fluorescent protein. The recombinant vector according to claim 3, wherein the recombinant vector is for treating or preventing hip dysplasia in dogs. The recombinant vector according to claim 3, wherein the recombinant vector is for targeting a gene involved in canine hip dysplasia. A recombinant virus into which the recombinant vector of claim 3 is introduced. A composition for treating or preventing hip dysplasia in dogs, comprising the recombinant vector of claim 3. A composition for managing dog breeding, comprising the recombinant vector of claim 3. A method for treating or preventing hip dysplasia in dogs, comprising introducing the recombinant vector of claim 3 into a subject.

Images